Plant Physiol.

(1 995) 107: 161-1 65

Individual Members of the Cab Gene Family Differ Widely in Fluence Response'
Michael j. White*, Lon S. Kaufman, Benjamin A. Horwitz, Winslow

R. Briggs, and William F. Thompson

Department of Biology, Saint Mary's University, Halifax, Nova Scotia, B3H 3C3 Canada (M.J.W.); Laboratory for Molecular Biology, Department of Biological Sciences, University of lllinois at Chicago, P.O. Box 4348, Chicago, lllinois 60680 (L.S.K.); Department of Biology, Technion, Haifa 32000, Israel (B.A.H.); Department of Plant Biology, Carnegie lnstitute of Washington, Stanford, California 94305 (W.R.B.); and Departments of Botany and Genetics, North Carolina State University, Raleigh, North Carolina 27695 (W.F.T.) ing light fluence (Horwitz et al., 1988). This biphasic response consists of the VLF response described above and additional accumulation in the low fluence range. This additional low fluence-induced transcript accumulation is regulated by phytochrome and is reversible by far-red light, unlike the VLF response, which is not reversed by far-red light. In the case of the wheat Cub-1 gene, the setting or timing of the circadian clock that regulates transcript levels appears to be regulated by a VLF response that can be initiated with far-red light (Nagy et al., 1993). Experiments with other wavelengths suggest that blue and UV light receptors also affect Cub transcript accumulation, at least under certain light regimes (Oelmiiller et al., 1989; Warpeha et al., 1989; Eskins and Beremand, 1990; Warpeha and Kaufman, 1990; Wehmeyer et al., 1990; Jordan et al., 1991). Severa1 interpretations of the biphasic Cub fluenceresponse curve for red light are possible. There are at least seven Cab genes in pea that encode polypeptides of the major light-harvesting complex, LHCII (White et al., 1992; Falconet et al., 1993). We do not know whether these genes differ in their fluence response characteristics, since previous fluence response studies did not discriminate among the transcripts produced by the seven LHCII genes. Five of the LHCII genes in pea are classified as type I genes, based on their high degree of sequence homology and the lack of an intron in those genomic clones that have been sequenced (summarized by White et al. [1992]). A sixth gene, Cub-215 (Lhcb2.1 in the nomenclature of Jansson et al. 119921) contains an intron and is a type I1 gene (Falconet et al., 1991), whereas the seventh gene, Cub-315 (Lhcb3*1in the nomenclature of Jansson et al. [1992]), contains two introns and is a type 1 1 gene (Falconet et al., 1 1993). In an earlier study (White et al., 1992) we examined light responses of a11 seven genes and found a wide range of variation among the type I genes. Two of the type I genes (Cub-8 and AB96 = LhcbZ-4 and Lhcbl'l) showed significant transcript accumulation 24 h after a red light pulse sufficient to saturate phytochrome photoconversion, whereas the other three type I genes (Cub-9, AB80, and AB66 = Lhcb15, Lhcb1'2, and Lhcb13, respectively) showed little or
Abbreviations: Cub, Chl u/b-binding protein; Fed-1, ferredoxin I; LHCII, light-harvesting complex 1; VLF, very low fluence. 1
161

Chlorophyll dbbinding protein genes (Cab genes) can be extremely sensitive to light. Transcript accumulation following a red light pulse increases with fluence over 8 orders of magnitude (L.S. Kaufman, W.F. Thompson, W.R. Briggs [1984] Science 226: 14471449). We have constructed fluence-response curves for individual Cab genes. At least two Cab genes (Cab-8 and AB96) show a very low fluence response to a single red light pulse. In contrast, two other Cab genes (AB80 and AB66) fail to produce detectable transcript following a single pulse of either red or blue light but are expressed in continuous red light. Thus, very low fluence responses and high irradiance responses occur in the same gene family.

