Journal of Plant Diseases and Protection, 118 (3/4), 119126, 2011, ISSN 1861-3829.

Eugen Ulmer KG, Stuttgart

Detection of physically interacting proteins with the CC and NB-ARC domains of a putative yellow rust resistance protein, Yr10, in wheat
Figen Yildirim-Ersoy1,2, Christopher J. Ridout3 & Mahinur S. Akkaya1,* 1 Middle East Technical University, Department of Chemistry, Plant Functional Genomics, Molecular Biology and Genetics Laboratory, Ankara, Turkey 2 Uludag University, Department of Biology, Bursa, Turkey 3 John Innes Centre, Disease and Stress Biology, Norwich Research Park, Norwich, UK * Corresponding author: akkayams@metu.edu.tr Received 25 April 2011, accepted 10 June 2011

Abstract
Gene-for-gene (GFG) resistance is a potent defense mechanism in plants, that is mediated by resistance (R) proteins. In GFG resistance, pathogen effector or avirulence (Avr) proteins are recognised by R-proteins which initiate a series of signal transduction events that lead to hypersensitive cell death. In cereals, many R-proteins are comprised of an N-terminal coiled-coiled (CC) domain, a Nucleotide Binding (NB) domain and a Leucine Rich Repeats (LRR) region associated with effector recognition. NB-LRR immunity proteins are highly conserved across plant and animal taxa. To advance understating of signal transduction events in cereals, we exploited the high level of protein conservation to first identify yeast gene products interacting with the CC and NB domains of the candidate yellow rust R-protein (Yr10). Screening revealed proteins having mostly apoptosis related functions (Signal Recognition Particle 72kDa (SRP72); Chromosome SEgregation 1 (CSE1); ARrest Defective 1 (ARD1), translation initiation control in response to stress conditions (General Control Nonderepressible 2 (GCN2)), and a HSP90 co-chaperone (Cyclosporin-sensitive proline rotamase 7 (CPR7)). We then identified the close homologues of the interactors in barley and show that they were induced at 6 h and/or 12 h after infection in Mla3 mediated Powdery Mildew (Blumeria graminis f.sp. hordei, Bgh) disease resistance, suggesting their involvement in pathogen response. Key words: Apoptosis, Blumeria graminis f.sp. hordei, Hordeum vulgare, Puccinia striiformis f.sp. tritici, Triticum aestivum, qRT-PCR, Yeast two-hybrid

teins involved in regulating cell death. The N-terminal region of non-TIR-NB-LRR proteins is less defined, but often contains a coiled-coil (CC) domain and cereals have CC-NB-LRR type R proteins. Yr10 confers resistance to yellow rust, and is one of the few wheat R-gene sequences present in GenBank (Accession no. AF149114). Yr10 is a CC-NB-LRR type R-gene of wheat located on chromosome 1B in Moro and originating from the Turkish line PI178383 (Laroche et al. 2000; 2002). Defining the mechanism of NB-LRR activation is a key challenge in understanding the basis of disease resistance. R proteins detect avirulence (Avr) molecules from plant pathogens which activates defense signaling pathways. This culminates typically in localised programmed plant cell death (PCD) also referred as the hypersensitive response (HR), which inhibits further pathogen growth (Dangl & Jones 2001). Conserved proteins such as RAR1 (Required for Mla-dependent resistance), SGT1 (Suppressor of G2 allele of SKP1) and HSP90 (Cytosolic heat shock protein 90) are known to be directly involved in resistance response (Shirasu et al. 1999; Kitagawa et al. 1999; Azevedo et al. 2002). However, little is known about other proteins that may be involved in the early stages of defense activation. Our objective was to improve understanding of R protein signaling after pathogen recognition in both wheat and barley by identifying further proteins associated with the Yr10 NB-ARC domain. NB-LRR immunity proteins are highly conserved across plant and animal taxa (Dangl & Jones 2001). We exploit the high level of protein conservation to first identify yeast gene products interacting with the NB-ARC domains of Yr10. We then identify the close homologues of the interactors in barley and show their differential expression in Mla3 mediated Powdery Mildew (Blumeria graminis f.sp. hordei, Bgh) disease resistance.

