The Journal of Nutrition

Effects of Probiotics and Prebiotics

Advanced Molecular Tools for the Identification

of Lactic Acid Bacteria1–3
Kaouther Ben Amor, Elaine E. Vaughan, and Willem M. de Vos*

Laboratory of Microbiology, Wageningen University, CT Wageningen, The Netherlands

Abstract
Recent years have seen an explosion in the development and application of molecular tools for identifying microbes and
analyzing their activity. These tools are increasingly applied to strains of lactic acid bacteria (LAB), including those used in
fermentation and as well as those marketed as probiotics, for identification and analysis of their activity. Many of these tools
are based on 16S ribosomal DNA sequences and exploit either hybridization or PCR techniques. Furthermore, complete or
partial genomes of various LAB and bifidobacteria have been determined and offer omics-based approaches to analyze the
activity of the bacteria provided that the mechanisms of their action are known. Finally, fluorescent probes coupled to flow

Downloaded from jn.nutrition.org by on November 9, 2010

cytometry are used to monitor the physiological capacity of bacterial cells in situ. All these approaches can be used for the
screening and selection of LAB, assessing their role in fermentation and flavor development in fermented products.
Additional aspects of probiotic LAB include their viability and vitality during processing and analysis of their presence,
persistence, and performance in the gastrointestinal tract. An overview of these approaches is provided, and specific
examples of their application to lactic cultures are presented. Because of their abundant use in tracing and tracking of LAB, a
complete listing of 16S ribosomal RNA probes for lactobacilli and bifidobacteria is provided. J. Nutr. 137: 741S–747S, 2007.

