Journal of Fish Biology (2006) 69 (Supplement B), 260–277

doi:10.1111/j.1095-8649.2006.01291.x, available online at http://www.blackwell-synergy.com

Genetic diversity of invasive and native Cichla

(Pisces: Perciformes) populations in Brazil with
evidence of interspecific hybridization
A. V. O LIVEIRA *†, A. J. P RIOLI *‡§, S. M. A. P. P RIOLI *‡,
T. S. B IGNOTTO *, H. F. J ÚLIO J R *‡, H. C ARRER k,
C. S. A GOSTINHO { AND L. M. P RIOLI *#
*Núcleo de Pesquisas em Limnologia, Ictiologia e Aqüicultura (Nupelia), Universidade
Estadual de Maringá, Av. Colombo 5790, Bloco G-90, 87020-900 Maringá, PR, Brasil,
‡Departamento de Biologia Celular e Gene´tica, Universidade Estadual de Maringá, Av.
Colombo 5790, Bloco H-67, 87020-900 Maringá, PR, Brasil, kDepartamento de Cieˆncias
Biológicas, Escola Superior de Agricultura Luiz de Queiroz, Universidade de São Paulo,
Av. Pádua Dias 11, 13418-900 Piracicaba, SP, Brasil, {Universidade Federal do
Tocantins, Jardim dos Ipeˆs, 77500-000 Porto Nacional, TO, Brasil and #Departamento de
Biologia, Universidade Estadual de Maringá, Av. Colombo 5790, Bloco H-78,
87020-900 Maringá, PR, Brasil

(Received 7 July 2005, Accepted 1 August 2006)

Invasive and native populations of the Amazonian fishes ‘peacock bass’ Cichla monoculus and of
a not yet described species ‘blue tucunaré’ here referred as Cichla sp. ‘Azul’ were analysed for
genetic diversity using the hypervariable domain of the mitochondrial DNA (mtDNA) control
region plus steady diagnostic random amplified polymorphic DNA loci. There is no detailed
historical record of the introduction of Cichla species into the Upper Paraná River basin, where
they became invasive and a potential threat to local ichthyofauna. Genetic diversity among
invasive populations confirmed the hypothesis of multiple introductions in this hydrographic
basin. Moreover, a large and previously unknown population of natural fertile hybrids between
C. cf. monoculus and Cichla sp. ‘Azul’ was identified in the Itaipu hydroelectric reservoir and
in the floodplain of the Upper Paraná River. Crossbred morphotypes were similar to C. cf.
monoculus, but their morphological identification was not unequivocal. This hybrid population
was characterized by high genetic diversity and it was composed of hybrids possessing
concurrently nuclear DNA fragments specific for C. cf. monoculus as well as fragments specific
for Cichla sp. ‘Azul’. The nuclear DNA markers indicated that reproductive isolation between
C. cf. monoculus and Cichla sp. ‘Azul’ has broken down in the new environment, and mtDNA
sequences revealed that both species can be the female donor in the interspecific crosses. The
data presented herein are potentially useful for future taxonomic, genetic and evolutionary
studies in the complex Cichla group, for monitoring of invasive populations, and for further
development of ecological guidelines. # 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles

Key words: Cichla; Cichlid; D-loop; interspecific hybrids; peacock bass; tucunaré.

§Author to whom correspondence should be addressed. Tel. and fax: þ55 44 3263 1424;
email: ajprioli@nupelia.uem.br
†Present address: Centro Universitário de Maringá (Cesumar), Av. Guedner 1610, 87050-390 Maringá,
PR, Brasil.

260
# 2006 The Authors
Journal compilation # 2006 The Fisheries Society of the British Isles
 GENETIC DIVERSITY OF CICHLA POPULATIONS 261

INTRODUCTION
Non-native freshwater fishes have been deliberately introduced in Neotropical
hydrographic basins even though these habitats are naturally abundant with
native fish species. During the last decades, Brazil has received the highest
number of non-native fishes in spite of its currently >2100 catalogued fish spe-
cies, which comprise c. 21% of the world list (Buckup & Menezes, 2003). In-
troductions have included fishes from other countries and also transfers
among Brazilian hydrographic basins (Agostinho et al., 1994, 2003; Júlio &
Agostinho, 2003). As extensively reported, non-native introduced fishes may
become invasive and have a serious impact on aquatic ecosystems. As discussed
by Agostinho et al. (2005), in Brazilian inland waters, fish species introductions
have been recognized as one of the principal direct causes of biodiversity loss.
Such introductions have been done mainly for aquaculture, fish stocking and
recreational fisheries, and generally without considering their potential
adverse impact on the environment and on the biodiversity of local aquatic
ecosystems.
The Upper Paraná River floodplain, a unique ecosystem with >250 reported
fish species, has been strongly affected by non-native introduced fishes. It com-
prises an environmental protected area, as well as the only remaining running
water stretch of the Paraná River in Brazilian territory, which is not restrained
by hydroelectric dams. In 1982, when the Itaipu hydroelectric dam was closed,
the floodplain received a massive introduction of at least 35 fish species from
the Middle Paraná River basin (Agostinho et al., 2003; Júlio & Agostinho,
2003). These fishes were introduced because the resulting Itaipu reservoir
submerged the Guaı́ra Falls (Seven Falls), which had previously formed the
natural geographic barrier between these two ichthyological provinces. As
a consequence, c. 150 km of the Paraná River downstream of the falls were
merged with the Upper Paraná River. On top of that, during the past three
decades populations of both non-native and local fishes have been intentionally
introduced in the Upper Paraná River basin. Amazonian piscivores have been
the most successful colonizers in this basin where they have spread out of res-
ervoirs and are now affecting areas with high abundance of endemic species,
including the floodplain (Agostinho et al., 2004, 2005).
Fishes of the genus Cichla Schneider, 1801, are among the species that were
deliberately introduced in many hydrographic basins, including in the Upper
Paraná (Agostinho et al., 1994, 2003, 2004; Shafland, 1996; Júlio & Agostinho,
2003). Most Cichla species are native to the Amazon and Orinoco basins.
Morphological traits have been the basis of Cichla taxonomy, but this genus
remains problematic. Although 15 different Cichla morphotypes have been
reported (Kullander, 1986; Kullander & Nijssen, 1989), presently only five
species are described: Cichla temensis Humboldt, 1821 (Orinoco, Negro and
Tapajós Rivers); Cichla monoculus Spix & Agassiz, 1831 (Amazon basin, includ-
ing the Tocantins–Araguaia sub-basin); Cichla ocellaris Bloch & Schneider,
1801 (Guyana rivers, from the Marowijne drainage in Suriname and French
Guyana to the Essequibo drainage in Guyana); Cichla orinocensis Humboldt,
1821 (Orinoco and Negro rivers); Cichla intermedia Machado-Allison, 1971
(Upper Negro River and Middle Orinoco River).

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
262 A. V. OLIVEIRA ET AL.

