European Journal of Phycology

ISSN: 0967-0262 (Print) 1469-4433 (Online) Journal homepage: http://www.tandfonline.com/loi/tejp20

Unarmoured dinoflagellates with a small

hyposome: Torodinium and Lebouridinium gen.
nov. for Katodinium glaucum (Gymnodiniales,
Dinophyceae)

Fernando Gómez, Haruyoshi Takayama, David Moreira & Purificación López-

García

To cite this article: Fernando Gómez, Haruyoshi Takayama, David Moreira & Purificación
López-García (2016) Unarmoured dinoflagellates with a small hyposome: Torodinium and
Lebouridinium gen. nov. for Katodinium glaucum (Gymnodiniales, Dinophyceae), European
Journal of Phycology, 51:2, 226-241, DOI: 10.1080/09670262.2015.1126767

To link to this article: http://dx.doi.org/10.1080/09670262.2015.1126767

Published online: 04 Mar 2016.

Submit your article to this journal

Article views: 14

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at

http://www.tandfonline.com/action/journalInformation?journalCode=tejp20

Download by: [Fernando Gómez] Date: 05 April 2016, At: 13:26

 Eur. J. Phycol. (2016), 51: 226–241

Unarmoured dinoflagellates with a small hyposome:

Torodinium and Lebouridinium gen. nov. for Katodinium
glaucum (Gymnodiniales, Dinophyceae)

FERNANDO GÓMEZ1, HARUYOSHI TAKAYAMA2, DAVID MOREIRA3 AND PURIFICACIÓN

LÓPEZ-GARCÍA3
1
Laboratory of Plankton Systems, Oceanographic Institute, University of São Paulo, São Paulo 05508–900, Brazil
2
Hatami 5–20–13, Ondo-cho, Kure, Hiroshima 737–1207, Japan
3
Unité d’Ecologie, Systématique et Evolution, CNRS UMR 8079, Université Paris-Sud, 91405 Orsay Cedex, France

(Received 13 August 2015; revised 23 September 2015; accepted 12 October 2015)

We investigated the morphology and evolutionary relationships of Torodinium spp. and Katodinium glaucum, unar-
Downloaded by [Fernando Gómez] at 13:26 05 April 2016

moured dinoflagellates characterized by a small hyposome. An emended generic description of Torodinium was
proposed based on light and scanning electron microscopy. Torodinium exhibited a unique combination of morpholo-
gical features including a minute hyposome, a long episome with longitudinal ribs and a canal of unknown function on
the dextro-lateral side. Unlike any known dinoflagellate both cingulum and sulcus extended in the episome. The apex
surface showed ribs that converged in a bill-like projection. The shape of the apical groove was a circular spiral that
extended around the apex running in 2.5 turns in an anticlockwise direction. The type species T. teredo was usually
longer than T. robustum. The longitudinal outline of T. teredo was linear, with almost parallel margins, a circular
transversal section, a relatively large hyposome and a conspicuous bill-like projection. The longitudinal outline of
T. robustum was oblong, widened in the middle, with an ellipsoidal transversal section, a small hyposome and a less
prominent bill-like projection. Several morphological features of Katodinium glaucum (=Gyrodinium glaucum)
resembled Gyrodinium, such as the cingular displacement, longitudinal ribs, trichocysts, rod-shaped and refractile
bodies and a capsule that surrounded the spherical nucleus. Distinctive features of K. glaucum were the horseshoe-
shaped apical groove under a tongue-shaped notch pointed towards the dorsal side, and a bifurcated proximal end of the
cingulum. Phylogenetic analysis revealed that Torodinium spp. and K. glaucum formed two independent lineages with
no close relationships with other known dinoflagellates. The morphology of K. glaucum was distant from the type
species of Katodinium. We propose the new genus and combination Lebouridinium glaucum gen. nov., comb. nov. for
the species Katodinium glaucum.

Key words: acrobase, apical groove, athecate Dinoflagellata, Gymnodinium, Gyrodinium, molecular phylogeny, naked
dinoflagellate, new genus, taxonomy

