1. -<Q>You have isolated a mutation in a regulatory protein.

The
mutation in the protein results in constitutive expression of a gene that is
normally regulated by that protein. Which of the following represents the
protein that has the mutation?
<C+>Repressor.
<C>Activator.
<C>Operator.
<C>Promoter.
<C>RNA polymerase.

2. <Q>In lac operon, when the inducer binds to the repressor:

<C>Repressor affinity for the operator is slightly increased.
<C+>Repressor affinity for the operator is highly reduced.
<C>Repressor affinity for the operator does not change.
<C>Repressor affinity for the promoter region is slightly increased.
<C>Repressor affinity for other random DNA sequences is highly increased.

3. -<Q>In E. coli lac operon, if the lacZ gene is mutated with a loss of
function then the following statement is TRUE:
<C>The amount of the allolactose will be increased.
<C>The expression of the lac A and lac Y will be increased.
<C>The binding of the repressor protein to the operator region of the lac operon will
be decreased.
<C+>The amount of allolactose might be decreased.
<C>The amount of allolactose should be unaffected.

4. -<Q>Which of the following changes will increase gene expression in

eukaryotes?
<C>Methylation of histones.
<C+>Acetylation of histones.
<C>Binding of methylcytosine binding protein to DNA.
<C>Increase compactness of the chromatin.
<C>X-chromosome inactivation.

?Q>Which of the following activities TFIIH has>- .5

.C+>Helicase, ATPase and kinase activities>
.C>Helicase, methylase and kinase activities>
.C>Helicase, acetylase activities>
.C>Methylase and kinase activities>

6. -<Q>NF1 transcription factor binds to:

<C+>CAAT box.
<C>TATA box.
<C>GC box.
<C>TATA box and GC box.
<C>CAAT and GC box.

-
 7. <Q>In lac operon, the natural inducer that binds repressor is:
<C>Lactose
<C>Mannose.
<C+>Allolactose.
<C>Glucose.
<C>Galactose.

8. -<Q>A mutation that permanently activates adenylate cyclase to

produce cAMP will have the following effect(s).
<C>The expression of the lac operon does not change.
<C>Lac operon will not be transcribed in the presence of lactose alone.
<C>The lac operon will be transcribed in the presence of glucose alone.
<C+>The lac operon will be transcribed in the presence of glucose and lactose.
<C>The presence of cAMP prevents the formation of active repressor from repressor
subunits.

9. -<Q>Which modification of DNA is inversely correlated with gene

activity?
<C>Acetylation.
<C+>Methylation.
<C>Phosphorylation.
<C>Dephosphorylation.
<C>Deamination.

10. -<Q>The role of TFIIA in the process of transcription is to:

<C+>Stabilize the TFIID DNA interaction.
<C>Provide an appropriate interaction site for the binding of RNA polymeraseII.
<C>Destabilize non-specific RNA polymerase II DNA interaction.
<C>Phosphorylate RNA polymerase II

11. -<C>Which of the following are common ways to modulate the

function of regulatory transcription factors.
A- Binding of hormones.
B- Protein-protein interaction.
C- Phosphorylation.
<C>A only
<C>A and B
<C>A and C
<C>C and B
<C+>A, B and C

12. Unlike the 5' end of a prokaryotic mRNA, the 5' end of a eukaryotic
mRNA
a. retains the nucleoside 5'-triphosphate.
b. is modified by addition of a methylguanosine cap.
c. is modified by the addition of a polyadenylate cap.
d. only contains a few (three or four) bases before the AUG.
e. has a consensus sequence to specify the start of translation.
 13. An E. coli strain has a mutation in the RNA Pol core enzyme that
prevents association with sigma factor. This is expected to cause an inability
of the enzyme to
a. catalyze elongation of RNA.
b. recognize operators.
c. recognize promoters.
d. recognize terminators.

14. It has the highest percentage of modified bases.

a. hnRNA
b. mRNA
c. rRNA
d. snRNA
e. tRNA

15. It represents the largest percentage by weight of cellular RNA.

a. hnRNA
b. mRNA
c. rRNA
d. snRNA
e. tRNA

16. Pick the type of mutation illustrated by the following nucleotide

changes.

Thr Ser Leu Asp Stop

wild-type ACU AGU UUA GAU UGA

mutant ACU AGU UUU GAU UGA

a. nonsense mutation
b. read through mutation
c. silent mutation
d. frameshift mutation
e. missense mutation

17. Prokaryotic RNA Polymerase

a. binds only the template strand of DNA.
b. has a 3' -> 5' exonuclease activity.
c. uses dNTPs as substrates.
d. requires a primer.
e. requires a sigma factor for promoter recognition

18. The aminoacyl-tRNA synthetases all:

a. are specific for one tRNA and one or a few cognate amino acids.
b. use GTP to activate the amino acids for formation of the aa-tRNA.
c. recognize the correct tRNA by the sequence of the anticodon.
d. activate the amino acids for peptide bond formation.
e. interact with the ribosomes during the initiation phase of protein synthesis.

19. A mutation in the lac repressor protein eliminates its binding to the lac
operator. The mutant strain displays:
a. an inability to express the lactose operon-encoded genes under any circumstances.
b. an inability to express the lactose operon-encoded genes unless lactose is present
and glucose is absent.
c. the same level of expression of the lactose operon-encoded genes under all
circumstances.
d. the highest level of expression of the lactose operon-encoded genes only when
glucose is absent whether or not lactose is present.
e. the highest level of expression of the lactose operon-encoded genes only when
glucose is absent and lactose is present

20. What do DNA-binding proteins of the leucine zipper, helix-loop-helix,

and zinc finger families have in common?
a. An amphipathic helix with a leucine-lined hydophobic surface
b. A small domain that protrudes from the surface of the protein and binds DNA
c. A conserved cysteine and histidine-containing motif
d. Ability to bind to DNA only as tetramers
e. Recognition of the same DNA sequence in the major groove of DNA.

21. The indicated gene has a mutation that eliminates the 3' splice site of intron
#2. What is the most likely structure of the mature mRNA in the mutant cells?
 22. The sequence of the 5`region of a bacterial gene (the non template
strand is shown) and several of its mutants which exhibit altered transcription
activity is presented below. A DNA fragment which has either the wild type
promoter region or one of its alternate forms, was transcribed in vitro, the
amount of specific transcription was measured and the data are presented in
the table below. Explain the role of each mutation in determining the level of
transcription found in the table.

5`TCTGGCGGTGTTGACATAAATACCACTGGGGTGATACTGAGACATCAG 3`
↓ ↓ ↓ ↓
T G T T
MUTANT # 1 2 3 4

Wild type 100

Mutant 1 16
Mutant 2 24
Mutant 3 297
Mutant 4 100