Professional Documents
Culture Documents
net/publication/328304840
CITATIONS READS
0 133
1 author:
s.Bala Murugan
Coimbatore Institute of Technology
4 PUBLICATIONS 0 CITATIONS
SEE PROFILE
All content following this page was uploaded by s.Bala Murugan on 16 October 2018.
Journal
of Engineering, Computers &
Applied Sciences
Journal of Applied
Engineering & Computer
Sciences Volume 2, No 4, April 2013
ww
SR.No Title/Author Page No.
1 Integrated Solar Wall System With Combined Electricity And Windows 1-4
Radhakrishnan.P, Mahesh Priya.L, Sowmya.S
ABSTR
RACT
This papper presents a study on thee utilization of
o solar energgy, and buildiing solar walll system. A significant
s
amount ofo research and developmeent work has to be carriedd out in develloped nationss. Windows w with power
generatioon system iss not develooped. A rangge of theoreetical model have investtigated for aand their
appropriiateness validaated by simullation data. Im
mprovement ofo the solar wall's
w perform
mances can bee obtained
using douuble glazing. The
T results deemonstrated thhat solar wall provides enerrgy savings.
Keyword ds: Solar wallls, Dynamic Simulation,
S Inddoor thermal comfort,
c Enerrgy analysis.
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 1
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
opptimization of
o its structuural, geometrrical and
teechnological parameters,
p a complex siimulation
m
model must be established. It basically coonsists of
inndividual models
m whhich are solved
simmultaneously.
ulation
3. Simu
For prediction of PV system behavior annd
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 2
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
4.. Results
Models discusssed Section IIII; a simulationn has
M
beeen developedd using MATL LAB/Simulinnk. In
orrder to verify
y the system performance load
deemand data.
Thhe power diffference betweeen the generaation
soources and the load demannd and micro grid
baalance power quality by FA
ACTS devices..
5.. Conclusioon
Inn this paper, a Window Phhotovoltaic syystem
is proposed. Studied utillization of solar
ennergy, and buuilding solar wall
w system which
w
Figg .3.3 Networkk of solar eneergy caapable to mainntain load demmand in peak load
conveersion .B
By using solaar wall ambieent temperaturre of
inndoor is minimmum in summ mer and electtrical
This eneergy is radiatted and convverted from the
t poower outage is maintained. Model cann be
modules’’ surfaces to surroundinngs or to the t ussed in hot /coool conditionns. The simulaation
window aair gap, respecctively. m
model of thee hybrid sy ystem has been
deeveloped using MA ATLAB/Simuulink.
The therm
mal model is then based onn solution of 1D
1 Siimulation studies have beeen carried ouut to
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 3
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
verify the system performance under different Sandia National Laboratories, Albuquerque,
scenarios using the practical load. 2004
[4] Incropera, F. P., DeWitt, D. P.: Introduction to
6. Reference Heat Transfer, 3rd ed., John Wiley & Sons,
[1] The German Solar Energy Society: Planning New York, 1996
and Installing Photovoltaic Systems – A [5] Mei, L., Infield, D., Eicker, U., Fux, V.:
Guide for Installers, Architects and Engineers, Thermal Modelling of a Building with an
James & James, London, 2005 Integrated Ventilated PV Façade, Energy and
[2] Heinemann, D.: Energy Meteorology – Buildings 35 (2003)pp. 605-617
Lecture notes, Carl von Ossietzky Universität, [6] C. Hua, J. Lin, and C. Shen, “Implementation
Oldenburg, 2002 of a DSP-controlled photovoltaic system with
peak power tracking,” IEEE Trans. Ind.
[3] King, D. L., Boyson, W. E., Kratochvil, J. A.: Electron., vol. 45, no. 1, pp. 99–107, Feb. 1998
Photovoltaic Array Performance Model,
www.borjournals.com Blue Ocean Research Journals 4
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
ABSTRACT
Optical characterization of lead chloride crystals prepared by sol-gel method is reported. The relevant sol-gel
technique is used for the preparation of PbCl2 samples with five different types. In this paper, we report the
absorption and fluorescence behaviour of pure, UV& IR irradiated and electric & magnetic field applied lead
chloride crystal samples in solution phase at two different concentrations. Optical bandgap and emission
studies of these crystals are also done.
KEYWORDS: Lead chloride, absorption,fluorescence,gel method,spectroscopy
Introduction
Flourescence spectroscopy is of overwhelming with layers perpendicular to the [010] direction.
importance in the field of photo physics. Lead The lead chloride crystal is characterized by an
chloride is a well known photosensitive material excitonic fundamental edge, which are formed by
possessing ionic crystalline nature belonging to electronic states of lead ion.Our experiments on the
orthorhombic system [1]. PbCl2 is the model growth of lead chloride confirm the utility of this
material from heavy element halogenide group method for growing large needles and single
since it satisfies high birefringence, low attenuation crystals. In the visible region the length of the
coefficient and wide transparency range [2]. Many needle is small compared to the growth of lead
of the researchers reported the luminescence chloride crystals under the influence of ultraviolet
property of PbCl2 [3]. Under excitation in the and infrared radiations.
fundamental absorption region, PbCl2 crystals
exhibit two types of intrinsic luminescence [4]. Experimental Technique
W.C.DE Gruijter had done emission studies on In our spectroscopic studies the PbCl2 crystal
PbCl2 [5]. The top of the valence band is composed samples used were prepared by using a stock
of Pb2+-6s with considerable admixing of chlorine- solution of sodium meta silicate (SMS). A quantity
np, while the bottom of the conduction band is of 25 ml. of SMS solution of specific gravity 1.03,
made up of Pb2+-6p [6]. PbCl2 is classified as a whose pH was adjusted to be 6.5, 7.0, 7.5 , 8.0 and
normal class I crystal and its transmission range is 8.5 by titration with 1M tartaric acid, and was
wide [7-8]. PbCl2 finds importance in experimental allowed to gel in five various boiling test tubes
field due to their large band gap and exhibiting without any disturbances. Growth experiments
interesting features from the stand point of were conducted for different densities of the gel
electron-lattice interaction [9-18]. Lead halide ranging from 1.02 to 1.06. It was found that for the
based materials can be used as laser hosts with low same concentration of HCl, tartaric acid and lead
phonon energies. The Pb2+ in the PbCl2 crystal is nitrate solution, the rate of growth of the needles is
known to be emissive in aqueous solution [19-22]. conspicuously larger and the needles are larger for
In the present study, we report for the first time the lesser densities of the gel. This is due to the
absorption and fluorescence emission properties of increased rate of diffusion of HCl in the gel and
PbCl2 crystal samples prepared by sol-gel increased mobility of the molecules of the crystals
technique through five different methods. PbCl2 is at lower densities of the gel. PbCl2 crystals were
marked as an insulator with a moderate bandgap. obtained by the reactions of lead nitrate, tartaric
They belong to the space symmetry group D2h16 acid and HCl (99.9% Sigma-Aldrich). Two
www.borjournals.com Blue Ocean Research Journals 1
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
different PbCl2 crystaal samples weere obtained by deescribed as eloongated alongg the c axis w
with (100),
irradiatinng pure PbCl2 crystals witth ultra violet ( (0010) as main forms
f and (1110), (120) andd (210) as
UV lampp (insect Killler)) and Inffrared radiatioons smmaller faces, while at the t top (0111) is the
(HL43111 (PHILIPS)) 230V~50H Hz~150w). The T doominant form m. From the exxternal observvations of
other twoo samples werre prepared by subjecting the t foour sets of lead chloride dihydrate
d crysstals, it is
crystal too an electric field of 20 V using paralllel cllear that there is no chhange in thee external
plate arraangement and d subjecting the
t crystal to oa m
morphology by
y naked eye.
magneticc field using two bar maagnets kept on 1.. Absorpption Studies
either sside of thee experimenntal test tu ube O
Optical absorpttion spectra of
o PbCl2 samples at two
perpendiccular to the length
l of the test-tube. Thhus diifferent concentrations c1 and
a c2 are shoown in the
five PbCCl2 samples were
w obtained for our studies figgure 1.
viz pure, UV and IR irradiated, sam mples subjectted (aa)
to electric and magnettic fields. Thee sol-gel deriv
ved
PbCl2 sam mples were suubjected to X-ray
X diffractiion
studies ( XPERT-PRO O using K-Alppha 1.54060 A0
(XRDML L)). The cryystal structurre of PbCl2 is
confirmeed to be orth horhombic diipyramidal with w
each Pbb having a coordination under 9.
Observattions under peetrological miicroscope reveeal
that PbC Cl2 crystals grown undeer all the fiive
conditionns show inclinned extinctionn. The preparred
crystal saamples were powdered ussing mortar and a
weighed about 0.15g and disssolved in 15 ml
pestle, w
of single distilled water
w (SDWW) to obtain a
concentraation c1=0.01 gm/m ml. Anothher
concentraation c2=0.02 2 gm/ml waas obtained by
dissolvinng 0.32gm inn 20 ml of SDW. For the t
dissolutioon ,a magnettic stirrer waas used and the t (bb)
solvent evaporation was preventeed by using a
sealed gglass containeer. Linear absorption of the t
crystal ssamples in soolution phasee was record ded
using Jassco V-570 UV V/VIS/IR Speectrophotometter.
Optical bband gap of these
t sampless were obtain ned
from liinear absorp ption measuurements. The T
emissionn and excitatioon studies werre carried out by
taking thhe room temp perature flourrescence specctra
of thesee PbCl2 samp ples using a Cary Eclip pse
fluoresceence spectrophhotometer (Vaarian).
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 6
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
Figure 2.
2 Optical baand gap plot of Pure PbC Cl2
sample att concentratio
ons (a) c1 and (b) c2
Figure 2 shows the direct
d band gaap behaviour of
PbCl2 saamples at twoo different cooncentrations c1
and c2. T
The chloride ioons at the larggest distance are
a
surroundded by four leead ions wherre as the closest
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 7
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 8
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
the strong interaction between phonon and Pb2+ [4] M.Kituara, H.Nakagawa, J. Electron Spectrosc.
ions. From the fluorescence spectra given in the Relat. Phenom. 79 (1996) 171
figure, it is evident that the emission peaks at 491 [5] W.C.DE.Gruijter, J. Solid State Chem. 6
and 533 nm are assigned to the excitonic emissions. (1973) 151
For pure PbCl2 sample, the emission peak at 431 [6] M. Fujita et al, J. Phys. Soc.Japan 60 (1991)
nm at concentration c2 is red shifted. The IR 4393
irradiated and electric field applied samples have [7] F.E.A.Melo, K.W.Garret, J. Mendes Filho,
almost same emission peak at 423, 492 and 533 nm J.E.Moreira, Solid State Commn., 29-33 (1979) 31
for the two concentrations c1 and c2. The shifting [8] O.Keefe.M, Comm. Sol.State Phys. 7 (1977)
of emission peaks at pure PbCl2 sample is due to 163
the band edge emission which are attributed to the [9] Plekhanov.V Phys.StatusSolidi B 57 (1973)
quasi free recombination at the absorption band K55
edge. Thus the spontaneous exciton dissociation [10] Nistor.S.V, Goovaerts.E and Schoemaker.D
has been revealed by the fluorescence emission in 1993 Phys.Rev.B 48 9575
sol- gel derived PbCl2 samples in solution phase. [11] Kitaura M, Nakagawa.H 1996 J.Electron
Spectrosc.Relat.Phenom. 79 171
Conclutions [12] Kitaura.M and Nakagawa.H 1997 J.Lumin.
High quality lead chloride crystals were prepared 72-74 883
by sol-gel technique. The obtained PbCl2 crystal [13] Itoh.M, Nakagawa.H, Kitaura. M, Fujita.M
samples of five different types in solution phase and Alov.D.L 1999 J.Phys.:Condens.Matter 11
were subjected to spectrophotometric studies. The 3003
linear absorption spectra give the optical band gap [14] Kink.R, Avarmaa.T, Kisand.V. Lohmus.A,
details of these crystals. Photo luminescence Kink.I and Martinson.I 1998
studies on these lead chloride samples were done J.Phys.:Condens.Matter 10 693
by fluorescence spectroscopy. The fluorescence [15] Kanbe.J, Takezoe.H,and Onaka.R 1976
emission of these crystals shows that PbCl2 crystals J.Phys.Soc.Jpn. 41 942
have the band gap in connection with the 6s to 6p [16] Eijkelenkamp A.J.H.and V A.J os.K J.. 1976
gap in lead ions and tend to become highly Phys.Status Solidi B 76 769
luminescent coming from the odd transition. Thus [17] Beaumont.J.H,.Bourdillon .A.J and Bordas.J
the high luminescence nature of lead chloride 1977 J.Phys.C 10 761
makes them suitable for applications in [18] Fujita.M, Nakagawa.H, Fukui.K,
photography, acoustical-optical devices and Matsumoto.H, Miyanaga.T and Watanabe.M 1991
radiation detectors. J.Phys.Soc.Jpn. 60 4393
[19] Hans Niikol, Alexander Becht, Arnd Vogler,
Acknowledgements Inorg. Chem. 3277-3279 (1992) 31
The authors acknowledge KSCSTE and Moulana [20] P. Pringshem, H,Vogels, Physica 225 (1940)
Azad National Fellowship schemes for financial 7
support. [21] C.W.Sill, H.E. Peterson, Anal. Chem. 1266
(1949) 21
[22] R. Narayanaswamy, P.J. Mayne, G.F.