Many of the modern molecular tools are based on 16S ribosomal
DNA sequences, complete or partial genomes, or specific
fluorescent probes that monitor the physiological activity of
microbial cells. These high throughput approaches are increas-
ingly applied to strains of lactic acid bacteria (LAB)4 and
bifidobacteria that provide health benefits and are marketed as
probiotic bacteria. The primary purpose of these approaches is
to provide proper strain identification as required for legal and
good manufacturing practices. In addition, these identification
1
Published as a supplement to The Journal of Nutrition. The articles included in
this supplement are derived from presentations and discussions at the World
Dairy Summit 2003 of the International Dairy Federation (IDF) in a joint IDF/FAO
symposium entitled ‘‘Effects of Probiotics and Prebiotics on Health
Maintenance—Critical Evaluation of the Evidence,’’ held in Bruges, Belgium.
The articles in this publication were revised in April 2006 to include additional
relevant and timely information, including citations to recent research on the
topics discussed. The guest editors for the supplement publication are Michael
de Vrese and J. Schrezenmeir. Guest Editor disclosure: M. de Vrese and
J. Schrezenmeir have no conflict of interest in terms of finances or current grants
received from the IDF. J. Schrezenmeir is the IDF observer for Codex
Alimentarius without financial interest. The editors have received grants or
compensation for services, such as lectures, from the following companies that
market pro- and prebiotics: Bauer, Danone, Danisco, Ch. Hansen, Merck, Müller
Milch, Morinaga, Nestec, Nutricia, Orafti, Valio, and Yakult.
2
Author disclosure: no relationships to disclose.
3 analyzing their activity can be divided into those based on
Part of this work was supported by the EU Quality of Life projects Microbe
Diagnostics (QLK1-2000-00108), EU and Microfunction (QLK1-2001-00135) and
Progid (QLK1-2000-00563).
4
Abbreviations used: AFLP, amplified fragment length polymorphism; DGGE,
denaturing gradient gel electrophoresis; FCM, flow cytometry; FISH, fluorescent
in situ hybridization; LAB, lactic acid bacteria; PFGE, pulsed-field gel electropho-
resis; RAPD, randomly amplified polymorphic DNA; RFLP, restriction fragment
length polymorphism; rDNA, ribosomal DNA; rRNA, ribosomal RNA.
* To whom correspondence should be addressed. E-mail: willem.devos@wur.nl.
0022-3166/07 $8.00 ª 2007 American Society for Nutrition.
tools can be used to trace and track LAB including probiotics in
the production phase and in food products as well as after
consumption in the intestinal tract. Moreover, many of these
identification tools can be instrumental in the selection of new
strains or species of LAB or bifidobacteria as starters, for flavor
developments, or to be developed into probiotics. Finally, a
series of functional approaches are being developed and
validated that can further be used in controlling quality. These
are either based on generic microbial properties or specifically
address the mechanisms by which LAB and probiotics may exert
their functional or benefical effects. The generic systems are used
to monitor the viability, vitality, or stress response of LAB during
fermentation or in bioreactors or food products, whereas the
specific ones have the potential to determine the performance of
probiotic bacteria in all these systems as well as in the intestinal
tract of the consumer. In this article we provide an overview of
these tools and their potential, provide examples of their use
with LAB with an emphasis on probiotic cultures, and present a
listing of the developed 16S ribosomal DNA (rDNA) probes that
have served in the identification of LAB and bifidobacteria.
Overview of molecular tools
The tools that have been developed for identifying microbes and
nucleic acids and other macromolecules and approaches directed
at analyzing the activity of complete cells. The nucleic acid–
based tools are more frequently used because of the high through-
put potential provided by using PCR amplification or ex situ or
in situ hybridization with DNA, RNA, or even peptide nucleic
acid probes. Notably, these include 16S rDNA sequences that
can be used to place diagnostics into a phylogenetic framework
741S
and can be linked to databases providing up to 100,000 se-
quences (1). These 16S rDNA–based methodologies are robust
and superior to traditional methods based on phenotypic ap-
proaches, which are often unreliable and lack the resolving power
to analyze the microbial composition and activity of bacterial
populations. In addition, a panoply of approaches that are based
on DNA sequences other than rDNAs have been applied fre-
quently to probiotic bacteria. These have been shown to be par-
ticularly useful for strain identification, as detailed below.
Recently, approaches based on complete or partial genomes
have been introduced in the food industry. These include DNA
arrays that can be used in comparative genomics or genome-
wide expression profiling (2). These omics approaches have now
become feasible for probiotic bacteria since the recent realiza-
tion of the complete genome sequences of human isolates of
Bifidobacterium longum (3) and Lactobacillus plantarum (4).
Other functional approaches may be based on the properties of
other macromolecules such as proteins. Notably, the link with
the complete or partial genomes provides the basis for the
further development of proteomics and other omics-related
approaches to detect, identify, and analyze the functionality of
LAB and bifidobacteria (5).
In addition to analysis of individual macromolecules or their
collective set in a LAB strain, whole cells can also be targeted.
This offers the possibility of analyzing the physiological prop-
erties of intact cells in situ using fluorescently labeled probes or
substrates in combination with high-throughput approaches
such as flow cytometry. These systems are notably useful to
provide information on the viability and stresses in lactic
cultures, as described below.
16S Ribosomal RNA probing: genus to
species identification
Over the last decade, hybridizations with ribosomal RNA
(rRNA)-targeted probes have provided a unique insight into the
structure and spatiotemporal dynamics of complex microbial
communities (6). Nucleic acid probes can be designed to spe-
cifically target taxonomic groups at different levels of specificity
(from species to domain) by virtue of variable evolutionary
conservation of the rRNA molecules. Appropriate software
environments such as the ARB package, a software environment
for sequence data (http://www.arb-home.de/) and availability of
large databases (http://rdp.cme.msu.edu/html/), or the online
resource for oligonucleotide probes probeBase (http://www.
microbial-ecology.de/probebase/index.html) offer powerful plat-
forms for a rapid probe design and in silico specificity profiling.
Oligonucleotide probes that are complementary to regions of 16S
or 23S rRNA have been successfully used for the identification of
LAB, and hence, they offer the potential to be used as reliable and
rapid diagnostic tools.
An overview of the currently available and validated 16S
rRNA targeted oligonucleotide probes for the identification of
LAB that belong to the low-GC-content gram-positive bacteria
is provided with a distinction between Lactobacillus spp. (Table
1) and Lactococcus, Leuconostoc, Pediococcus, and Enterococ-
cus spp. (Table 2). These probes have different degrees of
hierarchy ranging from group and genus to species and
subspecies level. Although most target the species or subspecies
level, the Lab-158 and Lab-722 probes detect nearly all species
of the genera Lactobacillus, Enterococcus, Pediococcus, Weis-
sela, Vagococcus, Leuconostoc, and Oenococcus (7,8).
The 16S rDNA probes used to detect and identify Bifidobac-
terium spp. are listed in Table 3. Also for this group of high-GC-
content gram-positive bacteria, both genus- and species-level
742S Supplement
probes have been developed and applied. Species-specific probes
include probes for B. lactis, B. adolescentis, B. breve, B. infantis,
B. dentium, and B. longum (9–11).
Nucleic acid probing is based on 2 major techniques: dot-blot
hybridization and whole-cell in situ hybridization. Dot-blot
hybridization is an ex situ technique in which total RNA is
extracted from the sample and is immobilized on a membrane
together with a series of RNAs of reference strains. Subse-
quently, the membrane is hybridized with a radioactively labeled
probe, and after stringent washing, the amount of target rRNA
is quantified. Because cellular rRNA content is dependent on the
physiological activity of the cells, no direct measure of the cell
counts can be obtained. In contrast to dot-blot hybridization,
fluorescent in situ hybridization (FISH) is applied to morpho-
logically intact cells and thus provides a quantitative measure of
the target organism. The listed probes can all be used for dot-
blot hybridizations, but for application in FISH, specific
validation is required because some regions of the rRNA are
not accessible because of their secondary structure and protec-
tion in the ribosome. Hence, the number of validated FISH
probes is much smaller than that of the probes suitable for ex
situ analysis. This is illustrated in the listing of the probes for
LAB and bifidobacteria in which the validated FISH probes are
underlined (Tables 1–3).
Downloaded from jn.nutrition.org by on November 9, 2010
Genotypic typing: strain identification
Several molecular typing techniques have been developed during
the past decade for the identification and classification of
bacteria at or near the strain level. The most powerful of these
are genetic-based molecular methods known as DNA finger-
printing techniques, e.g., pulsed-field gel electrophoresis (PFGE)
of rare-cutting restriction fragments, ribotyping, randomly
amplified polymorphic DNA (RAPD), and amplified fragment
length polymorphism (AFLP), which have been applied exten-
sively for the infraspecific identification and genotyping of LAB
and bifidobacteria isolated from fermented food products as
well as from the human gastrointestinal tract (12). Basically,
these methods rely on the detection of DNA polymorphisms
between species or strains and differ in their dynamic range of
taxonomic discriminatory power, reproducibility, ease of inter-
pretation, and standardization. Genetic fingerprinting tech-
niques that are currently being used for typing dairy LAB and
especially probiotic cultures are described below.
Pulse field gel electrophoresis
Restriction fragment length polymorphism (RFLP) analysis of
bacterial DNA involves the digestion of genomic DNA with
rare-cutting restriction enzymes to yield a few relatively large
fragments. The restriction fragments are then size-fractionated
using PFGE that allows separation of large genomic fragments.
The generated DNA fingerprint obtained depends on the
specificity of the restriction enzyme used and the sequence of
the bacterial genome and is therefore characteristic of a
particular species or strain of bacteria. This fingerprint repre-
sents the complete genome and thus can detect specific changes
(DNA deletion, insertions, or rearrangements) within a partic-
ular strain over time. Its high discriminatory power has been
reported for the differentiation between strains of important
probiotic bacteria, such as Bifidobacterium longum and B.
animalis (13), Lactobacillus casei and Lb. rhamnosus (14), Lb.
acidophilus complex (15), Lb. helveticus (16), and Lb. johnsonii
(17). More recently, a new approach combining RFLP with
DNA fragment sizing by flow cytometry has been reported for
bacterial strain identification (18). DNA fragment sizing by flow
 TABLE 1 rRNA-targeted oligonucleotide probes used for the identification of Lactobacillus (Lb.) spp.

