Rehan Sadiq Sheikh's PH.D Thesis

GENOTYPE/PHENOTYPE CORRELATION FOR HEREDITARY HEARING IMPAIRMENT LOCI
A THESIS SUBMITTED TO
UNIVERSITY OF THE PUNJAB

IN THE COMPLETE FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
IN
MOLECULAR BIOLOGY
BY
REHAN SADIQ SHAIKH
Supervisors:
DR. SHAHEEN. N. KHAN & DR. SHEIKH RIAZUDDIN

CENTRE OF EXCELLENCE IN MOLECULAR BIOLOGY, UNIVERSITY OF THE PUNJAB, LAHORE, PAKISTAN
(2006)
In the name of ALLAH the most merciful & compassionate the most gracious and beneficent whose help and guidance always solicit at every step, at every moment
CERTIFICATE
It is certified that the research work described in this thesis is the original work of the author and has been carried out under our direct supervision. We have personally gone through all the data reported in the manuscript and certify their correctness/authenticity. It is further certified that the material included in this thesis have not been used in part or full in a manuscript already submitted or in the process of submission in partial/complete fulfillment of the award of any other degree from any other institution. It is also certified that the thesis has been prepared under our supervision according to the prescribed format and we endorse its evaluation for the award of Ph.D. degree through the official procedures of the University. In accordance with the rules of the Centre, data book # 352, 415, M-18, and 558 is declared as unexpendable document that will be kept in the registry of the Centre for a minimum of three years from the date of the thesis defense examination.
Name of Supervisor: Dr. Shaheen. N. Khan Principal Scientific Officer, Punjab University, Lahore.
Name of Supervisor: Dr. Sheikh Riazuddin Director, CEMB, Punjab University, Lahore.
INDEX
Page List of Figure......................................................................................................................v List of Table.......................................................................................................................vi Summary ..........................................................................................................................vii Acknowledgments .............................................................................................................ix Abbrevations.......................................................................................................................x INTRODUCTION..............................................................................................................1 CHAPTER- I REVIEW OF LITERATURE ............................................................................................5
SECTION-I-INTRICACY OF AUDITORY SYSTEM ........................................................ 6
ANATOMY OF AUDITORY SYSTEM..............................................................................................7 THE EXTERNAL EAR ..............................................................................................................7 The Pinna................................................................................................................................7 The Auditory Canal (Auditory Meatus)..................................................................................7 Tympanic Membrane (Ear Drum) ..........................................................................................7 THE MIDDLE EAR (TYMPANIC CAVITY) ...........................................................................8 Auditory Ossicles....................................................................................................................8 Eustachian Tube .....................................................................................................................8 Oval and Round Windows......................................................................................................8 THE INNER EAR.....................................................................................................................10 Osseous Labyrinth ................................................................................................................10 Vestibule ..........................................................................................................................10 Semicircular canals ..........................................................................................................11 Cochlea ............................................................................................................................11 Membranous Labyrinth.........................................................................................................11 Neurosensory epithelia (Mechanotransducers) ................................................................11 Ion Transporting Epithelia ...............................................................................................12 Less Specialized Epithelia ...............................................................................................12 VESTIBULAR SYSTEM .........................................................................................................12 COCHLEAR SYSTEM.............................................................................................................12 Organ Of Corti......................................................................................................................13 Outer Hair Cells: (OHCs) ................................................................................................13 Inner hair cells: (IHCs) ....................................................................................................13 Hair Cell stereocilia and links..........................................................................................14 PHYSIOLOGY OF EAR ....................................................................................................................16 EVENTS IN THE HEARING OF SOUND WAVES ...............................................................16 Conductive Hearing ..............................................................................................................16 Sensory Hearing ...................................................................................................................16 Neural Hearing .....................................................................................................................17 MOLECULAR BASIS OF MECHANOSENSORY TRANSDUCTION AND ADAPTATION MECHANISMS ........................................................................................................................17 Transducer Channel Model...................................................................................................18 Adaptation Motor Model ......................................................................................................18
SECTION-II-GENETICS OF DEAFNESS ......................................................................... 21

DEAFNESS ........................................................................................................................................22 A BRIEF HISTORY .................................................................................................................22 GENETIC EPIDEMIOLOGY...................................................................................................25 MOLECUALR GENETIC OF DEAFNESS.......................................................................................25 HEARING LOSS/DEAFNESS LOCI .......................................................................................25
(i)
NONSYNDROMIC HEARING LOSS (NSHL) ..................................................................25 Nonsyndromic Autosomal Dominant Hearing Loss.........................................................25 Nonsyndromic Autosomal Recessive Hearing Loss.........................................................26 SYNDROMIC HEARING LOSS.........................................................................................26 Syndromic Autosomal Dominant Loci.............................................................................26 Syndromic Autosomal Recessive Loci.............................................................................27 PREVALENT SYNDROMIC AND NONSYNDROMIC LOCI/GENES IN PAKISTANI POPULATION ..............................................................................................................................36 DFNB1/DFNA3/CX26/GJB2/CX30/GJB6...............................................................................36 DFNB2/DFNA11/USH1B/MYO7A .........................................................................................37 DFNB3/MYO15A.....................................................................................................................39 DFNB4/PENDRED SYNDROME/SLC26A4 ..........................................................................40 DFNB6/TMIE ...........................................................................................................................41 DFNB7/11/DFNA36/TMC1 .....................................................................................................42 DFNB8/B10/TMPRSS3 ............................................................................................................42 DFNB12/USH1D/CDH23.........................................................................................................43 DFNB18/USH1C ......................................................................................................................44 DFNB21/ DFNA8/A12/TECTA ...............................................................................................44 DFNB23/USH1F/PCDH15 .......................................................................................................45 DFNB26 ....................................................................................................................................45 DFNB29/CLDN14 ....................................................................................................................45 DFNB35 ....................................................................................................................................46 DFNB36/ESPN .........................................................................................................................46 DFNB37/DFNA22/MYO6 ........................................................................................................46 DFNB38 ....................................................................................................................................47 DFNB39 ....................................................................................................................................47 DFNB42 ....................................................................................................................................47 DFNB44 ....................................................................................................................................47 DFNB46 ....................................................................................................................................47 DFNB48 ....................................................................................................................................47 DFNB49 ....................................................................................................................................47 DFNB51 ....................................................................................................................................47 DFNB56 ....................................................................................................................................48 MOLECULAR ARCHITECTURE OF THE INNER EAR HAIR CELLS AND HAIR BUNDLE STEREOCILIA...................................................................................................................................51 CORE OF STEREOCILIA...................................................................................................51 Shaping the stereocilium from tip to taper............................................................................52 Arrangement of stereocilia in the hair bundle.......................................................................54 Programmed elongation of stereocilia ..................................................................................55 Stereociliary links .................................................................................................................56 HAIR BUNDLE MORPHOGEENSIS AND MACROMOLECULAR COMPLEX OF USH1 PROTEINS................................................................................................................................57 SUPPORTING CELLS .............................................................................................................60 THE BASILAR MEMBRANE .................................................................................................60 TECTORIAL MEMBRANE.....................................................................................................61 STRIA VASCULARIS..............................................................................................................61 CONCLUSION .........................................................................................................................62
SECTION-III-LINKAGE ANALYSIS-A TOOL FOR MAPPING DISEASE CAUSING GENES..................................................................................................................................... 63

RECOMBINATION FRACTION REFLECTS GENETIC DISTANCE..................................65 SCORE METHOD....................................................................................................................65 MULTIPOINT MAPPING .......................................................................................................65 DNA POLYMORPHISM AS A TOOL FOR LINKAGE ANALYSIS.....................................66
CHAPTER-II MATERIAL AND METHODS........................................................................................67
(ii)
FIELD WORK ...............................................................................................................................68 INSTITUTIONAL REVIEW BOARD (IRB)...........................................................................68 IDENTIFICATION AND ENROLLMENT OF FAMILIES ....................................................68 CLINICAL EVALUATION......................................................................................................69 AUDIOLOGICAL EVALUAION........................................................................................69 Audiometry ......................................................................................................................69 Tympanometry.................................................................................................................70 Otoacoustic Emission (OAE)...........................................................................................70 VESTIBULAR EVALUATION...........................................................................................72 Romberg and Tandem Gait Test ......................................................................................72 Electronystagmography Test (ENG)................................................................................72 RETINITIS PIGMENTOSA ................................................................................................72 Funduscopy or Opthalmoscopy........................................................................................73 Electroretinogram Test (ERG) .........................................................................................73 BENCH WORK.............................................................................................................................75 DNA EXTRACTION................................................................................................................75 From Blood Samples ............................................................................................................75 From Buccal Swabs ..............................................................................................................75 Preparation of Replica Plates................................................................................................76 LINKAGE ANALYSIS FOR ALREADY REPORTED DFNB LOCI .....................................77 Genotyping By Using Polymerase Chain Reaction (PCR) and STR Markers ......................77 GENOME WIDE SCAN...........................................................................................................78 SAMPLE PREPARATION FOR ABI 3100 GENETIC ANALYZER .....................................81 Principle Of Automated Fluorescent Genotyping.................................................................81 HAPLOTYPE ANALYSIS ..................................................................................................83 GENOME SCAN DATA ORGANIZATION AND ANALYSIS .............................................83 How to Run the Macro .........................................................................................................83 Modules ...........................................................................................................................83 LOD SCORE CALCULATIONS.........................................................................................85 DNA SEQUENCING................................................................................................................85 Amplification of PCR Fragments .........................................................................................86 Agarose Gel Electrophoresis and EXO-SAP Treatment.......................................................86 Sequencing Reaction ............................................................................................................86 Sequencing Product Precipitation and Loading on ABI 3100 Sequencer.............................87 Analysis of DNA Sequences.................................................................................................88
CHAPTER-III RESULTS AND DISCUSSION ......................................................................................89

SECTION-I A MUTATION SPECTRUM OF MYO7A ASSOCIATED WITH USH1B AND EVIDENCE FOR THE EXISTENCE OF DFNB2 ............................................................. 90
PREAMBLE ..................................................................................................................................91 FAMLIES LINKED TO USHER TYPE 1B..................................................................................92 PKDF008 ..................................................................................................................................92 PKDF161 ..................................................................................................................................93 Missense Mutation (G214R) in MYO7A causes USH1B ......................................................93 PKDF189 ..................................................................................................................................93 PKB1.........................................................................................................................................95 In-frame Deletion Mutation (495delG) in MYO7A causes USH1B ......................................95 PKDF148 ..................................................................................................................................95 Frame shift Mutation (L1046fsX1054) in MYO7A causes USH1B ......................................95 PKDF137 ..................................................................................................................................97 Nonsense Mutation (Q531X) in MYO7A causes USH1B .....................................................97 PKDF164 ..................................................................................................................................97 Nonsense Mutation (R972X) in MYO7A causes USH1B......................................................97 PKDF142 ..................................................................................................................................98 Missense Mutation (D437N) in MYO7A causes USH1B ......................................................98
(iii)
PKDF290 ..................................................................................................................................98 Splice site Mutation (IVS16 +1G>A) in MYO7A causes USH1B.......................................101 PKDF426 ................................................................................................................................101 Splice site Mutation (IVS39 +1 G>A) in MYO7A causes USH1B......................................101 FAMLIY LINKED TO DFNB2 ...................................................................................................102 PKDF034 ................................................................................................................................102 Deletion Mutation (5146_5148 delGAG) in MYO7A causes DFNB2 ................................102 HAPLOTYPE ANALYSIS AND MYO7A ALLELES SEGREGATING IN MORE THAN ONE FAMILY..................................................................................................................................105 DISCUSSION ..............................................................................................................................107
SECTION-II-EXCLUSION STUDIES FOR KNOWN DEAFNESS LOCI AND MAPPING OF TWO NOVEL DEAFNESS LOCI DFNB51 & DFNB56 ........................................... 111
PREMABLE ................................................................................................................................112 RESULTS OF EXCULSION STUDIES ..........................................................................................113 FAMILIES LINKED TO DFNB4................................................................................................113 PKDF278 ................................................................................................................................113 Mutational Analysis .......................................................................................................114 PKDF453 ................................................................................................................................114 Mutational Analysis .......................................................................................................114 FAMILIES LINKED TO DFNB12..............................................................................................118 PKDF176 ................................................................................................................................118 PKDF177 ................................................................................................................................118 RESULTS OF GENOME WIDE SCAN ..........................................................................................120 DFNB51, MAPS TO CHROMOSOME 11P13-P12....................................................................120 PKDF240 ................................................................................................................................120 Haplotype Analysis ........................................................................................................122 PKDF407 ................................................................................................................................122 Haplotype Analysis ........................................................................................................122 SEQUENCING OF SOME OF THE IMPORTANT CANDIDATE GENES OF DFNB51 ...125 DFNB56, MAPS TO CHROMOSOME 3Q13.31-Q21.1.............................................................127 PKDF637............................................................................................................................127 Haplotype Analysis ........................................................................................................127 PKDF223 ................................................................................................................................129 Haplotype Analysis ........................................................................................................129 DISCUSSION ..............................................................................................................................132 MAPPING OF NEW LOCUS DFNB51 .................................................................................133 MAPPING OF NEW LOCUS DFNB56 .................................................................................134
CHAPTER-IV REFERENCES ..............................................................................................................137
(iv)
LIST OF FIGURES
Figuer Number............................................................................................................ Page
Fig 1.1 Fig 1.2 Fig 1.3 Fig 1.4 Fig 1.5 Fig 1.6 Fig 1.7 Fig 1.8 Fig 1.9 Fig 1.10 Fig 2.1 Fig 2.2 Fig 2.3 Fig 2.4 Fig 2.5 Fig 2.6 Fig 2.7 Fig 3.1 Fig 3.2 Fig 3.3 Fig 3.4 Fig 3.5 Fig 3.6 Fig 3.7 Fig 3.8 Fig 3.9 Fig 3.10 Fig 3.11 Fig 3.12 Fig 3.13 Fig 3.14 Fig 3.15 Fig 3.16 Fig 3.17 Structure of Human Ear ................................................................................................. Structure of Inner Ear..................................................................................................... Cross section of Membranous Labyrinth and Organ of Corti ........................................ Events in the Hearing of Sound Waves.......................................................................... Deflection of hair cells and production of action potential ............................................ Adaptation-motor model for the role of Myo1c in adaptation in the Hair cell............... Cytogenetic map positions of Human Nonsyndromic Deafness Loci ............................ Adhesion in the Hair bundle .......................................................................................... Drawings of an organ of Corti outer Hair cell and stereocilia........................................ Recombination Event ..................................................................................................... Chart representing severity of Hearing Loss .................................................................. Representative Audiogram of a normal and profound hearing loss ............................... Picture of normal retina and retina with retinitis pigmentosa......................................... Thermocycling Profiles for amplification of markers .................................................... Electropherogram representing Alleles .......................................................................... Representing the procedure to run Macro ...................................................................... Thermocycling Profiles for Exon amplification and Sequencing................................... Pedigree drawing of PKDF008 and PKDF161 .............................................................. Pedigree drawing of PKDF189 and PKB1..................................................................... Pedigree drawing of PKDF148 and PKDF137 .............................................................. 9 9 15 19 19 20 24 53 57 64 71 71 74 78 82 84 87 94 96 99
Pedigree drawing of PKDF164 and PKDF142 .............................................................. 100 Pedigree drawing of PKDF290 and PKDF426 .............................................................. 103 Pedigree drawing of PKDF034 ...................................................................................... 104 Graphical presentation of different mutations found in DFNB2/USH1B families.......... 109 ERG and Audiograms of deaf individuals from PKDF034 and PKDF008 .................... 110 Schematic representation of the ABI PRISM Linkage Mapping Set............................ 116 Pedigree drawing of PKDF278 and PKDF453 .............................................................. 117 Pedigree drawing of PKDF176 and PKDF177 .............................................................. 119 Pedigrees of families PKDF240 and PKDF407 segregating DFNB51 .......................... 121 Audiograms of PKDF240 and PKDF407 affected individuals ...................................... 123 Schematic presentation of DFNB51 interval on 11p13-p12........................................... 124 Pedigrees of families PKDF637 and PKDF223 segregating DFNB56 .......................... 128 Audiogram of PKDF223 affected individual ................................................................. 130 Schematic presentation of DFNB56 interval on 3q13.31-q21.1..................................... 131
(v)
LIST OF TABLES
Table Number.............................................................................................................. Page
Table 1.1 Table 1.2 Table 1.3 Table 2.1 Table 3.1 Table 3.2 Table 3.3 Table 3.4 Table 3.5 Table 3.6 Table 3.7 Table 3.8 Loci for Nonsyndromic Autosomal Recessive Deafness................................................ 29
Summary of the loci and genes for syndromes involving hearing loss........................... 30-35 Summary of the mutations of MYO7A. .......................................................................... 49-50 Genome Wide Panels Sets for Multiplex PCR............................................................... 79-80 Haplotype and Mutations of DFNB2/ USH1B families.................................................. Comparative clinical findings of DFNB2 linked families .............................................. Two-Point Lod Scores of DFNB51 linked families ....................................................... SNPs identified in SLC1A2, TRAF6, and RAMP .......................................................... Primer sequences for SLC1A2 exons ............................................................................. Primer sequences for TRAF6 exons ............................................................................... Primer sequences for RAMP exons ................................................................................ Two-Point Lod Scores of DFNB56 linked families ....................................................... 106 109 123 125 126 126 126 130
(vi)
SUMMARY
Deafness, the lack of ability to hear, is the most prevalent sensory deficit in human populations (McKusick, 1992). It can be divided into two groups; namely syndromic and nonsyndromic on the basis of associated phenotype other than deafness. To date, 123 loci and 37 of the corresponding genes for nonsyndromic deafness have been identified. Recessive and dominant mutant alleles of above 14 genes have been reported to cause both syndromic and nonsyndromic deafness. Considering the intricacy of hearing process, it has been estimated that at least 300 human genes are involved in the hearing process (Friedman and Griffith 2003). Thus, search for new deafness loci/genes is indispensable for a better understanding of genetic and molecular basis of auditory functions and allied syndromes. The ratio of recessively inherited deafness is 1.6 per 1000 in the Pakistani population, which is higher than worlds average due to high consanguinity (Hussain and Bittles 1998, Jaber et al. 1998). The present study has two basic objectives; firstly to determine genotype/phenotype correlation for one of the prevalent loci, DFNB2/USH1B, and secondly to identify new loci/genes involved in hearing impairment in Pakistani population. Fifty consanguineous families segregating deafness were identified and enrolled from different cities of Pakistan while twenty of them were selected for further molecular studies. All the families had three or more deaf individuals and showed recessive mode of inheritance. Clinical histories were obtained and pure tone audiometry tests for air and bone conduction were performed at frequencies 250 to 8,000 Hz on affected and unaffected members of these families. Vestibular function was evaluated by testing tandem gait ability, romberg test and electronystagmography (ENG). Ocular funduscopy and electroretinography (ERG) was
performed to detect the presence of retinopathy. Written informed consents were obtained and genomic DNA was isolated after collecting blood samples from affected, normal individuals, their parents, grandparents if alive, and other family members of related sibships. Previously, recessive and dominant mutant alleles of MYO7A were reported to be associated with both syndromic (USH1B) and nonsyndromic (DFNB2, DFNA11) deafness (Liu et al. 1997a; Liu et al. 1997b; Weil et al. 1997). However, clinical re-evaluation of all the reported DFNB2 families concluded that there is no published evidence of mutations of
(vii)
MYO7A associated with nonsyndromic deafness DFNB2 (Zina et al. 2001, Astuto et al. 2002). For the first objective and to eliminate the chaos about DFNB2, 270 families (20 enrolled + 250 families from CEMB repository) were screened for linkage to DFNB2/USH1B markers and as a result 11 families were found linked. Mutational analysis of DFNB2/USH1B linked families led to identification of 9 novel mutations in MYO7A gene. Amongst them, a novel mutation E1716del of MYO7A was found to be associated with DFNB2. This is the first clinically well documented example of MYO7A mutant allele associated with nonsyndromic deafness DFNB2. Furthermore, it is the first report describing mutation spectrum of MYO7A associated with USH1B and DFNB2 in Pakistani population. The results of these studies are being written up for publication. To study the second objective seventeen families (remaining of twenty families) were analyzed for linkage by typing at least three STR markers for all the known recessive deafness loci (except DFNB2/USH1B). Consequently, four families showed linkage to
DFNB4/PDS and DFNB12/USH1D while thirteen remained unlinked. Mutational studies of SLC26A4 gene revealed a known mutation V239D (Park et al. 2003) and a novel mutation Q446R in two families linked to DFNB4. The fact that a large number of families remained unlinked to known loci further supports the notion that still a large number of loci/genes remain undiscovered and instigate to identify more novel loci/genes associated with deafness. Genome wide scan was performed on seven selected unlinked families by using ABI PRISM Linkage Mapping Set version 2.5 having 411 fluorescent dye-labeled microsatellite markers spaced at an average distance of 10 cM across the human genome. Genome wide linkage analyses studies led to mapping of two novel nonsyndromic autosomal recessive deafness loci DFNB51 and DFNB56 as designated by Human Genome Organization (HUGO) committee. DFNB51 and DFNB56 were mapped to chromosome 11p13-p12 and 3q13.31-q21 on two set of families (PKDF240, PKDF407 and PKDF637, PKDF223) segregating recessively inherited, profound congenital deafness respectively. Moreover, sequencing of three candidate genes (SLC1A2, RAMP, and TRAF6) present in the critical linked region of DFNB51 was done but no potentially causative variant was identified (Shaikh et al. 2005). Localization of DFNB51 and DFNB56 is the first step towards the identification of novel genes that will help to further reveal the genetics of deafness.
(viii)
ACKNOWLEDGMENTS
All praises and thanks for Almighty Allah who is the ultimate source of all knowledge to mankind and for his endless blessings for humanity. Who made me reach at present pedestal of knowledge with quality of doing something adventurous, novel, thrilling, sensational, and path bearing. All respects are for Holy prophet Hazrat Muhammad (PBUH) who is the symbol of guidance, fountain of knowledge. My warmest and heartiest gratitude with a deep sense of obligation is to Professor Dr. Sheikh Riazuddin, Director, Centre of Excellence in Molecular Biology, for his personal interest, inspiring guidance, constructive criticism, and above all for providing necessary laboratory facilities during the whole span of this research work. I deem it my heartiest pleasure to express my profound sense of gratitude to Dr. Shaheen N. Khan for her marvelous guidance, penetrating criticism, and affectionate behavior throughout the progress of my research. My special and sincere thanks are due to Dr. Zubair and Dr. Saima for thoughtful discussions, sound advices, encouragement, and for the valuable suggestions in paper and thesis writing. Thanks are also due to several researchers at NIDCD/NIH especially to Dr. E.R. Wilcox, and Dr. T.B. Friedman. I am highly obliged to Mr Pervaiz Iqbal Director (Admin) Ministry of Special Education and the Principals of deaf schools all over Pakistan for their help in identifying consanguineous families and blood collection. I am happy to acknowledge the assistance of Mr. Ansar, Shahid, Kashif, Azhar, Abrar Hussain, and Naeem Chughtai in the collection of blood samples while profound respect is due to Farooq Sabir, Awais, Fazal and last but not the least Asad Riaz for their assistance in DNA sequencing lab. I would like to thank the subjects who voluntarily participated in this study and provided me with the family histories and clinical investigations that is so important. Special thanks to Mr. Ali Muhammad Warya and his family members for their help during our stay in Sindh. I am indebted to all my student colleagues, which are or were the part of CEMB, for providing stimulating and fun environment to learn and grow and for giving useful comments in my lab discussions. In this regard, I am passionately grateful to my dearest friends Jamil Ahmad, Khushnooda Ramzan, Sabiha Nazli, Shahid Yar Khan, Imran Shabbir, and Rashid Bhatti for their genial company, time devotion, synergistic help and cordial cooperation during my research. No words can express my feelings about them I harbor. I wish to thank my family for providing a loving environment; my brothers, and my brothers-in-law who were always supportive in my endeavors. I owe immense feelings of love to my sweet sister and fianc for their constant love, care, encouragement and sincere prayers to see me glittering high on the skies of success. Lastly, the most important, I feel an immense admiration and humble obligation for my parents, Muhammad Sadiq Shaikh and Tanweer Sadiq Shaikh, who raised me, taught me, loved me and supported me, to accomplish my academic goal. I feel poor of words to express my gratitude to them. Their prayers and love is my assets and my life. To them I dedicate this thesis. I have been supported by the Higher Education Commission (HEC) of Pakistan.
REHAN SADIQ SHAIKH
(ix)
ABREVIATIONS
AA ABR bp cM dB DFNA DFNB dNTPs EDTA Hz Kb M MgCl2 min mm l M ng pmole SDS STR TAMRA USH Amino Acid Auditory brain Stem response Base pair Centimorgan decibels Deafness, Autosomal Dominant Deafness, Autosomal Recessive Deoxynucleotide phosphates Ethylenediaminotetraacetic acid, disodium salt Hertz Kilobases Molar Magnesium Chloride Minutes Millimeter Microlitre Micromolar Nanogram Pico moles Sodium dodecyl Sulphate Short Tandem Repeat Carboxy tetramethyl rhodamine Usher Male Female Affected Male Affected Female Nonconsanguineous marriage == Consanguineous marriage Deceased
(x)
Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci
-1-
Absolute or partial defect in sense of hearing is called deafness. The phenotypic spectrum of deafness is broad, ranging from simple deafness without other clinically recognizable abnormalities (nonsyndromic-70%) to genetically determined syndrome (30%) of a more pleiotropic nature. Over 400 syndromes associated with hearing loss (HL) have been identified with common anomalies of the eye, kidney, muscle, nervous system, and skin etc (Gorlin et al. 1995; Bergstorm et al. 1971). Deafness can appear at any age with a variable degree of severity. It can be classified by the degree of severity of the HL (mild, moderate, severe, profound) as well as by the site of the defect i.e. conductive HL referring to external and/or middle ear defects, while sensorineural HL to the other defects from the inner ear to the cortical auditory centers of the brain. A severe hearing defect of congenital nature has a dramatic effect on speech acquisition and literacy; while severe deafness of late onset seriously compromises the quality of life. The etiology of HL is markedly diverse and involves many environmental and genetic factors or a combination of both. Environmental factors include birth injury, postnatal trauma, hypoxia, hypoglycaemia of the fetus, maternal diabetes, neonatal jaundice, erythroblastosis fetalis, congenital viral infections such as rubella and Cytomegalovirus, infectious diseases like meningitis, advancing age, iodine deficiency, and ototoxic drug (Chen 1988). Approximately one in every 500 newborns receives a diagnosis of congenital HL (Mehl and Thomson 1998; Mehl and Thomson 2002). Moreover, one in 1000 children become severe to profound deaf before adulthood (Morton 1991) and 50% of these prelingual deafness cases in developed countries are attributable to genetic factors (Marazita et al. 1993; Rehm 2003). While the prevalence of profound bilateral deafness is estimated to be 1.6 per 1000 individuals in Pakistan and 70% of the HL arises in consanguineous families (Elahi et al. 1998; Jaber et al. 1998). To date 123 nonsyndromic hearing loss (NSHL) loci have been reserved (Hereditary hearing loss homepage, http://dnalab-www.uia.ac.be/dnalab/hhh). The main pattern of inheritance in severe childhood deafness is autosomal recessive (over 75%), autosomal dominant (12-24%), while X linked (1-3%) and mitochondrial is also involved (Morton 1991). Overall, recessive deafness tends to be more severe than dominant deafness because it is generally profound, prelingual and fully penetrant whereas dominant deafness is frequently progressive, post lingual and is often observed clinically as the presence of unilateral or mild bilateral deafness (Fraser et al. 1976).
-2-
Taking the complextiy of hearing phenomena in view, it has been estimated that ~300 genes are involved in hearing (Friedman and Griffith 2003). Therefore,
identification of new deafness loci/genes is pivital for a better understanding of genetic and molecular basis of auditory functions and allied syndromes. Although HL is
common world wide, extreme genetic heterogeneity, assortive matings, unavailability of large consanguineous families, and limited clinical differentiation has presented serious hindrance to chromosomal mapping and gene identification (Petit et al. 2001; Reardon 1992). Furthermore, as small quantity of specialized cells, necessary for sound
transduction are present in the cochlea, classical biochemical and physiological approaches to characterize hearing processes in humans are often not feasible (Frolenkov et al. 2004; Forge and Wright 2002; Petit et al. 2001). Thus, a genetic approach to identify the molecular players in auditory processes seems to be an attractive alternative and large consanguineous families with inherited hearing impairment have been a key to the mapping and identification of the majority of the mutated genes associated with deafness (Friedman and Griffith 2003). Pakistan has a unique socio-cultural set up and consanguineous marriages are common. Approximately 60% of marriages are
consanguineous, of which more than 80% are between first cousins (Hussain and Bittles 1998). Thus, Pakistani population is an excellent genetic resource to identify the
loci/genes involved in deafness. Genetic heterogeneity has also been observed to be associated with clinical heterogeneity, when syndromic and nonsyndromic hearing impairment are caused by different mutant alleles of the same gene, for example, recessive mutant allele of PDS are responsible for both Pendred syndrome and DFNB4 (Li et al. 1998). Moreover, different mutant alleles of the same gene may lead to variations of phenotypes e.g., mutation of MYO7A can cause Usher syndrome type 1B (USH1B), dominant as well as recessively inherited (DFNA11 and DFNB2 respectively) nonsyndromic deafness (Liu et al. 1997a; Liu et al. 1997b; Weil et al. 1997). It has also been demonstrated that truncating, splice site or misense mutations of the genes causing USH1D/DFNB12, USH1C/DFNB18, and USH1F/DFNB23 are associated with deaf-blindness, where as only misense or leaky splice site mutations are associated with nonsyndromic recessive hearing impairment (Bork et al. 2001, Ahmed et al. 2002, Ahmed et al. 2003). Furthermore, recently it has been recognized that both recessive and dominant mutation of ESPN can cause nonsyndromic deafness (Naz et al. 2004, Donaudy et al. 2005).
-3-
This study was designed to determine genotype/phenotype correlation for one of the most common locus DFNB2/USH1B, to identify families truly segregating DFNB2, and to identify new loci/genes associated with deafness in Pakistani population. A total of 50 families were enrolled through the deaf children schools present in Punjab, Sindh, and Balochistan provinces while 20 families were selected for detailed studies. To identify prevalent mutant alleles of MYO7A associated with DFNB2/USH1B in Pakistani population, 270 families (20 enrolled + 250 from CEMB repository) were screened for linkage to DFNB2/USH1B markers. Eleven families showed linkage to chromosomal interval harbouring MYO7A. Mutational screening of the families linked to
DFNB2/USH1B helped in identification of 8 novel mutations associated with USH1B while 1 novel mutant allele of MYO7A was found to be associated with nonsyndromic deafness DFNB2. In the second half of this study, the remaining 17 families were studied for linkage to known loci; four families were found linked to DFNB4/PDS and DFNB12/USH1D. Furtheron seven unlinked families were separated for a genome wide linakge analysis studies and consequently two novel loci DFNB51 and DFNB56 were mapped on two set of families. Novel locus DFNB51 was mapped to chromosome 11p13-p12 on two consanguineous families PKDF240 and PKDF407 (Shaikh et al. 2005), while a second novel locus, DFNB56, was mapped on chromosome 3q13.31-q21 on two consanguineous families PKDF637 and PKDF223, segregating recessively inherited, profound congenital deafness. DNA samples of 250 additional Pakistani
families segregating HL were also available from the CEMB DNA repository and were screened for both the loci (DFNB51 and DFNB56) but no additional family was found linked to these loci. This thesis reports the first clinically well defined example of MYO7A mutant allele associated with nonsyndromic deafness DFNB2 and identification of two novel loci, DFNB51 and DFNB56 in Pakistani popultaion.
-4-
CHAPTER-I
-5-
SECTION-I
INTRICACY OF AUDITORY SYSTEM
-6-
ANATOMY OF AUDITORY SYSTEM

Human auditory system is one of the most intricate, miraculous, and an ingenious creation designed to transfer sound waves from environment to brain in an efficient manner. The ear can be described as both an analytic microphone and a microcomputer, sending sound impulses to the brain. Ear is capable of turning the tiniest disturbances to a form that brain can understand and doing so instantaneously, over an enormous range of pitch and loudness. Being extremely complicated organ, it performs dual function of balancing and perceiving sound. The auditory system is highly complex and composed of three anatomical compartments, the external, middle and inner ear, which function as an entity. The boundary between the external ear and the middle ear is the tympanic membrane. The middle ear contains the auditory ossicles (malleus, incus, and stapes). The boundary between the middle ear and the inner ear is the oval window (Fig. 1:1). The inner ear has sensory receptors, which utilize the hair cell for sensory transduction.
THE EXTERNAL EAR

The external ear consists of three parts: the pinna (auricle or outer ear), the external auditory canal (auditory meatus) and the eardrum (tympanic membrane). THE PINNA Pinna directs sound to auditory canal and composed of cartilaginous framework of elastic connective tissues; attached to skull by ligaments and muscles (Fig 1.1). THE AUDITORY CANAL (AUDITORY MEATUS) Auditory meatus is a short canal (~ 1"), extending from the pinna to tympanic membrane; carrying ceruminous glands in it. Cerumen (ear wax) excreted from
ceruminous glands keeps the tympanum soft, waterproof and prevents entry of foreign objects, collectively with the hairs (Fig 1.1). TYMPANIC MEMBRANE (EAR DRUM) Eardrum is a thin, double-layered, epithelial partition (~1 cm in diameter) between the auditory canal and the middle ear. It seals the delicate organs of the inner parts of the auditory system to protect it from bacterial infections and foreign matter which could clog the system (Fig 1.1). However, it is designed for efficient transmission of sound.
-7-
THE MIDDLE EAR (TYMPANIC CAVITY)

The middle ear is a narrow air-filled cavity located in the temporal bones of the skull and connects the outer ear to the inner ear. It is separated from the auditory meatus by the tympanic membrane while is separated from the inner ear by a bony partition, which contains two windows i.e. the oval window and the round window (Fig 1.1) AUDITORY OSSICLES Chain of three tiny, linked moveable bones, the auditory ossicles i.e. the malleus (hammer), the anvil (incus) and the stapes (stirrup) are connected at one end by ligaments to the tympanic membrane, and then ends with the oval window of the cochlea (Fig 1.1). The function of the ossicles is to transmit and amplify sound waves across the tympanic cavity from the tympanic membrane into the mechanical movements of oval window. Geometrical organization of ossicles and surface area difference between
tympanic and oval window give 20 fold amplification of sound waves. Any limitation of motion (impedance) will not transmit the original sound resulting in a loss of hearing. EUSTACHIAN TUBE Eustachian tube is a small tube connecting middle ear to nasopharynx of the throat and it equalizes air pressure on both sides of the tympanic membrane. It allows fresh air to be filled in the middle ear space periodically. Otitis media, infection of middle ear occur if the eustachian tube is blocked due to any reason (Fig 1.1). OVAL AND ROUND WINDOWS These windows separate air filled tympanic cavity from fluid filled membranous labyrinth. Oval window (Fenestra vestibuli) displacement occurs via movement of tympanic membrane via ossicles, and causing fluid displacement in inner ear. Round window (Fenestra cochlea) displacement is opposite that of oval window because of incompressible nature of inner ear fluid (Fig 1.2).
-8-
Fig 1.1 Structure of Human ear representing Outer, Middle and Inner ear.
Fig 1.2 Structure of Inner Ear
-9-
THE INNER EAR

Inner ear regulates two sensory systems simultaneously i.e. the vestibular system for spatial orientation and equilibrium and the cochlear/auditory system for hearing. The inner labyrinth is exceptionally an intricate series of structures, and
consists of two parts; the osseous (or bony) labyrinth located within the temporal bone, and the membranous labyrinth within the bony labyrinth with interconnected sacs and tubes. The osseous labyrinth is lined with the periosteum and is filled with perilymph, a fluid secreted by the cells lining the bony canals (Fig 1.2). Perilymph resembles cerebral spinal fluid (CSF) and normal extracellular fluids in chemical composition i.e. low K+ and high Na+ concentration. Since its osmolarity is similar to plasma; hence in osmotic equilibrium with the blood. The tubular chambers of the membranous labyrinth (Fig 1.2) are filled with a second fluid, known as the endolymph, having an unusual composition than perilymph i.e. high K+ concentration (~140 mM) and a very low Na+. In the cochlea, but not the vestibular system, endolymph has a high positive electrical potential (~ +80 mV) depending on an active secretion of K+, which involves fibroblasts, different support cells and the stria vascularis (Graham et al. 2000). These fluids provide the media for vibrations involved in hearing and the maintenance of equilibrium and are essential for the functioning of the sensory cells of the inner ear (Hudspeth et al. 1989). An important feature of the endolymphatic space is that it is completely bounded by tissues and there are no ducts or open connections between perilymph and endolymph. The border between the two fluids lies at the level of the junctions between the epithelial cells surrounding the endolymphatic spaces. Maintenance of this permeability barrier is essential for function of the inner ear OSSEOUS LABYRINTH The osseous labyrinth consists of three structural and functional divisions, vestibule, semicircular canals, and cochlea. VESTIBULE The vestibule is the central part of the bony labyrinth. The lateral wall of
vestibule contains the oval window (Fig 1.2) as a bean shaped white blotch between the utricle and saccule.
- 10 -
SEMICIRCULAR CANALS The three bony semicircular canals (superior, posterior, and lateral) are oriented at right angles to each other and are positioned posteriorly (dorsally) to the vestibule. At one end of each is a dilatation called ampulla which connects to the vestibule (Fig 1.2). COCHLEA The cochlea is a sense organ for hearing. Its purpose is to take the vibrations from middle ear and transform them to nerve impulses, detected by the brain (Fig 1.2). MEMBRANOUS LABYRINTH A second series of tubes made out of delicate cellular structures called the membranous labyrinth lies within the bony labyrinth. Structures of the membranous labyrinth include: Utricle and saccule (within the vestibule), three semicircular ducts and their ampulla (within semicircular canals), and cochlear duct (within the cochlea). Three types of epithelium surround the membranous labyrinth endolymphatic compartment, neurosensory epithelia, ion transporting epithelia and relatively unspecialized epithelia. NEUROSENSORY EPITHELIA (MECHANOTRANSDUCERS) The neurosensory epithelial sheets responsible for sense of position and sound are located in specific areas within the respective structures called as: For Vestibular system Maculae of the utricle and saccule Three Crista ampullaris in the ampulla of each of the three semicircular ducts For Cochlear system Organ of Corti within the cochlear duct Sensory epithelia are composed of sensory hair cells and accessory supporting cells. Hair cells are surrounded by supporting cells so that no two hair cells contact each other. They are called hair cells due to characteristic cuticular plate and tuft of
stereocilia bathing in the surrounding endolymph. The cell body itself is localized in the perilymph compartment. There are 50-100 stereocilia/cell in vestibular system and inner hair cells of cochlear system and 100-300 stereocilia/cell in outer hair cells of the cochlear system. The sensory epithelium is covered by an acellular extracellular matrix structure: the tectorial membrane in the cochlea, the otolithic membranes of macular organs, and the cupulae of the cristae. Hair bundles deflection either caused by sound waves or changes in head position modulates the opening/closing ion channels,
- 11 -
depending on direction of movement of stereocilia. Opening of ion channel result in flow of K+ ions from endolymph through the hair cells, exciting the hair cells resting electrical potentials and their cell activity. Hair cells are thus mechanotransducers
converting a mechanical stimulus (movement) into an electrical signal. ION TRANSPORTING EPITHELIA The ion transporting epithelia, the stria vascularis of the cochlea and the dark cell regions of the vestibular system, are involved in active (energy consuming) ion transport necessary to maintain the unusual endolymph composition (Fig 1.3A). LESS SPECIALIZED EPITHELIA The less specialized epithelia, Reissners membrane in the cochlea and the epithelium of the roof of the saccule, utricle, ampullae of the semicircular canals form permeability barriers separating the fluid spaces. It is expected that Rupturing of these membranes would result in fluid mixing and physiological dysfunction (Fig 1.3A).
VESTIBULAR SYSTEM
There are five sensory receptor regions associated with the vestibular system, two in the macula of utricle and saccule which contain receptors sensitive to gravity and linear movements of the head and one in each of the three semicircular ducts, cristae ampullaris of semicircular ducts which are sensitive to angular acceleration and deceleration of the head as in rotational movement.
COCHLEAR SYSTEM
Cochlea is the core element of the inner ear responsible for hearing. Its name come form its spiral structure mimicking a marine snail. The bony spiral makes roughly 2.5 revolutions around a central pillar of bone called the modiolus and is about 35 mm long (range 28-40 mm) in humans. Uncoiled, the cochlea is divided along its length into three fluid-filled compartments Upper, scala vestibule, filled with perilymph Middle triangular, scala media (cochlear duct), filled with endolymph Lower, scala tympani, filled with perilymph The cochlear duct is triangular in shape. Reissner's membrane (vestibular
membrane) divides the scala vestibuli from the scala media (cochlear duct) and the basilar membrane divides the scala media from the scala tympani (Fig 1.3A). The oval window is at the base of the cochlea in scala vestibuli while round window is at the base of the cochlea in scala tympani. Perilymph bath both the scala tympani and vestibuli
- 12 -
which are continuous till the apex (or tip of the spiral) through the helicotrema while the cochlear duct is filled with endolymph and terminates at the helicotrema. The cochlear duct contains the sensory organ of hearing the Organ of Corti. Movement of perilymph via oval window displacement causes movement of endolymph in cochlear duct which is sensed by the organ of Corti. ORGAN OF CORTI The extraordinary ability of the mammalian cochlea to detect and distinguish sounds over a wide range of frequencies depends on the precise organization of its highly specialized neurosensory epithelium, known as the organ of Corti. It is seated on the basilar membrane, covered by proteinacious tectorial membrane in the middle compartment, scala media of the cochlea. (Fig 1.3). It is composed of the sensory cells, called hair cells, the neurons, and several types of support cells. On the morphological and physiological basis, there are two kinds of hair cells in Organ of Corti; the inner hair cells (IHCs) and the outer hair cells (OHCs). Schematically, both types of cells, IHCs and OHCs, differ by their shape and the pattern of their stereocilia. In the human cochlea, there are about 12,000 OHCs and 3,500 IHCs. This number is extremely low as compared to millions of photo-receptors in retina and chemo-receptors in the nose! Moreover, hair cells share with neurons an inability to proliferate once they are differentiated. This means that the final number of hair cells is reached very early in development (around 10 weeks of fetal gestation); from this stage on our cochlea can only lose hair cells. OUTER HAIR CELLS: (OHCS) 12,000 OHCs are regularly arranged in most mammals within three or sometimes four rows. They are shaped cylindrically, like a cane, and have ~100 stereocilia at the top of the cell, and a nucleus at the bottom (Fig 1.3B). Their hair bundles form a characteristic W-shape and contact the underside of the overlying tectorial membrane in which impressions of the longest stereocilia from the OHC can be seen. Although they are much greater in number than the IHCs, they receive only about 5% of the innervations of the afferent nerve fibers from the acoustic portion of the VIII nerve and 80% of the efferent nerve innervations. INNER HAIR CELLS: (IHCS) There is only one row of approximately 3,500 IHCs, having ~ 50 stereocilia (Fig 1.3B). IHC are flask shaped and their hair bundles are in an approximately straight line
- 13 -
or wide U-shape. The hair bundles of the IHC do not appear to contact the overlying tectorial membrane. These cells receive about 95% of the afferent innervations from the nerve fibers from the acoustic portion of the VIII nerve and 20% of the efferent nerve innervations. These cells have primary responsibility for producing our sensation of hearing. When lost or damaged, a severe to profound HL usually occurs. HAIR CELL STEREOCILIA AND LINKS Hair cells are highly specialized mechanoreceptors having hair-like projections on their apical surfaces that help to translate the mechanical stimuli (sound vibration) into electrical signals, interpreted by the brain. These projections, known as stereocilia, have mechanosensitive ion channels (Corey and Hudspeth 1979; Ohmori 1985) and constitute the hair bundle which is formed of rows of stereocilia that increase in height in one particular direction across the bundle. Stereocilia are generally arranged in three rows of graded lengths and a single kinocilium located behind the row of longest stereocilia. In the hair cells of the organ of Corti, the kinocilium is present only during development, but as the cochlea matures it is reduced to remain as a basal body on one side of the stereociliary bundle. The tallest stereocilia of outer hair cells directly contact the tectorial membrane. The tip of each stereocilium is linked to the shaft of its neighbor by thin tip links which are involved in the mechano-transduction process, stereocilia are also attached by transverse (lateral) links, both in the same row and from row to row. There are thought to be at least three different types of lateral links between stereocilia. Ankle links which are absent from the hair cells of the organ of Corti, but present in the hair bundles of mammalian vestibular organs connect stereocilia at their proximal ends. Shaft connectors are present along the mid-region of the stereociliary shaft. connectors link stereocilia laterally just below the level of the tip-links. Top-
- 14 -
Fig 1.3 A. Membranous Labyrinth: Showing Scala vestibuli with perilymph, Cochlear duct with endolymph and organ of corti and Scala tympani with perilymph. B.Organ of Corti: Showing Inner hair cells, Outer hair cells, Tectorial membrane, Basilar membrane, Stereocilia and Supporting cells.
- 15 -
PHYSIOLOGY OF EAR
EVENTS IN THE HEARING OF SOUND WAVES
Sound creates vibrations in the air somewhat similar to the rippling waves created when a stone is thrown into a pond. A young human ear can hear sounds in the frequency range of 20 to 24,000 Hz, yet can distinguish between sounds that have only a 0.3% difference in frequency. The human ear can detect differences in sound intensity of only 0.1 to 0.5 db. Hearing involves a complex chain reaction within the ear and can be divided into three parts: Conductive, Sensory, and Neural. CONDUCTIVE HEARING Sound waves result from the alternate compression and decompression of air reaches the ear, are directed by the pinna into the external auditory canal. When the waves strike the tympanic membrane and set it to vibrate. The central area of the tympanic membrane is connected to the malleus, which in turn starts vibrating. These vibrations are picked up by the incus, and transmitted to stapes. As the stapes moves back and forth, it pushes the oval window in and out (Fig 1.4). SENSORY HEARING The movement of the oval window sets up waves in the perilymph of the scala vestibuli. As the oval window bulges inward, it pushes the perilymph of the scala vestibuli to produce pressure waves. The pressure waves moves through the perilymph of the scala vestibule and pushes the reissners membrane inward increasing the pressure of the endolymph inside the cochlear duct. As a result, the basilar membrane moves slightly and bulges into the scala tympani. Thus pressure in the perilymph of the scala vestibuli is transmitted through the basilar membrane eventually to the round window. Following the compression that resulted in the above actions is a decompression that causes the stapes to move toward the tympanic membrane and the above actions are reversed. That is, the fluid moves in the opposite direction along the same pathway, and the basilar membrane bulges into the cochlear duct. When the basilar membrane
vibrates, the hair cells of the Organ of Corti move against the tectorial membrane. This shearing action causes the stereocilia to be deflected and tip links stretch and open the mechanotransduction cationic channels located near the stereocilia tip, which let K+ ions flow into the hair cells from the endolymph (Fig 1.5). K+ ions rush in because the strongly negative potential of the hair cells attracts positive ions. This tends to neutralize
- 16 -
some of the negative charge, and brings the potential up towards zero, a process known as depolarization. NEURAL HEARING As the depolarization takes place voltage sensitive calcium channels are activated in IHCs and calcium triggers the release of neurotransmitters, which lead to the generation of nerve impulses. The impulses are passed on to the cochlear branch of the vestibulocochlear (VIII) nerve and then to the medulla. Within the medulla, most
impulses cross to the opposite side and then travel to the midbrain, to the thalamus, and finally to the auditory area of the temporal lobe of the cerebral cortex. In the resting position of stereocilia the transduction channels are partially open, leading to a small release of transmitter. This, in turn, generates a spontaneous activity in the auditory nerve and the ascending auditory pathways, even in the absence of sound. The cells are thought to recover from the stimulus by pumping out the potassium through gap junctions and voltage gated potassium channels (Petit 1996).
MOLECULAR BASIS OF MECHANOSENSORY TRANSDUCTION AND ADAPTATION MECHANISMS