References Kirkbright, J. Inorg. Nucl. Chem.129 (1978) 40
[1] H.Nakagawa, Y.Doi, T.Nakamura , [23] K.I Best, Z. Physik, 163 (1961) 309
“Absorption [24] K.J.Devries, Doctoral Dissertation, University
and luminescence in PbCl2 : Tl+ crystals”.J. of Utrecht (1965)
Lumin. 87-89 (2000) 1130-1132 [25] K.J.Devries, J.H.Vansanten, Physica 2051-
[2] P.Nishasanthakumari, S.Kalainathan, Cryst. 2058 (1964) 30
Res.Technol. 43 (2008) 4 [26] G.Liidja, V.I.Plekhanov, J. Lumin. 6 (1973)
[3] M.Kituara, H.Nakagawa, J. Lumin. 72-74 71
(1997) 883 [27] Masanobu Iwanga, Tetsusuke Hayashi, J.
Lumin. 102-103 (2003) 663-668
www.borjournals.com Blue Ocean Research Journals 9
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
ABSTRACT
Plasma Transferred Arc (PTA) hardfacing performed to improve the surface properties of metallic machine
parts locally. Hardfacing process was applied when the surface to be damaged by wear due to hard minerals.
The analyses of PTA hardfacing on structural steel with titanium carbide (TiC) are employed using by finite
element technique. The aim of this work is to compare the simulated measured weld bead geometry values with
experimental results at various heat input conditions and showing good agreement.
Key Words: PTA hardfacing, FEM, validation
www.borjournals.com Blue Ocean Research Journals 10
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
Table .1: Chemical Composition and Mechanical Properties of Structural Steel and TiC
Elements, Weight %
Sl.No Material Used
C Si Mn S P Mg Ti Fe
1 IS:2062 (Base Metal) 0.18 0.18 0.98 0.016 0.016 - - bal
Titanium Carbide (TiC)
2 0.04 0.03 0.03 - - 0.09 99.0 0.12
(PTA Powder)
Hardness
Tensile Strength Yield Strength
Base Metal Hardfaced Metal
18 HRC 56HRC 485 MPa 275 MPa
www.borjournals.com Blue Ocean Research Journals 11
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
Fig.1
1Meshed moddel of the PTA
A hardfaced pllate
5. Resu
ult And Disscussion strrongly affecteed by appliedd heat input during
d the
The resuults of simulaation obtainedd for three heeat TiiC hardfacing of plates. The measuured bead
input coondition as shown in the Table. 4. geeometry param meters of thee plates are compared
Transverrse section is taken from Q-Slice optiion w
with simulatioon results whhich are presented in
availablee in ANSYS, used to find the penetratiion Taable 4 and Fiigure 4. Thus to obtain a good
g weld
and longitudinal temperature plots are used to fiind beead profile, selection
s of process paraameters is
bead widdth of the weld profile. From the Figuress 2 im
mportant. It iss evident that, Finite Elemeent results
and 3, itt is understoo od the heat input increases, arre less deviateed when com mpared to expperimental
mulated results, it
penetratioon increases. From the sim reesults and th hese deviatioons are duee to the
is concluuded that beaad width and penetration area asssumptions madem nite element analysis.
in fin
www.bo
orjournals.co an Research Journals 12
om Blue Ocea
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
www.bo
orjournals.co an Research Journals 13
om Blue Ocea
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
Fig.4 Comparison
C off effect of heaat input on beaad width and penetration
p
6. Con
nclusion tw
wo similar pllates, Scientiffic Technicall Review,
Three dim mensional theermal models is employed to V LIX, No.1, 2009, pp. 577-59
Vol.
predict tthe bead geoometry param meters such as [99] Xiang gyang Lu, Tasnim
T Hassaan, Finite
penetratioon and beadd width andd the predictted reesidual stressees in butt andd socket weldded joints,
results arre compared with
w experimenntal results. Trransactions, SMiRT
S 16, Papper No. 1983,, 2001
[110] ASM reaady reference: Thermal prooperties of
7. Refferences m
metals, ASM
[1] U.Drraugelats, B. Bouaifi and T. T Plegge. Weeld [11] FU Yuue-chun, SHI Nan-lin,
N Zhanng De-zhi,
Res. Abrroad, 42,(11), pp.
p 39 -41, 19996. Y
YANG Rui. Prreparation of SiC/Ti compposites by
[2] A. K. Jha, B.. K. Prasad, R.R Dasgupta, et poowder cloth teechnique[J]. The
T Chinese Journal
J of
al.; J.Maater.Eng.Perfoorm, 8, (2), pp.
p 190 – 19 96, N
Nonferrous Metals,
M 2004, 14(3): 465− −470. (in
1999. Chhinese)
[3] J.R.Davis annd Associatees, Hardfacin ng,
weld claadding and dissimilar
d meetal joining in;
ASM Handbook
H – Welding, Brazing and a
Solderingg, Vol.6, 10th Ed, ASM metals
m Park, OH,
O
1993, pp – 699 – 823.
[4] E.Lugscheideer,U.Morkram mor, A. Ait- A
Makidechhe, Advancces in PT TA surfacin ng,
Proceedinng of the Fou urth National Thermal Sprray
Conferennce, Pittsburghh, PA, USA, 1991.
1
[5] Wolfgang Whal,
W Stuttgart, Trends forf
Hardfacinng, www.eengineers.org.il/
uploads/11683/drwhal0206.pdf
[6] D’ Oliveira, A.S.C.M., Yaedu,
Y A.E and
a
Silva P..S.C.P, “ Influence oof dilution on
microstruucture and meechanical propperties of cobaalt-
based allloy depositedd by Plasma Transferred
T A
Arc
Welding””, Internationnal Conferencce on Advancced
materialss, their processes andd application ns,
materialss week, Mucheen , 2002.
[7] Agustin Guallo Hernan G. Svoboda Esteela
S.Surian and Luis A. de vedia, Efffect of weldiing
procedurre on wear behavior of o a modifiied
martenstiic tool steel hardfacing
h deeposit, Materials
& Designn, Elsevier, 20011.
[8] Ivaana Vasovic, Dragi Stam menkovic, Finnite
element analysis of reesidual stress in butt weldiing
www.bo
orjournals.co an Research Journals 14
om Blue Ocea
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
www.borjournals.com Blue Ocean Research Journals 15
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
Fig.1: CM
MOS Dynamiic inverter
T-Spice1
v( cloc k)
1 .2
1 .1
1 .0
0 .9
0 .8
V o lt a g e (V )
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
T-Spice1
1 .2 v( out )
1 .1
1 .0
0 .9
0 .8
V o lt a g e (V )
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
T-Spice1
1 .2 v( In)
1 .1
1 .0
0 .9
0 .8
V o lt a g e (V )
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
Figg.2: Waveform
m for CMOS dynamic
d inverrter
www.bo
orjournals.co
om Blue Ocea
an Research
h Journals 16
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
Fig
g.3: Domino loogic
Cell0
v( out )
1 .0
0 .5
Voltage (V)
0 .0
- 0. 5
- 1. 0
0 10 20 30 40 50 60 70 80
Time (ns)
Cell0
1 .2 v( In)
1 .1
1 .0
0 .9
0 .8
Voltage (V)
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
Cell0
1 .2 v( Ckl )
1 .1
1 .0
0 .9
0 .8
Voltage (V)
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
www.bo
orjournals.co
om Blue Ocea
an Research
h Journals 17
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
Removval Of Charrge Sharingg Problem hiigh output levvel unless therre is a strong ppull-down
paath between thhe output andd the ground. It can be
Using W
Weak PMOS S Logic obbserved that the weak PM MOS transistoor will be
One simmple solution to remove charge shariing tuurned on only when the preecharge node voltage is
problem is just to add
a a weak PMOS pull--up keept high. Otheerwise it will be turned offf as output
with a small W/L ratio) to
device(w t the dynam mic vooltage becomees high.
CMOS sstage output, which essenntially forcess a
Above w
we have implem mented an invverter with weeak annd falling edgges and theree is no chargge sharing
PMOS using
u tanner and
a generatedd its waveforrm. prroblem.
As we caan see the wav
veform is sharrp at both risiing
efg
v( clk)
1 .2
1 .1
1 .0
0 .9
0 .8
V o lt a g e (V )
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
efg
1 .10 v( out )
1 .05
1 .00
0 .95
V o lt a g e (V )
0 .90
0 .85
0 .80
0 .75
0 .70
0 .65
0 10 20 30 40 50 60 70 80
Time (ns)
efg
1 .2 v( ni )
1 .1
1 .0
0 .9
0 .8
V o lt a g e (V )
0 .7
0 .6
0 .5
0 .4
0 .3
0 .2
0 .1
0 .0
0 10 20 30 40 50 60 70 80
Time (ns)
F
Fig.6: Wavefo
orm for weakeer PMOS logic
www.bo
orjournals.co
om Blue Ocea
an Research
h Journals 18
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
www.borjournals.com Blue Ocean Research Journals 16
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
ABSTRACT
Present work deals the long-term climate change and their effect on continuous increasing in global surface
temperature. The climate change is a long-term change in the weather patterns over periods of time that may
range from decades to thousands of years. There are two well-known causes that effect the climate change. One
of them is variation of solar activities and other is human made activities. The external change may involve a
variation in the Sun’s output. Mechanisms proposed to explain the climate response on solar variations can be
associated with variations in total solar irradiance (TSI). Internal variations in the climatic system may be
caused by changes in the concentrations of atmospheric gases, mountain building, volcanic activity, and
changes in surface or atmospheric albedo. In the present work, we have analysed long-term variations of
various solar activities and human made activities and their impact on climate changes. Adverse impacts of
climate change and challenges in near future have also been discussed.
Keywords: Total solar irradiance (TSI), climate change and global surface temperature.
www.borjournals.com Blue Ocean Research Journals 20
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
2. Long-term total solar irradiance absolute value is described by Kopp and Lean [7]
(TSI) variations based on new calibration and diagnostic
The total solar irradiance (TSI) is integrated solar measurements by using TIM V.12 data on 19th
energy flux over the entire spectrum which arrives January 2012, and is updated annually. TSI are
at the top of the atmosphere at the mean Sun-Earth known to be linked to Earth climate and
distance. The TSI observations show variations temperature. The historical reconstruction of TSI
ranging from a few days up to the 11-year sunspot and their association with 11-year sunspot cycle
cycle and longer timescales [6]. TSI has been from 1700 onwards are shown in Fig 1. From the
monitored from 1978 by several satellites, e.g. plot, it is find that TSI variation trend follows with
Nimbus 7, Solar Maximum Mission (SMM), the sunspot number within a limit but centurial
NASA, Earth Radiation Budget Satellite (ERBS), variation trends of TSI have not shown clear
NOAA9, NOAA 10, Eureca and the UARS (Upper association. Linear variation of TSI for last 311
Atmospheric Research Satellite) etc. The historical years shows continuously increasing trend.
reconstruction of more recently accepted TSI
200 1361
100 1360
0 1359
1700
1710
1720
1730
1740
1750
1760
1770
1780
1790
1800
1810
1820
1830
1840
1850
1860
1870
1880
1890
1900
1910
1920
1930
1940
1950
1960
1970
1980
1990
2000
2010
Years
Fig. 1 Shows the long-term variation of TSI and yearly mean SSN, during 1700 onwards. [The data of TSI
were taken from SOURCE website (http://lasp.colorado.edu/sorce/index.htm)]
www.borjournals.com Blue Ocean Research Journals 21
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
Table 1: Represent increase of main greenhouse gases from pre-industrial level to current level.
S.No. Main Greenhouse Gases Pre-industrial Current level Increase since Radiative
level 1750 forcing
01 Co2 280 ppm 394.29 ppm 114.29 ppm 1.46
02 Methane 700 ppb 1745 ppb 1045 ppb 0.48
03 Nitrous oxide 270 ppb 314 ppb 44 ppb 0.15
04 Clorofluoro-carbons (CFC- 0 ppt 533 ppt 533 ppt 0.17
12)
Atmospheric Co2 is an important kind of surface. Without the greenhouse effect, the average
greenhouse gas which influences global surface global temperature of the Earth would be a cold -
temperature. Its concentration variation could 18° Celsius rather than the present 15° Celsius. The
indicate the distribution of human and natural world’s most current data available for the
activities in various regions. The amount of Co2 atmospheric Co2 is from measurements at the
that can be held in oceans is a function of Mauna Loa Observatory in Hawaii. Monthly mean
temperature. Co2 is released from the oceans when Co2 concentrations are determined from daily
global temperatures become warmer and diffuses averages for the number of Co2 molecules in every
into the ocean when temperatures are cooler. Initial one million molecules of dried air and without
changes in global temperature were triggered by considering the water vapor in air. Annual mean
changes in received solar radiation by the Earth Co2 concentrations are the arithmetic mean of the
through the Milankovitch cycles. The increase in monthly averages for the year. The estimated
Co2 then amplified the global warming by uncertainty in the Mauna Loa annual mean growth
enhancing the greenhouse effect. The long-term rate is 0.11 ppm/yr. The variation of Atmospheric
climate change represents a connection between the Co2 (in ppm) during 1958 onwards are plotted in
concentrations of Co2 in the atmosphere and means Fig 2. From the plot, it is find that that the rate of
global temperature. Certain atmospheric gases, like concentration of atmospheric Co2 are increasing
Co2, water vapor and methane, are able to alter the continuously during above mentioned periods.
energy balance of the Earth by being able to absorb These increases can reach more than 550 ppmv
long wave radiation emitted from the Earth’s before the end of the 21st century.