Introduction
Plants have R proteins that recognise pathogen attack and trigger immune responses. The largest class of these R proteins contains Nucleotide Binding (NB) and Leucine Rich Repeats (LRR) domains. NB-LRR proteins can be divided into two groups according to the presence of the TIR (Toll-interleukin-like receptor) domain (Dangl & Jones 2001). The NB domain (also called as NB-ARC) shares homology with human APAF-1 and C. elegans CED-4, proJ.Plant Dis.Protect. 3/4/2011

Materials and methods

Plant materials Avocet-Yellow Rust differential line, Yr10 (Avocet-Yr10), originally generated by Colin Wellings (Australia) was used as the plant material to amplify Yr10-gene fragments by PCR. The seeds were obtained from ICARDA, Aleppo, Syria.

120

Yildirim-Ersoy et al.: Proteins interacting with a putative wheat yellow rust resistance protein
transformed into the mating partner yeast strain (SKY473; MAT a his3, leu2, trp1, ura3, lexAop-LEU2 cIop-LYS2) as described in Serebriskii et al. (1999).

Seedling from 7 days old barley Mla3 isogenic line, Pallas-02, was used as plant material to amplify the HvARD1, HvCPR7, HvCSE1, HvGCN2, and HvSRP72 gene fragments. The same plant material was also used to test the expression level changes after Bgh-CC156 isolate inoculations.

Screening for interacting proteins After the confirming that the bait proteins were expressed, two yeast cells were mated on YPD medium to form diploid cells. After mating, A600nm values of the cells were measured to make serial dilutions of the cells for plating on Glu/ CM-Trp-His-Ura. The mating efficiency was determined by counting growing colonies. To select interactors, mated cells were diluted with Gal-Raff/CM-Ura-His-Trp medium to A600nm:0.15 and grown at 30C until the absorbance value reach to 0.50.7 in for induction of GAL1 promoter. Growing cells on Gal-Raff/CM-Ura-His-Trp-Lys plates were collected after for 5 days of incubation. For confirmation, bait containing cells were transformed with the positive interactor plasmids and isolated using Yeast Plasmid Isolation Kit (USB) according to the manufacturers procedure. The resulting transformants were replica plated to test LYS2 and GusA transcriptional activation.

Construction of the bait plasmids for Y2H From Avocet-Yr10 plants total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturers protocol. The first strand cDNA was synthesised using SuperScript III (RNaseH-reverse transcriptase (Invitrogen)) according to the manufacturers procedure. RT-PCR was carried out in a reaction mixture 1X PCR Buffer (75 mM Tris-HCl with pH 8.8 at 25C, 20 mM (NH4)2SO4, 0.01% (v/v) Tween20), 0.25 mM dNTP mix (DNAmp), 1.5 mM MgCl2 (DNAmp), 2U of Taq DNA polymerase, 15 pmol forward primer, 15 pmol reverse primer and sterile distilled water up to 20 l volume. PCR cycling conditions were 94C for 2 min initial denaturation, 35 cycles of three steps as follows: denaturation at 94C for 1 min, annealing at 55C for 1 min and extension at 72C for 1 min, followed by 1 cycle of 5 min extension at 72C. Yr10-CC domain was amplified using forward (3-gaattcgtgaccgggg cgatgagca-5) and reverse (3-ctcgagaagagttgtcttccctaagc-5) primers. The NB-ARC domain of Yr10 was amplified using forward (3-gaattcggtagtagagtaatcgcaa-5) and reverse (3-ctcgaggtcgtgtacacggacagagct-5) primers. The PCR products were cloned into pGEM-T Easy (Promega) vector for sequencing on ABI prism-310 Genetic Analyzer both directions using T7 and SP6 primers on the plasmids isolated by QIAGEN QIAprep Spin Miniprep Kit according to the manufacturers protocol. The recombinant bait vectors pGLS23/Yr10-CC, and pGLS23/Yr10-NB-ARC were constructed and inserts are verified by sequencing. Bait vectors were co-transformed with pDR8 (pLacGus) reporter plasmid into SKY191 (MAT; trp1, his3, ura3, lexAop-LEU2, cIop-Lys2) yeast cells by the use of PEG4000 and lithium acetate (Finlayson et al. 1991). For checking the self transcriptional activation of the bait plasmid, pEG202-Krit was used as described by Serebriskii et al. (1999).