Sensory hair cells of the inner ear detect mechanical stimuli by deflections of the hair bundle, which open tension-gated transduction channels in the cell membrane to admit cations from the endolymph, resulting in alterations in the hair-cell membrane potential and generation of electrical signals. The current is mostly composed of
potassium ions, but also includes a small quantity of calcium ions (Lumpkin et al. 1997). A widely accepted, but unproven, model of the hair cell transduction channel complex depicts tip links connected directly to the sound transduction channels at the stereocilia's apices (Gillespie and Corey 1997; Steel and Kros 2001; Steel 2002; Friedman and Griffith 2003). The tip link is assumed to be a spring, which is oriented parallel with the axis of mechanosensitivity (Eatock 2000). Changes in tip-link tension caused by hair bundle deflections are thought to modulate the opening probability of associated channels (Pickles et al. 1984; Hudspeth 1989). Two adaptation mechanisms are known to modify the transduction ionic current flowing through the transduction channels of the hair bundles, causing it to decline with time (Howard and Hudspeth 1988; Wu et al. 1999; Holt and Corey 2000; Holt et al. 2002).
- 17 -
TRANSDUCER CHANNEL MODEL A rapid process which can occur on a sub-millisecond timescale is the consequence of Ca2+ entering the hair bundle and binding directly to the transduction channels (Fig. 1.5), making them more likely to close (Crawford et al. 1989). ADAPTATION MOTOR MODEL A second slower adaptation, which takes up to hundreds of milliseconds, is also dependent on Ca2+ concentration, and is thought to be caused by the movement of adaptation motors attached to the transduction channels, which adjusts the tension that gates them (Assad and Corey 1992; Hudspeth and Gillespie 1994; Shepherd and Corey 1994; Gillespie and Corey 1997). Although MyoVIIa has been proposed to anchor and cause tension in transduction channels and tip links in auditory hair cells (Kros et al., 2002), there is considerable evidence that Myo1c is the adaptation motor. A complex containing multiple molecules of MyoIc crosslinks the transduction channel to the actin core of the stereocilia and mediates adaptation (Fig. 1.6). The complex regulates the resting tension in the tip link filament by moving up and down the actin bundle to maximize the sensitivity of the hair cell (Assad and Corey 1992; Gillespie and Corey 1997; Holt et al. 2002). Myo1c possesses structural and mechanical changes associated with load-dependent ADP release mechanism to fulfill the mechanochemical attributes that allow it to respond to increased or decreased strain (Batters et al. 2004). Data suggest that in addition, the two adaptation processes may also act together in a hair bundle and thus combine to provide an active amplifier (Wu et al. 1999; Holt and Corey 2000; Vilfan and Duke 2003; Fettiplace and Ricci 2003). The closure of channels occurs prior to a return of stereocilia to their initial position. These
mechanisms reduce the time constant of channel opening, thus allowing cycles of mechano-transduction to occur in rapid succession i.e. at high frequencies (Hudspeth and Gillespie 1994). The cells are thought to recover from the stimulus by pumping out the K+ through gap junctions (Connexin channels) and voltage gated K+ channels. As clear from the above complexity of hearing process; a large ensemble of proteins act in concert to orchestrate the function of the sensory cells in the cochlea, through which we hear, and the vestibular apparatus of the inner ear, the organ that senses gravity and acceleration. Defects in any one of these proteins results in High
disturbance of the audiotory pathway which in turn can cause deafness.
proportions of HL cases are due to outer hair cell abnormalities (Avarham 1998, Kossal
- 18 -
1997). Damage to the hair cells can be caused by a number of agents, including loud sound (sustained high sound pressure levels above 90-dB), certain drugs (ototoxic drugs), disease, and processes associated with aging resulting in permanent HL. Mammalian cochlear hair cells do not regenerate and their loss or damage results in irreversible deafness or hearing impairment and/or balance disorders.
Fig 1.4 Events in the Hearing of Sound Waves
Fig 1.5 Deflection of hair cells and production of action potential. Shearing force between the basilar membrane and the tectorial membrane cause the stereocilia of the hair cells to bend. K+ ions depolarize the membrane of hair cells. Ca+ ions closes the transduction channels.
- 19 -
Fig. 1.6 Schematic representation of Adaptation-motor model for the role of Myo1c in adaptation in the hair cell. The model depict the nucleotide state of the Myo1c molecules in the adaptation motor complex at rest (left), under positive deflection (middle) and under negative deflection (right). Red signifies Myo1c in rigor (nucleotide-free); blue, Myo1c with ADP bound; yellow, Myo1c with ADP.Pi; and green, Myo1c undergoing Pi release. The pointed ends of actin lie towards the bottom of the illustration. At rest, Po is 0.1. The tension in the tip links is balanced by force produced by the motors. Strain is maintained by Myo1c in the ADP state. At positive deflection, Po approaches 1.0, the channels open and the tension in the tip link causes detachment of the motor complex from the actin filament. The motor complex, still attached to the deflecting membrane, slips relative to its starting position on the actin filament toward the minus end of the filament. During negative deflection, Po approaches 0. A reduction in tip link tension reduces the strain on Myo1c allowing the motor molecules, some of which are expected to be in the strained ADP state and some at the beginning of the power stroke, to complete the power stroke and move up the filament to re-establish the resting state.
- 20 -
SECTION-II
GENETICS OF DEAFNESS
- 21 -
DEAFNESS
Deafness is defined as partial or complete hearing loss (HL), which leads to an impaired ability to develop speech, language and effective communication skills. Many genetic and environmental causes have been recognized for hearing impairment. HL present at birth is known as congenital deafness, while one that occurs after birth is called adventitious deafness. Deafness can be classified in many ways, including the mode of inheritance, the age of onset, audiologic characteristics (mild, moderate, severe, profound), presence or absence of vestibular dysfunction, the location and/or identity of the causative gene and by the site of the defect. Conductive HL refers to external and/or middle ear defects, and sensorineural HL to the other defects anywhere from the inner ear to cortical auditory centers of the brain (Petit et al. 2001).
A BRIEF HISTORY
Documentation of awareness about involvement of inheritance in hearing impairment can be traced back to the sixteenth century. According to Goldstein (1933), the earliest known author to have recognized that some forms of deafness may be hereditary was Johannes Schenck (15311598) who noted a family in which several children were born deaf. Stephens (1985) includes a pedigree drawing of a sixteenth century family of the Spanish aristrocracy in which members in three generations were documented deaf. In 1621 the papal physician Paolus Zacchias (15841659)
recommended that the deaf refrain from marriage because of evidence that their children will also be deaf (Cranefield and Federn 1970), indicating his conviction that heredity is important in deafness. Reardon (1990) ascribes to Sir William Wilde (18151876) the awareness that deafness shows different patterns of inheritance, that consanguinity is a relevant factor, and that there is an excess of males among the congenitally deaf. These findings were confirmed by Hartmann (1881) who carried out extensive studies in schools for the deaf in Germany. More recently, Konigsmark (1969), Konigsmark and Gorlin (1976), and Fraser (1976) provided comprehensive reviews of hereditary hearing impairment, and emphasized the pronounced heterogeneity. Several studies attempted to estimate the number of loci for deafness in various populations (Stevenson and Cheeseman 1956; Chung et al.1959; Sank 1963; Chung and Brown 1970; Costeff and Dar 1980; Brownstein et al.1991) with the results ranging from less than ten to several thousand. As far pattern of inheritance is concerned, the analysis of large collections of
- 22 -
family data suggests that, approximately 7788% is transmitted as autosomal recessive traits, 1020 % as dominants, and 12% as X-linked traits (Rose et al. 1977). The frequency of mitochondrial deafness is quite variable and can range from less than 1% to more than 20% in some populations. Finally, in 2030% of cases, there may be other associated clinical findings that permit the diagnosis of a specific form of syndromic deafness. The phenotypic and genetic heterogeneity of deafness is underscored by Gorlin et al. (1995) who list 427 forms of syndromic and nonsyndromic hereditary hearing impairment. The earliest report of syndromal hearing loss is probably that of
mandibulofacial dysostosis by Thomas in 1846. Retinitis pigmentosa with HL was noted by Von-Graefe in 1858. This syndrome was later referred as Usher syndrome after Scottish ophthalmologist Charles Usher (1914). Combined euthyroid goiter and
congenital HL was described by Pendred in 1896 and its recessive pattern by Brain in 1927. The last decade of the 20th century has witnessed a rapid development and extensive studies of the genetic and molecular basis of deafness due to availability of large numbers of genetic markers. In the late 1980's a sex linked form of nonsyndromic hearing deafness locus was mapped to Xq13-q21.1 in a Mauritian (Wallis et al. 1988) and in a Dutch (Brunner et al. 1988) kindred. Four years later, an autosomal dominant deafness locus was mapped to 5q31, in large Costa Rican kindred (Leon et al. 1992). The third locus, a mitochondrial mutation was recognised in a large Arab-Israeli pedigree (Prezant et al. 1993). In 1994 three types of autosomal early childhood deafness were recognized as being linked to chromosomes. The first nonsyndromic recessive deafness locus (DFNB1) was linked to chromosome 13 (Guilford et al. 1994a), the DFNB2 to chromosome 11 (Guilford et al. 1994b) and the DFNB3 to chromosome 17 (Friedman et al. 1995). Till 1996, no nonsyndromic genes had been cloned (Petit 1996); while as to date, 54 autosomal dominant and 60 autosomal recessive and 8 X-linked loci of deafness have been mapped and 22 genes involved in nonsyndromic autosomal recessive deafness have been identified (Hereditary Heraing Loss Home Page:
http://www.uia.ac.be/dnalab/hhh.). The cytogenetic position of the nonsyndromic loci and some of the syndromic loci, mapped to various chromosomes is depicted in Fig 1.7.
- 23 -
Fig 1.7 Cytogenetic map positions of human nonsyndromic deafness loci. A deafness locus is underlined when the gene is known. Loci with published, statistically significant support for linkage are shown with a solid black font. Shown with a gray font are loci for which there are reserved symbols but no published data, or published loci lacking statistically significant support for linkage. DFN is the root of the locus symbol for deafness. An A or B suffix indicates that the mutant allele is segregating as an autosomal dominant or autosomal recessive, respectively. Sex-linked nonsyndromic hearing loss is designated with a DFN symbol and a numerical suffix. DFNM1 on chromosome 1q24 is a dominant modifier of DFNB26 on chromosome 4q31.
- 24 -
GENETIC EPIDEMIOLOGY
Prevalence estimates of congenital and early childhood deafness vary, and in many cases are underestimated. Figures based on universal neonatal screening programs are perhaps the most accurate. Mason and Herrmann have reported bilateral HL of >35 dB in 1.4:1000 live births in Hawaii (Mason et al. 1998); other US studies have shown rates of 2.2:1000 and 3:1000 live births (Mhatre et al.1996, White et al.1993). European rates, mainly obtained from retrospective studies, are similar with ranges 1.42.1:1000 live births (Parving 1996, Parving 1999, Das 1996). More than 50% of these cases are estimated to be inherited (Marres 1998). Likewise, estimated prevalence of profound bilateral HL is 1.6:1000 individuals in Pakistan and 70% of these cases arise in consanguineous families (Elahi et al. 1998; Jaber et al. 1998).
MOLECUALR GENETIC OF DEAFNESS

HEARING LOSS/DEAFNESS LOCI
Hereditary HL is genetically heterogeneous and over 300 genes are predicted to cause this disorder in humans (Friedman and Griffith 2003). Syndromic deafness,
associated with other recognizable phenotypic traits, is found in approximately 30% of the subjects and may be conductive, sensorineural or mixed, while nonsyndromic deafness, in which inner ear abnormalities are the only clinical feature, is found among the other 70% of the cases and is almost exclusively sensorineural (Gorlin et al. 1995). NONSYNDROMIC HEARING LOSS (NSHL) NSHL is the kind of deafness with no other associated symptoms except deafness and is more prevalent mode of HL than syndromic deafness. It seems to account for 70% of all the genetically determined cases of deafness. NONSYNDROMIC AUTOSOMAL DOMINANT HEARING LOSS 54 loci for autosomal dominant deafness have been mapped (Hereditary hearing loss homepage). Mapped loci for nonsyndromic autosomal dominant hearing
impairment are symbolized as DFNA1, DFNA2 and so on in the order in which they are reported or reserved. Some of the DFNA and DFNB loci share the same chromosomal localizations (Petit et al. 2001) and once all deafness genes have been identified many more dominant and recessive loci might be found to be allelic forms of each other.
- 25 -
NONSYNDROMIC AUTOSOMAL RECESSIVE HEARING LOSS Various loci for nonsyndromic autosomal recessive HL are symbolized as DFNB1, DFNB2 and so on in the order in which they are first reported or reserved. To date, 60 nonsyndromic recessive deafness loci have been mapped (Table 1.1). Some of the loci prevalent in Pakistan will be discussed ahead SYNDROMIC HEARING LOSS London dysmorphology database has identified over 400 syndromes associated with deafness and musculoskeletal, cardiovascular, urogenital, nervous, endocrine, digestive or integumentary systems (Gorlin et al.1995). It may accounts for 30% of all genetically determined deafness cases. Syndromic deafness can be either dominant (Wardenberg syndrome, Branchio-oto-renal syndrome and Stickler syndrome), recessive (Usher syndrome and Pendred syndrome), X-linked (Alport syndrome and Nance syndrome) or mitochondrial. Some of the syndromes of deafness are listed in Table 1.2. SYNDROMIC AUTOSOMAL DOMINANT LOCI Some of the common autosomal dominant syndromes are as under: Waardenburg Syndrome is the most common type of autosomal dominant syndromic HL with an incidence of 1 in 4000 live births, and a total of 2.3% of children with congenital HL are suspected to have the syndrome (Tomaski and Grundfast, 1999) It was named after Petrus Johannes Waardenburg, a Dutch ophthalmologist (1886-1979) who was the first to notice that people with two different colored eyes frequently had hearing problems. The clinical features usually include dystopia canthorum, meaning the lateral displacement of the inner canthus of the eyes to give an appearance of a widened nasal bridge, pigmentory abnormalities of the skin, iris, and hair, and sensorineural HL. Waardenburg syndrome is both clinically and genetically heterogenous, four subtypes of Waardenburg syndrome Type 1, Type 2, Type 3 and Type 4 are known. Mutations of PAX3 gene have been indicated to be associated with type 1 and type3 phenotypes, while Type 2 has been linked to MITF and SLUG gene mutations. Three genes EDN3, EDNRB, and SOX10 have been reported to be associated with type 4 phenotypes (Friedman et al. 2003a) Branchial-oto-renal syndrome (BOR) is an autosomal dominant disorder that affects branchial, ear, and kidney structures. Branchial anomalies include branchial cysts and fistulas and preauricular pits; renal abnormalities are remarkably varied, ranging from mild hypoplasia to bilateral aplasia, even in the same family. Hearing is most often
- 26 -
affected, with ~80% penetrance. It is mixed -50% of the time, pure conductive loss being more common (30%) than pure sensorineural (20%). The prevalence of BOR is estimated at 1 in 40,000, or 2% of all children with profound HL. The EYA1 gene, the human homologue of the Drosophila eye absent gene (eya) located at 8q13.3 has been identified as the responsible gene for BOR. A recently described EYAl knockout mice reveals the absence of ears and kidneys from apoptotic regression of the organ primordia implicating EYAl as the early inductive tissue interaction signal specifically involved in ear and kidney formation. It has been noted that 70% of families with the BOR
phenotype have no mutations in the coding sequence of EYA1. This is not surprising, and provides an opportunity to identify new genes and to further elucidate the pathophysiology of BOR (Tseng and Lalwani, 2000). SYNDROMIC AUTOSOMAL RECESSIVE LOCI Two most common autosomal recessive syndromes having deafness as one of the phenotype in Pakistan are Pendred syndrome and Usher syndrome. Pendred Syndrome is an autosomal recessive disorder comprised of HL and a thyroid hormone organification defect, resulting in a euthyroid goiter (Pendred, 1896). It is estimated that Pendred syndrome (PDS) is responsible for 4 to 10% of hereditary prelingual deafness worldwide (Park et al. 2003). An enlargement of the vestibule is found nearly in all patients. HL is characteristically prelingual (though not necessarily congenital), sensorineural or, rarely, mixed, and severe to profound (Cremers et al. 1998; Fraser, 1976; Phelps et al. 1998). Mutations of gene SLC26A4 are known to cause Pendred syndrome (Everett et al. 1997). Approximately 80 pathogenic mutations of PDS are known till to date. Defects in the same gene (SLC26A4) underlie nonsyndromic deafness DFNB4 and many cases of enlarged vestibular aqueduct syndrome (Li et al. 1998). SLC26A4 encodes pendrin, an anion transporter found in the inner ear, thyroid, and kidney (Everett et al. 1997; Scott and Karniski, 2000). Usher Syndrome is an autosomal recessive disorder characterized by bilateral sensorineural deafness associated with loss of vision due to retinitis pigmentosa. Usher syndrome is estimated to be responsible for more than 50% of deaf and blind individuals and 8-33% of patients with retinitis pigmentosa and 3-6% of congenitally deaf individuals (Vernon 1969, Boughman et al.1983). Its prevalence is between 1/16,000 and 1/50,000 based on studies of Scandinavian, Columbian, British and American populations (Grondahl 1987, Tamayo et al.1991, Hope et al.1997, Boughman et
- 27 -
al.1983).
Usher syndrome varies in the severity and onset of deafness, retinitis
pigmentosa and vestibular dysfunction. Various classifications were proposed due to clinical heterogeneity (Hammersschlag 1907, Hallgren 1959, Merin et al.1974). However, it is classified into three main clinical subtypes i.e. Type1, Type2 and Type3 on the basis of variability in the onset of RP and on the presence or absence of areflexia (Davenport and Omenn 1977). Twelve loci have been mapped for Usher syndrome (Table 1.2) and there is unpublished genetic data in our laboratory for at least one additional usher locus. At least seven distinct genetic loci for Usher syndrome type 1 (USH1A-1G), three for Usher syndrome type2 (USH2A-2C), and two for Usher syndrome type3 have been mapped to different chromosomes. Genes for seven usher syndrome loci have been identified as unconventional myosin VIIa encoded by MYO7A (USH1B, Weil et al.1995), harmonin encoded by USH1C (Bitner-Glindzicz et al.2000, Verpy et al.2000), cadherin23 encoded by CDH23 (USH1D, Bork et al.2001, Bolz et al.2001), protocadherin 15 encoded by PCDH15 (USH1F, Ahmed et al.2001, Alagramam et al.2001), SANS encoded by SANS (USH1G, Weil et al.2003), Userin encoded by USH2A (Eudy et al.1998) and USH3 encoded by USH3 (Joensuu et al.2001). Six of the known usher loci co-localize to overlapping chromosomal intervals with one of six nonsyndromic deafness loci DFNB2/DFNA11, DFNB18, DFNB12, DFNB23, DFNB6 and DFNA20/DFNA26; some of them will be discussed in detail ahead.
- 28 -
Locus
DFNB1 DFNB2 DFNB3 DFNB4 DFNB5 DFNB6 DFNB7 DFNB8 DFNB9 DFNB10 DFNB11 DFNB12 DFNB13 DFNB14 DFNB15 DFNB16 DFNB17 DFNB18 DFNB19 DFNB20 DFNB21 DFNB22 DFNB23 DFNB24 DFNB25 DFNB26 DFNB27 DFNB28 DFNB29 DFNB30 DFNB31 DFNB32 FNB33 DFNB34 DFNB35 DFNB36 DFNB37 DFNB38 DFNB39 DFNB40 DFNB41 DFNB42 DFNB43 DFNB44 DFNB45 DFNB46 DFNB47 DFNB48 DFNB49 DFNB50 DFNB51 DFNB52 DFNB53 DFNB54 DFNB55 DFNB56 DFNB57 DFNB58 DFNB59 DFNB60
Location
13q12 11q13.5 17p11.2 7q31 14q12 3p14-p21 9q13-q21 21q22 2p22-p23 21q22.3 9q13-q21 10q21-q22 7q34-36 7q31 3q21-q25, 19p13 15q21-q22 7q31 11p14-15.1 18p11 11q25-qter 11q 16p12.2 10p11.2-q21 11q23 4p15.3-q12 4q31 2q23-q31 22q13 21q22 10p12.1 9q32-q34 1p13.3-22.1 9q34.3 14q24.1-24.3 1p36.3 6q13 6q26-q27 7q11.22-q21.12 22q11.21-12.1 3p13.31-q22.3 7p14.1-q11.22
Gene
GJB2 MYO7A MYO15 SLC26A4 unknown TMIE TMC1 TMPRSS3 OTOF TMPRSS3 TMC1 CDH23 unknown unknown unknown STRC unknown USH1C unknown unknown TECTA OTOA PCDH15 unknown unknown unknown unknown unknown CLDN14 MYO3A WHRN unknown unknown
Screening Markers
D13S143, D13S175, D13S292 D11S911, D11S527, D11S937 D17S122, D17S805, D17S842 D7S501, D7S496, D7S523 D14S79, D14S253, D14S286 D3S1767, D3S1289, D3S1582 D9S50, D9S301, D9S166 D21S212, D21S1225, D21S1575 D2S144, D2S171, D2S158, D2S174 D21S168, D21S1260, D21S1259 See DFNB7 D10S168, D10S535, D10S580 D7S661, D7S498 D7S527, D7S3074 D3S1309, D3S1593, D3S1553, D19S591 THBS1, D15S132, D15S123 D7S2487, D7S655, D7S480 D11S902, D11S921, D11S861 D18S62, D18S843, D18S378 D11S969, D11S439 D11S4111, D11S925, D11S934 D16S490, D16S403, D16S3113 D10S220, D10S1762, D10S1652 D11S2017,D11S1986, D11S1992 D4S1632, D4S405, D4S428 D4S424, D4S1604, D1S1153, D1S1679 D2S326, D2S2257, D2S2273 D22S283, D22S423, D22S274 D21S2078, D21S2079, D21S1252 D10S1160, D10S1775 D10S197 D1S2739, D1S206 D9S1826, D9S1838 Reserved D14S77, D14S76, D14S53 D1S2870, D1S3774, D1S214 D6S1031, D6S1589, D6S286 D6S1599, D6S1277 D7S2204, D7S660, D7S2540 D22S686, D22S1174, D22S1124 Reserved Reserved
References
Guilford et al. 1994, Kelsell et al. 1997 Guilford et al. 1994, Liu et al. 1997 Friedman et al. 1995, Wang et al. 1998 Baldwin et al. 1995, Li et al. 1998 Fukushima et al. 1995 Fukushima et al. 1995, Naz et al, 2002 Jain et al. 1995, Kurima et al. 2002 Veske et al. 1996, Scott et al. 2001 Chaib et al. 1996, Yasunaga et al. 1999 Bonn-Tamir et al. 1996, Scott et al. 2001 Scott et al. 1996, Kurima et al. 2002 Chaib et al. 1996, Bork et al. 2001 Mustapha et al. 1998 Mustapha et al. 1998 Chen et al. 1997 Campbell et al. 1997; Verpy et al. 2001 Greinwald et al. 1998 Jain et al. 1998;. Ahmed et al, 2002 Deafness meeting Bethesda, October 8-11, 1998 (Green et al. abstract 108) Moynihan et al. 1999 Mustapha et al. 1999 Zwaenepoel et al. 2002 Ahmed et al, 2003 Richard Smith, unpublished Richard Smith, unpublished Riazuddin et al. 2000 Pulleyn et al. 2000 Walsh et al. 2000 Wilcox et al. 2001 Walsh et al. 2002 Mustapha et al, 2002 Mburu et al, 2003 Masmoudi et al, 2003 Medlej-Hashim et al, 2002 Ansar et al, 2003 Naz et al, 2004 Ahmed et al, 2003 Ansar et al, 2003 Wajid et al, 2003 Delmaghani et al, 2003 Aslam et al. 2005 Ansar et al. 2004
ESPN MYO6 unknown unknown unknown unknown
Reserved 18p11.32-p11.31 15q23-q25.1 5q12.3-q14.1 12q23 11p13-p12 6p21.3 4q12-q13.2 3q13.31-q21.1 unknown unknown unknown unknown unknown COL11A2 Reserved D15S973, D15S1027, D15S1005 D5S2055, D5S424 D11S935,D11S4102,D11S4200 Reserved D6S276,D6S1610 Reserved D4S2978, D4S2367 D3S2460,D3S1303,D3S4523,D3S1267 Reserved Reserved Reserved D5S404, D5S1979 Mir et al. 2005 Ahmad et al, 2005 Ramzan et al. 2005 Shaikh et al.2005 Chen et al. 2005 Irshad et al. 2005 This Study
5q22-q31
unknown
R. Smith unpublished
Table 1.1 Loci for Nonsyndromic Autosomal Recessive Deafness
- 29 -
Syndrome
Adrenoleukodystrophy Albinism-deafness Syndrome
OMIM
300100 300700 301050
Inher.
XLR XLR XLD AR, AD AR AD, usually spor. AR AR AR AR AD AD AR AD AD AD AR AR XLD XLR AR
Location
Xq28 Xq26.3-q27.1 Xq22 2q35-q37 2p14-p13 10q26 4q32-q33 4q22-q25 3p25 2q34-q36 8q13.3 8q13.3 17pter-p13 17p11.2 1q22 1p36-p35 8q13-q21.1 11q23 Xq13.1 Xp22.2 6p21.3
Gene (Locus)
ABCD1 (ADFN) COL4A5 COL4A3, COL4A4 ALMS1 FGFR2 AGA MANBA BTD (BJS/PTD) EYA1 EYA1 ASPA PMP22 MPZ K1F1B GDAP1 MTMR2 GJB1 (CMTX2) COL11A2
Gene Product
ATP-binding cassette, sub-family D, member 1
Protein Function
Peroxisome membrane transporter
Auditory Phenotype
Progressive SNHL Congenital SNHL
Associated Pathology
Progressive central nervous system demyelination; blindness Pigmentation abnormalities
Collagen 5(IV) Collagen 3(IV), 4(IV)-basement membrane ALMS1 Fibroblast growth factor receptor 2 N-aspartyl -glucosaminidase Beta-mannosidase Biotinidase Fibroblast growth factor receptor Lysosomal enzyme Lysosomal enzyme Biotin metabolism Basement membrane component
Alport syndrome 203780, 104200 Alstrom syndrome Apert syndrome Aspartylglucosaminuria Beta mannosidosis Biotinidase deficiency Bjornstad syndrome Branchio-oto-renal (BOR) dysplasia Branchio-otic (BO) Syndrome Canavan disease Charcot-Marie Tooth (CMT) Disease, type 1A CMT, Type 1B CMT, Type 2A CMT, Type 4A CMT, Type 4B Charcot-Marie Tooth Peroneal Muscular Atrophy Charcot-Marie Tooth Neuropathy Chondrodystrophy with Sensorineural deafness 203800 101200 208400 248510 253260 262000 113650 602588 271900 118220 118200 118210 214400 601382 302800 302801 215150
Progressive SNHL (cochlear); inconsistent cochlear histopathology Progressive SNHL (cochlear) Congenital conductive HL, usually stapedial footplate fixation CHL and/or SNHL Mild-mod. SNHL SNHL or MHL Congenital severe profound SNHL
Progressive nephritis; lens abnormalities
Pigmentary retinopathy, diabetes mellitus, obesity Premature fusion of cranial sutures with craniofacial deformities; digital deformities; mental retardation Mild bone abnormalities; progressive mental retardation; coarse facies Severe developmental delay, coarse facies Metabolic acidosis, dermatologic and central nervous system abnormalities Pili torti (flat, twisted hair Preauricular pits; branchial fistulas; renal abnormalities Preauricular pits; branchial fistulas Spongy degeneration of the brain. Onset in early infancy, megalocephaly, severe progressive psychomotor retardation, optic atrophy, hypotonia, death by 18 months on the average. Motor and sensory neuropathy Same as above Same as above Same as above Same as above Same as above Same as above Skeletal and craniofacial abnormalities; myopia
Eyes absent 1: human homolog of drosophila eyes-absent gene
Transcription factor
External, middle, or inner ear malformations; CHL and/or SNHL
Aspartoacylase Peripheral myelin protein-22 Myelin protein zero Kinesin family member 1B Ganglioside-induced differentiationassociated protein 1 Myotubularin-related protein 2 Connexin 32
Catalyzes hydrolysis of N-acetyl-aspartic acid to aspartate and acetate Structural protein of peripheral myelin Structural protein of peripheral myelin
SNHL Progressive SNHL Same as above Same as above Same as above Same as above
Gap junction protein
SNHL SNHL
Collagen 2(XI)
Fibrillar collagencartilage
Moderate-severe SNHL
- 30 -
Cleidocranial dysplasia Cockayne syndrome (CS), type I/A (classic form) CS, Type II/B (congenital form) Coffin-Lowry syndrome Craniofacial-deafnesshand Syndrome Craniometaphyseal dysplasia, Jackson type Crouzon syndrome
119600
AD
6p21
RUNX2
Runt-related transcription factor 2 CKN1
Osteoblast-specific transcription factor WD repeat protein involved in RNA polymerase II transcription (?) DNA excision repair Mitogen-activated ser/thr kinase Transcription factor
Deformed ear canals or ossicles; CHL or MHL Juvenile-onset SNHL; hair cell and cochlear neuron loss Same as above Occasional moderatesevere SNHL SNHL Progressive MHL; auditory nerve problem
Absent/abnormal clavicles; skeletal malformations
216400
AR
5q12.1
CKN1
Defective DNA repair; growth failure; mental retardation; central nervous system deterioration; photodermatitis; skeletal anomalies Same as above Mental and somatic growth retardation; skeletal anomalies Craniofacial and hand/skeletal abnormaltities Craniofacial and skeletal abnormalities, occasional facial nerve compression/palsy Premature fusion of cranial sutures with craniofacial deformities; occasional small or absent ear canal (15%) Aberrant development of thyroid and thymic glands; aortic anomalies; craniofacial deformities
133540 303600 122880 123000
AR XLD AD AD, AR
10q11 Xp22.2-p22.1 2q35 5p15.2-p14.1
ERCC6 CLS PAX3 (CMDJ)
ERCC6 Ribosomal protein S6 Kinase Paired-box DNA-binding Protein
123500
AD Spor., AD, AR
10q26
FGFR2
Fibroblast growth factor receptor 2 Contiguous gene deletion Same as above
Fibroblast growth factor receptor
188400 DiGeorge sequence 601362 Ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome, Type I EEC, Type II Fabry disease Fanconi anemia (FA), complementation group A FA, complementation group B FA, complementation group C FA, complementation group D1 FA, complementation group D2 FA, complementation group E FA, complementation group F FA, complementation group G FG syndrome
22q11 10p14-p13
(DGCR) (DGS2)
CHL in 55% of patients; middle ear anomalies; EAC atresia CHL and/or SNHL; middle and/or inner ear malformations Variable CHL and/or SNHL; ossicular and/or inner ear anomalies; possible vestibular hypofunction Same as above
129900
Spor. (AD)
7q11.2-q21.3
(EEC1)
Absent fingers, absent lacrimal puncta, cleft lip +/- palate, abnormal pigmentation of hair Same as above Cutaneous angiokeratomas; paresthesias; cataracts Pancitopenia, cardiac, renal, and limb malformations, dermal pigmentary changes, susceptibility to malignancy Same as above Same as above Same as above Same as above Same as above Same as above Same as above Mental retardation, facial dysmorphism, hypotonia, imperforate anus Central and peripheral nervous system degeneration with loss of myelinated nerve fibers Hepatosplenomegaly, CNS degeneration
602077 301500 607139 227660 227645 605724 227646 600901 603467 602956 305450 XLR AR AR AR AR AR AR AR AR XLR
19p13.1-q13.1 Xq21.3-q22 16q24.3 ? 9q22 ? 3p 6p22-p21 11p15 9p13 Xq12-q21.31
(EEC2) GLA FANCA (FANCB) FANCC (FANCD1) FANCD2 FANCE FANCE FANCG (FGS1) Mitochondrial protein; iron homeostasis Lysosomal enzyme FANCD2 FANCE FANCE FANCG Nucler protein complex Nucler protein complex Nucler protein complex Nucler protein complex FANCC Nucler protein complex -galactosidase A FANCA Lysosomal enzyme Nucler protein complex
HL CHL, mild to severe; outer and middle ear deformities Same as above Same as above Same as above Same as above Same as above Same as above Same as above SNHL in 35% of patients Mild-mod. SNHL; ABRs suggest brain stem, then CNVIII involvement SNHL
Friedreich ataxia, type I
229300
AR
9q13
FRDA1
Frataxin
Gaucher type III
23100
AR
1q21
GBA
Glucocerebroside
- 31 -
Gustavson syndrome Hunter syndrome Hurler syndrome Hypophosphatemia (HYP) (Familial hypophosphatemic rickets) HYP, Type II
309555 309900 252800
XL XLR AR
Xq26 Xq28 4p16.3
(GUST) IDS IDUA Iduronate 2-sulfatase L-iduronidase Lysosomal enzyme Lysosomal enzyme Phosphate regulation, homology to endopeptidases Voltage-gated chloride channel Import and insertion of hydrophobic membrane proteins into the mitochondrial membrane
Severe SNHL SNHL or MHL CHL or MHL Age-dependent SNHL; sclerosis, thickening of temporal bone, vestibular hypofunction. Same as above Congenital-prelingual SNHL
Severe mental retardation, seizures, spasticity, optic atrophy Central nervous system degeneration; mental retardation; craniofacial dysmorphism; dysostosis Central nervous system degeneration; mental retardation; craniofacial dysmorphism; dysostosis Vitamin-D resistant osteomalacia
307800
XLD
Xp22.2-p22.1
PHEX
PHEX
307810
XLD, XLR
Xp11.22
CLCN5
Chloride channel 5 Translocase of inner mitochondrial membrane 8, homolog A Potassium voltage-gated channel, KQT-like subfamily member 1 Potassium voltage-gated channel, Isk-related, family member 1 Neural cell adhesion molecule; axonal path finding Connexin 26 Collagen 1(II) Galactosyl-ceramidae Fibrillin-1
Same as above. Dementia, optic atrophy, skeletal muscle wasting, central nervous system calcifications.
Jensen syndrome
311150
XLR
Xq22
TIMM8A
11p15.5 Jervell and LangeNielsen syndrome 220400 AR 21q22.1-q22.2 XLR (AD) (AR) AD AD, usually spor. AR AD AD AD
KCNQ1
Delayed rectifier potassium channel
KCNE1
Congenital profound SNHL; cochleosaccular (Scheibe) dysplasia Hypogonadism, anosmia (agenesis of olfactory lobes) Congenital SNHL CHL and/or SNHL Progressive SNHL CHL or SNHL (rare)
Cardiac conduction abnormality; recurrent drop attacks; sudden death
Kallmann syndrome Keratitis-ichthyosis deafness Kniest dysplasia (metatropic dysplasia, type II) Krabbe disease Marfan syndrome (MS), type 1 MS, type 2 Marshall syndrome
308700 148210 156550 245200 154700 154705 154780
Xp22.32 13q12 12q13.11-q13.2 14q31 15q21.1 3p24.2-p25 1p21
KAL1 GJB2 COL2A1 GALC FBN1 (MFS2) COL11A1
Occasional mild SNHL mod.-severe MHL; malformed SCCs&IACs Gap junction Fibrillar collagencartilage Lysosomal enzyme Formation of microfibrils
Skin and corneal abnormalities Skeletal and epiphyseal dysplasia; cleft palate Central nervous system degeneration, optic atrophy Skeletal, ocular, and cardiovascular anomalies
Collagen 1 (XI) Translocase of inner mitochondrial membrane 8, homolog A
Fibrillar collagencartilage Import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane Antagonist of bone morphogenic protein (BMP) Tumor suppressor Regulation of intracellular Cholesterol trafficking Tyrosine phosphatase Homology to mucins; possible role in neuroectodermal cell-cell interactions
Progressive SNHL
Skeletal and joint abnormalities; myopia; cataracts; craniofacial dysmorphism
Mohr-Tranebjaerg Syndrome
304700
XLR
Xq22
TIMM8A
Progressive SNHL
Blindness, dystonia, mental deficiency, fractures
Multiple synostoses syndrome 1 Neurofibromatosis type2 Niemann-Pick disease, Type C Noonan syndrome
186500
AD
17q22
NOG
Noggin
101000
AD
22q12.
NF2
Neurofibromin 2
Progressive CHL; ossicular malformations and stapedial ankylosis Progressive SNHL & vestibular dysfunction
Premature joint fusions, skeletal abnormalities Schwannomas of other nerves; brain tumors; cataracts; caf-aulait spots; subcutaneous neurofibromas Progressive neurologic deterioration due to sphingomyelin accumulation Skeletal and craniofacial anomalies; congenital heart defects; mild mental retardation; hematologic abnormalities; lymphangiomas, schwannomas Congenital or progressive blindness; mental deficiency
257220
AR
18q11-q12
NPC1
NPC1 Protein tyrosine phosphatase, nonreceptor type 11 Norrie disease protein
Progressive SNHL Progressive SNHL or MHL Progressive SNHL strial atrophy; hair cell and cochlear neuron degeneration
163950
AD
12q24.1
PTPN11
Norrie disease
310600
XLR
Xp11.4
NDP
- 32 -
Ocular albinism with Sensorineural deafness
103470 300650
Autos,digenic XLR XLD
3p14.1-p12.3 Xp22.3 Xp22.3-p22.2 17q21.3 7q22.1
MITF (OASD) (OFD1) COL1A1 COL1A2
Microphthalmiaassociated transcription factor
SNHL Late onset, progressive SNHL Occasional CHL (possibly due to otitis media)
Ocular albinism Ocular albinism Midfacial clefting; hyperplasia of frenula; cleft tongue; hand anomalies; polycystic kidneys
Orofaciodigital syndrome, type I Osteogenesis imperfecta (OI) (types IIV) OI TypeI OI TypeIi OI TypeIII OI TypeIV Osteopetrosis (OPT) (Albers-Schonberg disease), Type I OPT, type II Otopalatodigital syndrome, type I
311200 166200 166240 166210 259420 166220 259700 166600 311300 167250 602080
Collagen 1(I) Collagen 2(I)
Fibrillar collagen-bone, tendon, skin
AD (AR)
Progressive CHL or MHL; fixed, absent, or soft stapes; ossicular fracture; abnormal otic capsule ossification
Brittle and deformed bones, hyperextensible joints; blue sclerae
AR AD XL
11q13.4-q13.5 16p13.3 Xq28 6p21.3 18q22.1
TCIRG1 CLCN7 (OPD1) (PDB1) TNFRSF11A SQSTM1 (PDB4) SLC26A4 FGFR1 FGFR2 FGFR3 KIT
T-cell immune regulator1 Chloride channel 7
Vacuolar proton pump Chloride channel
MHL or CHL; temporal bone otosclerosis CHL; ossicular anomalies. CHL; ossicular and external ear anomalies
Facial palsy, visual loss, generalized osteosclerosis Facial palsy; generalized osteosclerosis Craniofacial and skeletal anomalies
Paget disease of bone 601530 606263 Pendred syndrome 274600
AD 5q35 5q31 AR 7q31 8p11.2-p11.1
Tumor necrosis factor receptor superfamily, member 11A Sequestosome 1
Activator of NFKB Ubiqutin-binding protein
Occasional CHL and/or SNHL (cochlear); demineralization of otic capsule structures; occasional vestibular dysfunction Prelingual SNHL; vestibular dysfunction; inner ear malformations
Macrocephaly; bending of weight-bearing bones; neurologic deficits
Solute carrier family 26, member 4 Fibroblast growth factor receptor 1 Fibroblast growth factor receptor 2 Fibroblast growth factor receptor 3 KIT Phytanoyl-CoA hydroxylase Peroxisome biogenesis factor 1 Thyroid hormone receptor, beta subunit TWIST Fibroblast growth factor receptor 2 Fibroblast growth factor receptor 3
Anion transporter Fibroblast growth factor receptor Fibroblast growth factor receptor Fibroblast growth factor receptor Mast/stem cell tyrosine kinase receptor, protooncogene Peroxisomal enzyme, metabolizes phytanic acid Peroxisomal matrix protein import Transcription factor Transcription factor Fibroblast growth factor receptor Fibroblast growth factor receptor
Thyroid organification defect
Pfeiffer syndrome
101600
AD
10q26 4p16.3
CHL
Craniosynostosis; broad digits; syndactyly
Piebaldism
172800
AD
4q11-q12
Progressive SNHL Progressive SNHL; cochleosaccular atrophy Profound SNHL Mild SNHL
Congenital piebaldism; ataxia; MR Retinitis pigmentosa; cerebellar ataxia; increased plasma phytanic acid Retinitis pigmentosa; mental retardation; craniofacial dysmorphism; liver dysfunction; short stature Hypothyroidism, short stature, neurocognitive deficits
Refsum disease Refsum disease, infantile form Resistance to thyroid Hormone
266500 266510 190160
AR AR AD
10p15.3-p12.2 7q21-q22 3p24.3 7p21
PHYH PEX1 THRB TWIST FGFR2 FGFR3
Saethre-Chotzen Syndrome
101400
AD
10q26 4p16.3
Occasional CHL or MHL
Premature fusion of cranial sutures; digit abnormalities
- 33 -
Sialidosis Smith-Magenis Syndrome Spondyloepiphyseal dysplasia congenital Stickler syndrome (STL), Type I STL, Type II STL, Type III Symphalangism, Proximal Tay-Sachs disease
256550 182290 183900 108300 120280 184840
AR Spor. AD AD AD AD
6p21.3 17p11.2 12q13.11-q13.2 12q13.11-q13.2 1p21 6p21.3
NEU1 (SMCR) COL2A1 COL2A1 COL11A1 COL11A2
Sialidase 1 Contiguous deletion including MYO15 Collagen 1(II) Collagen 1(II) Collagen 1(XI) Collagen 2(XI)
Lysosomal enzyme
CHL or MHL CHL (possibly assoc. w/otitis media), occas. SNHL
Central nervous system degeneration; vision loss; dysostosis; unusual facies Growth retardation; mental deficiency; beharioral abnormalities; nonspecific combinations of anomalies Skeletal abnormalities; cleft palate; short stature Skeletal and joint abnormalities; myopia; cataracts; craniofacial dysmorphism Skeletal and joint abnormalities; myopia; cataracts; craniofacial dysmorphism Skeletal and joint abnormalities; craniofacial dysmorphism
Fibrillar collagen cartilage Same as above. Same as above. Same as above. Antagonist of bone morphogenic protein (BMP) Degrades GM2 ganglioside Transcription factor
Occas. mod.-severe highfreq. SNHL Progressive SNHL, occas. CHL Same as above. Same as above.
185800
AD
17q21-q22
NOG
Noggin
CHL; stapes ankylosis
Fusion of extremity joints
272800
AR
15q23-q24
HEXA
Hexosaminidase A Microphthalmiaassociated transcription factor
SNHL Congenital profound SNHL; normal vestibular function SNHL; occas. ossicular anomalies; malformed external ears
Progressive mental/motor retardation; seizures; blindness
Tietz syndrome
103500
AD
3q14.1-p12.3
MITF
Skin / hair albinism
Townes-Brocks Syndrome
107480
AD
16q12.1
SALL1
C2H2 zinc finger transcription factor
Homology to sal, a Drosophila homeotic gene
Deformities of anus, digits, kidneys, and heart
Treacher Collins Syndrome
154500
AD
5q31.3q33.1
TCOF1
Nucleolar phosphoprotein
Nucleolar protein trafficking
Variable CHL; middle, external ear deformities
Craniofacial anomalies; eyelid coloboma Short stature, gonadal dysgenesis, webbed neck, shield chest, cardiac and renal anomalies Onset of retinitis pigmentosa by 10 year
Turner syndrome
n.a.
1 X chromosome
SNHL Congenital severeprofound SNHL; absent vestibular function
Usher syndrome (USH), Type Ia USH, Type Ib USH, Type Ic USH, Type Id USH, Type Ie USH, Type If USH, Type Ig
276900
AR
14q32
(USH1A) Type VII myosin unconventional Harmonin Cadherin23 Unconventional myosin motor protein PDZ domain protein Cellular adhesion, PDZ binding motif Cellular adhesion Ankyrin domains, PDZ binding motif Laminin-EGF and fibronectin domains
276903 276904 601067 602097 602083 606943
AR AR AR AR AR AR
11q13.5 11p15.2-p14 10q21-q22 21q21 10q21-q22 17q24-q25
MYO7A USH1C CDH23 (USH1E) PCDH15 USH1G
Same as above Same as above Same as above Same as above
Same as above Same as above Same as above Same as above Same as above Same as above
Protocadherin 15 SANS
Same as above Same as above Congential moderatesevere SNHL; normal vestibular responses Same as above Same as above
USH, Type IIa USH, Type IIb USH, Type IIc
276901 276905 605472
AR AR AR
1q41 3p24.2-p23 5q14-q21
USH2A (USH2B) VLGR1
USHerin
Onset of retinitis pigmentosa in late teens/ early adulthood Same as above Same as above
- 34 -
USH, Type IIIa van Buchem disease Velocardiofacial (Shprintzen) syndrome Vohwinkel syndrome with ichthyosis
606397 239100 192430 604117
AR AR AD AD
3q21-q25 17q11.2 22q11 1q21
USH3A (VBCH) (VCFS) LOR
Clarin 1
Transmembrane protein
Progressive SNHL; normal or decreased vestibular responses Mixed or SNHL
Variable onset of retinitis pigmentosa Skeletal hyperostosis Heart anomalies; facial dysmorphism; cleft palate/dysfunction; mild mental retardation Hyperkeratosis and skin anomalies
Frequent contiguous gene deletion Loricrin Structural component of cell envelope of epidermis
CHL due to OM; occas. SNHL Congenital and/or progressive SNHL Occas. congenital, variable SNHL, may be asymmetric; vestibular hypofunction; occas. inner ear deformities; organ of corti, stria, and cochelar neuron atrophy Same as type I, SNHL may be progressive Same as above Same as above Cochleosaccular degeneration; atrophy of organ of corti, stria, cochlear neurons, vestibular sense organs and nerves Progressive SNHL (HF >LF) Progressive SNHL (HF >LF)
Waardenburg syndrome (WS), Type I
193500
AD
2q35-q37
PAX3
Paired-box gene 3
Craniofacial dysmorphism with dystopia canthorum; pigmentation abnormalities
WS, Type IIa
193510
AD
3p14.1-p12.3
MITF SNAI2 (SLUG) PAX3 EDN3 EDNRB SOX10 WFS1
Microphthalmiaassociated transcription factor SLUG Paired-box gene 3 Endothelin-3 Endothelin receptor, type B SOX10 Wolframin
Craniofacial dysmorphism without dystopia canthorum; pigmentation abnormalities Same as above Same as type I / II ? with skeletal abnormalities
WS, Type IIb Type III (KleinWaardenburg)
602150 148820 277580
AD AD, AR AR AR AD AR
8q11 2q35-q37 20q13.2-q13.3 13q22 22q13 4p16.1
Transcription factor Transcription factor Ligand Endothelin receptor Transcription factor Transmembrane glycoprotein
Type IV (ShahWaardenburg)
131244 602229
Same as type II, with Hirschsprung disease (lack of autonomic innervation to colon)
Wolfram syndrome
222300
Optic atrophy, diabetes mellitus, diabetes insipidus
Xeroderma pigmentosum, group A
278700
AR
9q22.3-q31
XPA
DNA excision repair
Photosensitivity; cutaneous malignancies; neurologic abnormalities
Table 1.2 Summary of the loci and genes for syndromes involving hearing loss.
- 35 -
PREVALENT SYNDROMIC AND NONSYNDROMIC LOCI/GENES IN PAKISTANI POPULATION