Atmospheric Co2
400
375
Parts per millian (ppm)
350
325
300
1958
1960
1962
1964
1966
1968
1970
1972
1974
1976
1978
1980
1982
1984
1986
1988
1990
1992
1994
1996
1998
2000
2002
2004
2006
2008
2010
2012
Years
www.borjournals.com Blue Ocean Research Journals 22
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
4. Long-term variation of global surface emerged lately. The increase in global surface
temperature temperature is extending the distribution of
Global warming is the rise in the average mosquitoes due to the increase in humidity levels
temperature of Earth’s atmosphere and oceans and their frequent growth in warmer atmosphere.
since the late 19th century and its projected Various diseases due to ebola, hanta and machupo
continuation. Since the early 20th century, Earth’s virus are expected due to warmer climates. The
mean surface temperature has increased by about effect of increase in global surface temperature will
0.8 °C (1.4 °F). The ranges of these estimates arise definitely be seen on some species in the water. A
from the use of models with differing sensitivity to survey was made in which the marine life reacted
greenhouse gas concentrations. The variation of significantly to the changes in water temperatures.
atmospheric Co2 and global surface temperature It is expected that many species will die off or
(GSTemp) during 1958 onwards are shown in Fig become extinct due to the increase in the
3. From the plot, it is observed that the Co2 and temperatures of the water, whereas various other
global surface temperature both are increasing species, which prefer warmer waters, will increase
continuously during above mentioned periods. A tremendously. The increase in global surface
rise in Earth’s temperatures may boost the temperature is expected to cause irreversible
occurrence and concentration of severe climate changes in the ecosystem and the behavior of
events, such as floods, famines, heat waves, animals. Based on the study on past climate shifts
tornados, and twisters. Other consequences may and computer simulations, many climate scientists
comprise of higher or lower agricultural outputs, say that lacking of big curbs in greenhouse gas
glacier melting, lesser summer stream flows, genus discharges, the 21st century might see temperatures
extinctions and rise in the ranges of disease vectors. rise of about 3 to 8º C, climate patterns piercingly
As an effect of increase in global surface shift, ice sheets contract and seas rise several feet.
temperature species like golden toad, harlequin The IPCC [8] suggests that if sea level rise could
frog of Costa Rica has already become extinct. convert as much as 33% of the world’s coastal
There are number of species that have a threat of wetlands to open water by 2080.
disappearing soon and various new diseases have
400 25
350 0
300 -25
1958
1960
1962
1964
1966
1968
1970
1972
1974
1976
1978
1980
1982
1984
1986
1988
1990
1992
1994
1996
1998
2000
2002
2004
2006
2008
2010
2012
Years
Fig. 3 Shows the variation of Atmospheric Co2 (in ppm) and global surface temperature (GSTemp) during
1958 onwards.
References [3] Steinhilber, F., Abreu, J. A., & Beer, J., Solar
[1] Muscheler, R., F. Joos, J. Beer, S.A. Muller, modulation during the Holocene, Astrophys.
M. Vonmoos and I. Snowball, Solar activity Space Sci. Trans., 4 (2008) 1–6.
during the last 1000 yr inferred from [4] Friis-Christensen, E. and K. Lassen, Science,
radionuclide records, Quat. Sci. Rev., 26 254 (1991) 698-700.
(2007) 82-97. [5] Lassen, K. and Friis-Christensen, E., J. Atmos.
[2] Usoskin, I.G., S.K. Solanki and M. Korte, Terr. Phys., 57 (1995) 835-845.
Astron. Astrophys., 413 (2004) 745-751.
www.borjournals.com Blue Ocean Research Journals 23
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
[6] Lockwood, M. and C. Fröhlich, Recent [8] IPCC: 2007, Climate Change 2007, The
oppositely-directed trends in solar climate Physical Science Basis. Contribution of
forcing and the global mean surface air Working Group I to the Fourth Assessment
temperature: II. Different reconstructions of Report of the Intergovernmental Panel on
the Total Solar Irradiance variation and Climate Change eds: Solomon, S., D. Qin, M.
dependence on response timescale, Proc. Roy. Manning, Z. Chen, M. Marquis, K.B. Averyt,
Soc., Lond. (2008). M. Tignor and H.L. Miller, Cambridge
[7] Kopp, G. and Lean, J.L., A New, Lower Value University Press, Cambridge, United Kingdom
of Total Solar Irradiance: Evidence and and New York, NY, USA, (2007) 663-745.
Climate Significance, Geophys. Res. Letters,
Vol. 38 (2011) L01706.
www.borjournals.com Blue Ocean Research Journals 24
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
Solar Pow
wered Generatoor Free Electricity
Amrit Paal Singh, Chaairperson. Jyotti Welfare Fouundation, Patiiala, Punjab, In
ndia
ABSTR
RACT
The givenn paper deals with design of Parabolic dish
d heat collector which inccreases the eff fficiency of sollar
heating ssystem.The optical efficiency
cy of parabolicc dishes is connsiderably higgher than that of through, LFR
L or
power tow wer systems because
b the miirror is alwayys pointed direectly at the sunn, whereas thee through, LFFR and
power tow wer have a reeduction in proojected area due
d to a frequeent low angle of incidence of o the solar raadiation.
Keywordds: Parabolic dish
d heat colleector (PDHC)), solar, Heat losses, Efficieency.
Introducction
In todayy's climate off growing eneergy needs and a Methodology
M
increasinng environmen ntal concern, alternatives to A solar ray fromfr sun whiich is time ddependent
the use oof non-renewaable and polluuting fossil fuels vaaries from 45degree to 90 degree. This solar ray
have to be investigatted. One such alternative is strrikes the refleector which inn turn reflectss it to the
solar eneergy. Enoughh amount off solar heart is RFPC (as show wn in fig). All
A the rays fromfr 0900
availablee, we can use this
t energy to heat water orr to hoours to1800 hours
h will strike the Parabbolic dish.
generate Electricity. Here
H what wee do we colleect Thhis ray will transfer
t throuugh glass into the CO2
solar heaat by parabolicc dish at a singgle point and we
w laazer. This willl increase heatt and send it to
t sterling
amplify hheat by CO2 lazer then we w have enouugh enngine head or o give start to the sterlinng engine
heat to ruun an Sterling
g Engine then we convert heeat w
which is couppled with dyynamo. Dynam mo starts
energy innto mechaniccal energy w with the help of geenerate Electriicity.
coupling with dynamo o we can gennerate electriccity W
Which can be directly
d use orr can store in battries.
b
from solaar energy.
Block Diiagram
www.bo
orjournals.co
om Blue Oceean Research
h Journals 25
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
arrea enclosed by
b the rim, which
w is propoortional to
a cylindeer a hemisphere
thhe amount ofo sunlight thhe reflector dish can
where and a conee Of inntercept.
course, is the apperture area of
o the dish, the
t
www.bo
orjournals.co
om Blue Oceean Research
h Journals 26
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
Fig:1
Figure (1) shows thee relevant vibbrational enerrgy laaser is limited
d by the disasssociation of thhe carbon
levels foor the electrronic groundd states of the t diioxide into oxyygen and carbbon monoxidee.
CO2 and N2 molecules. The N2 molecule,
m beiing 2.. The second type Of CO O2 laser is the axialflow
diatomic, has only onee vibrational mode;
m its lowest laaser. This is the
t most widdely used typee of CO2
two energgy levels (v= 0, v = 1) are indicated in thet laaser, in whichh the gas flowws along the axisa of the
figure. Energy levvels for CO C 2 are moore opptical cavity (Fig.2) Axxial flow alllows the
complicaated, since CO2 is a liinear triatom mic deepleted gas to be replaced byb new gas. Laaser beam
moleculee. In this case, there are thrree poowers of up to t 4 kW of continuous waave output
nondegennerate modess of vibration: Symmettric caan be achieveed. Laser beam ms with pure Gaussian
stretchingg, bending, annd asymmetricc stretching. inntensity profilees can be gennerated for pow wer levels
The rem maining energ gy between thhe intermediaate upp to about one o kW, whiile beams wiith power
states annd the groundd state is lost through kineetic abbove one kW generally havve a mixed moode output
energy trransfer, whicch generates heat instead of coontaining two or mom diffe ferent intensityy profiles.
light. Forr CO2 molecuules, the rate of
o energy releaase Siince the used gas is either exhausted im mmediately
through heat is muchh lower than energy releaase orr is reused aftfter removing any contaminnants, this
through light, so the t energy efficiency for f syystem requiress a constant supply of gas and a gas
producinng a laser beeam is high compared with w haandling system m. Axial floww lasers can be b further
other lasiing materials. In comparisoon, helium has a cllassified by th he speed of gas flow, nam mely low-
very higgh thermal diffusivity; theerefore, with its sppeed flow and d high-speed flow
f lasers. Low-speed
L
addition to the lasin ng gas mixtuure, the rate of floow lasers attaain power outtputs of aboutt 50 W to
energy reelease througgh heating is extremely hig gh. 700 W for each meter
m of cavitty length. To produce a
This com mbination of lasing
l interacttions makes the
t coompact packaage, the opticcal cavity is folded so
carbon dioxide laseer suitable for industrrial thhat longer disccharge lengthhs can be obtaained in a
applicatioons in terms ofo both the ennergy efficienncy smmaller assemb bly. The low flow speed causesc the
(up to 110%) and thee high outpuut beam poweers laaser to heat upp considerablyy, and the relattively low
achievable. coonductivity off the gas mixtture limits the bore size
The threee main typpes of gas flow f are sealled off the lasing tuube. Heating of the resonaator cavity
dischargee tube, axxialflow, andd traverse or caauses distortioons in the reesonator opticcs due to
crossfloww. The flow method
m determ
mines how fastf thhermal expannsion; these distortions affect a the
the post--stimulation carbon dioxiide gas can be beeam intensitty profile and beam stability.
removed from the optiical cavity so that
t new grouund H
However, withh external coooling for the resonator
state carrbon dioxide gas can be introduced for f annd optics, beaam outputs withw good adjjustability
excitationn and stimulattion. annd stability can
c be generated. Mgh-sppeed flow
1. The sealed
s dischaarge laser coontains a fix xed m
models typicallly have a gaas velocity off 60 nVs.
lasing gas
g mixture sealed in thhe laser caviity; Thhus, the carbon dioxide molecule
m only has time
thereforee, it does not require a gas supply or gas g foor one excitattion/stimulatioon cycle before exiting
handling system. How wever, becausee there is no gas
g thhe optical cavvity. Typical outputs
o are 6000 W per
flow, ouutput powers are limited to t about 50 W m
meter of caviity length, with
w total lasser beam
(since uused CO2 cannot c be discharged
d and
a ouutputs availaable up to 6 kW. Duee to the
replenishhed with new CO2), and thee lifetime of the t coonvective coo oling of the high-speed flow, the
www.bo
orjournals.co
om Blue Oceean Research
h Journals 27
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
thermal distortions in the resonaator optics are a prroduce intennsity profiless which arre nearly
minimizeed and larger bore
b diameterrs can be used
d to G
Gaussian in shaape.
Fig:2
www.bo
orjournals.co
om Blue Oceean Research
h Journals 28
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
System Design
D
REFER
RENCES [44] Patel, C. K. N. (19644). "Continuoous-Wave
[1] John n Danniel Laser Action on Vibrational-R Rotational
Kraus American physicist
p knowwn for his h Transitionss of CO2". Physical
contrributions to electrom
magnetics, raddio Review 1366 (5A): A1187–
astroonomy, and anntenna theory.. A1193. Bibbcode:1964PhhRv..136.11877P. doi:10
[2] Robeert Stirling , T. Finkelsteeinl; A.J. Orggan .1103/PhyssRev.136.A11187
(20001) [55] CO2-laser micromachhining and back-end
[3] Finkkelstein, T. Generalized
G T
Thermodynam mic processing for rapid production
p off PMMA-
Anallysis of Stirrling Enginess. Paper 1188B, based miccrofluidic systems". Retrrieved 21
Sociiety of Automotive Engineeers, 1960. October 20009.
www.bo
orjournals.co
om Blue Oceean Research
h Journals 29
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
ABSTRACT
We study the following problem: A data distributor has given sensitive data to a set of supposedly trusted agents
(third parties). Some of the data are leaked and found in an unauthorized place (e.g., on the web or somebody’s
laptop). The distributor must assess the likelihood that the leaked data came from one or more agents, as
opposed to having been dependently gathered by other means. We propose data allocation strategies (across the
agents) that improve the probability of identifying leakages. These methods do not rely on alterations of the
released data (e.g., watermarks). In some cases, we can also inject “realistic but fake” data records to further
improve our chances of detecting leakage and identifying the guilty party.
Keywords:Allocation strategies, data leakage, data privacy, fake records, leakage model.
www.borjournals.com Blue Ocean Research Journals 30
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
www.borjournals.com Blue Ocean Research Journals 31
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
data objeects the agents request in total, the moore It can be shown n that algorithhm s-max is opptimal for
recipients on average an object hass; and the moore thhe sum-objecctive and the t max-objeective in
objects arre shared amo ong different agents,
a the moore prroblems
difficult iit is to detect a guilty agentt. w
where M ≤ |T| and n < |T|. Itt is also optim
mal for the
m
maxobjective
Algorith hm 2. Alloccation for Sample Da ata iff |T| ≤ M ≤ 2 |T| or all ageents request data
d of the
Requestss (SF) saame size.