Probe Sequence (5# to 3#) Specificity Reference

4 1
Lab158 GGTATTAGCA(C/T)C TGT TTCCA Lactic acid bacteria (7)
Lab722 Y*CACCGCTACACATGR*AGTTCCAC T Lactic acid bacteria2 (8)
Lactobacillus cluster
NG3 GATAGAGGTAGTAACTGGCCTTTA Lb. acidophilus group (9)
LAA-1 TGAACCAACAGATTCACTTCGGTGATGACGTTGGGAAACGCT Lb. acidophilus ATCC 332 (52)
NG3 GAATCTGTTGGTTCAGCTCGC Lb. acidophilus (53)
Lba TCTTTCGATGCATCCACA Lb. acidophilus (54)
Lbam GTAAATCTGTTGGTTCCGC Lb. amylovorus (54)
Lbb TGTTGAAATCAAGTGCAAG Lb. brevis (55)
Lab86 GTGCTTGCACTGATTTCAAC Lb. brevis (56)
Lbcr GCAGGCAATACACTGATG Lb. casei/rhamnosus (57)
Cur150 ATGATAATACCCGACTAA Lb. curvatus (58)
Lbd AAGGATAGCATGTCTGCA Lb. delbrueckii (57)
Fer49 CCTGATTGATTTTGGTTGCC Lb. fermentum (56)
NG3 CAATCAATTGGGCCAACGCGT Lb. fermentum (53)
Lbh ACTTACGTACATCCACAG Lb. helveticus (57)
Lbj ATAATATATGCATCCACAG Lb. johnsonii (54)
Lbma CAAAACCGACTCGAAAG Lb. manihotivorans (59)
Lbpa CACTGACAAGCAATACAC Lb. paracasei (57)
PLp CTACGGTACAAGTACCAGT Lb. plantarum (60)

Downloaded from jn.nutrition.org by on November 9, 2010

NG3 CCAATCAATACCAGAGTTCG Lb. plantarum (53)
LbpV34 CCGTCAATACCTGAACAG Lb. plantarum (61)
Reu93 CTGATTGACGATGGTTCACC Lb. reuteri (56)
Lbre GATCCATCGTCAATCAGG Lb. reuteri (55)
NG3 TTCGGTGAAAGAAAGCTTCG Lb. ruminis (53)
1
Includes genera Lactobacillus, Leuconostoc, Pediococcus, Weissella, Enterococcus, Oenococcus, and Vagococcus.
2
Includes genera Lactobacillus, Leuconostoc, Pediococcus, and Weissella.
3
NG, not given.
4
These probes have been used in FISH.

cytometry was found to be faster and more sensitive than PFGE, ribotyping vary from partial sequences of the rDNA genes or
and this technique is also amenable to automation. the intergenic spacer regions to the whole rDNA operon (19).
Ribotyping has been used to characterize strains of Lactobacil-
Ribotyping lus and Bifidobacterium from commercial products as well as
Ribotyping is a variation of the conventional RFLP analysis. It from human fecal samples (20,21). However, ribotyping pro-
combines Southern hybridization of the DNA fingerprints, vides high discriminatory power at the species and subspecies
generated from the electrophoretic analysis of genomic DNA level rather than on the strain level. PFGE was shown to be more
digests, with rDNA-targeted probing. The probes used in
TABLE 3 rRNA-targeted oligonucleotide probes used for the
TABLE 2 rRNA-targeted oligonucleotide probes used for the identification of Bifidobacterium spp.
identification of Lactococcus, Leuconostoc (Lc.),
Pediococcus, and Enterococcus spp. Probe Sequence (5# to 3#) Specificity Reference
*
Lm3 GGTGCTI CCCACTTTCATG Bifidobacterium genus (66)
Probe Sequence (5# to 3#) Specificity Reference
Bif1641 CATCCGGCATTACCACCC Bifidobacterium genus (67)
Strc4931 GTTAGCCGTCCCTTTCTGG Lactococcus-Streptococcus (62) Bif2281 GATAGGGACGCGACCCCAT Bifidobacterium genus (68)
Llc TGCAAGCACCAATCTTCATC L. lactis subsp. lactis (63) Bif TCTACACATTCCACCGTTACACCGGGAA Bifidobacterium genus (69)
PLl1 AGTCGGTACAAGTACCAAC L. lactis subsp. lactis (60) PAD GCTCCCAGTCAAAAGCG B. adolescentis (11)
212RLa CTTTGAGTGATGCAATTGCATC Lacotococcus genus (64) PBI GCAGGCTCCGATCCGA B. bifidum (11)
LactV5 GCTCCCTACATCTAGCAC L. lactis (61) PBR AAGGTACACTCAACACA B. breve (11)
Lla CTATAATGCTTAAGTCCACG L. lactis (63) PIN TCACGCTTGCTCCCCGATA B. infantis (11)
PLc TTCAAATTGGTGCAAGCACC L. lactis subsp. cremoris (60) PLO TCTCGCTTGCTCCCCGATA B. longum (11)
68RCa TGCAAGCACCAATCTTCATC L. lactis subsp. cremoris (64) BDE ACGTCACGGTGGGAACTCA B. dentium (10)
LeucV5 CCTCCTAACACCTAGTGT Lc. mesenteroides (61) BAN CCGGTTCACAGGTGGT Bifidobacterium sp.2 (10)
Plcm CAGCTAGAATAGGAAATCAT Lc. mesenteroides (60) NG3 GTGGAGACACGGTTTCCCTT B. lactis (9)
Ppento89 AATCAGTACAAGTACGTCATA P. pentosaceus (65) 1
These probes have been used in FISH.
Enc16S CTTTCGGGTGTCGCTG E. faecalis (56) 2
The probe targets the following species: B. animalis DSM 20104, B. asteroides DSM
Efs GGTGTTGTTAGCATTTCG E. faecalis (63) 20089, B. coryneforme DSM 20216, B. cuniculi DSM 20435, B. globosum DSM
Efm CACACAATCGTAACATCC E .faecium (63) 20092T, B. magnum DSM 20222T, B. minimum DSM 20102T, B. subtile DSM 20096T.
3
NG, not given.
1
This probe has been used in FISH. * I denotes inosine.