Plants respond to light in many different ways, including morphological, physiological, and molecular responses. These responses may be qualitative or quantitative in nature and often possess minimum fluence thresholds. Fluentes below this threshold will not activate the response. Many such responses are characterized as low fluence responses, since they occur following a light treatment in the low fluence range (21 pmol mP2). Some pIant responses are extremely sensitive to light and occur in the VLF range with a threshold of approximately 10P4 pmol m-'. Responses to red light in the low fluence and VLF ranges are believed to be mediated by the photoreceptor phytochrome. However, VLF responses require very little active phytochrome (Pfr); it has been estimated that induction thresholds may require only 0.003% of the phytochrome dimers in the Pr:Pfr state (De Petter et al., 1988). Consequently, VLF responses are not reversible by far-red light treatments that normally result in about 3% Pfr. A single low fluence irradiation given to dark-grown seedlings is sufficient to elicit transcript accumulation for a number of higher plant genes. However, the Cub genes also possess a response to red light in the VLF range (Kaufman et al., 1984; Nagy et al., 1986; Horwitz et al., 1988). The Cub genes in pea (Pisum sutivum) collectively show a biphasic pattern of transcript accumulation in response to increasThis work was funded by a National Science Foundation grant to W.F.T. and in part by an Izaak Walton Killam postdoctoral fellowship to M.J.W. This article is Carnegie Institution of Washington, Department of Plant Biology publication No. 1220. * Corresponding author; fax 1-902-420-5261.

'

162

White et ai.

Plant Physiol. Vol. 107, 1995

no response to this same treatment. Although the type I1 and type I11 LHCII genes did respond to red light, they had Lower transcript levels than the abundantly expressed type 1 genes, Cab-8 and AB96. From these and other considerations it can be concluded that the type I genes Cab-8 and AB96 account for the bulk of Cab transcripts induced by red light in the low fluence range, with possibly a small contribution from the type I1 gene, Cab-215. Experiments described in this paper were designed to determine whether a11 three genes possess both a VLF and a low fluence response or whether significant differences in fluence response exist among these genes. To address this question, we used a highly sensitive and genespecific technique to construct replicate fluence-response curves for each gene. The data show that at least two Cab genes possess a VLF response.

MATERIALS AND METHODS Rlant Crowth Conditions

The Fed-1 internal PCR standard was obtained by deleting a 297-bp 1?glIIfragment from the full-length PCR product. Following BglII digestion, the flanking BglI1 fragments were ligated together and amplified using PCR. A BclI digestion cutting within the deleted 297-bp BgKI fragment was used to remove any residual full-length PCR product from the standard. In addition, the resulting 247-bp standard was purified by successive rounds of cgarose gel electrophoresis alternating with PCR amplification. Biotin-11-dUTP was incorporated during amplification so that PCR products could be visualized using streptavidin-alkaline phosphatase and a chemiluminescent substrate. Blots were then exposed to x-ray filrn, and the resulting images were quantitated using laser densitometry. This technique provides an extremely sens itive, quantitative, and gene-specific method of transcript measurement (White et al., 1992). The fluence-response curves presented in Figure 1 are an average of three experiments with independent populations of seedlings.

Pea seedlings (Pisum sativum cv Alaska) used for the red light fluence response curves were grown and irradiated as described by Horwitz et al. (1988). Plants grown in complete darkness for 5.5 d were given a red light pulse of defined fluence and returned to the dark for 24 h. Buds were then harvested and frozen in liquid nitrogen prior to RNA extraction. The fluence used to illuminate each set of seedlings is indicated on the horizontal axis of the fluenceresponse curves. The highest fluence used saturates Cab transcript accumulation. Differing fluences were achieved by using the same light source in combination with neutra1 density filters. Blue light experiments (Fig. 2) were as described by Warpeha and Kaufman (1990).Seedlings were grown in the dark for 6 d, given a single blue light pulse (fluence = 1000 pmol m-), and then returned to the dark for 24 h prior to harvesting buds and extracting RNA.
Quantitating Transcript Abundance

RESULTS AND DISCUSSION

Methods for isolating RNA and quantitating individual gene transcripts were described in detail by White et al. (1992). Briefly, full-length cDNA was synthesized using an oligo-dT,, primer and a reverse transcriptase lacking an RNase H domain. The cDNA was then amplified by PCR using gene-specific primers and a limited number of cycles to assist in quantitation. An internal standard template sharing the same primer recognition sites was included in a11 PCR reactions. Oligodeoxynucleotidesequences of a11 of the Cab PCR primers are given in figure 1 of White et al. (1992). Oligodeoxynucleotides used to amplify pea Fd I (Fed-1) cDNA were AAACACAAAACAGTGTTTGTT for the 5 (sense) primer and GAAACAAACATAACATGATATCATA for the 3 (antisense) primer. Conditions for amplification of Fed-2 cDNA were identical with those for Cab cDNA amplification except that the thermal cycles were 94C for 2 min, 55C for 2.5 min, and 72C for 3 min. The PCR product resulting from amplification of pea Fed-l cDNA was 544 bp in length.