Step 1: IInitialize Min__overlap ← 11, the minimuum W
With sample data
d requestss, each agentt Ui may
out of tthe maximum m relative ovverlaps that the
t reeceive any T from a subsett out of differrent ones.
allocationns of differentt objects to H
Hence, a different allocations. In every
there are
Step 2: foor k {k | } do alllocation, the distributor canc permute T objects
Initialize max_rel_ov ← 0, the maxiimum annd keep thee same channces of guillty agent
relative ooverlap between and any set that the deetection. The reason is thaat the guilt probability
p
allocationn of to deepends only on o which ageents have recceived the
Step 3: foor all j = 1,..., n : j = i and do leeaked objects and not on the identity of the t leaked
Calculatee absolute oveerlap as obbjects. Therrefore, from m the disstributor’s
abs_ov ← | ∩ | + 1 peerspective th here are diffferent allocattions. An
Calculatee relative overrlap as obbject allocatioon that satisfiees requests annd ignores
rel_ov ← abs_ov / minn ( , ) thhe distributor’s objective iss to give each agent a
Step 4: FFind maximum m relative as unnique subset ofo T of size m.m The s-max algorithm
max_rel__ov ← MAX (max_rel_ov,
( rel_ov) alllocates to an agent the data record that yields the
If max_reel_ov ≤ min_o overlap then m
minimum incrrease of th he maximum m relative
min_overrlap ← max_rrel_ov ovverlap amongg any pair of o agents. Thhe s-max
ret_k ← k allgorithm is as follows.
Return reet_k
www.bo
orjournals.co
om Blue Ocean
n Research Jo
ournals 32
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
www.borjournals.com Blue Ocean Research Journals 33
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
[3] P. Buneman, S. Khanna, and W.C. Tan, “Why SIGMOD, pp. 98-109, 2003. [18] L. Sweeney,
and Where: A Characterization of Data “Achieving K-Anonymity Privacy Protection
Provenance,” Proc. Eighth Int’l Conf. Database Using Generalization and Suppression,”
Theory (ICDT ’01), J.V. den Bussche and V. http://en.scientificcommons. org/43196131, 2002
Vianu, eds., pp. 316-330, Jan. 2001.
[4] P. Buneman and W.-C. Tan, “Provenance in
Databases,” Proc. ACM SIGMOD, pp. 1171-1173,
2007.
[5] Y. Cui and J. Widom, “Lineage Tracing for
General Data Warehouse Transformations,” The
VLDB J., vol. 12, pp. 41-58, 2003.
[6] S. Czerwinski, R. Fromm, and T. Hodes,
“Digital Music Distribution and Audio
Watermarking,” http://www.scientificcommons.
org/43025658, 2007.
[7] F. Guo, J. Wang, Z. Zhang, X. Ye, and D. Li,
“An Improved Algorithm to Watermark Numeric
Relational Data,” Information Security
Applications, pp. 138-149, Springer, 2006.
[8] F. Hartung and B. Girod, “Watermarking of
Uncompressed and Compressed Video,” Signal
Processing, vol. 66, no. 3, pp. 283-301, 1998.
[9] S. Jajodia, P. Samarati, M.L. Sapino, and V.S.
Subrahmanian, “Flexible Support for Multiple
Access Control Policies,” ACM Trans. Database
Systems, vol. 26, no. 2, pp. 214-260, 2001.
[10] Y. Li, V. Swarup, and S. Jajodia,
“Fingerprinting Relational Databases: Schemes and
Specialties,” IEEE Trans. Dependable and Secure
Computing, vol. 2, no. 1, pp. 34-45, Jan.-Mar.
2005.
[11] B. Mungamuru and H. Garcia-Molina,
“Privacy, Preservation and Performance: The 3 P’s
of Distributed Data Management,” technical report,
Stanford Univ., 2008.
[12] V.N. Murty, “Counting the Integer Solutions
of a Linear Equation with Unit Coefficients,” Math.
Magazine, vol. 54, no. 2, pp. 79-81, 1981.
[13] S.U. Nabar, B. Marthi, K. Kenthapadi, N.
Mishra, and R. Motwani, “Towards Robustness in
Query Auditing,” Proc. 32nd Int’l Conf. Very
Large Data Bases (VLDB ’06), VLDB
Endowment, pp. 151-162, 2006.
www.borjournals.com Blue Ocean Research Journals 34
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
ABSTRACT
Biotransformation of Acid Yellow 25 was carried out using Marinobacter gudaonensis AY-13(Accession No.
HE970768) isolated from natural marine environment. The decolorization of the azo dye Acid Yellow 25 in
nutrient broth and half strength nutrient broth having 8.0% salt concentration was up to 92.00% and 90.03%
respectively in 24 hours. The decolorization of the dye by cell-free extract was found to be upto 80.13 % in 24
hours. The decolorization of the dye was also studied in presence of different co-substrates viz. 1% glucose, 1%
yeast extract and 1% starch and found that percent decolorization was up to 92.77%, 94.00% and 92.05%
respectively. From these results it can be concluded that, the isolate could decolorize the dye very effectively.
The percent COD reduction of the dye by the isolate was 70.00%. The degradation products formed were
analyzed by GC-MS technique and it was found that culture degraded Acid Yellow 25 to the products having
molecular weights 98, 70, 112, 125, 140, 168, 186, 128, 141, 83, 111, 154, 72 and 155. The microbial toxicity
study revealed that degradation products of Acid Yellow 25 were non-toxic to ecologically important
microorganisms like Pseudomonas sp., Rhizobium sp. and Azotobacter sp.
Keywords – Acid Yellow 25, Biodegradation, COD Reduction, GC-MS analysis, Marine Bacteria
www.borjournals.com Blue Ocean Research Journals 35
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
textile azo dye Acid Yellow 25 by Marinobacter marine water and compost were collected as the
gudaonensis AY-13. source of microorganisms; these soil samples were
kept in a container and refrigerated till use.
II. Materials and Methods – Textile Dye – Acid Yellow-25 (λmax-392nm).
Materials Analytical Grade dye purchased from Sigma-
Soil samples from salterns (Saltpan), areas nearby Aldrich (USA).
waste disposal sites of the textile industry, sewage,
sludge from effluent treatment plants (ETP),
Table 1: Properties of the dye
Dye Name - Acid Yellow 25. (CI No. 18835) λmax 392nm
Structure
O
NH S OH
O N N
N
H3C N
SO3Na
Properties
Molecular Formula = C22H24N5NaO6S2
Formula Weight = 541.575629
Composition = C(48.79%) H(4.47%) N(12.93%) Na(4.24%) O(17.73%) S(11.84%)
www.borjournals.com Blue Ocean Research Journals 36
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
Ultrasonicator (Sonic-Vibra Cell System – 130) the supernatant containing the crude enzyme was then
output was kept 50amp with 6 strokes of 25 s each, added with 1500µg/ml concentration of dye
time interval kept was 2min at 40C. This solution and observed for dye decolorization. The
homogenate was centrifuged at 10,000 rpm for 10 percent decolorization studies were monitored by
min so as to separate the cell debris from the using spectrophotometer.
intracellular enzymes. The supernatant was used as The percent decolorization of the dye by the isolate
a crude intracellular enzyme source. The was determined by following formula,
A0 - At
Decolorization (%) = -------------------------- X 100
A0
Where,
A0 = Absorbance of the blank (dye solution).
At = Absorbance of the treated dyes solution.
c. Percent COD reduction Studies PCR amplification of 16S rDNA from all the
Percent COD reduction value of the dye strains was performed using 16S rDNA specific
decolorized in nutrient broth by isolate AY-13 was universal oligonucleotide primers 16F27N (5’-
calculated by COD analysis using K2Cr2O7 as a AGA GTT TGA TCM TGG CTC AG-3’) and
strong oxidizing agent under reflux conditions. 16R1488 (5’-CGG TTA CCT TGT TAC GAC
d. GCMS Analysis TTC ACC-3’) hybridizing respectively at positions
Degradation of the dye Acid Yellow 25 by the 8–27 and 1488–1511 relative to E. coli 16S rDNA
isolate AY-13 was confirmed by GC-MS analysis. numbering (Grifoni et al., 1995). The PCR
The samples for GCMS were prepared by reactions were carried out in PE 9700 thermal
extracting the degraded products in Di-Chloro cycler (Perkin Elmer, USA). The amplification
Methane (DCM). The decolorized broth was conditions were: an initial denaturation at 94°C for
centrifuged at 10,000 rpm for 20 min. The two minutes, followed by 35 cycles of denaturation
supernatant was taken in a separating funnel and at 94°C for one minute, annealing at 55°C for one
equal amount of DCM was added to and allowed to minute and extension at 72°C for one minute and
separate solvent and aqueous phase. The funnel final extension at 72°C for 10 minutes13. PCR was
was shaken vigorously for 20 min to extract the carried out in 25 µl reaction mixture consisted of
products in DCM. The products that are extracted 10 x Taq polymerase buffer Bangalore Genei,
in the solvent phase were concentrated in the vial Bangalore, India), 2mM dNTPs, 10pM primers, 1
by evaporation of the solvent at room temperature. unit Taq polymerase (Bangalore Genei, Bangalore,
This was then analyzed by Gas chromatography India), and 10ng DNA. The PCR amplification
and Mass spectroscopy (GC-MS). The GC-MS products were checked on 1% (wt/vol) agarose
analysis of metabolites was carried out using a gels. The PCR product was purified by PEG-NaCl
Shimadzu 2010 MS Engine, equipped with precipitation14. Briefly, the PCR product was mixed
integrated gas chromatograph with HP1 column with 0.6 volumes of PEG-NaCl solution (20% PEG
(60 m long, 0.25 mm id, non-polar). Helium was 6000, 2.5 M NaCl) and incubated for 10 min at
used as carrier gas at a flow rate of 1 ml min−1. The 370C. The precipitate was collected by
injector temperature was maintained at 2800C with centrifugation at 12,000 rpm for 10 min. The pellet
oven conditions as: 800C kept constant for 2 min was washed twice with 70% ethanol and dried
and increased up to 2000C with 100C min-1 raised under vacuum, which was then resuspended in
up to 2800C with 200C min−1 rate. glass distilled water at a concentration of >0.1
e. Identification of the isolate PCR pmol/ ml. Purified products were sequenced on
Amplification and sequencing of 16S rRNA gene both strands on an AB 3730 DNA analyzer using
– the Big Dye terminator kit (Applied Biosystems,
The 16S rRNA was determined in National Center Inc. Foster City, CA). Internal primers used were
for Cell Sciences, University of Pune Campus, 16S-704F- 5’GTAGCGGTGAAATGCGTAGA3’;
Pune. Genomic DNA isolation of isolate was 16S-907R-5’ CCGTCAATTCMTTTGAGTTT3’;
carried using Qiagen DNA isolation kit as per 16S-355F-5’ GGCGGACGGGTGAGTAAT3. The
manufacturer’s instruction. Its presence was sequence was deposited to European
checked by running in agarose gel (0.8%) stained Bioinformatics Institute (EBI).
with ethidium bromide. Sequence was analyzed at the Ribosomal Database
Project (RDP-II) (http://rdp.cme.msu.edu/) for
www.borjournals.com Blue Ocean Research Journals 37
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
closed homology. The sequences downloaded from lengths in the same units as those of the
the RDP II database were aligned by using evolutionary distances used to infer the
CLUSTAL X2 multiple sequence alignment tools. phylogenetic tree. The evolutionary distances were
The Phylogenetic tree was constructed by the computed using the Maximum Composite
neighbor joining method using Kimura-2- Likelihood method (Tamura et al., 2004) and were
parameter distances in MEGA 4.0 (Tamura et al., in the units of the number of base substitutions per
2007). site. Phylogenetic analyses were conducted in
f. Phylogenetic analysis and sequence MEGA4 (Tamura et al., 2004).
alignment
Initially the 16S rRNA gene sequence was III. Results
analyzed at NCBI server a. Screening and Identification of the
(http://www.ncbi.nlm.nih.gov) using BLAST isolate –
(blastn) tool and corresponding sequences of One isolate was selected and designated as AY-13
homologous species were downloaded and used for showing the zone of decolorization on nutrient agar
phylogenetic analysis. The evolutionary history containing 8.0% NaCl and 1500µg/ml dye. The
was inferred using neighbor joining method (Saitou isolate was gram negative, highly motile rod.
and Nei, 1987). The percentage of replicate trees in Colonies on nutrient agar containing 8.0% NaCl
which the associated taxa clustered together in the and dye were transparent and circular in shape. On
bootstrap test (1,000 replicates) was shown next to the basis of biochemical tests and 16S rRNA
the branches (Felsenstein, 1985).The phylogenetic analysis, the isolate was identified as Marinobacter
tree was linearized assuming equal evolutionary gudaonensis AY-13. The sequence was deposited in
rates in all lineages. The clock calibration to EBI with accession no. HE970768. Phylogenetic
convert distance to time was 0.01 (time/node tree was constructed using MEGA 4.0. (Figure I).
height). The tree was drawn to scale, with branch
0.005
Figure 1 Phylogenic tree of Marinobacter joining analyses of 1,000 replicates. The scale bar
gudaonensis AY-13. Phylogenetic analysis of 16s (0.005) indicates the genetic distance.
rRNA gene sequence of Marinobacter gudaonensis b. Decolorization studies –
AY-13. The percent numbers at the nodes indicate
the levels of bootstrap support based on neighbor-
www.borjournals.com Blue Ocean Research Journals 38
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
The decolorization capacity of a microorganism the dye in half (½) strength nutrient broth was
can be tested by examining its potential to degrade slightly less.
various dyes20. ii. Percent Decolorization in Cell Free
i. Decolorization studies in Nutrient Extract
Broth, Half (½) Strength Nutrient Broth Microbes can acclimatize themselves to toxic
The decolorization was conducted with the Acid wastes and new resistant strains develop naturally,
Yellow 25, supplemented with nutrient broth which can transform various toxic chemicals to less
having 8.0% NaCl and dye at 37oC. So as depicted harmful forms. The action of cell free extract of the
in Table 2, Marinobacter gudaonensis AY-13 Marinobacter gudaonensis AY-13 to decolorize the
showed the decolorization of the dye Acid Yellow dye Acid Yellow 25 was observed in nutrient
25 to a greater extent. Also the decolorization of medium containing 8.0% NaCl (Table 2).