INTRODUCTION Gymnodinium teredo C.H.G. Pouchet was

Two major groups of dinoflagellates can be distin-
guished based on morphological criteria: thecate or
armoured species with discernible thecal plates and
athecate, unarmoured or ‘naked’ species without
plates or with plates that are barely visible under the
light microscope. Unarmoured dinoflagellates,
especially gymnodinioid forms, tend to be delicate,
easily damaged by net sampling and often too dis-
torted by fixation to be identified. Live specimens can
be easily deformed when they are examined under the
microscope (Kofoid & Swezy, 1921).
Correspondence to: Fernando Gómez. (e-mail: fernando.
gomez@fitoplancton.com).
ISSN 0967-0262 (print)/ISSN 1469-4433 (online)/16/020226-241 © 2016 British Phycological Society
http://dx.doi.org/10.1080/09670262.2015.1126767
described as a fusiform unarmoured dinoflagellate
with a very large episome that occupied most of the
cell body, a posterior cingulum and a much reduced
hyposome (Pouchet, 1885). Schütt (1895) illustrated
G. teredo in more detail, including the cell shape
variability, particularly the length of the episome, as
later remarked by Lebour (1917). Kofoid & Swezy
(1921) used the marked torsion of the sulcus, amount-
ing to 0.5 turns, to support the erection of Torodinium
Kof. & Swezy as a genus independent from
Gymnodinium F. Stein. Kofoid & Swezy proposed
the type, Torodinium teredo (C.H.G. Pouchet) Kof.
& Swezy, and the new species Torodinium robustum
Kof. & Swezy based on their own observations and
some of the illustrations of G. teredo from Schütt
 Torodinium and Lebouridinium gen. nov.
(1895). Apparently Kofoid & Swezy (1921) did not
observe any specimens of T. teredo. However, they
considered that the apex of T. teredo lacked the apical
groove (which they called reversed terminal anterior
loop of the sulcus). This feature, together with the
relative ratio between the length and the transdia-
meter, with a stouter episome in T. robustum, was
used for species distinction.
The two Torodinium species have been commonly
reported in the literature and further authors agreed
with the diagnosis given by Kofoid & Swezy, with
no new taxonomic information (Elbrächter, 1979;
Dodge, 1982; Sournia, 1986; Hansen & Larsen,
1992; Steidinger & Tangen, 1997; Gárate-Lizárraga
& Muciño-Márquez, 2013). Gómez (2009) reported
that some specimens of Torodinium showed a body
extension that protrudes from the hyposome and
accumulation bodies (tentative food vacuoles).
These features supported the mixotrophic character
of Torodinium.
Downloaded by [Fernando Gómez] at 13:26 05 April 2016
Kofoid & Swezy (1921, p. 390) reported a link
between Torodinium and Spirodinium glaucum M.
Lebour. The latter species was further reported as
Gyrodinium glaucum (M. Lebour) Kof. & Swezy,
Massartia glauca (M. Lebour) J. Schiller and
Katodinium glaucum (M. Lebour) A.R. Loebl.
Katodinium glaucum is devoid of plastids, with a
postmedian cingulum, marked cingular displace-
ment, apex with a tongue-shaped notch, and the
cell surface is covered with longitudinal ribs
(Takayama, 1985, 1998). Daugbjerg et al. (2000)
placed K. glaucum again into the genus
Gyrodinium Kof. & Swezy. Kim & Kim (2007)
retained the name Katodinium glaucum because
they did not find a close relationship with
Gyrodinium or other dinoflagellates in their LSU
rDNA phylogenetic analysis. More than 40 species
have been described or transferred into the genus
Katodinium Fott. The type species, K. nieuportense
(W. Conrad) Loebl. & A.R. Loebl., only known
from the original description, is an unarmoured
dinoflagellate with two to four plate-like, yellowish
chloroplasts and numerous, minute oil droplets. Its
apex is rounded and the cell surface smooth
(Conrad, 1926). Further studies have revealed that
Katodinium was a polyphyletic group that even
included thecate species (Hansen, 1995; Murray
et al., 2007; Calado, 2011; Kang et al., 2015).
Reñé et al. (2015) provided new sequences of
Torodinium and K. glaucum. In their SSU rDNA
phylogeny, T. robustum and K. glaucum branched
together with very low support (Reñé et al., 2015).
In this study, we provide a detailed study of the
morphology of the two species of Torodinium and
Katodinium glaucum. We re-examined the molecu-
lar phylogeny of these taxa with new sequences of
Torodinium spp.
227
MATERIALS AND METHODS
Sampling and isolation of material
In the Mediterranean Sea, the specimens of Torodinium spp.
were collected from October 2007 to September 2008 by
slowly filtering surface seawater taken from the pier of the
Station Marine d’Endoume at Marseille (43°16′48.05″N, 5°
20′56.22″E, bottom depth 3 m). A strainer of 20 µm mesh
size was used to collect planktonic organisms from water
volumes ranging between 10 and 100 l, depending on particle
concentration. The plankton concentrate was scanned in set-
tling chambers at 100× magnification with an inverted micro-
scope (Nikon Eclipse TE200, Nikon Inc., Tokyo, Japan).
Cells were photographed alive at 200× or 400× magnification
with a Nikon Coolpix E995 digital camera. During the sam-
pling on 17–21 December 2007, the distinction between
species was not defined and we pooled a total of 20 speci-
mens of Torodinium spp. into a single sample for PCR ampli-
fication and cloning (isolated cells FG21–2, FG21–3, FG21–
4, GenBank accession numbers KR139781, KR139782,
KR139783). Sporadic samplings were carried out in the
Bay of Marseille at the SOMLIT (Service d’Observation en
Milieu LITtoral) site (43º14′52.8″N, 5º17′52.8″E). Samples
were collected with Niskin bottles at the surface and 55 m
depth and analysed following the procedure described above.
In this case, a single specimen (#FG187) was analysed by
single-cell PCR (GenBank accession number KR139784).
Further specimens were collected using the same method
from October 2008 to August 2009 in the surface waters
(depth of 2 m) of the port of Banyuls-sur-Mer, France
(42º28′50″N, 3º08′09″E). The concentrated sample was
examined in Utermöhl chambers with an inverted micro-
scope (Olympus IX51, Olympus Inc., Tokyo, Japan) and
photographed with an Olympus DP71 digital camera.
Sampling continued from September 2009 to February
2010 in the Bay of Villefranche-sur-Mer, Ligurian Sea. For
this location, sampling was performed at the long-term mon-
itoring site Point B (43º41′10″N, 7º19′00′′E, water column
depth ~80 m). Water column samples (0–80 m) were
obtained using a phytoplankton net (53 µm mesh size,
54 cm diameter, 280 cm length). Samples were prepared
according to the same procedure as described above and
specimens were observed with an inverted microscope
(Olympus IX51) and photographed with an Olympus DP71
digital camera. Sampling continued from May 2012 to
February 2013 in the port of Valencia, Spain (39°27′38.13″
N, 0°19′21.29″W, water column depth of 4 m). Specimens
were obtained using a phytoplankton net (20 µm mesh size).
Samples were prepared according to the same procedure as
described above and specimens were observed with an
