In Vitro Cell.Dev.Biol.
—Animal
DOI 10.1007/s11626-010-9326-y
REPORT
Development and characterization of a new epithelial
cell line PSF from caudal fin of Green chromide,
Etroplus suratensis (Bloch, 1790)
T. Raja Swaminathan & Wazir S. Lakra &
A. Gopalakrishnan & V. S. Basheer & B. Khushwaha &
K. A. Sajeela
Received: 23 February 2010 / Accepted: 26 May 2010 / Editor: J. Denry Sato
# The Society for In Vitro Biology 2010
Abstract A new cell line [pearlspot fin (PSF)] has been
developed from caudal fin of Etroplus suratensis, a
brackish/freshwater fish cultivated in India. The cell line
was maintained in Leibovitz’s L-15 supplemented with
10% fetal bovine serum (FBS). The PSF cell line consisted
predominantly of epithelial-like cells. The cells were able to
grow at temperatures between 25°C and 32°C with
optimum temperature of 28°C. The growth rate of PSF
cells increased as the FBS proportion increased from 2% to
20% at 28°C with optimum growth at the concentration of
10% FBS. One marine fish virus (fish nodavirus) was tested
on this cell line and found not susceptible. After conflu-
ency, the cells were subcultured with a split ratio of 1:2.
The cells showed epithelial-like morphology and reached
confluency on the third d after subculture. Polymerase
chain reaction amplification of mitochondrial 16S rRNA
and COI indicated identity of this cell line with those
reported from this fish species, confirming that the cell line
was of pearlspot origin. The cells were successfully
cryopreserved and revived at the tenth, 25th, and 35th
passages. The bacterial extracellular products from Vibrio
cholerae MTCC 3904 were found to be toxic to PSF.
Karyotyping analysis indicated that the modal chromosome
number was 48.
T. R. Swaminathan (*) : A. Gopalakrishnan : V. S. Basheer :
K. A. Sajeela
National Bureau of Fish Genetic Resources Cochin Unit,
CMFRI Campus, P.O. Number 1603,
Kochi, India 682018
e-mail: rajathanga@yahoo.co.in
W. S. Lakra : B. Khushwaha
National Bureau of Fish Genetic Resources,
Canal Ring Road, P.O. Dilkusha,
Lucknow, India 226002
Keywords Green chromide . Pearlspot . Etroplus
suratensis . PSF cell line
A number of potential fish species have been prioritized to
diversify the aquaculture production in India. One of the
candidate fish species for aquaculture both in brackish and
fresh water in India is Etroplus suratensis (popularly known
as “pearlspot” or “karimeen” in India; Vijayaraghavan et al.
1981). It is widely distributed in almost all the backwaters
and freshwaters, along the coastal tracts from South Canara
to Trivandrum on the west coast and later introduced to
different water bodies along the east coast of India such as
Chilka Lake. It is a high-value table fish endemic to
Peninsular India and Sri Lanka and is available throughout
the year (Jhingran and Natarajan 1973). This is perhaps the
first Indian food fish that has been transplanted to a foreign
country (Hornell 1923). Captive breeding of E. suratensis
for production of seeds was developed in India (Bindu
2006). Simultaneously, cage culture of the species in low
volume and high density, developed by Padmakumar et al.
2004) was well received in different regions of India, and
more areas are practicing cage-farming of pearlspot. This
may lead to outbreak of infectious diseases caused by
pathogens such as bacteria, virus, etc.
Cell lines from fish are particularly useful in detecting
viruses (Fryer and Lannan 1994) and in studying the
molecular and cellular basis of physiological processes and
toxicological mechanisms (Bols et al. 2001). In recent
years, cell lines from aquatic animals have attracted
considerable attention as a means of expediting disease
diagnosis. Fish viruses are host-specific that makes a cell
line derived from a particular fish species more appropriate
for investigating the viruses isolated from that fish. Species-
specific cell lines could also be important tools for studying
toxicology, carcinogenesis, gene regulation, and expression
 T.R. SWAMINATHAN ET AL.
in fish (Wise et al. 2002). In India, continuous cell lines from
mrigal Cirrhinus mrigala (Hamilton; Sathe et al. 1995) and
rohu Labeo rohita (Hamilton; Sathe et al. 1997), barramundi
Lates calcarifer (Bloch; Lakra et al. 2006b; Sahul Hameed et
al. 2006), barramundi (Parameswaran et al. 2006a, b), eye
muscle (Ahmed et al. 2008), heart (Ahmed et al. 2009b),
brain (Ahmed et al. 2009a) of catla and eye of rohu (Ahmed
et al. 2009a) have been established.
It is extremely important to establish a continuous cell line
for monitoring the viral diseases of fishes and for vaccine
production against viral pathogens. In India, detailed studies
on viral infections of pearlspot have not been carried out
owing to lack of species-specific cell lines. Thus, a cell line
in pearlspot was urgently required for isolating and identi-
fying viruses causing diseases in this species. In this
backdrop, we attempted to establish cell lines from different
tissues like fin, heart, kidney, and ovary of pearlspot.
Healthy juveniles of pearlspot with an approximate body
weight of 15–100 g were obtained from the Regional
Research Station, Kerala Agricultural University, Puduvype,
Kochi, Kerala, India, transported live to the laboratory and
acclimatized for a wk in water containing 500 IU/ml of