Transcription activation tests (Plate-based X-Gluc assays) Colonies were selected, replica plated on Gal-Raff/CM-UraHis-Trp (for GusA transcriptional activation) and Glu/CMUra-His-Trp-Lys (for LYS2 transcriptional activation) and incubated for 34 days at 30C for performing transcription activation tests (Duttweiler 1996). Colonies were selected based on the highest transcription activation. For gene identification, PCR was performed on the selected colonies using the primers of the library plasmid pJG4-5 combining 1 l of isolated plasmid, 1X PCR Buffer (75 mM Tris-HCl, pH 8.8, 20 mM (NH4)2SO4, 0.01% (v/v) Tween20), 0.25 mM dNTP mix (DNA Amp), 1.5 mM MgCl2 (DNA Amp), 2U Taq DNA polymerase, 15 pmol pJG4-5 forward (5-ctgagtggagatgcctcc-3) and reverse (5-ctggcaaggtagacaagccg-3) primers in a final volume of 30 l. PCR cycling conditions were 94C for 2 min as initial denaturation, 35 cycles of three steps as denaturation at 94C for 45 sec, annealing at 56C for 45 sec and extension at 72C for 1 min and 1 cycle of 5 min extension at 72C. The PCR products were visualised and confirmed on 1% agarose gel.

Expression of bait proteins Expressions of the domains in the bait vector were verified by protein blot. For immunoblotting the primary antibody cI (1/5000) from Invitrogen and secondary antibody Immunopure Goat Anti-Rabbit IgG (H+L) Horse Radish Peroxidase Conjugated Antibody (1/10000) from Pierce were used. Cloning and sequencing of HvARD1, HvCPR7, HvCSE1, HvGCN2 and HvSRP72 gene fragments from barley Total RNA was isolated from Pallas-02 isogenic line using the TRIzol reagent (Invitrogen) according to the manufacturers protocol. Synthesis of the first strand was achieved by using SuperScript III (RNaseH-reverse transcriptase, Invitrogen) according to the manufacturers procedure. RT-PCR was carried out in a reaction mixture 1X PCR Buffer (75 mM Tris-HCl, pH 8.8, 20 mM (NH4)2SO4, 0.01% (v/v) Tween20), 0.25 mM dNTP mix (DNAmp), 1.5 mM MgCl2
J.Plant Dis.Protect. 3/4/2011

Yeast library transformation S. cerevisiae S288C library DNA constructed in pJG4-5 plasmid was obtained from Dr. Ilya Serebriskii. The library was

Yildirim-Ersoy et al.: Proteins interacting with a putative wheat yellow rust resistance protein
(DNAmp), 2 U of Taq DNA polymerase, 15 pmol forward and reverse primers and sterile distilled water up to 20 l volume. PCR cycling conditions were 94C for 2 min initial denaturation, 35 cycles of three steps as; denaturation at 94C for 1 min, annealing at 50C for 30 sec and extension at 72C for 1 min and 1 cycle of 5 min extension at 72C. The PCR primers used are listed on Table 1. The PCR products were cloned into pGEM-T Easy (Promega) vector for sequencing on ABI prism-310 Genetic Analyzer both directions using T7 and SP6 primers on the plasmids isolated by QIAprep Spin Miniprep Kit (Qiagen) according to the manufacturers protocol.

121

genes, ubiquitin and elongation factor-1, were used for normalisation. Normalisation analysis indicated that all two transcripts were constitutively expressed under the experimental conditions, and was used to generate a normalisation factor for each cDNA sample (geNorm program v3.5; http://medgen.ugent.be/jvdesomp/genorm/) (Vandessompele et al. 2002). The normalised expression of each gene of interest was calculated relative to the mock inoculated control after normalisation factor correction of difference in threshold cycles (Ct). All primer sequences used in this study are presented in Table 2.