In 1985, a few specimens identified as C. monoculus species, which is popularly

known as ‘tucunaré’, ‘peacock bass’ and ‘pavón’, were found for the first time in
the Itaipu hydroelectric reservoir (Agostinho et al., 1994, 2004). Sometime later,
a not yet described Cichla species (S. Kullander, pers. comm.), which is popularly
known as ‘tucunaré azul’ and ‘blue tucunaré’ and native to the Tocantins–
Araguaia sub-basin of the Amazon River basin, was found in the Itaipu reser-
voir. Initially, both Cichla populations seemed to be present at low density,
but they increased rapidly and spread from the reservoir into many rivers and
streams. Diverse morphotypes resembling C. monoculus, but of unclear identifica-
tion as regards their morphological analysis, have also been found in the Itaipu
reservoir and in the floodplain (C. S. Pavanelli, pers. comm.). Taxonomy, origin
and introduction of Cichla in the Upper Paraná River basin remain unclear. It
has been assumed that multiple Cichla introductions might have occurred into
this basin, particularly in waters that are regulated by dams. Supposedly, Cichla
were introduced by sport fishing associations but incidental escapes from pisci-
culture might also have occurred occasionally (Orsi & Agostinho, 1999). More
recently, Cichla populations have also been found in other areas of the Upper
Paraná basin, mainly in reservoirs, but as far as is known, there is no record
of their introductions. Cichla species are voracious predators feeding on a wide
range of prey and displaying complex reproductive strategies (Fontanele & Peix-
oto, 1979; Novaes et al., 2004). The introduction of Cichla populations in the
Upper Paraná basin has developed into a controversial issue because while they
became the most important species for sport fishery, they also have become
highly invasive and voracious piscivores, a menace to local fishes, including
endemic species (Fontenele & Peixoto, 1979; Agostinho et al., 2003, 2004).
Knowledge of their genetic diversity and distinctive taxonomy is crucial for
monitoring introduced Cichla populations, particularly those that are now
invasive and a steady part of the current fauna in many areas of the Upper
Paraná River basin. Mitochondrial genome and nuclear DNA fragments have
proved useful in taxonomic and genetic studies. The hypervariable domain of
the mitochondrial DNA (mtDNA) control region has been the main nucleotide
sequence of choice for population and phylogenetic studies among closely
related species. Diagnostic nuclear DNA fragments such as steady random
amplified polymorphic DNA (RAPD) markers (Williams et al., 1990) have
been helpful in taxonomic and genetic research, including studies of hybridiza-
tion events. In native and non-native fish populations, these nuclear and mito-
chondrial molecular markers have been informative (Bardakci & Skibinski,
1994; Callejas & Ochando, 2001; Weiss et al., 2001; Oliveira et al., 2002; Prioli
et al., 2002; Rubidge & Taylor, 2004).
Genetic studies have not previously been reported on Cichla non-native pop-
ulations and little is known about their native populations. Evidence of hybrid-
ization between C. monoculus and C. temensis (‘speckled pavon’) species has
been reported for natural populations native to Amazonian regions (Andrade
et al., 2001; Brinn et al., 2004; Teixeira & Oliveira, 2005). These studies suggest
the possibility of interspecific crosses in regions where more than one Cichla
species have been introduced. Genetic studies of native and invasive Cichla
populations will help to improve current knowledge of taxonomy and evolution
within the cichlid group (Farias et al., 1999).

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
 GENETIC DIVERSITY OF CICHLA POPULATIONS 263

The objective of this work was to analyse the genetic diversity of native and
invasive populations, which have been identified as C. monoculus and Cichla sp.
species, by using the hypervariable domain of the mtDNA control region plus
diagnostic nuclear RAPD loci. With the taxonomic and genetic characteriza-
tion possible with these tools the aim was to improve the understanding of
Cichla introduction in the Upper Paraná basin, and to test the hypothesis of
hybridization between introduced species.

MATERIALS AND METHODS

F I S H SA M P L I N G A N D DN A E X T R A C T I O N
Cichla populations were sampled in four locations of the Upper Paraná River
basin and in three locations of the Amazon River basin (Fig. 1). On the basis of
morphological traits, the specimens (voucher specimens: NUP1908; NUP3180;
NUP1746; NUP3379; NUP3884) were initially identified as C. monoculus and C.
temensis (Kullander, 1986), and a third species not yet described, which is popularly
known as ‘blue tucunaré’ and ‘tucunaré azul’ (S. Kullander, pers. comm.). Given
the unclear status of the taxonomy of Cichla species, the species included in this
study are referred to as Cichla cf. monoculus, Cichla sp. ‘Azul’ and Cichla cf. temensis.
Cichla specimens were captured with gillnets, and muscle tissues were immediately
fixed in ethanol and stored at
20° C. Samples of total DNA were extracted from
muscle tissues macerated in the presence of liquid nitrogen, according to Monesi
et al. (1998) with few modifications. After phenol/chloroform extraction, DNA was
precipitated with ethanol and resuspended in diluted TE buffer (Tris 1 mM, EDTA
01 mM pH 80) containing RNAase (20 mg ml
1). DNA aliquots were used
for quantification by comparison with known quantities of l phage DNA in 1%
agarose gel.

AMPLIFICATION AND ANALYSIS OF RAPD LOCI

The eight RAPD primers OPW-04, OPW-09, OPW-17, OPW-19, OPA-06, OPE-09,
OPX-05 and OPX-18 (Operon Technologies Inc., Alameda, CA, U.S.A.) were used
for polymerase chain reaction (PCR) amplifications. The PCR reaction mix and
DNA amplification were performed according to Williams et al. (1990) with minor
modifications (Prioli et al., 2002). A sample without template DNA was included as
a negative control in each experiment. In order to test reproducibility of PCR amplifi-
cation products, reactions were performed at least twice and one to two samples of pre-
viously amplified and analysed PCR products, with the same primer, were included in
each agarose gel. Electrophoresis profiles were visualized under UV radiation and pho-
tographed with Kodak EDAS-290. Sizes of DNA fragments were estimated by compar-
ison with standard 100 base pair (bp) ladder (Invitrogen Life TechnologiesÔ, Carlsbad,
CA, U.S.A.).
RAPD electrophoresis profiles were analysed for polymorphism based on the pres-
ence and absence of accurate steady DNA bands on agarose gel. Specimens were com-
pared within and among populations. Indexes of molecular diversity were estimated
based on the average gene diversity over all haplotype loci using Arlequin v. 3.0
(Excoffier et al., 2005). Distance matrix between specimens, taken two by two, was
obtained by the arithmetic complement of Nei & Li (1979) similarity index, using
RAPDPLOT (Black, 1997). Because the genetic distance of Nei & Li (1979) is not met-
rical, the Lingoes correction (Legendre & Anderson, 1999) was applied using the
DistPCoA software (Legendre & Anderson, 1998).

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
264 A. V. OLIVEIRA ET AL.

FIG. 1. Map of South America displaying the seven sampling locations in which Cichla populations were
surveyed. Locations 1 to 4 are situated in the Upper Paraná River basin ( ) where Cichla monoculus
and Cichla sp. ‘Azul’ were introduced and became invasive. Locations 5 to 7 are situated in the
Amazon hydrographic basin ( ) including its Tocantins–Araguaia sub-basin ( ). Native species C.
monoculus is found in both and areas, C. temensis in and Cichla sp. ‘Azul’ in . Sampling
locations: 1, Upper Paraná River floodplain (22°479 S; 53°199 W) near Porto Rico township: Cichla
sp. ‘Azul’, C. monoculus and interspecific hybrids; 2, Itaipu hydroelectric reservoir (between 24°059;
25°339 S and 54°009; 54°379 W) in the Paraná River, downstream the floodplain: Cichla sp. ‘Azul’
and interspecific hybrids; 3, Capivara hydroelectric reservoir (27°399 S; 51°219 W) in the Para-
napanema River: C. monoculus; 4, Promissão hydroelectric reservoir (21°189 S; 17°479 W) in the Tietê
River, near Promissão township: Cichla sp. ‘Azul’; 5, Tocantins River (09°459 S; 48°229 W), Lajeado
reservoir, in the Amazon Tocantins–Araguaia sub-basin, near Porto Nacional city: Cichla sp. ‘Azul’
and C. monoculus; 6, Amazon River (03°079 S; 59°559 W) near the Solimões River and Manaus city:
C. monoculus; 7, Fish farm near the Teles Pires River, Lucas do Rio Verde City, Mato Grosso State
(13°039 S; 55°549 W): C. temensis.