penicillin and 500 μg/ml of streptomycin at room tempera-
ture (25–30°C). The fish were anesthetized in ice-cold water,
immersed in 5% chlorex for 5 min and wiped with 70%
ethanol, and operated in vivo. A total number of 72 explants
including 20 heart, seven kidney, five ovary, and 40 caudal
fin tissues were taken aseptically, minced into small pieces
(approximately 1 mm3 in size), and washed three times in
phosphate-buffered saline (PBS) containing antibiotics
(500 IU/ml penicillin, 500 μg/ml streptomycin, and
2.5 μg/ml Fungizone). The tissue fragments were inoculated
into 25-cm2 cell culture flasks containing 5 ml of complete
growth medium (L-15 supplemented with 20% fetal bovine
serum (FBS) and antibiotics (penicillin, 100 IU/ml and
streptomycin, 100 μg/ml) and Fungizone (2.5 μg/ml). The
flasks were incubated at 28°C in a normal atmosphere
incubator and half of the medium was changed every 4 or
5 d. Nikon TE2000-S (Nikon Corporation, Tokyo, Japan)
equipped with phase optics was used to observe and
photograph living cell cultures every 2–3 d for primary cell
cultures and subcultures.
After monolayers were obtained, each cell line was
examined to ensure that it was free of microbial contam-
ination. The morphology of the cells was normal, and the
cultures were confluent. The spent medium was removed to
a new flask and combined with the same volume of fresh
medium to make a conditioned medium. The cells were
washed with calcium- and magnesium-free PBS three
times. Each culture was examined under an inverted
microscope (Nikon TE2000-S) to ensure that cells were
released from the flask surface. Upon reaching 95%
confluence, the cells were subcultured at a ratio of 1:2
following the standard trypsinization method using trypsin–
EDTA solution (trypsin 0.25%, EDTA 0.02%) in phosphate-
buffered saline. Finally, 5 ml of the pearlspot fin (PSF) cell
suspension was transferred to a new flask and incubated at
28°C. The cells were confluent within 5–7 d. The subcultures
grew in fresh complete medium (15% FBS). After standard-
ization of the FBS and temperature requirements, the
concentration of FBS was reduced to 10%.
The optimal growing conditions for the PSF cell line
were obtained by determining temperature and FBS
concentration preferences. Temperature preference was
determined by plating PSF cells at a density of 5.0×104
cells per well in 12-well plates with 1 ml growing medium.
Cells were plated in normal growth medium as described
above. The cells were incubated at 28°C for 24 h to allow
the cells to attach, after which the cultures were moved to
different temperatures: 18°C, 22°C, 26°C, 28°C, 32°C, and
38°C. Temperature experiments were performed using
normal growing medium supplemented with 20% FBS.
After 5 d, cells were trypsinized and then counted micro-
scopically with a hemocytometer. Optimal growing serum
concentrations were determined using a similar experimental
design. After an incubation at 28°C for 24 h for allowing the
cells to attach, the growing medium was removed, and 1 ml
new medium containing varying concentrations of FBS was
added (5%, 7.5%, 10%, 15%, and 20% FBS). There were
three replicates for each FBS concentration. The cells,
incubated at 28°C, were collected by trypsinization at 3-d
intervals and counted using a hemocytometer.
The comparative effect of FBS and newborn calf serum
(NBCS) on the growth of the PSF cells at 30th passage was
studied by using FBS, NBCS, and equal mixture of FBA
and NBCS in L-15 medium at varying concentrations
(5%,10%, and 15%). The seeding amount of cells was 1×
105 per milliliters and incubated at 28°C. The formation of
monolayer of the cells and health status of the cells were
examined daily. After 10 d, cells were trypsinized and then
counted microscopically with a hemocytometer.
Standard procedures with some variations were used for
the chromosome analysis (Freshney 2005). Briefly, cells
undergoing exponential growth were treated with 1 μg/ml
colcemid (GIBCO, Grand Island, NY, USA) for 6 to 12 h.
The monolayer was trypsinized and pelleted as described
above. The cells were then suspended in 5 ml of a
hypotonic medium (0.075 M KCl) for 30 min and allowed
to settle. To this, four volumes of fixative (3:1, methanol to
glacial acetic acid) were added. After 10 to 20 min, the cells
were suspended in fresh fixative and centrifuged at
1,500 rpm for 15 min. The above step was repeated twice,
after which the cells were resuspended in a small volume
(0.5 ml or less) of fixative. Clean slides were dipped in ice-
cold 40% methanol. A drop of cell suspension was
immediately added to one end of the slide. The cells were
 CELL LINE FROM ETROPLUS SURATENSIS
dispersed by blowing and finally air-dried. Chromosomes
were stained with 5% giemsa (in 10 mM potassium
phosphate, pH 6.8) for 30 min, air-dried, mounted, and
photographed. Chromosome counts were performed for 100
metaphase plates.
For the storage of the cells, the cells were propagated for
3 to 4 d in flasks until confluent monolayers were reached.
L15 medium supplemented with 10% FBS (L-15-10) was
changed 24 h prior to harvesting. The cell suspension from
each flask was collected in a 50-ml centrifuge tube, and the
cells were counted. The cells were centrifuged at 500×g for