DFNB1/DFNA3/CX26/GJB2/CX30/GJB6
DFNB1, the first locus for nonsyndromic, recessive deafness was mapped to chromosome 13q12 in two Tunisian families affected with profound prelingual deafness (Guilford et al. 1994a). Subsequently, dominant form of deafness, DFNA3, was
localized to the same chromosomal region (Chaib et al.1994) and led the hypothesis that Cx26/GJB2 is the causative gene for both deafness forms. Kelsell et al. (1997) identified two distinct nonsense mutations in three consanguineous Pakistani DFNB1 families and established that Cx26 is the causative gene. Moreover, it has been demonstrated that Cx26 has a high level of expression in human cochlear cells, by immunohistochemical staining. Finally, authentic missense mutations, W44C and C202F, were eventually detected in two families, including the family described originally, thus establishing Cx26 as the causative gene for DFNA3 (Denoyelle et al.1998, Morle et al.2000). Cx26 missense mutations have also been reported in two forms of dominant syndromic deafness with skin anomalies (Heathcote et al.2000, Kelsell et al.2000, Maestrini et al.1999). GJB2 and other members of the connexin gene family have simple genomic structures composed of two exons: Exon 1 of GJB2 encodes the 5 untranslated region and exon 2 contains the entire open reading frame (680 bp) encoding 208 amino acids long protein Cx26 (26-kDa) which greatly simplifies mutational analysis. High prevalence of mutations at this locus became apparent once mutation in the connexin26 (Cx26) gene was identified. Mutations in connexin 26 (Cx26) have been found to be the most common cause of both familial and sporadic cases of deafness from many parts of the world (Carrasquillo et al. 1997, Scott et al. 1998). Over 70 different mutations within the Cx26 gene are known (Rabionet et al. 2000, Pandya et al.2003). DFNB1 accounts for 20% in Japan (Abe et al. 2000, Kudo et al. 2000), 13.3% in India (Maheshwari et al. 2003), 16.7% in Iran (Najmabadi et al.2005), while is less prevalent in Pakistan as compared to India (Santos et al. 2005). In populations where DFNB1 deafness is common, a single prevalent founder mutation accounts for most mutant alleles. There is also usually a relative high carrier frequency (>1%) for a single predominant recessive mutation. This includes the 35delG (3-4%) in some non-Jewish Caucasian populations (Estivill et al. 1998) and (3.4%) in the Czech Republic (Seeman et al. 2004), 167delT (4%) in Ashkenazi Jews (Morell et al. 1998), and 235delC (1%) in
- 36 -
Asian-Japanese, German, and Chinese populations (Abe et al. 2000; Kudo et al. 2000; Kupka et al. 2002; Liu et al. 2002). Recent analysis of published carrier frequencies of the 35delG mutation in 27 populations for 6,628 unrelated individuals in Europe and in the Middle East suggested that the mean carrier frequency of the mutation is 1.9% and probable origin of 35delG mutation was in ancient Greece which was subsequently propagated in other Mediterranean countries during recent historical times (Lucotte and Dieterlen 2005). More information is available on the connexin deafness Web site. It had been unclear that why a large fraction (10-42%) of patients with GJB2 mutations has only one mutant allele of GJB2, with the accompanying mutation unidentified. This was partially clarified as in some populations like Spanish, Ashkenazi Jews, and French the apparent excess of Cx26 heterozygotes has been associated with a novel large 342 kb deletion that includes the closely linked Cx30 gene (GJB6) on the other non-Cx26 mutation chromosome (del Castillo et al. 2002, Lerer et al. 2001), thereby concluded that mutations in the complex DFNB1 locus, which contains 2 genes (GJB2 and GJB6), can result in a monogenic or in a digenic pattern of inheritance of prelingual deafness. One model that postulate the pathophysiology of DFNB1, suggests Cx26 gap junction system play a role in K+ recycling, facilitating the rapid transport of K+ ions through the supporting cell network to the stria vascularis, where the ions can be actively pumped in to the endolymph through voltage-gated potassium channels thereby maintaining the unique K+/Na+ endolymph balance (Tekin et al. 2001). The genomic knockout of connexin 26 is lethal in the mouse, (Gabriel et al. 1998) so to study gene expression in vivo, a targeted, tissue-specific knockout of connexin 26 had to be created that eliminated the expression in the epithelial cells of the inner ear (Cohen-Salmon et al.2002) and concluded that Cx26-containing epithelial gap junctions are essential for cochlear function and cell survival and that prevention of cell death in the sensory epithelium is vital in restoring auditory function in DFNB1 patients.
DFNB2/DFNA11/USH1B/MYO7A
DFNB2, the second reported locus responsible for an autosomal recessive form of deafness, was localized to 11q13.5 by linkage studies in a large consanguineous Tunisian family (Guilford et al. 1994b), and it was noted that the region overlapped that of usher syndrome 1B (USH1B) (Kimberling et al. 1992, Smith et al. 1992). Positional cloning of sh-1 in the mouse led to the identification of a gene, MYO7A, predicted to encode an
- 37 -
unconventional myosin (myosin VIIA) (Gibson et al. 1995). Subsequently MYO7A gene was tested and mutations were identified in individuals with Usher 1B (Weil et al. 1995) and in two Chinese families linked to DFNB2 (Liu et al. 1997a), and in a DFNA11 family (Liu et al. 1997b). USH1B was found to account for about 75% of type I usher syndrome patients (Weil et al.1995) and its relative abundance in a sampling of Pakistani deaf children was found to be 42.9% (Ahmed et al. 2003a). Approximately 100 mutant alleles of MYO7A have been described to be associated with DFNB2, USH1B and DFNA11 (Table 1.3); these include nonsense, missense, insertions, deletion, and splice site mutations (Weil et al.1995; Weston et al.1996; Levy et al.1997; Adato et al.1997; Liu et al. 1997a; Liu et al. 1997b; Kumar et al. 2004; Ouyang et al.2005; Najera et al. 2002; Janecke et al.1999; Luijendijk et al.2004; Street et al.2004; Bolz et al.2004). Ophthalmological reevaluation of original Tunisian DFNB2 family revealed mild retinal degeneration and retinitis pigmentosa (Zina et al. 2001). Moreover, Astuto et al. (2002) noted that there is no discernable difference between mutations that can cause usher syndrome and those that are nonsyndromic, and questioned whether the cases of DFNB2 are truly nonsyndromic as it is difficult to explain the absence of a retinal phenotype. The predicted human protein encoded by MYO7A (49 exons) is a member of the family of unconventional myosins, which do not assemble into filaments like conventional myosins. Unconventional myosins are motor molecules with structurally conserved heads that move along actin filaments using their actin-activated ATPase activity. Myosin VIIA is expressed in a variety of tissues, is a common component of motile and sensory cilia, and is distributed along the entire length of stereocilia of inner ear hair cells (Hasson et al. 1995). Myosin VIIA has also been implicated in endocytosis in hair cells. The inner ears of wild-type mice take up aminoglycoside antibiotics, which are ototoxic. However, homozygous sh1 mice are protected from gentamicin toxicity presumably because a step in the endocytotic pathway is disrupted (Richardson et al. 1999). Moreover, myosin VIIA participates in opsin transport through the connecting cilium to the outer segment of the photoreceptor cell (Liu et al. 1999), which may be the critical cellular process disrupted by USH1B mutations of MYO7A. Yet another proposed role for myosin VIIA is in transduction channel adaptation of inner ear hair cells. A myosin motor has long been favored as the source of the resting tension on the gating spring(s) of the transduction channel. In mice homozygous for either of two hypomorphic alleles,
- 38 -
MYO7A6J or MYO7A4626SB, hair cell stereocilia bundles transduce a mechanical stimulus (Richardson et al. 1997), but require a larger force than is necessary in the wild-type bundles to open the transduction channel (Kros et al. 2002). Myosin VIIa may thus be a component of the adaptation motor complex. Alternatively, myosin VIIA may provide tension on the stereocilia plasma membrane and/or transport proteins to the stereocilia that are required for transduction indirectly affecting adaptation (Boeda et al. 2002). El-Amraoui et al. (1996) analyzed the expression of myosin VIIA in retinal and cochlear cells during development in mouse and human. Analysis of myosin VIIA distribution in mouse retina showed that the pigment epithelium cells expressed myosin VIIA throughout murine development and post-natal life, while myosin VIIA is expressed in the cochlear sensory hair cells during mouse embryonic development and that myosin VIIA expression is restricted to sensory hair cells in the developing human otic vesicle. They noted that this expression pattern correlated to the vestibular and cochlear dysfunctions resulting in balance problems and hearing impairment observed in both usher patients and shaker-1 mouse mutants. It has been anticipated that the shaping of the hair bundle relies on a functional unit composed of myosin VIIa , harmonin b, and cadherin23 and that the interaction of these proteins ensures the cohesion of the stereocilia (Boeda et al.2002). Furthermore, Adato et al. (2005) proposed that SANS via its binding to myosin VIIa and/or harmonin controls the hair bundle cohesion and proper development by regulating the traffic of USH1 proteins to the stereocilia. Interestingly, in the zebrafish myosin VIIa, five of eight different circler mutants, designated mariner, segregate two missense and three nonsense mutations. Mariner fish have inner ear hair cell abnormalities, lack accoustic vibrational sensitivity and reduced or abolished microphonic potential (Ernest et al.2000) and is likely to be a good model system to more fully explore the function of this unconventional myosin in the auditory system of vertebrates. Thus, demonstrating the striking conservation of the function of myosin VIIA throughout vertebrate evolution.
DFNB3/MYO15A
DFNB3 was identified on chromosome 17p11.2 for nonsyndromic recessive deafness segregating in 2% of the 2,200 residents of Bengkala (Friedman et al.1995). On the basis of conserved synteny, shaker 2 (sh2) was proposed as a mouse model of DFNB3 (Liang et al. 1998). Affected mice exhibit no auditory brainstem responses to sound pressure levels up to high levels, indicating profound deafness and associated
- 39 -
head-tossing and circling behavior due to vestibular defects. Families with deafness linked to DFNB3 were then screened for mutations of MYO15A and missense and nonsense mutations cosegregating with the hearing phenotype were found (Wang et al. 1998, Liburd et al. 2001). The largest of several splice isoforms of MYO15A has 65 exons encoding 3530 amino acids (365-kDa). The tail of myosin XVA (Liang et al. 1999) has two MyTh4 domains, two FERM domains and a SH3 domain and resembles the myosin VIIA tail, suggesting a common ancestral myosin (Thompson and Langford 2002). In situ
hybridization of MYO15A probes indicates that this gene is expressed in IHCs and OHCs, as well as in particular cell types of the pituitary where it is associated with secretary granules (Lloyd et al. 2001). Light and electron microscopic studies of sh2 and 2J mice inner ears show that hair cell stereocilia are present and properly positioned, but they are approximately 1/10 of the length of wild-type stereocilia (Beyer et al. 2000; Probst et al. 1998). Myosin XVa, an unconventional myosin is suggested to have a role in the formation of stereocilia (Anderson et al. 2000). Absence of staircase organization of sh2 mouse indicates that Myosin XVa is required for the elongation and formation of the stereocilia-bundle staircase (Belyantseva et al. 2003a; Belyantseva et al. 2003b).
DFNB4/PENDRED SYNDROME/SLC26A4
Nonsyndromic deafness DFNB4 locus (7q21-34) was first described in a deaf Israeli Druze family (Baldwin et al. 1995). When the Pendred syndrome (autosomal recessive deafness with goiter) was subsequently assigned to the same chromosomal region (Coyle et al. 1996; Sheffield et al. 1996), this family was clinically reexamined and diagnosed with Pendred syndrome. Nonsyndromic deafness DFNB4 and Pendred syndrome are allelic disorders caused by mutations of the SCL26A4 gene on chromosome 7q22-31.1 (Everett et al. 1997, Li et al. 1998). Enlargement of the
endolymphatic duct (EVA) is a sensitive and fairly specific radiological marker for Pendred syndrome or DFNB4 deafness (Phelps et al. 1998). Over 60 mutations have been found in nearly every coding exon and protein domain throughout SLC26A4 and account for as much as 10% of hereditary deafness in diverse populations that include east and south Asians (Park et al. 2003). Each ethnic population has a different and diverse mutant allele series, with one or a few prevalent founder mutations (Everett et al. 1997, Li et al. 1998, Coyle et al. 1998, Van Hauwe et al. 1998, Reardon et al. 2000, Campbell et al. 2001, Park et al. 2003).
- 40 -
SLC26A4 is composed of 21 exons encoding an 86-kDa polypeptide called Pendrin that is expressed in thyroid and kidney, as well as the cochlea (Everett et al. 1997). Pendrin is a multipass transmembrane protein predicted to have at least nine membrane-spanning domains, but its topology has not been experimentally determined. Recent studies by Scott et al. (2000), demonstrated that SLC26A4 mutations in individuals with Pendred syndrome differ functionally from mutations in individuals with NSHL. They found that mutations associated with pendred syndrome have a
complete loss of pendrin induced chloride and iodide transport, while alleles unique to people with DFNB4 are able to transport both iodide and chloride, although at much lower level than a wild type Pendrin. A Pds-/- knockout mouse generated and characterized by Everett and coworkers has provided fascinating insights into the function of pendrin in the inner ear and the pathogenesis of HL in Pendred syndrome (Everett et al. 2001). Homozygous Pds-/- mice manifest variable degrees of vestibular dysfunction as evidenced by gait unsteadiness, circling behavior, head-tilting, and abnormal performance in rotarod balance testing. Auditory brainstem response analyses demonstrated that Pds-/- mice are deaf, whereas Pds+/- heterozygotes have normal hearing. The endolymphatic duct of Pds-/- mice is anatomically normal until E15, which begin to enlarge in comparison to control mice afterwards. Interestingly, no thyroid abnormalities have been detected in the Pds-/- mice. Although serum thyroid function tests and macroscopic and histologic studies could detect no abnormalities, it is possible that a subtle iodination defect is still present. Since these phenotypic features are incompletely penetrant in human Pendred syndrome, and since the auditory/ vestibular phenotype is very similar to that observed in human patients, the pds knockout mouse should continue to provide an outstanding mouse model for further studies of pendrin and HL in Pendred syndrome.
DFNB6/TMIE
DFNB6 was first localized by homozygosity mapping to chromosome 3q21 in a consanguineous Indian family (Fukushima et al. 1995). Because of chromosomal
homology with the linked region, the mouse mutant spinner (sr) is a candidate for DFNB6. The spinner mouse has deafness and vestibular dysfunction, and histologic studies show abnormal maturation of the stereocilia of the cochlear hair cells. The casual gene for spinner was found and named to be Tmie (transmembrane inner ear), a novel gene which is predicted to encode a transmembrane protein with no sequence similarity
- 41 -
to other known proteins. Tmie mRNA is detectable by RT-PCR analysis in various tissues, including the cochlea (Mitchem et al. 2002). Naz et al. (2002) cloned the human TMIE ortholog and identified five different TMIE mutations cosegregating with DFNB6 deafness in five consanguineous families, including the original DFNB6 family.
DFNB7/11/DFNA36/TMC1
DFNB7and DFNB11, were mapped to chromosome 9q13-q21 in two consanguineous Indian families and two inbred Israeli Bedouin kindreds, respectively (Jain et al. 1995, Scott et al. 1996). DFNA36 was also mapped in a large five-generation US family to same region, suggesting that these all might be allelic disorders of a same gene. Eight different mutations were identified in a novel gene, transmembrane channellike gene 1 (TMC1), in the DFNA36 family and in 11 large families segregating DFNB7/B11 deafness from Pakistan and India, including the original DFNB7 family (Kurima et al. 2002). The function of TMC1 is unknown, but it is predicted to encode a multipass transmembrane protein and it is likely to be involved in ion transport. TMC1 mutations were also identified in the recessive deafness (dn) and dominant Beethoven (Bth) mouse mutant strains segregating HL and postnatal hair cell degeneration, indicating that TMC1 is required for postnatal hair cell development or maintenance (Kurima et al. 2002, Vreugde et al. 2002 ). Makishima et al (2004) recently identified a novel mutation D572N in TMC1 gene associated with DFNA36. Furthermore, a novel mutation 1165C>T and splice-site variant 19+5G>A in TMC1 gene was found to be associated with DFNB7/11 (Meyer et al. 2005).
DFNB8/B10/TMPRSS3
DFNB8/B10, an autosomal recessive deafness locus, was independently mapped in two consanguineous families from Palestine (DFNB10) and Pakistan (DFNB8) to chromosome 21q22.3 (Bonne-Tamir et al. 1996, Veske et al. 1996). Haplotype and gene sequence analyses of individuals in these two families led to the identification of mutations in a gene encoding a serine protease, TMPRSS3 (Scott et al. 2001, Ben-Yosef et al. 2001). TMPRSS3 is the only protease reported thus far to be involved in The TMPRSS3 gene, spanning approximately 24 kb on
nonsyndromic deafness.
chromosome 21, contains thirteen reported exons (Scott et al. 2001). In humans there are alternatively spliced transcripts (TMPRSS3 a, b, c and d), encoding predicted polypeptides of 454, 327, 327 and 344 amino acids, respectively (Scott et al. 2001). A fifth isoform, TMPRSS3e, which has a longest open reading frame is recently identified,
- 42 -
it encodes 538 amino acid residues and is the only isoform of this gene with a predicted signal sequence (Ahmed et al. 2004). TMPRSS3 message is expressed in supporting cells of the organ of Corti, in the stria vascularis and in the spiral ganglion cells of the cochlea (Guipponi et al. 2002). Although the specific role of TMPRSS3 in the development and maintenance of the audiosensory apparatus is still unknown, the reported mutant alleles of TMPRSS3 abolish catalytic activity of the serine protease, implying a proteolytic function during the inner ear development (Guipponi et al. 2002; Lee et al. 2003). Although the in vivo substrate (s) of TMPRSS3 have not been reported in the auditory system, TMPRSS3 is thought to regulate the activity of the epithelial amiloride sensitive sodium channel (ENaC) in vitro, which was suggested to control critical signaling pathway(s) in the inner ear and may have a role in the maintenance of the low sodium concentration of endolymph (Guipponi et al. 2002).
DFNB12/USH1D/CDH23
The nonsyndromic recessive deafness locus DFNB12 was mapped to chromosome 10q21q22 in consanguineous kindred from Syria (Chaib et al. 1996). The Usher syndrome type 1D (USH1D) locus was subsequently mapped in Pakistani kindred to 10q that colocalize DFNB12 interval (Wayne et al. 1996). Allelic mutations of CDH23 encoding cadherin23 cause both nonsyndromic deafness DFNB12 and USH1D (Bolz et al. 2001, Bork et al. 2001, Astuto et al. 2002a). A genotype-phenotype
relationship for USH1D and DFNB12 was proposed where some amino acid substitutions in cadherin23 were presumed to be leaky or hypomorphs, causing partial loss of function and nonsyndromic deafness, whereas more disabling mutations and functional null alleles of CDH23 cause RP and vestibular dysfunction as well as deafness (Bork et al. 2001, Astuto et al. 2002a). All reported CDH23 alleles identified in
nonsyndromic deafness patients are missense mutations (Bork et al. 2001, Astuto et al. 2002a) while nonsense mutations, insertions, deletions, splicing variants, and other missense mutations of CDH23 were only identified in USH1 probands (Astuto et al. 2002a, Bolz et al. 2001, Bork et al. 2001). A 193delC mutation accounted for 26% of CDH23 (USH1D) mutations, confirming its high frequency in UK and US populaltion (Ouyang et al. 2005). Cadherin23 is a member of cadherin superfamily of integral membrane proteins (Jamora and Fuchs, 2002, Nelson and Nusse 2004). Homophilic interaction of these
- 43 -
proteins might form links that interconnect stereocilia within a bundle. Cadherin23 is located at the tips of the bundle in frog and zebrafish hair cells and has been proposed as an essential component of tip links (Siemens et al. 2004, Sollner et al. 2004). It is suggested that CDH23 and PCDH15 play an essential long-term role in maintaining the normal organization of the stereocilia bundles (Zheng et al. 2005).
DFNB18/USH1C
The DFNB18 locus was mapped in a consanguineous Indian family at chromosome 11p15.1-p14 (Jain et al. 1998), overlapping within a region of USH1C (Smith et al. 1992). Mutations in USH1C gene were identified as the primary defect in USH1C patients (Verpy et al. 2000, Bitner-Glindzicz et al. 2000). USH1C has 20 primary and 8 alternatively spliced exons encoding several isoforms (Verpy et al.2000). Depending upon the harmonin splice isoform, there are either two or three PDZ domains and one or two coiled coil regions in the encoded protein. As postulated that DFNB18 and USH1C are allelic variants of the same gene, mutational analysis of harmonin in the Indian family with DFNB18 revealed a homozygous intronic mutation that causes skipping of exon 12 with a resulting framshift producing a stop codon in exon 13. This should disrupt isoforms in the retina as well as the ear. However expression studies have shown that normally spliced protein is also produced indicating that this is a leaky mutation. It is possible that enough product is formed to sustain activity in the eye but not in the ear (Ahmed et al. 2002). A splice-site mutation, 216G>A, in exon 3 of USH1C is associated with Acadian Usher type IC and was reported to create an in-frame deletion of 39 base pairs, resulting in an unstable transcript (Lentz et al. 2005).
DFNB21/ DFNA8/A12/TECTA
The DFNB21 locus was mapped in a Lebanese family to chromosome 11q23-25, and mutation in TECTA gene was identified (Mustapha et al. 1999). Mutations in the same gene (TECTA) were also found to be associated with both dominant DFNA8/A12 HL and provide an unusual robust correlation of auditory phenotype with TECTA genotype. TECTA encode -tectorin, a major noncollagenous glycoprotein component of the tectorial membrane, which is an extracellular matrix that overlies the stereocilia of the outer hair cells in the organ of Corti. Homozygosity for functional null alleles of TECTA at the DFNB21 locus causes recessive, prelingual, severe-to-profound stable HL with a flat or shallow U-shaped audiometric configuration (Naz et al. 2003). In contrast, heterozygous carriers of missense mutations in TECTA at the DFNA8/A12 locus have
- 44 -
dominant HL with phenotypic features dependent on the type and location of the amino acid substitution within TECTA (Balciuniene et al. 1999, Moreno-Pelayo et al. 2001, Verhoeven et al. 1998, Iwasaki et al. 2002).
DFNB23/USH1F/PCDH15
DFNB23 was mapped to an interval of chromosome 10q21-22 that colocalizes USH1F (Wayne et al. 1997). Recessive mutations in the human PCDH15 gene are identified in the affected members of families segregating USH1F (Ahmed et al. 2001, Alagramam et al. 2001, Ben-Yosef et al. 2003). PCDH15 mutant alleles were also found to cause nonsyndromic HL (DFNB23) in three families from Pakistan (Ahmed et al. 2003). A genotype-phenotype correlation was suggested, in which hypomorphic alleles of PCDH15 are associated with nonsyndromic hearing loss DFNB23, while more severe mutations of this gene result in USH1F (Ahmed et al. 2003). PCDH15 belongs to the cadherin superfamily of calcium-dependent cell-cell adhesion molecules (Alagramam et al. 2001). Precise cellular localization of protocadherin 15 showed its expression in the retina of mouse, human and monkey and along the entire stereocilia length (Ahmed et al. 2003). The R245X mutation of the PCDH15 gene was found to be the most common cause of USH1 in the Ashkenazi Jewish population (Ben-Yosef et al. 2003). A study showed that 5601-5603delAAC is a common mutation of PCDH15 (USH1F) in US and UK deaf individuals and accounts for 33% of mutant alleles (Ouyang et al. 2005).
DFNB26
Riazuddin et al.reported the localization of a novel recessive nonsyndromic deafness locus DFNB26 on chromosome 4q31 segregating in a large consanguineous Pakistani family. The family defining DFNB26 is unique as a dominant modifier
DFNM1 is also present in some members that can suppress the expression of deafness in its carriers (Riazuddin et al. 2000).
DFNB29/CLDN14
Wilcox and coworkers reported that mutations in the gene encoding tight junction Claudin 14 causes autosomal recessive deafness DFNB29 and mapped on chromosome 21q22. Loss of claudin 14 in the inner ear was hypothesized to create a breach in the paracellular barrier of the organ of Corti, compromising endolymph homeostasis. Claudin 14 mRNA and protein were localized in both vestibular and auditory (hair cells
- 45 -
and supporting cells of the organ of Corti) sensory neuroepithelia of the inner ear and (Wilcox et al. 2001). It is further precisely confirmed to be localized at the apical junctions of hair cells and supporting cells. Cldn-14 null are deaf due to rapid
degeneration of cochlear OHCs during the second and third weeks of life, although there is a normal endocochlear potential (Ben-Yosef et al. 2002). CLDN14 mutations are a relatively infrequent cause of nonsyndromic recessive deafness in the Pakistani population while the contribution of CLDN14 mutation to recessive deafness in other populations is unknown, and may significantly differ from Pakistani population.
DFNB35
DFNB35 was mapped to chromosome 14q24.1-24.3 in large consanguineous kindred from Pakistan (Ansar et al., 2003a).
DFNB36/ESPN
DFNB36 was mapped in two consanguineous Pakistani families segregating recessively inherited deafness and vestibular areflexia (Naz et al. 2004). ESPN, a gene in the DFNB36 critical interval at 1p36.3, was a good positional candidate because a mutation of Espn is known to cause deafness and vestibular dysfunction in the jerker mouse (Zheng et al. 2000). Mutation in ESPN, which encodes a calcium-insensitive actin-bundling protein called espin were found to segregate with the deafness phenotype in the both the families (Naz et al. 2004). PCR analysis of human fetal inner ear cDNA revealed expression of ESPN in the inner ear. Moreover, espin has multiple sites for protein-protein interactions, which may serve as a scaffold for assembly of macromolecular complexes important for structure and function of the stereocilia (Naz et al. 2004). Donaudy et al. (2005) recently demonstrated that dominant mutant allele of ESPN is associated with nonsyndromic deafness.
DFNB37/DFNA22/MYO6
A novel nonsyndromic recessive deafness locus DFNB37 was mapped on chromosome 6q13 in large consanguineous kindred from Pakistan. Mutational analysis has shown three different mutations in MYO6 gene: a homozygous single-base-pair insertion (36-37insT), a transition mutation, 3496CT, and a transversion mutation, 647AT segregated in families linked to DFNB37 (Ahmed et al. 2003b). Before this dominantly inherited missense allele (C422Y) of MYO6 was found to be associated with nonsyndromic, progressive HL in a single family defining the DFNA22 locus
- 46 -
(Melchionda et al. 2001) and two recessive null mutations of mouse MYO6 were known to cause deafness and vestibular dysfunction in Snell's waltzer mice (Avraham et al. 1995).
DFNB38
DFNB38 was mapped on chromosome 6q26-q27 in large consanguineous family from Pakistan (Ansar et al., 2003b).
DFNB39
A new autosomal recessive nonsyndromic deafness locus DFNB39 was mapped on chromosome 7q11.22-q21.12 in consanguineous Pakistani family (Wajid et al. 2003).
DFNB42
A consanguineous family with NSHL, ascertained from Pakistan displayed significant evidence of linkage to 3q13.31-q22.3 (Aslam et al., 2005).
DFNB44
DFNB44 was mapped to 20.9 cM interval on chromosome 7p14.1-q11.22 (Ansar et al., 2004).
DFNB46
DFNB46 was mapped on chromosome 18p11.32-p11.31 in large consanguineous kindred from Pakistan (Mir et al., 2005).
DFNB48
A novel autosomal recessive nonsyndromic deafness locus DFNB48 was mapped to chromosome 15q23-q25.1 in five large consanguineous Pakistani families. (Ahmad et al. 2005).
DFNB49
A novel autosomal recessive nonsyndromic deafness locus DFNB49 was mapped on chromosome 5q12.3-14.1 in two consanguineous families from Pakistan (Ramzan et al. 2004).
DFNB51
A novel autosomal recessive nonsyndromic deafness locus DFNB49 was mapped on chromosome 11p13-p12 in two consanguineous families from Pakistan (Shaikh et al. 2005).
- 47 -
DFNB56
DFNB56, a novel locus for nonsyndromic recessive deafness is mapped on two consanguineous families on chromosome 3q13.3-21.1 with a maximum two-point lod score of 4.84 at recombination fraction =0 (This study).
- 48 -
Phenotype
DFNA11
Mutation
N458I G722R R853C 886-888 R244P M599I IVS3-2 IVS24-21 1199insT 1716delE L16X G25R A26E C31X V67M 75delG R90P 120delC I134N R150X IVS5+1 166delG R212C R212H G214R D218-I219 A226T Q234X R241S R241C R244P 269delAAG R302H E314X Y333X 353delC A397D D437N E450Q A457V 468+Q P503L G519D IVS13-1 IVS13-8 521delC Q531X 532delA 542insC IVS16+1 C628X R634X R666X
Domain
Motor domain Motor domain IQ motif Coiled coil Motor domain Motor domain Motor domain FERM domain MyTH4 No known domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain Motor domain
References
Luijendijk et al.2004 Street et al.2004 Bolz et al.2004 Liu et al.1997d Liu et al.1997c Weil et al.1997 Liu et al.1997c Janecke et al.1999 Liu et al.1997c This Study Janecke et al.1999 Liu et al.1997a Bharadwaj et al.2000 Weston et al.1996 Bharadwaj et al.2000 Weston et al.1996 Bharadwaj et al.2000 Weston et al.1996 Bharadwaj et al.2000 Weil et al.1995 Adato et al.1997 This Study Weil et al.1995 Weil et al.1995 Adato et al.1997 & This Study Weil et al.1995 Mena et al.2000 Weil et al.1995 Janecke et al.1999 Bharadwaj et al.2000 Liu et al.1997c Bharadwaj et al.2000 Weston et al.1996 Weston et al.1996 Weston et al.1996 Liu et al.1997c Adato et al.1997 This Study Weston et al.1996 Bharadwaj et al.2000 Weston et al.1996 Weston et al.1996 Bharadwaj et al.2000 Bharadwaj et al.2000 Weston et al.1996 Liu et al.1997a This Study Weston et al.1996 Bharadwaj et al.2000 This Study Weston et al.1998 Weston et al.1998 Janecke et al.1999
DFNB2
USH1B
- 49 -
R669X 724delC IVS18+1 808delC Q821X A826T IVS24-21 G955S E960X E968D R972X 1046insC E1080X IVS27-1 E1170K IVS28+2 R1240E R1240Q IVS29+2 A1288P Q1327K R1343S 1346delTTC T1566M R1602Q A1628S Y1719C R1743W Q1798X IVS39+1 L1858P R1861X IVS40-1 P1887L 2008delG 2065delC 2119-2215del2kb G2137E G2163S G2167D G2187D Atypical USH1B L651P cpd. het. w/R1602Q
Motor domain Motor domain Motor domain IQ motif IQ motif IQ motif Post coiled coil domain Post coiled coil domain Post coiled coil domain Post coiled coil domain Post coiled coil domain MyTH4 domain MyTH4 domain MyTH4 domain MyTH4 domain MyTH4 domain MyTH4 domain MyTH4 domain Post MyTH4 domain FERM domain FERM domain FERM domain FERM domain FERM domain FERM domain SH3 domain Post SH3 domain MyTH4 domain MyTH4 domain MyTH4 domain Post MyTH4 domain Post MyTH4 domain Pre FERM domain FERM domain FERM domain FERM domain FERM domain FERM domain FERM domain FERM domain FERM domain Motor domain & FERM domain
Weston et al.1998 Weston et al.1998 Adato et al.1997 Liu et al.1998 Najera et al. 2002 Adato et al.1997 Janecke et al.1999 Levy et al.1997 Janecke et al.1999 Bharadwaj et al.2000 This Study This Study Cuevas et al.1999 Liu et al.1998 Cuevas et al.1999 Levy et al.1997 Janecke et al.1999 Bharadwaj et al.2000 Weston et al.1998 Janecke et al.1999 Najera et al. 2002 Janecke et al.1999 Bharadwaj et al.2000 Najera et al. 2002 Weston et al.1998 Weston et al.1998 Janecke et al.1999 Bharadwaj et al.2000 Janecke et al.1999 This Study Bharadwaj et al.2000 Adato et al.1997 Bharadwaj et al.2000 Bharadwaj et al.2000 Bharadwaj et al.2000 Adato et al.1997 Adato et al.1997 Levy et al.1997 Janecke et al.1999 Weston et al.1998 Bharadwaj et al.2000 Liu et al.1998
Table 1.3 Summary of the mutations of MYO7A.
- 50 -
MOLECULAR ARCHITECTURE OF THE INNER EAR

The inner ear is structurally complex. Analysis of the structure and function of the inner ear has lagged behind that of many other body tissues. This was due in part; to the relative inaccessibility of the inner ear tissues and the small number of specialized cells they contain (~104 hair cells in total in a single cochlea). However, our
understanding of the complexities of the architectural organization necessary for cochlear and vestibular function has advanced from the use of contemporary methods of cell and molecular biology, and from studies of ontogenetic development. The inner ear is becoming a major model for post-genomic studies, the attempt to discover for what all the genes identified in the human genome actually code. Studies of hereditary hearing impairment and use of mice as models for the human ear has allowed the identification of many critical and previously unknown, molecular components of the auditory system and provided an insight in the process of sound transduction. This has also helped to understand that how hair cells have adapted the molecular mechanisms of intracellular motility and intercellular adhesion for the morphogenesis of their apical surfaces. This work has provided new insights into how the tissues of the inner ear are built to perform their tasks, and into the pathogenesis of a range of inner ear disorders (Friedman and Griffith 2003; Rzadzinska et al. 2004; Frolenkov et al. 2004; Adato et al. 2005).
HAIR CELLS AND HAIR BUNDLE STEREOCILIA

CORE OF STEREOCILIA The hair bundle is composed of 20-300 rigid plasma membrane bound projections, the hair cell stereocilia, which are specialized derivatives of actin-based microvilli (DeRosier and Tilney 2000). Stereocilia are packed into rows of increasing height to form an organized and uniformly oriented hair bundle (Fig 1.9a). The core of stereocilia consists of parallel actin filaments closely packed in a hexagonally ordered paracrystalline array (DeRosier et al. 1980) and are cross-linked by different sets of actin-bundling proteins, such as espin and fimbrin/plastin. They distribute along the entire stereocilium and are present both in the developing and the adult stereocilia (Boeda et al. 2002). The filaments are unidirectionally aligned with their barbed end at the site of high-affinity actin polymerization oriented away from the surface of the cell
- 51 -
(Tilney et al. 1980). Growth of stereocilia therefore occurs by the addition of new actin monomers to their tips (Tyska et al. 2002; Schneider et al. 2002; Loomis et al. 2003). The high density of actin filaments and the extensive cross-linking between them imposes rigidity on the shaft of the stereocilium, which trapers at its proximal end. As a few of the stereocilia actin filaments extend rootlets into the cuticular plate, a rigid platform made of a dense meshwork of horizontal actin filaments located beneath the apical cell surface, to which they are connected (Fig.1.8b) and is thought to provide mechanical stability to the apex of the hair cell (Tilney et al. 1980). Espin is an important structural element of the hair bundle of mammalian hair cells, recessive mutations in the gene which encodes espin result in deafness in jerker mouse and profound prelingual HL (DFNB36) and peripheral vestibular areflexia in human (Naz et al. 2004). The deaf jerker mouse fails to accumulate detectable amounts of espin in in the hair bundle, which leads to shortening, loss of mechanical stiffness and eventual disintegration of stereocilia (Zheng et al. 2000a). This reveals the importance of actin bundling and the maintenance of stereociliary rigidity to hair cell function. -actin is found throughout the hair cell (Hofer et al. 1997), and could be considered as a housekeeping gene product. Nevertheless, there are several dominant missense alleles of ACTG1 that encode -actin that result in nonsyndromic, progressive, sensorineural HL in humans (Morell et al. 2000; Zhu et al. 2003; van Wijk et al. 2003), indicating a unique requirement for -actin, in hair cell stereocilia. SHAPING THE STEREOCILIUM FROM TIP TO TAPER To maintain the ultrastructure and morphology of stereocilium taper, tight control of actin polymerization and depolymerization is required at both locations: the tip and the taper. Several proteins have been implicated in the actin cytoskeleton dynamics of stereocilia. A mutation in a human homologue of the D. melanogaster gene diaphanous is linked to DFNA1 locus (Lynch et al. 1997). Diaphanous belongs to the formin family of proteins, which accelerate actin nucleation while interacting with the barbed end of actin filament (Higashida et al. 2004). Although the localization of diaphanous in the inner ear is unknown, its involvement in actin polymerization in the stereocilia was proposed (Lynch et al. 1997).
- 52 -
Fig 1.8 Adhesion in the hair bundle. a Four known types of link between adjacent stereocilia. b Schematized illustration of proteins that constitute adhesion complexes on the plasma membrane of stereocilia. Experimentally demonstrated interactions between myosin VIIa, harmonin, cadherin 23, SANS and vezatin are shown, as well as the interaction of myosin XVa with whirlin. c Interacting domains among the proteins that are essential for stereocilia micromorphogenesis and function. These proteins were identified through positional cloning of genes that underlie type 1 Usher syndrome. Ank, ankyrin repeat domain that is thought to be involved in proteinprotein interactions; CC, coiled coil domain that mediates dimerization; EC, cadherin extracellular repeat; FERM, domain that is also known as the talin homology domain, which is thought to be important for linking cytoskeletal proteins to the membrane; IQ, a motif that serves as a binding site for myosin light chains; Motor, a domain that mediates actin binding, ATP binding and hydrolysis, and force generation; MyTH4, a domain of unknown function in some myosin and kinesin tails; PDZ, a domain that mediates interactions with other proteins that contain a PDZ ligand sequence and that is thought to be important for targeting signalling molecules to sub-membranous sites; PST, a proline, serine, and threonine-rich region; SAM, a sterile -motif, a domain that is found in many signalling proteins and that is thought to be involved in proteinprotein interactions; SH3, a Src homology3 domain that is involved in proteinprotein interactions.
- 53 -
Radixin, an actin-binding protein, was detected at the taper of the hair cell stereocilium in the chick, frog, mouse and zebrafish (Pataky et al. 2004). Proteins of the ezrin/radixin/moesin (ERM) family crosslink actin filaments to plasma membranes and are involved in organizing the cortical cytoskeleton, especially in the formation of microvilli (Tsukita et al. 1999). So far, there are no reports of hair-bundle abnormalities associated with mutations of genes that encode ERM proteins. However, these proteins might interact with unconventional myosins VIIa or XVa that have FERM (ezrin, radixin, moesin) binding domains (Oliver et al. 1999) and are specifically expressed in hair cells (Hasson et al. 1997; Belyantseva et al. 2005) and have mutant allele products, known to disrupt formation of the hair bundle (Self et al. 1998; Probst et al. 1998). Another unconventional myosin, myosin VI, is also involved in stereocilium formation. Myosin VI is a backward-stepping actin-based motor that moves towards the pointed (minus) end of actin filaments (Wells et al. 1999). In humans, dominant and recessive mutations of MYO6 (which encodes myosin VI) can cause HL (Melchionda et al. 2001; Ahmed et al. 2003). In mammalian hair cells, myosin VI has not been
observed in stereocilia, but instead, is localized at the base of the hair bundle (Hasson et al. 1997), within the cuticular plate, a rigid platform to provide mechanical stability to the apex of the hair cell. The Snell's waltzer (sv) mouse is deaf and has no detectable myosin VI protein in any tissues (Avraham et al. 1995). Stereocilia of the Myo6sv/sv mouse are fused at their bases, (Fig 1.9c) indicating that myosin VI is required to tie the apical plasma membrane to the base of stereocilia and/or anchor stereocilia rootlets and when it is defective that membrane region becomes detached (Self et al. 1999; Altman et al. 2004). Ultrastructural studies show numerous links between the apical plasma
membrane and the actin network of the cuticular plate (Hirokawa and Tilney 1982), which might correspond to macromolecular complexes that contain myosin VI (Fig 1.8b). In addition to this potential anchoring function, the backward movement of myosin VI along the actin filaments might be essential for removing molecular components that are released by actin treadmilling at the taper of the stereocilium. ARRANGEMENT OF STEREOCILIA IN THE HAIR BUNDLE In the mammalian cochlea, stereocilia are arranged into precise V or W shaped arrays. It is thought that these configurations are stabilized by stereocilia rootlets that project into a densely organized cortical cytoskeleton, the cuticular plate, at the apex of the hair cell. The orientation and overall arrangement of the bundles indicate the
- 54 -
presence of a mechanism that stabilizes the overall orientation of the cuticular plate and hair bundle as an integrated complex. T his mechanism might involve myosin VIIa, which, anchored by vezatin to a cadherincatenins complex, could link the cortical cytoskeleton to the adhesion junctions between hair cells and neighboring supporting cells (Kussel-Andermann et al. 2000). Consistent with this hypothesis, mutations in myosin VIIa and a cadherin-related protein, cadherin 23, result in loss of the V/W configuration and disorientation of the bundle respectively (Self et al. 1999; Di Palma et al. 2001). The mouse mutant for MYO7A (Shaker 1) shows hair bundles in which groups of stereocilia are separated from each other at the hair cell apex and the kinocilium is misplaced (Fig 1.9d) suggesting an effect on maintenance of orientation and interstereociliary stabilization. PROGRAMMED ELONGATION OF STEREOCILIA The evolutionary conservation of a precise arrangement of stereocilia rows in a staircase-like pattern (Fig 1.9) indicates that this unique organization is required for mechanotransduction (Manley 2000). Mutations of MYO15A, which encodes
unconventional myosin XVa, cause DFNB3 as well as deafness and vestibular disorders in the shaker-2 mouse (Probst et al. 1998; Friedman et al. 1995; Wang et al. 1998). Hair cell stereocilia in homozygous shaker-2 mice are present and properly positioned, but are much shorter than wild-type stereocilia (Probst et al. 1998). In the shaker-2 mouse, all stereocilia within a bundle are approximately the same length and there is no staircase organization of the mature hair bundle (Fig 1.9e). Myosin XVa is discretely located at the tip of every stereocilium in wild-type auditory and vestibular hair cells, where it appears just before the staircase emerges, indicating that it is required for the elongation, formation and maintenance of the stereocilia-bundle staircase (Belyantseva et al. 2003b). Localization of myosin XVa to the extreme tips of stereocilia raises the possibility that it is tethered there by integral membrane proteins (Belyantseva et al. 2003a). Although the proteins that interact with myosin XVa are not known, it has two predicted FERM domains that could mediate interactions with ERM proteins. Perhaps more interestingly, myosin XVa has a PDZ ligand sequence that could interact with PDZ domain-containing proteins to coordinate a macromolecular complex at the tips of stereocilia. PDZ scaffold proteins serve as organizing centres of macromolecular
functional complexes (Harris and Lim 2001). One such PDZ protein, whirlin, has recently been described. Recessive mutations in WHRN and Whrn (which encode
- 55 -
whirlin) cause deafness in humans (DFNB31) and in whirler mice, respectively. Stereocilia of whirler mice are abnormally short and arrayed in a near-normal configuration on the apical hair cell surface (Mburu et al., 2003). The overall inner ear phenotype of whirler mice is strikingly similar to that of shaker-2 mice, raising the possibility that whirlin and myosin XVa interact physically within a macromolecular complex (Fig 1.8) that is responsible for programmed stereocilia elongation (Belyantseva et al. 2003b; Delpart et al. 2005). Whirlin also has a C-terminal PDZ ligand sequence that could interact with one of the PDZ domains of another whirlin protein to organize their multimerization into a higher-order structure (Frolenkov et al. 2004). STEREOCILIARY LINKS The stereocilia in an individual hair bundle are connected by a variety of fibrillar extracellular cross-links, the tip-links which are believed to be crucial in mechanotransduction (Pickles et al. 1984; Assad et al. 1991) and lateral links which connect the shaft of one stereocilium to its neighbors at different stages of the development of cochlear hair cells (Fig 1.8a). High-resolution imaging has suggested that the tip-link is formed of coiled filaments (Kachar et al. 2000). Myosin 1c localizes to the region near the upper
insertion point of the tip-link (on the shaft of the longer stereocilium) and is thought to be involved in an adaptation motor that closes the transduction channel when the stereocilium is exposed to a sustained excitatory deflection, thereby restoring sensitivity to further stimulation (Holt et al. 2002; Steyger et al. 1998). Myosin 7a may also play a role in controlling tip-link tension. Defects in myosin 7a cause a large decrease in the sensitivity of transduction channel opening to stereociliary deflection suggesting that in the absence of functional myosin 7a the channels are generally closed and that tension on the gating spring is significantly reduced (Kros et al. 2002). Shaft connectors may play a role in keeping the stereocilia spaced apart, fusion of stereocilia is frequently observed in the IHC hair bundles of Ptprq null mutant mice, also the stereocilia of the OHC bundles are shorter than those in age matched controls, suggesting inositol lipid phosphatase, Ptprq may be involved in the growth or resorption of stereocilia (Goodyear et al. 2003). At the base of stereocilium, myosin VIIa interacts with a novel transmembrane protein, vezatin, and could comprise part of an adhesion complex (Fig. 1.8) that is associated with ankle-links (Kussel-Andermann et al. 2000). Vezatin expression
- 56 -
diminishes as the mouse cochlear hair bundles mature; its expression therefore correlates fairly well the transient existence of the ankle links (Goodyear et al. 2005).
Fig 1.9 Drawings of an organ of Corti outer hair cell and stereocilia. Stereocilia are graded in height and range in length up to 10 m. The mammalian organ of Corti hair cell bundle has about 50 to 100 stereocilia. Panels A and B illustrate a wild-type outer hair cell and show tip links (arrow head) and points of abutment of adjacent stereocilia (arrow). Panels C, D, and E illustrate different abnormal morphologies of stereocilia from three different deaf strains of mice. C At P7 sv homozygotes deficient for myosin VI have stereocilia that are beginning to fuse with one another. D At P15 in homozygous shaker 1 mice (Myo7a6J) stereocilia are disorganized. E Homozygous shaker 2 mice expressing defective myosin XVA have numerous short stereocilia without tip links.
HAIR BUNDLE MORPHOGEENSIS AND MACROMOLECULAR COMPLEX OF USH1 PROTEINS

