Outline

1. Transcription in eukaryotic cells

2. The transcription initiation, elongation,
termination
3. Post transcription regulation: Cap,
PolyA, intron removal.
The sequence of a region of DNA around the 5′ end
of a gene in Escherichia coli is shown below. The –
10 hexamer and the transcription start site are
highlighted. What would be the sequence of the
first 10 nucleotides of the mRNA transcribed from
this gene? Write down the sequence from 5′ to 3′,
e.g. CGGAUAAACT.

5′…GCGCTTGGTATAATCGCTGGGGGTCAAAGAT…3′

5’ GGUCAAAGAU 3’
RNA Polymerase II Requires a Set of General
Transcription Factors

5 different General Transcription Factors

 Initiation of transcription of a eukaryotic gene by Pol II

Basal level of
transcription a) The promoter contains a
requires basal DNA sequence called the
transcription TATA box, which is located
factors bind 25 nucleotides away from
DNA the site at which
transcription is initiated.

b) Through its subunit TBP,

TFIID recognizes and binds
the TATA box, which then
enables the adjacent
binding of TFIIB
(C). For simplicity the DNA
distortion produced by the
binding of TFIID.

(D) The rest of the general

transcription factors, the RNA
polymerase itself, assemble at
the promoter.
 (E) TFIIH then uses energy
from ATP hydrolysis to pry
apart the DNA double helix at
the transcription start point,
locally exposing the template
strand.
TFIIH
TFIIH also phosphorylates
RNA polymerase II, changing
its conformation so that the
polymerase is released from
the general factors and can
begin the elongation phase of
transcription. As shown, the
site of phosphorylation is a
long C-terminal polypeptide
tail, also called the C-terminal
domain (CTD), that extends
from the polymerase
molecule.
• Other Proteins Required by RNA Pol in Eukaryotes: Polymerase II Also Requires
Activator, Mediator, and Chromatin-Modifying Proteins
1. Transcriptional activators- bind to specific sequences and facilitate binding of GTFs and RNA
Pol
2. Mediators- enable activators to interact w/ GTFs and RNA Pol
3. Chromatin Remodeling Complexes- allow greater accessibility to DNA
4. Many proteins required to initiate transcription, > 100 subunits

Transcription initiation in vivo

requires the presence of
transcription activator
proteins. These proteins bind
to specific short sequences in
DNA

Activators attract
ATP-dependent chromatin
remodeling complexes and
histone-modifying enzymes
Elongation
• Transcription
Elongation factors= ensures that RNA Pol does not disassociate before end of
gene; assoc. w/ RNA Pol shortly after initiation of transcription
• DNA topoisomerases removes superhelical tension
• DNA gyrases uses ATP to pump supercoils into DNA
• Elongation tightly coupled to RNA processing
How does a eukaryotic cell deal with the superhelical tension in its
genomic DNA resulting from the activity of RNA polymerases?

A. DNA gyrase introduces negative supercoils, keeping the DNA

under constant tension.
B. The RNA polymerases are allowed to rotate freely around their
templates during transcription, leading to the relaxation of the
tension.
C. DNA topoisomerases rapidly remove the superhelical tension
caused by transcription.
D. The nucleosomes adjust the tension by binding to positively
supercoiled regions behind a moving RNA polymerase.
E. All of the above.
Transcription in Eukaryotes vs Procaryotes
• Nucleosomes and higher order chromatin packaging
• RNA Pol requires General Transcription Factors
RNA Processing
1. Eukaryotic mRNA capped at 5’ end
Transcription
2. polyadenylated at 3’ end
3. Introns removed

Phosphorylation of RNA tail CTD

• consists of domain of repeated 52
times of 7 aa containing 2 serines that
are phosphorylated

• phosphorylation of tail promotes

disassoc of RNA Pol from proteins
presents at start of transcription

• allows new set of proteins that function

in elongation and pre-mRNA
processing, to assoc
 5’-5’ linkage of
7-methyl G to the
end of pre-mRNA

5’ cap contains a triphosphate bridge between the terminal

base and the 5' end of the pre-mRNA.