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
 GENETIC DIVERSITY OF CICHLA POPULATIONS 265

S E Q UE N C IN G A ND A NA L Y S IS O F M IT O C HO N DR IA L D NA
A mtDNA fragment of c. 460 bp was PCR amplified from DNA samples of four to
six specimens of each population. The primers D-loop L 59-AGAGCGTCGGTCTTG-
TAAACC-39 (Cronin et al., 1993) and H16498 59-CCTGAAGTAGGAACCAGATG-39
(Meyer et al., 1990) were used for PCR amplifications. The reaction mix consisted of
Tris-KCl (20 mM Tris-HCl pH 84 and 50 mM KCl), 15 mM MgCl2, 25 mM of each
primer, 01 mM of each dNTP, 25 U Taq DNA polymerase, 15 ng DNA and water to
a total volume of 25 ml. PCR amplification started with one cycle of 94° C for 4 min,
50° C for 30 s and 72° C for 2 min, followed by 40 cycles of 94° C for 15 s, 56° C for 30
s, 72° C for 2 min and a final extension step at 72° C for 10 min. The mtDNA segment
from each specimen was amplified in two independent PCR reactions, as replicates, and
then bi-directionally sequenced.
PCR products were directly used as templates for sequencing in an automated
sequencer ABI-3100 (Perkin Elmer, Norwalk, CT, U.S.A.). Approximately 50 ng of
template DNA and 20 pmol of either primer H16498 or D-Loop L were added to each
sequencing reaction. The reaction mix was heated at 94° C for 4 min, and amplifica-
tions were performed in 35 cycles of 30 s at 94° C, 30 s at 55° C and 1 min 30 s at
60° C, followed by 5 min at 60° C and then kept at 4° C. Sequence data were submitted
to quality check, assembly and alignment on the Vector NTI Suite 6.0 (Informax, Inc.,
Invitrogen Life TechnologiesÔ). DNA sequences were aligned using the CLUSTALW
and genetic analyses were conducted using MEGA 3.1 (Kumar et al., 2004). Matrix of
distances among specimens and among haplotypes was obtained from estimates of
genetic distances of Tamura & Nei (1993). Clustering was performed by the neighbour-
joining method (Saitou & Nei, 1987). Bootstrap analyses were based on 1000 replications.

RESULTS
Each of the selected RAPD primers amplified from eight to 11 intense DNA
fragments, which ranged from c. 350 bp to 24 kb. Eighty-three most intense,
defined and repeatable DNA fragments were chosen for analyses. Of those 83
RAPD loci, 53 (6386%) were polymorphic and 30 (3614%) were monomor-
phic. Electrophoresis profiles for the OPW-09 primer are illustrated in Fig. 2.
All primers, except OPA-06, produced steady monomorphic DNA fragments,
which were exclusive either to C. cf. monoculus or to Cichla sp. ‘Azul’. Mono-
morphic and exclusive DNA bands were identified in numbers suitable to dis-
tinguish these species and their studied populations, and they were used as
diagnostic nuclear markers.
Specimens from the native C. cf. monoculus populations, two individuals
from the Tocantins River (Fig. 1, location 5) and three individuals from the
Amazon River (Fig. 1, location 6), were clearly distinguished from each other
by exclusive monomorphic DNA fragments. In the native specimens from the
Tocantins River, 10 monomorphic DNA fragments were found to be exclusive
to Cichla sp. ‘Azul’ and 12 were exclusive to C. cf. monoculus. Cichla sp. ‘Azul’
from the Tocantins River contained 12 exclusive monomorphic DNA frag-
ments when compared to C. cf. monoculus from the Amazon River, while the
latter contained 14 exclusive monomorphic DNA fragments when compared
to Cichla sp. ‘Azul’ from the Tocantins River. All of the exclusive diagnostic
DNA fragments were confirmed in the native and invasive populations. The
invasive Cichla sp. ‘Azul’ populations sampled in the floodplain and in the Itaipu
and Promissão reservoirs shared characteristic exclusive monomorphic nuclear
markers with the native population from Tocantins River. The population

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
266 A. V. OLIVEIRA ET AL.

FIG. 2. Electrophoresis profiles, obtained by using the RAPD primer OPW-09, of specimens from native
and invasive Cichla populations. Lanes 1–3, Cichla temensis native to the Amazon River basin. Lanes
4–6, Cichla sp. ‘Azul’ native to the Tocantins River. Lanes 7–8, Cichla monoculus native to the
Tocantins River. Lanes 9–11, C. monoculus invasive to the Capivara reservoir. Lanes 12–15, hybrids
(C. monoculus  Cichla sp. ‘Azul’) sampled in the Upper Paraná River floodplain. Lanes 16–18,
hybrids (C. monoculus  Cichla sp. ‘Azul’) sampled in the Itaipu reservoir. Note the presence of
DNA fragments exclusive to C. monoculus (lanes 7–11) and Cichla sp. ‘Azul’ (lanes 4–6). Arrows in
lane 15 indicate DNA fragments exclusive to either C. monoculus (arrow at right) or Cichla sp. ‘Azul’
(arrow at left), which were inherited by this crossbred. L, Molecular mass markers (Ladder 100).

invasive to Promissão reservoir, however, contained two monomorphic DNA

fragments that were absent in the Tocantins, floodplain and Itaipu populations.
On the other hand, these latter populations shared three monomorphic DNA
fragments that were absent in the Promissão population. The non-native C. cf.
monoculus population from Capivara reservoir (Fig. 1, location 3) shared two
monomorphic DNA fragments with the population native to the Amazon River
(Fig. 1, location 6), which were absent in the Tocantins population (Fig. 1, loca-
tion 5). The analysed C. cf. temensis specimens were characterized by five exclu-
sive monomorphic RAPD fragments.
Of the 68 Cichla specimens captured in the Upper Paraná River floodplain
and in the Itaipu reservoir (Fig. 1, locations 1 and 2), a total of 52 specimens
contained simultaneously nuclear monomorphic DNA fragments exclusive to
C. cf. monoculus and fragments exclusive to Cichla sp. ‘Azul’. They resembled
C. cf. monoculus species based on morphological traits. Two of the C. cf.
monoculus exclusive monomorphic fragments were specific to the population
native to the Tocantins River and absent in the Amazon River population.
Genetic variability within these 52 specimens was high, as indicated by
4217% of RAPD polymorphic loci. In contrast, the percentage of polymorphic
loci was low in the C. cf. monoculus and in the Cichla sp. ‘Azul’ populations,
varying from 12 to 1446%. The haplotype molecular diversity index, as based
on the average gene diversity over all haplotype loci, was estimated as 0143 for
all populations analysed as a group. The haplotype molecular diversity index
for those 52 specimens sampled the floodplain and Itaipu reservoir was esti-
mated as 0085. This genetic diversity estimate was high when compared to
the haplotype molecular diversity indexes varying from 0012 to 0040 within
all other populations studied.