Mutant alleles of myosin VIIa (MYO7A) (Weil et al. 1995), harmonin (USH1C) (Bitner-Glindzicz et al. 2000; Verpy et al. 2000), cadherin 23 (CDH23) (Di Palma et al. 2001; Bork et al. 2001; Bolz et al. 2001), protocadherin 15 (PCDH15) (Ahmed et al. 2001; Alagramam et al. 2001) and SANS (Weil et al. 2003) had been found to underlie NSHL and USH1. There are corresponding mutant mouse models: shaker-1 (sh1) for myosin VIIa (Gibson et al. 1995; Self et al. 1998), deaf circler (dfcr) for harmonin (Johnson et al. 2003), waltzer (v) for cadherin23 (Di Palma et al. 2001, Wilson et al. 2001), Ames waltzer (av) for protocadherin 15 (Alagramam et al. 2001a, Raphael et al.
- 57 -
2001; Hampton et al. 2003) and Jackson shaker (js) for sans (Kikkawa et al. 2003). All these mutant phenotypes are characterized by deafness, vestibular dysfunction and similar morphological abnormalities in the development of hair bundles resulting in the disorganized, splayed stereocilia in homozygous mice. On the basis of similar mutant phenotypes, as well as in vitro protein-interaction studies, it had been suggested that the protein products of these genes form a macromolecular complex (Fig 1.8) that provides cohesiveness to the stereocilia bundles during bundle morphogenesis and some of them also thereafter in mature hair bundles (Boeda et al. 2002; Siemens et al. 2002; Weil et al. 2003; Frolenkov et al. 2004; Adato et al. 2005; Goodyear et al. 2005). Harmonin has PDZ domains (postsynaptic density, disc large, zonula occludens), modules known as organizers of submembranous protein complexes (Sheng and Sala 2001). Alternatively spliced USH1C transcripts (Verpy et al. 2000) predict at least 10 protein isoforms which can be grouped into three subclasses, referred to as harmonin a, b, and c, and collectively as harmonin (Fig. 1.8c). The similar spatiotemporal distributions of harmonin b (F-actin-bundling protein), cadherin 23 and myosin VIIa within the growing stereocilia, the direct interaction of harmonin with cadherin 23 and myosin VIIa and the absence of harmonin b, an F-actin binding isoform, from stereocilia in sh1 mouse mutants, made the bases to suggest that myosin VIIa is necessary for harmonin b targeting towards its stereocilia location, where harmonin b anchors cadherin 23 to the stereocilia actin core (Boeda et al. 2002, Frolenkov et al. 2004, Adato et al. 2005). This proposal is supported by the phenotypes of two recently characterized dfcr mouse mutants. Although one mutant dfcr is defective in all harmonin isoforms (a, b and c) and the other mutant dfcr 2J is defective only in harmonin b isoforms, both the mouse mutants exhibit the same hair bundle disorganization, also similar to the hair bundle phenotype observed in sh1 and v mutants (Johnson et al. 2003). Furthermore, second coiled coil region of harmonin b (CC2 domain) can bind to all the three harmonin isoforms groups through their PDZ1 and PDZ2 domains. PDZ1 domain of harmonin directly interacts with MyTH4 and FERM domains of myosin VIIa (Fig. 1.8) (Boeda et al. 2002; Siemens et al. 2002). Cadherin 23 and harmonin b concomitantly appear in the emerging stereocilia and disappear from the hair bundles of adult mice (Boeda et al. 2002; Lagziel et al. 2005). Similarly protocadherin 15 is detected all along the stereocilia as soon as these become distinguishable at the apical surface of hair cells (Ahmed et al. 2003). There can be possible interaction of
- 58 -
harmonins PDZ domain to the cytoplasmic tail of cadherin 23 and protocadherin 15. Cadherin 23 and protocadherin 15 are, therefore, good candidates for proteins of which stereociliary lateral links that are anchored to the actin core by harmonin b are formed (Boeda et al. 2002; Lagziel et al. 2005; Ahmed et al. 2003). Protocadherin 15 is also expressed in mature IHC and OHC bundles and may play a role in the development or maintenance of the stereociliary cross links that persist till maturity (Ahmed et al., 2003). Study of the distribution of sans in the mouse inner ear during hair bundle differentiation showed that sans is absent from the hair bundle (Adato et al. 2005), unlike all other USH1 proteins which are present in the growing stereocilia (Johnson et al. 2003; Boeda et al. 2002; Ahmed et al. 2003; Lagziel et al. 2005). However, like myosin VIIa, harmonin and protocadherin 15, sans is concentrated beneath the stereocilia, in the apical part of inner ear hair cells bodies (Fig. 1.8) (Hasson et al. 1997; Boeda et al. 2002; Adato et al. 2005). Sans is a putative scaffolding protein containing three ankyrin (ANK) repeats, a SAM domain and a C-terminal class I PDZ-binding consensus motif (Weil et al. 2003; Kikkawa et al. 2003). Sans molecules can form homomers through their central region, and that sans directly interacts with the MyTH4FERM domains of myosin VIIa and with harmonins PDZ1 and/or PDZ3 domains via its central and SAM domains, respectively (Fig. 1.8c). Based on sans sub-cellular localization and on its molecular interactions with myosin VIIa and/or harmonin, as well as on the Jackson shaker (js) phenotype, it is proposed that sans may directly or indirectly regulate the trafficking of USH1 proteins in their route to the stereocilia and contributes to the hair bundle cohesion via an activity exerted underneath the hair bundle (Adato et al. 2005). At least some hair-bundle adhesion complexes seem to be linked by unconventional myosin VIIa to the actin core at sites of links between stereocilia (Fig 1.8b). At the lateral surface, myosin VIIa probably links USH1 macromolecular
complexes to the actin filaments during hair-bundle maturation (Weil et al. 2003; Boeda et al. 2002; Siemens et al. 2002). At the base of the stereocilium, myosin VIIa interacts with vezatin, and could comprise part of an adhesion complex (Fig. 1.8b) that is associated with ankle-links (Kussel-Andermann et al. 2000). The emerging picture of proteins interactions reveals that every USH1 protein can bind to at least one other USH1 protein. Harmonin and SANS plays a pivital role in USH1 proteins network and thus might act as cytoplasmic scaffold organizer of proteins that are involved in maintaining the molecular architecture of stereocilia during hair cell
- 59 -
growth and differentiation. However, the crucial role of any of the USH1 proteins in the cohesion of adult hair bundle is yet unknown (Frolenkov et al. 2004; Adato et al. 2005).
SUPPORTING CELLS
The supporting cells posses a fairly extensive cytoskeletal system that is particularly well developed in the supporting cells of the organ of Corti, thus provide mechanical support to the epithelium and the hair cells. In the apical cytoplasm, there are cytoskeletal assemblies containing the -form of actin and intermediate filaments, cytoskeletal proteins, mainly several different isotypes of cytokeratins and vimentin. Vimentin provides rigidity; its presence in supporting cells may be a reflection of the role in providing a rigid structural support to hair cells that these cells play (Kuijpers et al. 1991; Schulte et al.1989). Supporting cells are coupled to each other by large numbers of gap junctions which are sites of direct communication between adjacent cells where clusters of channels in the membrane of one cell are in direct register with clusters of channels in the membrane of its neighbour to form continuous aqueous pores connecting the cytoplasms of the adjacent cells (Forge et al. 1999; Kikuchi et al. 1995). The protein sub-units that form gap junction channels are members of the connexin protein family. At least 20 different types, or isoforms, of connexin have been identified. The gap junctions on the organ of Corti and in vestibular sensory epithelia in mammals contain two connexin isoforms, cx26 and cx30. Mutations in the genes for at least three different connexins, connexin 26 (Cx26), Cx30 and Cx31, have been identified as causes of hereditary sensorineural HL. Mutations in the Cx26 gene are the most common cause of nonsyndromic hereditary deafness. However, connexin mutations do not appear to cause balance dysfunction. One role for supporting cells is thought to be to remove K+ ions from the intercellular spaces of the sensory epithelium as they flow through hair cells and thereby maintain the low K+ environment around the body of the hair cell necessary for transduction and sensitivity to stimulation.
+
It has been proposed that the gap
junctions provide a means to ferry the K away preventing local accumulation.
THE BASILAR MEMBRANE

The basilar membrane, upon which the organ of Corti sits, is a sheet of predominantly extracellular matrix structure composed of filaments within a ground
- 60 -
substance (Slepecky et al. 1996). The fibrils of the basilar membrane run predominantly radially, and are composed of collagen, mostly collagen type IV 1-5 chains (Cosgrove et al. 1996b). In addition, fibronectin and laminin type 11, adhesive-type molecules common to extracellular matrices are localized to the basilar membrane and presumably compose the ground substance in which the collagen fibrils reside (Cosgrove et al. 1996a; Rodgers et al. 2001). A novel extracellular matrix protein-usherin has been identified through the genetic mutation that is associated with Ushers syndrome type IIa, in which there is high frequency HL (Bhattacharya et al. 2002). Mutations in the genes for the proteins composing the basilar membrane might be expected to affect the mechanical responses of the organ of Corti in response to sound and thereby cause hearing impairment. X-linked Alports syndrome has been attributed to mutations in the gene for the COL4A5 gene (Harvey et al. 2001). It has been suggested that the loss of this protein from the basilar membrane affects the ability to create tension through interactions with the tension fibrocytes in the cochlear lateral wall resulting in the high frequency HL associated with this condition.
TECTORIAL MEMBRANE
The tectorial membrane is a structured sheet of extracellular matrix material that overlies the auditory neuroepithelium organ of Corti and deflects hair bundles in response to sound. The body of the tectorial membrane is formed of fibre bundles running approximately radially, embedded within a matrix composed of striated sheets formed of fine cross-linked fibrils (Hasko et al. 1988). The fibre bundles are formed of collagen types II, V and IX which are different types from those in the basilar membrane (Richardson et al. 1987; Richardson et al. 1992). Associated with the
collagen bundles is a glycoprotein unique to the inner ear, otogelin (Cohen-Salmon et al. 1997), defects in which result in the Twister mouse phenotype (Simmler et al. 2000). The matrix of the tectorial membrane also is composed of glycoproteins that are unique to the inner ear, and tectorin (Legan et al. 1997; 2000). Consequently, mutations in the genes for these proteins are associated with NSHL in humans (Cohen-Salmon et al. 1997; Verhoeven et al. 1998).
STRIA VASCULARIS
The stria vascularis lines the lateral wall of the scala media. It is responsible for the production and maintenance of both the high endolymphatic K+ concentration and the
- 61 -
endocochlear potential. The marginal cells of the stria vascularis and vestibular dark cells are primarily involved with the transport of K+. Their basolateral membranes are extensively infolded, enclosing numerous large mitochondria and they contain high levels of Na+/K+-ATPase, both and isoforms, which transport K+ into the cell in exchange for Na+. The infoldings provide a large surface area over which ion exchange can occur and the numerous large mitochondria enclosed within them provides the energy source (ATP) for the active ion transport. The basolateral membranes contain in addition a Na+/K+/Cl--co-transporter (NKCC1) that transports the three ions into the cell (Crouch et al. 1997). The uptake of Na+ enhances ATPase activity by stimulating the outward transport of Na+ and, thus, the inward transport of K+. The apical membranes of the marginal cells and the dark cells contain a K+ channel, which is formed of two subunits, the KCNE1 regulatory protein and the KCNQ1 channel proteins (these subunits were formally named IsK and KvQLT1, respectively). This channel provides the pathway through which K+ is secreted into endolymph (Sunose et al, 1997). Mutations in the KCNE1 gene disrupt endolymph production leading, in the cochlea, to collapse of Reissners membrane and deafness, and in the vestibular system to collapse of the epithelia of the roof of the utricle, saccule and ampullae and shaker/waltzer-type behaviors in mice indicating dysfunction of the vestibular sensory organs. Recessive mutations can in these genes are known to cause Jervell and Lange-Nielsen syndrome.
CONCLUSION
Several developmental themes have emerged from the identification of genes that are required for the morphogenesis of the hair cell bundle. Hair cells have adapted integrated mechanisms of cell-to-cell adhesion and intracellular motility to generate their precisely organized hair bundles. However, it is clear that there are still crucial genes and pathways that remain to be determined, indicating that the genetic investigation of hair-bundle morphogenesis is incomplete. It is prudent to continue positional cloning of genes that underlie hearing or balance disorders in humans and mice, especially genes that are expressed at low levels that elude detection by other screening methods. An integrated approach should be followed to encompass a comprehensive understanding of hair-bundle morphogenesis and insights into the pathogenesis of HL and balance disorders, as well as strategies for their prevention and treatment.
- 62 -
SECTION-III
LINKAGE ANALYSIS-A TOOL FOR MAPPING DISEASE CAUSING GENES
- 63 -
The human genome is very large and complex containing thousands of genes. Therefore, finding a particular gene or genes responsible for any human disease has always been tricky, literally like finding a needle in a haystack. Traditionally, the search for a disease gene begins with linkage analysis. Linkage analysis is a technique of developing a relationship between the loci; i.e. two loci on the same chromosome are said to be linked if the phenomenon of crossing over does not separate them. Actually at the stage of meiosis homologous chromosomes exchange segments as the basis for crossing over or recombination. The original arrangements of alleles on the two
chromosomes are called the parental combinations whereas the new combinations that are formed due to crossing over are known as recombinants (Fig 1.10). If two loci are physically close to each other on the same chromosome then there are rare chances that they will be separated by a recombination event. Sets of alleles for different markers or genes on the same chromosome are termed as haplotypes. Alleles on the same haplotype are passed on in pedigrees as a block. These blocks are only broken by a cross over. The term linkage refers to the loci, not to specific alleles at these loci. The most common application of linkage analysis is to try and find the location, in the genome, for a gene responsible for a certain mendelianly-inherited disease (Ott 1991).
Fig 1.10 Recombination event
- 64 -
RECOMBINATION FRACTION REFLECTS GENETIC DISTANCE

Alleles at loci on same chromosome for different genes co-segregate at a rate that is associated to the physical distance between them on the chromosome. This rate is the probability or recombination fraction (), of a recombination event occurring between two loci. Two loci are said to be genetically linked when recombination fraction is less than 0.5. One of these loci is the disease locus while the other is a polymorphic marker like micro satellite repeats (Strachan and Read, 1996). The recombination fraction ranges from = 0 for loci right next to each other through = 0.5 for loci apart (or on different chromosomes), so that it can be taken as a measure of the genetic distance or map distance between gene loci. Two loci which show 1% recombination are defined as being 1 centiMorgan (cM) apart on the genetic map. And a genetic distance of 1 cM represents 0.9 Mbp on the sex averaged physical map (Foroud, 1997).
SCORE METHOD
When parametric linkage analysis methods are used, a quantity known as lod score (logarithm of the odds) is typically calculated. The score provides the strength of evidence in favour of linkage. Log10 X Probability of the data if disease and marker are linked Lod score = Probability of data if disease and marker are unlinked
In a lod score calculation the numerator is the probability of data in the family if the disease and marker are linked and therefore not segregating independently and the denominator is the probability if the disease and the marker are unlinked and therefore segregating independently (null hypothesis). If the marker and the disease gene are unlinked then the numerator is no more than the denominator and the ratio will be less than or equal to 1. However, when the marker and the disease gene are linked, the numerator will be greater than the denominator and the ratio will be greater than 1. A score of +3 or a positive score is an indication of linkage while a score of 2 or a negative score denotes absence of linkage. programs (Ott, 1991; Terwillger and Ott, 1994). It is carried out by various computer
MULTIPOINT MAPPING
Linkage analysis can be more efficient if the data for more than two loci are analysed simultaneously. Multipoint mapping is particularly useful for finding the
chromosomal order of a set of linked markers. Usually the starting point in mapping a
- 65 -
disease locus is to find a two point score which gives linkage between a specific marker and a disease locus. A multipoint score is calculated to find the location of disease gene between two or more markers.
DNA POLYMORPHISM AS A TOOL FOR LINKAGE ANALYSIS

It is necessary to have polymorphic markers, which can be checked for inheritance with the disease locus in question for linkage analysis. Genotyping is carried out by a genetic marker defined as an observable polymorphism within the population. Prior to 1960s a limited source of genetic markers was obtained from blood group antigens (Conneally and Rivas, 1980). After 1980s restriction fragment length
polymorphism (RFLPs) were introduced as a new class of genetic markers (Botstein et al. 1980). The RFLPs detect genome sequence differences that results in the presence or absence of a restriction enzyme cutting site. Subsequently, variable number of tandem repeats (VNTRs) and short tandem repeat polymorphisms (STRPs) were identified as a new source for genetic markers; furthermore after publishing of human draft sequences single necleotide polymorphisms (SNPs) were also recognized as a major tool for linkage mapping. The most useful class of polymorphisms for the purpose of fine genetic mapping are STRPs and SNPs which can be analysed either by PCR or array. The main advantage of STRPs and SNPs is there ubiquitous presence across the genome and a small amount of DNA is required for analysis as compared to RFLPs or VNTRs. Moreover RFLP and VNTR analysis are not commonly performed since they are laborious techniques involving restriction enzyme digestion and the subsequent performance and anlysis of southern blots. The short tandem repeat polymorphisms are also known as microsatellite and have revolutionised the world of genotyping. STRPs are hyper variable tandem
sequence repeats, which consist of di-tri-, or tetra-nucleotide repeats. The most widely used STRPs for genotyping are the simple (CA)n and (GT)n dinucleotide repeats. The (CA)n repeats are extremely abundant and can be found, on average, once every 30-60 kb. (CA)n repeats are generally polymorphic if the repeat length is greater than 10. By isolating and sequencing DNA fragments containing the microsatellite, PCR primers that flanked the STRPs can be created and used to amplify it.
- 66 -
CHAPTER-II
- 67 -
To study the genetic and molecular basis of hereditary deafness, the work plan can be essentially divided into two phases which are further sub divided as depicted below:
Study of the Genetic and Molecular Basis of Hereditary Deafness
Field Work Approval of study from IRB at CEMB & NINDS/NIDCD Identification of families with three or more deafness affected individuals Enrollment of identified families and collection of blood samples Clinical evaluation of enrolled families
Bench Work DNA extraction Genotyping & Linkage analysis for known DFNB loci Genome Wide Scan of Unlinked families Sequencing of genes
FIELD WORK
INSTITUTIONAL REVIEW BOARD (IRB)
Approval for this study was obtained from the Institutional Review Board (IRB) at the National Centre of Excellence in Molecular Biology, Lahore, Pakistan (FWA00001758) and the NINDS/NIDCD IRB at the National Institutes of Health, USA (OH-93-N-016). Informed consent document had been designed containing facts, risks, and discomforts that might be expected to influence an individuals decision to willingly participate as a volunteer in a research project.
IDENTIFICATION AND ENROLLMENT OF FAMILIES

Families segregating sensorineural HL (either syndromic or nonsyndromic) with three or more deafness affected individuals were identified through special education schools and centre present in different cities of Pakistan. Principals were contacted and briefed about the research program on deafness and a specially designed performa in Urdu was provided to them in order to obtain information about the history of deafness and number of affected in the family of each student. Families were visited and multiple family members were interviewed for confirmation of consanguineous sibships and pedigree drawing. Once the recessive mode of inheritance of deafness is evident from the family structure, blood samples from all participants were obtained after proper signing of informed consent. If a family had other affected relatives with HL, they were also included in the study depending upon their willingness and availability. Detailed
- 68 -
history was taken from each family by questioning about skin pigmentation, hair pigmentation, problems relating to balance, vision, night blindness, thyroid, kidneys, diabetes, heart, and infectious diseases like meningitis, antibiotic usage, injury, and typhoid, to minimize the presence of enviormental causes and to have a detailed view of syndromic nature of the familiy, if any. CYRILLIC 3.1 and Macromedia FreeHand MX Softwares were used to draw pedigrees structures of the enrolled families.
CLINICAL EVALUATION
Detailed clinical histories were obtained for all of the individuals of the enrolled families to investigate the presence of other clinical abnormalities segregating with deafness and environmental causes for HL. Families were questioned regarding skin pigmentation, hair pigmentation, and problems relating to balance, vision, night blindness, thyroid, kidneys, heart, diabetes, and infectious diseases like meningitis, typhoid, mumps, rubella, injury, chronic otitis media and, antibiotic/ototoxic drug usage. Parents as well as other members of the family were asked about the onset of deafness for each affected individual to confirm that deafness was congenital. Pure tone
audiometry tests for air and bone conduction were performed at frequencies 250 to 8,000 Hz on many affected and unaffected members of these families. Ocular funduscopy and electroretinography (ERG) was performed to detect the presence of retinopathy. Vestibular function was evaluated by testing tandem gait ability, Romberg test, and Electronystagmography Test (ENG) while goiter was observed physically in case of Pendred syndrome. AUDIOLOGICAL EVALUAION AUDIOMETRY Audiometry is a method used to determine the degree of HL as it provides means to classify deafness according to the scale of severity shown in Fig 2.1 (Mazeas and Bourguet 1975). Hearing sensitivity using air borne pure tones and bone conducted pure tones were measured by Siemens SD 28 Audiometer. Audiometric studies were carried out on deaf individuals and their normal hearing relatives. The results of representative audiograms from an affected individual and normal individual are presented in Fig 2.2. The affected individuals of all the families included in the present study had severe to profound HL at sound frequencies from 250 Hz to 8000 Hz. Normal individuals had hearing 25-30 dB from 250 Hz to 8000 Hz, which is considered as normal hearing.
- 69 -
1. THRESHOLD SENSITIVITY USING AIR BORNE PURE TONES Threshold sensitivity was measured by using right and left earphones, allowing each ear to be examined independently. Tones were reduced in intensity until a just detectable threshold of hearing was determined. This was repeated at frequencies from 250 to 8000 Hz within the audible range and the results were plotted as an audiogram. The shape of the curve is a measure of the frequency sensitivity of both the middle and inner ear. To differentiate between the middle ear (conductive) and inner ear
(sensorineural) components, additional tests were conducted. 2. THRESHOLD SENSITIVITY USING BONE CONDUCTED PURE TONES In this method, testing was done by means of a vibrator which was placed somewhere on the skull, usually the mastoid bone. The testing and plotting procedures were same as with air conduction testing. Sound at various frequencies and sound pressure leads directly to the cochlea via bone conduction bypassing the middle ear. Audiograms obtained using bone and air conducted sounds provide information about the integrity of both the middle and inner ears. TYMPANOMETRY Tympanometry, a method to measure mobility and compliance of the tympanic membrane which provides information about the function of the middle ear including the tympanic membrane, ossicles and the eustachian tube. The instrument used is known as tympanometer. OTOACOUSTIC EMISSION (OAE) Otoacoustic emissions are widely used in human and animals to study the cochlear function. The origin of OAE is ascribed to the process associated with the mechanical motion of the outer hair cells. Thus the OAEs are the sounds that the activity of the outer hair cell generate and can be measured with a microphone. A probe
containing both a speaker and a microphone is sealed in the ear canal and a stimulus (sound of two different frequencies) is provided to the ear and the emissions produced by the outer hair cell in response to the stimulus are recorded.
- 70 -
Fig 2.1 Showing the Severity of Hearing Loss.
Fig 2.2 Representative audiogram showing a normal hearing and a profound hearing loss.
- 71 -
VESTIBULAR EVALUATION Body orientation is controlled by the vestibular system, which consists of three semi-circular canals, the utricle and saccule. Each of these semi-circular canals lie automatically in a different plane. Each plane is at a right angle to the other and deals with different movement up and down, side-to-side and tilting from one side to the other. As the head moves, hair cells in the semicircular canals send nerve impulses to the brain by way of the vestibular portion of the acoustic nerve. Vestibular testing is used to determine the vestibular apparatus of the inner ear. In this regard, tandem gait ability, Romberg test, and ENG test are usually performed on the affected individuals. ROMBERG AND TANDEM GAIT TEST The Romberg test is a physical examination in which the patient is asked to stand with their feet together (touching each other) and to close their eyes. Observer should remains close to the patient, if the patient begins to fall. With closed eyes, visual input is removed and instability can be apparent. If there is a more severe vestibular lesion, or a midline cerebellar lesion, the patient will be unable to maintain this position even with their eyes open and may fall (Blumenfeld, 2001). In case of tandem gait test, the patient is asked to walk with their hand attached with the body, each foot has to place adjacent with the other foot and have to walk. If there is any problem with in the vestibular system, the person can not walk properly. ELECTRONYSTAGMOGRAPHY TEST (ENG) Electronystagmography (ENG) is another clinical test used to evaluate patients with dizziness and balance problems. It is a graphic recording of eye movements. ENG consists of an oculomotor evaluation, positioning testing, and caloric stimulation of the vestibular system. Comparison of results obtained from various subtests of ENG tests assist in determining whether a disorder is central or peripheral. In peripheral vestibular disorders, the lesion can be inferred from results of caloric stimulation and, to some degree, from positional findings (Levy and Arts 1996). RETINITIS PIGMENTOSA Retinitis pigmentosa is a progressive retinal degeneration (Fig 2.3) that begins with loss of peripheral vision and night blindness, and often leads to total blindness in later life. Two tests were performed on the affected individuals of each family for the diagnosis of retinitis pigmentosa.
- 72 -
FUNDUSCOPY OR OPTHALMOSCOPY An ophthalmoscope or slit lamp is used to examine the retina, optic disc, choroids, and blood vessels. Ophthalmoscopy is performed by dilating the pupils for obtaining the best view inside the eye. An ophthalmoscope is an instrument that gives a wide-field view of the sensory portion of vitreous and retina. A light source is directed into the eye by an adjustable mirror and the reflected light is gathered by a condensing lens to form a virtual inverted image of the retina. Opthalmoscopy of the retina in individuals with advanced RP is characterized by the presence of intra retinal clumps of black pigment, markedly attenuated retinal vessels, loss of retinal pigment epithelium (RPE), and pallor of the optic nerve (Fig 2.3). These changes reflect long-standing retinal degeneration and need not be present to make the diagnosis of RP. The fundus findings are, however, instrumental in distinguishing RP from other retinal dystrophies that have similar clinical findings but distinctive retinal changes. ELECTRORETINOGRAM TEST (ERG) Electroretinogram (ERG) is considered the gold standard and the most decisive diagnostic test for RP because it provides an objective measure of rod and cone function across the retina. The ERG measures the retinal response to a stimulus of light using a corneal electrode and neutral electrodes placed on the skin around the eye. The corneal electrode is placed gently behind the lower eyelid and contacts the cornea. A flash of light is shown to the patient and the electrodes record the retinal potentials, which develop as a response to the flash. The ERG is usually abnormal in infancy or early childhood, except for some of the very mild and regional forms of RP. This diagnostic procedure is also useful in distinguishing between a variety of retinal disorders such as cone or rod dystrophy and retinitis pigmentosa.
- 73 -
Fig 2.3 Picture of normal human retina and retina with retinitis pigmentosa.
- 74 -
BENCH WORK
DNA EXTRACTION
FROM BLOOD SAMPLES White blood cells (WBC) are the only nucleated cell present in the blood and an easily source to extract genmomic DNA of individuals. Genomic DNA was extracted from the blood samples following a non-organic method (Grimberg et al 1989) as under: Ten milliliters of venous blood samples were collected in 50 ml Sterilin falcon tubes containing 400 l of 0.5 M EDTA. Till the commencement of DNA extraction, blood samples were kept frozen either at -70C for 20-30 min or at -20C for long term storage. Blood samples were thawed for the red blood cells (RBC) lyses. 35 ml of TE buffer (10 mM Tris HCl, 2 mM EDTA, pH 8.0) was added for washing of blood samples. Samples were centrifuged at 3000 rpm for 20 min and supernatant was
discarded to wash out the lysed RBC. Washing was repeated for three to four times till the WBC pellet is free of hemoglobin. Digestion of proteins in the pellets of WBC was carried out by adding 0.5 mg of proteinase K along with 200 l of 10% SDS in the presence of 6 ml TNE buffer (10 mM Tris HCl, 2 mM EDTA, 400 mM NaCl). Samples were left overnight in an incubating shaker at a temperature of 37oC and a speed of 250 rpm. Proteins were precipitated by adding 1ml of super saturated NaCl, followed by vigorous shaking and chilling on ice for 15 min before centrifugation at 2400 rpm. Supernatant is shifted to another Sterilin falcon tube and DNA was extracted from the supernatant by adding equal volume of Isopropanol. After washing the DNA pellet with 70% ethanol, DNA was dissolved in TE buffer (10 mM Tris HCl, 0.2 mM EDTA) and heated at 70oC in a water bath for 1 h to inactivate any remaining nucleases. Further the DNA was kept at -20C for long storage. FROM BUCCAL SWABS In case of elderly people or very young children where it was difficult to obtain blood sample buccal swabs were collected, as it is simple and noninvasive technique for obtaining buccal cell DNA. Cheek cells were obtained by means of MasterAmpTM Buccal Swab Brushes (EPICENTRE Biotechnologies WI, Medical Package Cooperation, CA, USA). Subjects were asked to refrain from smoking, drinking, or eating for 1 h before sample collection to reduce the possibility that food particles or other
- 75 -
exogenous materials would compromise the sample and they were instructed to thoroughly rinse their mouth with water. Two swabs were taken from an individual by swirling each brush firmly on the oral mucosa for 30 sec, air dried and then stored in the original packaging at room temperature. DNA was extracted from these buccal cells using MasterAmpTM DNA Extraction Solution from EPICENTRE Biotechnologies (Walker et al. 1999). 1) 500l of the MasterAmpTM DNA Extraction Solution was added into an appropriate number of 1.5 ml ependroff tubes and placed them on ice 2) Buccal brush was placed into a tube containing DNA extraction solution and was rotated a minimum of 20 times. The brush was pressed against the side of the tube and rotated while removing it from the tube to ensure most of the liquid remains in the tube. 3) The cap was closed on the tube tightly, vortex for 10 seconds and was incubated at 60C for 30 minutes. 4) Vortex mixed for 15 seconds. The tube was transferred to 98C and incubated for 8 minutes. 5) Vortex mixed for 15 seconds. The tube was returned to 98C and incubated for an additional 8 minutes. Again vortex mixed for 15 seconds. 6) Chilled the tube on ice briefly to reduce the temperature and cellular debris was pellet down by centrifugation at 4C for 5 minutes at 14000 rpm. 7) The supernatant containing the DNA was transferred carefully to a sterilized properly labeled screw tube without including any of the beads. 8) The yields of the DNA are usually 2-8 ng/l and were kept at -20C, or at 70C for longer term storage. PREPARATION OF REPLICA PLATES Concentration of the DNA was obtained by measuring the optical density (OD) at 260 nm and 280 nm. DNA was diluted in low TE Buffer (10 mM Tris HCl pH 8.0, 0.1 mM EDTA) and working DNA dilutions concentration were kept at 25 ng/l and 100 ng/l for single marker and multiplex PCR amplification, respectively. For the purpose of automated fluorescent genotyping; initially a 96 well master plate was designed and DNA samples of set of particular families were assigned to each of the wells. Plate map was designed that consist of at least 3 affected with a parent and normal sibling from each family. Replicates of the designed master plate were made with 50ng of DNA for
- 76 -
exclusion studies and 200ng for genome wide scan dispensed into each well overlaid with a 10 l mineral oil.
LINKAGE ANALYSIS FOR ALREADY REPORTED DFNB LOCI

Three or four short tandem repeat (STR) markers were genotyped for all the known recessive deafness loci (Table 1.1) as preliminary exclusion studies. DNA
templates were amplified by PCR; using fluorescently labeled primers (forward primers labeled with one of the fluorescent dyes, FAM, NED, VIC). The markers used for linkage analysis encompassed the chromosomal locations as mentioned by hereditary hearing loss homepage (http://dnalab-www.uia.ac.be/dnalab/hhh) and were obtained commercially from either Applied Biosystems (ABI) or Integrated DNA Technologies (IDT). The labeling dyes of the primers were assigned in a manner that a single locus could be pooled at one time. GENOTYPING BY USING POLYMERASE CHAIN REACTION (PCR) AND STR MARKERS PCR fragments were amplified from 50ng of genomic DNA in 10 l reaction using replica plates. REACTION MIXTURE FOR AMPLIFICATION OF STR MARKERS Ingredients Genomic DNA Primer Forward Reverse dNTPs (dATP, dTTP, dCTP, dGTP) 200M PCR Buffer* Taq Polymerase dH2O 1X 0.5 units 1.25 mM 10X 2 units/l 0.8 l 1 l 0.05 l q.s to 10 l Final 50 ng 2.4 pM 2.4 pM Conc.Stock 25 ng/l 8.0 pM 8.0 pM Required 2 l 0.3 l 0.3 l
* 10X PCR buffer (100 mM Tris HCl pH 8.4, 500 mM KCl, 15-25 mM MgCl2 and 1% Triton) The microsatellite markers were amplified on an ABI 2700 or ABI 9700 thermocycler. The thermo cycling programs used for amplification of single markers were touch down programs of either 67C57C or 64C54C and for amplification
- 77 -
of primers in form a multiplex annealing of 54C along with extension of 2 min was used as shown in Fig 2.4.
1 Hld.
96 C 4.00 Min
. . . . . . . . . . . .
3 Tmp
10 Cycles
95 C 0.45 Sec
67 C 0.45 Sec
72 C 1.00 Min
. 3 Tmp . . 95 C . . . 0.45 . . . Sec . .
30 Cycles
57 C 0.45 Sec
30 Cycles
72 C 1.00 Min
. . . . . . . . . . .
2 Hld.
72 C 10.0 Min
25 C
1 Hld.
96 C 4.00 Min
. . . . . . . . . . . .
3 Tmp
10 Cycles
95 C 0.45 Sec
64 C 0.45 Sec
72 C 1.00 Min
. 3 Tmp . . . 95 C . . . 0.45 . . . Sec .
54 C 0.45 Sec
72 C 1.00 Min
. . . . . . . . . . . .
2 Hld.
72 C 10.0 Min
25 C
1 Hld.
95 C 5.00 Min
. . . . . . . . . . . .
3 Tmp
36 Cycles
94 C 0.30 Sec
54 C 0.30 Sec
65 C 2.00 Min
. 2 Hld. . . . 70 C . . . . 10.0 . . Min .
25 C
Fig 2.4s Thermocycling profiles used for the amplification of markers. A. Thermocycler programme touch down 67C57C, B. Thermocycler programme, touch down 64C54C, C. Thermocycler programme for amplifying multiplex PCR reaction.
GENOME WIDE SCAN

Selected families which remained unlinked to known DFNB loci were subjected to genome wide search. Genome wide scan was carried out with ABI PRISM Linkage Mapping Set version 2.5 MD10 having 411 microsatellite markers (28 panels) spaced at ~10 cM intervals across the whole human genome (Fig 3.2), to map new loci on families which remained unlinked to known loci. Multiplex PCR were standardized for the 388 markers of first 27 panels (covering autosomes) by dividing them into appropriate sets by taking in account their dyes and sizes of amplified products (Table 2.1). PCR fragments were amplified from 200 ng of genomic DNA in 5l reaction containing 0.04-0.08 pM of each primer, 200M of dATP, dTTP, dCTP and dGTP, 0.8 units of Taq polymerase, .0.5 l of 10 X PCR reaction buffer (750 mM KCl; 100 mM Tris HCl PH: 8.3. 25 mM MgCl2) and 10l overlay of mineral oil. PCR cycle is same as above (Fig 2.4C).
- 78 -
Set A B C Set A B Set A B C Set A B Set A B Set A B C Set A B C Set A B Set A B Set A B C Set A B C Set A B C D Set A B Set A B
PANEL 1 D1S2797, D1S2800, D1S234, D1S255, D1S2785, D1S2890, D1S484 D1S2878, D1S206, D1S2842, D1S2726 D1S249, D1S450, D1S2667, D1S196, D1S2836 PANEL 2 D1S207 (0.15), D1S413 (0.15), D1S2866, D1S438, D1S2841D1S2697, D1S468, D1S498 D1S199, D1S252, D1S230, D1S214, D1S218, D1S425 PANEL 3 D2S286, D2S165, D2S160, D2S2211, D2S367, D2S125, D2S325, D2S337 D2S2333, D2S126, D2S364 D2S206, D2S117, D2S142 PANEL 4 D2S319, D2S2382, D2S335, D2S162, D2S338 D2S112, D2S2330, D2S2216, D2S347, D2S2259, D2S168, D2S151, D2S2368, D2S391, D2S396, D2S305 PANEL 5 D4S392, D3S1311, D3S1565, D4S1575, D4S405, D4S1534, D3S1263, D3S1285, D4S1597 D3S1271 (0.075), D3S3681 (0.075), D4S406 (0.15), D4S414, D3S1614 PANEL 6 D4S2935, D3S1304, D3S1601, D4S415 D3S1262, D4S1572, D4S413, D4S426, D4S391 D3S1569, D3S1300, D4S1592, D3S1292, D3S1297, D4S419 PANEL 7 D3S1289, D3S1277, D4S1539, D4S403, D3S12179, D4S102, D3S1266 D3S1580, D3S2338, D4S2964, D4S412 D4S424, D3S1278, D3S1267, D3S1566, D4S1535 PANEL 8 D5S407 (0.15), D6S281 (0.15), D5S406, D5S400, D5S422, D5S433, D5S419, D5S644, D6S422, D6S289, D5S424 D6S1581 (0.1), D6S262, D6S309, D5S406 PANEL 9 D6S264, D6S276, D5S408, D6S308, D6S434, D5S1981, D6S257, D5S641 D6S1574, D6S287, D6S292, D5S426, D6S446 PANEL 10 D5S436, D6S462, D5S2115, D5S630, D6S470, D6S441, D5S647 D5S2027, D6S460, D5S428, D5S471 D5S410, D5S418, D5S416 PANEL 11 D7S530 (0.15), D7S517 (0.15), D7S484, D8S264, D8S549, D8S258, D7S669 D7S516 (0.15), D7S510 (0.15), D8S272, D7S502, D7S630, D7S640, D7S513, D8S514, D7S657 D8S260, D8S1784, D7S2465, D8S1771 PANEL 12 D7S507, D7S515, D7S486, D7S519, D7S661, D8S277 D8S284, D7S684, D8S270 D7S798, D8S505, D7S636 D7S493, D8S550, D7S531, D8S285 PANEL 13 D11S937, D11S935, D9S1677, D11S902, D11S904, D10S547, D11S905, D10S249, D9S171, D9S273, D10S192 D11S4175, D9S285, D11S987, D11S1314 PANEL 14 D10S197, D10S1653, D9S161, D11S901, D10S1686 D10S185, D9S175, D10S212, D9S287, D9S1597, D9S167, D9S288
Amount 0.1l 0.1l 0.1l Amount 0.1l 0.1l Amount 0.1l 0.1l 0.15l Amount 0.1l 0.1l Amount 0.1l 0.1l Amount 0.1l 0.1l 0.1l Amount 0.1l 0.1l 0.1l Amount 0.1l 0.15l Amount 0.1l 0.1l Amount 0.1l 0.15l 0.15l Amount 0.1l 0.1l 0.15l Amount 0.1l 0.1l 0.1l 0.1l Amount 0.1l 0.1l Amount 0.15l 0.15l
- 79 -
Set A B Set A B C Set A B Set A B Set A B Set A B Set A B Set A B C Set A B Set A B Set A B Set A B SM Set A
PANEL 15 D9S286, D9S1690, D11S1320, D11S968, D9S1776, D11S1338, D10S591, D10S587, D10S189 D9S164, D11S4151, D11S4191, D10S537, D11S925 PANEL 16 D10S548, D9S1826, D9S1682, D11S908, D10S1693, D9S290 (0.2), D10S597 (O.2), D10S1652 (0.2) D11S898, D10S196, D10S217, D9S283 (0.15), D10S165 (0.15) D9S1817, D9S158 PANEL 17 D13S218, D12S78, D13S217, D12S1659, D12S1723, D13S175, D12S346, D12S1617 D12S83, D13S285, D13S170, D13S263 PANEL 18 D12S85, D12S351, D12S368, D13S1265, D12S79 D12S345, D12S99, D12S87, D13S156, D12S336 PANEL 19 D13S158, D13S173, D12S364, D12S352, D12S326, D13S171, D12S324 D13S159, D13S265, D12S310, D13S153 PANEL 20 D14S475, D14S280, D14S65, D14S258, D14S70, D14S283, D14S985, D14S276 D14S292, D14S74, D14S288, D14S261, D14S68, D14S63 PANEL 21 D16S3075, D16S3136, D16S3068, D15S130, D15S165, D16S503, D15S127, D16S3091, D15S153 D16S515, D15S1002, D16S520, D15S131, D15S117 PANEL 22 D16S3046, D16S415, D15S978, D16S3103, D15S120 D15S205, D16S404, D15S128, D16S516 D15S1007, D15S994, D15S1012, D16S423 PANEL 23 D18S462, D18S70, D17S1857, D17S1852, D17S799, D18S1102, D17S849 D17S949, D18S478, D17S831, D17S1868, D17S798, D17S787, D18S61 PANEL 24 D17S944, D17S784, D18S464, D18S63, D18S64, D18S474 D18S53, D17S938, D18S59, D17S921, D17S928, D18S452, D17S785, D18S1161, D18S68 PANEL 25 D20S889, D20S117, D20S112, D19S220, D20S171, D19S420, D19S414, D20S115, D20S196 D19S221, D19S210, D20S100, PANEL 26 D20S119, D21S266, D20S107, D19S902, D20S186, D22S420, D22S280, D19S216, D22S423 D19S884, D12S1252, D22S539 D22S274 PANEL 27 D22S283, D20S195, D22S315, D19S209, D19S418, D20S173, D21S263, D20S178, D19S226, D19S571, D21S1914
Amount 0.1l 0.1l Amount 0.15l 0.1l 0.15l Amount 0.1l 0.1l Amount 0.1l 0.1l Amount 0.1l 0.1l Amount 0.1l 0.15l Amount 0.1l 0.1l Amount 0.1l 0.1l 0.1l Amount 0.1l 0.1l Amount 0.1l 0.1l Amount 0.1l 0.1l Amount 0.1l 0.1l 0.1l Amount 0.1l
Table 2.1 Genome Wide Panels Sets for Multiplex PCR.
- 80 -
SAMPLE PREPARATION FOR ABI 3100 GENETIC ANALYZER

The fluorochromes labelled PCR products were pooled together in such a way that none of the PCR products had the same size or fluorochrome in common. 1-2 l of the PCR products together with 11.8 l deionized Hi-DiTM Formamide (ABI) and 0.2 l of one of the internal size standard ROX or LIZ (ABI) were pooled by using 12 capillary Hamilton Syringe into a 96 well MicroAmp PCR plate. The samples were denatured at 95C for 5 min followed by chilling in the ice and loaded for genotyping in ABI 3100 Genetic Analyzer according to the manufacturers instructions given in technical manuals. PRINCIPLE OF AUTOMATED FLUORESCENT GENOTYPING The phenomenon behind the automated genotyping is that when DNA fragments labeled with four different dyes electrophorese through the capillaries filled with acrylamide gel are separated according to their size. At lower end of the capillaries the dye labelled fragments pass through a region where a laser beam continuously scans the capillaries. The laser excites the fluorescent dyes attached to the fragments and they emit light at a specific wavelength for each dye. These light emissions are separated according to wavelength, thus all four types of fluorescent emissions are detected with one pass of the laser. With the help of data collection software light intensities are collected and stored as electrical signals (Lee et al. 1997). Automated allele assignment was performed using the ABI PRISM Gene Scan Analysis Software Version 3.7 for Windows NT Platform. The Gene Scan analysis software uses the automated fluorescent detection capability of the ABI PRISM 3100 Genetic Analyzer instrument to size and quantitate DNA fragments and displays the result of the experiment as a reconstructed gel image, electropherogram or tabular data or a combination of electropherogram and corresponding tabular data. Genotyper
ABI PRISM
3.7 NT is data analysis software and transformation tool that converts data
from Gene Scan result files into user application results. After obtaining a printout of the genotypic results, alleles (smallest allele was called as 1) were called manually (Fig 2.5).
- 81 -
Fig 2.5 Electropherogram of marker D11S4166 representing heterozygous alleles (1,2; 2,3) of father, mother, and normal while all the deaf individuals are homozygous for allele 2,2. The alleles were called manually; smaller one was called as 1.
- 82 -
HAPLOTYPE ANALYSIS Haplotype represents an individuals chromosomal segment. It is the set of genotyped alleles arranged according to the cM distance along a chromosome. Alleles were arranged in ways that confirm the inheritance pattern of segregating disease. If three polymorphic markers located in the linkage interval of a DFNB locus did not show homozygosity among the affected of a family, the family was considered unlinked. Linkage to a particular locus was confirmed when homozygous data of affected members cosegregates with the disease pattern in the family tree.
GENOME SCAN DATA ORGANIZATION AND ANALYSIS