Molecular methods for identification of LAB 743S

discriminatory in typing closely related Lb. casei and Lb.
rhamnosus as well as Lb. johnsonii strains than either ribotyping
or RAPD analysis (14,17).
Randomly amplified polymorphic DNA
Arbitrary amplification, also known as RAPD, has been widely
reported as a rapid, sensitive, and inexpensive method for
genetic typing of different strains of LAB and bifidobacteria.
This PCR-based technique makes use of arbitrary primers that
are able to bind under low stringency to a number of partially or
perfectly complementary sequences of unknown location in the
genome of an organism. If binding sites occur in a spacing and
orientation that allow amplification of DNA fragments, finger-
print patterns are generated that are specific to each strain (19).
RAPD profiling has been applied to distinguish between strains
of Bifidobacterium (22) and between strains of the Lb.
acidophilus group and related strains (14,15,23–25). Several
factors have been reported to influence the reproducibility and
discriminatory power of the RAPD fingerprints, i.e., annealing
temperature, DNA template purity and concentration, and
primer combinations. The use of 5 single-primer reactions under
optimized conditions improved the resolution and accuracy of
the RAPD method for the characterization of dairy-related
bifidobacteria including B. adolescentis, B. animalis, B. bifidum,
B. breve, B. infantis, and B. longum (22).
Amplified restriction length polymorphism
AFLP combines the power of RFLP with the flexibility of PCR-
based methods by ligating primer-recognition sequences (adap-
tors) to the digested DNA. Total genomic DNA is digested using
2 restriction enzymes, 1 with an average cutting frequency and a
second with higher cutting frequency. Double-stranded nucleo-
tide adapters are usually ligated to the DNA fragments serving as
primer binding sites for PCR amplification. The use of PCR
primers complementary to the adapter and the restriction site
sequence yields strain-specific amplification patterns (26). At
present, AFLP has mostly been employed in clinical studies, but
its successful application for strain typing of the Lb. acidophilus
group and Lb. johnsonii isolates has recently been reported
(17,23).
Other PCR approaches
PCR-based approaches other than RAPD and AFLP have been
used for molecular typing, such as amplified ribosomal DNA
restriction analysis (ARDRA) (27–29), repetitive extragenic
palindromic PCR (Rep-PCR) (30), and triplicate arbitrary
primed PCR (TAP-PCR) (31), and have been shown to offer a
high discriminatory power for the identification and differenti-
ation of LAB.
Although these genotypic fingerprinting methods have been
successfully applied to the identification and taxonomic classi-
fication of a number LAB and bifidobacteria, the outcome can be
highly variable between laboratories. Furthermore, a basic limi-
tation in genotypic typing procedures is that the organism to be
typed must be isolated because DNA from other sources disturbs
the DNA fingerprints. Considering the cost/time-effectiveness
and ambiguities that are still inherent to some of these tech-
niques, 16S rRNA sequence–based methods (PCR amplification
or nucleic acid probing) offer a viable option for the rapid and
reliable identification of LAB and probiotic strains in mixed
populations. Yet, DNA fingerprinting is a very powerful tool for
the intraspecific classification of LAB and bifidobacteria pro-
vided that its methods are used in combination with other ap-
proaches. Subsequently, these methods may offer a useful means
744S Supplement
for the quality assurance of LAB starters and probiotic strains
used in food products by monitoring their genetic stability and
integrity over time.
Characterization of microbial communities and
detection of lactic acid bacteria
The separation of PCR-amplified segments of 16S rRNA genes
different in sequence by denaturing gradient gel electrophoresis
(DGGE) offers a unique and comprehensive tool for the
characterization of bacterial communities. With DGGE, double-
stranded DNA is denatured in a linearly increasing denaturing
gradient of urea and formamide at elevated temperatures. As a
result a mixture of amplified PCR products will form a banding
pattern after staining that reflects the different melting behavior
of the various sequences. The DGGE-generated patterns make it
possible to monitor shifts in the structure of microbial commu-
nities over time and/or following different treatments. Subse-
quent identification of specific bacterial groups or species
present in the sample can be achieved either by cloning and
sequencing of the excised bands or by hybridization of the
profile using phylogenetic probes (32). Since its application to
study the intestinal microbiota, PCR-DGGE fingerprinting has
provided a sound knowledge of the succession and temporal
changes of this complex microbial ecosystem (33). The predom-
Downloaded from jn.nutrition.org by on November 9, 2010
inant microbiota was shown to be remarkably stable over time
and very complex in adults, less complex and more unstable in
children, and unstable and developing in infants (34,35). With
use of group-specific primers, the sensitivity of the method for
detecting intestinal bifidobacteria and lactobacilli has been
considerably enhanced (36,37). The application of these group-
specific primers allowed the detection of novel species of
