SBA3503/AQU3601 BIOTEKNOLOGI AKUAKULTUR

DNA Manipulation

DNA

Purify Cutting Joining Amplify Probe Marker Cloning Expression Library Assemble Sequencing Microarray

DNA PURIFICATION
DNA purification can be done using: Gel extraction

Column purification
Chemical such as proteinase K, ethanol, RNase, DNase

The purpose of DNA purification is to remove any contamination such as protein, salt, excess reagent

CUTTING DNA
Restriction endonucleases (RE) : the enzymes that are used to cut DNA molecules in specific places Type I RE: Recognizes specific sequences in the DNA but does not cut them Type II RE: Recognizes and cut within specific target sequences and therefore generate specific fragments The name of RE: Identified firstly by the name of the organism from which they are obtained, using the first letter of the genus and the first two letters of the specific name, together with a suffix indicating the specific enzyme from that species: E Co R I Escherichia (genus) coli (species) RY13 (strain) The first RE identified in that bacteria

The Nobel Prize in Physiology or Medicine 1978 "for the discovery of restriction enzymes and their application to problems of molecular genetics"

Switzerland Biozentrum der Universitt Basel, Switzerland

USA Johns Hopkins University School of Medicine Baltimore, MD, USA

USA Johns Hopkins University School of Medicine Baltimore, MD, USA

Examples of Restriction endonuclease

Enzyme Recognition site G/AATTC G/GATCC A/GATCT CTGCA/G No. Ends generated of bases 6 6 6 6 5 sticky ends 5 sticky ends 5 sticky ends 5 sticky ends Original source of enzyme

EcoRI BamHI BglII PstI

Escherichia coli RY13 Bacillus amyloliquefaciens H Bacillus globigii Providencia stuartii

XmaI
SmaI Sau3A AluI NotI PacI

C/CCGGG
CCC/GGG /GATC AG/CT TTAAT/TAA

6
6 4 4 8

5 sticky ends
Blunt ends 5 sticky ends Blunt ends 5 sticky ends 5 sticky ends

Xanthomonas malvacearum
Serratia marcescens Staphylococcus aureus Arthrobacter luteus Nocardia otitidis-caviarum Pseudomonas alcaligenes

GC/GGCCGC 8

Only one strand of the recognition site is shown, with a slash (/) showing the position of the cleavage site

Hae III

EcoR I

Alu I Not I

Hind III

5 sticky ends

Isoschizomers are pairs of restriction enzymes specific to the same recognition sequence. For example, Sph I (CGTAC/G) and Bbu I (CGTAC/G) are isoschizomers of each other. Isoschizomers are isolated from different strains of bacteria and therefore may require different reaction conditions. An enzyme that recognizes the same sequence but cuts it differently is a neoschizomer. Neoschizomers are a specific type (subset) of Isoschizomers. For example, Sma I (GGG/CCC) and Xma I (G/GGCCC) are neoschizomers of each other.

An enzyme that recognizes slightly different sequence, but produces the same ends is a isocaudomer.

Restriction digestion: Incubate the DNA fragment, RE and buffer at 37oC

After a restriction digestion, if a digest produces more than one fragment, the fragments will normally need to be separated on a agarose gel and the desired fragment excised and purified

JOINING DNA
The joining or ligation of DNA fragments is carried out by an enzyme known as DNA ligase

DNA ligase, an enzyme that catalyses the formation of a phosphodiester bond between two DNA chain
DNA ligase enzymes require a free hydroxyl group at the 3 end of one DNA chain and a phosphate group at the 5 end of the other. The formation of a phosphodiester bond between these groups requires energy DNA ligases are only able to join DNA molecules that are part of a double helix they are unable to join two molecules of single stranded DNA Recommended ligation temperature: 4oC - 22oC

DNA ligase has been used by researchers to join DNA fragments to form recombinant DNA molecules

DNA AMPLIFICATION
PCR is the amplification of specific DNA sequences in vitro PCR requires two primers one that is complementary to each strand of DNA and a DNA polymerase Repetitive heating and cooling cycles amplify the DNA between the two primer binding sites to yield large quantities of replicated DNA Involves 3 steps: denaturing, annealing, extension

Thermal cycler

PCR Cycle

DNA CLONING
DNA cloning strategies are composed of 4 parts: the generation of foreign DNA fragments,

the insertion of foreign DNA into a vector,

the transformation of the recombinant DNA molecule into a host cell in which it can replicate and

a method of selecting or screening clones to identify those that contain the particular recombinant we are interested in.