inverted microscope (Nikon Eclipse T2000) and photo-
graphed with an Olympus DP71 digital camera.
In addition, samples were collected during the BOUM
(Biogeochemistry from the Oligotrophic to the Ultra-oligo-
trophic Mediterranean) cruise on board R/V L’Atalante from
the south of France to the south of Cyprus (20 June–18 July
2008). Seawater samples were collected with Niskin bottles
from 30 stations. At each station 6 depths were sampled
between 5 and 125 m, with an additional sample at 250 m
depth. These samples were preserved with acid Lugol’s solu-
tion and stored at 5ºC. Samples of 500 ml were concentrated
via sedimentation in glass cylinders. The top 450 ml of
 F. Gómez et al.
sample was slowly siphoned off with small-bore tubing over
6 days. The remaining 50 ml of concentrate, representing 500
ml whole water, was then settled in composite settling cham-
bers. The sample was examined in Utermöhl chambers at
100× magnification with a Nikon inverted microscope
(Nikon Eclipse TE200) and the specimens were photo-
graphed with a digital camera (Nikon Coolpix E995).
In the North Pacific Ocean, samples were collected with a
plankton net (30 µm mesh size) from the coastal Inland Sea of
Japan at Kure (34°10′30″N, 132°33′21.6″E). The living con-
centrated samples were observed at 400× and 1000× magni-
fication with an upright microscope (Olympus BH2), and
photographed with a digital camera (Canon EOS Kiss F.,
Canon Inc., Tokyo, Japan).
Scanning electron microscopy
Seawater samples were collected with a bucket from the
coastal areas of the Inland Sea of Japan along Hiroshima
Prefecture in 1980–1985 as described in Takayama (1998).
For scanning electron microscopy, dinoflagellate cells were
Downloaded by [Fernando Gómez] at 13:26 05 April 2016
pipetted individually, rinsed three times in filtered seawater
and placed on poly-lysine coated coverslips. They were fixed
in 2% osmium tetroxide in seawater for 20 min. After wash-
ing in distilled water for 30 min, cells were dehydrated in an
ethanol series, 10 min in each change of 30%, 50%, 70%,
90% and 95%, followed by two 30 min changes in absolute
ethanol, and finally transferred to amyl acetate. The cells
were critical-point dried using liquid carbon dioxide and
ion sputter-coated with gold. They were observed using a
scanning electron microscope (Hitachi S–430, Hitachi Ltd,
Tokyo, Japan) operated at 15 kV. The method is explained in
detail in Takayama (1998). Pictures were scanned and pre-
sented on a black background using Adobe Photoshop CS3
(Adobe Systems Inc., San José, California, USA).
PCR amplification of small subunit rRNA genes (SSU
rDNAs) and sequencing
For molecular analysis, each specimen was photographed and
then micropipetted individually with a fine capillary into a
clean chamber and washed several times in a series of drops
of 0.2 µm-filtered and sterilized seawater. Finally, the speci-
men was placed in a 0.2 ml tube (ABgene; Thermo Fisher
Scientific Inc., Courtaboeuf, France) filled with several drops
of absolute ethanol. The sample was kept at room temperature
and in darkness until the molecular analysis could be per-
formed. The specimens fixed in ethanol were centrifuged for
5 min at 504 × g. The ethanol was then evaporated in a vacuum
desiccator and single cells were resuspended directly in 25 µl
of Ex TaKaRa buffer (TaKaRa, distributed by Lonza,
Levallois-Perret, France). PCRs were done in a volume of
30–50 µl reaction mix containing 10–20 pmol of the eukar-
yotic-specific SSU rDNA primers EK-42F (5′–
CTCAARGAYTAAGCCATGCA–3′) and EK-1520R (5′–
CYGCAGGTTCACCTAC–3′) (López-García et al., 2001).
PCRs were performed under the following conditions: 2 min
denaturation at 94ºC; 10 cycles of ‘touch-down’ PCR (dena-
turation at 94ºC for 15 s; a 30 s annealing step at
decreasing temperature from 65 down to 55ºC, employing
a 1ºC decrease with each cycle, extension at 72ºC for 2
min); 20 additional cycles at 55ºC annealing temperature;
228
and a final elongation step of 7 min at 72ºC. A nested
PCR was then carried out using 2–5 µl of the first PCR
products in a GoTaq (Promega, Lyon, France) polymerase
reaction mix containing the eukaryotic-specific primers
EK-82F (5′–GAAACTGCGAATGGCTC–3′) and EK-
1498R (5′–CACCTACGGAAACCTTGTTA–3′) (López-
García et al., 2001) and similar PCR conditions as
described above. Negative controls without template
DNA were used at all amplification steps. Amplicons of
the expected size (~1700 base pairs) were then sequenced
bi-directionally using primers EK-82F and EK-1498R
using an automated 96-capillary ABI PRISM 3730xl
sequencer (BC Genomics, Takeley, UK). In other sam-
ples, the amplified product was subsequently cloned
using the Topo TA Cloning system (Invitrogen, Life
Technologies, Saint Aubin, France) following the instruc-
tions provided by the manufacturers. Three clones were
picked and the corresponding insert amplified using vec-
tor primers. Amplicons of the expected size were fully
sequenced (Cogenics, Meylan, France) with vector pri-
mers using the same automated sequencer.
Phylogenetic analyses
The new SSU rDNA sequences were aligned to a large multi-
ple sequence alignment containing ~1500 publicly available
complete or nearly complete (>1300 base pairs) dinoflagel-
late sequences using the profile alignment option of
MUSCLE 3.7 (Edgar, 2004). The resulting alignment was
manually inspected using the program ED of the MUST
package (Philippe, 1993). Ambiguously aligned regions and
gaps were excluded in phylogenetic analyses. Preliminary
phylogenetic trees with all sequences were constructed
using the Neighbour joining method (Saitou & Nei, 1987)
implemented in the MUST package (Philippe, 1993). These
trees allowed identification of the closest relatives of our
sequences together with a sample of other dinoflagellate
species, which were selected to carry out more computation-
ally intensive Bayesian inference analyses. These analyses
were done with the program MrBayes 3.2.3 (Ronquist et al.,
2012) applying a GTR + Γ4 model of nucleotide substitution,
taking into account a Γ-shaped distribution of substitution
rates with four rate categories. Four chains (three heated and
one cold) were run for 2 million generations with trees
sampled every 100 generations. The first 5000 trees were
discarded as burn-in and a majority-rule consensus tree was
constructed with the remaining trees. Our sequences were
deposited in DDBJ/EMBL/GenBank under accession num-
bers KR139781–KR139784.
RESULTS
Light microscopy of Torodinium spp.
The observations of Torodinium, with more or less
slender co-existing specimens, were sporadic in the
sampling areas. The separation of the two species of
Torodinium in the literature has traditionally been
based on morphometric parameters: T. teredo for lar-
ger slender specimens [length more than 3.5–4 depths
(=transdiameter sensu Kofoid & Swezy)] and T.
robustum for shorter and stouter specimens. We
 Torodinium and Lebouridinium gen. nov. 229