Results
qRT-PCR Yeast two-hybrid analysis RNA was extracted from mock inoculated and Bgh-CC156 inoculated Pallas-02 plants (Mla3 R-gene) using the RNeasy Plant Mini Kit (Qiagen) according to the manufacturers instructions. For each time point, three biological replicates were used. RNA from the biological replicates was pooled for the qRT-PCR analysis. Samples were treated with TURBO DNA-free (Ambion, Austin, TX, USA) before cDNA synthesis from total RNA of 1 g using SuperScript III (RNaseH-reverse transcriptase (Invitrogen)), according to the manufacturers instructions. cDNA was diluted 1:20 with nuclease-free water prior to qRT-PCRs, which are consisted of 10 ml SybrGreen JumpStart Taq Ready mix (Sigma-Aldrich, St. Louis,MO, USA), 5 ml cDNA template and 0.1 mM of forward and reverse primers in a final reaction volume of 20 l. PCR amplification and real-time analysis were performed using the DNA Engine Opticon2 Continuous Fluorescence Detector (MJ Research Inc., Alameda, CA, USA). The cycling conditions were 95C for 4 min, followed by 40 cycles of 30 sec at 94C, 30 sec at 50C and 30 sec at 72C. Melt curve analysis was used at the end of each reaction to check primer-dimer formation and gene-specific product amplification. Data were analysed using Opticon Monitor analysis software v2.02 (MJ Research Inc.). Two reference Yeast two-hybrid analysis detected 147 yeast proteins that interact with CC and NB-ARC domains of Yr10 gene. From these, 52 colonies with interacting proteins were selected based on the transcription activation of GusA and LYS2 (Fig. 1). Interaction was determined based on -glucoronidase activity on both Glu/CM-Ura-His-Trp and Gal-Raff/ CM-Ura-His-Trp media. The selected colonies were further confirmed by growth with lysine activation on Gal-Raff/ CM-Ura-His-Trp-Lys plates compared to Glu/CM-Ura-HisTrp-Lys plates. Protein blot analysis confirming bait vector expressions is shown in Fig. 2, and selected PCR products from the positive clones were sequenced. From this, five interactors (ARD1, CPR7, CSE1, GCN2 and SRP72) were identified (Table 3).

Expression level detection by qRT-PCR Gene fragments of barley homologues of HvARD1, HvCPR7, HvCSE1, HvGCN2, and HvSRP72 were amplified from Pallas-02 plant, cloned into pGEM-T Easy (Promega) vector and sequenced. The sequenced gene fragments were

Table 1: Primers used to amplify the gene fragments from barley

Name of the primer HvARD1-Fwd HvARD1-Rev HvCSE1-Fwd HvCSE1-Rev HvCRR7-Fwd HvCPR7-Rev HvGCN2-Fwd HvGCN2-Rev HvSRP72-Fwd HvSRP72-Rev Sequence (5 to 3) ATGGTGTGCATCCGGCAGGCG TTATGAGTCGGCCTCTTCTC GGAGTGCTCTCTTTACTCGCT CAGAATAACCTGATGTCCTCT TGAATTTTGAGGATGAGAATT AGTTGGAAGGTCAGCTTCTCC GGAGGAGAGATGCTAGAACT AACTCCTGCCCAACAAA CAAGGTCGCCGACCAAGT TCATGCAATCATTCATTCT

Table 2: Primers used in qRT-PCR

Name of the primer HvARD1-Fwd-RT HvARD1-Rev-RT HvCSE1-Fwd-RT HvCSE1-Rev-RT HvCRR7-Fwd-RT HvCPR7-Rev-RT HvGCN2-Fwd-RT HvGCN2-Rev-RT HvSRP72-Fwd-RT HvSRP72-Rev-RT Sequence (5 to 3) GAGAACTACCAGATGAAGTA CCTCGCCGTCGGCGTAGTAC AGCAATGCTACTTGGGATCG GCTGCTGCGTGAAAATAGAC TGCTATTGTTAATTGTGGGG GCAGAATCAACAGCATTAAT GGAGGAGAGATGCTAGAACT AACTCCTGCCCAACAAA AGAAGCTCCAAAAGTTTAAG TCCTAGTATCTCTGAGTGCT

J.Plant Dis.Protect. 3/4/2011

122

Yildirim-Ersoy et al.: Proteins interacting with a putative wheat yellow rust resistance protein

X-Gluc overlay on Glu/CM-Ura-His-Trp

X-Gluc overlay on Gal-Raff/CM-Ura-His-Trp

Growth of cells on Glu/CM-Ura-His -Trp-Lys

Growth of cells on Gal-Raff/CM-Ura-His-Trp-Lys

2 3

2 3

2 3

Fig. 1: LYS2 and GusA transcription activation tests of Yr10-CC interactors (1. SRP72, 2. CPR7, 3. ARD1) and Yr10-NB-ARC interactors (4. GCN2, 5. CSE1). Positive cells give better blue color development on Gal-Raff/CM-Ura-His-Trp than Glu/CM-Ura-His-Trp medium and better growth on Gal-Raff/CM-Ura-His-Trp-Lys than Glu/CM-Ura-His-Trp-Lys medium.