EXPRESSION
Expression vector: vector that used in expression study of DNA fragment Expression vector will often contain multiple cloning site located between a strong transcriptional promoter and terminator sequence The expression vector will also contain an origin of replication and a selectable marker such that the vactor may be autonomously replicated and maintained within cells Using expression vector, protein that codes by DNA fragment will be expressed/produced by the bacteria cell

Common host-vector systems that are used for protein production: E. coli, yeast, insect and mammalian cells
E. coli remains the host cell of choice for the majority of protein expression experiments. E. coli: rapid doubling time (approximately 20-30 min), inexpensive media, easily broken for the harvesting of the proteins produced within the cell

DNA MARKER
DNA marker has been used in many organisms for population study, gender determination, selective breeding, disease detection

Various techniques: Random Amplified Polymorphic DNA (RAPD), Amplified Fragment Length Polymorphism (AFLP), Restriction Fragment Length Polymorphism (RFLP), microsatellite

M1 male specific band (M)

M2

M3

F1

F2

F3

female specific band (F) M1 M2 M3 F1 F2 F3

DNA marker for male DNA marker for female Identify the male specific band and female specific band cut the specific bands purify clone identify the sequence design specific primers amplify the DNA using the specific primers run gel

DNA marker for population study

Perak

Perlis

Pahang Pulau Pinang

DNA PROBE
DNA probe used to detect specific DNA fragment or specific clone

Nucleic acid probe (DNA or RNA), which will hybridize to the DNA sequence you are looking for in a specific clone

DNA sample (Southern Blot), RNA sample (Northern Blot) and protein sample (Western Blot)

Following gel electrophoresis, probes are often used to detect specific molecules from the mixture. However, probes cannot be applied directly to the gel. The problem can be solved by three types of blotting methods: Southern blotting Southern blotting is a technique for detecting specific DNA fragments in a complex mixture Northern blotting Northern blotting is used for detecting RNA fragments, instead of DNA fragments. In the Southern blotting, DNA fragments are denatured with alkaline solution. In the Northern blotting, RNA fragments are treated with formaldehyde to ensure linear conformation.

Western blotting Western blotting is used to detect a particular protein in a mixture. The probe used is therefore not DNA or RNA, but antibodies. The technique is also called "immunoblotting".

Probe preparation
M 1

1000 bp PCR product (double stranded) PCR product (single strand)

500 bp

Denature the PCR product

Amplification of PCR product

Target preparation
M 23000 bp 1 23000 bp M 1

Run genomic DNA

Cut genomic DNA with RE

Southern blotting - method for the identification of DNA fragments that are complementary to a know DNA sequence. It allows a comparison between the genome of a particular organism and that of an available gene or gene fragment (the probe). It can tell us whether an organism contains a particular gene, and provide information about the organisation and restriction map of that gene. In Southern blotting, chromosomal DNA is isolated from the organism of interest, and digested to completion with a restriction endonuclease enzyme. The restriction fragments are then subjected to electrophoresis on an agarose gel, which separates the fragments on the basis of size. DNA fragments in the gel are denatured (separated into single strands) using an alkaline solution. The next step is to transfer fragments from the gel onto nitrocellulose filter or nylon membrane. This can be performed by electrotransfer (electrophoresing the DNA out of the gel and onto a nitrocellulose filter), but is more typically performed by simple capillary action.

In this system, the denatured gel is placed onto sheet(s) of moist filter paper and immersed in a buffer reservoir. A nitrocellulose membrane is laid over the gel, and a number of dry filter papers are placed on top of the membrane. By capillary action, buffer moves up through the gel, drawn by the dry filter paper. It carries the single-stranded DNA with it, and when the DNA reaches the nitrocellulose it binds to it and is immobilised in the same position relative to where it had migrated in the gel. The DNA is bound irreversibly to the filter/membrane by baking at high temperature (nitrocellulose) or cross-linking through exposure to UV light (nylon).