propose the separation of both species based on cell Emended generic description of Torodinium based on
length, with Torodinium teredo (55–100 µm long) scanning electron microscopy
usually longer than T. robustum (40–75 µm long),
The detailed morphology was examined from speci-
and outline of the cells. The outline of T. teredo was
mens of Torodinium spp. collected from the south of
linear, with almost parallel margins, while the outline
Japan (Figs 25–50). We first established the orienta-
of T. robustum was oblong, widened in the middle
tion of the cells, whose ventral side was defined by the
(Figs 1–24). The hyposome and the bill-like projec-
position of the sulcus and the pore of the longitudinal
tion, the latter further described in detail, were more
flagellum. The hyposome was small and conical. The
conspicuous in T. teredo than in T. robustum. From the
ventral side of the hyposome was concave and occu-
pier of the Marine Station of Endoume, some records
pied by the posterior end of the sulcus below the pore
corresponded to larger and more slender specimens in
of the longitudinal flagellum (Figs 25–28).
agreement with the definition of T. teredo (Figs 1–6).
The sulcus extended for almost the entire ventral
Other observations corresponded to shorter specimens
side of the hyposome, occupying about 1/3 of the
with an oblong shape in agreement with our definition
contour of the hyposome (Figs 28–29). The pore of
of T. robustum (Figs 7–11). One of the specimens of T.
the longitudinal flagellum was located in the sulcus
teredo showed an interesting morphological feature
between the transversal flagellar pore and the pos-
with a kind of edging of crenate margin (with rounded
terior end of the cingulum (Figs 25–30). The poster-
teeth) that extended longitudinally in the episome
ior end of the sulcus, directed posteriorly from the
(Fig. 1).
longitudinal flagellar pore, was placed in a wide
Numerous specimens were observed in Lugol-fixed
Downloaded by [Fernando Gómez] at 13:26 05 April 2016