For genome scan data organization and analysis, Microsoft Excel macro was specially developed by Bioinformatics Lab, CEMB. This macro has different modules and help in integrating different excel sheets to analyze data. Different excel sheets were named: Data, Ranges, Basic Info, and Code sheet. Data Sheet Genotyping data of individuals in shape of alleles sizes were called and entered manually into the data sheet, it contain further information like: Panel ID, Markers ID and cM distance, Labeling dye, Person name and ID, Disease status/ relation. Markers were listed column wise while individuals were arranged horizontally and assigned 2 columns per individual for a set of alleles. Ranges Sheet Data entered in the data sheet was subjected to different analysis by using various modules of the macro, like Parentage, Coloring, Coding, and Filing. To run specific module different ranges were adjusted in the ranges sheet. HOW TO RUN THE MACRO Data sheet and Ranges sheet act as a backbone to run different modules of software. To run the macro it is selected from the Tools present in the Menu bar. A window with the list of modules will be opened; relevant module was selected and Run command is given. The whole procedure is depicted in Fig 2.6. MODULES They provide a computerized format for the enhanced management of data and related information. The macro package is provided with five dynamic modules: 1. Parentage (Confirmation of inheritance pattern) This module compare the given alleles of siblings with parental alleles. If any deviation regarding inheritance pattern is observed the relevant cell was highlighted as RED.
- 83 -
2. Coloring (Coloring of homozygous alleles) This module highlights all the homozygous alleles by changing their background color. For each marker, if there were more than one homozygous pairs of alleles, different colors were assigned to different set of values and same color to same set of values. 3. Coding This module analyze all the alleles appearing against a marker and assign them a numeric codes starting from the lowest number. Finally it generates a new version of data sheet having all information of original data sheet except alleles are replaced by its numeric code. 4. Filing This module compiles the allelic data for a given set of markers (as adjusted in the ranges sheet) in the form of concatenated alleles. The out put of the module is to populate the column labeled alleles on a different sheet named Basic Info which is further used to make pre file for lod score calculation. Other columns of this sheet are filled manually according to the information of subjected pedigree. 5. Create Pre This module picks the data from Basic Info sheet; arrange it in a specific pattern recommended by Linkage programme and saves it in a text-formatted file with a pre extension. This pre file act as starting point to calculate Lod scores.
Fig 2.6 Representing the procedure to run Macro.
- 84 -
LOD SCORE CALCULATIONS Morton (1995) demonstrated that lod scores represent the most efficient statistical proof of evaluating pedigrees for linkage. Lod scores were calculated using FASTLINK (v4.1p) (Schaffer et al 1994). Two point and multipoint lod scores were calculated with MLINK and LINKMAP programs respectively. Deafness was assumed to be inherited in an autosomal recessive manner with complete penetrance. Recombination frequencies were assumed to be equal in both males and females. Genetic distances were based on Marshfield human genetic map (http://www.marshmed.org/genetics/). PRE FILE is a simple notepad file containing information regarding family structure, affection status and sex of individuals along with their genotypic data for one marker or more than one. PED FILE is a file in which the information about the consanguineous marriages/loops in the family is entered. The loops are broken with the help of a program named MAKEPED so that the program doesnt revolve in enclosed circle. As the result the program makes double entry of those individuals from where the loops were broken and make a .Ped file. DAT FILE file is made with the help of PREPLINK program, and contains the population data (allele frequency) of each of the marker for which lod score is to be calculated. The frequency of deafness alleles were estimated by genotyping the genomic DNA from 90 unrelated Pakistani subjects. Some time, the allele frequencies were considered equal, according to the data of family or 10 alleles with equal frequency of 0.1 were assumed to make total sum equals to 1.0. These a;ll above file acts as a back bone for LCP PROGRAM to calculates the lod score and as result generates a file named Final.out as default name. FAM2PD PROGRAM read this Final.out file and gives us a readable file of lod score in notepad file format respresenting all the Zmax against all the values.
DNA SEQUENCING
DNA sequencing, the process of determining the exact order of chemical building blocks (called bases and abbreviated A, T, C, and G) that make up the DNA of 23 different human chromosomes. The crucial technique involves, making many copies of targeted exon of gene or DNA fragment through PCR using primer pairs designed through the Primer3 website and exposing these many copies of the DNA fragment to a flourescently label at the end of the DNA strands. More than one primer pair was used to sequence longer exons. The sequencing reactions were performed on an automated ABI PRISM 3100 Genetic Analyzer using Big Dye Terminator Chemistry (Heiner et al.
- 85 -
1998). The ABI PRISM 3100 Genetic Analyzer functions the same way for both sequencing and gene scan analysis. It performs electrophoretic separation and spectral detection of dye labeled DNA fragments. ABI PRISM DNA Sequencing Analysis Software Version3.7 was used to separate and analyze the results of four different dyes used to identify A, C, G, and T extension reactions. AMPLIFICATION OF PCR FRAGMENTS The fragment of interest was amplified in a PCR reaction as follows: PCR reactions were performed with 100 ng of template DNA in 25 l reaction mixture containing 0.75 l of forward and reverse primer (8 M), 2.5 l of 10X PCR buffer (100 mM Tris-hCl, pH 8.4, 500 mM KCl, 15-20 mM MgCl2 and 1% Triton), and 2.5l of 1.25 mM dNTPs and 1-2 unit of Taq DNA polymerase. Thermal cycling profile used for amplification of different exons of genes is shown in Fig 2.7A whereas annealing temperature is variable (52-580 C) for different exons. AGAROSE GEL ELECTROPHORESIS AND EXO-SAP TREATMENT 5 l of the PCR product was analyzed on a 1.5% agarose gel to confirm the amplification and to check the purity of the PCR product before sequence analysis. The DNA was then treated to remove unincorporated nucleotides and oligonucleotides with a mixture containing Exonuclease1 and Shrimp Alkaline Phosphatase (SAP) according to the USB Corporation instruction. EXO-SAP Treatment Amplified DNA Shrimp alkaline phosphatase Exonuclease 1 10X SAP Buffer dH2O 20 l 0.2 l 0.2 l 1.5 l q.s to 25 l
Incubated at 37oC for 1 hour, followed by 80oC for 15 min to inactivate the enzymes and lastly at 25C for 30 min. SEQUENCING REACTION To the above 20 l reaction, equal volume of dH2O was added to dilute the salt concentration in the samples which otherwise could affect the sequencing results. Sequencing PCR (Fig 2.7B) with both forward and reverse primer was performed using the Big Dye Terminator Chemistry (Heiner et al. 1998) as under:
- 86 -
Reaction Mix Diluted DNA sample Big dye sequencing mix Primer (3.2 M) 5X dilution buffer * dH2O 6 l 1 l 1 l 1 l q.s to 10 l
* 5X buffer (Tris HCl 400 mM pH 8.7, MgCl2 10 mM)
1 Hld.
. . . . 95 C . . . . 5.00 . . . Min . .
3 Tmp
36 Cycles
94 C 0.45 Sec
52-58 C 0.45 Sec

36 Cycles
. 2 Hld. . . . . 72 C . 72 C . . . 2.00 . 10.0 . . Min . Min . 2 Hld. . . . . 70 C . 70 C . . . 4.00 . 10.0 . . Min . Min
25 C
1 Hld.
. 3 Tmp . . . 95 C . 94 C . . . 2.00 . 0.10 . . Min . Sec .
50 C 0.10 Sec
25 C
Fig 2.7 A. Thermal cycling profile for exon amplification. B. Thermal cycler programme for sequencing reaction.
SEQUENCING PRODUCT PRECIPITATION AND LOADING ON ABI 3100 SEQUENCER Sequencing reaction was set up in 96 well MicroAmp PCR plate (ABI) and precipitated using ethanol. 95% ethanol 18.9 l and 1.1 l of dH2O was added to each well containing 10 l sequencing reaction to make the final concentration of ethanol up 60 3%. Plate was inverted a few times to mix after sealing with 3M Scotch aluminum foil tape and was kept at room temperature for 15 min to precipitate the extended products. The tray was centrifuged at 3000 rpm for 30min and adhesive tape was carefully removed and supernatant was discarded by inverting the plate on a paper towel. 150 l of 70% ethanol was added to each well to rinse the pellet, and plate was again centrifuged at 3250 rpm for 20 min after covering with adhesive tape. Finally ethanol was discarded similarly as above, pellets were air dried and dissolved in 12 l of deionized Hi-DiTM Formamide (ABI). Samples were denatured at 95C for 5 min and
- 87 -
quick chilled by placing in ice before loading on the ABI PRISM 3100 Genetic Analyzer according to manufacturer instructions. ANALYSIS OF DNA SEQUENCES Sequencing data was analyzed using ABI PRISM DNA Sequencing Analysis Software Version3.7 and was read manually by using Chromas (v1.45) software. The sequence was also blast against normal sequence by using either BlastN or BLAST 2 Sequences on the NCBI web. BLAST (Basic Local Alignments Search Tool) a family of search programs designed to explore all the available databases against a query protein or DNA sequence. The scores are assigned in a BLAST search based on a statistical interpretation, thus differentiating real matches from random background hits (Altschul et al 1990). 'BLAST 2 Sequences', a new BLAST-based tool for aligning two protein or nucleotide sequences (Tatusova et al 1999). It utilizes the BLAST algorithm for
pairwise DNA-DNA or protein-protein sequence comparison. The resulting alignments are presented in both graphical and text form. Any change in the DNA sequence was confirmed by sequencing both sense and antisense strands for all the family individuals.
- 88 -
CHAPTER-III
- 89 -
SECTION-I
A MUTATION SPECTRUM OF MYO7A ASSOCIATED WITH USH1B AND EVIDENCE FOR THE EXISTENCE OF DFNB2
- 90 -
PREAMBLE
Usher syndrome is an autosomal recessive disorder characterized by bilateral sensorineural hearing impairment and progressive loss of vision due to retinitis pigmentosa (RP). There are three clinical subtypes of usher syndrome as well as atypical cases (Keats et al. 2004). Type 1 usher syndrome (USH1) is characterized by the presence of severe to profound HL, vestibular dysfunction, and early onset of RP. Seven USH1 loci have been mapped and genes for USH1B, 1C, 1D, 1F and 1G have been identified (Weil et al. 1995, Verpy et al. 2000, Bork et al. 2001, Bolz et al. 2001, Ahmed et al. 2001, Alagramam et al. 2001, Weil et al. 2003). Defects of myosin VIIa are responsible for HL due to splayed and disorganized stereocilia of shaker 1 mouse, the mariner zebrafish, the tornado rat (Self et al. 1998, Ernest et al. 2000, Smits et al. 2005), Usher syndrome type 1B and dominantly inherited, progressive HL DFNA11 in humans (Weil et al. 1995, Liu et al. 1997b). Mutations of MYO7A at USH1B locus are a leading cause of USH1 in United States, Northern Europe, Colombia and other populations and more than 100 mutant alleles of MYO7A (Table 1.3) have been reported (Astuto et al. 2000, Hope et al. 1997, Tamayo et al. 1991). Moreover, four mutant alleles of MYO7A are associated only with progressive HL (DFNA11) inherited as a dominant trait (Liu et al. 1997, Bolz et al. 2004, Luijendijk et al. 2004, Street et al. 2004). In addition, three mutant alleles of MYO7A were initially reported to be associated with nonsyndromic deafness (DFNB2) in one Tunisian and two Chinese families (Liu et al. 1997, Weil et al. 1997). However, the original Tunisian family was re-evaluated to have usher syndrome when affected members showed early signs of RP on detailed ocular examination (Zina et al. 2001). In the absence of ERG data or fundoscopy examinations, affected members of the two Chinese families were assumed to have a normal retinal function, although deaf individuals from both these families have vestibular dysfunction, a feature of USH1 (Weil et al. 1997). An evaluation of these two families by Astuto and co-workers concluded that there is no published evidence of mutations of MYO7A associated with nonsyndromic deafness DFNB2 (Astuto et al. 2002). So far, no family with normal vestibular or vision function (DFNB2) has been documented segregating recessive mutant alleles of MYO7A.
- 91 -
A cohort of 270 families was studied (20 newly enrolled families + 250 families from CEMB repository); DNA was isolated from the venous blood samples or buccal swabs as described in previously. An exhaustive screen to identify an authentic DFNB2 family and to determine any genotype/phenotype correlation was undertaken by typing at least three informative STR markers. Families linked to USH1B/DFNB2 locus were sequenced for the 49 exons of MYO7A with primers designed from flanking intronic sequence (Levy et. al, 1997). Medical histories were obtained and pure tone audiometry was performed on affected individuals of all these families. Physical and clinical
examinations including Romberg test, Tandem gait, ENG (electonystagmography), Fundoscopy and/or ERG were conducted on oldest affect individual from each family. Eleven families showed linkage to DFNB2/USH1B region. Affected individuals of all families had night vision problem except one family PKDF034 that does not have such phenotype. No other neurological or clinical abnormality was detected in these families. The mutational screen of MYO7A in affected individuals of these eleven USH1B/DFNB2 families yielded 9 recessive mutant alleles of MYO7A. There were seven previously not recognized MYO7A mutations in eight families with Usher syndrome and an additional one in a family with DFNB2. These mutations were found on 7 different haplotypes (Table 3.1) and are distributed across the gene (Fig 3.7). 96 or 180 normal anonymous DNA samples of Pakistani origin were sequenced to determine if the mutations of MYO7A are common polymorphisms.
FAMLIES LINKED TO USHER TYPE 1B

PKDF008
This family was enrolled from Multan (Punjab) and belongs to Jadral cast. PKDF008 was a large, highly inbred family with five consanguineous marriages and five affected individuals (V:4, V:5, V:6, V:7, V:11) in three sibships (Fig 3.1A); however spouse IV:1 was thought to be distantly related cousin. Severe to profound sensorineural HL with vestibular dysfunction, segregated in affected individuals of the family. Family PKDF008 had a history of night vision problem which was further confirmed by fundoscopic evaluation of the oldest affected member V:5 (aged 17yrs). Haplotype analysis clearly showed linkage to USH1B locus as all the five affected individuals were homozygous for the USH1B screening markers i.e. D11S4186, D11S1789, and
- 92 -
D11S4079; while 12 unaffected members of the family were either heterozygous or normal (Fig 3.1A). The family fits on the USH1 criteria so evidently an USH1B family.
PKDF161
Family PKDF161 was enrolled from Gujrat (Punjab) and belongs to caste Harjoay. PKDF161 had three affected individuals in two-loops, while spouse III:1 was thought to be a distantly related cousin (Fig 3.1B). Pure-tone air conduction
audiometry showed profound sensorineural HL segregating in family PKDF161. Fundoscopy of oldest affected IV:7 (aged 15yrs) demonstrated early signs of RP, vestibular dysfunction was also observed in affected individuals. All the three affected individuals (IV:5, IV:6 and IV:7) were found homozygous for three informative STR, while the normal individuals (III:2, III:5, III:6, IV:5, IV:8) were obligate carriers. Haplotype analysis established linkage to DFNB2/USH1B bounded by markers D11S4186, D11S1789, and D11S4079 (Fig 3.1B). MISSENSE MUTATION (G214R) IN MYO7A CAUSES USH1B Haplotypes of both the families (PKDF008 and PKDF161) were alike (Table 3.1) raising the likelihood of a common ancestral mutation. On sequencing affected
individuals from both the families were found homozygous for a 640G>A transition mutation (G214R) in exon 7 of MYO7A (Fig 3.1C) which encodes part of head domain of myosinVIIa (Fig 3.7). This G214R mutation is conserved in 14 myosinVIIa
orthologues (Fig 3.1D) and previously reported in a family of Morocco origin (Adato et al. 1997).
PKDF189
This family was enrolled from Lahore (Punjab) and was Malik by cast. Family PKDF189 had seven affected individuals in three loops; 4 affected and 3 unaffected members of the family were available for the study (Fig 3.2A). Severe to profound sensorineural HL segregated in family PKDF189, while oldest affected individuals (III:4 and IV:3) complained loss of vision at night and vestibular dysfunction, demonstrating the segregation of USH1 in this family. Fundoscopy of two older affected individuals III:4 and IV:3 (aged 20 and 10 yrs) further confirmed the presence of RP. Deafness phenotype of the family was syndromic in nature and all the four affected individuals (III:4, IV:3, IV:4, and IV:5) were homozygous for six markers D11S4186, D11S1789, D11S911, D11S937, D11S4166, and D11S918 on chromosme11 (Fig 3.2A).
- 93 -
I II
PKDF008
1
C
4
III
IV
2 3 1 2 2 2 V
1 2 3
2 2 1 2 2 1
4 5 6 7
2 2 1 2 2 1
8
2 1 1 2 2 1
9 10
2 1 1 2 2 1
11 12
D11S4186 2 2 D11S1789 1 2 D11S4079 2 1
2 2 1 2 2 1
2 3 1 2 2 2
2 2 1 1 2 2
2 2 1 1 2 2
2 2 1 1 2 2
1
2 2 1 1 2 2
2 2 1 2 2 1
2
2 1 1 2 2 1
2 1 2 2 1 1
2 2 1 1 2 2
2 1 1 2 2 1
PKDF161
1 2
D
3 4
II
1 2
III
2 1 1 2 2 1 IV
1 2 3 4 5 6 7
2 1 1 2 2 1
8
2 1 1 3 2 1
9 10 11
D11S4186 D11S1789 D11S4079
2 1 1 2 2 1
2 2 1 1 2 2
2 2 1 1 2 2
2 2 1 1 2 2
2 1 1 2 2 1
Fig 3.1 A. Pedigree drawing of PKDF008 along with haplotypes for markers on chromosome11. B. Pedigree drawing of PKDF161 along with haplotypes for markers on chromosome11. C. Electropherogram illustrate homozygosity for a 640G>A transition mutation (G214R, Exon 7) in affected individuals of PKDF008 and PKDF161 and homozygosity for the wild-type allele in an unaffected individual. D. Conservation of the glycine residue 214 in myosinVIIa orthologues and the alignment of amino acids surrounding the mutation.
- 94 -
PKB1
PKB1, a small family enrolled from Multan having just two affected individuals (II:2 and II:3) in a single loop. Six samples were available for the study in total i.e. 2 affecteds and 4 normals (Fig 3.2B). Severe to profound sensorineural HL was
segregating in family; moreover affected individuals (II:2 and II:3) had a history of night blindness and vestibular dysfunction which indicated USH1 in this family. Family had a syndromic phenotype and both the affected individuals (II:2, and II:3) were found homozygous for six markers D11S4186, D11S1789, D11S911, D11S937, D11S4166, and D11S918 bounding the region of USH1B (Fig 3.2B). IN-FRAME DELETION MUTATION (495DELG) IN MYO7A CAUSES USH1B Affected members of families PKDF189 and PKB1 linked to USH1B carry a novel deletion mutation of G at 495th base (Fig 3.2C), which truncates the protein after 169th aminoacid residue (E166fsX170) and was not detected in 96 normal representative DNA samples. This glutamate residue 166 in conserved in 14 myosinVIIa orthologues (Fig 3.2D). Furthermore, haplotypesof both the families were alike (Table 3.1).
PKDF148
PKDF148 was enrolled from Rawalpindi (Punjab) with 3 affected (IV:1, IV:2, and IV:3) and 3 normal (III:3, III:4 and IV:4) individuals and belongs to Khokhar caste (Fig 3.3A). Severe to profound level of HL was observed on audiometry. Parents informed that the oldest affected individual IV:1 (aged 10yrs) complains night vision problem. Fundoscopy showed early signs of RP and demonstrate the presence of USH1 phenotype. All the three affected individuals (IV:1, IV:2, and IV:3) were found
homozygous for three markers D11S4186, D11S1789, and D11S4079 bounding the region of USH1B (Fig 3.3A). FRAME SHIFT MUTATION (L1046FSX1054) IN MYO7A CAUSES USH1B Affected members of family PKDF148 were homozygous for a insertion of cytosine between nucleotides 3135 and 3136 in exon25, encoding part of first MyTH4 domain of myosinVIIa (Fig 3.3C). 3513_3516 insC frame shift mutation truncates the protein after 1053rd aminoacid residue (L1046fsX1054) and was not detected in 96 normal representative DNA samples. This leucine residue 1046 is conserved in all the myosinVIIa orthologues (Fig 3.3E).
- 95 -

1
I II
PKDF189
1 2 1 2
C
3 4 4 5 6 7
III 1 1 1 2 1 3
1 2 3 4
2 2 1 2 2 1
5 6
1 1 1 2 1 3
1 1 1 2 1 3
7 8 9 10
IV D11S4186 D11S1789 D11S911 D11S937 D11S4166 D11S918
1 1 1 2 1 3
2 2 1 1 3 2
1 1 1 2 1 3
1 1 1 2 1 3
1 1 1 2 1 3
1 1 1 2 1 3
1 1 1 2 1 3
1 1 1 2 1 3
1 1 1 2 1 3
1 1 1 3 1 3
B
I
PKB1
D
1 1 1 2 1 3
4
1 1 1 2 1 3
1 2
2 3 2 1 2 1
3
1 3 1 2 2 1
5
II D11S4186 D11S1789 D11S911 D11S937 D11S4166 D11S918
1 3 1 2 2 1
2 3 2 1 2 1
1 1 1 2 1 3
1 1 1 2 1 3
1 1 1 2 1 3
1 1 1 2 1 3
1 1 1 2 1 3
2 3 2 1 2 1
Fig 3.2 A. Pedigree drawing of PKDF189 along with haplotypes for markers on chromosome11. B. Pedigree drawing of PKB1 along with haplotypes for markers on chromosome11. C. Electropherogram illustrate homozygosity for a 495delG mutation (E166fsX170, Exon 6) in affected individuals of PKDF189 and PKB1 and homozygosity for the wild-type allele in an unaffected individual. D. Conservation of the glutamate residue 166 in myosinVIIa orthologues and the alignment of amino acids surrounding the mutation.
- 96 -
PKDF137
PKDF137, a highly inbreed family with three consanguineous marriages was enrolled from Multan (Punjab) and was Baloch by cast. It had six affected individuals (V:3, V:4, V:5, V:6, V:7, and V:8) in two sibships of 5th generation. Nine samples were available for the study i.e. 6 affecteds and 3 normals (Fig 3.3B). Severe to profound sensorineural HL segregated in family PKDF137 and all the affected individuals had night vision and balance problem. Funduscopy of two affected individuals V:7 and V:8 (aged 22 and 25yrs) confirmed the segregation of RP in the family. Phenotype of this family was syndromic in nature and all the affected individuals (V:3, V:4, V:5, V:6, V:7, and V:8) were found homozygous for three markers D11S4186, D11S1789, and D11S4079 bounding the region of USH1B locus (Fig 3.3B). NONSENSE MUTATION (Q531X) IN MYO7A CAUSES USH1B All the affected members were homozygous for a novel 1591C>T nonsense mutation in exon14 of MYO7A (Fig 3.3D). Q531X nonsense mutation truncates the protein prematurely in the motor domain and was not detected in 96 normal representative DNA samples. Glutamine residue 531 is conserved in 10 myosinVIIa orthologues (Fig 3.3E).
PKDF164
This single loop family was enrolled from Lahore with two affected individuals IV:1, and IV:2 and belongs to Arain caste (Fig 3.4A). Audiometric analysis showed that all the affected individuals had severe to profound HL. Gradual worsening of night vision was reported by parent of the deaf individuals (aged 13 and 15 years); moreover balance problem was also observed. Fundoscopy of the oldest affected confirmed the presence of RP which was indicative of USH1 phenotype of the family. Both the affected individuals were homozygous for three informative STR markers, while the normal individuals (III:3, III:4, and IV:3) were obligate carriers. Haplotype analysis established the linkage to USH1B (Fig 3.4A). NONSENSE MUTATION (R972X) IN MYO7A CAUSES USH1B Affected members of family PKDF164 linked to USH1B were homozygous for a 2914C>T nonsense mutation (R972X) in exon 24 (Fig 3.4C). Novel nonsense mutation R972X causes the protein to truncate just downstream of the coiled-coil region and was not detected in 96 normal representative DNA samples. This arganine residue 972 is conserved in 8 of the myosinVIIa orthologues (Fig 3.4E).
- 97 -
PKDF142
PKDF142, a single loop family enrolled from Multan (Punjab) belongs to Rajput caste. Pedigree was drawn up to 4th generations and only three affected individuals (IV:2, IV:3 and IV:4) and two normal members (III:4 and IV:5) were available for the study (Fig 3.4B). Audiometric analysis showed that all the affected individuals had severe to profound level of HL. Oldest affected individuals IV:2 and IV:3 (aged 11 and 10yrs) had a history of night blindness and abnormal vestibular response indicating USH1 phenotype of the family. Haplotype analysis of the family clearly showed linkage to USH1B locus as all the three affected individuals were homozygous for screening markers D11S4186, D11S1789, and D11S4079. Father
(III:4) of deaf individuals was an obligate carrier while the normal sibling (IV:5) was not even a carrier of the diseased allele (Fig 3.4B). MISSENSE MUTATION (D437N) IN MYO7A CAUSES USH1B All the affected individuals of PKDF142 were homozygous for a novel 1309G>A transition mutation (D437N) in exon 12 of MYO7A (Fig 3.4D) which encodes part of head domain of myosinVIIa (Fig 3.7). This missense mutation, D437N, is a residue of the conserved switch II loop of the motor domain (Fig 3.4E) and was not detected in 96 normal representative DNA samples. D437 is equivalent to chicken skeletal muscle myosin D465 and is conserved in all myosin reported till to date. mutations of D465 are nonmotile. Myosins with
PKDF290
PKDF290, a large inbreed family enrolled from Rahimyar Khan had six affected individuals in three loops and belongs to cast Warya (Fig 3.5A). Altogether 4 affected individuals (IV:4, IV:5, IV:6, and IV:7) and 8 normal members (III:3, III:4, III:6, III:7, IV:1, IV:3, IV:8 and IV:9) were enrolled. Affected individuals were severe to profound deaf with a history of night vision problem and vestibular dysfunction. Fundoscopic examination revealed early signs of RP confirming presence of USH1 phenotype in the family. All the four affected individuals were homozygous for the seven STR markers D11S4186, D11S1789, D11S4079, D11S911, D11S937, D11S4166, and D11S918 bounding DFNB2/USH1B region, seven unaffecteds members were obligate carriers except individual IV:1 who is genetically normal (Fig 3.5A).
- 98 -
I II III
PKDF148
1 2
BI PKDF137
3 4
II
6
III 2 1 2 2 2 1 2 1 2 1 2 1
4 5 6 1 2
4 6 7
3 4
10
IV
IV D11S4186 D11S1789 D11S4079
2 2 2 2 2 2
2 2 2 2 2 2
2 2 2 2 2 2
2 1 2 2 2 1
2 1 2 1 2 2 V
1 2 3 4 5 6 7 8 9
D11S4186 D11S1789 D11S4079
2 2 2 2 2 3
2 2 2 2 2 2
2 2 2 2 2 2
2 2 2 2 2 2
2 2 2 2 2 2
2 2 2 2 2 2
2 2 2 2 2 2
2 2 2
Fig 3.3 A. Pedigree drawing of PKDF148 along with haplotypes for markers of DFNB2/USH1B on chromosome11. B. Pedigree drawing of PKDF137 along with haplotypes for markers on chromosome11. C. Electropherogram illustrate homozygosity for an insersion C between 3135_3136 base (L1046fsX1054, Exon 25) in affected individuals of PKDF148 and homozygosity for the wild-type allele in an unaffected individual. D. Electropherogram illustrate homozygosity for a 1591C>T nonsense mutation (Q531X, Exon 14) in affected individuals of PKDF137 and homozygosity for the wild-type allele in an unaffected individual. E. Conservation of the leucine residue 1046 and glutamine residue 531 in myosinVIIa orthologues and the alignment of amino acids surrounding the mutation.
- 99 -
A IPKDF164
II III
1 1 2 2
B
3 4
PKDF142
1 2
II
6
III
2 1 2 1 2 2 IV D11S4186 D11S1789 D11S4079

1 2 3
2 2 2 3 2 1
4 5 1 2 3
1 1 1 3 1 2
4 5 6
2 2 2 2 2 2
2 2 2 2 2 2
2 1 2 1 2 2
IV
D11S4186 D11S1789 D11S4079
1 1 1 1 1 1
1 1 1 1 1 1
1 1 1 1 1 1
1 2 3 2 2 2
Fig 3.4 A. Pedigree drawing of PKDF164 along with haplotypes for markers on chromosome11. B. Pedigree drawing of PKDF142 along with haplotypes for markers of DFNB2/USH1B on chromosome11. C. Electropherogram illustrate homozygosity for a 2914C>T nonsense mutation (R972X, Exon 24) in affected individuals of PKDF164 and homozygosity for the wild-type allele in an unaffected individual. D. Electropherogram illustrate homozygosity for a 1309G>A transition mutation (D437N, Exon 12) in affected individuals of PKDF142 and homozygosity for the wild-type allele in an unaffected individual. E. Conservation of the arganine residue 972 and aspartic acid residue 437 in myosinVIIa orthologues and the alignment of amino acids surrounding the mutation.
- 100 -
SPLICE SITE MUTATION (IVS16 +1G>A) IN MYO7A CAUSES USH1B Affected family members of PKDF290 were homozygous for a novel splice site mutation IVS16 +1G>A (Fig 3.5C). This mutation was not detected in 96 normal representative DNA samples. This splice site mutation is a transition of G>A at the splice donor site of exon 16 and is predicted to cause exon skipping resulting in a truncated protein, if synthesized at all (Maquat LE. 2004).
PKDF426
PKDF426 was enrolled from Okara (Punjab) with multiple affected individuals. There were two consanguineous marriages and seven affected individuals in two sibships. Sposuse III:1 was thought to be a distantly related cousin (Fig 3.5B).
Audiometric analysis revealed severe to profound HL in affected individuals. Parent observed deteriorating night vision and vestibular function in affected individuals. Funduscopic examination of IV:7 revealed RP signs and established the presence of USH1 phenotype in this family. Phenotype of this family was found linked to three markers D11S4186, D11S1789, and D11S4079 bounding the region of USH1B on chromosme11 (Fig 3.5B). SPLICE SITE MUTATION (IVS39 +1 G>A) IN MYO7A CAUSES USH1B A novel splice site mutation IVS39 +1G>A (Fig 3.5D) was detected in deaf individuals of family PKDF426 which was not detected in 96 normal representative DNA samples. This splice site mutation is a transition of guanine to adenine at the splice donor site of exon 39, which is predicted to use a downstream cryptic splice site leading to a frame shift and truncation of the protein in the second MyTH4 domain.
- 101 -
FAMLIY LINKED TO DFNB2

PKDF034
PKDF034 is a large consangenious family having 6 deaf individuals from 4 sibships ranging in age from 15 to 48 years with no vision abnormality (Fig 3.6A). This family was enrolled from Lahore and was Gujjar by cast. There was no history of any other extra auditory phenotype in affected individuals of family PKDF034. However, normal ENG of two oldest affected individuals (IV:3 and IV:4) and normal ERG of affected family members aged 32 (IV:3), 36 (IV:2), 39 (V:8), 48 (IV:4) ruled out vestibular abnormalities and further established the absence of retinal phenotype in this family. All the five affected individuals (IV:2, IV:3, IV:4, V:8, and VI:5) were
homozygous for seven markers D11S4186, D11S1789, D11S4079, D11S911, D11S937, D11S4166, and D11S918 bounding the region of DFNB2 while all the normal were heterozygous for the diseased allele (Fig 3.6A). DELETION MUTATION (5146_5148 DELGAG) IN MYO7A CAUSES DFNB2 Sequence analysis of MYO7A revealed a novel in-frame deletion of three nucleotides 5146_5148delGAG, resulting in the loss of a glutamate at residue1716 (Fig 3.6B) in all the affected members of family PKDF034. All the normal hearing family members were heterozygous for the wild type allele. This mutation was not detected in 180 representative, ethnically matched DNA samples. The glutamate at residue 1716 is located in the tail region between the SH3 domain and the second MyTH4 domain (Fig 3.7). Furthermore, this glutamate is evolutionarily conserved among many myosinsVIIa proteins (Fig 3.6C) with the exception of C. elegans where this residue is asparagines. The loss of this glutamate residue of myosinVIIa is associated with profound HL in family PKDF034 but does not alter retinal function.
- 102 -
I II III
1
PKDF290
1 2 2 3
C
5 6
1 1 1 2 1 3 2 IV D11S4186 D11S1789 D11S4079 D11S911 D11S937 D11S4166 D11S918

11 2
1 1 1 3 6 4 3
3
1 1 1 2 1 3 2
4
1 1 1 1 4 2 1
9 10
1 1 1 2 1 3 2
1 1 1 3 6 4 3
6
1 1 1 2 1 3 2
7
3 3 3 5 3 3 1
8
2 2 2 1 2 1 2
2 3 3 4 5 2 2
1 1 1 2 1 3 2
1 1 1 1 4 2 1
1 1 1 2 1 3 2
1 1 1 2 1 3 2
1
1 1 1 2 1 3 2
1 1 1 2 1 3 2
1 1 1 2 1 3 2
2
1 1 1 2 1 3 2
1 1 1 2 1 3 2
1 1 1 2 1 3 2
1 1 1 2 1 3 2
1 1 1 3 6 4 3
1 1 1 2 1 3 2
1 1 1 3 6 4 3
I II III
PKDF426
1 2 1 2 3
1 2 1 1 1 1
1 1 1 1 1 2
IV
10
D11S4186 D11S1789 D11S4079
1 1 1 1 1 1
1 1 1 1 1 1
1 1 1 1 1 1
2 1 1 1 1 2
Fig 3.5 A. Pedigree drawing of PKDF290 along with haplotypes for markers on chromosome11. B. Pedigree drawing of PKDF426 along with haplotypes for markers of DFNB2/USH1B on chromosome11. C. Electropherogram illustrate homozygosity for an IVS16 +1G>A splice site mutation (Exon 16) in affected individuals of PKDF290 and homozygosity for the wild-type allele in an unaffected individual. D. Electropherogram illustrate homozygosity for an IVS39 +1 G>A splice site mutation (Exon 39) in affected individuals of PKDF426 and homozygosity for the wild-type allele in an unaffected individual.
- 103 -
I II
PKDF034
1 2
III
10
1 1 1 2 2 1 3
1 2
1 1 1 3 1 2 1
3 4 5 6 7 8
IV
1 2
1 1 1 2 2 1 3
1 1 1 2 2 1 3
1 1 1 2 2 1 3
1 1 1 2 2 1 3
1 1 1 2 2 1 3
1 14 1 2 2 1 3
D11S4186 D11S1789 D11S4079 D11S911 D11S937 D11S4166 D11S918

4 5
1 1 1 2 2 1 3
1 1 1 2 2 1 4
6
1 1 1 2 2 1 3
2 2 2 1 3 2 2
7
VI
1 1 1 2 2 1 3
1 1 1 2 2 1 3
1 1 1 2 2 1 3
2 2 2 1 3 2 2
1 1 1 2 2 1 3
2 2 2 1 3 2 2
Fig 3.6 A. Pedigree drawing of PKDF034 along with haplotypes for markers of DFNB2 on chromosome11q13.5. B. Electropherogram illustrates homozygosity of a novel in-frame deletion of three nucleotides 5146_5148delGAG (E1716del. Exon 37) in affected individuals of PKDF034 and homozygosity for the wild-type allele in an unaffected individual. C. Conservation of glutamate at residue 1716 in myosinVIIa orthologues and the alignments of amino acids surrounding the mutation.
- 104 -
HAPLOTYPE ANALYSIS AND MYO7A ALLELES SEGREGATING IN MORE THAN ONE FAMILY
Similar mutations 640G>A and 495delG were identified in two set of families rising the probability that these families might have same founder alleles of MYO7A segregating in them. To check this hypothesis two more STR markers (D11S5044 and D11S5045) were designed flanking the MYO7A genes with the help of Primer3 web server (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) and were
registered with GDB (http://www.gdb.org). Two affected individuals from each family linked to DFNB2/USH1B region were amplified for three markers D11S5044, D11S5045 and D11S4186 and were simultaneously loaded on the ABI PRISM Genetic Analyzer 3100 to find the exact alleles and haplotypes of the families linked to DFNB2/USH1B. The haplotype analysis and mutational screen of MYO7A in affected individuals of eleven USH1B/DFNB2 families yielded 9 recessive mutant alleles of MYO7A. Out of which 7 novel and 1 known recessive mutant allele of MYO7A is associated with USH1B, while 1 novel recessive mutant allele of MYO7A is associated with nonsyndromic deafness DFNB2. These mutations were found on 7 different haplotypes (Table 3.1) and are distributed across the gene (Fig 3.7). Postulate of having identical haplotypes for families carrying identical mutations was confirmed (PKDF008 and PKDF161, PKDF189 and PKB1), indicating a common ancestral origin of these families. On the contrary some families share analogous
haplotype but had different mutations e.g. PKDF148 and PKDF137, PKDF290 and PKDF426 (Table 3.1). Occurrence of different mutation on the same haplotype may be due to high frequency of these haplotypes in the population or these can be acquired denovo mutations at a later time after the haploype have been formed. It is also possible that these families may show different haplotype if additional markers in close proximity to gene or from intronic region are genotyped.
- 105 -
Families
PKDF008 PKDF161 PKDF189 PKB1 PKDF142 PKDF164 PKDF137 PKDF148 PKDF290 PKDF426 PKDF034
City
Multan Gujrat Lahore Multan Multan Lahore Multan Rawalpindi R.Y Khan Okara Lahore
Ethnic Group
Punjabi Punjabi Punjabi Punjabi Punjabi Saraiki Punjabi Sindhi Punjabi Punjabi
Cast
Jadral Harjoay Mailk Rajput Araeen Balouch Khokhar Warya Gujjar
D11S5044 76468431 bp
330 330 332 332 324 330 330 330 324 324 326
D11S5045 76646095 bp
237 237 239 239 241 239 243 243 237 237 237
D11S4186 76646142 bp
158 158 162 162 164 162 164 164 158 158 158
Nucleotide Change
640G>A 640G>A 495delG 495delG 1309G>A 2914C>T 1591C>T 3135_3136 insC IVS16 +1G>A IVS39 +1G>A 5146_5148del GAG*
Protien Effect
G214R G214R E166fsX170 E166fsX170 D437N R972X Q531X L1046fsX 1054 Frame shift Frame shift E1716del
Domain
Motor Motor Motor Motor Motor Post coiledcoil domain Motor MyTH4 Motor MyTH4 No known domain
Table 3.1 Haplotype and Mutations of DFNB2/ USH1B families. Primer sequence of D11S5044 (Forward: ACCAATTTGTCCTCCTACCACTAA, Reverse: TGGAAGAAAAAGTGCCCAAC) Primer sequence of D11S5045 (Forward: TCCGATCAACATGTTTTCCA, Reverse: TGCACAGCTACCATTTGAGC) Previously reported USH1B mutations. Novel mutations of USH1B reported in this study. * Novel mutation of DFNB2. Codon numbering starts with the first in-frame methionine (accession number U39226). MYO7A is located at 76516957-76603931 bp on chromosome 11on the UCSC browser as of May 2004.
- 106 -
DISCUSSION
Ten of the eleven families ascertained on the basis of HL actually have a type 1 usher syndrome, a diagnosis based upon ERG and /or fundus examination as well as ENG testing. Eight mutations of MYO7A in the USH1B families are identified, six of which are private mutations while a known mutation G214R is identified in two families (Adato et al. 1997). Two missense, two nonsense, two frame shift and two splice site mutations for USH1B were identified and are scattered throughout the gene (Fig 3.7). About 4% of families analyzed during this study showed linkage to DFNB2/USH1B locus which is comparable to my lab data (4.5%) and observed in more heterogeneous populations as in USA and UK (Astuto et al. 2000, Petite C. 2001). Family PKDF034 is segregating profound congenital NSHL without the evidence of vestibular dysfunction or retinopathy. Furthermore, normal ERG of affected family members aged 32 (IV:3), 36 (IV:2), 39 (V:8), 48 (IV:4) fortified the observation of a normal retinal phenotype in this family. Late onset RP is unlikely since ERG of a 48 years old male (IV:4) in this family was normal. However, we cannot rule out a retinal degeneration below the threshold of detection by ERG, which is the gold standard for evaluating subtle degenerative changes of the retina. The mutation of MYO7A identified in PKDF034 family is an in-frame deletion of three nucleotides (5146_5148delGAG), which encodes a glutamate at residue1716 located inbetween SH3 and second MyTH4 domain. The loss of E1716 residue of myosinVIIa is associated with profound deafness in family PKDF034 but doesnt alter the retinal or vestibular function. Till today three families have been reported to segregate nonsyndromic deafness DFNB2. However, one of these families from Tunisia (Family D) was found to have a balance problem and RP upon re-examination (Zina et al. 2001). The other two DFNB2 families (DFNB.01 and DFNB.05) are of Chinese origin. Family DFNB.01 has profound congenital deafness and vestibular dysfunction. ERGs of two individuals, 25 and 27 years old, were reported to be normal (Liu et al. 1997; Liu 2002). Affected members of DFNB.01 family are homozygous for R244P, which is an amino acid substitution in the motor domain. R244P is equivalent to F277 of chicken skeletal muscle myosin and is an arginine in some other myosins. Introduction of a proline at this residue is likely to disable the motor domain and give rise to an USH1 phenotype. In the second Chinese family (DFNB.05) affected individuals are profound deaf and show signs of vestibular dysfunction. Affected individuals are compound heterozygous for a splice acceptor site
- 107 -
mutation (IVS3 -2A>G) in intron 3 and a T insertion mutation in exon 28 (V199insT) leading to a frame shift and premature stop codon (Liu et al. 1997). These two mutations of MYO7A reported for family DFNB.05 are both truncating and are consistent alleles of MYO7A that are associated with usher syndrome. In contrast to the DFNB.01 and DFNB.05 families described above, the affected individuals of family PKDF034 have normal vestibular function based on an ENG examination and there are no signs of RP based on ERG (Fig 3.8A-D and Table 3.2). Also in contrast to typical USH1B patients (Fig 3.8F) and to the originally reported nonsyndromic families, which have a profound HL across all frequencies (Liu 2002), all affected members of PKDF034 have a residual hearing ability at low frequencies and show a down-sloping audiogram from 75-80 dB thresholds at 250 and 500 Hz to >90 dB at higher frequencies (Fig 3.8E). Taken together, these clinical data indicate that family PKDF034 segregates nonsyndromic deafness. Previously evidence for the genotype-phenotype relationship for the genes associated with usher syndrome type1 at the USH1D/DFNB12, USH1C/DFNB18, and USH1F/DFNB23 loci has been published (Bork et al. 2001, Ahmed et al. 2002, Ahmed et al. 2003). Truncating or splice site mutations and some missense mutations of these genes are associated with usher syndrome, whereas a few leaky splice site or missense mutations are associated with nonsyndromic deafness. It is anticipated that might be the residual protein function of harmonin, cadherin23, protocadherin15 or myosinVIIa is sufficient for normal vision. Testing of these hypotheses will require development of functional assays for each of these proteins. Such an obvious genotype-phenotype
correlation is difficult to predict for MYO7A mutant alleles due to insufficient number of DFNB2 families however in-frame single amino acid deletion reported herein for DFNB2 family in a post domain region might do not dysfunction the protein completely and retina seems to be more tolerant for this milder MYO7A allele than organ of Corti. Exploring the nature and location of the DFNB2/USHIB mutations provides an insight into the molecular basis of this disorder and the diversity of mutations in Pakistani population. It is concludes that USH1B represents a major portion of USH1 in a cohort from Pakistan, which is associated to variety of mutations of MYO7A. Family PKDF034 provides convincing evidence of the existence of nonsyndromic recessive deafness, DFNB2. However the DFNB2 phenotype makes only a minor contribution to families segregating HL with mutations in MYO7A.
- 108 -
Table 3.2 Comparison of molecular genetics and clinical findings in three reported nonsyndromic families and in family PKDF034 linked to DFNB2.
Family/ Ethnicity
PKDF034/ Pakistani Family D/ Tunisian DFNB.01/ Chinese DFNB.05/ Chinese
Mode of Inheritance
Recessive Recessive Recessive/ semidominant Recessive
Mutation/ Domain
E1716del in-frame/ no known domain M599I/ motor R244P/ motor IVS3-2A>G/ motor Val1199insT/ FS MyTH4
Auditory phenotype
75-80 dB at 250500 Hz >90 dB at 1000-4000 Hz 65-100 dB >90 dB at 5008000 Hz >90 dB at 5008000 Hz
Age of onset of hearing loss

Congenital Birth-16years Congenital Congenital
Vestibular dysfunction
Absent Present Present Present
Retinopathy/age at the time of ERG

Absent/ 32,36,39 and 48 years Present/ 25-65 years Absent but data not shown/ 25-27 years Absent but data not shown/ 28,33 years
Reference
This study Zina et al.2001 Liu et al. 1997 Liu et al. 1997
18
21
24
27
30
36 37
42
IVS16+1 G-A
IVS39+1 G-A
NH2
MOTOR HEAD DOMAIN

G214R D437N Q531X E166fsX170
COILED COIL
R972X L1046fsX1054
SH3
delE1716
COOH
Fig 3.7 Schematic presentation of the domain organization of myosinVIIa, along with mutations found in DFNB2/USH1B families. Mutation in purple is of DFNB2 family (PKDF034), highlighted are novel USH1B mutations while other is reported earlier.
- 109 -
Fig 3.8 (A-D) Normal ERG waves for four of the affected individuals of family PKDF034. A is IV:3, age 32 years, B is IV:2, age 36 years, C is V:8 age 39 years, D is IV:4 age 48 years. (E-F) Audiograms of left and right ears from two affected members of family PKDF034 and one affected member of USH1B family respectively. Symbols , represents right and left ears of individual IV:2 of family PKDF034 respectively. Symbols , represents right and left ears of individual IV:4 of family PKDF034 respectively. Symbols , * represent right and left ears of an affected from PKDF008.
- 110 -
SECTION-II
EXCLUSION STUDIES FOR KNOWN DEAFNESS LOCI AND MAPPING OF TWO NOVEL DEAFNESS LOCI DFNB51 & DFNB56
- 111 -
PREMABLE
Deafness transmitted as recessive trait is the most frequent cause (77-88%) of hereditary HL. It can occur with other pleiotropic manifestations to form a
recognized phenotype (syndromic hearing loss, SHL) or appear in isolation (nonsyndromic hearing loss, NSHL). Nonsyndromic autosomal recessive deafness is usually clinically homogeneous and exhibits a non progressive, severe hearing phenotype (Van Camp et al. 1997). As expected from the structural and functional complexity of the inner ear, sensorineural deafness exhibits a high degree of genetic heterogenity; presently there are about 41 loci for nonsyndromic autosomal recessive deafness reported in peer-reviewed journals, and twenty two of the causative genes have been identified through positional cloning efforts (Hereditary Hearing Loss Homepage, http://www.uia.ac.be/dnalab/hhh). Pakistani population offers a powerful genetic resource for mapping and identifying novel deafness loci due to high consanguinity (Hussain and Bittles 1998, Jaber et al. 1998, Elahi et al. 1998). Fifty families with three or more affected individuals in a single or multiple sibships were enrolled through schools for deaf children from different cities of Punjab, Sindh, and Balochistan, out of them twenty families were selected for further studies. Linkage analysis studies for all the known recessive deafness loci except DFNB2 were performed on 17 families (3 families; PKDF008, PKDF290, and PKDF426 were found linked to DFNB2 in priority screening for authentic DFNB2 families) by typing at least three STR markers. If the deafness phenotype in a family showed potential linkage to a known locus, all the members of that family were genotyped for those markers as well as additional markers to confirm the results. Two families each to DFNB4 and DFNB12 were found linked during the exclusion studies. Thirteen families remained unlinked to known loci; further augmenting the conjecture that a large repertoire of human genes associated with deafness remains to be mapped and identified (Friedman and Griffith 2003). This genetic heterogeneity of deafness is further established by my lab data which represents that more than 50% of the families segregating deafness remain unlinked to known loci (Unpublished). All the thirteen families which remained unlinked during exclusion studies were an excellent genetic resource to map novel deafness loci and genes. Genome wide scan was planned on seven selected families as an advancing step to map novel deafness loci. Panels 1 to 27 of the ABI PRISM Linkage Mapping Set version 2.5
- 112 -
MD10 containing 388 fluorescently labeled microsatellite markers spaced at an average interval of 10 cM across the human genome was used for genome wide scan (Fig 3.9). For intervals in which a single informative marker was homozygous, the entire family was retyped for the same marker as well as additional closely spaced markers to distinguish between a false positive and a real positive chromosomal interval in which the new DFNB locus resides. Two-point and multi-point linkage analysis was performed after calculating allele frequencies for microsatellite markers by genotyping ninety randomly selected normal individuals from the same population. Two novel loci DFNB51 and DFNB56 (as designated by HUGO Gene Nomenclature Committee) were mapped on two sets of families. First novel locus DFNB51 was mapped to chromosome 11p13-p12 in two consanguineous families PKDF240 and PKDF407 (Fig 3.12) while two more consanguineous families (PKDF637 and PKDF223) segregating recessively inherited, profound congenital deafness helped to map another novel locus DFNB56 to chromosome 3q13.31-q21.1 (Fig 3.15). No other clinically allied feature was observed in all the four families except deafness. Two hundred and fifty families segregating deafness from the
CEMB repository were screened for both the loci (DFNB51 and DFNB56) but unfortunately no more family was found linked with these loci, perhaps both these loci are rare in Pakistani population. No visual homozygosity was found in three families on genome scan. Probably, due to slippage of small linkage interval between the two markers placed apart. Every new discovery in the auditory system unveils new molecular mechanisms of hearing impairment. Similarly DFNB51 and DFNB56 are two new discoveries in the fascinating biology of the auditory system and hopefully both will bring us one step closer to transform the silence into sound.
R ESULTS
PKDF278
OF
E XCULSION S TUDIES
FAMILIES LINKED TO DFNB4