The final step is to immerse the membrane in a solution containing the probe - either a DNA (cDNA clone, genomic fragment, oligonucleotide) or RNA probe can be used. This is DNA hybridization - in other words the target DNA and the probe DNA/RNA form a 'hybrid' because they are complementary sequences and so can bind to each other. The probe is usually radioactively labelled with 32P or labelled with special detection reagent such as enzyme horseradish peroxidase.

The membrane is washed to remove non-specifically bound probe, and is then exposed to X-ray film (blue light sensitive film) - a process called autoradiography. At positions where the probe is bound, emissions from the probe cause the X-ray film to blacken. This allows the identification of the sizes and the number of fragments of chromosomal genes with strong similarity to the gene or gene fragment used as a probe.

Southern blot (DNA sample)

Emissions from the probe cause the X-ray film/blue-light sensitive film to blacken. This allows the identification of the sizes and the number of fragments of chromosomal genes with strong similarity to the gene or gene fragment used as a probe

RNA samples

Northern blot (RNA sample)

Colony blotting

The principle involved is that the library (in form of bacterial colony) is replicated onto a filter, which is then treated to release the DNA and bind it to the filter, which then carries a pattern of DNA spots that replicates the position of the colonies on the original plate.

The filter is then hybridized with the probe, which has first been labelled so that it can be easily detected.

This allows us to detect which DNA spots hybridize to the probe and recover the corresponding clones from the original plate

LIBRARY
A genomic library: a collection of clones which between them represent the entire genome of an organism A cDNA library: a collection of clones that constructed from DNA copies of the mRNA present in the originating cells at the time of isolation

The first step in producing a genomic library is to fragment the genomic DNA into pieces of a suitable size for cloning in an appropriate vector. To construct a library of overlapping fragments is to use partial digestion This means using conditions, such as short digestion times, that result in only a small proportion of the available sites being cut A similar effect can be obtained by using very small amounts of enzyme, or by incubating the digest at reduced temperature

The digested material is then fractionated by electrophoresis to obtain fragments of the required size range before cloning in an appropriate vector

Restriction sites

Genomic DNA

Collection of overlapping fragments

mRNA template

First strand cDNA synthesis Second strand cDNA synthesis Ligation with EcoRI adapter XhoI Digest with XhoI Synthesis of cDNA strand for cDNA library construction

Each colony contains different DNA fragment

DNA ASSEMBLE
Process to assemble DNA sequences using bioinformatics analysis in order to produce a consensus

Restriction sites

Genomic DNA

Collection of overlapping fragments

Consensus

CTAGACCGTAGACTAGCAGAGATCAGTACGATAGCCAGTAGCAGAATGCCAGTA ATGCGTGACTAGACCGTAGACTAGCAGAGATCAGTACGA CTAGACCGTAGACTAGCAGAGATCAGTACGATA GTGACTAGACCGTAGACTAGCAGAGATCAGTACGATAGCCAGTAGC

Assemble
ATGCGTGACTAGACCGTAGACTAGCAGAGATCAGTACGATAGCCAGTAGCAGAATGCCAGTA

Consensus

ATGCGTGACTAGACCGTAGACTA GCAGAGATATTGGCTGACATACA

DNA SEQUENCING

The most fundamental way of analyzing the structure of DNA, whether it is a recombinant plasmid, a natural gene or a whole genome is to determine the sequence of bases of which it is composed

The advent of automated DNA sequencing machines has made the determination of the sequence of individual fragments very much faster and more reliable and the dramatic increase in the available computer power has enabled the assembly of very large numbers of fragments

DNA SEQUENCING
ELECTROPHORESIS: Slab gel Capillary system

ABI Prism Genetic Analyser

Capillary electrophoresis:
Small amount of sample Detection system is more sensitive

Faster
Result more consistent

C G A T

1963 F. Sanger of Britain developed sequencing procedure for proteins

2000 J. Craig Ventor, along with Francis Collins, jointly announce the sequencing of the entire human genome

DNA SEQUENCING
Sample preparation - (PCR product / plasmid)

Cycle sequencing

Sample purification

Automated sequencing

Sequence analysis

Sample preparation
In 0.2 ml tube, add:
3.0 ul sample (DNA plasmid) 8.0 ul ABI BigDye Terminator ready reaction mix 1.0 ul primer (5 pmol) 8.0 ul deionized water Total volume: 20 ul Cycle sequencing: 96 oC - 5 min 96 oC - 30 s