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
 GENETIC DIVERSITY OF CICHLA POPULATIONS 267

The genetic differentiation pattern on the basis of Nei & Li (1979) similarity
index is represented by principal co-ordinates (Fig. 3), where the three distinct
species C. cf. monoculus, Cichla sp. ‘Azul’ and C. cf. temensis were distinguished
from each other. Cichla cf. temensis was positioned closer to Cichla sp. ‘Azul’
than to C. cf. monoculus. The 52 specimens from the Upper Paraná River flood-
plain and Itaipu reservoir, which shared C. cf. monoculus and Cichla sp. ‘Azul’
nuclear DNA fragments, were arranged as a population in an intermediate
position between these two species. These results are evidence of crossbreeding
between C. cf. monoculus and Cichla sp. ‘Azul’. The specific nuclear diagnostic
DNA fragments were not equally distributed in the 52 specimens from the
invasive populations established in the floodplain and Itaipu reservoir, which
indicate that they could represent C. cf. monoculus v. Cichla sp. ‘Azul’ advanced
progenies.
The mtDNA fragments (c. 460 bp) consisted of a partial sequence of the
tRNAThr gene, immediately followed by the complete sequence of the tRNAPro
gene, and then by c. 360 bp corresponding to the hypervariable domain of
the control region (GenBank accession numbers AY836716 to AY836750).
Nucleotide polymorphism was low among the tRNA sequences, therefore they
were not informative and were excluded from the analysis. The CLUSTALW
alignment of the mtDNA control region sequence (c. 360 bp) from 35 Cichla
specimens revealed a total of 97 polymorphic nucleotide sites, which were

FIG. 3. The first two axes in the principal co-ordinates analysis (PCO) of Cichla populations: Invasive to
the Upper Paraná River basin: ( ) Upper Paraná River floodplain composed of Cichla sp. ‘Azul’
(left) and ( ) interspecific hybrids (middle); ( ) Itaipu reservoir composed of Cichla sp. ‘Azul’ (left)
and ( ) interspecific hybrids (middle); ( ) Promissão Reservoir consisted of Cichla sp. ‘Azul’; ( )
Capivara reservoir composed of C. monoculus. Native to the Amazon River basin: ( ) Tocantins
River comprising C. monoculus and Cichla sp. ‘Azul’ ( ) Amazon River near Manaus composed of
C. monoculus; ( ) fish farm near the Teles Pires River, in Mato Grosso State, comprising C. temensis.
Analyses were corrected by the Lingoes method from the matrix of arithmetic complements of Nei
and Li’s (1979) similarity coefficients obtained from RAPD markers.

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
268 A. V. OLIVEIRA ET AL.

distributed in 10 haplotypes (Table I). Almost all changes were single nucleo-
tide substitutions, and transitions were the most frequent (average ti:tv ¼
212) as is typical for the mtDNA control region.
Genetic distances of Tamura & Nei (1993), as based on the mtDNA control
region sequences, are shown in Table II. Genetic distances were low among
haplotypes found within the same species, varying from 0006 to 0057. As
to native populations, the C. cf. monoculus haplotypes (Hapl-Cmn-VI and
Hapl-Cmn-II) were discriminated from Cichla sp. ‘Azul’ (Hapl-Csp-I) by
175–186% nucleotide divergence (63–67 sites), and from C. cf. temensis
(Hapl-CtmI) by c. 185% divergence. As expected, the genetic distance esti-
mates were proportional to the nucleotide diversity when C. cf. monoculus
was compared to Cichla sp. ‘Azul’ or to C. cf. temensis, varying from 0177
to 0195. On the other side, the estimates indicated that Cichla sp. ‘Azul’ is
more closely related to C. cf. temensis (0125) than to the C. cf. monoculus
(0178–0195) populations. In addition, the analysed mtDNA control region
sequence was suitable to discriminate the populations of C. cf. monoculus native
either to the Tocantins River (Hapl-Cmn-II) or to the Amazon River (Hapl-
Cmn-VI). They were differentiated by 19 nucleotide site polymorphisms
(53%), with a genetic distance estimate of 0054.
The mtDNA control region sequences indicated the possible native popula-
tions that were involved in the Cichla introductions to the locations studied in
Upper Paraná River basin. Interestingly, the same C. cf. monoculus haplotype
(Hapl-Cmn-VI) from the Amazon River native population (Fig. 1, location 6)
was identified in the population introduced in the Capivara reservoir (Fig. 1,
location 3). In addition, a second C. cf. monoculus haplotype (Hapl-Cmn-VII)
was identified in the Capivara reservoir. As compared to the native C. cf.
monoculus, the haplotype Hapl-Cmn-VII was more closely related to the
Hapl-Cmn-VI from the Amazon River specimens (39% divergence) than to
the Hapl-Cmn-II from Tocantins specimens (78% divergence). The haplotypes
of Cichla sp. ‘Azul’ invasive to the floodplain and Itaipu reservoir were identi-
cal to those of Cichla sp. ‘Azul’ native to the Tocantins River. The neighbour-
joining dendrogram based on Tamura & Nei (1993) genetic distance matrix
among Cichla specimens is represented in Fig. 4. Three major haplotype
groups, corresponding to C. cf. monoculus, Cichla sp. ‘Azul’ and C. cf. temensis,
were separated and supported by a 100% bootstrap rate. The species Cichla sp.
‘Azul’ was more closely related to C. cf. temensis than to C. cf. monoculus
(Table II and Fig. 4).
As shown in Table I, the specimens identified as interspecific hybrids con-
tained the mitochondrial genome from either C. cf. monoculus or Cichla sp.
‘Azul’. Nine of the 11 interspecific hybrids analysed contained C. cf. monoculus
haplotypes, which were divergent by only one to three nucleotide sites from the
Hapl-Cmn2 haplotype from the population native to the Tocantins River. The
C. cf. monoculus haplotypes of populations invasive to the floodplain and Itaipu
reservoir diverged by c. 19 nucleotide changes (53%) when compared to the
population native to the Amazon River. As expected, these nine specimens
were clustered with specimens native to the Tocantins River in the neigh-
bour-joining dendrogram based on Tamura & Nei (1993) genetic distances
(Fig. 4). The remaining two interspecific hybrids carried a haplotype identical

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
 TABLE I. Nucleotide polymorphisms in the hypervariable sequence (c. 360 bp) of the mtDNA control region (D-loop) from Cichla invasive and
native populations. Sampling locations are indicated by the first number in each specimen identification: 1, Upper Paraná River floodplain; 2,
Itaipu reservoir; 3, Capivara reservoir; 5, Tocantins River; 6, Amazonas River; 7, fish farm near Teles Pires River (see Fig. 1). Haplotypes:
Hapl-Cmn, C. monoculus; Hapl-Csp, Cichla sp. ‘Azul’; Hapl-Ctm, C. temensis. Entire sequences at Genbank: AY836716 to AY836750

# 2006 The Authors

0112222233335566677777888889999111111111111111111111111111111111111111111222222222222222222333333

7451345856783506824789067890246111112222222333344455666667777788888899999000123333445577788223455

Specimen Haplotypes Identification 123450125679037917809245792345803578902458127070278265905814060316

2-TUC83 Hapl-Cmn-I Hybrid CCCATACAATTAATTTGGTCGTTTATGAACTTTAAC—GATTACCTGATTCATAT-TGTTAACTTAACAATTT-GCA-CCTCAATACGTCTTACGT

2-TUC85 Hapl-Cmn-I Hybrid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . - . . .- . . . . . . . . . . . . . . . . . .

2-TUC90 Hapl-Cmn-I Hybrid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . - . . .- . . . . . . . . . . . . . . . . . .

2-TUC62 Hapl-Cmn-I Hybrid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . - . . .- . . . . . . . . . . . . . . . . . .

1-TUC18 Hapl-Cmn-I Hybrid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . - . . .- . . . . . . . . . . . . . . . . . .