lactobacilli in the human intestine, allowing for the development
of novel probiotic cultures (36). These group-specific primers
were also instrumental in monitoring the effect of the admin-
istration of a prebiotic (galactooligosaccharide) and/or probiotic
(B. lactis Bb-12) on the composition of indigenous bifidobacte-
rial species and in tracking the probiotic strain itself (38). The
results showed that the simultaneous administration of the
prebiotic and probiotic (synbiotic approach) did not improve
the colonization of the probiotic strain in the gut. PCR-DGGE
was successfully used to monitor the development of the
microbial community and specifically the LAB population
during the production and ripening of artisanal Sicilian cheese
from milk to the ripened cheese (39). DGGE was also used to
differentiate among the predominant species in a commercial
mix of probiotic cultures (40). Thus, PCR-DGGE can offer an
alternative tool for rapid detection and identification of LAB in
food products as well as in the gastrointestinal tract.
One major limitation of DGGE fingerprinting is its low
sensitivity in detecting rare members of the community (,1%).
However, with group- or species-specific primers, the sensitivity
of detecting less-frequent bacteria has been significantly im-
proved. Furthermore, the detection limit of PCR-DGGE for the
major intestinal bacterial groups is ;105 cells/mL fecal sample
depending on the DNA extraction method used (41). Addition-
ally, the detection of heteroduplex formation of heterogeneous
rRNA operons, which can lead to an overestimation of the
bacterial diversity, has been reported. Simple modifications to
current PCR amplification protocols, however, were shown to be
an effective approach to minimize such artifacts (42).
More high-throughput methods for determining the compo-
sition of LAB including probiotics may be achieved with DNA
microarrays (43). Identification can be accomplished with
designed diagnostic arrays within a matter of hours without
prior cultivation and knowledge. Detection-type arrays gener-
ally contain oligonucleotides targeting a set of sequences, usually
the 16S rRNA gene. The probes have to be designed so that they
will hybridize with similar efficiencies to a target group of
sequences. Essentially, the oligonucleotides are designed by in
silico prediction using sequences from the databases and printed
or arrayed onto slides. The target DNA or rRNA of the bacteria
from the food or sample is purified and prepared to incorporate
a fluorescent label, fragmented, and hybridized to the arrays.
Although generally the 16S RNA is targeted, especially for a very
complex microbial ecosystem such as that in the human
gastrointestinal tract, highly specialized arrays may target
specific microbes in fermented foods such as cheese and
vegetables using other genes that are relatively conserved.
Analyzing the viability of lactic acid bacteria
It is crucial that the viability of the LAB strain and stability of the
desirable characteristics be maintained during processing, stor-
age, and delivery of the final product (44–46). In particular, for a
microorganism to be potentially selected as a probiotic, it should
be metabolically active toward the identified target in vivo.
Therefore, it should survive during transit through the acidic
conditions of the stomach and resist degradation by hydrolytic
enzymes and bile salts in the small intestine. Although the plate
count approach is often employed as the gold standard method
to measure bacterial viability, it actually only indicates how
many of the cells can replicate under the conditions provided for
growth. The ability to reproduce might be repressed or blocked
in a certain cell type, or reproduction might be limited to a
certain set of conditions. Furthermore, cell populations that
have been exposed to stress (e.g., oxidative, heat, freezing,
osmotic stress, or starvation) can enter an unculturable state in
which they still can maintain activity. Alternatively, fluorescent
techniques in combination with flow cytometry (FCM) offer a
powerful tool to analyze a cell population at the single-cell level
because they can be used to measure different physical and
biochemical parameters simultaneously and hence offer sub-
stantial information on the dynamics and physiological hetero-
geneity of a bacterial population (47). Ben Amor et al. used a set
of fluorescent probes including carboxyfluorescein diacetate,
oxonol, and propidium iodide to monitor the esterase activity,
membrane potential, and membrane permeability of bile salt–
stressed bifidobacteria (48). These physiological parameters
serve as good indicators to assess viable, injured, and dead cells
as illustrated for B. adolescentis (Fig. 1). Cell sorting confirmed
that a fraction of the injured cells of B. adolescentis adopted a
latent state in which they could not reproduce but could be
induced to a physiologically active state after recovery. In
addition, FCM has been used to detect and enumerate a number
of lactobacilli and other LAB in milk and commercial probiotic
products after chemical or enzymatic clearing of milk and
staining of bacteria with fluorescent probes (49–51). The FCM
assay was rapid (,1 h) and very sensitive (,104 bacteria/mL
milk). Undoubtedly, FCM technique will provide a novel tool for
the assessment of viability and stability of various lactic acid
bacteria and probiotic-containing products.