aligned using NCBI Blast tool and similarities are presented in Table 4. The expression levels analysis of HvARD1, HvCPR7, HvCSE1, HvGCN, and HvSRP72 by qRT-PCR revealed the induction in Mla3 mediated disease resistance in barley (Fig. 3). All of the genes except, HvCPR7 showed maximum expression level at 12 hours post inoculation (hpi) and gradually dropped at later tested time points, 24 and 72 hpi. On the other hand, HvCPR7 showed highest induction at 6 hpi, indicating that these genes are up-regulated early after pathogen infection.

Discussion
One strategy for achieving durable resistance in crops may be the utilisation of common downstream signaling components controlling many disease resistance pathways. Since R-protein signaling complexes are highly conserved between plant and animal taxa, screening in yeast provides an efficient method for identifying candidate interacting partners. Candidates identified through this approach can then be validated during pathogen infection in the crop species of
J.Plant Dis.Protect. 3/4/2011

Yildirim-Ersoy et al.: Proteins interacting with a putative wheat yellow rust resistance protein

123

M (kDa)
64.2 48.8 37.1 25.9 19.4

Translation initiation control and apoptosis related interactor, GCN2 General Control Nonderepressible-2 (GCN2; GenBank accession no. AAA34636) is involved in yeast protein translation mechanism. GCN2 is a protein kinase that phosphorylates the alpha-subunit of translation initiation factor eIF2 (eIF2) (Samuel 1993). In yeast, GCN2 activation is a defense mechanism induced by elevated cellular concentrations of reactive oxygen species (ROS) including H2O2 (Mascarenhas et al. 2008). ROS production and signaling is an important part of disease resistance mechanisms (Torres et al. 2006). Yeast GCN2 is regulated by the molecular chaperone HSP90 in budding yeast (Donze & Picard 1999). In plants, HSP90 is essential for resistance mediated by several R-proteins of the NB-ARC-LRR class (Takahashi et al. 2003, Liu et al. 2004). Indeed, the chaperone activity of HSP90 is required for the synthesis, maturation and activity of GCN2 protein (Donze & Picard 1999). Arabidopsis thaliana GCN2 protein (AtGCN2; GenBank accession no. CAD30860) is structurally and functionally relat-

Fig. 2: Detection of the cI fused baits on the X-Ray film. M: Marker BenchMark pre-stained protein ladder (Invitrogen); Lanes 1, 3: cI fused YR10-2 protein; Lanes 2, 4: cI fused YR10-1 protein.
interest, in this case barley. This investigation revealed the following proteins interacting with Yr10-NB-ARC bait; and they are novel candidates for a role in disease resistance signaling.

Table 3: Yr10 domains interacting with yeast proteins.

Bait Yr10-CC Yr10-CC Yr10-NB-ARC Yr10-NB-ARC Yr10-NB-ARC Prey SRP72 ARD1 CPR7 GCN2 CSE1 Accession #s CAA97925 AAB68937 CAA89559 AAA34636 CAA96957 Function in yeast Targeting nascent secretory proteins to the ER membrane Subunit of the major N alpha-acetyltransferase Cyclophilin-like protein (HSP90 co-chaperone) Serine/threonine-protein kinase (eIF2 phosphorylation) Importin alpha re-exporter

Table 4: Barley homologues of interactors and their Blast hits.

ESTs Accession No. Size* bp aa 588 196 Nucleotide Sequence Homology Gene (Accesion No.) Identity (%) Os04g0635800 (NM_001060546) 93 Protein Sequence Homology Protein (Accesion No.) Identity (%) Z. mays Silencing group B (AAK67148) A. thaliana GCN5-related N-acetyltransferase (NP_196882) Os02g0761100 (BAF10108) A. thaliana Squint (NP_565381) O. sativa putative importin-alpha re-exporter (BAA92904) A. thaliana cellular apoptosis susceptibility protein (AAM15266) SORBIDRAFT_06g021140 (XP_002446719) A. thaliana GCN2 homologue (NP_191500) O. sativa putative signal recognition particle 72 (BAF06958) A. thaliana 7S RNA binding (NP_176933) 91 78

HvARD1

HQ009507.1

HvCPR7

HO208992

221

71

Os02g0761100 (NM_001054729) Os01g0235400 (NM_001049057)

91

88 81 86 60

HvCSE1

HO208993

402

133

93

HvGCN2

HO208990

309

103

Os04g0492600 (NM_001059713)

86

81 55

HvSRP72

HO208991

287

95

SORBIDRAFT_03g042 250 (XM_002456719)

87

91 52

* cloned PCR product sizes and corresponding amino acid length.