1-TUC26 Hapl-Cmn-I Hybrid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . - . . .- . . . . . . . . . . . . . . . . . .

5-TUC103 Hapl-Cmn-II C. monoculus* . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . - - - . . . . . . . . . . . . . . . . . - . A . . . . . . . . . . . . . . . - . . .- . . . . . . . . . . . . . . . . . .

5-TUC104 Hapl-Cmn-II C. monoculus* . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . - - - . . . . . . . . . . . . . . . . . - . A . . . . . . . . . . . . . . . - . . .- . . . . . . . . . . . . . . . . . .

5-TUC105 Hapl-Cmn-II C. monoculus* . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . - - - . . . . . . . . . . . . . . . . . - . A . . . . . . . . . . . . . . . - . . .- . . . . . . . . . . . . . . . . . .

1-TUC16 Hapl-Cmn-III Hybrid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . - - - . . . . . . . . . . . . . . . . . - . A . . . . . . . . . . . . . . . - . . .- . . . . . G . . . . . . . . . . . .

1-TUC15 Hapl-Cmn-IV Hybrid . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . - - - . . . . . . . . . . . . . . . . . - . A . . . . . . . . . . . . . . . - . . .- . . . . . G . . . . . . . . . . . .

1-TUC21 Hapl-Cmn-V Hybrid . . .G . . G . . . . . . . . . . . . . . . . . . . . . . . .C . . . . - - - . . . . . . . . . . . . . . . . . - . A . . . . . . . . . . . . . . . - . . .- . . . . . G . . . . . . . . . . . .

6-TUC114 Hapl-Cmn-VI C. monoculus* . T . . .G . . . . . . . . . . . . . . . . . A . . .T . . . . C . . .- - - . . . . . . . C A . C . . .A . . C . A . C . . . . . G . T T . C . . - . . .- . . . . . . . . . . . T C . . . . C

6-TUC115 Hapl-Cmn-VI C. monoculus* . T . . .G . . . . . . . . . . . . . . . . . A . . .T . . . . C . . .- - - . . . . . . . C A . C . . .A . . C . A . C . . . . . G . T T . C . . - . . .- . . . . . . . . . . . T C . . . . C

6-TUC116 Hapl-Cmn-VI C. monoculus* . T . . .G . . . . . . . . . . . . . . . . . A . . .T . . . . C . . .- - - . . . . . . . C A . C . . .A . . C . A . C . . . . . G . T T . C . . - . . .- . . . . . . . . . . . T C . . . . C

6-TUC120 Hapl-Cmn-VI C. monoculus* . T . . .G . . . . . . . . . . . . . . . . . A . . .T . . . . C . . .- - - . . . . . . . C A . C . . .A . . C . A . C . . . . . G . T T . C . . - . . .- . . . . . . . . . . . T C . . . . C

3-TUC42 Hapl-Cmn-VI C. monoculus . T . . .G . . . . . . . . . . . . . . . . . A . . .T . . . . C . . .- - - . . . . . . . C A . C . . .A . . C . A . C . . . . . G . T T . C . . - . . .- . . . . . . . . . . . T C . . . . C

GENETIC DIVERSITY OF CICHLA POPULATIONS

3-TUC55 Hapl-Cmn-VI C. monoculus . T . . .G . . . . . . . . . . . . . . . . . A . . .T . . . . C . . .- - - . . . . . . . C A . C . . .A . . C . A . C . . . . . G . T T . C . . - . . .- . . . . . . . . . . . T C . . . . C

3-TUC77 Hapl-Cmn-VI C. monoculus . T . . .G . . . . . . . . . . . . . . . . .A . . .T . . . . C . . .- - - . . . . . . . C A . C . . .A . . C . A . C . . . . .G . T T . C. . - . . .- . . . . . . . . . . . T C . . . . C

3-TUC80 Hapl-Cmn-VI C. monoculus . T . . .G . . . . . . . . . . . . . . . . . A . . .T . . . . C . . .- - - . . . . . . . C A . C . . .A . . C . A . C . . . . . G . T T . C . . - . . .- . . . . . . . . . . . T C . . . . C

3-TUC57 Hapl-Cmn-VII C. monoculus T . . . . G . . . . . . . C . C . . .A . . . C . . A T . . . . . . . . - - - . . .. . . . .A . C . - . A . . C . A C . . . . C .G . T T . C . . - . . .- . . . . . . . . . . . T . . . . . .

3-TUC78 Hapl-Cmn-VII C. monoculus T . . . . G . . . . . . . C . C . . .A . . . C . . A T . . . . . . . . - - - . . . .. . . .A . C . - . A . . C . A C . . . . C .G . T T . C . . - . . .- . . . . . . . . . . . T . . . . . .

3-TUC79 Hapl-Cmn-VII C. monoculus T . . . . G . . . . . . . C . C . . .A . . . C . . A T . . . . . . . . - - - . .. . . .. . A . C . - . A . . C . A C . . . . C .G . T T . C . . - . . .- . . . . . . . . . . . T. . . . . .

269

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
 270

Journal compilation
#
TABLE I. Continued

0112222233335566677777888889999111111111111111111111111111111111111111111222222222222222222333333

7451345856783506824789067890246111112222222333344455666667777788888899999000123333445577788223455

Specimen Haplotypes Identification 123450125679037917809245792345803578902458127070278265905814060316

1-TUC5 Hapl-Csp-I Hybrid . . . . . G . G C . . .T . - . . .A T A C . . T A A T T A C . . T . A C A T A C C . . A T C A T . A . T A C . T A A . C - T . . A T T . C T C C A A A A T C T T A T T G . . A A C T . A T G A C

1-TUC19 Hapl-Csp-I Hybrid . . . . . G . G C . . .T . - . . .A T A C . . T A A T T A C . . T . A C A T A C C . . A T C A T . A . T A C . T A A . C - T . . A T T . C T C C A A A A T C T T A T T G . . A A C T . A T G A C

1-TUC68 Hapl-Csp-I Cichla sp. . . . . . G . G C . . .T . - . . .A T A C . . T A A T T A C . . T . A C A T A C C . . A T C A T . A . T A C . T A A . C - T . . A T T . C T C C A A A A T C T T A T T G . . A A C T . A T G A C

1-TUC69 Hapl-Csp-I Cichla sp. . . . . . G . G C . . .T . - . . .A T A C . . T A A T T A C . . T . A C A T A C C . . A T C A T . A . T A C . T A A . C - T . . A T T . C T C C A A A A T C T T A T T G . . A A C T . A T G A C

1-TUC70 Hapl-Csp-I Cichla sp. . . . . . G . G C . . .T . - . . .A T A C . . T A A T T A C . . T . A C A T A C C . . A T C A T . A . T A C . T A A . C - T . . A T T . C T C C A A A A T C T T A T T G . . A A C T . A T G A C

2-TUC63 Hapl-Csp-I Cichla sp. . . . . . G . G C . . .T . - . . .A T A C . . T A A T T A C . . T . A C A T A C C . . A T C A T . A . T A C . T A A . C - T . . A T T . C T C C A A A A T C T T A T T G . . A A C T . A T G A C

5-TUC98 Hapl-Csp-I Cichla sp.* . . . . . G . G C . . .T . - . . .A T A C . . T A A T T A C . . T . A C A T A C C . . A T C A T . A . T A C . T A A . C - T . . A T T . C T C C A A A A T C T T A T T G . . A A C T . A T G A C

5-TUC96 Hapl-Csp-I Cichla sp.* . . . . . G . G C . . .T . - . . .A T A C . . T A A T T A C . . T . A C A T A C C . . A T C A T . A . T A C . T A A . C - T . . A T T . C T C C A A A A T C T T A T T G . . A A C T . A T G A C

A. V. OLIVEIRA ET AL.

5-TUC95 Hapl-Csp-II Cichla sp.* . . . . . G . G T . . .T . - . . .A T A C . . T A A T T A C . . T . A C A T A C C . . A T A A T . A . T A C . T A A . C - T . . A T T . C T C C A A A A T C T T A T T G . . A A C T . A T G A C

7-TUC73 Hapl-Ctm-I C. temensis* . . T . . G . G T A A T T . - . A A A T . C C . . .A T . . C . . C G T T A T A C . C C A T C A C C C . T A T C A . A . . - . - . A T T . C . C C G A A T G C T T A . . G C C A A C T C . T . . .