concave area surrounded by the cingulum and the

samples collected from the open Mediterranean Sea,
hyposome in the left and right margins, respectively
from Cyprus to the Gulf of Lions in summer 2008.
(Figs 26–27). The texture of the sulcus surface was
Torodinium reached an abundance of up to 64 cells l−1.
rugose, similar to the surface of the rest of the cell.
Several of these fixed specimens showed posterior
Towards the episome and after the longitudinal
body extension in samples collected in the open
flagellar pore, the sulcus became thinner and
waters of the Sicily Strait, Algerian Basin and Gulf
extended anteriorly describing a loop of about 1/6
of Lions (Fig. 12).
of the cell contour towards the dextral side
One specimen was isolated from a sample collected
(Figs 26–32). Anteriorly, from the longitudinal fla-
off the Bay of Marseille at 55 m depth in July 2008
gellar pore, the anterior margin of the sulcus
(Fig. 13). This specimen, ascribed to T. robustum,
showed an overhanging tube-like structure that
showed a prominent vacuole and a stouter cell body
separated it from the anterior extension of the cin-
(Fig. 13). It was isolated for single-cell PCR analysis
gulum (Figs 26–28, 33). We named this structure
(isolated cell FG187, GenBank accession number
the sulcal lip. The sulcus extended along the epi-
KR139784).
some to end below the beginning of the apical
Other specimens were observed in live samples
groove (Fig. 34).
from Banyuls-sur-Mer (Figs 14–17). The presence of
The transversal and longitudinal flagellar pores
chlorophyll a was confirmed with epifluorescence
were separated by the sulcal lip (Fig. 26). The
microscopy (Fig. 16). The cell showed longitudinal
pore of the transversal flagellum delimited the two
chloroplasts along the antero-posterior axis in the dor-
sections of the cingulum. The transversal flagellum
sal side. The chloroplasts were oblique or transversal in
encircled the posterior section of the cingulum
the apex and the cingulum (Fig. 16). All the observed
above the hyposome and the posterior end of the
specimens of Torodinium showed slow swimming and
sulcus (Fig. 34). In contrast to the sulcus, the sur-
the length of the longitudinal flagellum was similar to
face of the posterior cingulum was smooth and
the cell length (Fig. 17; see video S1 as supplementary
lacked any ornamentation (Figs 28, 34). The ante-
information, https://youtu.be/Y7RPT-UdqeE). Few
rior section of the cingulum was thinner than the
specimens were observed from samples collected at
posterior one. The anterior cingulum continued par-
Villefranche-sur-Mer (Fig. 18). This was very likely
allel to the anterior (left) margin of the sulcus,
due to the inappropriate sampling using a coarse plank-
describing the same looping (Figs 28, 34). The
ton net (53 µm mesh size) (Fig. 18). Torodinium teredo
anterior extensions of the sulcus and cingulum
and T. robustum co-existed in the samples from the
were separated by the sulcal lip from the flagellar
port of Valencia, with more frequent observations of T.
pore to the convex basis of the episome. The ante-
robustum. Under light microscopy the episomes of T.
rior cingulum diverged from the sulcal lip and
robustum (Figs 19–23) and T. teredo (Fig. 24) were
shortly ended (Fig. 34).
covered by longitudinal ribs between the cingulum and
Based on these observations, we established that
the basis of the apex. Both species showed an apical
the cell of T. teredo showed a circular transversal
groove (named reversed terminal anterior loop of the
section, whereas T. robustum was laterally com-
sulcus sensu Kofoid & Swezy) that was hardly visible
pressed instead of dorsoventrally compressed as
in LM (Figs 23–24).
 F. Gómez et al. 230
Downloaded by [Fernando Gómez] at 13:26 05 April 2016