Although molecular tools based on 16S rDNA sequence
diversity and genomic differences are now generally being used
for analyzing LAB cultures at the taxonomic and strain level,
various new developments are worthy of notice. First, there is
considerable interest in analyzing the fate of probiotic strains
following consumption, and various community-based method-
ologies such as PCR-DGGE have shown their value in analyzing
the effect of oral intake of probiotics on the endogenous
Figure 1 Dual parameter dot plot of B. adolescentis DSM 20083 representing
carboxyfluorescein (cF) vs. propidium iodide (PI) fluorescence. Cultures were
exposed for 10 min to different concentrations of deconjugated bile salts (0.1%,
left; 0.25%, right) and subsequently stained with cFDA and PI to monitor the
esterase activity and membrane permeability, respectively (63). Three main
subpopulations can be readily differentiated, corresponding to viable cF-stained
cells, injured cells double-stained with PI and cF, and dead PI-stained cells. The
number of colony-forming units corresponded to the number of cF-stained cells,
whereas the injured cells were not detected by plate count method.
intestinal microbiota. Second, there is a growing interest in using
physiological probes to discriminate among viable, stressed or
injured, and dead cells. This approach can be used as a quality
control tool in the manufacture of probiotics. Finally, although
Downloaded from jn.nutrition.org by on November 9, 2010
an increasing number of genomes are being analyzed, the fruits
of the omics approaches have yet to be harvested for further
development of LAB cultures as starters and in flavor develop-
ment as well as for probiotic cultures (70). It is expected that
these will permit an advanced understanding of the mechanisms
by which probiotic bacteria improve the well-being of the
consumer. This molecular basis will be a prerequisite to control
the performance of probiotics in the fermentor, the food product
by which it is delivered, and, finally, in the consumer.
Literature Cited
1. Amann R, Ludwig W. Ribosomal RNA-targeted nucleic acid probes for
studies in microbial ecology. FEMS Microbiol Rev. 2000;24:555–65.
2. de Vos WM. Advances in genomics for microbial food fermentations
and safety. Curr Opin Biotechnol. 2001;12:493–8.
3. Schell MA, Karmirantzou M, Snel B, Vilanova D, Berger B, Pessi G,
Zwahlen M-C, Desiere F, Bork P, et al. The genome sequence of
Bifidobacterium longum reflects its adaptation to the human gastroin-
testinal tract. Proc Natl Acad Sci USA. 2002;99:14422–7.
4. Kleerebezem M, Boekhorst J, van Kranenburg R, Molenaar D, Kuipers
OP, Leer R, Tarchini R, Peters SA, Sandbrink HM, et al. Complete
genome sequence of Lactobacillus plantarum WCFS. Proc Natl Acad Sci
USA. 2003;100:1990–5.
5. Klaenhammer T, de Vos WM, Mercenier A. Genomics impact on
probiotic bacteria. In: Neeser JR, German B, editors. Biotechnology for
performance foods, functional foods and nutraceuticals. New York:
Marcel Dekker; 2003.
6. Amann R, Fuchs BM, Behrens S. The identification of microorganisms by
fluorescence in situ hybridisation. Curr Opin Biotechnol. 2001;12:231–6.
7. Harmsen JHM, Elfferich P, Schut F, Welling GW. A 16 S rRNa-tageted
probe for detection of lactobacilli and enterococci in faecal samples by
fluorescent in situ hybridization. Microb Ecol Health Dis. 1999;11:3–12.
8. Sghir A, Antonopoulos D, Mackie RI. Design and evaluation of a
Lactobacillus group-specific ribosomal RNA-targeted hybridization
probe and its application to the study of intestinal microecology in
pigs. Syst Appl Microbiol. 1998;21:291–6.
9. Malinen E, Kassinen A, Rinttila T, Palva A. Comparison of real-time
PCR with SYBR Green I or 5#-nuclease assays and dot-blot hybridiza-
tion with rDNA-targeted oligonucleotide probes in quantification of
selected faecal bacteria. An Microbiol (Rio J). 2003;149:269–77.
10. Nebra Y, Bonjoch X, Blanch AR. Use of Bifidobacterium dentium as an
indicator of the origin of fecal water pollution. Appl Environ Microbiol.
2003;69:2651–6.
Molecular methods for identification of LAB 745S
11. Yamamoto T, Morotomi M, Tanaka R. Species-specific oligonucleotide
probes for five Bifidobacterium species detected in human intestinal
microflor. Appl Environ Microbiol. 1992;58:4076–9.
12. McCartney A. Application of molecular biological methods for studying
probiotics and the gut flora. Br J Nutr. 2002;88:S29–37.
13. Roy D, Ward P, Champagne G. Differentiation of bifidobacteria by use
of pulsed-field gel electrophoresis and polymerase chain reaction. Int J
Food Microbiol. 1996;29:11–29.
14. Tynkkynen S, Satokari R, Saarela M, Mattila-Sandholm T, Saxelin M.
Comparison of ribotyping, randomly amplified polymorphic DNA
Analysis, and pulsed-field gel electrophoresis in typing of Lactobacillus
rhamnosus and L. casei strains. Appl Environ Microbiol. 1999;65:
3908–14.
15. Roy D, Ward P, Vincent D, Mondou F. Molecular identification of
potentially probiotic lactobacilli. Curr Microbiol. 2000;40:40–6.
16. Lortal S, Rouault A, Guezenec S, Gautier M. Lactobacillus helviticus:
Strain typing and genomic size estimation by pulsed field gel electro-
phoresis. Curr Microbiol. 1997;34:180–5.
17. Ventura M, Zink R. Specific identification and molecular typing
analysis of Lactobacillus johnsonii by using PCR-based methods and
pulsed-field gel electrophoresis. FEMS Microbiol Lett. 2002;217:
141–54.