PolyA added using ATP

Capping of Pre-mRNAs
• Capping of 5’ end w/ modified guanine nucleotide occurs after ~25 bases
synthesized
• 3 enzymes involved in capping process
1. phosphatase removes one P’ from 5’ end of RNA
2. guanyl transferase adds GMP to 5’ end
3. methyl transferase adds methyl grp to guanosine
• Capping enzymes bind to phosphorylated tail of RNA Pol
• Cap binds CBC (cap binding complex) that facilitates RNA processing and
export
Eukaryotic pre-mRNAs undergo a number of
modifications such as capping at the 5' end. A 5'
cap...
• A. consists of a modified terminal adenine
nucleotide.
• B. has a 3'-to-5' linkage between the terminal
nucleotide and the 5' end of the pre-mRNA.
• C. contains a triphosphate bridge between the
terminal base and the 5' end of the pre-mRNA.
• D. carries a negative charge in the terminal base
due to methylation.
• E. is identical for all mRNAs that are transcribed
by RNA polymerase II.
The splicing machinery recognize three portions of the premRNA: the 5’splice site, 3’
splice site and branch point in the intron sequence that form the base of the excised
lariat
Mechanism of RNA Slicing
1. spliceosome recognizes splicing signals on
pre-mRNA, brings ends of intron together
2. branch point site recognized by BBP and
U2AF
3. U2 snRNP displaces BBP base pairing w/
branch point consensus seq
4. U1 snRNP base pairs w/ 5’ splice site
junction
5. U4/U6•U5 triple snRNP enters
6. RNA-RNA rearrangements disrupts U4/U6
base pairing to enable U6 to displace U1 at
5’ splice junction; U4 exits
7. U2 and U6 snRNPs in spliceosome form 3d
RNA structure bringing 5’ junction into
position near branch chain A for first
esterification
Mechanism of RNA Slicing

8. 5’ and 3’ junctions
brought together via U5
snRNP for second
esterification

9. snRNPs remain bound

to lariat while splice
product released
The U1 snRNP forms base pairs with the 5
splice junction (see Figure 6–29) and the BBP
(branch-point binding protein) and U2AF
(U2 auxilliary factor) recognize the
branch-point site.
Mechanism of RNA Slicing
1. spliceosome recognizes splicing signals
on pre-mRNA, brings ends of intron
together
2. branch point site recognized by BBP
and U2AF
3. U2 snRNP displaces BBP base pairing
w/ branch point consensus seq
4. U1 snRNP base pairs w/ 5’ splice site
junction
5. U4/U6•U5 triple snRNP enters
6. RNA-RNA rearrangements disrupts
U4/U6 base pairing to enable U6 to
displace U1 at 5’ splice junction; U4
exits
7. U2 and U6 snRNPs in spliceosome form
3d RNA structure bringing 5’ junction
into position near branch chain A for
first esterification
General Features of RNA
Transcription
Splicing

• Involves two transesterification

reactions to join exons and remove
intron in form of lariat
• 5 additional RNAs, > 50 proteins,
and lots of ATP required
• Complexity ensures accuracy
• Alternative splicing occurs in 60%
of human genes
• Increase coding potential and
facilitates evol of new protein
sequences
Sequences Mark Where Splicing Occurs
• Intron size varies from 10-100,000 nucleotides
• 3 conserved nucleotide sequences
5’ splice site
3’ splice site
branch points that forms base of excised lariat
Spliceosome Mediates Splicing of
RNA
• performed primarily by 5 snRNA
molec (U1, U2, U4, U5) forming
spliceosome core
• snRNA molec recognize intron-
exon borders and participate in
splicing chemistry
• Spliceosome complex of RNA
and protein
• More than 50 proteins involved
 Transcription
Spliceosome and ATP Hydrolysis
• Not required for splicing chemistry
• Needed for assembly and rearrangements
• RNA helicase requiring ATP needed to break RNA-
RNA interactions
• All steps except assoc of BBP w/ branch chain A, and
U2 w/ 5’ splice site require ATP and other proteins
• Removal of snRNP from lariat requires RNA-RNA
interactions that are dependent on ATP hydrolysis
 Transcription
Plasticity of RNA Splicing
• Splicing mech selected for flexibility
• Flexibility enables cell to regulate pattern of RNA
splicing
• Alternative splicing when diff proteins can be made
from same gene
• Splicing patters regulated so diff forms of protein
produced at diff times and in diff tissues
 Transcription