Figs 1–24. Light microscopy (LM) images of Torodinium teredo and T. robustum. Bright field optics, except Fig. 16 by epifluor-
escence microscopy. Figs 1–11. Specimens from Endoume, Marseille, France. Figs 1–6. T. teredo. Figs 7–11. T. robustum. Fig. 12.
(continued)
 Torodinium and Lebouridinium gen. nov.
previously reported (Fig. 28). The transdiameter sensu
Kofoid & Swezy corresponded to the cell depth (ven-
tral to dorsal distance). The episome occupied about 9/
10 of the cell length and ended in a hemispheric
bonnet-shaped apex (Figs 27, 35–50). The cell surface
of the episome was covered by well-marked longitu-
dinal ribs. There were 12–14 longitudinal ribs (~0.35
µm wide) that were equidistant and separated by 3–4
µm (Figs 35–50). In addition to the ribs, at least on the
dextro-lateral side, the episome surface was covered
in fine longitudinal striae (Fig. 36). In addition to the
anterior extensions of the sulcus and cingulum, the
episome showed a third groove. This deep groove
appeared in the middle of a concave area on the
dextro-lateral side (Figs 33, 35, 38, 41). This concave
area was not observed in live cells and it could not be
ruled out that the depression of the deep groove was
due to a sample preparation artefact. The anterior and
posterior ends of this groove were different (Figs 33,
35). The anterior one ended in a straight line between
Downloaded by [Fernando Gómez] at 13:26 05 April 2016
two longitudinal ribs that converged at their anterior
ends (Fig. 35). The posterior end of the groove was
located above the distal end of the anterior cingulum
and showed a short loop towards the left side
(Figs 28–33, 35). We were unable to find an analogous
structure in any other dinoflagellate. This straight deep
groove was named a ‘slender canal, anterior pusule’
by Kofoid & Swezy (1921, p. 391). Following this
terminology, we named this groove the lateral canal.
The hemispherical apex showed unique morpholo-
gical structures such as a spiral-shaped apical groove
and ribs that converged in a pointed projection
(Figs 37–50). The posterior end of the apical groove
began above the anterior end of the sulcus (Figs 39,
55, 58). The apical groove continued below the basis
of the pointed projection and took 2.5 turns describing
an anticlockwise spiral that ended in the dextro-lateral
side, pointing to the lateral canal in T. teredo (Figs 42–
45, 53).
The hemispherical apex showed a pointed projec-
tion oriented towards the sinistro-lateral or dorsal
sides in T. teredo and T. robustum, respectively
(Figs 27, 42–50, 53, 57). This structure was here
named ‘bill-like projection’. Six or seven ribs coming
from the basis of the apical groove converged from
each side into the bill-like projection (Figs 27, 42–50).
These transversal or oblique apical ribs were thinner
and they were not connected with the prominent long-
itudinal ribs on the episome. The most posterior apical
rib was placed above the apical groove (Figs 48–50,
Figs 1–24. Continued
Lugol-fixed specimen of T. robustum from the open Algerian Basin, western Mediterranean Sea (BOUM cruise, station #21). The
arrow points to the body extension. Fig. 13. T. robustum from the Gulf of Lions, isolated cell #FG187 (GenBank accession number
KR139784). Figs 14–16. T. teredo from Gulf of Lions. Note the chloroplasts in epifluorescence microscopy. Fig. 17. T. robustum
from Banyuls-sur-Mer. The arrow points to the longitudinal flagellum. Fig. 18. Torodinium sp. from the Bay of Villefranche-sur-Mer,
France. Figs 19–23. T. robustum from the port of Valencia, Spain. The arrows point to the longitudinal ribs. Fig. 24. T. teredo from the
port of Valencia. The arrow indicates the apical groove. ag = apical groove. bp = bill-like projection. lf = longitudinal flagellum. lr =
longitudinal rib. Scale bars: 10 µm.
231
53, 57). The first apical rib emerged in the dextro-
lateral side from the base of the apical groove. Each rib
emerged at each side of the basis of the apical groove
and converged between the sinistro-lateral and dorsal
sides. The last pair of apical ribs joined in a triangular
structure (Figs 48, 53, 57).
Differences between T. teredo and T. robustum
As reported above, under light microscopy T. ter-
edo was usually longer than T. robustum. The
longitudinal outline of T. teredo was linear, with
almost parallel margins, a circular transversal sec-
tion, a relatively large hyposome and a conspicu-
ous bill-like projection. The longitudinal outline of
T. robustum was oblong, widened in the middle,
with an ellipsoidal transversal section, a small
hyposome and a less prominent bill-like projec-
tion. Based on SEM, the transversal section was
circular (Figs 53–54) and ellipsoidal (Figs 57–58)
in T. teredo and T. robustum, respectively.
Torodinium teredo (Figs 27–29, 46–47, 51–52,
54) showed a larger hyposome than T. robustum
(Figs 28–34, 35, 38, 41, 55–56, 58). In T. teredo,
the proximal part of the anterior extension of the
sulcus and cingulum extended transversally
towards the dextral side and then described a
marked loop (Figs 52, 54). In contrast, in T. robus-
tum the proximal part of the anterior extension of
the sulcus and cingulum extended obliquely
towards the episome (Figs 55, 58). The anterior
extension of the sulcus and cingulum was more
displaced towards the dextral side in T. teredo than
in T. robustum (Figs 52, 54, 55, 58). Consequently,
the proximal part of the anterior extension of the
cingulum and sulcus were visible in ventral view
in T. robustum (Fig. 55) and in dorsal view in T.
teredo (Fig. 52). In the apex of T. teredo, the bill-
like projection was more conspicuous, overlying
the episome, and oriented between the ventral
and sinistro-lateral sides (Figs 45–50, 53). The
bill-like projection of T. robustum was more
reduced, and oriented between the sinistro-lateral
and dorsal sides (Figs 40–41, 57).
Morphology of Katodinium glaucum
Cells were spindle-shaped, tapering at both the apex
and the antapex, and about 35–40 µm long and
about 14–22 µm wide (Figs 59–63). The cells
 F. Gómez et al. 232
Downloaded by [Fernando Gómez] at 13:26 05 April 2016

