Specific Determination of Oligonucleotide Therapeutics by Dual Ligation Hybridization Assay
G. A. Tremblay, P. R. Oldfield and A. J. Bartlett
Charles River Laboratories Preclinical Services Montreal Inc., 22022 Transcanadienne, Senneville, Quebec, Canada H9X 3R3
Patents pending No. US 61/258 046, US 61/327 245
Abstract
Objective: Hybridization assays quantify oligonucleotide-
based therapeutics in various biological matrices such as
plasma or tissues. Current methods fail to discriminate
the parent compound from 5’ or 3’ (N-x) truncated
metabolites. The objective was to develop an assay
specific for the parent compound.
Method: The method is based on a bi-enzymatic reaction
that results in ligation of probes at both ends of the
analyte.
Results: Full-length, unmodified or phosphorothioate
oligonucleotide therapeutics are quantified with the
dual ligation immunoassay. We have demonstrated the
mechanism and investigated the specificity of the assay
for the analyte. Validation parameters were assessed to
document suitability of the method.
Conclusion: We have developed, what we believe to be
the first hybridization-based assay specific for the parent
compound. The method is currently being adapted to the
determination of oligonucleotide therapeutics by qPCR.
Introduction
Hybridization assays are used to quantify investigational
DIA, Washington, DC
oligonucleotide (OGN) therapeutics at the discovery,
preclinical and clinical stages of the drug development
process1. They include sandwich, competitive, ligation2
and nuclease-based3 methods.
Until now there was no hybridization assay specific for
the parent compound or full-length product (FLP). Indeed
metabolites short of 1, 2 or more nucleotides over the
FLP would be detected.
Specific hybridization assays are highly desirable as they
lead to accurate pharmacokinetic (PK) and toxicokinetic
(TK) profiles in support of OGN drug development.
Although antisense compounds may be active when
truncated of a few nucleotides4, other classes of
compounds such as siRNA may not be as permissive for
sustaining RNA interference activity.
A specific method to determine the parent compound
will assess the FLP with both 5’- and 3’-ends intact. The
ligation reaction could be well suited for that purpose,
considering the specificity of T4 DNA ligase for fully
matched duplexes. However, ligation cannot be directly
06/2010 implemented at the 5’-end of an OGN analyte since OGN
therapeutics are not usually phosphorylated.
Therefore, it was envisaged that T4 polynucleotide kinase
www.criver.com
(PNK) could phosphorylate the 5’-end of the OGN analyte
prior to the ligation step. The cloned T4 PNK and T4
DNA ligase available on the market are bacteriophage
enzymes involved in DNA repair. Although both enzymes
are known to work together, they have not been applied
in a quantitative method.
The dual ligation immunoassay integrates bi-enzymatic
processing of the ON analyte with a defined set of
probes, and constitutes the first parent compound-
specific quantitative hybridization assay.
Methods
The analyte, s2B was a phosphodiester DNA OGN with
the sequence of a published siRNA3. All oligonucleotides
were DNA and have 5’-OH and 3’-OH unless otherwise
stated. All oligonucleotides were purified by HPLC.
s2B: gcctcagcacgtacctctatt
s2B 5’ N-1: cctcagcacgtacctctatt
s2B 3’ N-1: gcctcagcacgtacctctat
s2B template probe: NH2-gaatagcgaaatagaggtacgtgctga
ggcggattcacg-NH2
Ligation probe 1: PO4-tcgctattc-[Biotin-TEG]
Ligation probe 2: [Digoxigenin]-cgtgaatcc
The oligonucleotides were obtained from IDT Inc. The
PNK was purchased from New England Biolabs and the
T4 DNA ligase was from USB.
The anti-DIG HRP was from Roche Inc. The QuantaBlu
and HBC Neutravidin-coated plates were from Pierce Inc.
Figure 1: Schematic representation of the dual ligation immunoassay.
Oligonucleotide Analyte: 3’OH
Template Probe:
Ligation Probe 1:
Biotin
OH
Phosphorylation
PO4
Ligation
Probe 2:
Ligation
Ligation Ligation
Quantification
Process
• The dual ligation-hybridization assay workflow is
depicted on Figure 1. The template probe is fully
complementary to the test OGN, in addition to having
extensions on either side that are complementary
to Ligation Probes 1 and 2.