10 min. The pellet was resuspended in ice-cold storage
medium (50% FBS, 10% dimethyl sulfoxide, and 40% L-15
medium) to obtain a concentration of 6×106 cells per
milliliter. Approximately 1.5-ml aliquots were dispensed into
2-ml sterile plastic ampoules using a pipette. The ampoules
were placed in a polystyrene box and stored at −80°C
overnight. The ampoules were then placed on aluminum
storage can for cryotubes (Nunc, Roskilde, Denmark) and
transferred into cryocans (IBP, Nashik, India, 22 l) contain-
ing liquid nitrogen (−196°C). Frozen cells were recovered
after 6 mo by removing an ampoule from the aluminum
storage can for cryotubes and thawing in circulating water at
37°C for 2 min. The ampoule exterior was then cleaned with
70% ethanol and its cap unscrewed. The contents of the
ampoule were transferred to L-15-10 medium in a T-25 flask
and incubated at 28°C. The medium was decanted from the
flask 24 h after incubation and replaced with 10-ml fresh L-
15-10 medium. The flask was incubated at 28°C until the
cells reached confluence.
Cell lines in passages 10 and 30 were used to determine the
plating efficiencies of PSF. Cell densities of 200, 500, and
1,000 cells flask–1 were seeded in duplicate in 25-cm2 tissue
culture flasks at 28°C in L-15 medium with 10% FBS. After
12 d, the medium was discarded, and the cells were fixed with
5 ml of crystal violet–formalin stain–fixative for 15 min,
rinsed with tap water, and air-dried. The stained colonies were
then counted under the microscope, and plating efficiency was
calculated as described by Freshney (2005).
The cytotoxicity of bacterial extracellular products from
Vibrio cholerae MTCC 3904 to PSF cells was tested. The
cellophane plate technique of Liu (1957) was used. Briefly,
sterilized cellophane sheets were placed on the surface of
brain heart infusion agar plates and inoculated by spreading
0.5 ml of a 24-h old broth culture of V. cholerae with a
sterile swab and incubated at 37°C. After incubation for
48 h, cells were washed off the cellophane with a minimum
volume of PBS. All the cell suspensions were centrifuged at
l0,000g for 30 min at 4°C. The supernatants were filtered
through a 0.22-µm pore-size membrane (Millipore, Bill-
erica, MA), freeze-dried, and reconstituted in PBS to a final
volume of 10 ml. All ECP samples were stored at −30°C
until use. The cells were grown as a monolayer in 24-well
plates at 28°C using L-15 medium supplemented with 5%
FBS. For the toxicity test, the cell line was inoculated with
0.1 ml serial dilutions of ECP. For negative controls, plates
were inoculated with sterile saline. Plates were incubated at
28°C, and the effects of ECP on the cells were observed
after 24 and 48 h.
The PSF cell line was used in an attempt to isolate the
virus from pearlspot. For this suspected pearlspot, animals
were collected from different farms and backwater lakes in
Kerala, India, and transported live to the laboratory for testing
the presence of any virus. Visceral organs viz., head kidney,
liver, spleen, etc., from suspected animal were dissected
aseptically and pooled and homogenized in Leibovitz L-15
medium with 100 IU/ml penicillin, 100 μg/ml streptomycin,
and 2.5 μg/ml Fungizone and without FBS. After centrifuga-
tion, the supernatant was filtered by a 0.22-μm membrane and
then inoculated into PSF cell line. After 1 h of adsorption at
room temperature, the supernatant was discarded, and the cells
were washed with phosphate buffer three times. Next, L-15
medium with 10% FBS was added to the cells and incubated
at 28°C and examined daily for 2 wk for the appearance of
cytopathic effect (CPE).
To test the susceptibility of the cell line to a virus,
marine fish virus, i.e., nodavirus was used (no freshwater
fish viruses have been reported from India yet). Cells were
inoculated in wells of a 24-well plate to give a confluence
of 70–80% and incubated for 12–24 h at 28°C. After
removal of the medium, 0.1 or 1 mL of virus suspension at
a dilution of 10-1 to 10-3 was added and allowed to adsorb
for 1 h. Then, 0.5 or 5 mL maintenance medium containing
5% FBS was added. The cells were incubated at 28°C and
examined daily for 2 wk for the appearance of CPE
(Tables 1 and 2).
The origin of the PSF cell line was authenticated by
partial amplification and sequencing of 16S rRNA and
Cytochrome Oxidase I (COI) region of the pearlspot.
Briefly, the samples were homogenized separately in NTE
buffer (0.2 m NaCl, 0.02 m Tris–HCl, 0.02 m EDTA, pH
7.4) and centrifuged at 3,000g at 4°C, after which the
supernatant fluids were placed in fresh centrifuge tubes
together with an appropriate amount of digestion buffer
(100 mm NaCl, 10 mm Tris–HCl, pH 8.0, 50 mM EDTA,
pH 8.0, 0.5% sodium dodecyl sulfate, 0.1 mg/mL, and
proteinase K. After incubation at 65°C for 2 h, the digests
were deproteinized by successive phenol/chloroform/iso-
amyl alcohol extraction, and DNA was recovered by
ethanol precipitation, drying, and resuspension in TE
buffer. The primer pair sequences of the 16S rRNA and
COI are given in Table 3. PCR was carried out in a Vetri™
96-well thermal cycler (Applied Biosystems, Foster City,
CA, USA). Each PCR reaction was in a 25-µL volume
containing both forward and reverse primers (10 µm,
0.5 µL each), MgCl2 (25 mm, 1.5 µL) dNTPs (2 mm,
 T.R. SWAMINATHAN ET AL.