Fluence-response curves were constructed f 33: four red light-regulated genes (Fig. 1) using a single pulse of red light given to dark-grown pea plants (see M,iterials and Methods for details). Three individual genes account for the bulk of Cab transcript under these conditioris (White et al., 1992). These genes are the type I Cab genes, Cab-8 (Alexander et al., 1991) and AB96 (Coruzzi et a1 ,1983), and the type I1 Cab gene Cab-215 (Falconet et a[., 1991). A fluence-response curve was also constructed lor a fourth phytochrome-regulated gene, Fed-1 (Dobres et al., 1987; Elliott et al., 1989). A 1 four light-regulated genes showed a measurable level 1 of expression in complete darkness (Fig. 1). Cab-8, AB96, and even Fed-1 showed a response to red light in the VLF range ( l O P 4 to 1 pmol m?). The fluence-responsecurves in Figure 1 were constructed by averaging individual curves normalized to the transcript level at the highest fluence. To determine the statistical significance of the measured VLF response for each gene, t tests were performed using the raw fluence response data (Table I). These t te& compare mean transcript levels in the dark with mea n transcript levels at log fluence = 0.3 pmol m-. This jluence was chosen because it marks the upper boundary of the VLF response and occupies the edge of the plateaii preceding the low fluence response in the collective Cab g-ne fluenceresponse curve (Horwitz et al., 1988). C a b d , AB96, and Fed-1 a11 possessed a statistically significant V ,F response (Table I) when transcript levels at log fluence = 0.3 pmol m- were compared to the dark transcript levels. However, it is not possible to conclude definitely that (ab-215 possesses a VLF response (Table I). Cab-215 is expressed at lower levels than C a b d or AB96 (White et al, 1992) and appears to be induced by red light to a lesser extent than the other genes in Figure 1, making it difficult to detect any VLF response that might exist for Cab-215. The results of the t tests for a11 four genes (Table I) fit well with a visual inspection of the fluence-response curves (Fig 1).

Cab Genes Differ Widely in Fluence Response

163

Cab-8

120

'8
- 0

e 4 0
2o

:
'p

II p
AB96
60

O
-54-3-2.1

o 1

- 5 4 - 3 ~ 2 - o 1

muence ( log pmol m-2)

muence ( log pmol m-2

Cab-215

120

e 4 0
20

l: i"
60

Fed-I

- 5 4 - 3 - 2 - 1o

o
1 2

- 5 4 . 3 - 2 - 1

Ruence ( log pmol

nuence ( log pmol m-?

Figure 1. Red light fluence-response curves for the LHCll genes Cab-8 (Lhcb7*4), AB96 (Lhcbl'l), Cab-215 (LhcbZ'l), and Fd I (Fed7). Pea seedlings were grown in absolute darkness, irradiated with a single 10-5 pulse of red light (as described by Horwitz et al., 1988), and returned to darkness for 24 h. Buds were harvested and frozen in liquid nitrogen, and total RNA was extracted. Transcript levels for individual genes were quantitated as described in "Materials and Methods." For the more abundant transcripts Cab-8 and AB96, 16 thermal cycles were used to amplify 2 ng of cDNA, whereas for Cab-215 and Fed-7, 18 and 20 thermal cycles were used, respectively. The error bars are SE. All four curves have been normalized so that the maximal transcript level (which occurs at the highest fluence) is 100%.