• Ligation Probe 1 is modified for immobilization onto a
solid support and synthesized with a phosphate
moiety for easier ligation. Ligation Probe 2 is labeled
for downstream signaling.
• The biological sample containing the test OGN is
mixed with the Template Probe and Ligation Probe 1
followed by denaturation/annealing/immobilization
onto a 96-well plate.
• Bi-enzymatic reaction: PNK, ligase and Ligation
Probe 2 for ca. 1h30 min.
• The plates are washed thoroughly to remove
un-ligated products at the 3’ and 5’-end sides of the
Template Probe; in order for signaling to occur, both
ends of the test OGN must have ligated.
• Subsequent signaling follows using standard
reagents.
Results Dual Ligation qPCR for Quantifying Oligonucleotide
Standard curve Specificity for the parent compound Validation parameters: precision and accuracy, Therapeutics on Dried Blood Spots
specificity, prozone and dilution linearity A) Primer 1 Ligation Ligation
• A representative calibration curve obtained with the • In Figure 4, the signal generated at different
dual ligation immunoassay in mouse plasma is concentrations for the FLP of the analyte versus the • The assay performed comparably in mouse, monkey
shown in Figure 2. same analyte truncated by 1 nucleotide at either the and human plasma (K2EDTA). Template 1 Template 2
• The curve working range was 0.12 nM (0.8 ng/mL) up 5’-end or the 3’-end (5’ N-1 or 3’ N-1 metabolites) are • In Table 1, the intra-assay precision and accuracy Primer 2
to 4.5 nM (28 ng/mL) using a linear regression compared. demonstrates that the method reproducibly determines qPCR
model. The behavior and sensitivity of the curve are • In this instance, a low interference of ≤4% was the test OGN within 10% accuracy in mouse plasma.
comparable to other hybridization assays. observed with the 3’ N-1 metabolite for • The assay was specific for the analyte, within ±25% of
concentrations above 4.5 nM. In some assays, no the theoretical concentration in five different lots of
interference was detected from the 3’-end. mouse plasma (Table 2); the dual ligation assay
• No interference was detected for the 5’ N-1 recovers the analyte irrespective of individual lot
metabolite in all assays. variations. B) C)
Figure 2: Representative calibration curve with the test oligonucleotide in
• The dual ligation immunoassay is thus considered • No interference was observed in all matrices tested R2=0.996
mouse plasma.
specific for the FLP. (mouse, human, monkey) and there was no detectable
prozone effect when tested at a concentration ca.
Figure 4: Specificity of the dual ligation assay for the parent compound
100-fold the upper limit of quantitation (ULOQ) in mouse
(FLP) evaluated against the 5’ N-1 metabolite and the 3’ N-1
metabolite in mouse plasma. plasma.
• The recovery of dilution is linear over the range
5’OH
analyzed when performed in mouse plasma (Figure 6).
Table 1: Intra-assay precision and accuracy of the analyte in mouse plasma
Log concentration (picoMolar)
• Current miRNA/siRNA qPCR methods lack specificity and
Oligonucleotide Concentration in
Mouse Plasma (nM) §
Intra-Assay Precision & Accuracy (n=3) largely detect metabolites in addition to the parent
Theoretical Measured CV (%) Recovery (%) compound.
Low QC
Mid QC
0.375
2.400
0.412
2.506
9.2
3.5
110.0
104.4
• We report the application of a dual ligation-based qPCR
method (DL-qPCR) for the quantitation of oligonucleotide
High QC 4.500 4.433 13.3 98.5 analytes on dried blood spots.
§ Both 5’ and 3’ (N-1) truncated sequences were <LLOQ and therefore undetected.
• Two template probes guide the ligation of the analyte
onto two generic adapters at either end of the analyte (A).
Table 2: Specificity assessment of the analyte in five different lots of mouse
plasma • qPCR is performed post bi-enzymatic processing using
adapters.