Table 1. Details of cell line

development from the different Details of explants cultures Organs/tissues
tissues of E. suratensis
Heart Fin Kidney Ovary

Number of explant 20 40 7 5
a
One of the two cell lines could
Contamination of the explant 3 28 2 2
not be subcultured after 15th pas-
sage and the other after 12th Radiation of the explant 7 18 2 3
passage No radiation of the explant 10 4 3 0
b
Two cell lines could not be Formation of monolayer 2 8 0 1
subcultured after tenth passage Contamination of the monolayer 0 2 0 0
c
Cell line could not be Number of cultures capable of subculturing 2a 3b 0 1c
subcultured after 12th passage
d
Number of cultures still being cultured 0 1d 0 0
Current passage level is 35

2.0 µL), PCR buffer (10×, 2.5 µL), Taq DNA polymerase
(1U, 0.5 µL), template DNA (0.3–0.4 µg), and nucleic acid-
free water. PCR cycling conditions included an initial
denaturation at 95°C for 5 min, followed by 30 cycles of
95°C for 45 s, annealing temperature of 50°C (for CO1)
and 58°C (for 16S rRNA) for 30 s, 72°C for 45 s and a final
extension of 5 min at 72°C. The PCR products were
visualized on 1.2% agarose gels, and the amplified products
were selected for sequencing. The cleaned-up PCR prod-
ucts were sequenced in Applied Biosystems AB 3730 XL
capillary sequencer following manufacturer’s instructions at
the sequencing facility. The raw DNA sequences were
aligned against known sequences from the National Center
for Biotechnology Information (NCBI, Bethesda, Maryland,
USA) database and edited using BIOEDIT sequence
alignment editor version 7.0.5.2.
Results and Discussion
Cell cultures were initiated from 72 explants of pearlspot
including 20 heart, seven kidney, five ovary, and 40 caudal
fin tissues (Table 1). The cells migrated from the heart,
ovary, kidney, and fin tissue fragments and grew well and
formed a monolayer during the first mo. However, only
the cells from the fin tissue grew continuously, and these
were subcultured at intervals of 5–7 d. The cells were split at a
ratio of 1:2 or 1:3. The cells from heart and kidney consisted
of long and short fibroblastic cells, respectively, whereas the
cells from ovary explant showed fibroblastic cells. We could
not maintain the heart, ovary, and kidney cells after 15th, 12th,
and 12th passage, respectively. In the initial passages, PSF
cultures were composed of a heterogeneous mixture of
fibroblastic-like and epithelial-like cells. After ten subcultures,
PSF cultures were predominantly epithelial-like cells. A
similar morphological change has also been observed in
orange spotted grouper, Epinephelus coicoides fin (GF-1)
cells (Chi et al. 1999), and yellow grouper, Epinephelus
awoara fin (GF), and heart (GH) cells (Lai et al. 2003),
Asian seabass fry, L. calcarifer (Bloch), (SF) cells (Chang et
al. 2001), L. calcarifer (Parameswaran et al. 2006a; b), and
catla and rohu (Ahmed et al. 2009a). The change could be
due to a common serum-derived factor present in all sera,
which has strong mitogenic effect on epithelial cells thereby
inhibiting the fibroblast proliferation as reported in other
animal cells (Freshney 2005).

Table 2. Effect of fetal bovine serum and newborn calf serum on growth of PSF cells at 30th passage

S. no. Animal sera Concentration Number of Monolayer Health status Number of cells after
cells seeded formation (days) of the cells 10days (×105 cells/ml)

1. Fetal bovine serum (FBS) 5 1×105/ml 10 +++ 1.3

10 1×105/ml 8 ++++ 4.5
15 1×105/ml 5 +++++ 6.8
2. Newborn calf serum (NBCS) 5 1×105/ml 14 ++ 1
10 1×105/ml 12 +++ 2.5
15 1×105/ml 10 +++ 4.4
3. Equal mixture of FBS and NBCS 5 1×105/ml 12 ++ 1.4
10 1×105/ml 10 ++ 3.2
15 1×105/ml 8 +++ 6.0

S. no. serial number

 CELL LINE FROM ETROPLUS SURATENSIS

Table 3. List of mtDNA primers

Sl. no. Primers Sequence 5′-3′ No. of bases Reference

1 16S rRNA L CGCCTGTTTATCAAAAACAT 20 Palumbi et al 1991

H CCGGTCTGAACTCAGATCACGT 22
2 COI F TCAACCAACCACAAAGACATTGGCAC 26 Ward et al 2005
R TAGACTTCTGGGTGGCCAAAGAATCA 26

The fin cell has been subcultured more than 35 times
since initiation and is designated as PSF cell line.
Morphologically, PSF cell line is composed of epithelial-
like cells. The different morphologies of the cells from
heart, kidney, ovary, and fin were shown in Fig. 1. Majority
of PSF cells were fairly homogenous in size and reached
confluency on the third day of culture.
PSF cells exhibited different growth rates at different
incubation temperatures between 26°C and 28°C. However,
maximum growth was obtained at 28°C. The growth rate of
PSF cells increased as the FBS proportion increased from 2%
to 20% at 28°C. Cells exhibited poor growth at 5%
concentrations of FBS, relatively good growth at 7.5%; but,
maximum growth occurred with the concentrations of 10–
20% FBS. It was concluded that PSF cells grew best with 10%
FBS supplementation and at 28°C (Fig. 2A, B). At 32°C, a
slight increase in cell number occurred; cells remained attached
to the culture wells for at least 7 d. At the both extreme
incubation temperatures, PSF cell morphology changed
(Fig. 3D–F) with high incubation temperatures; monolayer

Figure 1. Photomicrographs of pearlspot cells derived from different passage (200×); F, Monolayer of ovary cells at second passage (200×); G,
tissues. A, Fin explant (200X); B, Heart explant (200×); C, Ovary explant Monolayer of PSF cells at fifth passage; H, Monolayer of PSF cells at
(200×); D, Kidney explant (200×); E, Monolayer of heart cells at third 20th passage; I, Monolayer of PSF cells at 30th passage (100×).
 T.R. SWAMINATHAN ET AL.

A Growth of PSF cells at different temperatures

15% FBS, monolayer formation was observed within 5 d,
5
while it was 10 d in the case of 15% NBCS and 8 d in the
4.5 case of equal mixture of FBS and NBCS. There was
No. of cells X 105 per ml

4 deterioration of the health status of the PSF cells when the

3.5 supply of serum changed to 15% NBCS and equal mixture
3
2.5
of FBS and NBCS (Fig 3A–C). The effects of FBS, NBCS,
2 and equal mixture of FBS and NBCS at three different
1.5 concentrations (5%, 10%, and 15%) significantly affected
1 the attachment, proliferation, and growth of explant culture.
0.5
0
Nanda et al. (2009) found that the goat serum at 10%
1 2 3 4 5 concentration can be used as effectively as newborn calf
Days serum for routine culture of fish cells. Many times, high serum
18ºC 22ºC 26ºC 28ºC 32ºC 38ºC concentration results in poor cell growth and is reported to be
toxic to cells (Cheng et al. 1993). In our study, we found that
B no significant difference in the number of viable cells could
Growth of PSF cells at different concerntration of FBS at 28ºC be recorded for FBS and equal mixture of FBS and NBCS at
5 15% serum concentration. In order to reduce the cost factor,
4.5 15% equal mixture of FBS and NBCS could be used for the
No. of cells X 105 per ml