7-TUC74 Hapl-Ctm-I C. temensis* . . T . . G . G T A A T T . - . A A A T . C C . . .A T . . C . . C G T T A T A C . C C A T C A C C C . T A T C A . A . . - . - . A T T . C . C C G A A T G C T T A . . G C C A A C T C . T . . .

7-TUC75 Hapl-Ctm-I C. temensis* . . T . . G . G T A A T T . - . A A A T . C C . . .A T . . C . . C G T T A T A C . C C A T C A C C C . T A T C A . A . . - . - . A T T . C . C C G A A T G C T T A . . G C C A A C T C . T . . .

*Specimens from native populations.

2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
# 2006 The Authors
# 2006 The Authors
TABLE II. Genetic distances of Tamura & Nei (1993) among Cichla haplotypes from invasive and native populations, based on the
hypervariable sequence of the mtDNA control region. Haplotypes: Hapl-Cmn, C. monoculus; Hapl-Csp, Cichla sp. ‘Azul’; Hapl-Ctm, C.
temensis. Sampling locations: 1, Upper Paraná River floodplain; 2, Itaipu reservoir; 3, Capivara reservoir; 5, Tocantins River; 6, Amazonas
River; 7, fish farming near Teles Pires River (see Fig. 1)

Hapl-Cmn-II Hapl-Cmn-VI Hapl-Cmn-VII Hapl-Cmn-I Hapl-Csp-I Hapl-Csp-I

C. monoculus C. monoculus C. monoculus Hybrid Cichla sp.* Hybrid
Haplotypes, locations 5* 6* and 3 3 1 and 2 5*, 1 and 2 1

Hapl-Cmn-VI, C. monoculus 0054

6* and 3
Hapl-Cmn-VII, C. monoculus 0057 0042
3
Hapl-Cmn-I, Hybrid 0006 0054 0057
1 and 2
Hapl-Csp-I, Cichla sp.* 0192 0178 0195 0192
5*, 1 and 2
Hapl-Csp-I, Hybrid 0192 0178 0195 0192 0000
1
Hapl-Ctm-I C. temensis 0192 0177 0187 0191 0125 0125
7
GENETIC DIVERSITY OF CICHLA POPULATIONS

*Specimens from native populations.

271

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
272 A. V. OLIVEIRA ET AL.

FIG. 4. Neighbour-joining dendrogram obtained from the hypervariable domain of the mtDNA control
region (D-loop) sequences of Cichla haplotypes from populations invasive to the Upper Paraná
River basin and populations native to the Amazon hydrographic basin: ( ) Upper Paraná River
floodplain; ( ) Itaipu reservoir; ( ) Capivara reservoir; ( ) Tocantins River; ( ) Amazon River
near Manaus; ( ) fish farm near the Teles Pires River, in Mato Grosso State. Genetic distances were
estimated by the Tamura & Nei (1993) method. Numbers in the dendrogram indicate bootstrap
probability as based on 1000 replicates. *, Specimens from native populations.

to native Cichla sp. ‘Azul’, and they were grouped with this species population
native to the Tocantins River. Therefore, the specimens positioned in the inter-
mediate area of the graph of PCO factors I and II (Fig. 3) had maternal ances-
tors from the C. cf. monoculus and Cichla sp. ‘Azul’ species.

DISCUSSION
The molecular genetic data described in this work confirm that the species
C. cf. monoculus and the Cichla sp. ‘Azul’ (blue tucunaré), a not yet described
species, were introduced into the southern part of the Upper Paraná River

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
 GENETIC DIVERSITY OF CICHLA POPULATIONS 273

basin. Moreover, the data indicate that introduced populations of C. cf.

monoculus and Cichla sp. ‘Azul’ interbred in the Itaipu reservoir and in the
floodplain of the Upper Paraná River. Hybrids between C. cf. monoculus and
Cichla sp. ‘Azul’ have not been described in the Tocantins–Araguaia sub-basin
where both species are native and sympatric.
Polymorphisms in the mtDNA sequences and in nuclear DNA fragments
confirm the hypothesis of multiple Cichla introductions in the Upper Paraná
River basin. Data revealed two subpopulations of C. cf. monoculus in the
Capivara reservoir and indicated that they were derived from populations
native to the Amazon River basin, which are diverse of the Tocantins–
Araguaia sub-basin. In the Upper Paraná floodplain and Itaipu reservoir,
however, invasive populations might have been introduced at first from C.
cf. monoculus and Cichla sp. ‘Azul’ native to the Tocantins–Araguaia sub-
basin. Data also indicated that a diverse subpopulation of Cichla sp. ‘Azul’
was introduced in the Promissão reservoir. Therefore, multiple intentional in-
troductions of Cichla species from the Tocantins–Araguaia sub-basin and from
the Amazon River are likely to have occurred into the Upper Paraná River
basin, and they obviously involved diverse native subpopulations at the different
events. In addition, Orsi & Agostinho (1999) reported recent Cichla introduc-
tions into the Capivara reservoir probably were the result of fish escapes from
fish farming operations.
The genetic differentiation pattern demonstrated 52 specimens genetically
intermediate between C. cf. monoculus and Cichla sp. ‘Azul’ (Fig. 3). The data
presented here provide strong indication for the breakdown of reproductive
isolation between Cichla species in a new environment, resulting in hybridiza-
tion. The low frequencies of Cichla parental species in the Itaipu reservoir
and in the floodplain of the Upper Paraná basin reinforce the assumption of
local hybridization. Because hybrids were prevalent (765%) in the established
invasive populations plus the evidence that currently they would represent
advanced progenies, it could be hypothesized that the C. cf. monoculus v. Cichla
sp. ‘Azul’ hybrids are fertile. The number and repeatability of the exclusive
diagnostic nuclear DNA bands were sufficient for an unambiguous discrimina-
tion of the three Cichla species and their populations. Diagnostic nuclear DNA
fragments exclusive to the same studied Cichla species and populations have
also been confirmed using the inter-simple sequence repeat (ISSR) technique.
In addition, the ISSR diagnostic markers corroborate the results reported in
this work both for the native and invasive Cichla populations and for the exis-
tence of C. cf. monoculus  Cichla sp. ‘Azul’ hybrids (G. C. A. Almeida, pers.
comm.). RAPD diagnostic loci have been used effectively for preliminary
assessments of genetic variability and for unequivocal detection of natural
interspecific hybrids in other fishes (Bardakci & Skibinski, 1994; Callejas &
Ochando, 2001; Weiss et al., 2001; Oliveira et al., 2002; Khrisanfova et al.,
2004).
The Cichla hybrids identified in the Upper Paraná River basin inherited
mtDNA either from C. cf. monoculus or from Cichla sp. ‘Azul’, hence demon-
strating that both parental species can act as the female donor in the interspe-
cific crosses. Hybrid haplotypes were clustered with their corresponding native
species, which must have been the mother in the interspecific crosses, and