Figs 25–34. Scanning electron microscopy (SEM) images focused on the hyposome of five specimens of Torodinium. Figs 25–27.
Three specimens of T. teredo. Figs 28–34. Two specimens of T. robustum. The micrographs 29–34 correspond to the same specimen
(also Figs 36–44). Fig. 25. Ventral view. Fig. 26. Ventro-antapical view. Fig. 27. Ventral view. Fig. 28. Antapical view. Fig. 29.
Ventro-antapical view. Figs 30–31. Ventral view. Fig. 32. Dorsal view. Fig. 33. Dextro-lateral view. Fig. 34. Ventral-dextro-lateral
view. ac = anterior cingulum. as = anterior sulcus. bp = bill-like projection. ci = cingulum. lc = lateral canal. lf = longitudinal
flagellum. lfp = longitudinal flagellar pore. sl = sulcal lip. su = sulcus. tf = transversal flagellum. tfp = transversal flagellum pore. Scale
bar: 5 µm.
 Torodinium and Lebouridinium gen. nov. 233
Downloaded by [Fernando Gómez] at 13:26 05 April 2016

Figs 35–50. SEM focused on the hyposome of five specimens of Torodinium. Figs 35–44. T. robustum. Micrographs 35–43
correspond to the same specimen (also Figs 29–34). Figs 44–50. T. teredo. Fig. 35. Dextro-lateral view. Fig. 36. The arrows point
to the longitudinal striae. Fig. 37. Apex. Fig. 38. Ventral view. Fig. 39. Apex. Figs 40–41. Dextro-lateral dorsal view. Figs 42–43.
Apex. Fig. 44. Another specimen of T. robustum in apical view. Fig. 45. T. teredo in apical-dorsal view. Figs 46–48. Another
specimen in dorsal view. Fig. 49. Another specimen in sinistro-lateral view. Fig. 50. Dorsal view. ag = apical groove. ar = apical rib. as
= anterior sulcus. bp = bill-like projection. lc = lateral canal. lr = longitudinal rib. sl = sulcal lip. su = sulcus. Scale bar: 5 µm.

under division reached 55–60 µm long (Figs 64–66).
The hyposome was about 1/4 of the cell length. The
descending cingulum was displaced by three to four
cingular widths (Figs 59–63). Cells lacked chloro-
plasts. Vacuoles and refractile bodies were observed
in the upper episome (Figs 59–62). Groups of tri-
chocysts and some rod-shaped bodies were situated
along the cell margin in the episome and the hypo-
some (Figs 60–61). The nucleus was spherical and
located in the posterior part of the episome at the
 F. Gómez et al. 234

51 52 53 55 56 57
lc
ag lc
bp

as

bp ac ag
sl ac
as
ac
sl as
su
as su
ci ci
ac lc
lc
54 58
ac lc
as
lc
Downloaded by [Fernando Gómez] at 13:26 05 April 2016

Figs 51–58. Line drawings of different views of Torodinium teredo (Figs 51–54) and T. robustum (Figs 55–58). Figs 51, 55. Ventral
view. Figs 52, 56. Dorsal view. Figs 53, 57. Apical view. Figs 54, 58. Antapical view. ac = anterior cingulum. ag = apical groove; as =
anterior sulcus. bp = bill-like projection. ci = cingulum. lc = lateral canal. sl = sulcal lip. su = sulcus.