Self-Splicing Introns
• Group I Intron= reactive G nucleotide attacks the initial
phosphdiester bound cleaved during the spicing rxn
• Group II Intron= reactive A in intron seq is attaching grp,
and lariat intermediate generated
• Sequence of self=splicing introns is critical; RNA folds in
specific 3d conformation that brings 5’ and 3’ junctions
together and provides precisely positioned reactive grps to
perform chemistry
• Pre-mRNA splicing mech evolved from Grp II Splicing
spliceosomal snRNPs took over structural and chemical
roles of Grp II Introns so sequence constraints no longer
needed
Group I Introns Group II Introns
Processing of 3’ End of pre-mRNA
• Termination signs are transcribed into RNA and recognized proteins as RNA Pol
transcribes through them
• CstF (cleavage stimulating factor F) and CPSF (cleavage and processing specificity
factor) proteins assoc w/ RNA Pol tail transferred to RNA as it emerges
Processing the 3’ End of the Pre-mRNA
• Additional proteins assemble w/ CstF and CPSF to perform processing:
1. RNA is cleaved
2. Poly-A-Polymerase adds ~200 A’s to 3’ end of cleaved product
3. RNA Pol II continues to transcribe after pre- mRNA has been
cleaved; several 100 bases before falls off template and transcription terminates
4. RNA downstream of cleavage is degraded
Selective Export of Mature mRNAs from Nucleus
Transcription
How does cell distinguish btwn rate mature mRNA and debris from mRNA
processing?
• Export highly selected and coupled to correct mRNA processing
• mRNA exported only if appr set of proteins are bound including: 1) cap binding complex 2)
snRNP proteins absent 3) proteins that mark complete splicing

Selective Export of Mature mRNAs from Nucleus

 Transcription

hnRNPs= heterogeneous nuclear ribonuclear proteins, most abundant

proteins that assemble on pre-mRNA as it emerges from RNA Pol
• Some hnRNPs remove hairpin helices from RNA so that splicing and other
signals on RNA can be read
• hnRNPs excluded from exons, remain on excised introns marking them for
nuclear retention and/or destruction
• Some remain bound to fully processed mRNA and accompany them to
cytoplasm
 Transcription

Most of the RNA in the Cell Performs a Catalytic or Structural

Function
• ~80% of total RNA is rRNA
• 3-5% of total RNA mRNA
• rRNA transcribed by RNA Pol I (which has no C-terminal tail)
• rRNA is neither capped or polyadenylated
• RNA components of ribosome are final gene products;
growing cell syn ~10 million of each type of rRNA per cell
generation
 Transcription

rRNA Genes
• Mammalian cells contain 10 million ribosomes
• Multi-copy genes
E. coli has 7 copies of its rRNA
Humans ~200 copies on 5 chromosomes
Xenopus ~600 copies single cluster on 1 chromosome
• 4 types of euckaryotic rRNAs ea present in one copy/ribosome
18S, 5.8S and 28S encoded by single lg precursor RNA-chemically modified
5S rRNA syn from separate cluster by Pol III- not chemically modified
 Transcription
Nucleolus as a Ribosome Producing Factory
• site for processing rRNAs and assembly into
ribosomes
• lg aggregate of macromolecules including:
rRNA genes, precursor rRNAs, mature rRNAs,
rRNA processing enzymes, snoRNPs,
ribosomal protein subunits, and some
partially assembled ribosomes
• Size varies and reflects number of ribosomes
cell is making; may occupy 25% of nuclear
vol
• Also site where other RNAs produced and
other RNA-protein complexes assembled
(tRNAs, snoRNAs, U6 snRNP, telomerase)