Biotechnology Letters 23: 12051208, 2001. 2001 Kluwer Academic Publishers. Printed in the Netherlands.

1205

A single band does not always represent single bacterial strains in denaturing gradient gel electrophoresis analysis
Hiroyuki Sekiguchi1,2 , Noriko Tomioka1 , Tadaatsu Nakahara2 & Hiroo Uchiyama1,
1 National 2 Institute

Institute for Environmental Studies, 16-2 Onogawa, Ibaraki 305-8506, Japan of Applied Biochemistry, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8577, Japan Author for correspondence (Fax: 81-298-50-2576; E-mail: huchiyam@nies.go.jp)
Received 23 April 2001; Revisions requested 2 May 2001; Revisions received 21 May 2001; Accepted 22 May 2001

Key words: bias, DGGE, microbial community, PCR, 16S rDNA

Abstract DNA in a denaturing gradient gel electrophoresis (DGGE) band that could not be sequenced after recovery from the gel was cloned into a TA cloning vector and a library was constructed and then 13 clones randomly picked up from the library was sequenced. Although the excised DNA from the DGGE gel showed a single band, the library consisted of several different sequences phylogenetically. This phenomenon was also observed in several other DGGE bands. Therefore, this suggests that a single DGGE band does not always represent a single bacterial strain and a new bias for quantitative analyses based on band intensities has been identied.

Introduction The structure of the bacterial community in the environment has been investigated by culture-dependent methods for many years. However, since it is difcult to culture most bacteria in samples from the environment (Jannasch & Jones 1959, Amann et al. 1995), evaluation of changes in the structure of bacterial communities using only culturing methods is inadequate. Recently, analyses of the structure of bacterial communities that do not depend on cultivation techniques have been carried out (Amann et al. 1995, Head et al. 1998). As one of the culture-independent methods, denaturing gradient gel electrophoresis (DGGE) analysis of the 16S rRNA gene segment has been widely used to identify complex microbial communities and to determine the phylogenetic afliation of the community members (Ferris et al. 1996, Watanabe et al. 2000). DGGE was originally developed to detect specic mutations within genomic genes due to one base mismatch (Myers et al. 1985). Since Muyzer et al. (1993) applied this method to environmental microorganisms, analyses of microbial communities using DGGE have become increasingly popular. DGGE allows the simultaneous analysis of multiple samples and the compar-

ison of microbial communities based on temporal and geographical differences. Furthermore, the method enables sequence data to be obtained on the DNA of dominant species from individual bands. Although this tool has many advantages, as mentioned above, a few biases derived from PCR and heterogeneity of copy number of 16S rDNA among bacterial species have been reported (Muyzer 1998, Lionel et al. 2000). In this paper, we have identied a new bias associated with the co-migration of phylogenetically heterogeneous bands in a DGGE gel and have attempted to alleviate this shortcoming in the method.

Materials and methods DNA source, extraction, amplication, and purication Water sample collected from a river was ltered using a 0.2 m pore size lter (25 mm diam. Type JG, Millipore, New Bedford, MA) to trap bacterial cells. Total DNA was extracted from the bacterial cells on the lter using Fast DNA kit (BIO101, Vista, CA). For DGGE analysis, the V3 region of

1206 Sequencing of DGGE band The band in the DGGE gel was carefully excised with a razor blade under UV illumination, and then placed in 100 l TE buffer. DNA was extracted from the gel piece by overnight incubation at 4 C, and then 0.5 l supernatant was used as template DNA in the re-amplication by PCR using 357F-GC and 518R primers. The resulting amplicon was run again on DGGE gel to verify its position with the original band. This operation was repeated until the band appeared to be single. Thereafter, PCR using GC-2 (5 GAAGTCATCATGACCGTTCTGGCACGGGGGGC CTA-3 , Watanabe et al. 1998) and 518R primers was performed to obtain a sufcient amount of template DNA for sequencing. Thereafter, the amplicon was puried with Wizard PCR preps (Promega, Madison, WI) and sequenced directly by using BigDye terminator cycle sequencing kit (Applied biosystems, Foster City, CA). When the resultant sequencing failed due to the presence of many ambiguous peaks, DNA in the band was cloned by using TA-cloning kit (Invitrogen, Carlsbad, CA), and a clone library was constructed. Phylogenetic analysis A phylogenetic tree was constructed by the neighborjoining method (Saito & Nei 1987) with the CLUSTAL X software packages (Thompson et al. 1994, Jeanmougin et al. 1998).

Fig. 1. DGGE analysis showing the proles of original PCR amplicon (A), puried DNA until a single band was observed by repeating DGGE 3 times after excision of the band from the original prole (B), and migrations of inserted region in the clones (113). Excised DGGE band is indicated by an arrow.

16S rDNA was amplied by using 357F-GC (5 -CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGC ACGGGGGGCCTACGGGAGGCAGCAG-3 ) and 518R (5 -GTATTACCGCGGCTGCTGG-3 ) as PCR primers (Muyzer et al. 1993), and a temperature program was implemented with touch down program (Muyzer et al. 1993). The amplicon was applied to a 2% agarose gel and DNA in a band was excised and puried using a DEAE-cellulose membrane (DE81, Whatman International Ltd., Maidstone, UK), and applied to DGGE. For the control experiment, Arthrobacter atrocyaneus ATCC13752T was used as standard strain. After cultivation in YG medium, the cells were collected by centrifugation at 4 C, and DNA extraction and purication at the following steps were performed in the same way as described above. Denaturing gradient gel electrophoresis (DGGE) DGGE was performed using a D-Code system (BioRad Laboratories, Inc., Hercules, CA). Acrylamide gel (8%) was prepared and run with 0.5 TAE buffer (1 TAE = 0.04 M Tris base, 0.02 M sodium acetate, and 10 mM EDTA; pH adjusted to 7.4). DGGE gel consisted of a 2070% gradient of urea and formamide in the direction of electrophoresis as denaturant, a condition common in many studies. The 100% denaturant consisted of 40% (v/v) formamide and 7 M urea. DGGE was conducted at a constant voltage of 100 V at 60 C for 4 h. The gel was stained with SYBR Gold (Molecular Probes, Eugene, OR) and photographed.