4
3.5
3
2.5
2 storage after 6 mo or 1 yr showed 85–90% viability and
1.5
1 morphological alteration or changes in growth rate/dou-
0.5
0
1 2
5%
Figure 2. Growth response of the PSF cell line at the 20th passage to
A selected temperature and B selected fetal bovine serum (FBS)
concentrations.
of PSF cells rounded and floated in the medium after week’s
incubation. The PSF cell line was well-adapted to grow in
Leibovitz’s L-15 supplemented with 10% FBS at 28°C. The
growth temperature ranged from 28–32°C with the optimum
growth at 28°C as reported for cell lines other warm water
fish (Tong et al.1997; 1998; Kang et al. 2003). The growth
rate of the PSF cells improved as the FBS concentration
increased from 2% to 20%. However, a 10% concentration of
FBS also provided relatively good growth, and this is an
advantage for low-cost maintenance of PSF cell lines.
The details of the formation of the monolayer of PSF
cells at varying concentrations of FBS, NBCS, and equal
mixture of FBS and NBCS has been given in Table 2.
When the concentration of the sera increased from 5% to
15%, the monolayer formation was quicker, and in the three
treatments, it was 5, 8, and 10 d, respectively, at 15% of
sera. The cell count (×105 cells per milliliter) was highest
6.8, 4.4, and 6.0 at 15% FBS, NBCS, and equal mixture of
FBS and NBCS, respectively. The period of monolayer
formation varied with respect to serum concentration. At
normal maintenance of the PSF cells in vitro.
The PSF cells were cryopreserved at tenth, 25th, and
35th passages. The cells recovered from liquid nitrogen
grew to confluency within 5 d. There was no significant
bling times after freezing and thawing. Cryopreservation of
3 4 5 cell lines was done to minimize genetic change in
Days continuous cell lines, long-term storage, and to avoid aging
7.50% 10% 15% 20%
and transformation in cell lines (Freshney 2005). The
feasibility of cryopreservation of PSF cell line was
demonstrated, with appreciable recovery after thawing up
to 85–90%, was comparable with that of other fish cell lines
such as SISK and SISS cell lines (90%; Parameswaran et al.
2006a; b), SAF-1, GF-1, and SF cell lines (50%, 73%, and
80% to 85%, respectively; Bejar et al. 1997; Chi et al.
1999; Chang et al. 2001).
Plating efficiency for each cell line was determined at
seeding concentrations of 200, 500, and 1,000 cells.
Moderately low plating efficiencies were observed, with
PSF cells at 30th passage (6%, 9.4%, and 15.7%,
respectively) growing marginally better than cells at tenth
passage (4%, 7%, and 12.1%, respectively), with no
significant differences between replicates (data not shown).
These low percentages coincided with observations of low-
seeded flasks, in which cells were widely separated, and
had difficulties replicating and achieving a sub-confluent
monolayer within the 7 d after initial seeding.
The results of chromosome counts of 100 metaphase
plates revealed that the number of chromosomes in PSF
cells (at 20th passage) ranged from 42–50. Aneuploidy was
observed in the cell line though they were small in
proportion. Nevertheless, the modal number of chromo-
somes for all the PSF cell lines was 48 (Fig. 4). Karyotype
analysis revealed that over 72.57% (SD±1.42) of the
 CELL LINE FROM ETROPLUS SURATENSIS
Figure 3. PSF cellular morphology at different animal serum, growing
temperatures, and cytotoxic effects of ECP of V. cholerae MTCC 3904.
A, PSF cells at 28°C and 10% FBS (200×), B, PSF cells at 28°C and
7.5% NBCS and 7.5% FBS (200×), C, PSF cells at 28°C and 15%
pearlspot cell lines possessed a diploid chromosome number
of 2 N=48, which was identical to the modal chromosome
number of pearlspot reported earlier (Natarajan and
Subrahmanyam 1974). The diploid number was also noticed
in grouper cell lines (Chi et al. 1999; Lai et al. 2003; Qin et
al. 2006; Wen et al. 2008). Loss of chromosomes or
additions from nearby cells during karyotype preparation
could be the possible reason for the abnormal chromosome
number in a low percentage PSF cells.
The ECP from V. cholerae was cytotoxic for the PSF cell
line. Cytotoxic effects were observed within 12 h after
inoculation of ECP. PSF cells became rounded, shrunken,
detached, and leading to the destruction of the monolayer
(Fig. 3G–I). The susceptibility of cell lines to viral infection
is the basis for isolating and characterizing fish viruses.
Nodavirus, a marine fish virus (the only fish virus reported
from India), was tested on the PSF cell line but was not
susceptible to the virus. No significant CPE was observed
in the PSF cells after 2 wk even after ten blind passages of
NBCS (200X), D, PSF cells at 18°C (100×), E, PSF cells at 32°C
(200×), F, PSF cells at 38°C (200×), G, PSF cells at 1 d post-inoculation
of V. cholerae ECP, H, PSF cells at 2 d post-inoculation of V. cholerae
ECP, and I, PSF cells at 3 d post-inoculation of V. cholerae ECP.
the samples. No virus could be isolated from the pearlspot
samples tested during the study. In earlier studies, attempts
to isolate pilchard herpesvirus on various poikilothermic
cell lines have not been successful, and the inability to
isolate and grow this virus has severely limited the progress
of research on this virus (Hyatt et al. 1997). In addition,
some pathogenic viruses are known to be organ- and tissue-
specific, which makes the establishment of additional cell
lines from different organs and tissues of a host species
essential for proper monitoring of viral diseases. In the
absence of susceptible cell culture systems, other methods
and techniques, such as electron microscopy and bioassays,
may be relied upon for the diagnosis of viruses which are not
as simple and easily reproducible as in vitro cell cultures.
Many fish cells have proven suitable for demonstrating
the cytotoxic effects of fish pathogenic bacteria, such as
members of the genus Vibrio (Bejar et al. 1997). In the
present study, ECPs of V. cholerae MTCC 3904 was tested
on this cell line and proved to be much more potent. Thus,
 T.R. SWAMINATHAN ET AL.