Family PKDF278 was enrolled from Tundo Muhammad Khan (Sindh) and belongs toJaskanicaste. It is a highly in-breed family having eight consanguineous marriages and six affected individuals dispersed in four generations (Fig 3.10A). A total of five members of the family were available, including three affected (IV:2, IV:3, and VI:2) and two normal (V:5 and VI:1) individuals. Audiometric studies on
- 113 -
the affected individuals, showed severe to profound level of HL and no vestibular or retinal dysfunction was observed. The haplotype of the entire family PKDF278 was found to be linked to DFNB4 locus at chromosome 7q31. The affected individuals IV:2, and VI:2 were homozygous for markers D7S2420, D7S2459 and D7S2456 while IV:3 gave a telomeric recombination at D7S2456, present out side the SLC26A4 gene (Fig 3.10A). This chromosomal region harbors two overlapping loci i.e. DFNB4 and Pendred syndrome. Since no symptoms of goiter were observed in the affected members of the family, so PKDF278 was considered to be linked with DFNB4. MUTATIONAL ANALYSIS Mutational analysis of SLC26A4 gene was performed as previously described (Everett et al. 1997). A reported transition mutation 716T>A (Fig 3.10C) was
identified in all the affected individuals (Park et al. 2003). This missense mutation replaces valine at 239th residue with aspartic acid and is conserved in seven orthologues of pendrin (Fig 3.10E).
PKDF453
This family had four affected individuals in two consanguineous sibships. PKDF453 was enrolled from Sahiwal (Punjab) and belongs to Arain caste. Affected individuals appeared in fourth generation and only three affected (IV:2, IV:3, and IV:4) and two normal siblings (IV:1 and IV:5) were available for the study (Fig 3.10B). Audiometric studies on the affected individuals, showed severe to
profound level of HL and no vestibular or retinal dysfunction is observed. Haplotype analysis of the five siblings revealed its linkage to DFNB4 locus at chromosome 7q31. All the affected individuals IV:2, IV:3 and IV:4 were homozygous for markers D7S2420, D7S2459 while normal individuals IV:1 and IV:5 were absolutely normal and carrier of the affected allele, respectively (Fig 3.10B). No symptoms of goiter were observed in the affected members of the family, thus PKDF453 was considered linked to DFNB4. MUTATIONAL ANALYSIS A transition mutation 1337A>G (Q446R) in exon 11 of SLC26A4 gene was identified in all the affected individuals of PKDF453 (Fig 3.10D), which replaces glutamine to arginine and is conserved in six orthologues of pendrin (Fig 3.10E).
- 114 -
- 115 -
Fig 3.9 Schematic representation of the ABI PRISM Linkage Mapping Set version 2.5. Bolded are the markers of MD10 panel set arranged 10 cM apart, while plain are markers of HD5 panel set arranged 5 cM apart.
- 116 -
A
I II III
PKDF278
1 1 2
B
6 6
PKDF453
1 2 1 2 3
I II
2 3
5 6
III
IV
9 8
IV
6 7
D7S2420 D7S2459 V D7S2456
2 2 2 2 2 2
2 2 2 2 2 1
2 3 2 1 2 3 VI
1 2 3
D7S2420 1 1 D7S2459 2 3 D7S2456 2 1
2 2 1 1 4 3
2 2 1 1 4 3
2 2 1 1 4 3
1 1 1 2 3 2
2 1 2 2 2 2
2 2 2 2 2 2
Fig 3.10 A. Pedigree drawing of PKDF278 along with haplotypes for markers on chromosome7. B. Pedigree drawing of PKDF453 along with haplotypes for markers of DFNB4/PDS on chromosome7. C. Electropherogram illustrate homozygosity for a 716T>A missense mutation (V239D, Exon 6) in affected individuals of PKDF278 and homozygosity for the wild-type allele in an unaffected individual. D. Electropherogram illustrate homozygosity for a 1337A>G transition mutation (Q446R, Exon 11) in affected individuals of PKDF453 and homozygosity for the wild-type allele in an unaffected individual. E. Conservation of the valine residue 239 and glutamine residue 446 in pendrin orthologues and the alignment of amino acids surrounding the mutations.
- 117 -
FAMILIES LINKED TO DFNB12

PKDF176
PKDF176 was a single loop family collected from Kasur (Punjab) and belongs to Arain cast with three affected individuals (IV:3, IV:4, and IV:5). At the time of enrollment, three affected individuals aged between 20-25years and two normal members (III:3 and IV:6) were available (Fig 3.11A). Audiometric assessment revealed severe to profound level of HL in all the affected individuals. Clinical examination ruled out presence of any extra auditory phenotype in affected individuals of PKDF176, demonstrating that deafness is segregating as a nonsyndromic trait in this family. The deafness phenotype of this family was found linked to DFNB12 locus on chromosome 10q21-q22. All the three affected individuals (IV:3, IV:4, and IV:5) were homozygous for three markers D10S606, D10S1694 and D10S1432 (Fig 3.11A). DFNB12 is an overlapping locus with USH1D, as there were no symptoms of retinitis pigmentosa in affected individuals of family PKDF176, establishing its linkage to DFNB12. A
maximum two-point LOD score of 2.3 at =0 was observed for markers D10S1694 and D10S1432 in family PKDF176.
PKDF177
PKDF177, a single loop family with two affected individuals (IV:3, and IV:4) was collected from Kasur (Punjab) and belongs to Ansari cast. Two affected
individuals aged 14 and 11years along with two normal members (III:3 and IV:5) were only available at the time of enrollment (Fig 3.11B). Audiometric assessment revealed severe to profound level of HL in both the affected individuals. Although there was no history of RP, it was difficult to rule out RP phenotype in affected individuals as they were too young. The haplotype of the affected individuals of this family showed linkage to DFNB12 locus on chromosome 10q21-q22. Both the affected individuals (IV:3, and IV:4) were homozygous for three markers D10S606, D10S1694 and D10S1432 bounding the DFNB12/USH1D locus (Fig 3.11B). Since, no symptoms of RP appeared in affected individuals of family PKDF177 yet, it was considered to be potentially linked to DFNB12 with a maximum two-point LOD score of 1.5 at =0 on markers D10S606 and D10S1694.
- 118 -
A
I II
PKDF176
1 2 3 1 2 4
B
I II
6
PKDF177
1 2 1 2 3 4
III
III
2 1 1 2 1 3
1 2 3 4 5 6 7 1 2 3
2 1 2 1 1 1
4 5 6 7
IV
IV
D10S606 D10S1694 D10S1432
2 2 1 1 1 1
2 2 1 1 1 1
2 2 1 1 1 1
1 1 2 3 3 2
D10S606 D10S1694 D10S1432
2 2 2 2 1 1
2 2 2 2 1 1
2 1 2 1 1 1
Fig 3.11 A. Pedigree drawing of PKDF176 with haplotypes for markers on chromosome10. B. Pedigree drawing of PKDF177 with haplotypes for markers of DFNB12/USH1D on chromosome10.
- 119 -
R ESULTS
OF
G ENOME W IDE S CAN
DFNB51, MAPS TO CHROMOSOME 11P13-P12

A novel locus DFNB51 was localized to chromosome 11p13-p12 following a whole genome wide scan in two consanguineous families PKDF240 and PKDF407 segregating recessively inherited, profound congenital deafness (Fig 3.12). Haplotype analysis of affected individuals in family PKDF240 mapped the gene distal to D11S4200 (42.55 cM) and proximal to D11S1279 (50.88 cM), delineating a genetic interval of approximately 8.3 cM (Sheikh et al. 2005). A maximum two-point lod score of 3.5 and 2.5 for markers D11S4102 and D11S935 at recombination fraction =0 was obtained for families PKDF240 and PKDF407, respectively (Table 3.3). Several good candidate deafness genes reside in the DFNB51 interval including CD44, SLC1A2, RAMP, TRAF6 and NGL-1 (Fig 3.14). The mapping of DFNB51 is part of our saturating search for human genes that are necessary for the development of the inner ear and the maintenance of normal hearing. Below is the detailed description of the families that helped to map this novel locus DFNB51.
PKDF240
PKDF240, a highly inbreed family with five consanguineous marriages was enrolled from Hyderabad (Sindh) and belong to Qureshi caste (Fig 3.12A). There were ten affected individuals in three loops, out of which seven affected and six normal members were enrolled for detailed study. Multiple individuals were interviewed to acquire the clinical history of the family and to draw a detailed pedigree up to seven generations. However, spouses V:1 and VI:3 are thought to be distantly related cousins and their relationship could not be confirmed. The affected individuals range in age from 4 years to 42 years. The first affected individuals appeared in the 6th generation i.e. three affected siblings (VI:4, VI:5, and VI:6). All affected individuals of family PKDF240 exhibited prelingual bilateral profound sensorineural HL, with no obvious vestibular or ocular abnormalities. Representative audiometric profiles of affected
individual (VII:3) of family PKDF240 is shown in Fig 3.13A. Moreover, no other medical problem was found cosegregating with the deafness.
- 120 -
PKDF240
1 2
II
3 4
III
IV
VI
10
11
VII
12
13
2 1 1 1 2 1 2
3 1 1 1 2 1 1
2 1 1 1 2 1 3
1 2 2 2 1 1 3
VII D11S4200 D11S935 D11S4102 D11S5041 D11S5042 D11S5043 D11S1279 42.55cM 45.94cM 47.61cM
10
11
50.88cM
1 2 2 2 1 1 3
2 1 1 1 2 1 2
1 2 2 2 1 1 3
3 1 1 1 2 1 1
2 1 1 1 2 1 3
3 1 1 1 2 1 1
2 1 1 1 2 1 3
2 1 1 1 2 1 2
2 1 1 1 2 1 3
3 1 1 1 2 1 1
2 1 1 1 2 1 3
2 1 1 1 2 1 2
2 1 1 1 2 1 3
3 1 1 1 2 1 2
1 1 1 1 2 1 3
2 1 1 1 2 1 2
1 2 2 2 1 1 3
2 1 1 1 2 1 2
1 2 2 2 1 1 3
2 1 1 1 2 1 2
1 2 2 2 1 1 3
2 1 1 1 2 1 2
I II
1
PKDF407
1 2 2 3 4
III
2 1 2 1 2 1 2
2
1 3 1 3 3 1 3
2 2 3 3 1 2 1
2 3 4 3 2 1 1
3
2 1 2 1 2 1 2
1 3 1 3 3 1 3
IV
2 1 3 3 1 2 1
2 2 3 2 4 3 1
2 2 3 3 1 2 1
1 3 1 3 3 1 3
2 2 3 3 1 2 1
1 3 1 3 3 1 3
2 2 3 3 1 2 1
1 3 1 3 3 1 3
2 2 3 3 1 2 1
1 3 1 3 3 1 3
V D11S915 D11S904 D11S914 D11S907 D11S4203 D11S935 D11S4102 30.88cM 33.57cM 37.62cM 42.55cM 45.94cM 45.94cM 47.61cM
10
11
2 1 3 3 1 2 1
2 1 2 1 2 1 2
2 3 4 3 2 1 1
2 2 3 2 4 3 1
2 1 2 1 2 1 2
2 2 3 2 4 3 1
1 3 1 3 3 1 3
1 3 1 3 3 1 3
2 2 1 3 3 1 3
2 2 1 3 3 1 3
2 2 3 3 1 2 1
2 2 3 3 1 2 1
2 2 3 3 1 2 1
2 2 3 3 1 2 1
2 2 3 3 1 2 3
2 2 3 3 1 2 1
2 2 3 3 1 2 3
2 2 3 2 4 3 1
2 2 3 2 4 3 1
2 2 3 3 1 2 1
2 1 2 1 2 1 2
1 3 1 3 3 1 3
Fig 3.12 Pedigrees of families PKDF240 and PKDF407 segregating recessive deafness with haplotypes of markers at 11p13-p12. Filled and clear symbols represent affected and unaffected individuals, respectively. The core haplotypes are boxed representing the ancestral chromosome harboring DFNB51. A Haplotypes of PKDF240 revealed a 8.33 cM interval delimited by markers D11S4200 and D11S1279. Spouses V:1 and VI:3 are thought to be distantly related cousins; however their relationship could not be confirmed. B Haplotypes of PKDF407 showing a homozygous region of 14.04 cM delimited by markers D11S904 and D11S4102. The STR markers and their relative positions in centiMorgan (cM) according to the Marshfield human genetic map [http://research.marshfieldclinic.org/genetics] are shown on the left side of the each pedigree.
- 121 -
HAPLOTYPE ANALYSIS Genome wide linkage analysis of family PKDF240 showed initial evidence of linkage at marker D11S935 on chromosome 11p13-p12. In order to fine map and confirm the linkage six additional STR markers (D11S4200, D11S4102, D11S5401, D11S5402, D11S5403, and D11S1279) were genotyped for all participating family members. Haplotype analysis revealed a homozygous region of 8.33 cM (Fig 3.12A), delimited by markers D11S4200 (42.55 cM) and D11S1279 (50.88 cM). The
centromeric recombination at D11S4200 was given by individuals VI:6, VII:3, VII:5, VII:7, and VII:8 while distal recombination at D11S1279 was provided by individuals VI:6, VII:3, VII:4, VII:5, VII:6, VII:7, and VII:8. A maximum multi-point lod score of 3.8 was obtained at marker D11S4102, while a two-point lod scores (Z max) of 3.5 at recombination fraction =0 was obtained at D11S4102 (Table 3.3).
PKDF407
Family PKDF407 had only three affected individuals in a single loop though highly inbreed with five consanguineous marriages. It was enrolled from Rawalpindi and belongs to Rajput Janjua caste (Fig 3.12B). Detailed pedigree up to five
generations was drawn and a total of eighteen affected and unaffected members were enrolled from three generations. Affected individuals (V:6, V:7, and V:8) appeared in the 5th generation and aged in range of 10 to 15 years. All affected individuals of family PKDF407 showed prelingual bilateral profound sensorineural HL, with no obvious vestibular or ocular abnormalities. Representative audiometric profiles of affected No extra auditory
individual (V:6) of family PKDF407 is shown in Fig 3.13B.
phenotype was observed in all the affected of PKDF407 after complete clinical. HAPLOTYPE ANALYSIS For deafness segregating in family PKDF407, evidence of linkage, although not rising to statistical significance (Z max of 2.5 for D11S935 at =0, Table 3.3), was found between markers D11S914 (37.62 cM) and D11S935 (45.94 cM) following a genome wide scan. Multi-point linkage analysis yielded a lod score of 2.6 at marker D11S935. After typing additional STR markers in the linkage region, haplotype analysis revealed a homozygous region of approximately 14.04 cM (Fig 3.12B) flanked by markers D11S904 (33.57 cM), a proximal boundary defined by normal hearing individual V:5 and D11S4102 (47.61 cM) a telomeric break point given by individual V:8.
- 122 -
Markers D11S915 D11S904 D11S914 D11S907 D11S4200 D11S4203 D11S935 D11S4102 D11S5041 D11S5042 D11S5043 D11S1279
Table 3.3 Two-Point Lod Scores
Marshfield Map Position (cM) 30.88 33.57 37.62 42.55 42.55 45.94 45.94 47.61
Z max at = 0 PKDF240 - 3.38 3.50 3.09 3.38 0.44 - PKDF407 - - 2.18 0.23 2.28 2.50 - -
50.88
Some markers in the region of homozygosity were not fully informative, thus yielding reduced positive lod scores. For both families mapped to DFNB51, none of the markers on other chromosome region gave lod score greater than 2.0.
A
-10 0 10 20 30 40 50 60 70 80 90 100 110 120
FREQUENCIES
B
-10 0 10 20 30 40 50 60 70 80 90 100 110 120
FREQUENCIES
Fig.3:13 Pure tone air (O, X right and left ear, respectively) audiograms. A Affected individual VII:3 (12 years) of PKDF240. B Affected individual V:5 (15 years) of PKDF407. The observed threshold in all deaf subjects showed severe-to-profound hearing loss.
- 123 -
Chr 11
cM
D11S915 D11S904 D11S914 D11S907 D11S4200 D11S4203 D11S935 D11S4102 D11S5041 D11S5042 D11S5043 D11S1279
30.88 33.57 37.62 42.55 42.55 45.94 45.94 47.61

MMRP19 PDHX CD44 SLC1A2 RAMP AF370388 FJX1 TRIM44 AF274942 LOC143458 AK098257 FLJ45212 COMMD9 FLJ14213 BC008922 TRAF6 BC037344 BC008922 RAG1 RAG2 LOC1197 AK127441 NGL-1
50.88
Fig 3.14 Schematic representation of the DFNB51 interval on chromosome 11p13-p12 showing STR markers ( ) and meiotic recombinations (X). Solid vertical lines represent the genetic intervals in which affected individuals are homozygous for the STR markers. Based on analyses of family PKDF240, DFNB51 resides in a critical interval of approximately 8.33 cM, delimited by D11S4200 (42.55 cM) and D11S1279 (50.88 cM). There are 23 genes annotated in the DFNB51 interval (UCSC Genome Browser, http://genome.ucsc.edu). Genes in the 5.06 cM DFNB51 interval are shown in bold font. Genes that are highlighted were sequenced and no mutation was found. Gene symbols were approved by the HUGO Gene Nomenclature Committee (Povey et al. 2001).
- 124 -
SEQUENCING OF SOME OF THE IMPORTANT CANDIDATE GENES OF DFNB51

Cloning and identification of the causative gene has always been a daunting task, as mapped regions are usually very large for positional cloning efforts. For that reason two methodologies are normally adopted; one way is to have another family with a different recombination event than the original family to reduce the linkage interval, or to screen candidate genes for mutations on the bases of their putative functions. Approximately 21 genes reside in the DFNB51 interval (5.06 cM) including good candidates such as CD44, SLC1A2, RAMP, and TRAF6 while 3 additional genes are present in larger region (8.33 cM) given by PKDF240 (Fig 3.14). Moreover, GeneScan, Geneid and TwinScan softwares predict approximately 19 more genes. As part of our still on going search for the causative gene of DFNB51, both the strategies were conducted simultaneously. Firtstly 250 consanguineous families from CEMB repository were screened for linkage to DFNB51 but no more family was found linked; perhaps it is a rare locus in Pakistani population. Secondly, three potential candidate genes SLC1A2, TRAF6, and RAMP were sequenced. Primers were designed using Primer3 site (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi), for all the three genes (Table 3.5, Table 3.6, and Table 3.7). Coding regions of these genes were sequenced in a deaf and an unaffected individual from both families used to map DFNB51. No potentially causative variants were identified however six known SNPs and 1 novel SNP is identified which further demonstrate that the two alleles of the families PKDF240 and PKDF407 are different from each other (Table 3.4).
Family I.D SLC1A2 T/C PKDF240 PKDF407 VI: 6* VI: 7 V: 8* IV: 3 T T T T G/A G G G G T/A T T T T T/A T T T T A/G G G G G TRAF6 ins T T T RAMP G/A G G G G
Table 3.4 SNPs identified in SLC1A2, TRAF6, and RAMP. * Deaf Individual Normal Individual IVS4 -36 T/C G885A-Exon5 T915A-Exon5 T916A-Exon5 A1504G-Exon 8 IVS2 -8 ins T G1409A-Exon8 All polymorphism are listed in UCSC Genome Browser except which is novel to this report.
- 125 -
Exon 1 2 3 4 5 6 7 8 9 10 11
Forward Primer CCGCAGCAAAGCACAGGT GTCGAGCCCCTGAAACTGTA GTCTAGAGTAAGTCATTTGACGAAGG CGTCATAGAAATGTAGACACAGGTC TTGTTAACCTGTTGGGAACCTT TGGCTCCATACATTGGGAAT CAGAAGAGCCAAGCGTTTTC TGCAGTGGCATTCCAGTTT CCAGGGTTGGTTTTGCTAAG TCCTCACTGAACCTTTTCTGTTC CTTGGATTTGGTGCTTCTCC
Reverse Primer CGCCTCTCTATCCGCATCC CCCACAGAGCCAGGAGAGT TAAAAGCCAGGGCAGGAGTA AAAATACTCTTAAGTTATCGCCTTGA GAAAAGGGAGTGCAGGATAGC AGCCCATGCCAACTTTTTC GCAAAGAGGGCAAAAGAGTG GGCCTCTGTCACATGGAGTT GCCATGGGGATTAGCTAAGAT ATACATGCAGGGCTTTACGG AAGCCTCGGCTAACAGATTAAG
Product Size (bp) 479 271 275 399 343 319 391 354 299 359 295
Table 3.5 Primer sequences for SLC1A2 exons. Exon11 is 9KB big and starting few bases code for protein so primer is designed for the coding region Product Size (bp) 483 244 292 247 295 499 549
Exon 1 2 3 4 5 6A 6B
Forward Primer GATATATATGTGTGGGGTGTGAGTG TTGTTTGGATTTTCTAATGTGAGTCT GCTTATATGTAGAAGACTTCAGAGTTGG TCAAAATTAGTTGTTTTCACTTTTTCA TAAATGTGATCGCATCAAACTAGAA CCTTTTCCTACTCCTCACGGTAT AGGAGAAACCTGTTGTGATTCATAG
Reverse Primer TGTAAGACTACTTTTGGGATGTTCC CATGTGCTAACAGCTAGAAAAGAAC ACCCCCTCAAGTACACATTTAAGA TCAATCTGTATTTCTTTGCCTTATTG CTCACAGCATCCATGAATAACTCTA AGTCGGTAACTGAAGGTGCAAG CTTGTTTGTTTGCATGTTATTGAGA
Table 3.6 Primer sequences for TRAF6 exons. Product Size (bp) 196 299 265 318 356 240 219 396 233 599 426 438 394
Exon 1 2 3 4 5 6 7 8 9 10 11 12A 12B
Forward Primer CTCCCTGGGTCCCTCCTCTC TCTTACCACTCCCTGCCAGGAC GATCAGAACTCGCAGGTGCTTTG GGTGTGGCATGTGCTCAAAGTC CTTGAATGAGCCCAGCGGTC CAAGACTCTGGGCCTGAAGACATC TGATTTTCAGTCTTGCCTTCTGTCTTAG TCTTTTGAGCACCAGATCCTATATC CACCTGGTGTCCAGAAGTGGG TGGGTAGTAAGGTTAAGCCAAAGGAAA CTCCTTTGGATGGCAAAGTCTGAG AAAATTTAGCTCCAAGCCTTGTCTG GCTTCAAGAACGACACACTGCG
Reverse Primer CCCAGGAGGAAAATGCTCCC GTTCAGCCTGTTCCTGTTCATTACC GGAGATAAATTTTGGTCCATTGTAAGC GGCTCCAATATACAAAGGCTCCAG CATGGAAAGGAGATATTTATCTGGAGC TCTTAAAATCCTTCCATACCAGCCC AGAGCTCTCCCACCCTCCTTCTG GCTACCAAAAAGTCTAGCAACTTCA AAGGGGAATGGAAGGGGAAATACTC TGGAGTGAGGGACAGAGGGAGA GGTATAATCACTGCTCTCCCGTGC AGATATCAGAAGGGGCAGTGGGTTC CGCAATGACACACGTACAGACG
Table 3.7 Primer sequences for RAMP exons.
- 126 -
DFNB56, MAPS TO CHROMOSOME 3Q13.31-Q21.1

The disease gene for a novel locus, DFNB56, was localized in two families PKDF637 and PKDF223 segregating NSHL as an autosomal recessive trait through a genome scan to chromosome 3q13.31-21.1 (Fig 3.15). A maximum two-point lod score of 4.84 and 3.16 for markers D3S4523 and D3S1267 at recombination fraction =0 was obtained for families PKDF637 and PKDF223, respectively (Table 3.8). Recombination events in affected individuals mapped the gene distal to D3S2460 (134.64 cM) and proximal to D3S1267 (139.12), delineating a genetic interval of 4.48 cM. SLC15A2, UPK1B, CASR, and IQCB1 are among the candidate genes in the DFNB56 interval (Fig 3.17). Below is the thorough description of the families used to map this novel locus DFNB56. PKDF637 Family, PKDF637, an extremely inbreed family had five consanguineous marriages and four affected individuals (VI:1, VI:6, VI:7, and VI:8) in three sibships (Fig 3.15A). It was enrolled from Khuzdar (Balochistan) and belongs to Badini caste. Perhaps due to strict social customs, family members rarely marry outside the family. Multiple family members were interviewed to construct the pedigrees up to six generations and all together thirteen samples from both affected and normal members were collected for a comprehensive study. All affected individuals from the families PKDF637 exhibited prelingual, bilateral, profound, deafness, with no vestibular symptoms and retinitis pigmentosa (RP). No other extra auditory phenotype was found co-segregating with the deafness after through clinical evaluation. HAPLOTYPE ANALYSIS Preliminary evidence of linkage in family PKDF637 was shown on chromosome 3q13.31-q21.1 by marker D3S4523 during a genome wide search. Additional eight markers lying proximal and distal to D3S4523 were genotyped for all participating members of the family PKDF637. Haplotype analysis revealed a region of
homozygosity of approximately 9.4 cM (Fig 3.15A), delimited by markers D3S1278 (129.73 cM) and D3S1267 (139.12 cM). The proximal recombination at D3S1278 was provided by individual VI:8, while individual VI:1 provided the distal break point of the critical linked region at D3S1267 (139.12 cM). A maximum two point lod score (Z max) of 4.84 at recombination fraction =0 was obtained at D3S4523 (Table 3.8).
- 127 -
PKDF637
1 2
II
III
IV
3 2 1 1 4 1 1 1 2 VI D3S1278 D3S1558 D3S2460 D3S1303 D3S4523 D3S1267 D3S1269 D3S1589 D3S3606 129.73cM 133.93cM 134.64cM 136.32cM 138.00cM 139.12cM 139.65cM 141.79cM 143.94cM
1 2
4 1 3 3 2 5 4 2 2
3
3 2 1 1 4 1 1 3 4
1 3 3 4 1 3 2 3 3
4 5 6
3 2 1 1 4 1 1 3 4
7
5 2 2 6 2 2 2 3 1
8 9 10
3 2 1 1 4 1 1 3 4
2 4 3 5 3 4 3 2 2
11
3 2 1 1 4 1 1 3 4
3 2 1 1 4 5 4 2 2
3 2 1 1 4 1 1 3 4
4 1 3 3 2 5 4 2 2
3 2 1 1 4 1 1 3 4
4 1 3 3 2 5 4 2 2
1 3 3 4 1 3 2 3 4
3 2 1 1 4 1 1 1 2
3 2 1 1 4 1 1 3 4
3 2 1 1 4 1 1 3 4
3 2 1 1 4 1 1 3 4
4 3 3 2 2 2 1 3 4
1 2 1 1 4 1 1 3 4
3 2 1 1 4 1 1 3 4
3 2 1 1 4 1 1 3 4
3 2 1 1 4 1 1 3 4
3 2 1 1 4 1 1 3 4
1 3 3 4 1 3 2 3 3
PKDF223
1 2
II
III
10
1 1 1 2 1 5 3 2 2 IV D3S1278 D3S1558 D3S2460 D3S1303 D3S4523 D3S1267 D3S1269 D3S1589 D3S3606 129.73cM 133.93cM 134.64cM 136.32cM 138.00cM 139.12cM 139.65cM 141.79cM 143.94cM
1 3 4 5
1 2 2 2 1 3 1 2 4
1 1 1 2 1 5 3 2 3
3 3 2 1 2 1 1 2 2
1 2 3 2 1 4 4 1 1
2 2 1 2 3 2 2 2 2
8
1 2 3 2 1 4 4 1 1
2 2 1 2 3 2 2 2 2
1 2 3 2 1 4 4 1 1
9
3 3 2 1 2 1 1 2 2
10
1 1 1 2 1 5 3 2 3
3 3 2 1 2 1 1 2 2
3 3 2 1 2 1 1 2 2
1 2 2 2 1 3 1 2 4
1 1 1 2 1 5 3 2 3
1 2 2 2 1 3 1 2 4
1 1 1 2 1 5 3 2 3
1 2 2 2 1 3 1 2 4
3 1 1 2 1 5 3 2 3
1 2 2 2 1 5 3 2 2
1 1 1 2 1 5 3 2 3
1 1 1 2 1 5 3 2 4
1 1 1 2 1 5 3 2 3
1 1 1 2 1 5 3 2 2
3 3 2 1 2 1 1 2 2
1 1 1 2 1 5 3 2 2
3 3 2 2 1 5 3 2 3
1 2 2 2 1 3 1 2 4
3 3 2 1 2 1 3 2 3
1 2 2 2 1 3 1 2 4
3 3 2 1 2 1 1 2 2
1 1 1 2 1 5 3 2 2
Fig 3.15 Pedigrees of families PKDF637 and PKDF223 segregating recessive deafness with haplotype of markers at 3q13.31-q21.1. Squares or circles filled with black symbolize individuals affected with NSHL. The core haplotypes are boxed representing the ancestral chromosome harboring DFNB56. A Haplotypes of PKDF637 revealed a homozygosity of approximately 9.4 cM delimited by markers D3S1278 and D3S1267. Affected individual VI:8 provided the centromeric break point at marker D3S1278 while affected individual VI:1provided the telomeric recombination at marker D3S1267. B Haplotypes of PKDF223 showing a homozygous region of 9.3 cM delimited by markers D3S2460 and D3S3606. The STR markers and their relative positions in centimorgan (cM) according to the Marshfield human genetic map are shown on the left side of the each pedigree.
- 128 -
PKDF223
This is the second family that helped to map DFNB56. PKDF223, a small family with three affected members (IV:4, IV:5, and IV:6) in single loop and was enrolled from a Sukkhur (Sindh). Verbal history from multiple individuals was obtained for up to four generations and a detailed pedigree was drawn (Fig 3.15B). In total, sixteen samples were collected for in-depth analysis. This family belongs to Yousaf Zai caste and age of the affected individuals fall in a range of 12 to 20 years. All affected individuals of family PKDF223 exhibit prelingual, bilateral, profound, sensorineural HL, with no obvious vestibular or ocular abnormalities. A representative audiometric profile of an affected individual (IV:5) of family PKDF223 is shown in (Fig 3.16). HAPLOTYPE ANALYSIS For deafness segregating in family PKDF223, evidence of linkage was found at marker D3S1267 (139.12 cM) following a genome wide scan. Haplotype analysis
revealed a region of homozygosity of approximately 9.3 cM (Fig 3.15B) flanked by markers D3S2460 (134.64 cM), a centromeric boundary defined by individual (IV:4) and D3S3606 (143.94 cM) a distal break given by individuals IV:4, IV:5, and IV:6. The Z max of 3.16 at =0 was found for D3S1267 (Table 3.8). Fine mapping of both families revealed that the DFNB56 gene lies within a 4.48 cM genetic interval delimited by D3S2460 (134.64 cM) and D3S1267 (139.12 cM) on chromosome 3q13.31-q21.1. Haplotypes of both families differ from each other; most likely the two mutant alleles would not be the same (Fig 3.15). Approximately 65 putative and known genes are present on 3q13.31-21.1 region, including interesting candidate genes like SLC15A2, UPK1B, CASR, and IQCB1 (Fig 3.17).
- 129 -
MARKERS D3S1278 D3S1558 D3S2460 D3S1303 D3S4523 D3S1267 D3S1269 D3S1589 D3S3606
Table 3.8 Two-Point Lod Scores
Marshfield Map Position (cM) 129.73 133.93 134.64 136.32 138.00 139.12 139.65 141.79 143.94
Z max at = 0 PKDF637 3.16 3.74 3.73 4.84 -1.84 -0.85 PKDF223 0.87 0.91 3.16 2.86
Some markers in the region of homozygosity were not fully informative, thus yielded intermediate positive lod scores. For both families mapped to DFNB56, none of the markers on other chromosome region gave lod score greater than 2.0.
FREQUENCIES
- 10 0 10 20 30 40 50 60 70 80 90 100 110 120
Fig 3.16 Pure tone air conduction audiogram of an affected individual IV:5 (14 years) of family PKDF223. The observed threshold in all deaf subjects showed profound hearing loss. O denote right ear while X denote left ear.
- 130 -
Chr 3
cM
D3S1278 129.73
IGSF11 FLJ32859 UPK1B AF163259 B4GALT4 HCLS1 CDGAP GOLGB1 FLJ10902 BC057227 MSD010 AK126736 IQCB1 EAF2 C3orf1 SLC15A2 CD80 ILDR1 ADPRH AK129974 PLA1A CD86 POPDC2 CASR COX17 CSTA CR749242 E2lG5 C3orf15 WDR5B AF497717 KPNA1 AL133066 PARP9 NR1l2 BX648869 GSK3B AL832929 AY123976 DTX3L AK126260 PARP15 GPR156 PARP14 AY255565 HSPBAP1 AK128198 AK096705 BC013757 BC063629 FSTL1 DIRC2 NDUFB4 AK127315 HGD SEMA5B RABL3 PDIR GTF2E1 AB023223 SEC22L2 ADCY5 BC037531 POLQ
D3S1558 D3S2460 D3S1303 D3S4523 D3S1267 D3S1269 D3S1589 D3S3606
133.93 134.64 136.32 138 139.12 139.65 141.79 143.94
D3S2453
151.55
Fig 3.17 Schematic representation showing a comparison between DFNB42 and DFNB56 linked Pakistani families on chromosome 3q13.31-q21.1. The linkage markers are arranged according to Marshfield genetic map and represented as filled circles. A cross symbol is a meiotic recombination, and the solid vertical line represents the chromosomal intervals in which markers are homozygous for affected individuals. Fine mapping of the two families revealed a centromeric recombination at D3S2460 (134.64 cM) in family PKDF223 while a telomeric recombination was detected at D3S1267 (139.12 cM) in family PKDF637. Thus the linked region for DFNB56 is 4.48 cM delimited by D3S2460 (134.64 cM) and D3S1267 (139.12 cM). Genes inside the interval of DFNB56 are derived from data available on the UCSC Genome Browser as on Jun 2005, while the candidate genes are bolded.
- 131 -
DISCUSSION
Sense of hearing and balance is attributable to conductance of electrical signals via nerve fibers to brain in reaction to stereocilia movements generated by pressure waves of sound. This transduction requires a large ensemble of proteins to act in concert, mutation in any of these proteins can result in deafness (Trussell, 2000). Given the intricacy and fine precision required for the smooth operation of inner ear structures, this implication that approximately 1% of the 30,000 or more human genes are necessary for hearing (Friedman and Griffith 2003), seems to be legitimate. Although, remarkable progress has been made regarding the molecular and biomechanics of sound transduction in the last decade, still little is known about the loci and genes involved in deafness. Till today more than 113 genetic loci for nonsyndromic deafness has been mapped with some successfully traced up to gene and protein level (Hereditary Hearing Loss Homepage). DFNB4/PDS, the 2nd most common locus in Pakistani population (~5.6%; unpublished lab data). Two families PKDF278 and PKDF453 showed linkage to
DFNB4/PDS and have different haplotypes. A reported missense mutation (V239D) in 3rd extra cellular loop of pendrin is identified in PKDF278 (Park et al. 20003), while a novel missense mutation Q446R is identified in PKDF453. Q446R is present in 10th transmembrane domain of pendrin and is a prevalent mutation among Pakistani population (unpublished lab data). Mutations of SLC26A4 contribute to approximately 10% of hereditary deafness in diverse populations including east and south Asians (Park et al. 2003). Normally it is difficult to differentiate between PDS and DFNB4 as the goitrous phenotype is incompletely penetrant and not usually evident until adolescence (Reardon et al 1999). Moreover, phenocopies are common (Kopp et al. 1999) and intermediate perchlorate discharge results are non-diagnostic (Sato et al. 2001). Since these families are remotely resided, clinical diagnosis is difficult. However, no
symptoms of goiter were observed in the affected members of the families PKDF278 and PKDF453 at the time of enrollement; hence considered as DFNB4 families. Two families PKDF176 and PKDF177 are linked to DFNB12/USH1D locus. Although the lod score of both the families does not rise to statistical significance yet there linkages can be further established by enrolling additional members of the families. DFNB12/USH1D is the 5th common deafness locus (3.7%; unpublished lab data) found in Pakistani population. CDH23 is the gene for these two overlapping loci
DFNB12/USH1D which when mutated causes stereocilia abnormalities in number,
- 132 -
organization, shape and position relative to the kinocilium (Bork et al. 2001, Bolz et al. 2001). Affected individuals of both the families have no symptoms of RP and have different haplotypes; so it is predicated that they would carry different mutations of CDH23. The high variability of prevalence between the results could be due to biasness of sample size.
MAPPING OF NEW LOCUS DFNB51

Cosegregation of markers on chromosome11p13-p12 with profound deafness in two families (PKDF240 and PKDF407) defines a novel recessive deafness locus DFNB51 (Fig 3.12). A maximum two-point lod score of 3.5 and 2.5 for markers
D11S4102 and D11S935 at recombination fraction =0 was obtained for families PKDF240 and PKDF407, respectively (Sheikh et al. 2005). Assuming that the deafness segregating in both families PKDF240 and PKDF407 is caused by allelic mutations, haplotype analysis mapped the gene distal to D11S4200 (42.55 cM) and proximal to D11S4102 (47.61 cM), delineating a genetic interval of approximately 5.06 cM (Fig 3.14). Most likely the two mutant alleles will not be the same, as the haplotypes in the DFNB51 interval for the two families are different (Fig 3.12). An alternative possibility is that there are two closely linked deafness loci. To date, several NSHL and syndromic hearing loss loci including DFNB2/A11/USH1B, DFNB18/USH1C, DFNB20, DFNB21/A8/A12, DFNB24, and DFNA32, as well as Jervell and Lange-Nielsen syndrome type 1 (JLNS1) have been localized on chromosome 11 (Friedman and Griffith, 2003). However, all of the above nonsyndromic and syndromic deafness loci and genes are located outside of the DFNB51 genetic interval. Moreover, there is not a reported deaf mouse model mapped to the syntenic region on mouse chromosome 2 corresponding to human chromosome 11p13p12. Approximately 21 genes reside in the DFNB51 interval (5.06 cM) including
candidates such as CD44, SLC1A2, RAMP, and TRAF6 (Fig 3.14). CD44 belongs to a family of transmembrane glycoproteins and is considered to be one of the major hyaluronic acid receptors (Underhill, 1992). Previous studies have indicated that the intracellular domain of CD44 binds to certain cytoskeletal proteins such as ankyrin, and ezrin, moesin, and radixin (Hirao et al. 1996; Bretscher, 1999; Thorne et al. 2004). Recently it was reported that radixin deficiency in a mouse knock out of this gene is associated with deafness (Pataky et al. 2004; Kitajiri et al. 2004).
- 133 -
Another interesting candidate is SLC1A2 (GLT1), which encodes a sodiumdependent glutamate/aspartate transporter, and is a member of a super family of transporters (Kanai et al. 2004). Lethal spontaneous seizures and increased susceptibility to acute cortical injury was observed in a SLC1A2 knock out mouse, but deafness was not reported (Tanaka et al. 1997). Pendred syndrome, DFNB4, and EVA (Enlarged Vestibular Aqueduct) are allelic disorders caused by mutations of SLC26A4 (Everett et al. 1997; Li et al. 1998; Usami et al. 1999). Mutations of SLC26A4 contribute to approximately 10% of hereditary deafness in diverse populations including east and south Asians (Park et al. 2003). RAMP has three major domains, one of which predicts serine protease activity. So far, TMPRSS3 is the only gene encoding a serine protease which when mutated is involved in the etiology of nonsyndromic deafness. Mutations of TMPRSS3 account for 1.8% of the hereditary deafness segregating in 449 families ascertained from Pakistan (Scott et al. 2001; Ben-Yosef et al. 2001; Ahmed et al. 2004). In the linkage interval of 8.33 cM defined by family PKDF240, there is another interesting candidate NGL-1. The human NGL-1 encodes a transmembrane protein
(NGL-1) expressed in embryonic and adult brain (Lin et al. 2003). NGL-1 is reported to bind to two of the three PDZ domains of whirlin and is predicted to be involved in stabilization of interstereociliar links (Delprat et al. 2005). In hair cells of the inner ear whirlin is transported to the tips of stereocilia by myosin XVa (Belyantseva et al. 2005). Mutations of both WHRN, and MYO15A, encoding whirlin and myosin XVa, respectively, are associated with nonsyndromic, congenital, profound HL (Mburu et al. 2003; Wang et al. 1998; Liburd et al. 2001). Sequencing of three genes SLC1A2, RAMP, and TRAF6 was done but no mutation was identified. Results of DFNB51 mapping in two consanguineous families should encourage efforts to replicate these findings in other families in the suggested region and further refine the interval to uncover the causative gene.
MAPPING OF NEW LOCUS DFNB56