Results and discussion In our previous study on bacterial community structure by DGGE, unreadable sequences from repeatedly puried bands were often observed. To address this problem, we constructed a clone library of an unreadable band DNA and sequenced 13 clones picked randomly from the library. As shown in Figure 1, although the excised DNA gave a single band (Band B), the migrations of the inserted region of the clones on DGGE were not the same, and the clone library consisted of several different sequences phylogenetically. Especially for the clones no. 25, 9, 11, 12, and 13, the migrations were almost identical. As for the clones no. 1, 68, and 10, the migrations apparently differed from those of band B, and also phylogenetically. These results suggested that, although the repeatedly puried band appeared as a single band, it may include a small amount of heterogeneous DNA on DGGE.

1207

Fig. 2. Phylogenetic tree showing the relationship of the sequences obtained from the excised band clone library (A) and control experiment using Arthrobacter atrocyaneus (B). Shading in tree A indicates phylogenetically independent groups estimated based on the variation of shading in tree B. The scale bar represents the percentage of divergence.

The heterogeneity of the excised single band may be ascribed to mis-incorporation or mis-reading during the PCR and sequencing steps. To determine whether the clone library was articially heterogeneous due to these steps, we performed a control experiment and veried the error rate by using the V3 region of 16S rDNA of Arthrobacter atrocyaneus ATCC13752T which had the same region as that described above. Amplied V3 region of 16S rDNA of A. atrocyaneus was applied to DGGE three times as described in Materials and methods, and then a clone library was constructed and sequenced. Consequently, among 11 clones, the sequences from nine clones were completely the same as those of the reference sequence of A. atrocyaneus recorded in GenBank, and for two clones, only one base pair was mismatched in each clone (their phylogenetic tree is shown in Figure 2B). These results suggested that since mis-incorporation or mis-reading rates were very low they could not account for the diversity of the clones shown in Figure 2A. Based on Figures 2A and 2B, it was considered that there would be at least seven groups in this clone library (no. 26; no. 11; no. 10; no. 12, 13; no. 7; no. 1; no. 9; no. 8) The heterogeneity was also ascribed to the presence of faint bands, which were located very to or overlapped the target band. However, with the current DGGE method, it is difcult to rule out this possibil-

ity and a higher resolution DGGE method would need to be developed. These results suggested that a single DGGE band does not represent a single bacterial strain and that the band which migrated to the same position in different lanes may consist of different bacteria. Therefore, we considered that a quantitative analysis of each band based on the intensity should be performed carefully due to the bias identied in this study, in addition to the other biases already reported. Until now, cloning analysis of 16S rDNA and uorescence in situ hybridization, in addition to DGGE, had also been used to study microbial communities. Therefore, it will be important to evaluate the characteristics of respective techniques and cross-check the results obtained by these approaches to analyze the genuine microbial community structure.

References
Amann RI, Ludwig W, Schleifer K-H (1995) Phylogenetic identication and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59: 143169. Ferris MJ, Muyzer G, Ward DM (1996) Denaturing gradient gel electorophoresis proles of 16S rRNA-dened populations inhabiting a hot spring microbial mat community. Appl. Environ. Microbiol. 62: 340346. Head IM, Saunders JR, Pickup RW (1998) Microbial evolution, diversity, and ecology: a decade of ribosomal RNA analysis of uncultivated microorganisms. Microb. Ecol. 35: 121.

1208
Jannasch HW, Jones GE (1959) Bacterial populations in sea water as determined by different methods of enumeration. Limnol. Oceanogr. 4: 128139. Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ (1998) Multiple sequence alignment with Clustal X. Trends Biochem. Sci. 23: 403405. Lionel R, Franck P, Sylvie N (2000) Monitoring complex bacterial communities using culture-independent molecular techniques: application to soil environment. Res. Microbiol. 151: 167177. Muyzer G (1998) Structure, function and dynamics of microbial communities: the molecular biological approach. In: Carvalho GR, ed. Advances in Molecular Ecology. Amsterdam: IOS Press, pp. 157187. Muyzer G, de Waal EC, Uitterlinden AG (1993) Proling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplied genes coding for 16S rRNA. Appl. Environ. Microbiol. 59: 695700. Myers RM, Fischer SG, Lerman LS, Maniatis T (1985) Nearly all single base substitutions in DNA fragments joined to a GCclump can be detected by denaturing gradient gel electrophoresis. Nucl. Acids Res. 13: 31313145. Saito N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406 425. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specic gap penalties and weight matrix choice. Nucl. Acids Res. 22: 46734680. Watanabe K, Teramoto M, Futamata H, Harayama S (1998) Molecular detection, isolation, and physiological characterization of functionally dominant phenol-degrading bacteria in activated sludge. Appl. Environ. Microbiol. 64: 43964402. Watanabe K, Watanabe K, Kodama Y, Syutsubo K, Harayama S (2000) Molecular characterization of bacterial populations in petroleum-contaminated groundwater discharged from underground crude oil storage cavities. Appl. Environ. Microbiol. 66: 48034809.