PSF is suitable for testing the cytotoxic factors of fish

Figure 4. Chromosome analysis of PSF cells. A, Karyotype of PSF
cells (passage 20) indicates all 24 pairs of telocentric chromosomes. B,
Metaphase chromosome of PSF cells (passage 20).
vibriosis. The PSF cell line was very sensitive to the ECP
of V. cholerae MTCC 3904, and the morphological changes
due to ECPs of V. cholerae were similar to those described
by Bejar et al. (1997) in the SAF cell line and by Sahul
Hameed et al. (2006) in the SISK cell line.
Amplification of the 16S rRNA and COI gene from the
cell lines and pearlspot muscle tissue gave products of ∼600
and 700 bp (Fig. 5), respectively. A BLAST search
indicated greater than 99% sequence identity among the
16S rRNA and COI genes from PSF and pearlspot muscle
tissue and a 99% identity with the known pearlspot
mitochondrial DNA sequences in NCBI Genebank. The
sequences have been submitted to NCBI GenBank
(GenBank accession number: GU566027 and GU566028).
The mitochondrial 16S rRNA, 12S rRNA, and COI gene
sequence alignment has been used as reliable molecular
methods to accurately identify the origin of cell lines of
many fish species such as grouper (Ding et al. 2006), red sea
bream (Maki et al. 2005), and other animals (Tsai et al.
2007). Therefore, based on the DNA sequence data, the
origin of PSF cell lines was confirmed as from the
pearlspot, E. suratensis.
Although the PSF cells remained viable following liquid
nitrogen storage, their plating efficiency was rather low
(<16%). Since general characteristics for transformed cell
cultures include serum-independent growth, high contact
inhibition, and high plating efficiency (Freshney 2005), our
findings suggest that PSF cells were not transformed in the
passages for which they were tested. The non-transformation
status of these cell line was further evidenced by their
chromosomal typing, showing a diploid chromosomal count
of 48 in majority of cells, which has been documented in the

16S rRNA
CCCGCCTGCCTGTGACCATGAGTTTAACGGCCGCGGTATTTTGACCGTGCAAAGGTAGCGCAATC
ACTTGTCTTTTAAATGAAGACCCGTATGAATGGCATAACGAGGGCTTAACTGTCTCCCTTTTCCA
GTCAATGAAATTGATCTCCCCGTGCAGAAGCGGGGATCCCCACATAAGACGAGAAGACCCTATG
GAGCTTTAGACAAAAGACAGCCCATGTCAAACACCCCTAAACAAAGGACAAAACTAATTGGCCC
CTGTCCTAATGTCTTTGGTTGGGGCGACCGCGGGGAAACAAAAAACCCCCATGTGGACTGAAGG
CACCCTTCTTCACAACCAAGAGCCACAGCTCTAAGTAACAGAACATCTGACCAACAAGATCCGG
AATAATAACCGATCAACGGACCGAGTTACCCTAGGGATAACAGCGCAATCTCCTTCTAGAGCCC
ATATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAATGGTGCAGCCGCTATT
AAGGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGAG
CO1
GCTGGAATAGTAGGCACTGCTTTAAGCCTACTTATCCGAGCAGAACTAAGCCAACCAGGCTCTCT
CCTTGGAGACGACCAGATTTACAATGTTATCGTAACTGCGCACGCCTTCGTTATAATTTTCTTCAT
GGTTATGCCAATCATAATTGGCGGCTTCGGAAACTGACTAGTTCCCTTAATAATTGGTGCCCCCG
ATATAGCCTTCCCCCGAATAAACAACATGAGCTTCTGACTCCTTCCTCCCTCATTCTTGCTCCTTT
TAGCATCCTCTGGTGTAGAGGCAGGGGCAGGAACAGGGTGAACCGTATACCCTCCTCTAGCAGG
CAACCTTGCCCATGCAGGGGCCTCTGTTGATTTAACCATCTTTTCCCTACATCTAGCAGGTGTTTC
ATCTATTCTTGGGGCAATCAACTTTATCACCACAATCATTAATATGAAACCTCCCGCTATTTCAC
AATATCAAACCCCCTTATTTGTCTGAGCTGTTCTTATTACGGCCGTCCTTCTTCTTCTCTCTCTCCC
CGTACTAGCAGCCGGCATCACAATGCTTCTAACAGATCGAAATTTAAATACGACCTTTTTCGATC
CCGCAGGGGGAGGAGACCCCCTCTTATACCAGCACCT