J.Plant Dis.Protect. 3/4/2011

124

Yildirim-Ersoy et al.: Proteins interacting with a putative wheat yellow rust resistance protein

Fig. 3: Differential expression of Barley ARD1, CPR7, CSE1, GCN2 and SRP72 transcripts in Mla3 mediated disease resistance response. Transcript levels are shown for the interaction between Pallas-02 with Pallas-02-avirulent isolate Bgh-CC156 at 4 different time points (6, 12, 24 and 72 hpi). Mean values of three independent replicates are shown with standard deviations.

ed to yeast GCN2 (Zhang et al. 2003). Screening of expressed sequence tag (EST) and genomic databases with the AtGCN2 sequence showed that there are similar genes and transcripts in many plants including wheat (Halford 2006). A key study shows that wheat eIF2 is phosphorylated by yeast GCN2 in yeast cells indicating that there is a conservation of this mechanism in eukaryotes, from yeast to plants (Chang et al. 2000). Interestingly, analysis of the Arabidopsis genome sequence revealed a single gene, AtGCN2, is the only eIF2-kinase encoding gene (Zhang et al. 2008). Higher plants only contain a single GCN2-like eIF2 kinase (Lageix et al. 2008) whereas mammals have four different eIF2 kinases which respond to a variety of biotic and abiotic stress (Harding et al. 2002, Clemens 1997, Chen 2007). AtGCN2 is activated by wounding and exposure to key hormones involved in plant defense such as methyl jasmonate, the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) and salicylic acid (Lageix et al. 2008). Our results indicate that CGN2 may be a component in plant disease resistance complexes.

(TNF) superfamily) binds (Ren et al. 2004). In the YR-10-CC screening, we identified arrest defective 1 protein (ARD1; GenBank accession no. AAB68937). ARD1 is the catalytic subunit which forms a heterodimer with N-terminal acetyltransferase 1 (Nat1) to produce a functional protein NatA (Park & Szostack 1992). NATH (Human Nat1p) and hARD1 (human ARD1) are cleaved during apoptosis resulting in reduced NAT activity and they are considered to be the targets of caspases associated with protein translation (Arnesen et al. 2005). Combined, our results suggest that these three apoptosis-related proteins may also be involved in the regulation of programmed cell death during disease resistance responses in plants.

Co-chaperone of HSP90, CPR7 Yeast CPR7 (GenBank accession no. CAA85559) is a peptidyl-prolyl cis-trans isomerase (cyclophilin) that binds to Hsp82p (HSP90) and contributes to chaperone activity (Mayr et al. 2000). Our findings indicate that the interaction of yeast CPR7 with Yr10-CC protein provides new insight into the association with HSP90, a key protein for the disease resistance response in plants. In Arabidopsis thaliana mutations in SQN (CPR7 homologue) cause the expression of adult vegetative traits needed for vegetative growth but not for the reproduction maturation (Berardini et al. 2001). As adult leaves are more resistant to fungal pathogens, this gene product is considered to have a role in adult plant resistance although there is no experimental evidence up to this date. It is known that the HSP90-SGT1RAR1 complex coordinately contributes to the stability and activation of R-proteins and is a critical component of the plant immune responses (Holt et al. 2005). Recent studies suggest that R-proteins exist in multi-protein complexes and require chaperones to maintain their functions (Liu et al. 2004, Holt et al. 2005). We propose that the plant homologues of CPR7 may work with the HSP90 in maturation and controlling the function of Yr10 protein. We have found very promising yeast interacting proteins with some of the Yr10 fragments having conserved domains
J.Plant Dis.Protect. 3/4/2011