To determine whether a statistically significant VLF response could be detected at a still lower fluence, we chose a second fluence at the upper end of the VLF range and calculated t values similar to those in Table I. Cab-8, AB96, and Fed-1 also possess statistically significant VLF responses if log fluence = -0.9 pmol m-' is used instead of log fluence = 0.3 pmol m-' in the t tests (data not shown). This lower fluence (log fluence = -0.9 pmol m-' or 0.13 pmol m-') is at the center of the plateau between the VLF and low fluence responses (Horwitz et al., 1988). The low level of noise seen in the Cab fluence-response curves at log fluence = -0.9 (Fig. 1) may be due partly to the stable nature of the response at this fluence. Cab-8 appears to be the most light sensitive of the four genes. Cab-8 transcript accumulation is induced by extremely low red light fluences and half-maximal transcript accumulation is reached within the VLF range. AB96 and Fed-1 also show significant transcript accumulation within this same VLF range. Variation in the data (combined into single error bars in Fig. 1) makes it impossible to specify a precise fluence at which each gene begins responding to

light. Nevertheless, Cab-8, AB96, and Fed-1 possess a VLF response. In addition to their VLF responses, a11 of the genes show a further increase in transcript abundance as the fluence is increased from approximately 1 pmol m-' to more than 1000 pmol m-'. Thus, accumulation of Cab-8 and AB96 transcripts is sensitive to light fluence over a range spanning at least severa1 orders of magnitude. The biphasic pattern of the composite Cab fluence-response curve (Horwitz et al., 1988) is less clear for the individual Cab genes. However, it appears that the characteristic shape of the composite Cab fluence-response curve derives in large part from that for Cab-8. This is concluded since Cab-8 possesses a biphasic light response (Fig. 1) similar to the composite curve and also because Cab-8 is the most highly expressed Cab gene in pea (White et al., 1992). In earlier experiments (White et al., 1992) we observed that transcripts of the pea Cab genes AB80 and AB66 (Timko et al., 1985) remained undetectable following a saturating red light pulse. To test the hypothesis that these genes respond preferentially to blue light, we carried out experiments in which a blue light pulse was substituted for the red pulse used previously. Figure 2 shows that blue light also failed to induce accumulation of A B 8 0 and AB66 transcripts, even though the same seedlings showed significant accumulations of Cab-8, AB96, and Fed-1 transcripts. The accumulation of Cab-8, AB96, and Fed-1 transcripts does not prove involvement of a blue light receptor in these responses, since blue light is known to produce small amounts of Pfr (Briggs and Iino, 1983).However, it is clear that neither red nor blue light can induce A B 8 0 or AB66 when etiolated seedlings are irradiated for short periods of time. In contrast, Figure 2 shows that transcripts of both A B 8 0 and AB66 do accumulate when seedlings are exposed to continuous red light (Fig. 2). Expression after prolonged illumination may reflect a requirement for a high irradiance response (White et al., 1992; Mancinelli, 1994) and/or coupling of gene expression to a developmental event, such as leaf expansion, that is stimulated by continuous irradiation to a much greater extent than by single light pulses. These data suggest that accumulation of A B 8 0 and AB66 transcripts under these conditions requires many orders of magnitude more red light than the VLF responses of Cab-8 and AB96.

Table 1. Statistical significance o f the VLF response m G r e d for

Cab-8, AB96, Cab-215, and Fed-1 A ttest was used to compare the mean transcript levels in the dark with mean transcript levels at log fluence = 0.3 (see text for details). The value of t i s given in column 2 and the statistical significance in column 3.
Cene

Significance

Cab-8 A696 Cab-215 Fed- 1

3.95 2.77 1.57 4.97

>95 95 >80 >99

164

White et al.

Plant Physiol. Vol. 107, 1995

AB80
CDNA cDNA

AB66

std

std

0 B CR C

D B CR C

Cab-8
CDNA cDNA

AB96

et al., 1985, 1986). More recent studies have identified two protein factors binding to a 247-bp regulatory region of AB80 (Arguello et al., 1992). One of these factors is found only in green tissue but not in etiolated or root tissue, consistent with our previous studies in which the highest level of AB80 expression was detected in pea leaves (White et al., 1992) and consistent with the lack of AB80 response to a red or blue pulse (Fig. 2). Since AB80 transcript accumulation can be induced by continuous red light, it would be interesting to determine whether the leaf-specific DNAbinding factor can also be induced by continuous red light. Thus, AB80 could be used as model gene to investigate high irradiance response or leaf-induced development. In contrast, a gene such as Cab-8 would be ideal to study early light responses or VLF responses.