Figure 5. (Left panel) PCR amplification of 600-bp and 700-bp
sequences of the pearlspot genome using universal oligonucleotide
primers of the 16S rRNA and CO1 genes, respectively. Two hundred
to 300 ng DNA isolated from pearlspot was amplified and then
subjected to 2.0% gel electrophoresis. mtDNA profile with 16S rRNA
primer (lane 1 and 2 PSF cells; lane 3 and 4 pearlspot tissue); with
CO1 primer (lane 5 and 6 PSF cells; lane 7 and 8 pearlspot tissue); M
marker (100 bp DNA ladder). (Right panel) Nucleotide sequences of
the 558 bp and 626 bp fragments amplified using oligonucleotide
primers of the 16S and CO1 genes of pearlspot.
 CELL LINE FROM ETROPLUS SURATENSIS
literature for this aquatic species (Natarajan and Subrahma-
nyam 1974).
With no permanent cell line available from pearlspot (E.
suratensis), our research sought to establish a first cell line
from this fish species which has very high potential for
culture. Since the first fish cell line reported by Wolf and
Quimby (1962), about 268 cell lines have been established
(unpublished data), but only a few of them are available
from international cell culture repositories (ATCC or
ECACC) for scientific research. In India, till recently, very
little work was carried out on fish cell lines. Most of the
works were mainly concentrated on the development of
primary cell culture from freshwater fish (Sathe et al. 1995;
Lakra and Bhonde 1996; Rao et al. 1997; Rathore et al.
2001; Lakra et al. 2006a; Rathore et al. 2007). Recently,
continuous fish cell lines were developed from fin of L.
calcarifer (Lakra et al. 2006b), eye muscle (Ahmed et al.
2008), heart (Ahmed et al. 2009b), brain (Ahmed et al.
2009a) of catla and eye of rohu (Ahmed et al. 2009a). The
PSF cell line has been submitted to the fish cell line
repository at the National Bureau of Fish Genetic Resour-
ces, Lucknow, India, which is the official agency for storing
the characterized fish cell lines in India.
Although a cell line from a fish species that is not of
direct interest can be a useful surrogate, having lines from
the species of interest is superior for many purposes
(Dewitte-orr et al. 2006). For example, susceptibility to
some viruses can be species-specific and some physiolog-
ical processes can vary between species, leading to different
sensitivities to stimuli. Thus, additional cell lines from E.
suratensis would be valuable for studying species-specific
responses at the cellular level.
We plan to carry out further research on the newly
established PSF cell line regarding their biological proper-
ties and functions, so that the cell lines can be made
available to scientists all over the world for the advance-
ment of in vitro research in aquatic science.
Acknowledgement The authors are thankful to Dr. S. Ayyappan,
Director General, ICAR, New Delhi, India, for the encouragement and
guidance. Thanks are due to the Head, Fish Health Management Division,
National Bureau of Fish Genetic resources, Lucknow, for the support.
Reference
Ahmed V. P. I.; Chandra V.; Parameswaran V.; Venkatesan C.; Shukla
R.; Bhonde R. R.; Sahul Hameed A. S. A new epithelial-like cell
line from eye muscle of catla (Catla catla): development and
characterization. J. Fish Biol. 72: 2026–2038; 2008.
Ahmed V. P. I.; Chandra V.; Sudhakaran R.; Rajesh Kumar S.; Sarathi
M.; Sarath Babu V.; Bhonde R. R.; Sahul Hameed A. S.
Development and characterization of cell lines derived from
rohu, Labeo rohita (Hamilton); and catla; Catla catla (Hamilton).
J. Fish Dis. 32: 211–218; 2009a.
Ahmed V. P. I.; Sarath Babu V.; Chandra V.; Nambi K. S.; Thomas
J.; Bhonde R. R.; Sahul Hameed A. S. A new fibroblastic-like
cell line from heart muscle of the Indian major carp (Catla
catla): development and characterization. Aquaculture 293:
180–186; 2009b.
Bejar J.; Borrego J. J.; Alvarez M. C. A continuous cell line from the
cultured marine fish gilt-head sea bream (Sparus aurata).
Aquaculture 150: 143–153; 1997.
Bindu L. Captive breeding protocols of two potential cultivable fishes,
Etroplus suratensis (Bloch) and Horabagrus brachysoma (Gun-
ther) endemic to the Western Ghat region, Kerala. PhD thesis
submitted to Mahatma Gandhi University, Kottyam; 2006: pp 215.
Bols N. C.; Brubacher J. L.; Ganassin R. C.; Lee L. E. J. Ecotoxicology
and innate immunity in fish. Dev. Comp. Immunol. 25: 853–873;
2001.
Chang S. F.; Ngoh G. H.; Kueh L. F. S.; Qin Q. M.; Che C. L.; Lam T.
J.; Sin Y. M. Development of a tropical marine fish cell line from
Asian seabass (Lates calcarifer) for virus isolation. Aquaculture
192: 133–145; 2001.
Cheng L. L.; Browser P. R.; Spitsbergen J. M. Development of cell
cultures derived from lake trout liver and kidney in a hormone
supplemented; serum-reduced medium. J. Aquat. Anim. Health 5:
119–126; 1993.
Chi S. C.; Hu W. W.; Lo B. J. Establishment and characterization of a
continuous cell line (GF-1) derived from grouper; Epinephelus
coioides: a cell line susceptible to grouper nervous necrosis virus
(GNNV). J. Fish Dis. 22: 173–182; 1999.
Dewitte-orr S. J.; Lepic K.; Bryson S. P.; Walsh S. K.; Lee L. E. J.;
Bols N. C. Development of a continuous cell line; PBLE; from
an American eel peripheral blood leukocyte preparation. In Vitro
Cell Dev. Biol. Anim. 42: 263–272; 2006.
Ding S.; Zhuang X.; Guo F.; Wang J.; Su Y.; Zhang Q.; Li Q.
Molecular phylogenetic relationships of China Seas groupers
based on cytochrome b gene fragment sequences. Sci. China C.
Life Sci. 49: 235–242; 2006.
Freshney R. I. Culture of animal cells—a manual of basic techniques.
Wiley-Liss, New York; 2005.
Fryer J. L.; Lannan C. N. Three decades of fish cell culture: a current
listing of cell lines derived from fish. J. Tissue Cult. Methods 16:
87–94; 1994.
Hornell J. Administrative report for the year 1921-1922. Madras Fish
Bulletin Madras 17: 44; 1923.
Hyatt A. D.; Hine P. M.; Jones B.; Whittington R.; Kearns C.; Wise T.