Table 2 – Percent Decolorization in Nutrient Broth, Half (½) Strength Nutrient Broth, Cell Free Extract
by Marinobacter gudaonensis AY-13 in 24 hrs at 392nm λ max.
Culture COD
Code % Decolorization in Reduction
% Decolorization in
% Decolorization in Half Strength
cell-free extract
Nutrient Broth Nutrient Broth
70
92.00 90.03 80.13
AY-13
Percent Decolorization in presence of different 24 hours and observed for decolorization of the
Co-substrates- dye. Additionally, nutrient medium containing 1%
The isolate was inoculated in 20ml nutrient broth Starch and 1% Yeast extract with the same dye and
(Peptone – 1.0g, NaCl – 0.5g, Beef Extract – 0.3g, NaCl concentration were also used to test the
Distilled Water – 100ml,) containing 8.0% NaCl ability of the isolate AY-13 to decolorize the dye
concentration, 1500μg/ml concentration of dye and Acid Yellow-25.
1% Glucose. Tube was then incubated at 37oC for
Table 3 – Percent Decolorization in presence of Co-substrates viz. 1%Glucose, 1%Yeast Extract and 1%
Starch by Marinobacter gudaonensis AY-13 in 24 hrs at 392nm λ max.
Culture Code % Decolorization in
1% Glucose 1% Yeast Extract 1% strach
AY-13 92.77 94.00 92.05
Percent COD reduction The GCMS analysis report showed that the dye
To evaluate the level of biodegradation of Acid Acid Yellow 25 was degraded by Marinobacter
Yellow 25 by Marinobacter gudaonensis AY-13, gudaonensis AY-13 and not decolorized (Figure
we have determined the percentage of II). The molecular weights of the degraded
mineralization (represented by COD removal) by products are 98, 70, 112, 125, 140, 168, 186, 128,
measuring the initial and final organic content. 141, 83, 111, 154, 72 and 155 respectively. The
70% of COD was removed which is significant probable degradation pathway is depicted in
removal of COD was observed after a period of 24 Figure III which helps for the confirmation of the
hours. degradation of the dye Acid Yellow 25.
Confirmation of Biodegradation of dye
Figure II : GC-MS analysis report of the dye Acid Yellow 25 by Marinobacter gudaonensis AY-13
www.borjournals.com Blue Ocean Research Journals 39
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
www.bo
orjournals.co
om Blue Oceean Research
h Journals 40
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
www.bo
orjournals.co
om Blue Oceean Research
h Journals 41
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
O
OH
NH S N N
O N
H 3C N
SO 3 Na
Acid Yellow 25
Molecular Formula = C22H24N5NaO6S2
Formula Weight = 541.575629
OH
O H 2N
NH S NH 2 N
H 3C N
O SO 3 Na
4-am ino-N-phenylcyclohexanesulfonam ide
sodium
Mol. wt.- 254
4-(4-am ino-5-hydroxy-3-m ethyl-1H-pyrazol-
1-yl)benzenesulfonate
Mol. wt.- 291
O
+
NH 2 S NH 2 OH
H 2N
O
aniline Mol. wt.- 162 NH
Mol. wt.- 93 H 3C SO 3 Na
N
4-am ino-3-m ethyl-1 sodium benzenesulfonate
H-pyrazol-5-ol Mol. wt.- 167
Mol. wt.- 113
NH 2
CH 3 H 3C NH
CH 2 3-im inobut-1-en-2-am ine
CH 3
Mol. wt.- 84
CH 2 pentane
Mol. wt.- 72
buta-1,3-diene
Mol. wt.- 54 H 2N CH 2
CH 3 H 3C
but-1-en-2-am ine
Mol. wt.- 71
CH 3
butane
Mol. wt.- 58 H 2N CH 2
H 3C
prop-1-en-2-am ine
Mol. wt.- 57
www.borjournals.com Blue Ocean Research Journals 42
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
www.borjournals.com Blue Ocean Research Journals 43
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
development of local bacterial consortia with [13] I.M. Banat, P. Nigam, D. Singh, R. Marchant,
azo dyes decolourising capability,” Malaysian “Microbial decolorization of textile dye-
Journal of Microbiology, Vol. 5, pp. 25-32, containing effluents: a review,” Bioresour
2009. Technol., Vol. 58, pp. 217-227, 1996.
[2] A. Tripathi, S.K. Shrivastava, “Ecofriendly [14] J. Sambrook, E.F. Fritsch, T. Maniatis,
treatment of azo dyes – Biodecolorization “Molecular cloning: a laboratory manual, 2nd
using bacterial strains,” International Journal edn. Cold Spring Harbor Laboratory,” Cold
of Bioscience, Biochemistry and Spring Harbor, NY. 1989.
Bioinformatics., Vol.1, no.1, pp. 37 – 40, 2011. [15] K. Tamura, J. Dudley, M. Nei, S. Kumar,
[3] F. P. Van der Zee, S. Villaverde, “Combined “MEGA4: Molecular evolutionary genetics
anaerobic-aerobic treatment of azo dyes—A analysis (MEGA) software version 4.0,” Mol
short review of bioreactor studies,” Water Biol Evol, Vol. 24, pp. 1596–1599, 2007.
Research, Vol. 39, pp. 1425–1440, 2005. [16] N. Saitou, M. Nei, “The neighbor-joining
[4] P. Kaushik, A. Malik, “Fungal dye method: a new method for reconstructing
decolourization: Recent advances and future phylogenetic trees,” Mol Biol Evol, Vol. 4, pp.
potential,” Environment International, Vol. 35, 406–425, 1987.
pp. 127–141, 2009. [17] J. Felsenstein, “Confidence limits on
[5] E. Forgacs, T. Cserhati, G. Oros, “Removal phylogenies: an approach using the bootstrap,”
Of Synthetic Dyes From Wastewaters: A Evolution, Vol. 39, pp. 783–791, 1985.
Review,” Environ Int, Vol. 30, pp. 953-71, [18] K. Tamura, M. Nei, S. Kumar, “Prospects for
2004. inferring very large phylogenies by using the
[6] Mohandass Ramya, Bhaskar Anusha, S. neighbor-joining method,” Proc Natl Acad Sci
Kalavathy, S. Devilaksmi, “Biodecolorization USA, Vol. 101, pp. 11030–11035, 2004.
and biodegradation of Reactive Blue by [19] K. Tamura, J. Dudley, M. Nei, S. Kumar,
Aspergillus sp.,” African Journal of “MEGA4: Molecular evolutionary genetics
Biotechnology, Vol. 6, pp. 1441-1445, 2007. analysis (MEGA) software version 4.0,” Mol
[7] E. Forgacs, T. Cserhati, G. Oros, “Removal Of Biol Evol, Vol. 24, pp.1596–1599, 2007.
Synthetic Dyes From Wastewaters: A [20] R.C. Senan, T.E. Abraham, “Bioremediation of
Review,” Environ Int, Vol. 30, pp. 953-71, textile azo dyes by aerobic bacterial
2004. consortium,” Biodegradation, Vol. 15, pp.
[8] K. Jirasripongpun, R. Nasanit, J. Niruntasook, 275–280, 2004.
B. Chotikasatian, “Decolourization and [21] Pandu krishna and Compala Prabhakar.,
degradation of C. I. Reactive Red 195 by “Bioremediation of textile dyes and
Enterobacter sp. Thammasat,” International improvement of plant growth by marine
Journal of Science and Technology, Vol.12, bacteria,” Thesis submitted to University of
pp. 6–11, 2007. Boras. 2013
[9] U. Shedbalkar, R. Dhanve, J. Jadhav, [22] J. Guo, J. Zhou, D. Wang, J. Yang, “The new
“Biodegradation of Triphenylmethane Dye incorporation bio-treatment technology of
Cotton Blue By Penicillium Ochrochloron bromoamine acid and azo dyes wastewaters
MTCC 517,”Journal Of Hazardous Materials, under high-salt conditions,” Biodegradation,
Vol. 157, pp. 472–479, 2008. Vol. 19 no.1, pp. 93–98, 2008.
[10] K.P. Gopinath, H. A. M. Sahib, K. [23] S. Asad, M.A. Amoozegar, A.A. Pourbabaee,
Muthukumar, M. Velan, “Improved M.N. Sarbolouki, S.M.M. Dastgheib,
biodegradation of Congo red by Bacillus sp.,” “Decolorization of textile azo dyes by newly
Bioresource Technology, Vol. 100, pp. 670– isolated halophilic and halotolerant bacteria,”
675, 2009. Bioresource Technology, Vol. 98, pp. 2082-
[11] G. Mcmullan, C. Meehan, A. Conneely, N. 2088, 2007.
Kirby, T. Robinson, P. Nigam, I.M. Banat, R. [24] A. Khalid, M. Arshad, D.E. Crowley,
Marchant, W.F. Smyth, 2001 “Microbial “Accelerated decolorization of structurally
Decolourization And Degradation Of Textile different azo dyes by newly isolated bacterial
Dyes,” Appl Microbiol Biotechnol, Vol. 56, strains,” Applied Microbiology and
pp. 81–87, 2001. Biotechnology, Vol. 78, pp. 361-369, 2008.
[12] S. Y. An, S. K. Min, I. H. Cha, Y. L. Choi, Y. [25] J. Axelsson, U. Nilsson, E. Terrazas, T.
S. Cho, C. H. Kim, “Decolourization of Alvarez Aliaga, U. Welander, “Decolorization
triphenylmethane and azo dyes by Citrobacter of the textile dyes Reactive Red 2 and Reactive
sp.,” Biotechnology Letters, Vol. 24, pp. 1037– Blue 4 using Bjerkandera sp. Strain BOL 13 in
1040, 2002. a continuous rotating biological contactor
www.borjournals.com Blue Ocean Research Journals 44
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
www.borjournals.com Blue Ocean Research Journals 45
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319-5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
ABSTRACT
Consequent to the disappearance of Japan, USSR and Korea from the silk production scenario, the onus of
international grade raw silk production in massive scale and absorption of global demand lies on China and
India, which have emerged as leaders in the recent past. Indian sericulture is mostly is multivoltine oriented and
concentrated in the southern part, with conspicuous contribution from Karnataka state. Karnataka that enjoys
salubrious climatic conditions, is all set for accepting the challenge, but requires the active intervention of all
the stake holders for gearing up the production of international grade bivoltine raw silk in appreciable
quantities. This should begin from encouraging the existing grainages and enable them to produce the
proportionate quantities of both multivoltine and bivoltine disease free layings required y the industry. This
paper discusses the techno-economic feasibility of such facility for Karnatka state.
(Key words: Mixed Grainage, Techno-Economics, Multivoltine, Bivoltine, Commercial Seed)
B.Returns
Total 44.84
C. Profit/loss 4.15
Total 41.19
B.Returns
Total 44.84
C. Profit/loss 3.65
A.Expenditure
- - -
Total 37.55
B.Returns
Total 44.84
C. Profit/loss 4.49
C
Comparrative Sttudy off EMC Greenp
G plum an
nd Oracle
E
Exadata
a
Ektaa Rajput, Studennt ,Computer SScience , RKG
GITW, Ghaziabbad
Harshitaa Yadav, Stud
dent ,Computeer Science , RK
KGITW, Ghazziabad
Ayushi S
Singh, Student ,Computer Science
S , RKG
GITW, Ghaziabbad
ABSTR
RACT
Our papeer deals with the
t comparatiive study of tw wo databases namely
n EMC Greenplum
G annd Oracle Dattabase
.Greenpllum is a massiively parallel processing
p daatabase serverr that is designned to supportt the next geneeration of
data warrehousing andd large-scale analytics
a proceessing. Oraclee is the first database
d desiggned for enterpprise grid
computinng, the most flexible and cosst effective waay to manage information and a applications.Our paper focuses
on the eff
fficiency, compplexity and cappacity of bothh the databasees. It is believeed that this pap
aper is giving the
insight off pros and conns in both dataabases .
Keywordds: EMC; MPP P; database
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls
50
Journaal of Engineerring, Computeers & Applied
d Sciences (JEC
C&AS) ISSN No: 23
319‐5606
Volum
me 2, No.4, Ap pril 2013
_________________ ________________________ ___________________________________ _____________
Petabyte-Scaale Loading
High-performmance loadingg uses MPP Scatter/Gather
S r
Streaming teechnology. Loading speedds scale with h
each additionnal node to grreater than 100 terabytes perr
hour, per rack
k.