std

ACKNOWLEDGMENTS We especially thank Lynn Dickey, Maria Gallo-Meagher, and Lisa Childs for advice and assistance in developing a system to amplify pea Fed-1 cDNA accurately and for construction of the Fed-1 PCR standard. We greatly appreciate the assistance of Brian Fristensky, Denis Falconet, and Lisa Childs in designing specific Cab gene primers and Katherine M.F. Warpeha for preparation of RNAs in the blue light experiments. Finally, we thank Keith Everett for oligonucleotide synthesis, photography, and densitometry. Received May 11, 1994; accepted October 10, 1994. Copyright Clearance Center: 0032-0889/95/107/0161/05. LITERATURE CITED
D B CR C

std

D B CR C

0 B CR C

Cab-215
cDNA Std

Fed-7

std -^ * *
CDNA **

D B CR C

Figure 2. Effects of a blue light pulse or continuous red light on gene expression. Seedlings were grown in complete darkness (D) or were given a blue light pulse (B) as described in "Materials and Methods" and returned to darkness for 24 h. A separate group of seedlings was grown in continuous red light (CR). Buds were harvested and frozen in liquid nitrogen, and total RNA was extracted. The fourth lane in each panel is a control (C) lacking reverse transcriptase but containing a PCR standard (std). Sixteen thermal cycles were used to amplify 1 ngof cDNA for the more abundant transcripts Cab-8 (Lhcbl"4) and AB96 (Lhcbfl); 18 cycles were used for Cab-215 (i/icb2"1) and 20 were used for Fed-1, AB80 (Lhcbl'2), and AB66 (Lhcbl'3).

The dramatic difference in the light response of AB80 and AB66 compared to other Cab genes can now be considered when interpreting studies on the role of cis-acting elements in gene expression. Previously, studies of individual Cab gene expression required transgenic tobacco, since the transcripts of the various Cab genes in pea (or other species) could not be distinguished from one another. Therefore, it was not possible to determine whether a transgene behaved identically with the native pea gene or whether the pattern of expression of the frans-gene was typical of Cab gene responses. AB80 was one of the first plant genes whose light response was studied in detail in transgenic plants (Simpson

Alexander L, Falconet D, Fristensky BW, White MJ, Watson JC, Roe BA, Thompson WF (1991) Nucleotide sequence of Cab-8, a new type I gene encoding a chlorophyll a/b-binding protein of LHCII in Pisum. Plant Mol Biol 17: 523-526 Arguello G, Garcia-Hernandez E, Sanchez M, Gariglio P, Herrera-Estrella L, Simpson J (1992) Characterization of DNA sequences that mediate nuclear protein binding to the regulatory region of the Pisum sativum (pea) chlorophyll a/b binding protein gene AB80: identification of a repeated heptamer motif. Plant J 2: 301-309 Briggs WR, lino M (1983) Blue light-absorbing photoreceptors in plants. Philos Trans R Soc Lond-Biol Sci B303: 347-359 Coruzzi G, Broglie R, Cashmore A, Chua NH (1983) Nucleotide sequences of two pea cDNA clones encoding the small subunit of ribulose 1,5-bisphosphate carboxylase and the major chlorophyll a/b-binding thylakoid polypeptide. J Biol Chem 258: 1399-1402 De Fetter E, Wiemeersch LV, Rethy R, Dedonder A, Fredericq H, De Greet J (1988) Fluence-response curves and action spectra for the very low fluence and the low fluence response for the induction of Kalanchoe seed germination. Plant Physiol 88: 276-283 Dobres MS, Elliot RC, Watson JC, Thompson WF (1987) A phytochrome regulated pea transcript encodes ferredoxin I. Plant Mol Biol 8: 53-59 Elliott RC, Pedersen TJ, Fristensky B, White MJ, Dickey LF, Thompson WF (1989) Characterization of a single copy gene encoding ferredoxin I from pea. Plant Cell 1: 681-690 Eskins K, Beremand PD (1990) Light-quality and irradiance-level control of light-harvesting complex of photosystem 2 in maize mesophyll cells. Evidence for a low fluence-rate threshold in blue-light reduction of mRNA and protein. Physiol Plant 78: 435-440