G.; Crane M. S.; Williams L. M. Epizootic mortality in the
pilchard Sardinops sagax neopilchardus in Australia and New
Zealand in 1995. II. Identification of a herpesvirus within the gill
epithelium. Dis. Aquat. Org. 28: 17–29; 1997.
Jhingran V. G.; Natarajan A. V. Role of Chilka lake fisheries in the
development of coastal aquaculture in Eastern India. In: Pillay T.
V. R. (ed) Coastal aquaculture in the Indo-Pacific Region.
Fishing News (Books) Ltd, London, pp 109–115; 1973.
Kang M. S.; Oh M. J.; Kim Y. J.; Kawai K.; Jung S. J. Establishment
and characterization of two cell lines derived from flounder;
Paralichthys olivaceus (Temminck & Schlegel). J. Fish Dis. 26:
657–665; 2003.
Lai Y. S.; John J. A. C.; Lin C. H.; Guo I. C.; Chen S. C.; Fang F.; Lin
C. H.; Chang C. Y. Establishment of cell lines from a tropical
grouper; Epinephelus awoara (Temminck and Schlegel); and
their susceptibility to grouper irido and nodaviruses. J. Fish Dis.
26: 31–42; 2003.
Lakra W. S.; Bhonde R. R. Development of primary cell culture from
the caudal fin of an Indian major carp; Labeo rohita (Ham).
Asian Fish Sci. 9: 149–152; 1996.
Lakra W. S.; Bhonde R. R.; Sivakumar N.; Ayyappan S. A new
fibroblast like cell line from the fry of golden mahseer Tor
putitora (Ham). Aquaculture 253: 238–243; 2006a.
 T.R. SWAMINATHAN ET AL.
Lakra W. S.; Sivakumar N.; Goswami M.; Bhonde R. R. Development
of two cell culture systems from Asian seabass Lates calcarifer
(Bloch). Aquaculture Res. 37: 18–24; 2006b.
Liu P. V. Survey of haemolysin production among species of
Pseudomonas. J. Bacteriol. 74: 718–727; 1957.
Maki T.; Koiwa T.; Imada K.; Toyoda M.; Sugimura T.; Ikeda T. M.;
Yano H. Species identification of ‘seabream’ (Pagrus major;
Evynis japonica and Dentex tumifrons) by PCR-based DNA
analysis using the mitochondrial cytochrome b gene. J. Jpn. So.
Food Sci. Technol. 52: 366–372; 2005.
Nanda P. K.; Swain P.; Nayak S. K.; Dash S.; Routray P.; Swain S. K.;
Patra B. C. Goat serum as an alternative to establish cell culture
from Indian major carp; Cirrhinus mrigala. In Vitro Cell Dev.
Biol. Anim. 45: 148–151; 2009.
Natarajan R.; Subrahmanyam K. A karyotype study of some teleosts
from Portonovo waters. P. Plant Sci. 79: 173–196; 1974.
Padmakumar K. G.; Krishnan A.; Joetreson S.; Reynold K.; Bindu L.
Potentials of open water fish culture in net cages in Vembenad
lake; Kerala. In: Ambat B. (ed) Proceedings of 3rd Indian
Environmental Congress 2004. Centre for Environmental and
Development, Kerala, pp 155–165; 2004.
Palumbi S.; Martin A.; Romano S.; McMillan W. O.; Stice L.;
Grabowski G. The simple fool’s guide to PCR. University of
Hawaii, Honolulu; 1991.
Parameswaran V.; Shukla R.; Bhonde R. R.; Sahul Hameed A. S.
Establishment of embryonic cell line from sea bass (Lates calcarifer)
for virus isolation. J. Virol. Methods 137: 309–316; 2006a.
Parameswaran V.; Shukla R.; Bhonde R. R.; Sahul Hameed A. S.
Splenic cell line from sea bass; Lates calcarifer: establishment
and characterization. Aquaculture 261: 43–53; 2006b.
Qin Q. W.; Wu T. H.; Jia T. L.; Hegde A.; Zhang R. Q. Development
and characterization of a new tropical marine fish cell line from
grouper; Epinephelus coioides susceptible to iridovirus and
nodavirus. J. Virol. Methods 131: 58–64; 2006.
Rao K. S.; Joseph M. A.; Shankar K. M.; Mohan C. V. Primary cell
culture from explants of heart tissue of Indian major carps. Curr.
Sci. 73: 374–375; 1997.
Rathore G.; Kumar G.; Swaminathan T. R.; Sood N.; Singh V.; Abidi
R.; Lakra W. S. Primary cell culture from fin explants of Labeo
rohita (Ham). Indian J. Fish 541: 93–97; 2007.
Rathore G.; Sood N.; Swaminathan T. R. Primary cell culture from
fish gills and kidney using fish serum. Indian J. Exp. Biol. 39:
936–938; 2001.
Sahul Hameed A. S.; Parameswaran V.; Shukla R.; Singh I. B.;
Thirunavukkarasu A. R.; Bhonde R. R. Establishment and
characterization of India’s first marine fish cell line from kidney
of sea bass; Lates calcarifer. Aquaculture 257: 92–103; 2006.
Sathe P. S.; Basu A.; Mourya D. T.; Marathe B. A.; Gogate S. S.;
Banerjee K. A cell line from the gill tissues of Indian cyprinoid
Labeo rohita. In Vitro Cell Dev. Biol. Anim. 33: 425–427; 1997.
Sathe P. S.; Maurya D. T.; Basu A.; Gogate S. S.; Banerjee K.
Establishment and characterization of a new fish cell line; MG-3;
from the gills of mrigal Cirrhinus mrigala. Indian J. Exp. Biol.
33: 589–594; 1995.
Tong S. L.; Lee H.; Miao H. Z. The establishment and partial
characterization of a continuous fish cell line FG-9307 from the
gill of flounder; Paralichthys olivaceus. Aquaculture 156: 327–
333; 1997.
Tong S. L.; Miao H. Z.; Li H. Three new continuous fish cell lines of
SPH; SPS and RSBF derived from sea perch (Lateolabrax
japaonicus) and red sea bream (Pagrosomus major). Aquaculture
169: 143–151; 1998.
Tsai L. C.; Huang M. T.; Hsiao C. T.; Lin C. Y.; Chen S. Z.; Lee C. I.;
Hsieh H. M. Species identification of animal specimens by
cytochrome b gene. Forensic Sci. J. 6: 63–65; 2007.
Vijayaraghavan S.; Krishnakumari L.; Gopinath V. J.; Dhawan R. M.
Aquaculture of pearlspot Etroplus suratensis in an esturine pond:
environmental characteristics; primary production; growth and
cost benefit ratio. Indian J. Mar. Sci. 10: 82–89; 1981.
Ward R. D.; Zemlak T. S.; Innes B. H.; Last P. R.; Hebert P. D. N.
DNA barcoding Australia’s fish species. Philos Trans.-R. Soc.
Lond., Phys. Sci. Eng. 360: 1847–1857; 2005.
Wen C. M.; Lee C. W.; Wang C. S.; Cheng Y. H.; Huang H. Y.
Development of two cell lines from Epinephelus coioides brain
tissue for characterization of betanodavirus and megalocytivirus
infectivity and propagation. Aquaculture 278: 14–21; 2008.
Wise Sr. J. P.; Winn R. N.; Renfro J. L. Generating new marine cell
lines and transgenic species. J. Exp. Zool. 15: 292–295; 2002.
Wolf K.; Quimby M. C. Established eurythermic line of fish cells in
vitro. Science 135: 1065–1066; 1962.