50 oC - 15 s
60 oC - 4 min 10 oC -

50 cycles

C G A

Cycle sequencing

Thermal cycler

Sequencer

Cycle sequencing using thermal cycler BigDye terminator

ddNTP (dideoxynucleotide triphosphate: ddATP,ddGTP,ddCTP,ddTTP)

Sample purification
Cycle sequencing product, add: 50 ul ethanol (95% ETOH), 2 ul 3M sodium acetate (pH 4.6)

Vortex, incubate at room temperature for 15 min

Centrifuge at 14,000 rpm for 30 min at 4 oC Remove supernatant

Add 250 ul ethanol (70% ETOH) to the pellet

Vortex, Centrifuge at 14,000 rpm for 5 min at 4 oC Remove supernatant

Add 250 ul ethanol (70% ETOH) to the pellet

Vortex, Centrifuge at 14,000 rpm for 5 min at 4 oC Remove supernatant

Dry the pellet

Automated sequencing
Purified pellet, add: 10 ul formamide HIDI (Applied Biosystem, USA) to dissolve the pellet Denature the DNA strand at 95 oC for 7 min Short spin the tube Samples are ready to analyze in sequencer

SEQUENCER

ABI PRISM 3100 Genetic Analyzer

Sample A

Sample B

Sample A

Sample B

Detector in sequencer machine will detect the fluorescence dyes based on the wave length of each fluorescence dye and these data will be transformed into a graph (chromatogram) by computer software

Automated sequencing
Automated sequencing using sequencer machine (eg. ABI PRISM 3100 Genetic Analyzer) Automated sequencing involves electrophoresis of samples from cathode to anode through a special medium called polymer (eg. POP6, Applied Biosystems, USA) The migration of sample will be detected by a sensitive detector that connects to a CCD camera that detects the fluorescence dye. The data will be transformed into a chromatogram file by computer software. The chromatogram file can be used to characterize the sequence using bioinformatics analysis

Unpurified sample

Purified sample

HUMAN GENOME PROJECT

The Human Genome Project (HGP) is an international 13-year effort formally begun in October 1990. The project was planned to last 15 years, but rapid technological advances accelerated the completion to 2003. Project goals were to determine the complete sequence of the 3 billion DNA subunits (bases), identify all human genes, and make them accessible for further biological study. As part of the HGP, parallel sequencing was done for selected model organisms such as the bacterium E. coli to help develop the technology and interpret human gene function. The Department of Energy's Human Genome Program and the National Institutes of Health's National Human Genome Research Institute (NHGRI) together sponsored the U.S. Human Genome Project.

HUMAN GENOME PROJECT

Approximately, 10 - 20 human DNA samples used in Human Genome Project and the identity of the samples are still remain unknown

The objectives of Human Genome Project: To determine all the 3 billions (3 x 109) base in the human genome

To determine all the 30,000 genes in human genome

To determine the function of all the 30,000 genes To store all the data into one appropriate database To catalyze the development of new biotechnology technique and new medicine

DNA MICROARRAY

Large scale

DNA library

Multi channel micropipette

96 well Microplate

Large scale plasmid extraction

DNA MICROARRAY
Glass slide that contains microscopic elements that allow it binding to DNA, gene or gene product

Biochips, DNA chip or gene chip/microarray contains a collection of small elements in row and column

DNA microarray is a very effective method in determining expressed genes in one experiment

Commercial Genechip in the market:

Affymetrix GeneChip

Human, Mouse, Yeast

The Affymetrix GeneChip Zebrafish Genome Array can be used to study gene expression of over 14,900 Danio rerio transcripts.

DNA spotting onto glass slide using robotic machine

Cy5

Cy3

Scanner

Data analysis based on the intensity of fluorescence dye of DNA spot

Image scan at 650 nm Cy5 (0 hr)

Image scan at 550 nm Cy3 (16 hrs)

Red spot: Gene expressed in sample: 0 hr

Green spot: Gene expressed in sample: 16 hrs Yellow spot: Genes expressed in both samples

Overlay image

Experiment: Determination of expressed gene in fishes that have been cultured at 10 oC for 16 hrs

Data analysis based on the color intensity of DNA spot