Anywhere Data
D Access
www.bo
orjournals.co
om Blue O
Ocean Resea
arch Journalls 51
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
Anywhere data access enables queries to be executed deduplication process to Greenplum Database
from the database against external data sources, servers, and enables them to send only unique data to
returning data in parallel regardless of location, the Data Domain system. This dramatically increases
format, or storage medium. aggregate throughput, reduces the amount of data
transferred over the network, and eliminates the need
In-Database Compression
for NFS mount management[5].
In-database compression uses industry-leading
compression technology to increase performance and Interoperatibility
dramatically reduce the space required to store data.
Indexes – B-Tree, Bitmap, and More
Multi-level Partitioning Greenplum Database supports a range of index types,
Flexible partitioning of tables is based on date, range, including B-Tree and Bitmap.
or value. Partitioning is specified using DDL and Client Access and Third-Party Tools
enables an arbitrary number of levels. The query Greenplum supports standard database
optimizer will automatically prune unneeded interfaces(PostgreSQL,SQL,ODBC,JDBC,OLEDB,
partitions from the query plan. etc.) and is fully supported and certified by a wide
Dynamic Partioning Elimination and Query range of business intelligence (BI) and
Memory Optimization extract/transform/load (ETL) tools
Greenplum Database supports dynamic partition Comprehensive SQL
elimination and query memory optimization. Greenplum Database offers comprehensive SQL-92
Dynamic Partition Elimination desregards irrelevant and SQL-99 support with SQL 2003 OLAP
partions in a table and allows for significant extensions and full support, including window
reduction in the amount of data scanned and results in functions, rollup, cube, and a wide range of other
faster query execution times. The query memory expressive functionality. All queries are parallelized
optimization feature intelligently frees and reallocates and executed across the entire system.
memory to different operators during query XML Support
processing, allowing for better memory utilzation, Greenplum Database provides support for XML, it
higher throughput, and higher concurrency. enables high-performance, support for XML data
type, parallel load of XMLdocuments into the
3.2 EMC Greenplum Features database and the XML Path language (xpath)
High Availability,Backup and Disaster
Recovery
Self-Healing Fault tolerance:
Traditional MPP fault tolerance techniques were
suitable for environment havin less than 100 servers.
Greenplum’s fault-tolerance capabilities provide
intelligent fault detection and fast online differential
recovery, it lowers TCO and enabling cloud-scale
systems with the highest levels of availability.
Post-Recovery Online Segment Rebalancing
After segment recovery, the EMC Greenplum
Database segments can be rebalanced while the
system is online. There is no downtime and all client
sessions remain connected . The database remain
functional while the system is recovered back into an
optimal state.
Simpler, Scalable Backup with Data Domain
Boost
Greenplum Databse includes integration with EMC
Data Domain deduplication storage systems via
EMCDataDomain Boost for faster, more efficient
backup. This integration distributes parts of the
www.borjournals.com Blue Ocean Research Journals 52
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
4. Comparison
Table 1. Comparison Table
Data Loading Fastest data loading, virtual private cloud Comparatively slower
infrastructer for datawarehouse & analytics.
Total Servers 18 22
Data Sharing Parallel Storage, if one storage fails then only Shared Storage, if one storage fails
the defected part suffers. entire system suffers.
Total Cores 192 264
External Database No ability to connect to external database. It can connect to external database.
www.borjournals.com Blue Ocean Research Journals 53
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
[3]http://www.greenplum.com/sites/default/files/201 m/sites/default/files/2012_0614_GPDB_DS.pdf&ei=
2_0614_GPDB_DS.pdf ocxbUam0AsnTrQegk4H4BQ&usg=AFQjCNElmp-
uyHtlz6VKAIpyNQBfD_90Iw&bvm=bv.44697112,d
[4]www.google.co.in/url?sa=t&rct=j&q=greenplum+
.bmk
database+architecture&source=web&cd=4&cad=rja
[5]http://www.greenplum.com/sites/default/files/201
&ved=0CEEQFjAD&url=http://www.greenplum.co
2_0614_GPDB_DS.pdf
www.borjournals.com Blue Ocean Research Journals 54
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
ABSTRACT
Mobile communication is continuously one of the hottest areas that are developing at a booming speed, with
advanced techniques emerging in all the fields of mobile and wireless communications. This paper deals with
the comparative study of wireless cellular technologies namely First Generation, Second Generation, Third
Generation, and Fourth Generation. A cellular network or mobile network is a radio network distributed over
land areas called cells, each served by at least one fixed-location transceiver, known as a cell site or base
station. In a cellular network, each cell uses a different set of frequencies from neighbouring cells, to avoid
interference and provide guaranteed bandwidth within each cell. The First Generation were referred to as
cellular, which was later shortened to "cell", Cell phone signals were based on analog system transmissions,
and First Generation devices were comparatively less heavy and expensive. Second Generation phones deploy
GSM technology. Global System for Mobile communications or GSM uses digital modulation to improve voice
quality but the network offers limited data service. The Third Generation revolution allowed mobile telephone
customers to use audio, graphics and video applications. Fourth Generation is short for fourth-generation cell
phones or/and hand held devices.
Keywords— Cellular network, First Generation, Second Generation, Third Generation, and Fourth Generation
www.borjournals.com Blue Ocean Research Journals 55
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
provide radio coverage over a wide w geographhic fixxed transceivers and teleph hones anywhere in the
area. This
T enables a large number of neetwork, via base
b stations, even if som
me of the
portablettransceivers (ee.g., mobile phones, pageers, traansceivers aree moving thro
ough more thaan one cell
etc.) to communicatee with each other and with w duuring transmisssion.
FIGU
URE I: EVOL
LUTION OF MOBLIE
M CEL
LLULAR N
NETWORKS[
[7]
www.bo
orjournals.co an Research Journals 56
om Blue Ocea
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
data serrvice. As dem mand drove uptake of cell c As the requireement for sen
A nding data onn the air-
phones, 2G carrierrs continuedd to improove innterface increaased, new eleements such as SGSN
transmisssion quality an nd coverage. The 2G carrieers (SServing GPRS S) and GGSN (Gateway GP PRS) were
also beggan to offer additional
a seervices, such as addded to the exxisting GSM system.
s Thesee elements
paging, ffaxes, text messages
m and voicemail. TheT m
made it possibble to send packet
p data onn the air-
limited data
d servicess under 2G included WA AP, innterface. This part of the network hanndling the
HSCSD and a MLS.An intermediary
i p
phase, 2.5G was
w a called thee 'packet core network'.
paacket data is also
introduceed in the latte 1990s. It uses the GPR RS Inn addition too the SGSN and GGSN N, it also
standardd, which dellivers packett-switched daata coontains the IPP routers, fireewall servers and DNS
capabilitties to existin ng GSM netw works. It allows (ddomain namee servers). This T enables wireless
users to send graphiccs-rich data as a packets. The
T acccess to the Internet
I and thhe bit rate reeaching to
importannce for packett-switching inccreased with the t 1550 kbps in opttimum conditiions.
rise of the Internet andd the Internet Protocol,
P or IP.
I
In the miid-1980s the European
E com
mmission startted G
GSM and ED DGE (Enhaanced Data rates for
a seriees of actiivities to liberalise the t gllobal evolution):
communiications seector, incluuding mobbile W
With both voice and data traffic movinng on the
communiications. Thiss resulted in the creation of syystem, the neeed was felt too increase the data rate.
ETSI, which
w inheritted all the standardisatiion Thhis was done by using morre sophisticateed coding
activitiess in Europe. This
T saw the birth
b of the fiirst m
methods over the
t Internet anda thus increeasing the
specificaations, and thhe network bbased on digiital daata rate up to 384 kbpps. EDGE/EGPRS is
technologgy; it was caalled the Gloobal System for f immplemented as a bolt-on
b enhhancement
Mobile C Communicatioon or GSM. Since the fiirst foor 2.5G GSM//GPRS netwoorks, making it easier
networkss appeared at the beginningg of 1991, GS SM foor existing GS
SM carriers to upgrade to it.. EDGE is
has graduually evolved d to meet the requirements of a superset to GPRS and can functionn on any
data trafffic and manny more serrvices than the t neetwork with GPRS
G deployyed on it, proovided the
original nnetworks. caarrier implemments the neceessary upgradde. EDGE
GSM (Global System for Mobbile caan carry a banndwidth up to o 236 kbit/s (with
( end-
Commun nication): too-end latency of
o less than 1550 ms) for 4 timeslot in
The maiin elements of o this system m are the BSS paacket mode. This
T means it can handle ffour times
(Base Sttation Subsysttem), in whicch there are the t ass much traffic as standard GPRS.
G
BTS (Baase Tran receiiver Station) and BSC (Baase
Station Controllers); and the NSS N (Netwo ork
Switchinng Subsystem)), in which thhere is the MS SC
(Mobile Switching Ceentre); VLR (V Visitor Locatiion
Register)); HLR (Hom me Location Register); AC A
(Authenttication Centtre), and EIIR (Equipmeent
Identity Register) Thhis network is capable of
providingg all the basicc services such as speech and a
data servvices up to 9.6 kbps, fax, etc. This GS SM
network also has an a extension to the fix xed
telephonyy networks.
GSM an nd VAS (Valu ue Added Servvices):
The nextt advancementt in the GSM system was the t
addition of two plaatforms, calleed Voice Mail M
System (VMS) and the Short Message M Serviice F
FIGURE III: 2G
2 TECHNOL
LOGY
Centre (SMSC). Th he SMSC proved to be
incredibly commerciaally successfuul, so much so GSM technolog
G gy is a combbination of Frequency
F
that in soome networks the SMS trafffic constitutes a D
Division Multtiple Access (FDMA) and a Time
major paart of the total traffic. Alongg with the VA AS, D
Division Multip
iple Access (T
TDMA). The first
f GSM
IN (Intellligent servicees) also made its mark in the t syystems used a 25MHz freqquency spectruum in the
GSM syystem, with its i advantagee of giving the t 9000MHz band d. FDMA is used to divide d the
operatorss the chance too create a whoole range of neew avvailable 25M
MHz of bandw width into 1224 carrier
services. Fraud manag gement and 'prre-paid' servicces frrequencies off 200 kHz each. Each freqquency is
are the reesult of the IN
N service. thhen divided using
u a TDM MA scheme into
i eight
GSM aand GPRS (General Packet Raddio timmeslots. Thee use of seeparate timeeslots for
Services)): trransmission and recep ption simplififies the
ellectronics in the mobile units. Todaay, GSM
www.bo
orjournals.co an Research Journals 57
om Blue Ocea
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
systems ooperate in thee 900MHz andd 1.8 GHz bannds exxisting GSM and TDMA networks. Woorking on
throughoout the worldd with the exxception of the
t thhe basis of em
mails, it sendss text and grapphics-rich
Americass where they operate
o in the 1.9 GHz band
d daata as pack kets at very fast speedd. EDGE
teechnology is a standard thaat has been sppecified to
2.3 Gen
neration orr 2G+ Wireeless ennhance the throughput
t p
per timeslot for both
Networrk H
HSCSD and GPRS. Althhough GPR RS is an
The virtuual explosion of Internet usage
u has hadd a exxtension to thhe radio access network, iit requires
tremendoous Impact on the demannd for advancced w
whole new paccket based IP data links, serrvers, and
wireless data communnication servicces. The mobbile gaateways in thhe core netwoork. Thus GP PRS adds
technologgy using geeneral packett radio serviice seeveral new components
c besides channging the
(GPRS) standard has been termedd as 2.5G. 2.5 5G exxisting GSM oro TDMA netw work
systems enhance the data capacityy of GSM and a
mitigate some of its limitations
l thhe effective daata
rate of 2G circuit-sw witched wirelless systems is
relativelyy slow -- too slow
s for todayy's Internet. As a
result, GSM, PDC andd other TDMA-based mobbile
system pproviders and carriers have developed 2G G+
technologgy that is paccket-based annd increases the t
data commmunication speeds to as high h as 384kbp ps.
These 2G G+ systems are based onn the followiing
technologgies: High Sp peed Circuit--Switched Da ata
(HSCSD D), General Packet Radio R Serviice
(GPRS) and Enhancced Data Raates for Glob bal
Evolutioon (EDGE) technologies.