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
274 A. V. OLIVEIRA ET AL.

the clustering did not discriminate native and introduced Cichla specimens. As
based on the mtDNA nucleotide similarity (Fig. 4 and Table I), a C. cf. mono-
culus population from the Tocantins-Araguaia hydrographic basin rather than
the Amazon River must have been involved in the interspecific crosses.
Introgressive hybridization is a common feature between divergent lineages
of fishes, particularly when allopatric taxa are introduced into new habitats
(Hubbs, 1955; Arthington, 1991; Pierce & Van Den Avyle, 1997; Avise et al.,
2002; Rubidge & Taylor, 2004). In the Upper Paraná River floodplain, for
instance, diagnostic RAPD markers revealed crossbreeding between the
endemic Steindachnerina insculpta (Eigenmann & Eigenmann, 1889) and
Steindachnerina brevipinna (Fernández-Yépez, 1948), which was introduced
from the Middle Paraná River (Oliveira et al., 2002). Cichla species have
a highly similar karyotype (2n ¼ 48) macrostructure (Alves, 1998; Nishiyama,
1998), and the possibility of occasional natural hybridization between C. cf.
monoculus and C. cf. temensis has been previously reported in their native re-
gions, as inferred from karyological and esterase analyses (Andrade et al.,
2001; Brinn et al., 2004; Teixeira & Oliveira, 2005). The three species studied
were sharply separated in the neighbour-joining dendrogram (Fig. 4). The
mtDNA sequences indicated that C. cf. temensis population is more closely
related to Cichla sp. ‘Azul’ than to C. cf. monoculus, but there are no reports
of natural coexistence and hybridization between them.
Crossbreeding between C. cf. monoculus and Cichla sp. ‘Azul’ in their native
region has not been reported. Hybridization between closely related fish species
has been described in regions where the introduced species is genetically com-
patible to either local or other introduced species (Hubbs, 1955; Arthington,
1991; Pierce & Van Den Avyle, 1997; Oliveira et al., 2002). Displacement of
species outside their native region may disrupt isolation mechanisms (Scribner
et al., 2001). Cichla species are known to have complex reproductive and
behaviour strategies such as nest building and parental care (Agostinho et al.,
2003). It appears that the C. cf. monoculus and Cichla sp. ‘Azul’ populations
have not encountered major restrictions in the new habitat, since already
shortly after their introduction they were widespread in the lentic environments
of the Upper Paraná River basin. Moreover, the high frequency of interspecific
hybrids in the Upper Paraná River suggests that the new environment was
favourable for hybridization between Cichla sp. ‘Azul’ and C. cf. monoculus.
As discussed by Smith et al. (2003), hybridization among cichlids may be
more significant as an evolutionary impact than previously assumed. Moreover,
interspecific hybridization can lead to local species extinction and can represent
a threat to the integrity of unique gene pools (Scribner et al., 2001; Perry et al.,
2002). When hybridization between species results in fertile hybrids, well-
adapted and vigorous strains may be created, which are potentially more com-
petitive than the most aggressive variants of the parental species (Arthington,
1991). Since the number of hybrid specimens in the Upper Paraná basin was
relatively large, they may have some competitive advantage over the parental
species. Continued surveillance of these populations, including studies on pop-
ulation density and differentiation migration patterns, might be useful in deter-
mining causes for hybridization and thus that will be of genetic and ecological
interest.

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
 GENETIC DIVERSITY OF CICHLA POPULATIONS 275

The data presented herein are potentially useful for the monitoring of the
invasive Cichla populations and for future taxonomic, genetic and evolutionary
studies within this genus. The detection of a large interspecific hybrid popula-
tion calls attention to the imminent possibility of natural hybridization with
unpredictable consequences when two or more Cichla species are concurrently
introduced. Therefore, the data are also of interest for the development of
future ecological guidelines.

The authors gratefully acknowledge A. A. Agostinho and M. Petrere Jr for valuable

discussions and suggestions, C. S. Pavanelli and W. J. Gracxa for assisting with species
identification, E. K. Okada for helping with fish sampling, C. T. Harms for revising the
manuscript, and Nupelia-UEM for logistic support. Part of this research was supported
by grants from CNPq and CAPES.

References
Agostinho, A. A., Júlio, H. F. Jr & Petrere, M. Jr (1994). Itaipu Reservoir (Brazil):
impacts of the impoundment on the fish fauna and fisheries. In Rehabilitation of
Freshwater Fisheries (Cowx, I. G., ed.), pp. 171–184. Hull: Hull International
Fisheries Institute, University of Hull.
Agostinho, A. A., Júlio, H. F. Jr & Gomes, L. C. (2003). Allochthonous species in the
Upper Parana basin: status and patterns. In 2003 Joint Meeting of Ichthyologists and
Herpetologists, Abstracts (Vogt, R. C. & Chao, N. L., eds), p. 5. Manaus, AM:
American Society of Ichthyologists and Herpetologists (ASIH).
Agostinho, A. A., Bini, L. M.; Gomes, L. C., Júlio, H. F. Jr, Pavanelli, C. S. &
Agostinho, C. A. (2004). Fish Assemblage. In The Upper Paraná River and its
Floodplain: Physical Aspects, Ecology and Conservation (Thomaz, S. M., Agostinho,
A. A. & Hahn, N. S., eds), pp. 223–246. Leiden: Backhuys Publishers.
Agostinho, A. A., Thomaz, S. M. & Gomes, L. C. (2005). Conservation of the bio-
diversity of Brazil’s island waters. Conservation Biology 19, 646–652.
Alves, M. N. (1998). Análise Citogenética da Famı́lia Cichlidae: Gênero Cichla
(Schneider, 1801) Perciformes, Labroidei. MS Thesis Dissertation, Instituto
Nacional de Pesquisas da Amazônia, AM, Brazil.
Andrade, F., Schneider, H., Farias, I., Feldberg, E. & Sampaio, I. (2001). Análise
filogenética de duas espécies simpátricas de tucunaré (Cichla, Perciformes), com
registro de hibridacxão em diferentes pontos da bacia amazônica. Revista Virtual de
xão Acadeˆmica da UFPA 1, 1–11.
Iniciac
Arthington, A. H. (1991). Ecological and genetic impacts of introduced and translocated
freshwater fishes in Australia. Canadian Journal of Fisheries and Aquatic Sciences
48, 33–43.
Avise, J. C., Jones, A. G., Walker, D. & Dewoody, J. A. (2002). Genetic mating systems
and reproductive natural histories of fishes: lessons for ecology and evolution.
Annual Review of Genetics 36, 19–45.
Bardakci, F. & Skibinski, D. O. F. (1994). Application of the RAPD technique in tilapia
fish: species and subspecies identification. Heredity 73, 117–123.
Black, B. (1997). RAPDPLOT 3.0. Fort Collins, CO: Colorado State University.
Brinn, M. N., Porto J. I. & Feldberg, E. (2004). Karyological evidence for interspecific
hybridization between Cichla monoculus and C. temensis (Perciformes, Cichlidae) in
the Amazon. Hereditas 141, 252–257.
Callejas, C. & Ochando, M. D. (2001). Molecular identification (RAPD) of the eight
species of the genus Barbus (Cyprinidae) in the Iberian Peninsula. Journal of Fish
Biology 59, 1589–1599.
Cronin, M. A., Spearman, W. J., Wilmot, R. L., Patton, J. C. & Bickham J. W. (1993).
Mitochondrial DNA variation in chinook (Oncorhynchus tshawytscha) and chum
salmon (O. keta) detected by restriction enzyme analysis of polymerase chain