18. Larson EJ, Hakovirta JR, Cai H, Jett JH, Burde S, Keller RA, Marrone
BL. Rapid DNA fingerprinting of pathogens by flow cytometry.
Cytometry. 2000;41:203–8.
19. O’Sullivan DJ. Methods for analysis of the intestinal microflora. In:
Tannock GW, editor. Probiotics: a critical review. Norfolk (UK):
Horizon Scientific Press; 1999.
20. Giraffa G, Gatti M, Rossetti L, Senini L, Neviani E. Molecular diversity
within Lactobacillus helveticus as revealed by genotypic characteriza-
tion. Appl Environ Microbiol. 2000;66:1259–65.
21. Zhong W, Millsap K, Bialkowska-Hobrzanska H, Reid G. Differenti-
ation of Lactobacillus species by molecular typing. Appl Environ
Microbiol. 1998;64:2418–23.
22. Vincent D, Roy D, Mondou F, Dery C. Characterization of bifidobac-
teria by random DNA amplification. Int J Food Microbiol. 1998;
43:185–93.
23. Gancheva A, Pot B, Vanhonacker K, Hoste B, Kersters K. A polyphasic
approach towards the identification of strains belonging to Lactobacil-
lus acidophilus and related species. Syst Appl Microbiol. 1999;22:
573–85.
24. Richard B, Groisillier A, Badet C, Dorignac G, Lonvaud-Funel A.
Identification of salivary Lactobacillus rhamnosus species by DNA
profiling and a specific probe. Res Microbiol. 2001;152:157–65.
25. Torriani S, Zapparoli G, Dellaglio F. Use of PCR-based methods for
rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus
and L. delbrueckii subsp. lactis. Appl Environ Microbiol. 1999;65:
4351–6.
26. Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M,
Frijters A, Pot J, Peleman J, et al. AFLP: a new technique for DNA
fingerprinting. Nucleic Acids Res. 1995;23:4407–14.
27. Delley M, Germond JE. Differentiation of Lactobacillus helveticus,
Lactobacillus delbrueckii subsp bulgaricus, subsp lactis, and subsp
delbrueckii using physiological and genetic tools and reclassification of
some strains from the ATCC collection. Syst Appl Microbiol.
2002;25:228–31.
28. Roy D, Sirois S, Vincent D. Molecular discrimination of lactobacilli
used as starter and probiotic cultures by amplified ribosomal DNA
restriction analysis. Curr Microbiol. 2001;42:282–9.
29. Ventura M, Elli M, Reniero R, Zink R. Molecular microbial analysis of
Bifidobacterium isolates from different environments by the species-
specific amplified ribosomal DNA restriction analysis (ARDRA). FEMS
Microbiol Ecol. 2001;36:113–21.
30. Ventura M, Meylan V, Zink R. Identification and tracing of Bifidobac-
terium species by use of enterobacterial repetitive intergenic consensus
sequences. Appl Environ Microbiol. 2003;69:4296–301.
31. Cusick SM, O’Sullivan DJ. Use of a single, triplicate arbitrarily primed-
PCR procedure for molecular fingerprinting of lactic acid bacteria. Appl
Environ Microbiol. 2000;66:2227–31.
32. Muyzer G, de Waal E, Uitterlinden A. Profiling of complex microbial
populations by denaturing gradient gel electrophoresis analysis of
polymerase chain reaction-amplified genes coding for 16S rRNA. Appl
Environ Microbiol. 1993;59:695–700.
746S Supplement
33. Vaughan EE, de Vries MC, Zoetendal EG, Ben-Amor K, Akkermans
AD, de Vos WM. The intestinal LABs. Antonie Leeuwenhoek 2002;
82:341–52.
34. Favier CF, Vaughan EE, De Vos WM, Akkermans ADL. Molecular
monitoring of succession of bacterial communities in human neonates.
Appl Environ Microbiol. 2002;68:219–26.
35. Zoetendal EG, Akkermans ADL, De Vos WM. Temperature gradient gel
electrophoresis analysis of 16S rRNA from human fecal samples reveals
stable and host-specific communities of active bacteria. Appl Environ
Microbiol. 1998;64:3854–9.
36. Heilig HGHJ, Zoetendal EG, Vaughan EE, Marteau P, Akkermans
ADL, de Vos WM. Molecular diversity of Lactobacillus spp. and other
lactic acid bacteria in the human intestine as determined by specific
amplification of 16S ribosomal DNA. Appl Environ Microbiol. 2002;
68:114–23.
37. Satokari RM, Vaughan EE, Akkermans ADL, Saarela M, de Vos WM.
Bifidobacterial diversity in human feces detected by genus-specific PCR
and denaturing gradient gel electrophoresis. Appl Environ Microbiol.
2001;67:504–13.
38. Satokari RM, Vaughan EE, Akkermans AD, Saarela M, De Vos WM.
Polymerase chain reaction and denaturing gradient gel electrophoresis
monitoring of fecal bifidobacterium populations in a prebiotic and
probiotic feeding trial. Syst Appl Microbiol. 2001;24:227–31.
39. Randazzo CL, Torriani S, Akkermans ADL, de Vos WM, Vaughan EE.
Diversity, dynamics, and activity of bacterial communities during
production of an artisanal sicilian cheese as evaluated by 16S rRNA
analysis. Appl Environ Microbiol. 2002;68:1882–92.
Downloaded from jn.nutrition.org by on November 9, 2010
40. Temmerman R, Scheirlinck I, Huys G, Swings J. Culture-independent
analysis of probiotic products by denaturing gradient gel electrophore-
sis. Appl Environ Microbiol. 2003;69:220–6.
41. Zoetendal EG, Ben-Amor K, Akkermans ADL, Abee T, de Vos WM.
DNA isolation protocols affect the detection limit of PCR approaches of
bacteria in samples from the human gastrointestinal tract. Syst Appl
Microbiol. 2001;24:405–10.
42. Thompson JR, Marcelino LA, Polz MF. Heteroduplexes in mixed-
template amplifications: formation, consequence and elimination by
Ôreconditioning PCRÕ. Nucleic Acids Res. 2002;30:2083–8.
43. Ye RW, Wang T, Bedzyk L, Croker KM. Applications of DNA
microarrays in microbial systems. J Microbiol Methods 2001;47:
257–72.
44. Dunne C, O’Mahony L, Murphy L, Thornton G, Morrissey D,
OÕHalloran S, Feeney M, Flynn S, Fitzgerald G, et al. In vitro selection