Bi-enzymatic mechanism of detection Recovery of the analyte
• Based on the threshold cycle (Ct) values obtained from
Independent lots Spiked Recovery
• In Figure 3, when the enzymatic reaction is carried- of mouse plasma (0.25 nM) (% theoretical) the amplification of the spiked analyte (B), a standard
Versatility with the phosphorothioate chemistry curve was constructed with data points within 20%
out with either individual enzyme, no signal is
Lot #1 0.28 111.2
• The ligation-hybridization assay typically works with a Lot #2 0.27 106.7 of the theoretical value (C).
detected above the lower limit of quantitation (LLOQ).
variety of OGN chemistries including DNA, RNA and
Lot #3 0.31 124.0 • No amplification products were detected with the N-1
For a curve to be generated, both T4 PNK and T4 Lot #4 0.28 113.3 metabolites from the 5’-end or the 3’-end, making the
DNA ligase are required. phosphothioates2 (PS); T4 DNA ligase is permissive Lot #5 0.28 110.1 DL-qPCR specific for the parent compound.
to a variety of nucleic acid chemistries.
• Thus the reaction is occurring as schematized in Average: 0.28 113.1
• Fully modified or chimeric PS OGNs are reported to
Figure 1, where a bi-enzymatic reaction takes place.
Also, the washing conditions satisfactorily eliminate inhibit PNK5. Figure 6: Dilution linearity assessment of the analyte in mouse plasma.
7
Conclusion
un-ligated OGNs. • Thus we compared the signal generated with the • The dual ligation hybridization assay is specific for the
dual ligation immunoassay with the phosphodiester 6
parent test OGN and does not significantly detect
analyte versus a fully phosphorothioated analogue.
R2 = 0.9997
5 metabolites.
• The dual ligation immunoassay is permissive to • The method relies on a bi-enzymatic process
Concentration (nM)
PS OGNs (Figure 5). 4
comprising DNA ligase and polynucleotide kinase from
• The inflexion at the end of the curve may be due to a 3 phage T4.
Figure 3: Mechanism of detection of the dual ligation assay, where
reliance on PNK and DNA ligase was tested in mouse plasma. limited inhibition of PNK by PS. • With the added advantage of specificity for the FLP,
2
overall the dual ligation hybridization assay performs
Figure 5: Comparison of the signal generated with phosphorothioate and
phosphodiester variations of the test oligonucleotide in mouse
1
similarly to the ligation-hybridization assay2; and
plasma. 0 notably from the perspective of OGN chemistry
0 0.002 0.004 0.006 0.008 0.01 0.012 versatility.
Dilution-1 • Validation parameters including intra-assay precision
References and accuracy, specificity and interference, dilution
1. Tremblay, G.A. and Oldfield, P.R. 2009. Bioanalysis of siRNA and oligonucleotide therapeutics in linearity and prozone demonstrated the robustness,
biological fluids and tissues. Bioanalysis. 1(3), 595–609. reproducibility and accuracy of the assay.
2. Baker BF, Yu Z, Leed JM. 2002. Development of an ultrasensitive noncompetitive hybridization- • One application of the dual ligation hybridization
ligation enzyme-linked immunosorbent assay for the determination of phosphorothioate
assay is for metabolite testing. The assay can be
oligodeoxynucleotide in plasma. Anal Biochem. 304(1):19-25.
3. Overhoff, M., Wünsche, W. and Sczakiel, G. 2004. Quantitative detection of siRNA and single- adapted to determine parent as well as shortmers
stranded oligonucleotides: relationship between uptake and biological activity of siRNA Nucleic simply by designing the appropriate (N-x) Template
Acids Res. Vol. 32, No. 21, e170.
Probe complementary to the desired metabolite.
4. Crooke, S.T. and Lebleu, B., ed. 1993. Antisense Research and Application. CRC Press, Taylor &
Francis Group, NY, USA. pp 527-528.10. • We are currently developing a dual ligation-based
qPCR method for the quantitation of oligonucleotide
5. Teasdale, R.M., Matson, S.J., Fisher, E. and Krieg, A.M. 1994. Inhibition of T4 polynucleotide
kinase activity by phosphorothioate and chimeric oligodeoxynucleotides. Antisense Res Dev. 4 (4):
295-97.
therapeutics.