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
276 A. V. OLIVEIRA ET AL.

reaction (PCR) products. Canadian Journal of Fisheries and Aquatic Sciences 50,
708–715.
Excoffier, L., Laval, G. & Schneider, S. (2005). Arlequin ver. 3.0: an integrated software
package for population genetics data analysis. Evolutionary Bioinformatics Online
1, 47–50.
Farias, I. P., Orti, G., Sampaio, I., Schneider, H. & Meyer, A. (1999). Mitochondrial
DNA phylogeny of the family Cichlidae: monophyly and fast molecular evolution
of the neotropical assemblage. Journal of Molecular Evolution 48, 703–711.
Fontenele, O. & Peixoto, J. T. (1979). Apreciacxão sobre os resultados da introduc xão do
tucunaré comum, Cichla ocellaris (Bloch & Schneider, 1801), nos acxudes do
nordeste brasileiro, através da pesca comercial. Boletim Te´cnico do DNOCS 37,
109–134.
Hubbs, C. L. (1955). Hybridization between fish species in nature. Systematic Zoology
4, 1–20.
Júlio, H. F. Jr & Agostinho, A. A. (2003). Introduced species into the Upper Paraná
River floodplain by elimination of a geographical barrier and stocking programs.
In 2003 Joint Meeting of Ichthyologists and Herpetologists, Abstracts (Vogt, R. C. &
Chao, N. L., eds), pp. 244–245. Manaus, AM: American Society of Ichthyologists
and Herpetologists (ASIH).
Khrisanfova, G. G., Ludannyi, R. I., Slyn’ko, Iu. V., Iakovlev, V. N. & Cemenova, S. K.
(2004). RAPD fingerprinting of common bream Abramis brama L., roach Rutilus
rutilus L., and their F1 hybrids. Genetika 40, 1432–1436.
Kullander, S. O. (1986). Cichlid Fishes of the Amazon River Drainage of Peru. Stockholm:
Swedish Museum of Natural History.
Kullander, S. O. & Nijssen, H. (1989). The Cichlids of Surinam. Leiden: E.J. Brill.
Kumar, S., Tamura, K. & Nei, M. (2004). MEGA3: Integrated software for Molecular
Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics
5, 150–163.
Legendre, P. & Anderson, M. J. (1998). Program DistPCoA. Montreal: Département de
sciences biologiques, Université de Montréal.
Legendre, P. & Anderson, M. J. (1999). Distance-based redundancy analysis: testing
multispecies responses in multifactorial ecological experiments. Ecological Mono-
graphs 69, 1–24.
Meyer, A., Kocher, T. D., Basasibwaki, P. & Wilson, A. C. (1990). Monophyletic origin
of Victoria cichlid fish suggested by mitochondrial DNA sequences. Nature 347,
550–553.
Monesi, N., Jacobs-Lorena, M. & Pac xo-Larson, M. L. (1998). The DNA puff gene BhC4-
1 of Bradysia hygida is specifically transcribed early prepupal salivary glands of
Drosophila melanogaster. Chromosoma 107, 559–569.
Nei, M. & Li, W. H. (1979). Mathematical model for studying genetic variation in terms
of restriction endonucleases. Proceedings of the National Academy of Sciences of the
United States of America 76, 5269–5273.
Nishiyama, P. B. (1998). Análise citogenética de tucunarés (Cichla: Pisces, Cichlidae) da
represa de Volta Grande, municı́pio de Conceicxão das Alagoas, Minas Gerais.
MS Thesis Dissertation, Instituto de Biociências – UNESP, SP, Brazil.
Novaes, J. L. C., Caramaschi, E. P. & Winemiller, K. O. (2004). Feeding of Cichla
monoculus Spix, 1829 (Teleostei: Cichlidae) during and after reservoir formation in
the Tocantins River, Central Brazil. Acta Limnologica Brasileira 16, 41–49.
Oliveira, A. V., Prioli, A. J., Prioli, S. M. A. P., Pavanelli, C. S., Júlio, H. F. Jr & Panarari,
R. S. (2002). Diversity and genetic distance in populations of Steindachnerina in the
upper Paraná river floodplain of Brazil. Genetica 115, 259–267.
Orsi, M. L. & Agostinho, A. A. (1999). Introducxão de espécies de peixes por escapes
acidentais de tanques de cultivo em rios da bacia do rio Paraná, Brasil. Revista
brasileira de Zoologia 16, 557–560.
Perry, W. L., Lodge, D. M. & Feder, J. L. (2002). Importance of hybridization between
indigenous and nonindigenous freshwater species: an overlooked threat to North
American biodiversity. Systematic Biology 51, 255–275.

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277
 GENETIC DIVERSITY OF CICHLA POPULATIONS 277

Pierce, P. C. & Van Den Avyle, M. J. (1997). Hybridization between introduced spotted
bass and smallmouth bass in reservoirs. Transactions of the American Fisheries
Society 126, 939–947.
Prioli, S. M. A. P., Prioli, A. J., Júlio, H. F. Jr, Pavanelli, C. S., Oliveira, A. V., Carrer,
H., Carraro, D. M. & Prioli, L. (2002). Identification of Astyanax altiparanae
(Teleostei, Characidae) in the Iguacxu river, Brazil, based on mitochondrial DNA
and RAPD markers. Genetics and Molecular Biology 25, 421–430.
Rubidge, E. M. & Taylor, E. B. (2004). Hybridization zone structure and the potential
role of selection in hybridizing populations of native westlope cutthroat trout
(Oncorhynchus clarki lewisi) and introduced rainbow trout (O. mykiss). Molecular
Ecology 13, 3735–3749.
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406–425.
Scribner, K. T., Page, K. S. & Bartron, M. L. (2001). Hybridization in freshwater fishes:
a review of case studies and cytonuclear methods of biological inference. Reviews in
Fish Biology and Fisheries 10, 293–323.
Shafland, P. L. (1996). An overview of Florida’s introduced butterfly peacock bass
(Cichla ocellaris) sportfishery. Natura Caracas 96, 26–29.
Smith, P. S., Konings, A. D. & Kornfield, I. (2003). Hybrid origin of a cichlid population
in lake Malawi: implications for genetic variation and species diversity. Molecular
Ecology 12, 2497–2504.
Tamura, K. & Nei, M. (1993). Estimation of the number of nucleotide substitutions in the
control region of mitochondrial DNA in humans and chimpanzees. Molecular
Biology and Evolution 10, 512–526.
Teixeira, A. S. & Oliveira, S. S. (2005). Evidence for a natural hybrid of peacock bass
(Cichla monoculus vs. Cichla temensis) based on esterase electrophoretic patterns.
Genetics and Molecular Research 4, 74–83.
Weiss, S., Schlötterer, C., Waidbacher, H. & Jungwirth, M. (2001). Haplotype (mtDNA)
diversity of brown trout Salmo trutta in tributaries of the Austrian Danube:
massive introgression of Atlantic basin fish – by man or nature? Molecular Ecology
10, 1241–1246.
Williams, J. G. K., Kubelik, A. R., Livak, J., Rafalski, J. A. & Tingey, S. V. (1990). DNA
polymorphisms amplified by arbitrary primers are useful as genetic markers.
Nucleic Acids Research 18, 6531–6535.

Electronic Reference
Buckup, P. A. & Menezes, A. (2003). Catálogo dos peixes marinhos e de água doce do
Brasil. Available from http://www.mnrj.ufrj.br/catalogo

# 2006 The Authors

Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277