DFNB56, a novel locus for nonsyndromic recessive deafness is mapped on two consanguineous families PKDF637 and PKDF223 to chromosome 3q13.3-21.1 (Fig 3.15). A maximum two-point lod score of 4.84 and 3.16 for markers D3S4523 and D3S1267 at recombination fraction =0 was obtained for families PKDF637 and PKDF223, respectively (Table 3.8). Fine mapping of both families revealed that the DFNB56 gene lies within a 4.48 cM genetic interval delimited by D3S2460 (134.64 cM)
- 134 -
and D3S1267 (139.12 cM) on chromosome 3q13.31-q21.1. As the haplotypes of both families differ from each other, most likely the two mutant alleles are not the same. So far, six deafness loci (DFNB6, DFNA18, DFNA44, USH2B, USH3) have been localized on chromosome 3 including DFNB15, which was presumably mapped to 3q21.3-25.2 (Fukushima et al. 1995; Bonsch et al. 2001; Modamio et al. 2003; Hmani et al. 1999; Sankila et al. 1995; Chen et al. 1997). All the above loci segregate deafness as one of the major phenotype and do not overlap with DFNB56 genetic interval. Approximately 65 putative and known genes are present on 3q13.31-21.1 region, including interesting candidate genes like SLC15A2, UPK1B, CASR, and IQCB1, encoding solute carrier family 15 member 2, tansmembrane 4 superfamily member, cellular calcium sensing receptor protein, integral membrane protein, and IQ domain containing protein, respectively (Fig 3.17). Many syndromic and NSHL genes encoding membrane transporters, ionic channels, integral membrane proteins have been reported to play a critical role in homeostasis of endolymph and cochlear function (Friedman and Griffith 2003). One of the candidate gene in the DFNB56 interval is SLC15A2 (PEPT2) encoding a peptide transporter. Pendred syndrome, DFNB4 and EVA are allelic disorder caused by mutations of SLC26A4 (Everett et al. 1997; Li et al. 1998; Usami et al. 1999). Mutations in SLC26A4 contribute to approximately 10% of hereditary deafness in diverse populations including east and south Asians (Park et al. 2003). In conjunction to this SLC12A2 knock out was also reported deaf (Delpire et al. 1999). Targeted
disruption of the SLC15A2 gene markedly reduces the dipeptide uptake in choroids plexus of the kidney. The SLC15A2 knock out has not been reported deaf apparently due to unevaluated hearing phenotype (Hong et al. 2003). Another interesting candidate is Uroplakin1B; a transmembrane protein believed to play a role in ocular surface homeostasis, and stabilizes the apical surface of the mammalian urothelium during bladder distension (Adachi et al. 2000). Five mutant alleles of TMIE (an integral transmembrane protein, with unknown function) have been identified so far as a cause of hearing impairment linked to DFNB6 locus (Naz et al. 2002). Similarly TMC1 (transmembrane channel-like gene1) is predicted to encode a multipass transmembrane protein was found to be mutated in families segregating DFNA36 and DFNB7/11 deafness (Kurima et al. 2002). CASR is defective in familial hypocalciuric hypercalcemia, type1 (FHH1) and is involved in maintaining and sensing
- 135 -
the extracellular calcium ions concentration (Aida et al. 1995). Knock out of Pmca2 gene encoding plasma membrane Ca+ ATPase isoform 2 was found to be deaf (Kozel et al. 1998; Street et al. 1998). Pmca2 is expressed in stereocilia and basolateral membrane of hair cells, where it is proposed to extrude intracellular calcium and maintain a high local concentration of calcium in the endolymph surrounding hair cells (Yamoah et al. 1998). DFNB42 has been recently mapped to a 21.6 cM region on chromosome
3q13.31-q22.3 in a Pakistan family (Aslam et al. 2005), which seems to overlap the smaller interval (4.48 cM) defined by DFNB56 (Fig 3.17). The acronyms DFNB56 and DFNB42 were assigned by HUGO, considering the postulates that the mapped regions (DFNB56 & DFNB42) are two closely spaced DFNB loci, which might have mutations in different underlying genes. The other possibility is that these two loci might turn over to be the mutant alleles of a same gene. The confirmation of either of the postulates will be determined by the identification of underlying gene in both cases. More than 60 recessive loci have been mapped/reserved till today and it has been obsereved that loci/genes are population specific; DFNB1, DFNB2, DFNB3, DFNB4, DFNB7/1, DFNB8/B10, DFNB12, DFNB23, and DFNB39 are some of the common loci in Pakistan. Marriages within the family are quite common in our culture. Therefore, in recessive deafness it is possible to identify carriers and to offer genetic counseling to the families to reduce the incidence of hereditary deafness in our population. For obtaining this objective, the need is to characterize the deafness at molecular level and identify genes that contribute the most to HL in the respective country. Since NSHL is the most prevalent form of hereditary deafness, mapping of new genetic location always promises the identification and characterizing genes and genes products expressing in the inner ear, which will ultimately augment our understanding regarding the molecular processes behind the development and maintenance of the auditory system. Similarly, identification of DFNB51 and DFNB56 hold the promise to fill the missing links of auditory pathway and to unveil the absorbing biology of the hearing. Moreover, it confirms the genetic heterogeneity underlying autosomal recessive forms of nonsyndromic deafness. This research work will be succeeded if the continuing voyage of discovery of deafness loci and causative genes will finish. Yet, the journey is far from finish.
- 136 -
CHAPTER-IV
- 137 -
Abe, S., Usami, S., Shinkawa, H., Kelley, P. M., Kimberling, W. J. (2000) Prevalent connexin 26 gene (GJB2) mutations in Japanese. J. Med. Genet. 37:41-43. Adachi, W., Okubo, K., Kinoshita, S. (2000) Human Uroplakin1B in ocuar surface epithelium. Invest Ophthalmol Vis Sci 41:2900-2905. Adato, A., Weil, D., Kalinski, H., Pel-Or, Y., Ayadi, H., Petit, C., Korostishevsky, M., Bonne-Tamir, B. (1997) Mutation profile of all 49 exons of the human myosin VIIA gene, and haplotype analysis, in usher 1B families from diverse origins. Am J Hum Genet 61:813-821. Adato, A., Michel, V., Kikkawa, Y., Reiners, J., Alagramam, K. N., Weil, D., Yonekawa, H., Wolfrum, U., El-Amraoui, A., Petit, C. (2005) Interactions in the network of usher syndrome type 1 proteins. Hum Mol Genet 14:347356. Ahmad, J., Khan, S. N., Khan, S. Y., Ramzan, K., Riazuddin, S., Ahmed, Z. M., Wilcox, E. R., Friedman, T. B., Riazuddin, S. (2005) DFNB48, a new nonsyndromic recessive deafness locus, maps to chromosome 15q23-q25.1. Hum Genet 116:407-412 Ahmed, Z. M., Riazuddin, S., Bernstein, S. L., Ahmed, Z., Khan, S., Griffith, A. J., Morell, R. J., Friedman, T. B., Wilcox, E. R. (2001) Mutations of the protocadherin gene PCDH15 cause Usher syndrome type 1F. Am J Hum Genet 69:25-34. Ahmed, Z. M., Smith, T. N., Riazuddin, S., Makisima, T., Ghosh, M., Bokhari, S., Menon, P. S. N., Desmukh, D., Griffith, A. J., Riazuddin, S., Friedman, T. B., Wilcox, E. R. (2002) Nonsyndromic Recessive Deafness DFNB18 and Usher Syndrome Type IC Are Allelic Mutations of USHIC. Hum Genet. 110:527-531. Ahmed, Z. M., Riazuddin, S., Ahmad, J. Bernstein, S. L., Guo, Y., Sabar, M. F., Sieving, P., Riazuddin, S., Griffith, A. J., Friedman, T. B., Belyantseva, I. A., Wilcox, E. R. (2003) PCDH15 is expressed in the neurosensory epithelium of the eye and ear and mutant alleles are responsible for both USH1F and DFNB23. Hum Mol Genet 12 32153223. Ahmed, Z. M., Riazuddin, S., Riazuddin, S., Wilcox, E. R. The molecular genetics of Usher syndrome. (2003a) Clin Genet 63:431-444 Ahmed, Z. M., Morell, R. J., Riazuddin, S., Gropman, A., Shaukat, S., Ahmad, M. M., Mohiddin, S. A., Fananapazir, L., Caruso, R. C., Husnain, T., Khan, S. N., Riazuddin, S., Griffith, A. J., Friedman, T. B., Wilcox, E. R. (2003b) Mutations of MYO6 are associated with recessive deafness, DFNB37. Am J Hum Genet 72:1315-1322. Ahmed, Z. M., Li, X. C., Powell, S. D., Riazuddin, S., Young, T. L., Ramzan, K., Ahmad, Z., Luscombe, S., Dhillon, K., MacLaren, L., Ploplis, B., Shotland, L. I., Ives, E., Riazuddin, S., Friedman, T. B., Morell, R. J. and Wilcox, E. R. (2004) Characterization of a new full length TMPRSS3 isoform and identification of mutant alleles responsible for nonsyndromic recessive deafness in Newfoundland and Pakistan. BMC Med Genet 5: 24. Aida, K., Koishi, S., Inoue, M., Nakazato, M., Tawata, M., Onaya, T. (1995) Familial hypocalciuric hypercalcemia associated with mutation in the human Ca(2+)-sensing receptor gene. J. Clin. Endocr. Metab 80:2594-2598. Alagramam, K. N., Yuan, H., Kuehn, M. H., Murcia, C. L., Wayne, S., Srisailpathy, C. R., Lowry, R. B., Knaus, R., Van Laer, L., Bernier, F. P., Schwartz, S., Lee, C., Morton, C. C., Mullins, R. F., Ramesh, A., Van Camp, G., Hageman, G. S., Woychik, R. P.,
- 138 -
Smith, R. J., Hagemen, G. S. (2001) Mutations in the novel protocadherin PCDH15 cause Usher syndrome type 1F. Hum Mol Genet 10:1709-18. Alagramam, K. N., Murcia, C. L., Kwon, H. Y., Pawlowski, K. S., Wright, C. G., Woychik, R. P. (2001a) The mouse Ames waltzer hearing-loss mutant is caused by mutation of Pcdh15, a novel protocadherin gene. Nat Genet 27:99-102. Altman, D., Sweeney, H. L., Spudich, J. A. (2004) The mechanism of myosin VI translocation and its load-induced anchoring. Cell 116:737-749. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. (1990) Basic local alignment search tool. J Mol Biol 215:403-10. Anderson, D. W., Probst, F. J., Belyantseva, I. A., Fridell, R. A., Beyer, L., Martin, D. M., Wu, D., Kachar, B., Friedman, T. B., Raphael, Y., Camper, S. A. (2000) The motor and tail regions of myosin XV are critical for normal structure and function of auditory and vestibular hair cells. Hum Molec Genet 9:1729-1738. Ansar, A., Aminudin, M., Arshad, M., Sohail, M., Faiyaz-ul-Haq, M., Haque, S., Ahmed, W., Leal, S. M. (2003a) A Novel Autosomal Recessive Non-Syndromic Deafness Locus (DFNB35) Maps to 14q24.114q24.3 in Large Consanguineous Kindred from Pakistan. Euro J Hum Genet 11:77-80. Ansar, A., Ramzan, M., Pham, T. L., Yan, K., Jamal, S. M., Haque, S., Ahmad, W., Leal, S. M. (2003b) Localization of A Novel Autosomal Recessive Non-Syndromic Hearing Impairment Locus (DFNB38) to 6q26-q27 in a Consanguineous Kindred from Pakistan. Hum Hered 55:71-74. Ansar, M., Chahrour, M. H., Amin ud Din, M., Arshad, M., Haque, S., Pham, T. L., Yan, K., Ahmad, W., Leal, S. M. (2004) DFNB44, a novel autosomal recessive nonsyndromic hearing impairment locus, maps to chromosome 7p14.1-q11.22. Hum Hered 57:195-199. Aslam, M., Wajid, M., Chahrour, M. H., Ansar, M, Haque, S., Pham, T. L., Santos, R. P., Yan, K., Ahmad, W., Leal, S. M. (2005) A Novel Autosomal Recessive Nonsyndromic Hearing Impairment Locus (DFNB42) Maps to Chromosome 3q13.31-q22.3. Am J Med Genet 133:18-22. Assad, J. A., Corey, D. P. (1992) An active motor model for adaptation by vertebrate hair cells. J Neurosci 12:3291-3309. Assad, J. A., Shepherd, G. M., Corey, D. P. (1991) Tip-link integrity and mechanical transduction in vertebrate hair cells. Neuron 7:985-994. Astuto, L. M., Weston, M. D., Carney, C. A., Hoover, D. M., Cremers, C. W., Wagenaar, M., Moller, C., Smith, R. J., Pieke-Dahl, S., Greenberg, J., Ramesar, R., Jacobson, S. G., Ayuso, C., Heckenlively, J. R., Tamayo, M., Gorin, M. B., Reardon, W., Kimberling, W. J. (2000) Genetic heterogeneity of Usher syndrome: analysis of 151 families with Usher type I. Am J Hum Genet 67:1569-74. Astuto, L. M., Philip, M. K., James, W. A., Weston, M. D., Smith, R. J., Alswaid, A. F., Mona, Al-Rakf., Kimberling, W. J. (2002) Searching for evidence of DFNB2. Am J Hum Genet 109: 291-297. Astuto, L. M., Bork, J. M., Weston, M. D., Askew, J. W., Fields, R. R., Orten, D. J., Ohliger, S. J., Riazuddin, S., Morell, R. J., Khan, S., Riazuddin, S., Kremer, H., van
- 139 -
Hauwe, P., Moller, C. G., Cremers, C. W., Ayuso, C., Heckenlively, J. R., Rohrschneider, K., Spandau, U., Greenberg, J., Ramesar, R., Reardon, W., Bitoun, P., Millan, J., Legge, R., Friedman, T. B., Kimberling, W. J. (2002a) CDH23 mutation and phenotype heterogeneity: a profile of 107 diverse families with Usher syndrome and nonsyndromic deafness. Am J Hum Genet 71:262-275. Avraham, K. B., Hasson, T., Steel, K. P., Kingsley, D. M., Russell, L. B., Mooseker, M. S., Copeland, N. G., Jenkins, N. A. (1995) The mouse Snell's waltzer deafness gene encodes an unconventional myosin required for structural integrity of inner ear hair cells. Nature Genet 11:369-375. Avraham, K. B. (1998) Hear come more genes! Nat Med 4:1238-1239. Balciuniene, J., Dahl, N., Jalonen, P., Verhoeven, K., Van Camp, G., Borg, E., Pettersson, U., Jazin, E. E. (1999) Alpha-tectorin involvement in hearing disabilities: one gene-two phenotypes. Hum Genet 105:211-216. Baldwin, C. T., Weiss, S., Farrer, L. A., De Stefano, A. L., Adair, R., Franklyn, B., Kidd, K. K., Korostishevsky, M., Bonne-Tamir, B. (1995) Linkage of congenital, recessive deafness (DFNB4) to chromosome 7q31 and evidence for genetic heterogeneity in the Middle Eastern Druze population. Hum Mol Genet 4:1637-1642. Batters, C., Arthur, C. P., Lin, A., Porter, J., Geeves, M. A., Milligan, R. A., Molloy, J. E., Coluccio, L. M. (2004) Myo1c is designed for the adaptation response in the inner ear. EMBO J 23:1433-1440. Belyantseva, I. A., Boger, E. T., Friedman, T. B. (2003a) Myosin XVa localizes to the tips of inner ear sensory cell stereocilia and is essential for stair case formation of the hair bundle. Proc Natl Acad Sci USA 100:13958-13963. Belyantseva, I. A., Labay, V., Boger, E. T., Griffith, A. J. Friedman, T. B. (2003b) Stereocilia: the long and the short of it. Trends Mol Med 9:458-461. Belyantseva, I. A., Boger, E. T., Naz, S., Frolenkov, G. I., Sellers, J. R., Ahmed, Z. M., Griffith, A. J., Friedman, T. B. (2005) Myosin-XVa is required for tip localization of whirlin and differential elongation of hair-cell stereocilia. Nat Cell Biol 7:148-156. Ben-Yosef, T., Wattenhofer, M., Riazuddin, S., Ahmed, Z. M., Scott, H. S., Kudoh, J., Shibuya, K., Antonarakis, S. E., Bonne-Tamir, B., Radhakrishna, U., Naz, S., Ahmed, Z., Riazuddin, S., Pandya, A., Nance, W. E., Wilcox, E. R., Friedman, T. B., Morell, R. J. (2001) Novel mutations of TMPRSS3 in four DFNB8/B10 families segregating congenital autosomal recessive deafness. J Med Genet 38:396-400. Ben-Yosef, T., Belyantseva, I., Saunders, T. L., Hughes, E. D., Kawamoto, K., et al. (2002) Claudin 14 tight junction knockout mice are deaf due to cochlear hair cell degeneration. Mol Biol Cell 13:497a. Ben-Yosef, T., Ness, S. L., Madeo, A. C., Bar-Lev, A., Wolfman, J. H., Ahmed, Z. M., Desnick, R. J., Willner, J. P., Avraham, K. B., Ostrer, H., Oddoux, C., Griffith, A. J., Friedman, T. B. (2003) A mutation of PCDH15 among Ashkenazi Jews with the type 1 Usher syndrome. N Engl J Med 348:1664-1670. Bergstrom, L., Hemenway, W. G., Downs, M. P. (1971) A high risk registry to find congenital deafness. Otolaryngol Clin North Am 4:369-399.
- 140 -
Bergstrom, L. (1980) Pendreds syndrome with atypical features. Annals of Otology, Rhinology and Laryngology 89:135139. Beyer, L. A., Odeh, H., Probst, F. J., Lambert, E. H., Dolan, D. F., Camper, S. A., Kohrman, D. C., Raphael, Y. (2000). Hair cells in the inner ear of the pirouette and shaker 2 mutant mice. J Neurocytol 29:227-240. Bharadwaj, A. K., Kasztejna, J. P., Huq, S., Berson, E. L. and Dryja, T. P. (2000) Evaluation of the myosin VIIA gene and visual function in patients with Usher syndrome type I. Exp Eye Res 71:173-81. Bhattacharya G, Miller C, Kimberling WJ, Jablonski MM, Cosgrove D. Localization and expression of usherin: a novel basement membrane protein defective in people with Ushers syndrome type IIa. (2002) Hear Res 163: 111 Bitner-Glindzicz, M., Lindley, K. J., Rutland, P., Blaydon, D., Smith, V. V., Milla, P. J., Hussain, K., Furth-Lavi, J., Cosgrove, K. E., Shepherd, R. M., Barnes, P. D., O'Brien, R. E., Farndon, P. A., Sowden, J., Liu, X. Z., Scanlan, M. J., Malcolm, S., Dunne, M. J., Aynsley-Green, A. and Glaser, B. (2000) A recessive contiguous gene deletion causing infantile hyperinsulinism, enteropathy and deafness identifies the Usher type 1C gene. Nat Genet 26:56-60. Blumenfeld, H. (2001) Neuroanatomy through Clinical Cases. Yale University School of Medicine, New York. Boeda, B., El-Amraoui, A., Bahloul, A., Goodyear, R., Daviet, L., Blanchard, S., Perfettini, I., Fath, K. R., Shorte, S., Reiners, J., Houdusse, A., Legrain, P., Wolfrum, U., Richardson, G., Petit, C. (2002) Myosin VIIa, harmonin, and cadherin 23, three Usher I gene products, cooperate to shape the sensory hair cell bundle. EMBO J 21:6689-6699. Bolz, H., von Brederlow, B., Ramirez, A., Bryda, E. C., Kutsche, K., Nothwang, H. G., Seeliger, M., del, C. S. C. M., Vila, M. C., Molina, O. P., Gal, A., Kubisch, C. (2001) Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D. Nat Genet 27:108-112. Bolz, H., Bolz, S. S., Schade, G., Kothe, C., Mohrmann, G., Hess, M., Gal, A. (2004) Impaired calmodulin binding of myosin-7A causes autosomal dominant hearing loss (DFNA11). Hum Mutat 24: 274-275. Bonne-Tamir, B., DeStefano, A. L., Briggs, C. E., Adair, R., Franklyn, B., Weiss, S., Korostishevsky, M., Frydman, M., Baldwin, C. T., Farrer, L. A. (1996) Linkage of congenital recessive deafness (gene DFNB10) to chromosome 21q22.3. Am J Hum Genet 58:1254-1259. Bonsch, D., Scheer, P., Neumann, C., Lang Roth, R., Seifert, E., Storch, P., Weiller, C., Lamprecht Dinnesen, A., Deufel, T. (2001) A novel locus for autosomal dominant, nonsyndromic hearing impairment (DFNA18) maps to chromosome 3q22 immediately adjacent to the DM2 locus. Eur J Hum Genet 9:165-170. Bork, J. M., Peters, L. M., Riazuddin, S., Bernstein, S. L., Ahmed, Z. M., Ness, S. L., Polomeno, R., Ramesh, A., Schloss, M., Srisailpathy, C. R., Wayne, S., Bellman, S., Desmukh, D., Ahmed, Z., Khan, S. N., Kaloustian, V. M., Li, X. C., Lalwani, A., Riazuddin, S., Bitner-Glindzicz, M., Nance, W. E., Liu, X. Z., Wistow, G., Smith, R. J., Griffith, A. J., Wilcox, E. R., Friedman, T. B., Morell, R. J. (2001) Usher syndrome 1D
- 141 -
and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of the novel cadherin-like gene CDH23. Am J Hum Genet 68:26-37. Botstein, D., White, R. L., Skolnick, M., Davis, R. W. (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 32: 314-331. Boughman, J. A., Vernon, M. and Shaver, K. A. (1983) Usher syndrome: definition and estimate of prevalence from two high-risk populations. J Chronic Dis 36:595-603. Bretscher, A. (1999) Regulation of cortical structure by the ezrin-radixin-moesin protein family. Curr Opin Cell Biol 11:109-116. Brownstein, Z., Friedlander, Y., Peritz, E., Cohen, T. (1991) Estimated number of loci for autosomal recessive severe nerve deafness within the Israeli Jewish population, with implications for genetic counseling. Am J Med Genet 41: 306-312. Brunner, H. G., van Bennekom, A., Lambermon, E. M., Oei, T. L., Cremers, W. R., Wieringa, B., Ropers, H. H. (1988) The gene for X-linked progressive mixed deafness with perilymphatic gusher during stapes surgery (DFN3) is linked to PGK. Hum Genet 80: 337-40. Campbell, C., Cucci, R. A., Prasad, S., Green, G. E., Edeal, J. B., Galer, C. E., Karniski, L. P., Sheffield, V. C., Smith, R. J. H. (2001) Pendred syndrome, DFNB4, and PDS/SLC26A4 identification of eight novel mutations and possible genotype-phenotype correlations. Hum Mutat 17:403-411. Carrasquillo, M. M., Zlotogora, J., Barges, S., Chakravarti, A. (1997) Two different connexin 26 mutations in an inbred kindred segregating nonsyndromic recessive deafness: implications for genetic studies in isolated populations. Hum Mol Genet 6:2163-2172. Chaib, H., Lina-Granade, G., Guilford, P., Plauchu, H., Levilliers, J., Morgon, A., Petit, C. (1994) A gene responsible for a dominant form of neurosensory nonsyndromic deafness maps to the NSRD1 recessive deafness gene interval. Hum Mol Genet 3:22192222. Chaib, H., Place, C., Salem, N., Dode, C., Chardenoux, S., Weissenbach, J., el Zir, E., Loiselet, J. and Petit, C. (1996) Mapping of DFNB12, a gene for a non-syndromal autosomal recessive deafness, to chromosome 10q21-22. Hum Mol Genet 5:1061-4. Chen, A., Wayne, S., Bell, A., Ramesh, A., Srisailpathy, C. R., Scott, D. A,, Sheffield, V. C., Van Hauwe, P., Zbar, R. I., Ashley, J., Lovett, M., Van Camp, G., Smith, R. J. (1997) New gene for autosomal recessive nonsyndromic hearing loss maps to either chromosome 3q or 19p. Am J Med Genet 71:467-471. Chen, H. (1988) Introduction to Human Genetics. In: Medical Genetics Handbook Green, W. H. Missouri, USA. Chung, C. S., Robison, O. W., Morton, N.E. (1959) A note on deaf mutism. Ann Hum Genet 23: 357366. Chung, C. S. and Brown, K. S. (1970) Family studies of early childhood deafness ascertained through the Clarke School for the Deaf. Am J Hum Genet 22: 630644. Cohen-Salmon M, El-Amraoui A, Leibovici M, Petit C. Otogelin: a glycoprotein specific to the acellular membranes of the inner ear. (1997) Proc Natl Acad Sci USA 94: 144505
- 142 -
Cohen-Salmon, M., Ott, T., Michel, V., Hardelin, J.-P., Perfettini, I., Eybalin, M., Wu, T., Marcus, D. C., Wangemann, P., Willecke, K., Petit, C. (2002 Targeted ablation of connexin26 in the inner ear epithelial gap junction network causes hearing impairment and cell death. Curr. Biol. 12: 1106-1111. Conneally, P. M., and Rivas. (1980) Linakge analysis in man. New York, Plenum. Corey, D. P., Hudspeth, A. J. (1979) Ionic basis of the receptor potential in a vertebrate hair cell. Nature 281:675677. Corey, D. P. and Hudspeth, A. J. (1983) Kinetics of the receptor current in bullfrog saccular hair cells. J. Neurosci 3: 962-976. Corwin, J. T. and Warchol, M. E. (1991) Auditory hair cells: structure, function, development, and regeneration. Annu Rev Neurosci 14:301-33. Cosgrove D, Samuelson G, Pinnt J. Immunohistochemical localization of basement membrane collagens and associated proteins in the murine cochlea. (1996a) Hear Res 97: 5465 Cosgrove D, Kornak JM, Samuelson G. Expression of basement membrane type IV collagen chains during postnatal development in the murine cochlea. (1996b) Hear Res 100: 2132 Costeff, H. and Dar, H. (1980) Consanguinity analysis of congenital deafness in Northern Israel. Am J Hum Genet 32: 6468. Coyle, B., Coffey, R., Armour, J. A. L., Gausden, E., Hochberg, Z., Grossman, E., Britton, K., Pembrey, M., Reardon, W., Trembath, R. (1996) Pendred syndrome (goitre and sensorineural hearing loss) maps to chromosome 7 in the region containing the nonsyndromic deafness gene DFNB4. Nat Genet 12:421-423. Coyle, B., Reardon, W., Herbrick, J. A., Tsui, L. C., Gausden, E., Lee, J., Coffey, R., Grueters, A., Grossman, A., Phelps, P. D., Luxon, L., Kendall-Taylor, P., Scherer, S. W., Trembath, R. C. (1998) Molecular analysis of the PDS gene in pendred syndrome. Hum Mol Genet 7:1105-1112. Cranefield, P.F. and W. Federn. (1970) Paulus Zacchias on mental deficiency and on deafness. Bull NY Acad Med 46: 321. Crawford, A. C., Evans, M. G., Fettiplace, R. (1989) Activation and adaptation of transducer currents in turtle hair cells. J Physiol (Lond.) 419:405-434. Cremers, W. R., Bolder, C., Admiraal, R. J., Everett, L. A., Joosten, F. B., van Hauwe, P., Green, E. D., Otten, B. J. (1998) Progressive sensorineural hearing loss and a widened vestibular aqueduct in Pendred syndrome. Archives of Otolaryngology Head and Neck Surgery 124:501505. Crouch, J. J., Sakaguchi, N., Lytle, C., Schulte, B. A. J Immunohistochemical localization of the Na-K-Cl co-transporter (NKCC1) in the gerbil inner ear. (1997) Histochem Cytochem 45:773-778 Das, V. K. (1996) Aetiology of bilateral sensorineural hearing impaiment in children: a 10 year study. Arch Dis Childhood 74: 812. Davenport, S. L. H. and Omenn, G. S. (1977) The Heterogeneity of Usher syndrome. Paper presented at Int Conf Birth Defects. Montreal.
- 143 -
del Castillo, I., Villamar, M., Moreno-Pelayo, M. A., del Castillo, F. J., Alvarez, A., Telleria, D., Menendez, I., Moreno, F. (2002) A deletion involving the connexin 30 gene in nonsyndromic hearing impairment. New Eng J Med 346:243-249. Delpire, E., Lu, J., England, R., Dull, C., Thorne, T. (1999) Deafness and imbalance associated with inactivation of the secretory Na-K-2Cl co-transporter. Nat Genet 22:192-195. Delprat, B., Michel, V., Goodyear, R., Yamasaki, Y., Michalski, N., El-Amraoui, A., Perfettini, I., Legrain, P., Richardson, G., Hardelin, J. P., Petit, C. (2005) Myosin XVa and whirlin, two deafness gene products required for hair bundle growth, are located at the stereocilia tips and interact directly. Hum Mol Genet 14:401-410. den Dunnen, J. T., and Antonarakis, S. E: (2001) Nomenclature for the description of human sequence variations. Hum Genet 109:121-124. Denoyelle, F., Lina-Granade, G., Plauchu, H., Bruzzone, R., Chaib, H., Levi-Acobas, F., Weil, D., Petit, C.(1998) Connexin 26 gene linked to a dominant deafness. Nature 393: 319-320. DeRosier, D. J., Tilney, L. G., Egelman, E. (1980) Actin in the inner ear: the remarkable structure of the stereocilium. Nature 287:291-226. DeRosier, D. J., Tilney, L. G. (2000) F-actin bundles are derivatives of microvilli: what does this tell us about how bundles might form? J Cell Biol 148:1-6. Di Palma, F., Holme, R. H., Bryda, E. C., Belyantseva, I. A., Pellegrino, R., Kachar, B., Steel, K. P., Noben-Trauth, K. (2001) Mutations in Cdh23, encoding a new type of cadherin, cause stereocilia disorganization in waltzer, the mouse model for Usher syndrome type 1D. Nat Genet 27:103-107. Donaudy, F., Zheng, L., Ficarella, R., Ballana, E., Carella, M., Melchionda, S., Estivill, X., Bartles, J. R., Gasparini, P. (2005) Espin gene (ESPN) mutations associated with autosomal dominant hearing loss cause defects in microvillar elongation or organization. J Med Genet Published Online Jun 1. Eatock, R. A. (2000) Adaptation in Hair Cells. Annu Rev Neurosci 23:285-314. Estivill, X., Fortina, P., Surrey, S., Rabionet, R., Melchionda, S., D-Agruma, L., Mansfield, E., Rappaport, E., Govea, N., Mila, M., Zelante, L., Gasparini, P. (1998) Connexin-26 mutations in sporadic and inherited sensorineural deafness. Lancet 351:394-398. El-Amraoui, A., Sahly, I., Picaud, S., Sahel, J., Abitbol, M., Petit, C. Human Usher 1B/mouse shaker-1: the retinal phenotype discrepancy explained by the presence/absence of myosin VIIA in the photoreceptor cells. (1996) Hum Mol Genet 5:1171-1178 El-Amraoui, A., Schonn, J. S., Kussel-Andermann, P., Blanchard, S., Desnos, C., Henry, J. P., Wolfrum, U., Darchen, F. and Petit, C. (2002) MyRIP, a novel Rab effector, enables myosin VIIa recruitment to retinal melanosomes. EMBO Rep 3:463-70. Elahi, M. M., Elahi, F., Elahi, A., Elahi, S. B. (1998) Paediatric hearing loss in rural Pakistan. J Otolaryngol 27:348-353. Ernest, S., Rauch, G. J., Haffter, P., Geisler, R., Petit, C. and Nicolson, T. (2000) Mariner is defective in myosin VIIA: a zebrafish model for human hereditary deafness. Hum Mol Genet 9:2189-96.
- 144 -
Eudy, J. D., Weston, M. D., Yao, S., Hoover, D. M., Rehm, H. L., Ma-Edmonds, M., Yan, D., Ahmad, I., Cheng, J. J., Ayuso, C., Cremers, C., Davenport, S., Moller, C., Talmadge, C. B., Beisel, K. W., Tamayo, M., Morton, C. C., Swaroop, A., Kimberling, W. J. and Sumegi, J. (1998) Mutation of a gene encoding a protein with extracellular matrix motifs in Usher syndrome type IIa. Science 280:1753-7. Everett, L. A., Glaser, B., Beck, J. C., Idol, J. R., Buchs, A., Heyman, M., Adawi, F., Hazani, E., Nassir, E., Baxevanis, A. D., Sheffield, V. C., Green, E. D. (1997). Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nat. Genet., 17: 411-422. Everett, L. A., Belyantseva, I. A., Noben-Trauth, K., Cantos, R., Chen, A., Thakkar, S. I., Hoogstraten-Miller, S. L., Kachar, B., Wu, D. K., Green, E. D. (2001) Targeted disruption of mouse Pds provides insight about the inner-ear defects encountered in Pendred syndrome. Hum Mol Genet 10:153161. Fettiplace, R., Ricci, A. J. (2003) Adaptation in auditory hair cells. Curr Opin Neurobiol. 13:446-451. Forge A, Becker D, Casalotti S et al. Gap junctions and connexin expression in the inner ear. (1999) Novartis Found Symp 219: 13450, discussion 1516 Forge, A., and Wright, T. (2002) The molecular architecture of the inner ear. Br Med Bull 63:5-24. Foroud, T. (1997) Introduction to genetic linkage analysis. Cancer Invest 15: 548-552. Fraser, G. R. (1976) The causes of profound deafness in childhood. The Johns Hopkins University Press, Baltimore, MD. Friedman, T. B., Liang, Y., Weber, J. L., Hinnant, J. T., Barber, T. D., Winata, S., Arhya, I. N. Asher Jr, J. H. (1995) A gene for congenital recessive deafness DFNB3 maps to the pericentromeric region of chromosome 17. Nat Genet 9: 86-91. Friedman, T. B., and Griffith, A. J. (2003) Human nonsyndromic sensorineural deafness. Annu Rev Genomics Hum Genet 4:341402. Friedman, T. B., Schultz, J. M., Ben-Yosef, T., Pryor, S. P., Lagziel, A., Fisher, R. A., Wilcox, E. R., Riazuddin, S., Ahmed, Z. M., Belyantseva, I. A., Griffith A. J. (2003a) Recent Advances in the Understanding of Syndromic Forms of Hearing Loss. Ear and Hearing 24:289302. Frolenkov, G. I., Belyantseva, I. A., Friedman, T. B., Griffith, A. J. (2004) Genetic insights into the morphogenesis of inner ear hair cells. Nature review Genetics 5:489498 Fukushima, K., Ramesh, A., Srisailapathy, C. R. S., Ni, L., Wayne, S., O'Neill, M. E., Van Camp, G., Coucke, P., Jain, P., Wilcox, E. R., Smith, S. D., Kenyon, J. B., Zbar, R. I. S., Smith, R. J. H. (1995b) An autosomal recessive nonsyndromic form of sensorineural hearing loss maps to 3p-DFNB6. Genome Res 5:305-308. Gabriel, H. D., Jung, D., Butzler, C., Temme, A., Traub, O., Winterhager, E., Willecke, K. (1998) Transplacental uptake of glucose is decreased in embryonic lethal connexin26 deficient mice J Cell Biol 140:1453-461.
- 145 -
Gibson, F., Walsh, J., Mburu, P., Varela, A., Brown, K. A., Antonio, M., Beisel, K. W., Steel, K. P. and Brown, S. D. (1995) A type VII myosin encoded by the mouse deafness gene shaker-1. Nature 374:62-4. Gillespie, P. G., Corey, D. P. (1997) Myosin and adaptation by hair cells. Neuron 19:955-958. Goodyear, R. J., Legan, P. K., Wright, M. B., Marcotti, W., Oganesian, A., Coats, S. A., Booth, C. J., Kros, C. J., Seifert, R. A., Bowen-Pope, D. F., Richardson, G. P. (2003). A receptor-like inositol lipid phosphatase is required for the maturation of developing cochlear hair bundles. J Neurosci 23:9208-9219. Goodyear, R. J., Marcotti, W., Kros, C. J., Richardson, G. P. (2005) Development and properties of stereociliary link types in hair cells of the mouse cochlea. J Comp Neurol 485:75-85. Goldstein, M.A. (1933) Problems of the deaf. The Laryngoscope Press, St. Louis, MO. Gorlin, R. J., Toriello, H. V. and Cohen, M. M. (1995) Hereditary Hearing Loss and Its Syndromes. Oxford University Press, New York/Oxford. Graham, A. (2000) Development. Hear, hear, for the inner ear. Science 290:1904-5. Grimberg, J., Nawoschik, S., Belluscio, L., McKee, R., Turck, A., Eisenberg, A. (1989) A simple and efficient non-organic procedure for the isolation of genomic DNA from blood. Nucleic Acids Res 17:8390. Grondahl, J. (1987) Estimation of prognosis and prevalence of retinitis pigmentosa and usher syndrome in Norway. Clin Genet 31:255-64. Guilford, P., Ben Arab, S., Blanchard, S., Levilliers, J., Weissenbach, J., Belkahia, A., Petit, C. (1994a) A non-syndrome form of neurosensory, recessive deafness maps to the pericentromeric region of chromosome 13q. Nat Genet 6: 24-28. Guilford, P., Ayadi, H., Blanchard, S., Chaib, H., Le Paslier, D., Weissenbach, J., Drira, M. and Petit, C. (1994b) A human gene responsible for neurosensory, nonsyndromic recessive deafness is a candidate homologue of the mouse sh 1 gene. Hum Mol Genet 3:989-93. Guipponi, M., Vuagniaux, G., Wattenhofer, M., Shibuya, K., Vazquez, M., Dougherty, L., Scamuffa, N., Guida, E., Okui, M., Rossier, C., Hancock, M., Buchet, K., Reymond, A., Hummler, E., Marzella, P. L., Kudoh, J., Shimizu, N., Scott, H. S., Antonarakis, S. E., Rossier, B. C. (2002) The transmembrane serine protease (TMPRSS3) mutated in deafness DFNB8/10 activates the epithelial sodium channel (ENaC) in vitro. Hum Mol Genet 11(23):2829-2836. Hallgren, B. (1959) Retinitis pigmentosa combined with congenital deafness, with vestibulo-cerebellar ataxia and mental abnormality in a proportion of cases. A clinical and genetico-statistical study. Munksgaard, Copenhagen. Hammersschlag, V. (1907) Zur Kenntnis der hereditaer-de-generativen Taubstummen und ihre differential-diagnostische Bedeutung. Z Ohrenheilk 54:18-36. Hampton, L. L., Wright, C. G., Alagramam, K. N., Battey, J. F., Noben-Trauth, K. (2003) A new spontaneous mutation in the mouse Ames waltzer gene, Pcdh15. Hear Res 180:67-75.
- 146 -
Harris, B. Z., Lim, W. A. (2001) Mechanism and role of PDZ domains in signaling complex assembly. J Cell Sci 114:3219-3231. Hartmann, A. (1881) Deafmutism and the education of deaf mutes by lipreading and articulation. (translated by J.P. Cassels) Balliere, Tindall and Cox, London, UK. Harvey SJ, Mount R, Sado Y et al. The inner ear of dogs with X-linked nephritis provides clues to the pathogenesis of hearing loss in X-linked Alport syndrome. (2001) Am J Pathol 159: 1097104 Hasko JA, Richardson GP. The ultrastructural organization and properties of the mouse tectorial membrane matrix. (1988) Hear Res 35: 2138 Hasson, T., Heintzelman, M. B., Santos-Sacchi, J., Corey, D. P. and Mooseker, M. S. (1995) Expression in cochlea and retina of myosin VIIa, the gene product defective in usher syndrome type 1B. Proc Natl Acad Sci U S A 92:9815-9. Hasson, T., Walsh, J., Cable, J., Mooseker, M. S., Brown, S. D. and Steel, K. P. (1997) Effects of shaker-1 mutations on myosin-VIIa protein and mRNA expression. Cell Motil Cytoskeleton 37:127-38. Heathcote, K., Syrris, P., Carter, N. D., Patton, M. A. (2000) A connexin 26 mutation causes a syndrome of sensorineural hearing loss and palmoplantar hyperkeratosis. J. Med. Genet. 37:5051. Heiner, C. R., Hunkapiller, K. L., Chen, S. M., Glass, J. I., Chen, E. Y. (1998) Sequencing multimegabase-template DNA with BigDye terminator chemistry. Genome Res 8:557-61. Higashida, C., Miyoshi, T., Fujita, A., Oceguera-Yanez, F., Monypenny, J., Andou, Y., Narumiya, S., Watanabe, N. (2004) Actin polymerization-driven molecular movement of mDia1 in living cells. Science 303:2007-2010. Hirao, M., Sato, N., Kondo, T., Yonemura, S., Monden, M., Sasaki, T., Takai, Y., Tsukita, S., Tsukita, S. (1996) Regulation mechanism of ERM (ezrin/radixin/moesin) protein/plasma membrane association: possible involvement of phosphatidylinositol turnover and Rho-dependent signaling pathway. J Cell Biol 135:37-51. Hirokawa, N., Tilney, L. G. (1982) Interactions between actin filaments and between actin filaments and membranes in quick-frozen and deeply etched hair cells of the chick ear. J Cell Biol 95:249-261. Hmani, M., Ghorbel, A., Boulila-Elgaied, A., Ben Zina, Z., Kammoun, W., Drira, M., Chaabouni, M., Petit, C., Ayadi, H. (1999) A novel locus for Usher syndrome type II, USH2B, maps to chromosome 3 at p23-24.2. Eur J Hum Genet 7:363-367. Hofer, D., Ness, W., Drenckhahn, D. (1997) Sorting of actin isoforms in chicken auditory hair cells. J Cell. Sci. 110:765-770. Hong, S., Smith, D. E., Keep, R. F., Xiang, J., Brosius III, F. C. (2003) Targeted disruption of the PEPT2 gene markedly reduces dipeptide uptake in choroids plexus. J Biol Chem 278:4786-4791. Hope, C. I., Bundey, S., Proops, D., Fielder, A. R. (1997) Usher syndrome in the city of Birmingham--prevalence and clinical classification. Br J Ophthalmol 81:46-53. Holt, J. R., Corey, D. P. (2000) Two mechanisms for transducer adaptation in vertebrate hair cells. Proc Natl Acad Sci USA 97:11730-11735.
- 147 -
Holt, J. R., Gillespie, S. K., Provance, D. W., Shah, K., Shokat, K. M., Corey, D. P., Mercer, J. A., Gillespie, P. G. (2002) A chemical-genetic strategy implicates myosin-1c in adaptation by hair cells. Cell 108:371-381. Howard, J. and Hudspeth, A. J. (1988) Compliance of the hair bundle associated with gating of mechanoelectrical transduction channels in the bullfrog's saccular hair cell. Neuron.1: 189-199. Hudspeth, A. J. (1989) How the Ears Works. Nature 341: 397-404. Hudspeth, A, J., Gillespie, P. G. (1994) Pulling springs to tune transduction: adaptation by hair cells. Neuron 12:1-9. Hussain, R., and Bittles A. H. (1998) The prevalence and demographic characteristics of consanguineous marriages in Pakistan. J Biosoc Sci 30:261-275. Iwasaki, S., Harada, D., Usami, S., Nagura, M., Takeshita, T., Hoshino, T. (2002) Association of clinical features with mutation of TECTA in a family with autosomal dominant hearing loss. Arch Otolaryngol Head Neck Surg 128:913-917. Jaber, L., Halpern, G. J., Shohat, M. (1998) The impact of consanguinity worldwide, Community. Genetics 1:12-17. Jain, P. K., Fukushima, K., Deshmukh, D., Ramesh, A., Thomas, E., Lalwani, A. K., Kumar, S., Plopis, B., Skarka, H., Srisailapathy, C. R. (1995) A human recessive neurosensory nonsyndromic hearing impairment locus is potential homologue of murine deafness (dn) locus. Hum Mol Genet 4:2391-2394. Jain, P. K., Lalwani, A. K., Li, X. C., Singleton, T. L., Smith, T. N., Chen, A., Deshmukh, D., Verma, I. C., Smith, R. J. and Wilcox, E. R. (1998) A gene for recessive nonsyndromic sensorineural deafness (DFNB18) maps to the chromosomal region 11p14-p15.1 containing the Usher syndrome type 1C gene. Genomics 50:290-2. Jamora, C., Fuchs, E. (2002) Intercellular adhesion, signalling and the cytoskeleton. Nature Cell Biol 4:101-108. Janecke, A. R., Meins, M., Sadeghi, M., Grundmann, K., Apfelstedt-Sylla, E., Zrenner, E., Rosenberg, T. and Gal, A. (1999) Twelve novel myosin VIIA mutations in 34 patients with Usher syndrome type I: confirmation of genetic heterogeneity. Hum Mutat 13:133-40. Joensuu, T., Hamalainen, R., Yuan, B., Johnson, C., Tegelberg, S., Gasparini, P., Zelante, L., Pirvola, U., Pakarinen, L., Lehesjoki, A. E., de la Chapelle, A., Sankila, E. M. Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3. (2001) Am J Hum Genet 69:673-684 Johnson, K. R., Gagnon, L. H., Webb, L. S., Peters, L. L., Hawes, N. L., Chang, B. Zheng, Q. Y. (2003) Mouse models of USH1C and DFNB18: phenotypic and molecular analyses of two new spontaneous mutations of the Ush1c gene. Hum Mol Genet 12:3075-3086. Kachar, B., Parakkal, M., Kurc, M., Zhao, Y., Gillespie, P. G. (2000) High-resolution structure of hair-cell tip links. Proc Natl Acad Sci USA 97:13336-13341. Kanai, Y., and Hediger, M. A. (2004) The glutamate/neutral amino acid transporter family SLC1: molecular, physiological and pharmacological aspects. Pflugers Arch 447: 469-479.
- 148 -
Keats, B. J. and Savas, S. (2004) Genetic heterogeneity in Usher syndrome. Am J Med Genet 130: 13-16. Kelsell, D. P., Dunlop, J., Stevens, H. P., Lench, N. J., Liang, J. N., Parry, G., Mueller, R. F., Leigh, I. M. (1997) Connexin 26 mutations in hereditary nonsyndromic sensorineural deafness. Nature 387:80-83. Kelsell, D. P., Wilgoss, A. L., Richard, G., Stevens, H. P., Munro, C. S., Leigh, I. M. (2000) Connexin mutations associated with palmoplantar keratoderma and profound deafness in a single family. Europ. J. Hum. Genet. 8:141-144. Kikkawa, Y, Shitara, H, Wakana, S, Kohara, Y, Takada ,T., Okamoto, M., Taya, C., Kamiya, K., Yoshikawa, Y., Tokano, H., Kitamura, K., Shimizu, K., Wakabayashi, Y., Shiroishi, T., Kominami, R., Yonekawa, H. (2003) Mutations in a new scaffold protein Sans cause deafness in Jackson shaker mice. Hum. Mol Genet 12:453-461. Kikuchi T, Kimura RS, Paul DL, Adams JC. Gap junctions in the rat cochlea: immunohistochemical and ultrastructural analysis. (1995) Anat Embryol (Berl) 191: 10118 Kimberling, W. J., Moller, C. G., Davenport, S., Priluck, I. A., Beighton, P. H., Greenberg, J., Reardon, W., Weston, M. D., Kenyon, J. B., Grunkemeyer, J. A. and et al. (1992) Linkage of USHer syndrome type I gene (USH1B) to the long arm of chromosome 11. Genomics 14:988-94. Kitajiri, S., Fukumoto, K., Hata, M., Sasaki, H., Katsuno, T., Nakagawa, T., Ito, J., Tsukita, S., Tsukita, S. (2004) Radixin deficiency causes deafness associated with progressive degeneration of cochlear stereocilia. J Cell Biol 166:559-570. Kobayashi, T., Walsh, M. C., Choi, Y. (2004) The role of TRAF6 in signal transduction and the immune response. Microbes Infect. 6:1333-1338. Konigsmark, B.W. (1969) Hereditary deafness in man. N Engl J Med 281: 713720, 774778, 827832. Konigsmark, B. W. and Gorlin, R. J. (1976) Genetic and metabolic deafness. W.B. Saunders, Philadelphia, PA. Kopp, P., Arseven, O. K., Sabacan, L., Kotlar, T., Dupuis, J., Cavaliere, H., Santos, C. L., Jameson, J. L., Medeiros-Neto, G. (1999) Phenocopies for deafness and goiter development in a large inbred Brazilian kindred with Pendreds syndrome associated with a novel mutation in the PDS gene. J Clin Endocrinol Metab 84:336-341. Kossal, M. (1997) Sound emissions from cochlear filters and foveae-Does the auditory sense organ makes sense? Naturwissenchaften 84: 9-16. Kozel, P. J., Friedman, R. A., Erway, L. C., Yamoah, E. N., Liu, L. H. (1998) Balance and hearing deficits in mice with a null mutation in the gene encoding plasma membrane Ca2C-ATPase isoform 2. J Biol Chem 273:1869318696. Kros, C. J., Marcotti, W., van Netten, S. M., Self, T. J., Libby, R. T., Brown, S. D., Richardson, G. P., Steel, K. P. (2002) Reduced climbing and increased slipping adaptation in cochlear hair cells of mice with Myo7a mutations. Nat Neurosci 5:41-47. Kudo, T., Ikeda, K., Kure, S., Matsubara, Y., Oshima, T., Watanabe, K., Kawase, T., Narisawa, K., Takasaka, T. (2000) Novel mutations in the connexin 26 gene (GJB2)
- 149 -
responsible for childhood deafness in the Japanese population. Am J Med Genet 90:141145. Kuijpers, W., Tonnaer, E. L., Peters, T. A., Ramaekers, F. C. Expression of intermediate filament proteins in the mature inner ear of the rat and guinea pig (1991) Hear Res 52: 13346. Kumar, A., Babu, M., Kimberling, W. J., Venkatesh, C. P. (2004) Genetic analysis of a four generation Indian family with Usher syndrome: a novel insertion mutation in MYO7A. Mol Vis 10:910-916. Kupka, S., Braun, S., Aberle, S., Haack, B., Ebauer, M., Zeissler, U., Zenner, H. P., Blin, N., Pfister, M. Frequencies of GJB2 mutations in German control individuals and patients showing sporadic non-syndromic hearing impairment. (2002) Hum Mutat 20:7778. Kurima, K., Peters, L. M., Yang, Y., Riazuddin, S., Ahmed, Z. M., Naz, S., Arnaud, D., Drury, S., Mo, J., Makishima, T. Ghosh, M., Menon, P. S. N., Deshmukh, D., Oddoux, C., Oster, H., Khan, S., Riazuddin, S., Deininger, L. P., Hampton, L. L., Sullivan, L. S., Battey, F. J., Keats, B. J. B., Wilcox, E. R., Friedman, T. B., and Griffith, A. J. (2002) Dominant and recessive deafness caused by mutations of a novel gene, TMC1, required for cochlear hair-cell function. Nat Genet 30: 277284. Kussel-Andermann, P., El-Amraoui, A., Safieddine, S., Nouaille, S., Perfettini, I., Lecuit, M., Cossart, P., Wolfrum, U., Petit, C. (2000) Vezatin, a novel transmembrane protein, bridges myosin VIIA to the cadherin-catenins complex. EMBO J 19:6020-6029. Lagziel, A., Ahmed, Z. M., Schultz, J. M., Morell, R. J., Belyantseva, I. A., Friedman, T. B. Spatiotemporal pattern and isoforms of cadherin 23 in wild type and waltzer mice during inner ear hair cell development. (2005) Dev Biol 280:295-306 Lee, L. G., Spurgeon, S. L., Heiner, C. R., Benson, S. C., Rosenblum, B. B., Menchen, S. M., Graham, R. J., Constantinescu, A., Upadhya, K. G., Cassel, J. M. (1997) New energy transfer dyes for DNA sequencing. Nucleic Acids Res 25:2816-22. Lee, Y. J., Park, D., Kim, S. Y., Park, W, J. (2003) Pathogenic mutations but not polymorphisms in congenital and childhood onset autosomal recessive deafness disrupt the proteolytic activity of TMPRSS3. J Med Genet 40(8):629-631. Legan PK, Rau A, Keen JN, Richardson GP. The mouse tectorins. Modular matrix proteins of the inner ear homologous to components of the sperm-egg adhesion system. (1997) J Biol Chem 272: 8791801 Legan PK, Lukashkina VA, Goodyear RJ, Kossi M, Russell IJ, Richardson GP. A targeted deletion in alpha-tectorin reveals that the tectorial membrane is required for the gain and timing of cochlear feedback. (2000) Neuron 28: 27385 Lentz, J., Savas, S., Ng, S. S., Athas, G., Deininger, P., Keats, B. The USH1C 216G-->A splice-site mutation results in a 35-base-pair deletion. (2005) Hum Genet 116:225-227 Leon, P. E., Raventos, H., Lynch, E., Morrow, J., King, M. C. (1992) The gene for an inherited form of deafness maps to chromosome 5q31. Proc Natl Acad Sci USA 89: 5181-5184.
- 150 -
Lerer, I., Sagi, M., Ben-Neriah, Z., Wang, T., Levi, H., Abeliovich, D. (2001) A deletion mutation in GJB6 cooperating with a GJB2 mutation in trans in nonsyndromic deafness: A novel founder mutation in Ashkenazi Jews. Hum. Mutat. 18:460 Levy, R. A. and Arts, H. A. (1996) Predicting neuroradiologic outcome in patients referred for audiovestibular dysfunction. Am J Neuroradiology 17:1717-24. Levy, G., Levi-Acobas, F., Blanchard, S., Gerber, S., Larget-Piet, D., Chenal, V., Liu, X. Z., Newton, V., Steel, K. P., Brown, S. D., Munnich, A., Kaplan, J., Petit, C., Weil, D. (1997) Myosin VIIA gene: heterogeneity of the mutations responsible for Usher syndrome type IB. Hum Mol Genet 6:111-116. Liang, Y., Wang, A., Probst, F. J., Arhya, I. N., Barber, T. D., Chen, K. S., Deshmukh, D., Dolan, D. F., Hinnant, J. T., Carter, L. E., Jain, P. K., Lalwani, A. K., Li, X. C., Lupski, J. R., Moeljopawiro, S., Morell, R., Negrini, C., Wilcox, E. R., Winata, S., Camper, S. A., Friedman, T. B. (1998) Genetic mapping refines DFNB3 to 17p11.2, suggests multiple alleles of DFNB3, and supports homology to the mouse model shaker2. Am J Hum Genet 62:904-915. Liang, Y., Wang, A., Belyantseva, I. A., Anderson, D. W., Probst, F. J., Barber, T. D., Miller, W., Touchman, J. W., Jin, L., Sullivan, S. L., Sellers, J. R., Camper, S. A., Lloyd, R. V., Kachar, B., Friedman, T. B., Fridell, R. A. (1999) Characterization of the human and mouse unconventional myosin XV genes responsible for hereditary deafness DFNB3 and shaker 2. Genomics 61:243-258. Liburd, N., Ghosh, M., Riazuddin, S., Naz, S., Khan, S., Ahmed, Z., Riazuddin, S., Liang, Y., Menon, P. S., Smith, T., Smith, A. C., Chen, K. S., Lupski, J. R., Wilcox, E. R., Potocki, L., Friedman, T. B. (2001) Novel mutations of MYO15A associated with profound deafness in consanguineous families and moderately severe hearing loss in a patient with Smith-Magenis syndrome. Hum Genet 109:535-541. Li, X. C., Everett, L. A., Lalwani, A. K., Desmukh, D., Friedman, T. B., Green, E. D., Wilcox, E. R. (1998) A mutation in PDS causes nonsyndromic recessive deafness. Nat Genet 18: 215-217. Lin, J. C., Ho, W. H., Gurney, A., Rosenthal, A. (2003) The netrin-G1 ligand NGL-1 promotes the outgrowth of thalamocortical axons. Nat Neurosci 6:1270-1276. Liu, X. Z., Newton, V. E., Steel, K. P. and Brown, S. D. (1997c) Identification of a new mutation of the myosin VII head region in Usher syndrome type 1. Hum Mutat 10:168-70. Liu, X. Z., Walsh, J., Mburu, P., Kendrick-Jones, J., Cope, M. J., Steel, K. P., Brown, S. D. (1997a) Mutations in the myosin VIIA gene cause nonsyndromic recessive deafness. Nat Genet 16:188-190. Liu, X. Z., Walsh, J., Tamagawa, Y., Kitamura, K., Nishizawa, M., Steel, K. P., Brown, S. D. (1997b) Autosomal dominant nonsyndromic deafness caused by a mutation in the myosin VIIA gene. Nat Genet 17:268-9. Liu, X. Z., Hope, C., Walsh, J., Newton, V., Ke, X. M., Liang, C. Y., Xu, L. R., Zhou, J. M., Trump, D., Steel, K. P., Bundey, S. and Brown, S. D. (1998) Mutations in the myosin VIIA gene cause a wide phenotypic spectrum, including atypical Usher syndrome. Am J Hum Genet 63:909-12.
- 151 -
Liu, X., Udovichenko, I. P., Brown, S. D., Steel, K. P. and Williams, D. S. (1999) Myosin VIIa participates in opsin transport through the photoreceptor cilium. J Neurosci 19:6267-74. Liu, X. Z. (2002) The clinical presentation of DFNB2. Adv Otorhinolarynngol. 61: 120-123. Liu, X. Z., Xia, X. J., Ke, X. M., Ouyang, X. M., Du, L. L., Liu, Y. H., Angeli, S., Telischi, F. F., Nance, W. E., Balkany, T., Xu, L. R. (2002) The prevalence of connexin 26 (GJB2) mutations in the Chinese population. Hum Genet 111:394-397. Lloyd, R. V., Vidal, S, Jin, L., Zhang, S., Kovacs, K., Horvath, E., Scheithauer, B. W., Boger, E. T., Fridell, R. A., Friedman, T. B. (2001) Myosin XVA expression in the pituitary and in other neuroendocrine tissues and tumors. Am J Pathol 159:1375-1382. Loomis, P. A., Zheng, L., Sekerkova, G., Changyaleket, B., Mugnaini, E., Bartles, J. R. (2003) Espin cross-links cause the elongation of microvillus-type parallel actin bundles in vivo. J Cell Biol 163:1045-1055. Lucotte, G., Dieterlen, F. The 35delG mutation in the connexin 26 gene (GJB2) associated with congenital deafness: European carrier frequencies and evidence for its origin in ancient Greece. (2005) Genet Test 9:20-25 Luijendijk, M. W., Van, W. E., Bischoff, A. M., Krieger, E., Huygen, P. L., Pennings, R. J., Brunner, H. G., Cremers, C. W., Cremers, F. P, Kremer, H. (2004) Identification and molecular modelling of a mutation in the motor head domain of myosin VIIA in a family with autosomal dominant hearing impairment (DFNA11). Hum Genet 115:149-156. Lumpkin, E. A., Marquis, R. E., Hudspeth, A. J. (1997) The selectivity of the hair cell's mechanoelectrical-transduction channel promotes Ca2+ flux at low Ca2+ concentrations. Proc Natl Acad Sci USA 94:10997-11002. Lynch, E. D., Lee, M. K., Morrow, J. E., Welcsh, P. L., Leon, P. E., King, M. C. (1997) Nonsyndromic deafness DFNA1 associated with mutation of a human homolog of the Drosophila gene diaphanous. Science 278:1315-1318. Maestrini, E., Korge, B. P., Ocana-Sierra, J., Calzolari, E., Cambiaghi, S., Scudder, P. M., Hovnanian, A., Monaco, A. P., Munro, C. S. (1999) A missense mutation in connexin26, D66H, causes mutilating keratoderma with sensorineural deafness (Vohwinkel's syndrome) in three unrelated families. Hum Mol Genet 8:1237-1243. Maheshwari, M., Vijaya, R., Ghosh, M., Shastri, S., Kabra, M., Menon, P. S. Screening of families with autosomal recessive non-syndromic hearing impairment (ARNSHI) for mutations in GJB2 gene: Indian scenario. (2003) Am J Med Genet 120:180-184 Makishima, T., Kurima, K., Brewer, C. C., Griffith, A. J. (2004) Early onset and rapid progression of dominant nonsyndromic DFNA36 hearing loss. Otol Neurotol 25:714719. Manley, G. A. (2000) Cochlear mechanisms from a phylogenetic viewpoint. Proc Natl Acad Sci USA 97:11736-11743. Maquat, L. E. (2004) Nonsense-mediated mRNA decay: splicing, translational and mRNP dynamics. Nat Rev Mol Cell Biol 5: 89-99 Marazita, M. L., Ploughman, L. M., Rawlings, B., Remington, E., Arnos, K. S. and
- 152 -
Nance, W. E. (1993) Genetic Epedimiological studies of early onset deafness in U. S. School-age population. Am J Med Genet 46: 486-491. Marres, H. A. (1998) Congenital abnormalities of the inner ear. In: Ludman H, Wright T (eds) Diseases of the Ear. Bath: Arnold & Oxford University Press pp. 288296. Mason, J.A. and Herrmann, K. R. (1998) Universal infant hearing screening by automated auditory brainstem response measurement. Pediatrics 101: 221228. Mazeas, R. and Bourguet, J. (1975) [New method of deafness classification]. Ann Otolaryngol Chir Cervicofac 92:567-72. Mburu, P., Mustapha, M., Varela, A., Weil, D., El-Amraoui, A., Holme, R. H., Rump, A., Hardisty, R. E., Blanchard, S., Coimbra, R. S., Perfettini, I., Parkinson, N., Mallon, A. M., Glenister, P., Rogers, M. J., Paige, A. J., et al. (2003) Defects in whirlin, a PDZ domain molecule involved in stereocilia elongation, cause deafness in the whirler mouse and families with DFNB31. Nat Genet 34:421-428. Mehl, A. L., and Thomson, V. (1998) Newborn hearing screening: the great omission. Pediatrics 101: 16. Mehl, A. L., and Thomson, V. (2002) The Colorado newborn hearing screening project, 19921999: on the threshold of effective population-based universal newborn hearing screening. Pediatrics 109: 18. Melchionda, S., Ahituv, N., Bisceglia, L., Sobe, T., Glaser, F., Rabionet, R., Arbones, M. L., Notarangelo, A., Di Iorio, E., Carella, M., Zelante, L., Estivill, X., Avraham, K. B., Gasparini, P. (2001) MYO6, the human homologue of the gene responsible for deafness in Snell's waltzer mice, is mutated in autosomal dominant nonsyndromic hearing loss. Am J Hum Genet 69, 635-640. Merin, S., Abraham, F. A., Auerbach, E. (1974) Usher's and Hallgren's syndromes. Acta Genet Med Gemellol (Roma) 23:49-55. Meyer,C. G., Gasmelseed, N. M., Mergani, A., Magzoub, M. M., Muntau, B., Thye, T., Horstmann, R. D. (2005) Novel TMC1 structural and splice variants associated with congenital nonsyndromic deafness in a Sudanese pedigree. Hum Mutat 25:100. Mhatre, A. N. and Lalwani, A. K. (1996) Molecular genetics of deafness. Otolaryngol Clin North Am 29: 421435. Mir, A., Ansar, M., Chahrour, M. H., Pham, T. L., Wajid, M., Haque, S., Yan, K., Ahmad, W., Leal, S. M. (2005) Mapping of a novel autosomal recessive nonsyndromic deafness locus (DFNB46) to chromosome 18p11.32-p11.31. Am J Med Genet A 133:2326. Mitchem, K. L., Hibbard, E., Beyer, L. A., Bosom, K., Dootz, G. A., Dolan, D. F., Johnson, K. R., Raphael, Y., Kohrman, D. C. (2002) Mutation of the novel gene Tmie results in sensory cell defects in the inner ear of spinner, a mouse model of human hearing loss DFNB6. Hum Molec Genet 11:1887-1898. Modamio-Hoybjor, S., Moreno-Pelayo, M. A., Mencia, A., del Castillo, I., Chardenoux, S., Armenta, D., Lathrop, M., Petit, C., Moreno, F. (2003) A novel locus for autosomal dominant nonsyndromic hearing loss (DFNA44) maps to chromosome 3q28-29. Human Genet 112:24-28.
- 153 -
Morell, R. J., Kim, H. J., Hood, L. J., Goforth, L., Friderici, K., Fisherm, R., Van Camp, G., Berlin, C. I., Oddoux, C., Ostrer, H., Keats, B., Friedman, T. B. Mutations in the connexin 26 gene (GJB2) among Ashkenazi Jews with nonsyndromic recessive deafness. (1998) N Engl J Med 339:1500-1505 Morell, R. J., Friderici, K. H., Wei, S., Elfenbein, J. L., Friedman, T. B., Fisher, R. A. A. (2000) new locus for late-onset, progressive, hereditary hearing loss DFNA20 maps to 17q25. Genomics 63:1-6. Moreno-Pelayo, M. A., delCastillo, I., Villamar, M., Romero, L., Hernandez-Calvin, F. J., Herraiz, C., Barbera, R., Navas, C., Moreno, F. (2001) A cysteine substitution in the zona pellucida domain of alpha-tectorin results in autosomal dominant, postlingual, progressive, mid frequency hearing loss in a Spanish family. J Med Genet 38:13. Morle, L., Bozon, M., Alloisio, N., Latour, P., Vandenberghe, A., Plauchu, H., Collet, L., Edery, P., Godet, J., Lina-Granade, G. (2000) A novel C202F mutation in the connexin26 gene (GJB2) associated with autosomal dominant isolated hearing loss. J. Med. Genet. 37:368-370. Morton, N. E. (1991) Genetic epidemiology of hearing impairment. Ann N Y Acad Sci 630:16-31. Mustapha, M., Weil, D., Chardenoux, S., Elias, S., El-Zir, E., Beckmann, J. S., Loiselet, J., Petit, C. (1999) An alpha-tectorin gene defect causes a newly identified autosomal recessive form of sensorineural pre-lingual non-syndromic deafness, DFNB21. Hum Mol Genet 8:409-412. Mustapha, M., Chouery, E., Torchard-Pagnez, D., Nouaille, S., Khrais, A., Sayegh, F. N., Megarbane, A., Loiselet, J., Lathrop, M., Petit, C. and Weil, D. (2002) A novel locus for Usher syndrome type I, USH1G, maps to chromosome 17q24-25. Hum Genet 110:348-50. Najera, C., Beneyto, M., Blanca, J., Aller, E., Fontcuberta, A., Millan, J. M., Ayuso, C. Mutations in myosin VIIA (MYO7A) and usherin (USH2A) in Spanish patients with Usher syndrome types I and II, respectively. (2002) Hum Mutat 20:76-77 Najmabadi, H., Nishimura, C., Kahrizi, K., Riazalhosseini, Y., Malekpour, M., Daneshi, A., Farhadi, M., Mohseni, M., Mahdieh, N., Ebrahimi, A., Bazazzadegan, N., Naghavi, A., Avenarius, M., Arzhangi, S., Smith, R. J. GJB2 mutations: passage through Iran. (2005) Am J Med Genet 133:132-137 Nance, W. E. (2003) The genetics of deafness. Mental retardation and developmental disabilities. Research reviews 9: 109119. Naz, S., Giguere, C. M., Kohrman, D. C., Mitchem, K. L., Riazuddin, S., Morell, R. J., Ramesh, A., Srisailpathy, S., Deshmukh, D., Riazuddin, S., Griffth, A. J., Friedman T. B., Smith, R. J., Wilcox, E. R. (2002) Mutations in a novel gene, TMIE, are associated with hearing loss linked to DFNB6 locus. Am J Hum Genet: 71: 632-636. Naz, S., Alasti, F., Mowjoodi, A., Riazuddin, S., Sanati, M. H., Friedman, T. B., Griffith, A. J., Wilcox, E. R. Riazuddin, S. (2003) Distinctive audiometric profile associated with DFNB21 alleles of TECTA. J Med Genet 40:360-363. Naz, S., Griffith, A. J., Riazuddin, S., Hampton, L. L., Battey, J. F. Jr., Khan, S. N., Riazuddin, S., Wilcox, E. R., Friedman, T. B. (2004) Mutations of ESPN cause autosomal recessive deafness and vestibular dysfunction. J Med Genet 41:591-595.
- 154 -
Nelson, W. J., Nusse, R. (2004) Convergence of Wnt, -catenin, and cadherin pathways. Science 303:1483-1487. Newton, V. E. (1985) Aetiology of bilateral sensorineural hearing loss in young children. Journal of Laryngology and Otology (Suppl) 10: 157. Ohmori, H. (1985) Mechano-electrical transduction currents in isolated vestibular hair cells of the chick. J Physiol 359:189217. Oliver, T. N., Berg, J. S., Cheney, R. E. (1999) Tails of unconventional myosins. Cell Mol Life Sci 56:243-2457. Ott, J. (1991) Analysis of Human Genetic Linkage. Johns Hopkins University Press, Baltimore. Ouyang, X. M., Yan, D., Du, L. L., Hejtmancik, J. F., Jacobson, S. G., Nance, W. E., Li, A. R., Angeli, S., Kaiser, M., Newton, V., Brown, S. D., Balkany, T., Liu, X. Z. (2005) Characterization of Usher syndrome type I gene mutations in an Usher syndrome patient population. Hum Genet 116: 292-299. Pandya, A., Arnos, K. S., Xia, X. J., Welch, K. O., Blanton, S. H., Friedman, T. B., Sanchez, G. G., Liu, X. Z., Morell, R., Nance, W. E. (2003) Frequency and distribution of GJB2 (connexin 26) and GJB6 (connexin 30) mutations in a large North American repository of deaf probands. Genet Med 5:295-303. Park, H. J., Shaukat, S., Liu, X. Z., Hahn, S. H., Naz, S., Ghosh, M., Kim, H. N., Moon, S. K., Abe, S., Tukamoto, K., Riazuddin, S., Kabra, M., Erdenetungalag, R., Radnaabazar, J., Khan, S., Pandya, A., Usami, S. I., Nance, W. E., Wilcox, E. R., Riazuddin, S., Griffith, A. J. (2003) Origins and frequencies of SLC26A4 (PDS) mutations in east and south Asians: global implications for the epidemiology of deafness. J Med Genet 40:242-248. Pataky, F., Pironkova, R., Hudspeth, A. J. (2004) Radixin is a constituent of stereocilia in hair cells. Proc Natl Acad Sci USA 101:2601-2606. Parving, A. (1996) Epidemiology of genetic hearing impairment. In: Genetics and Hearing Impairment. London: Whurr, pp. 7381. Parving, A. (1999) The need for universal neonatal hearing screening--some aspects of epidemiology and identification. Acta Paediatr (Suppl) 432: 6972. Pendred, V. (1896). Deaf-mutism and goitre. Lancet 2:532. Petit, C. (1996) Genes responsible for human hereditary deafness: symphony of a thousand. Nat Genet 14:385-91. Petit, C. (2001) Usher syndrome: from genetics to pathogenesis. Annu Rev Genomics Hum Genet 2:271-97. Petit, C., Levilliers, J. and Hardelin, J. P. (2001) Molecular genetics of hearing loss. Annu Rev Genet 35:589-646. Phelps, P. D., Coffey, R. A., Trembath, R. C., Luxon, L. M., Grossman, A. B., Britton, K. E., Kendall-Taylor, P., Graham, J. M., Cadge, B. C., Stephens, S. G., Pembrey, M. E., Reardon, W. (1998) Radiological malformations of the ear in Pendred syndrome. Clinical Radiology 53:268273.
- 155 -
Pickles, J. O., Comis, S. D., Osborne, M. P. (1984) Crosslinks between stereocilia in the guinea pig organ of Corti, and their possible relation to sensory transduction. Hear Res 15:103-112. Povey, S., Lovering, R., Bruford, E., Wright, M., LUSH, M., Wain, H. (2001) The HUGO Gene Nomenclature Committee (HGNC). Hum Genet 109:678-680. Prezant, T. R., Agapian, J. V., Bohlman, M. C., Bu, X., Oztas, S., Qiu, W. Q., Arnos, K. S., Cortopassi, G. A., Jaber, L., Rotter, J. I., and et al. (1993) Mitochondrial ribosomal RNA mutation associated with both antibiotic- induced and nonsyndromic deafness. Nat Genet 4: 289-294. Probst, F. J., Fridell, R. A., Raphael, Y., Saunders, T. L., Wang, A., Liang, Y., Morell, R. J., Touchman, J. W., Lyons, R. H., Noben-Trauth, K., Friedman, T. B., Camper, S. A. (1998) Correction of deafness in shaker-2 mice by an unconventional myosin in a BAC transgene. Science 280:1444-1447. Rabionet, R., Gasparini, P., Estivill, X. (2000) Molecular genetics of hearing impairment due to mutations in gap junction genes encoding beta connexins. Hum. Mutat 16:190-202. Ramzan, K., Shaikh, R. S., Ahmad, J., Khan, S. N., Riazuddin, S., Ahmed, Z. M., Friedman, T. B, Wilcox, E. R., Riazuddin, S. (2005) A new locus for nonsyndromic deafness DFNB49 maps to chromosome 5q12.3-q14.1. Hum Genet 116:17-22 Raphael, Y., Kobayashi, K. N., Dootz, G. A., Beyer, L. A., Dolan, D. F., Burmeister, M. (2001) Severe vestibular and auditory impairment in three alleles of Ames waltzer (av) mice. Hear Res:151:237-249. Reardon, W. (1990) Sex linked deafness: Wilde revisited. J Med Genet 27: 376379. Reardon, W., Coffey, R., Chowdhury, T., Grossman, A., Jan, H., Button, K., Kendall- L. S.,Taylor, P., Trembath, R. (1997) Prevalence, age of onset, and natural history of thyroid disease in Pendred syndrome. J Med Genet 36:595-598. Reardon, W., O'Mahoney, C. F., Trembath, R., Jan, H., Phelps, P. D. (2000) Enlarged vestibular aqueduct: a radiological marker of Pendred syndrome, and mutation of the PDS gene. Quart J Med 93:99-104. Rehm, H. L. (2003). Genetics and the genome project. Ear and Hearing 24. Riazuddin, S., Castelein, C. M., Ahmed, Z. M., Lalwani, A. K., Mastroianni, M. A., Naz, S., Smith, T. N., Liburd, N. A., Friedman, T. B., Griffith, A. J., Riazuddin, S., Wilcox, E. R. (2000) Dominant modifier DFNM1 suppresses recessive deafness DFNB26 Nat Genet 26(4):431-434. Richardson GP, Russell IJ, Duance VC, Bailey AJ. Polypeptide composition of the mammalian tectorial membrane. (1987) Hear Res 25: 4560 Richardson, G. P., Forge, A., Kros, C. J., Fleming, J., Brown, S. D., Steel, K. P. (1997) Myosin VIIA is required for aminoglycoside accumulation in cochlear hair cells. J Neurosci 17:9506-9519.
-
Richardson, G. P., Forge, A., Kros, C. J., Marcotti, W., Becker, D., Williams, D. S., Thorpe, J., Fleming, J., Brown, S. D. and Steel, K. P. (1999) A missense mutation in myosin VIIA prevents aminoglycoside accumulation in early postnatal cochlear hair cells. Ann N Y Acad Sci 884:110-24.
- 156 -
Richardson NB, Savage JE, Cefaratti LK, Yoo TJ. Electron-microscopic localization of type II, IX, and V collagen in the organ of Corti of the gerbil. (1992) Cell Tissue Res 267: 4138 Rodgers KD, Barritt L, Miner JH, Cosgrove D. The laminins in the murine inner ear: developmental transitions and expression in cochlear basement membranes. (2001) Hear Res 158: 3950 Rose, S. P., Conneally, P. M., Nance, W. E. (1977) Genetic analysis of childhood deafness. In: Bess FH, editor. Childhood Deafness. New York:Grune & Stratton. p 19 35. Rzadzinska, A. K., Schneider, M. E., Davies, C., Riordan, G. P., Kachar, B. (2004) An actin molecular treadmill and myosins maintain stereocilia functional architecture and self-renewal J Cell Biol 164:887-897. Sank, D. (1963) Genetic aspects of early total deafness. In Family and mental health problems in a deaf population (ed. J.D. Rainer, K.Z. Altshuler, and F.J. Kallman), New York State Psychiatric Institute, New York, NY pp. 2881. Sankila, E. M., Pakarinen, L., Kaariainen, H., Aittomaki, K., Karjalainen, S., Sistonen, P., de la Chapelle, A. (1995) Assignment of an Usher syndrome type III (USH3) gene to chromosome 3q. Hum Mol Genet 4:93-8. Santos, R. L., Wajid, M., Pham, T. L., Hussan, J., Ali, G., Ahmad, W., Leal, S. M. (2005) Low prevalence of Connexin 26 (GJB2) variants in Pakistani families with autosomal recessive nonsyndromic hearing impairment. Clin Genet 67:61-68. Sato, E., Nakashima, T., Miura, Y., Furuhashi, A., Nakayama, A., Mori, N., Murakami, H., Naganawa, S., Tadokoro, M. (2001) Phenotypes associated with replacement of His by Arg in the Pendred syndrome gene. Eur J Endocrinol 145:697-703. Schaffer, A. A., Gupta, S. K., Shriram, K., Cottingham, R. W., Jr. (1994) Avoiding recomputation in linkage analysis. Hum Hered 44:225-37. Schaffer, A. A. (1996) Faster linkage analysis computations for pedigrees with loops or unused alleles. Hum Hered 46:226-35. Schneider, M. E., Belyantseva, I. A., Azevedo, R. B., Kachar, B. (2002) Rapid renewal of auditory hair bundles. Nature 418:837-838. Schulte BA, Adams JC. Immunohistochemical localization of vimentin in the gerbil inner ear (1989). J Histochem Cytochem 37: 178797 Scott, D. A., Carmi, R., Elbedour, K., Yosefsberg, S., Stone, E. M., Sheffield, V. C. (1996) An autosomal recessive nonsyndromic-hearing-loss locus identified by DNA pooling using two inbred Bedouin kindreds. Am J Hum Genet 59:385-391. Scott, D. A., Kraft, M. L., Stone, E. M., Sheffield, V. C., Smith, R. J. (1998) Connexin mutations and hearing loss. Nature 391:32. Scott, D. A., and Karniski, L. P. (2000) Human pendrin expressed in Xenopus laevis oocytes mediates chloride/formate exchange. American Journal of Physiology. Cell Physiology 278:C207211. Scott, H. S., Kudoh, J., Wattenhofer, M., Shibuya, K., Berry, A., Chrast, R., Guipponi, M., Wang, J., Kawasaki, K., Asakawa, S., et al. (2001) Insertion of beta-satellite repeats
- 157 -
identifies a transmembrane protease causing both congenital and childhood onset autosomal recessive deafness. Nat Genet 27: 59-63. Seeman, P., Malikova, M., Raskova, D., Bendova, O., Groh, D., Kubalkova, M., Sakmaryova, I., Seemanova, E., Kabelka, Z. Spectrum and frequencies of mutations in the GJB2 (Cx26) gene among 156 Czech patients with pre-lingual deafness. (2004) Clin Genet 66:152-157 Self, T., Mahony, M., Fleming, J., Walsh, J., Brown, S. D., Steel, K. P. (1998) Shaker-1 mutations reveal roles for myosin VIIA in both development and function of cochlear hair cells. Development 125:557-566. Self, T., Sobe, T., Copeland, N. G., Jenkins, N. A., Avraham, K. B., Steel, K. P. (1999) Role of myosin VI in the differentiation of cochlear hair cells. Dev Biol 214:331-341. Siemens, J., Lillo, C., Dumont, R. A., Reynolds, A., Williams, D. S., Gillespie, P. G., Muller, U. (2004) Cadherin 23 is a component of the tip link in hair-cell stereocilia. Nature 428:950-955. Shaikh, R. S., Ramzan, K., Nazli, S., Sattar, S., Khan, S. N., Riazuddin, S., Ahmed, Z. M., Friedman, T. B., Riazuddin, S., (2005) A New Locus for Nonsyndromic Deafness DFNB51 Maps to Chromosome 11p13-p12. Am J Med Genet Published Online Sheffield, V. C., Kraiem, Z., Beck, J. C., Nishimura, D., Stone, E. M., Salameh, M., Sadeh, O., Glaser, B. (1996) Pendred syndrome maps to chromosome 7q21-34 and is caused by an intrinsic defect in thyroid iodine organification. Nat Genet 12:424-426. Sheng, M., Sala, C. (2001) PDZ domains and the organization of supramolecular complexes. Annu Rev Neurosci 24:1-29. Shepherd, G. M., Corey, D. P. (1994) The extent of adaptation in bullfrog saccular hair cells. J Neurosci 14:6217-6229. Simmler MC, Zwaenepoel I, Verpy E et al. Twister mutant mice are defective for otogelin, a component specific to inner ear acellular membranes. (2000) Mamm Genome 11: 960966 Slepecky NB. Structure of the mammalian cochlea. In: Dallos P, Popper AN, Fay RR. (eds) The Cochlea. (1996) New York: Springer 44129 Smith, R. J., Lee, E. C., Kimberling, W. J., Daiger, S. P., Pelias, M. Z., Keats, B. J., Jay, M., Bird, A., Reardon, W., Guest, M. and et al. (1992) Localization of two genes for Usher syndrome type I to chromosome 11. Genomics 14:995-1002. Smits, B. M. G., Peters, T. A., Mul , J. D., Croes, H. J., Fransen, J. A. M., Beynon, A. J., Guryev, V., Plasterk, R. H. A., Cuppen, E. (2005) Identification of a rat model for usher syndrome type 1B by ENU mutagenesis-driven forward genetics. Genetics Published Online June 18 Sollner, C., Rauch, G. J., Siemens, J., Geisler, R., Schuster, S. C., Muller, U., Nicolson, T (2004) Mutations in cadherin 23 affect tip links in zebrafish sensory hair cells. Nature 428:955-959. Steel, K. P., Kros, C. J. (2001) A genetic approach to understanding auditory function. Nat Genet 27:143-149. Steel, K. P. (2002) Varitint-waddler: a double whammy for hearing. Proc Natl Acad Sci USA 99:14613-4615.
- 158 -
Stephens, S.D.G. (1985) Genetic hearing loss: A historical overview. Adv. Audiol. 3: 317. Steyger, P. S., Gillespie, P. G., Baird, R. A. (1998) Myosin Ibeta is located at tip link anchors in vestibular hair bundles. J Neurosci 18:4603-4615. Stevenson, A. C. and Cheeseman, E. A. (1956) Hereditary deaf mutism, with particular reference to Northern Ireland. Ann Hum Genet 20: 177207. Strachen, T. and Read, A. P. (1996) DNA structure and gene expression. Am J Hum Genet 71:1-26. Street, V. A., McKee-Johnson, J. W., Fonseca, R. C., Tempel, B. L., Noben-Trauth, K. (1998) Mutations in a plasma membrane Ca2C-ATPase gene cause deafness in deafwaddler mice. Nat Genet 19:390394. Street, V. A., Kallman, J. C., Kiemele, K. L. (2004) Modifier controls severity of a novel dominant low-frequency MyosinVIIA (MYO7A) auditory mutation. J Med Genet 41:e62. Sunose, H., Liu, J., Marcus, D. C. cAMP increases K+ secretion via activation of apical IsK/KvLQT1 channels in strial marginal cells. (1997) Hear Res 114:107-116 Tamagawa, Y., Kitamura, K., Ishida, T., Ishikawa, K., Tanaka, H., Tsuji, S. Nishizawa, M. (1996) A gene for a dominant form of nonsyndromic sensorineural deafness (DFNA11) maps within the region containing the DFNB2 recessive deafness gene. Hum Mol Genet 5:849-52. Tamayo, M. L., Bernal, J. E., Tamayo, G. E., Frias, J. L., Alvira, G., Vergara, O., Rodriguez, V., Uribe, J. I., Silva, J. C. (1991) Usher syndrome: results of a screening program in Colombia. Clin Genet 40:304-311. Tanaka, K., Watase, K., Manabe, T., Yamada, K., Watanabe, M., Takahashi, K., Iwama, H., Nishikawa, T., Ichihara, N., Kikuchi, T., Okuyama, S., Kawashima, N., Hori, S., Takimoto, M., Wada, K. (1997) Epilepsy and exacerbation of brain injury in mice lacking the glutamate transporter GLT-1. Science 276:1699-1702. Tatusova, T. A., Madden, T. L (1999) BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol Lett 174: 247-250. Tekin, M., Akar, N., Cin, S., Blanton, S. H., Xia, X. J., Liu, X. Z., Nance, W. E., Pandya, A. Connexin 26 (GJB2) mutations in the Turkish population: implications for the origin and high frequency of the 35delG mutation in Caucasians. (2001) Hum Genet 108:385389 Terwillger, J. D. and Ott, J. (1994) Handbook of human genetic linkage. Baltimore, John Hopkins University Press. Thorne, R. F., Legg, J. W., Isacke, C.M. (2004) The role of the CD44 transmembrane and cytoplasmic domains in co-ordinating adhesive and signalling events. J Cell Sci 117:373-380. Thompson, R. F., Langford, G. M. 2002. Myosin superfamily evolutionary history. Anat. Rec. 268:276-289. Tilney, L. G., Derosier, D. J. & Mulroy, M. J. (1980) The organization of actin filaments in the stereocilia of cochlear hair cells. J. Cell Biol. 86:244-259.
- 159 -
Tomaski, S. M., and Grundfast, K. M. (1999) A stepwise approach to the diagnosis and treatment of hereditary hearing loss. Pediatr Clin North Am 46:35-49. Trussell, L. (2000) Mutant ion channel in cochlear hair cells causes deafness. Proc Natl Acad Sci U S A 97:3786-3788. Tseng, C. J. and Lalwani, A. K. (2000) Cracking the Auditory Genetic Code: Part II Syndromic Hereditary Hearing Impairment. Am J Otol 21:437-451. Tsukita, S., Yonemura, S. (1999) Cortical actin organization: lessons from ERM (ezrin/radixin/moesin) proteins. J Biol Chem 274:34507-34510. Tyska, M. J., Mooseker, M. S. (2002) MYO1A (brush border myosin I) dynamics in the brush border of LLC-PK1-CL4 cells. Biophys J 82:1869-1883. Underhill, C. (1992) CD44: the hyaluronan receptor. J Cell Sci 03:293-298. Usami, S., Abe, S., Weston, M. D., Shinkawa, H., Van Camp, G., Kimberling, W. J. (1999) Nonsyndromic hearing loss associated with enlarged vestibular aqueduct is caused by PDS mutations. Hum Genet 104:188-192. Usher, C. H. (1914) On the inheritance of retinitis pigmentosa, with notes of cases. R Lond Ophthalmol Hosp Rep 19:130-236. Van Camp, G., Willems, P. J., Smith, R. J. H. (1997) Nonsyndromic hearing impairment unparalleled heterogeneity. Am J Hum Genet 60: 758764. Van Hauwe, P., Everett, L. A., Coucke, P., Scott, D. A., Kraft, M. L., Ris-Stalpers, C., Bolder, C., Otten, B., de Vijlder, J. J., Dietrich, N. L., Ramesh, A., Srisailapathy, S. C., Parving, A., Cremers, C. W., Willems, P. J., Smith, R. J., Green, E. D., Van Camp, G. (1998) Two frequent missense mutations in pendred syndrome. Hum Mol Genet 7:10991104. van Rijn, P. M., and Cremers, C. W. R. J. (1991). Causes of childhood deafness at a Dutch school for the hearing impaired. The Annals of Otology, Rhinology and Laryngology 100: 903 908. van Wijk, E., Krieger, E., Kemperman, M. H., De Leenheer, E. M. R., Huygen, P. L. M., Cremers, C. W. R. J., Cremers, F. P. M., Kremer, H. (2003) A mutation in the gamma actin 1 (ACTG1) gene causes autosomal dominant hearing loss (DFNA20/26). J. Med. Genet. 40:879-884. Verhoeven, K., Van Laer, L., Kirschhofer, K., Legan, P. K., Hughes, D. C., Schatteman, I., Verstreken, M., Van Hauwe, P., Coucke, P., Chen, A., Smith, R. J., Somers, T., Offeciers, F. E., VandeHeyning, P., Richardson, G. P., Wachtler, F., Kimberling, W. J., Willems, P. J., Govaerts, P. J., Van Camp, G. (1998) Mutations in the human alphatectorin gene cause autosomal dominant nonsyndromic hearing impairment. Nat Genet 19:60-62. Vernon, M. (1969) Usher's syndrome--deafness and progressive blindness. Clinical cases, prevention, theory and literature survey. J Chronic Dis 22:133-151. Verpy, E., Leibovici, M., Zwaenepoel, I., Liu, X. Z., Gal, A., Salem, N., Mansour, A., Blanchard, S., Kobayashi, I., Keats, B. J., Slim, R., Petit, C. (2000) A defect in harmonin, a PDZ domain-containing protein expressed in the inner ear sensory hair cells, underlies usher syndrome type 1C. Nat Genet 26:51-55.
- 160 -
Veske, A., Oehlmann, R., Younus, F., Mohyuddin, A., Muller-Myhsok, B., Mehdi, S. Q., Gal, A. (1996) Autosomal recessive non-syndromic deafness locus (DFNB8) maps on chromosome 21q22 in a large consanguineous kindred from Pakistan. Hum Mol Genet 5:165-168. Vilfan, A, Duke, T. (2003) Two adaptation processes in auditory hair cells together can provide an active amplifier. Biophys J 85:191-203. von Graefe, A. (1858) Vereinzelte Beobachtungen und Bemerkungen. Exceptionelle Verhalten des Gesichtsfeldes bei Pigmentenartung des Netzhaut. Albrecht Graefes Arch Klin Ophthalmol 4:250-3. Vreugde, S., Erven, A., Kros, C. J., Marcotti, W., Fuchs, H., Kurima, K., Wilcox, E. R., Friedman, T. B., Griffith, A. J., Balling, R., Hrabe De Angelis, M., Avraham, K. B., Steel, K. P. (2002) Beethoven, a mouse model for dominant, progressive hearing loss DFNA36. Nat Genet 30:257-258. Wajid, M., Abbasi, A. A., Ansar, M., Pham, T. L., Yan, K., Haque, S., Ahmad, W. Leal, S. M. (2003) DFNB39, a recessive form of sensorineural hearing impairment, maps to chromosome 7q11.22-q21.12. Eur J Hum Genet 11:812-815. Wang, A., Liang, Y., Fridell, R. A., Probst, F. J., Wilcox, E. R., Touchman, J. W., Morton, C. C., Morell, R. J., Noben-Trauth, K., Camper, S. A., Friedman, T. B. (1998) Association of unconventional myosin MYO15 mutations with human nonsyndromic deafness DFNB3. Science 280: 1447-1451. Walker, A. H., Najarian, D., White, D. L., Jaffe, J. F., Kanetsky, P. A, Rebbeck, T. R. (1999) Collection of genomic DNA by buccal swabs for polymerase chain reactionbased biomarker assays. Environ Health Perspect 107:517-20. Wallis, C., Ballo, R., Wallis, G., Beighton, P., Goldblatt, J. (1988) X-linked mixed deafness with stapes fixation in a Mauritian kindred: linkage to Xq probe pDP34. Genomics 3: 299-301. Wayne, S., Der Kaloustian, V. M., Schloss, M., Polomeno, R., Scott, D. A., Hejtmancik, J. F., Sheffield, V. C. and Smith, R. J. (1996) Localization of the Usher syndrome type ID gene (USH1D) to chromosome 10. Hum Mol Genet 5:1689-92. Wayne, S., Lowry, R. B., McLeod, D. R., Knaus, R., Farr, C. and Smith, R. J. H. (1997) Localization of the Usher syndrome type IF (USH1F) to chromosome 10. Am J Hum Genet 61:300 Suppl. Weil, D., Blanchard, S., Kaplan, J., Guilford, P., Gibson, F., Walsh, J., Mburu, P., Varela, A., Levilliers, J., Weston, M. D., et al. (1995) Defective myosin VIIA gene responsible for usher syndrome type 1B. Nature 374:60-61. Weil, D., Kussel, P., Blanchard, S., Levy, G., Levi-Acobas, F., Drira, M., Ayadi, H., Petit, C. (1997) The autosomal recessive isolated deafness, DFNB2, and the Usher 1B syndrome are allelic defects of the myosin-VIIA gene. Nat Genet 16:191-193. Weil, D., El-Amraoui, A., Masmoudi, S., Mustapha, M., Kikkawa, Y., Laine, S., Delmaghani, S., Adato, A., Nadifi, S., Zina, Z. B., Hamel, C., Gal, A., Ayadi, H., Yonekawa, H., Petit, C. (2003) Usher syndrome type I G (USH1G) is caused by mutations in the gene encoding SANS, a protein that associates with the USH1C protein, harmonin. Hum Mol Genet 12: 463-71.
- 161 -
Wells, A. L., Lin, A. W., Chen, L. Q., Safer, D., Cain, S. M., Hasson, T., Carragher, B. O., Milligan, R. A., Sweeney, HL. (1999) Myosin VI is an actin-based motor that moves backwards. Nature 401, 505-508. Weston, M. D., Kelley, P. M., Overbeck, L. D., Wagenaar, M., Orten, D. J., Hasson, T., Chen, Z. Y., Corey, D., Mooseker, M., Sumegi, J., Cremers, C., Moller, C., Jacobson, S. G., Gorin, M. B. and Kimberling, W. J. (1996) Myosin VIIA mutation screening in 189 Usher syndrome type 1 patients. Am J Hum Genet 59:1074-83. Weston, M. D., Carney, C. A., Rivedal, S. A. and Kimberling, W. J. (1998) Spectrum of myosin VIIA mutations causing Usher syndrome type 1b. Paper presented at Assoc Res Otolaryngol Abs. White, K. R., Vohr, B. R., Behrens, T. R. (1993) Universal newborn hearing screening using transient evoked otoacoustic emissions: results of the Rhode Island Hearing Assessment Project. Semin Hear 14: 1829. Wilcox, E. R., Burton, Q. L., Naz, S., Riazuddin, S., Smith, T. N., Ploplis, B., Belyantseva, I., Ben-Yosef, T., Liburd, N. A., Morell, R. J., Kachar, B., Wu, D. K., Griffith, A. J., Riazuddin, S., Friedman, T. B. (2001). Mutations in the Gene Encoding Tight Junction Claudin-14 Cause Autosomal Recessive Deafness DFNB29. Cell 104:165-172. Wilson, S. M., Householder, D. B., Coppola, V., Tessarollo, L., Fritzsch, B., Lee, E. C., Goss, D., Carlson, G. A., Copeland, N. G., Jenkins, N. A. (2001) Mutations in Cdh23 cause nonsyndromic hearing loss in waltzer mice. Genomics 74:228-233. Wu, Q. and Maniatis, T. (1999) A striking organization of a large family of human neural cadherin-like cell adhesion genes. Cell 97:779-90. Yamoah, E. N., Lumpkin, E. A., Dumont, R. A., Smith, P. J., Hudspeth, A. J., Gillespie, P. G. (1998) Plasma membrane Ca2C-ATPase extrudes Ca2C from hair cell stereocilia. J. Neurosci 18: 610624. Zheng, J., Shen, W., He, D. Z., Long, K. B., Madison, L. D. and Dallos, P. (2000) Prestin is the motor protein of cochlear outer hair cells. Nature 405:149-155. Zheng, L., Sekerkova, G., Vranich, K., Tilney, L. G., Mugnaini, E., Bartles, J. R. (2000a) The deaf jerker mouse has a mutation in the gene encoding the espin actin-bundling proteins of hair cell stereocilia and lacks espins. Cell 102:377-385. Zheng, Q. Y., Yan, D., Ouyang, X. M., Du, L. L., Yu, H., Chang, B., Johnson, K. R., Liu, X. Z. Digenic inheritance of deafness caused by mutations in genes encoding cadherin 23 and protocadherin 15 in mice and humans. (2005) Hum Mol Genet 14:103111 Zhu, M., Yang, T., Wei, S., DeWan, A. T., Morell, R. J., Elfenbein, J. L., Fisher, R. A., Leal, S. M., Smith, R. J., Friderici, K. H. (2003) Mutations in the -actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26). Am J Hum Genet 73:1082-1091. Zina, Z. B., Masmoudi, S., Ayadi, H., Chaker, F., Ghorbel, A. M., Drira, M., Petit, C. (2001) From DFNB2 to Usher syndrome: variable expressivity of the same disease. Am J Med Genet 101:181-183.
- 162 -
Electronic database information