FIGURE V: GPRS
G NETW
WORK [9]
Mobile Station:
S The MS
M includes radio
r equipmeent seeparate module called SIM M (Subscribeer Identity
and the Man Machiine Interface (MMI) thatt a M
Module)).
subscribee needs in order
o to acceess the servicces Base Transceiiver System (BTS): Thee physical
providedd by the GSM.. The MS is a combination of annd radio transm
mission interfface between ssubscriber
terminal equipmentt (called ME (Mobbile station and the BSC are prov vided by the BTS. The
Equipmeent)) and sub bscriber dataa (stored in a raadio equipmennt’s that are reequired to serrvice each
www.bo
orjournals.co an Research Journals 58
om Blue Ocea
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
cell in the network are components of the BTS. wireless networks and sell mobile services to end-
Cells are the logical divisions in the Radio users, usually on a monthly subscription basis.
transmission coverage. BTS controls each cell in a Mobile service providers use licensed spectrum to
network, and in turn, one BSC controls a group of provide wireless telephone coverage over some
BTSs. It takes care of Air interface signalling, Air relatively large contiguous geographic serving area.
interface ciphering and speech processing. Historically, this might have included a
Base Station Controller (BSC): The management metropolitan area. Today it may include the entire
of several Base Transceiver Stations (BTS) is done country. From a user’s perspective, the key feature
by the BSC. It also provides all the control of mobile service is that it offers (near) ubiquitous
functions and physical links among the different and continuous coverage that is, a consumer can
BTS and between the switching center (SC) and the carry on a telephone conversation while driving
BTS’s. Being a high-capacity switch, it provides along a highway at 100Km/hour. To support this
functions such as cell configuration data, and service, mobile operators maintain a network of
control of radio frequency power levels in BTS. interconnected and overlapping mobile base
One SC serves a number of BSCs stations that hand-off customers as those customers
Base Station Subsystem (BSS): BSS is the point move among adjacent cells. Each mobile base
where all radio transmission related functions are station may support users up to several kilometres
performed. The BSS is composed of the BSC and away. The cell towers are connected to each other
the BTS. by a backhaul network that also provides
Home Location Register (HLR): All the interconnection to the wire line Public Switched
administrative information related to each Telecommunications Network (PSTN) and other
subscriber registered in the respective services. The mobile system operator owns the
communication network, including the current end-to-end network from the base stations to the
location of the subscriber, is contained in the HLR backhaul network to the point of interconnection to
Visitor Location Register (VLR): The VLR is a the PSTN (and, perhaps, parts thereof). These can
database containing all the temporary information support data rates of from 384Kbps up to 2Mbps,
about the subscribers. This information is needed although most commercial deployments are
by the MSC to service the visiting subscribers. expected to offer data rates closer to 100Kbps in
Equipment Identity Register (EIR): The EIR is a practice. While this is substantially below the rates
database containing a list of all the valid mobile supported by the current generation of wire line
subscriber stations on the network. broadband access services such as DSL or cable
modems, it is expected that future upgrades to
2.3 Third Generation the3G or the transition to 4G mobile services will
The third generation mobile technology based on offer substantially higher bandwidths. Although
wide band wireless network fulfilling the wire line systems are likely to always exceed the
International Mobile Telecommunications-2000 capacity of wireless ones, it remains unclear
(IMT-2000) specifications by the International precisely how much bandwidth will be demanded
Telecommunication Union. As per the IMT-2000 by the typical consumer and whether 3G services
standards, a system is required to provide peak data will offer enough to meet the needs of most
rates of at least 200 Kbit/s. 3G functions in the consumers. Auctions for 3G spectrum licenses
range of 2100 Hz and bandwidth 15-20 MHz The occurred in a number of countries in 2000 and the
communication provides enhanced clarity and first commercial offerings of 3G services began in
perfection like the real conversation. Recent 3G Japan in October 2001. More recently, Verizon
releases provide mobile broadband access of Wireless has announced "3G" service in portions of
several M bit/s to smart phones and mobile its serving territory (though this is not true-3G
modems in laptop computers. The first release of service). 3G offers much narrower bandwidth but
(Third Generation Partnership Project) 3GPP Long over a wider calling area and with more support for
Term Evolution (LTE) standard completely fulfil rapid movement between base stations.
the (International Telecommunications Union) ITU The IMT-2000 framework sets the following goals
4G requirements called the IMT-Advanced. 4G or for the so called 3G wireless systems:
3.9G technology is the first release LTE. Its Global standards to allow for low cost and
evolution LTE Advanced is a 4G technology. worldwide roaming.
3G offers a vertically- integrated, top-down, High Quality of Service (QoS) especially for
service-provider approach to delivering wireless voice.
Internet access. 3G is a technology for mobile Support for advanced services: Multimedia,
service providers. Mobile services are provided by Bandwidth on Demand, High speed data.
service providers that own and operate their own
www.borjournals.com Blue Ocean Research Journals 59
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
Flexibiility for evoluution allowinng for backwaard Sigtran (SCTTP, M3UA): protocols suitte used to
compaatibility and too cope with anny future markket transfer SCN
N signaling prootocols over IP
P network
disconttinuity.
Multi-eenvironment capabilities.
c
Compaatibility of serrvices with fixxed networks.
In building/Private Systems
S Integration.
www.bo
orjournals.co an Research Journals 60
om Blue Ocea
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
smootherr and quickerr handoff, widder mobile areea, innterfaces, incllude e.g. vission, hearingg, speech,
more varrious service, lower
l cost, etcc. toouch sense, haands and fingeers, body, etc.
Terminal Diversity an nd Adaptabillity: The
teerminals’ exterrnal diversitiees are the diffeerences of
teerminals in botth static and mobile
m attribuutes. Static
atttributes incluude e.g. functtionality, weiight, size,
baattery life, hu uman interfacce, antenna, processing
p
caapability, seccurity, style, and cost.. Mobile
atttributes incllude dynamic attributes of both
teemporal and sp patial featuress.
Network Diversity
D annd Adaptabillity: The
exxternal diversity of networrks is obviouss. Internet
is assorted by nature,
n while wireless
w netwworks keep
thhe same propeerty. For instaance air interrfaces can
inntegrate all kinds
k of staandards and work on
diifferent frequeencies. Moreo over, multiple operators
deeploy networrks with muultiple standdards and
prrotocols. The internal diverrsity of networrks means
thhat one netw work can intterconnect with w other
diifferent netwoorks and trannsfer various kinds of
looads, e.g. celluular systems with
w various cooverage.
FIGURE E IX: 4G FRAM MEWORK NETWORK[3]
N ]
User Divversity: The ex xternal diverssity of users, i.e.
i 3. C
Comparison
n Between 1G, 2G, 3G AND
people inn different situuations, includes e.g. cultuure,
educationnal backgrouund, econom mic capabiliity,
4G
G
Here Table I. summarises
H s thhe comparisonn between
physical property, peersonal preferrence, etc. The T
1G
G, 2G, 3G andd 4G.
internal ddiversity of ussers, i.e. peoplle with differeent
www.bo
orjournals.co an Research Journals 61
om Blue Ocea
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
Conclu
usion
The last few years hav ve witnessed the phenomennal veersions of HT TML, Java, GIF,
G HTTP, and
a many
growth of wireless generations. There is evver more. New stan
m ndards will neeed to be deveeloped for
increasinng demands off the cellular networks whiich usse in 4G.
motivatedd the researchhers and indusstrialists to comme 5G technology has channged the meaans to use
up witth fourth generation (4G) mobbile ceell phones witthin very high bandwidth. User
U never
communiication and further more m with 5G 5 exxperienced ever
e before such a higgh value
technologgy.. As the t historyy of mobbile teechnology. No owadays mobbile users haave much
communiications show ws, many attem mpts have beeen awwareness of the
t cell phonee (mobile) technology.
made to reduce a nuumber of Tecchnologies too a Thhe 5G techno ologies includde all type of advanced
single gllobal standard d. The first generation
g (1G) feeatures whicch makes 5G 5 technology most
has fulfillled the basicc mobile voicce using anallog poowerful and in huge dem mand in near future.5G
techniquees, while the second geneeration (2G) has h A
Although updatted standards that define caapabilities
introduceed capacity and coveragee using digiital beeyond those defined
d in thee current 4G standards
techniquees. This is followed by the third generatiion arre under consiideration, those new capabbilities are
(3G), whhich has questt for data at higher
h speeds to still being grou
uped under thee current 4G standards.
s
open thee gates for truly “mobbile broadban nd” N mobile geenerations are typically assiigned new
New
experiencce, which will be further realized by the t frequency band ds and wider spectral banddwidth per
fourth generation (4G G). 4G will provide better- frequency chan nnel (1G up too 30 kHz, 2G up to 200
than-TV quality imaages and viideo-links. The T kH Hz, 3G up to 5 MHz, and 4G 4 up to 40 MHz),
M but
communiications modeel has new devveloped
www.bo
orjournals.co an Research Journals 62
om Blue Ocea
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
the main issue that there is little room for new Department of Informatics Engineering of the
frequency bands or larger channel bandwidths. University of Coimbra, Portugal 2004.
[6] Kamarularifin Abd Jalil, Mohd Hanafi Abd.
References Latif, Mohamad Noorman Masrek, “Looking Into
[1] F. Williams, Ericsson, “Fourth generation The 4G Features”, MASAUM Journal of Basic and
mobile,” in ACTS Mobile Summit99, Sorrento, Applied Sciences Vol.1, No. 2 September 2009.
Italy, June 1999. [7] Amit Kumar, Dr. Yunfei Liu ,Dr. Jyotsna
[2] H. Huomo, Nokia, “Fourth generation mobile,” Sengupta, Divya, “Evolution of Mobile Wireless
in ACTS Mobile Summit99, Sorrento, Italy, June Communication Networks 1G to 4G”, International
1999. Journal of Electronics & Communication
[3] Jun-Zhao Sun, Jaakko Sauvola, and Douglas Technology, IJECT Vol. 1, Issue 1, Dece- mber
Howie, “Features in Future: 4G Visions From a 2010.
Technical Perspective,”in IEEE, 2001. [8] Mobile Technology: Evolution from 1G to 4G,
[4] Mishra, Ajay K. “Fundamentals of Cellular Electronics for You, June 2003.
Network Planning and Optimization, [9] Third Generation (3G) Wireless White Paper,
2G/2.5G/3G…Evolution of 4G”, John Wiley and Trillium Digital Systems, Inc. March 2000.
Sons, 2004. [10] Nabeel ur Rehman, Asad Asif,Junaid Iqbal,
[5] Pereira, Vasco & Sousa, Tiago. “Evolution of “3G Mobile Communication Networks”,in Explore
Mobile Communications: from 1G to 4G”, Summer 2006.
www.borjournals.com Blue Ocean Research Journals 63
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
ABSTRACT
In modern era when populations increasing exponentially, chances of colliding to uneven situations are also
increasing. In such situation we have to take some decision and human intelligence is the key of finding out the
solutions and creating a socio technical environment to find out the solutions in easy steps. The motive of the
solution methods should observe, analyze and prevent such hazardous and critical occurrences. The proposed
work provides an android mobile application which provides help to a victim to recover from such critical
situation by getting frequent help on time.
Keywords: Voice Recognition, Patterns, Artificial Intelligence, Criticpal, Machine Learning, NLP.
www.borjournals.com Blue Ocean Research Journals 64
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
As we know that AI is a very vast field to be dealt. digitized voice input. These similarities will be
It consists of various other verticals and further present for a wide range of speakers, and so the
those verticals are also not limited to a specific system need not be trained by each new user. The
area. Given basic elements of Artificial types of speech differences that the speaker-
Intelligence has used here to create a gross view of independent method can deal with, but which
the application development. As Voice Recognition pattern matching would fail to handle, include
system is the key factor, which we are using in our accents, and varying speed of delivery, pitch,
proposed work, is an application of Pattern volume, and inflection. Speaker-independent
Recognition. speech recognition has proven to be very difficult,
with some of the greatest hurdles being the variety
2.1 Voice Recognition of accents and inflections used by speakers of
Voice recognition is the process of taking the different nationalities. Recognition accuracy for
spoken word as an input to a computer program. speaker-independent systems is somewhat less than
This process is important to virtual reality because for speaker-dependent systems, usually between 90
it provides a fairly natural and intuitive way of and 95 percent.
controlling the simulation while allowing the user's Voice Recognition alternatively called Speech
hands to remain free. Voice recognition is "the recognition. It implies various algorithms for its
technology by which sounds, words or phrases various applications. It is the basic need of our
spoken by humans are converted into electrical proposed work.
signals, and these signals are transformed into
coding patterns to which meaning has been 3.Proposed Work
assigned". While the concept could more generally The project aims at providing the help or
be called "sound recognition", we focus here on the immediate service to the people who unfortunately
human voice because we most often and most falls into the critical situations such as fatal
naturally use our voices to communicate our ideas accidents, sudden attack or theft. This application
to others in our immediate surroundings. The helps the people through their mobile phones by
difficulty in using voice as an input to a computer remaining in the running state in their phones.
simulation lies in the fundamental differences Whenever this application hears the cry of the user,
between human speech and the more traditional it rushly sends text messages of user’s current GPS
forms of computer input. While computer programs location to the already registered numbers and not
are commonly designed to produce a precise and only message, it also make calls on those numbers
well-defined response upon receiving the proper one by one. So that the happening fatal situation
(and equally precise) input, the human voice and can be cured or we can stop the things becoming
spoken words are anything but precise [3]. Each worst.
human voice is different, and identical words can It is an application based on android and voice
have different meanings if spoken with different recognition system which treats you in your bad
inflections or in different contexts. Several times. This bad time could be anything such as
approaches have been tried, with varying degrees accident, any attack while going on the road, theft,
of success, to overcome these difficulties. robbery etc. One has to just register it his mobile
phone. And it starts working from the minute user
2.1.1 Approaches to Voice Recognition installs it.
The most common approaches to voice recognition Currently there is no such system which can
can be divided into two classes: "template provide immediate help like this. Or we can say
matching" and "feature analysis". Template that the manual way is the existing system. Manual
matching is the simplest technique and has the way means calling police and relatives of the
highest accuracy when used properly, but it also victim, hours after the incident happened.
suffers from the most limitations.