Cab Genes Differ Widely in Fluence Response

165

Falconet D, Godon C, White MJ, Thompson WF (1993) Sequence of lhcb3*l, a gene encoding a photosystem I1 chlorophyll a/b-binding protein in Pisum. Biochim Biophys Acta 1173: 333-336 Falconet D, White MJ, Fristensky BW, Dobres MS, Thompson WF (1991) Nucleotide sequence of Cab-215, a type I1 gene encoding a photosystem I1 chlorophyll a/b-binding protein in Pisum. Plant Mo1 Biol 17: 135-139 Horwitz 8, Thompson W, Briggs W (1988) Phytochrome regulation of greening in Pisum. Plant Physiol 86: 299-305 Jansson S, Pichersky E, Bassi R, Green BR, Ikeuchi M, Melis A, Simpson DJ, Spagfort M, Staehelin LA, Thornber JP (1992) A nomenclature for the genes encoding the chlorophyll p/b-binding proteins of higher plants. Plant Mo1 Biol Rep 10: 242-253 Jordan BR, Chow WS, Strid A, Anderson JM (1991) Reduction in cab and psbA RNA transcripts in response to supplementary ultraviolet-B radiation. FEBS Lett 284 5-8 Kaufman LS,Thompson WF, Briggs WR (1984) Different red light requirements for phytochrome induced accumulation of cab RNA and rbcS RNA. Science 2 6 1447-1449 2: Mancinelli AL (1994) The physiology of phytochrome action. In GHM Kronenberg, RE Kendrick, eds, Photomorphogenesis in Plants, Ed 2. Kluwer, Dordrecht, The Netherlands, pp 211-269 Nagy F, Fejes E, Wehmeyer B, Dallman G, Schafer E (1993) The circadian oscillator is regulated by a very low fluence response of phytochrome in wheat. Proc Natl Acad Sci USA 90: 6290-6294 Nagy F, Kay SA, Boutry M, Hsu M-Y, Chua N-H (1986) Phytochrome-controlled expression of a wheat Cab gene in transgenic : tobacco seedlings. EMBO J 5 1119-1124 Oelmiiller R, Kendrick R, Briggs W (1989) Blue-light mediated accumulation of nuclear-encoded transcripts coding for proteins of the thylakoid membrane is absent in the phyto-

chrome-deficient aurea mutant of tomato. Plant Mo1 Biol 13: 223-232 Simpson J, Schell J, Van Montagu M, Herrera-Estrella L (1986) Light-inducible and tissue-specific pea lhcp expression involves an upstream element combining enhancer and silencer like properties. Nature 323: 551-554 Simpson J, Timko MP, Cashmore AR, Schell J, Van Montagu M, Herrera-Estrella L (1985) Light-inducible and tissue-specific expression of a chimaeric gene under control of the 5 flanking sequence of a pea chlorophyll a/b-binding protein gene. EMBO J 11:2723-2729 Timko MP, Kausch AP, Hand JM, Cashmore AR, HerreraEstrella L, Van den Broeck G, Van Montagu MV (1985) Structure and expression of nuclear genes encoding polypeptides of the photosynthetic apparatus. In Molecular Biology of the Photosynthetic Apparatus. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 381-396 Warpeha KMF, Kaufman LS (1990) Two distinct blue-light responses regulate the levels of transcripts of specific nuclearcoded genes in pea. Planta 182: 553-558 Warpeha KMF, Marrs KA, Kaufman LS (1989) Blue light regulation of specific transcript levels in Pisum sativum.Plant Physiol 91: 1030-1035 Wehmeyer B, Cashmore AR, Schafer E (1990) Photocontrol of the expression of genes encoding chlorophyll a/b binding proteins carboxylase in and small subunit of ribulose-1,5-bisphosphate etiolated seedlings of Lycopersicon esculentum (L.) and Nicotiana tabncum (L.). Plant Physiol 93: 990-997 White MJ, Fristensky B, Falconet D, Childs LC, Watson JC, Alexander L, Roe BA, Thompson WF (1992) Expression of the chlorophyll a/b protein multigene family in pea (Pisum sativum L.): evidence for distinct developmental responses. Planta 188: 190-198