Apoptosis related genes; CSE1, SRP72, and ARD1 We identified three apoptosis-related genes, indicating conserved mechanisms of disease resistance between plants and animals. Yeast chromosome segregation protein (CSE1; GenBank accession no. CAA96957) is a cellular apoptosis susceptibility (CAS) protein and is associated with cell proliferation, apoptosis, and cancer in human (Brinkmann 1998). CAS and HSP70 function together to accelerate nucleotide exchange on Apaf-1 and they stop inactive Apaf-1/cytochrome c aggregation (Kim et al. 2008). Yeast signal recognition particle 72 (SRP72; GenBank accession no. CAA97925) is a highly conserved cytoplasmic complex. Human SRP72 is cleaved during apoptosis and is modified post-translationally to regulate targeting of secretory proteins into the ER lumen during apoptosis (Utz et al. 1998). Silencing of SRP72 inhibits apoptosis by preventing the cell-surface localisation of the DR4 receptor to which TRAIL (widely expressed member of the tumor necrosis factor

Yildirim-Ersoy et al.: Proteins interacting with a putative wheat yellow rust resistance protein
as CC and NB-ARC. Most of the human homologues of them are widely studied and found to have roles in apoptosis. The plant homologues of these proteins are also available in the GenBank. In future silencing and over expression studies may be performed to assess the functions of these interactors in wheat or barley. We believe that these candidate interactors of an R-protein together with further studies may enlighten the downstream signaling in R-gene mediated disease resistance.

125

Acknowledgements
We would like to thank Dr. Ilya Serebriskii and Dr. Erica Golemis for their support in Yeast-two hybrid analyses. The writers appreciate grants from The Scientific and Technical Research Council of Turkey, TUBITAK (TBAG-2316), International Center for Genetic Engineering and Biotechnology, ICGEB (TUR/07-03) State Planning Organization (DPT2004K120750), also grant supports from Middle East Technical University and Uludag University (UAP(F)-2009/ 26 and YDP(F)-2009/10).

References
Arnesen T, Anderson D, Baldersheim C, Lanotte M, Varhaug JE & Lillehaug JR, 2005. Identification and characterization of the human ARD1NATH protein acetyltransferase complex. Biochem J 386, 433-43. Azevedo C, Sadanandom A, Kitagawa K, Freialdenhoven A, Shirasu K & Schulze-Lefert P, 2002. The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science 295, 2073-6. Berardini TZ, Bollman K, Hui S & Poethig RS, 2001. Regulation of vegetative phase change in Arabidopsis thaliana by cyclophilin 40. Science 291, 2405-07. Brinkmann U, 1998. CAS, the human homologue of the yeast chromosome-segregation gene CSE1, in proliferation, apoptosis, and cancer. Am J Hum Genet 62, 509-13. Clemens MJ, 1997. PKR a protein kinase regulated by doublestranded RNA. Int J Biochem Cell Biol 29, 945-949. Chen JJ, 2007. Regulation of protein synthesis by the heme-regulated eIF2lpha kinase: relevance to anemias. Blood 109, 2693-2699. Chang L-Y, Yang WY & Roth D, 2000. Functional complementation by wheat eIF2 in the yeast GCN2-mediated pathway. Biochem Bioph Res Co 279, 468-74. Dangl JL & Jones JDG, 2001. Plant pathogens and integrated defense responses to infection. Nature 411, 826-833. Donze O & Picard D, 1999. Hsp90 binds and regulates the ligand-inducible subunit of eukaryotic translation initiation factor kinase Gcn2. Mol Cell Biol 19, 8422-32. Duina AA, Kalton HM & Gaber RF, 1998. Requirement for Hsp90 and a CyP-40-type cyclophilin in negative regulation of the heat shock response. J Biol Chem 273, 18974-78. Duttweiler HM, 1996. A highly sensitive and non-lethal beta-galactosidase plate assay for yeast. Trends Genet 12, 340-341.
J.Plant Dis.Protect. 3/4/2011