A more general form of voice recognition is
available through feature analysis and this
technique usually leads to "speaker-independent"
voice recognition. Instead of trying to find an exact
or near-exact match between the actual voice input
and a previously stored voice template, this method
first processes the voice input using "Fourier
transforms" or "linear predictive coding (LPC)",
then attempts to find characteristic similarities
between the expected inputs and the actual
www.borjournals.com Blue Ocean Research Journals 65
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
www.bo
orjournals.co
om Blue Ocean Research JJournals 66
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
a coupled hidden Markov model", in Proc. [8] Lewis, T. W. and D. M. W. Powers., “Audio-
INTERSPEECH. (2002) Visual Speech Recognition using Red Exclusion
[4] Marschark M, LePoutre, D, and Bement L.; and Neural Networks,” Journal of Research and
“Mouth movement and signed communication,” In Practice In Information Technology, Vol. 35(1).
Campbell R., Dodd B, and Burnham D. (Eds.), (2003)
Hearing by Eye II. Hove, United Kingdom: [9] The NIST Speaker Recognition Evaluation
Psychology Press Ltd. Publishers, pp. 245–266. Plan:
(1998) http://www.nist.gov/speech/tests/spk/2006/sre06_e
[5] Lynn W, Francine C, Kimber D, and valplan-v9.pdf (2006)
Balasubmnianzan V. “Segmentation of speech [10] Poli G, Levada A, Mari J. And Saito J. H.
using speaker identification”, ICASSP-94,1161- “Voice Command Recognition with Dynamic Time
1164. (2003) Warping (DTW) using Graphics Processing Units
[6] Zhou P, An exploration of Voice-over-IP using (GPU) with Compute Unified Device Architecture
Ruby. In Proceedings of the Workshop on Optimal (CUDA)”, 19th International Symposium on
Epistemologies. (1964) Computer Architecture and High Performance
[7] Cawsey A, The Essence of Artificial Computing, 19-25. (2007)
Intelligence Prentice Hall ISBN: 0135717795
(1998)
www.borjournals.com Blue Ocean Research Journals 67
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
www.borjournals.com Blue Ocean Research Journals 68
Journal off Engineering,, Computers & 5606
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
www.bo
orjournals.co
om Blue Occean Researcch Journals 69
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
www.bo
orjournals.co
om Blue Occean Researcch Journals 70
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
www.borjournals.com Blue Ocean Research Journals 71
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
www.borjournals.com Blue Ocean Research Journals 72
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
Syntacttic rule-basedd relation exttraction system ms annd Side Efffect, becausee these are of most
are compplex systems based
b on addittional tools ussed immportance. Appplying task1 first followedd by task2
to assignn POS tags or o to extract syntactic parrse giives far bettter results thhan applying machine
trees. It iis known thatt in the biommedical literatuure leearning directtly to the conntent.This appproach is
such toolls are not yet at the state-off-the-art level as beetter becau use uninform mative data can be
they are for general English textss, and therefoore coonsidered as potential
p data if
i not filtered((task1).
their perrformance on sentences is not always the t
best(Bunnescu et al. [6]).
3 Prop
posed Apprroach
3.1 Tassk
The workk that we preesent in this paper
p is focussed
on two ttasks: automaatically identiifying sentencces
publishedd in medical abstracts (Medline) as
containinng or not infoformation aboout diseases and a
treatmentts, and autommatically identtifying semanntic Fig 1.Architecture Of th
he Proposed System
S
relations that existt between diseases and a
treatmentts, as expressed in these teexts. The secoond 3..2 Algorithms
A U
UsedAs classsification
task is foocused on thrree semantic R Relations: Cuure, allgorithms, wee use a set of six repreesentative
Prevent, and Side Effeect. m
models: decisiion-based mo odels (Decisioon trees),
The prroblems addressed in this paper form the t prrobabilistic models
m (Naı¨¨ve Bayes (NB) ( and
building blocks of a frramework thatt can be used by Complement Naı¨ve N Bayees (CNB), which w is
healthcarre providers (ee.g., private cllinics, hospitaals, addapted for text withh imbalanceed class
medical ddoctors, etc.), or laypeople who want to be diistribution), adaptive
a learnning (Ada- B Boost), a
in chargee of their heaalth by readinng the latest lifel linnear classifieer (support vector machinne (SVM)
science published
p articcles related too their interessts. w
with polynomial kernel), and a classsifier that
The finall product cann be envisioneed as a browsser allways predictss the majorityy class in thee training
plug-in or a desk ktop applicattion that will w daata (used as a baseline). We W decided to use these
automaticcally find annd extract thee latest mediccal cllassifiers becaause they are representativve for the
discoveriies related too disease-treaatment relatioons leearning algorithms in thee literature and a were
and preseent them to thet user. The product can be shhown to work k well on bothh short and loong texts.
developeed and sold by y companies thatt do researrch D
Decision trees are
a decision-b based models similar to
in Heallthcare Inforrmatics, Nattural Languaage thhe rule-based models that are a used in haandcrafted
Processinng, and Mach hine Learning,, and companies syystems, and are suitabble for shoort texts.
that develop tools liike Microsoftt Health Vauult. Prrobabilistic models,
m especially the ones based on
Consumeers are looking to buy or use u products thhat thhe Naı¨ve Bayyes theory, aree the state of the art in
satisfy ttheir needs and gain their t trust and
a teext classificatiion and in almmost any autom matic text
confidencce. Healthcarre products arre probably the t cllassification task.
t Adaptivve learning algorithms
a
most sennsitive to th he trust and confidence of arre the ones th hat focus on hard-to-learn
h concepts,
consumers. Compannies that want w to sell
s ussually undeerrepresented in the data, a
informatiion technolo ogy healthcaare frameworrks chharacteristic that
t appears in i our short texts and
need to bbuild tools thhat allow them m to extract and
a immbalanced daata sets. SV VM-based moodels are
mine auutomatically the wealth of publish hed accknowledged state-of-th
he-art classsification
research. The first task (task 1 or sentennce teechniques on text.
t All classsifiers are partt of a tool
selectionn) identifies sentences from Medliine caalled Weka[14 4].(Oana Frunnza et al. [1]).
publishedd abstracts thhat talk abouut diseases and a
treatmentts. The taskk is similar to a scan of 3..2.1 Bag-of-w words Repressentation
sentencess contained inn the abstract of an article in Thhe bag-of-w words (BOW W) representtation is
order to present to thee user-only seentences that are a coommonly usedd
identifiedd as contaiining relevannt informatiion foor text classifiication tasks. It
I is a represeentation in
(disease treatment infformation). The T second taask w
which features are chosen am mong the wordds that are
(task 2 or relation identification)
i ) has a deepper prresent in the training
t data. Because we deal with
semantic dimension an nd it is focuseed on identifyiing shhort texts wiith an averaage of 20 w words per
disease-trreatment relattions in the seentences alreaady seentence, the difference
d beetween a binary value
selected as
a being inforrmative (e.g., task
t 1 is appliied reepresentation and
a a frequency value repreesentation
first). We focus on thhree relations:: Cure, Preveent, is not large. Inn our case, we w chose a ffrequency
vaalue representtation. This haas the advantaage that if
www.bo
orjournals.co
om Blue Ocean Research JJournals 73
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
a feature appears more than once in a sentence, this macromeasure is not influenced by the majority
means that it is important and the frequency value class, as the micromeasure is. The macromeasure
representation will capture this—the feature’s value better focuses on the performance the classifier has
will be greater than that of other features. We keep on the minority classes. The formulas for the
only the words that appeared at least three times in evaluation measures are: Accuracy ¼ the total
the training collection, contain at least one number of correctly classified instances; Recall ¼
alphanumeric character, are not part of an English the ratio of correctly classified positive instances to
list of stop words[15] and are longer than three the total number of positives. This evaluation
characters. Words that have length of two or one measure is known to the medical research
character are not considered as features because of community as
two other reasons: possible incorrect tokenization sensitivity. Precision ¼ the ratio of correctly
and problems with very short acronyms in the classified positive instances to the total number of
medical domain that could be highly ambiguous classified as positive. F-measure ¼ the harmonic
(could be an acronym or an abbreviation of a mean between precision and recall(Oana Frunza et
common word). al. [1]).
www.borjournals.com Blue Ocean Research Journals 74
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
www.borjournals.com Blue Ocean Research Journals 75
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
A Review
R o Need
on d of BI in
i an Organizaation
Saloni B
Bansal, Studen
nt, Informationn Technology, RKGITW, Ghaziabad
G
Soumya Awasthi, Stuudent, Informaation Technoloogy, RKGITW
W, Ghaziabad
Charu GGupta, Lectureer, Informatioon Technology
y, RKGITW, Ghaziabad
G
ABSTR
RACT
Business intelligence is a broad part of techhnologies whiich includes collecting, sttoring, accesssing, and
analyzingg data to helpp business useers in making g better decisions and analyyzing business performancce through
data-drivven insight. Thhe ability to extract
e and prresent informaation in a meaaningful mannner is vital forr business
success. BBusiness intellligence helpss an organisattion to transfo
form data into actionable in nsight regardlless of the
location. This technoloogy understannds the past annd predicts thhe future. This paper providdes an overvieew of need
of busineess intelligencee in an organiisation.
Keyword ds: business intelligence,
i d
decision makinng, data mininng, future insiight, businesss performancee, decision
support ssystem
Introdu
uction deemands that business
b conttinue to imprrove their
Why bussiness intelliggence? It is essential for an abbility to makke decisions and
a anticipatee changes
organisattion to knoow its bussiness, markket, .B
Business intellligence tools help
h the organnisation in
customerrs, and com mpetition. Exxecutives neeed deelivering righht information
n to the right people at
summarizzed data whiich gives an overall view of thhe right time in
i order to maake smart andd effective
the comppany and its functionalityy if they are to deecisions. Com mpanies are moost likely to reach
r their
measure performance and respondd proactively to buusiness outcom mes when maany different users can
changes happening in the maarketplace and a acccess compllete, consisteent and truustworthy
organisattion. Manageers, teams, and a individuals innformation. AsA can be seenn by vendor offerings,
need thhe ability to o search, shhare, and use u i to move an organisation down the
thhe aspiration is
informatiion from acrooss all aspectss of the busineess paath of analytical maturity, from past innformation
to perforrm various taasks efficienttly and monittor too future insigh
ht.(Fig1)
business operations.[1] Increasinng complex xity
Businesss Users an
nd BI efffect on an orgganisation was considerablee. Though
Former generations of BI soluutions normaally most of the employees
m e in the organisaation had
targeted specific
s high-level roles in an organisatio
on, grrown expert ini using the basic
b tools avvailable, it
so only a less number of people hadd opportunityy to w
was not sufficient in meeting their iincreasing
use them m. As an alternative, they analyzzed innformation maanagement neeeds. They needed
n the
informatiion using usuual office prooductivity toools abbility to quickkly analyze their
t data to turn their
such as spreadsheets and desktop databases. The T innsight into acttions for imprrovement. Wee are now
www.bo
orjournals.co
om Bllue Ocean Reesearch Jourrnals 76
6
Journal off Engineering,, Computers &
& Applied Scieences (JEC&ASS) ISSSN No: 2319‐5
5606
Volume 2,, No.4, April 2
2013
________________________________________________________________________________________
in the deecade of smaart. The worlld is now moore orrganisation froom the execuutive group alll the way
instrumennted, organissed and inteellectual. Moore too the front linnes of the bussiness. More explicitly,
e
Data is available thann ever beforee- that to froom thhey need:
multiple sources. In this fast, interrelated
i and
a Analyttics they cann use to answer key
complex world, it is non longer adeqquate to makee a buusiness question present at a single placee with the
decision and perform m on the bassis of restrictted m meaningfu
most ful informationn.
informatiion, fixed tiime horizons, and strateggic Collecctive intelliggence gatherred from
planning cycles. Busin ness users neeed BI solutioons otther business users
u to agree, decide and act.
a
that are intended to offer agility-- the ability to Actionnable insight that anyonee can use
assess, reeinvent and addjust.[2] reegardless of time and locaation to respoond at the
pooint of impactt.(Fig2)
For the bbest business output, comppanies must set
free the intelligence found in alll parts of th
heir
www.bo
orjournals.co
om Bllue Ocean Reesearch Jourrnals 77
7
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
www.borjournals.com Blue Ocean Research Journals 78
Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606
Volume 2, No.4, April 2013
_________________________________________________________________________________
Conclusion
BI is not only a group of processes, practices, References
applications and technologies, but it is this group [1] R. Fitriana, Eriyatno, T. Djatna “Progress
that over time, is a path leading to destination. It in Business Intelligence System research: A
helps each individual within an organisation to literature Review,” International Journal of Basic
make day-to-day decisions through better analysis & Applied Sciences IJBAS-IJENS Vol: 11 No: 03.
of different areas of the business. BI helps in [2] White Paper: The Business Intelligence –
problem solving by giving answers to each and Why should I care? – October 2011
every question. It provides access to external data [3] Business intelligence requirements for IT:
which helps in satisfying each employee’s different What every IT manager should know about
analytical need. BI enables users to define new business users’ real needs for BI – January 2011
views and reports for better understanding and [4] Microsoft Dynamics GP Business
utilization of information. BI helps in automated Intelligence – April 2007
generation of reports and its distribution throughout
the organisation which reduces human efforts. Thus [5] Business intelligence for business users: Insight
BI ensures making the fast, informed decisions that when and where you need it – May 2010
fuels success and helps business in moving towards
a bright future.
www.borjournals.com Blue Ocean Research Journals 79