criteria for probiotic bacteria of human origin: correlation with in vivo
findings. Am J Clin Nutr. 2001;73:386S–92S.
45. Saarela M, Lahteenmaki L, Crittenden R, Salminen S, Mattila-
Sandholm T. Gut bacteria and health foods - the European perspective.
Int J Food Microbiol. 2002;78:99–117.
46. Tuomola E, Crittenden R, Playne M, Isolauri E, Salminen S. Quality
assurance criteria for probiotic bacteria. Am J Clin Nutr. 2001;73:
393S–8S.
47. Davey HM, Kell DB. Flow cytometry and cell sorting of heterogeneous
microbial populations: the importance of single-cell analyses. Microbiol
Rev. 1996;60:641–96.
48. Ben Amor K, Breeuwer P, Verbaarschot P, Rombouts FM, Akkermans
ADL, De Vos WM, Abee T. Multiparametric flow cytometry and
cell sorting for the assessment of viable, injured, and dead Bifidobac-
terium cells during bile salt stress. Appl Environ Microbiol. 2002;68:
5209–16.
49. Bunthof CJ, Abee T. Development of a flow cytometric method to
analyze subpopulations of bacteria in probiotic products and dairy
starters. Appl Environ Microbiol. 2002;68:2934–42.
50. Gunasekera TS, Attfield PV, Veal DA. A flow cytometry method for
rapid detection and enumeration of total bacteria in milk. Appl Environ
Microbiol. 2000;66:1228–32.
51. Holm C, Jespersen L. A flow-cytometric gram-staining technique for
milk-associated bacteria. Appl Environ Microbiol. 2003;69:2857–63.
52. Wang RF, Beggs ML, Robertson LH, Cerniglia CE. Design and
evaluation of oligonucleotide-microarray method for the detection of
human intestinal bacteria in fecal samples. FEMS Microbiol Lett. 2002;
213:175–82.
53. Hensiek R, Krupp G, Stackerbrandt E. Development of diagnostic
oligonucleotide probes for four Lactobacillus species occurring in the
intestinal tract. Syst Appl Microbiol. 1992;15:123–8.
54. Pot B, Hertel C, Ludwig W, Descheemaeker P, Kersters K, Schleifer KH.
Identification and classification of Lactobacillus acidophilus, L. gasseri
and L. johnsonii strains by SDS-PAGE and rRNA-targeted oligonucle-
otide probe hybridization. J Gen Microbiol. 1993;139:513–7.
55. Vogel RF, Bocker G, Stolz P, Ehrmann M, Fanta D, Ludwig W, Pot B,
Kersters KH, Hammes W. P. Identification of lactobacilli from
sourdough and description of Lactobacillus pontis. nov. Int J Syst
Bacteriol. 1994;44:223–9.
56. Laitinen R, Malinen E, Palva A. PCR-ELISA I:Application to simulta-
neous analysis of mixed bacterial samples composed of intestinal
species. Syst Appl Microbiol. 2002;25:241–8.
57. Hertel C, Ludwig W, Pot B, Kersters K, Schleifer KH. Differentiation of
lactobacilli occuring in fermented milk products bu using oligonucle-
otide probes and electrophoretic protein profiles. Syst Appl Microbiol.
1993;16:463–7.
58. Ehrmann M, Ludwig W, Schleifer KH. Reverse dot blot hybridization: A
useful method for the direct identification of lactic acid bacteria in
fermented food. FEMS Microbiol Lett. 1994;117:143–9.
59. Ampe F. Design and evaluation of a Lactobacillus manihotivorans
species-specific rRNA-targeted hybridization probe and its application
to the study of sour cassava fermentation. Appl Environ Microbiol. 2000;
66:2224–6.
60. Klijn N, Weerkamp AH, de Vos WM. Identification of mesophilic lactic
acid bacteria by using polymerase chain reaction-amplified variable
regions of 16S rRNA and specific DNA probes. Appl Environ
Microbiol. 1991;57:3390–3.
61. Ercolini D, Hill PJ, Dodd CER. Bacterial community structure and
location in stilton cheese. Appl Environ Microbiol. 2003;69:3540–8.
62. Franks AH, Harmsen HJM, Raangs GC, Jansen GJ, Schut F, Welling
GW. Variations of bacterial populations in human feces measured by
fluorescent In situ hybridization with group-specific 16S rRNA-
targeted oligonucleotide probes. Appl Environ Microbiol. 1998;64:
3336–45.
63. Beimfohr C, Krause A, Amann R, Ludwig W, Schleifer KH. In situ
identification of lactococci, enterococci and streptococcin. Syst Appl
Microbiol. 1993;16:450–6.
64. Salama M, Sandine W, Giovannoni SJ. Development and application of
oligonucleotide probes for identification of Lactococcus lactis subsp.
cremoris. Appl Environ Microbiol. 1991;57:1313–8.
65. Sujaya N, Amachi S, Saito K, Yokota A, Asano K, Tomita F. Specific
enumeration of lactic acid bacteria in ragi tape by colony hybridization
with specific oligonucleotide probes. World J Microbiol Biotechnol. 2002;
18:263–70.
66. Kaufmann P, Pfefferkorn A, Teuber M, Meile L. Identification and
quantification of Bifidobacterium species isolated from food with genus-
specific 16S rRNA-targeted probes by colony hybridization and PCR.
Appl Environ Microbiol. 1997;63:1268–73.
67. Langendijk P, Schut F, Jansen G, Raangs G, Kamphuis G, Wilkinson
M, Welling G. Quantitative fluorescence in situ hybridization of
Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes
and its application in fecal samples. Appl Environ Microbiol. 1995;61:
3069–75.
68. Marteau P, Pochart P, Dore J, Bera-Maillet C, Bernalier A, Corthier G.
Comparative Study of bacterial groups within the human cecal and fecal
microbiota. Appl Environ Microbiol. 2001;67:4939–42.
69. Nebra Y, Jofre J, Blanch AR. The effect of reducing agents on the
recovery of injured Bifidobacterium cells. J Microbiol Methods 2002;
Downloaded from jn.nutrition.org by on November 9, 2010
49:247–54.
70. Zoetendal EG, Vaughan EE, de Vos WM. A microbial world within us.
Mol Microbiol. 2006;59:1639–50.
Molecular methods for identification of LAB 747S