Finlayson SD, Fleming C, Berry DR & Johnston JR, 1991. An improved lithium acetate method for yeast transformation. Biotech Tech 5, 13-18. Halford NG, 2006. Regulation of carbon and amino acid metabolism, roles of sucrose nonfermenting-1-related protein kinase-1 and general control nonderepressible-2-related protein kinase. Adv Bot Res 43, 93-142. Harding HP, Calfon M, Urano F, Novoa I & Ron D, 2002. Transcriptional and translational control in the Mammalian unfolded protein response. Annu Rev Cell Dev Biol 18, 575-599. Holt BF, Belkhadir Y & Dangl J, 2005. Antagonistic control of disease resistance protein stability in the plant immune system. Science 309, 929-932. Torres MA, Jones JDG & Dangl JL, 2006. ROS signaling in response to pathogens. Plant Physiol 141, 373-378. Kim H, Jiang X, Du F & Wang X, 2008. PHAPI, CAS, and Hsp70 Promote Apoptosome Formation by Preventing Apaf-1 Aggregation and Enhancing Nucleotide Exchange on Apaf-1. Mol Cell 30, 239-247. Kitagawa K, Skowyra D, Elledge SJ, Harper JW & Hieter P, 1999. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell 4, 21-33. Lageix S, Lanet E, Pouch-Plissier M-N, Espagnol M-C, Robaglia C, Deragon J-M & Plissier T, 2008. Arabidopsis eIF2 kinase GCN2 is essential for growth in stress conditions and is activated by wounding. BMC Plant Biol 8, 1-9. Laroche A, Eudes F, Frick MM, Huel R, Nykiforuk CL, Conner RL, Kuzyk A, Acharya S & Jordan M, 2002. A wheat resistance gene against stripe rust. Can J Plant Pathol 24, 504-507. Laroche A, Nykiforuk CL, Huel R, Frick MM, Conner RL, Kuzyk A, Eudes F, Acharya S & Jordan M, 2000. Identification of a candidate gene for the wheat stripe rust resistance locus Yr10. In International Plant Molecular Biology Meeting, Quebec, Canada, S22-S55. Liu Y, Burch-Smith T, Schiff M, Feng S & Dinesh-Kumar SP, 2004. Molecular chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1 and Rar1 to modulate an innate immune response in plants. J Biol Chem 279, 2101-8. Mascarenhas C, Edwards-Ingram LC, Zeef L, Shenton D, Ashe MP & Grant CM, 2008. Gcn4 Is Required for the Response to Peroxide Stress in the Yeast Saccharomyces cerevisiae. Mol Biol Cell 19, 2995-3007. Mayr C, Richter K, Lilie H & Buchner J, 2000. Cpr6 and Cpr7, two closely related Hsp90-associated immunophilins from Saccharomyces cerevisiae, differ in their functional properties. J Biol Chem 275, 34140-46. Park EC & Szostack JW, 1992. ARD1 and NAT1 proteins form a complex that has N-terminal acetyltransferase activity. EMBO J 11, 2087-93. Ren Y-G, Wagner KW, Knee DA, Aza-Blanc P, Nasoff M & Deveraux QL, 2004. Differential Regulation of the TRAIL Death Receptors DR4 and DR5 by the Signal Recognition Particle. Mol Biol Cell 15, 5064-74. Samuel CE, 1993. The eIF2 protein kinases, regulators of translation in eukaryotes from yeasts to humans. J Biol Chem 268, 7603-8.

126

Yildirim-Ersoy et al.: Proteins interacting with a putative wheat yellow rust resistance protein
Chem 273, 35362-70. Vandessompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A & Speleman F, 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3, research 00341-003411. Zhang Y, Dickinson JR, Paul MJ & Halford NG, 2003. Molecular cloning of an Arabidopsis homologue of GCN2, a protein kinase involved in co-ordinated response to amino acid starvation. Planta 217, 668-75. Zhang Y, Wang Y, Kanyuka K, Parry MAJ, Powers SJ & Halford NG, 2008. GCN2-dependent phosphorylation of eukaryotic translation initiation factor-2 in Arabidopsis. J Exp Bot 59, 3131-41.

Serebriskii I, Khazak V & Golemis EA, 1999. A Two-hybrid dual bait system to discriminate specificity of protein interactions. J Biol Chem 274, 17080-87. Shirasu K, Lahaye T, Tan MW, Zhou F, Azevedo C & SchulzeLefert P, 1999. A novel class of eukaryotic zinc binding protein is required for disease resistance signaling in barley and development in C. elegans. Cell 99, 355-366. Takahashi A, Casais C, Ichimura K & Shirasu K, 2003. HSP90 interacts with RAR1 and SGT1 and is essential for RPS2mediated disease resistance in Arabidopsis. Proc Nat Acad Sci USA 100, 11777-82. Utz PJ, Hottelet M, Le TM, Kim SJ, Geiger ME, van Venrooij WJ & Anderson P, 1998. The 72-kDa component of signal recognition particle is cleaved during apoptosis. J Biol

J.Plant Dis.Protect. 3/4/2011