Center for Medical Genetics, Marshfield Medical Research Foundation: http://research.marshfieldclinic.org/genetics/ Hereditary Hearing Loss Homepage: http://dnalab-www.uia.ac.be/dnalab/hhh/ Online Mendelian Inheritance in Man (OMIM): http://www.ncbi.nlm.nih.gov/entrez/OMIM Primer3 Web-Based Server (primer3_www.cgi v 0.2) http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi The Human Genome Organization (HUGO) http://www.gene.ucl.ac.uk/hugo/ UCSC Genome Bioinformatics: http://genome.ucsc.edu/
- 163 -

Rehan Sadiq Sheikh's PH.D Thesis

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Rehan Sadiq Sheikh's PH.D Thesis

Uploaded by

Copyright:

Available Formats

GENOTYPE/PHENOTYPE CORRELATION FOR HEREDITARY HEARING IMPAIRMENT LOCI

UNIVERSITY OF THE PUNJAB

REHAN SADIQ SHAIKH

DR. SHAHEEN. N. KHAN & DR. SHEIKH RIAZUDDIN

SECTION-II-GENETICS OF DEAFNESS ......................................................................... 21

SECTION-III-LINKAGE ANALYSIS-A TOOL FOR MAPPING DISEASE CAUSING GENES..................................................................................................................................... 63

CHAPTER-II MATERIAL AND METHODS........................................................................................67

CHAPTER-III RESULTS AND DISCUSSION ......................................................................................89

CHAPTER-IV REFERENCES ..............................................................................................................137

REHAN SADIQ SHAIKH

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

INTRICACY OF AUDITORY SYSTEM

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

ANATOMY OF AUDITORY SYSTEM

THE EXTERNAL EAR

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

THE MIDDLE EAR (TYMPANIC CAVITY)

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Fig 1.2 Structure of Inner Ear

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

THE INNER EAR

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

MOLECULAR BASIS OF MECHANOSENSORY TRANSDUCTION AND ADAPTATION MECHANISMS

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

disturbance of the audiotory pathway which in turn can cause deafness.

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Fig 1.4 Events in the Hearing of Sound Waves

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

MOLECUALR GENETIC OF DEAFNESS

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Usher syndrome varies in the severity and onset of deafness, retinitis

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

ESPN MYO6 unknown unknown unknown unknown

Table 1.1 Loci for Nonsyndromic Autosomal Recessive Deafness

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Progressive nephritis; lens abnormalities

Eyes absent 1: human homolog of drosophila eyes-absent gene

External, middle, or inner ear malformations; CHL and/or SNHL

Gap junction protein

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

Runt-related transcription factor 2 CKN1

Absent/abnormal clavicles; skeletal malformations

133540 303600 122880 123000

10q11 Xp22.2-p22.1 2q35 5p15.2-p14.1