middle of the cell (Figs 59–62). A capsule sur- Molecular phylogeny

rounded the nucleus (Figs 60, 62). The proximal
We obtained sequences of Torodinium from two
end of the cingulum was bifurcated, with a short
samples. One sample (#FG21) contained a mix of
anterior extension almost parallel to the cingulum
20 specimens of T. teredo and T. robustum, col-
(Fig. 63). The cell surface showed longitudinal ribs,
lected from a pier at Marseille over five days in
hard to see on the hyposome (Figs 63, 65). Under
December 2007 (Figs 1–11). PCR amplification
SEM, the proximal end of the cingulum was bifur-
and cloning provided three almost complete SSU
cated (Figs 71–72). The transverse flagellum
rDNA sequences (GenBank accession numbers
emerged from the posterior end of the bifurcation
KR139781, KR139782, KR139783). These
(Fig. 71). The anterior end of the bifurcation
sequences differed by 4–9 base pairs. The second
extended parallel to the cingulum. This structure
sample (#FG187) corresponded to a single speci-
could be interpreted as an anterior extension of the
men of T. robustum collected from offshore
cingulum. However, it could also be interpreted as a
Marseille at 55 m depth (Fig. 13). Sample
notch that invaded and dissected the proximal end of
#FG187 was analysed by single-cell PCR and pro-
the cingulum (Fig. 71). The apex showed a tongue-
vided an almost complete SSU rDNA sequence
shaped notch (Figs 69, 70–73). It was bordered by
(GenBank accession number KR139784). The
two longitudinal ribs, and contained five other long-
sequences of T. robustum and the clones of
itudinal ribs that converged towards a pointed end in
Torodinium spp. were 99% identical and differed
the dorsal side (Figs 67–69, 73). From the five long-
by 11 base pairs. The three clones of sample
itudinal ribs, the three central ones extended poster-
#FG21 have been assigned to T. teredo.
iorly along the episome (Figs 69, 73–77). This
We examined the phylogenetic position of
tongue-shaped notch extended over a horseshoe-
Torodinium spp. and Katodinium glaucum using a
shaped apical groove with the ends oriented towards
data set including a variety of dinoflagellate SSU
the ventral side (Figs 69, 73). The cell surface of the
rDNA sequences. The Bayesian tree showed that all
episome contained 24 equidistant longitudinal ribs
Torodinium spp. sequences branched in a well-sup-
(Figs 73, 77). Those longitudinal ribs ended at the
ported clade [posterior probability (PP) of 0.99]
basis of the apical groove, with the exception of
together with several environmental sequences
three ribs that extended towards the pointed end of
(Fig. 78). The new sequence of T. robustum was
the tongue-shaped notch (Figs 73–74). The texture
very similar to two sequences of T. robustum from
of the surface between the ribs was rugose, with two
the NW Mediterranean Sea available in GenBank
or three transversal granules between each two ribs
(KP790166–7) and an environmental clone
(Figs 73–74).
(KJ762990) retrieved from California off San
 Torodinium and Lebouridinium gen. nov. 235
Downloaded by [Fernando Gómez] at 13:26 05 April 2016

Figs 59–74. LM (Figs 59–65) and SEM (Figs 66–74) images of Katodinium glaucum from South Japan. Fig. 59. Specimen with a
large vacuole. Figs 60–61. Another specimen. Note the capsule of the nucleus, the rod-shaped bodies, refractile bodies and
trichocysts. Figs 62–63. Another specimen. Note the longitudinal ribs and the bifurcation of the proximal end of the cingulum,
named anterior cingular extension. Figs 64–66. Specimen undergoing binary division. Fig. 67. Ventral view. Fig. 68. Dextro-lateral
view. Fig. 69. Dorsal-apical view. Fig. 70. Ventral view. Figs 71–72. Sinistro-lateral and ventral view. The inset shows the proximal
end of the cingulum. Figs 73–74. Detail of the apex. ac = anterior extension of the cingulum. ag = apical groove. ci = cingulum. lf =
longitudinal flagellum. lr = longitudinal rib. n = nucleus. rb = refractile body. rsb = rod-shaped body. su = sulcus. tf = transversal
flagellum. tr = trichocyst. v = food vacuole. Scale bars: 10 µm.
 F. Gómez et al. 236

75 ag 76 Diego. The three clones assigned to T. teredo were

lr
closer to an environmental clone (KJ759393) retrieved
rsb
v
77 from the Gulf Stream and formed the sister group of the
sequences of T. robustum. Two environmental
sequences retrieved from the under-ice waters of the
North Pole (HQ438140, HQ438165) were basal to the
n
whole clade of Torodinium spp. All these sequences
formed a strongly supported clade (PP = 1) that was
tf sister group of an environmental clone (KJ758208)
retrieved from the Ross Sea, Antarctica (PP = 0.98).
The three sequences of Katodinium glaucum available
tf
in GenBank (KP790160–2) formed a lineage not clo-
lf
sely related to Torodinium spp. or to any other dino-
Figs 75–77. Line drawings of different views of Katodinium flagellate group. The sequences of Torodinium and
glaucum. Fig. 75. Ventral view. Fig. 76. Sinistro-lateral view. Katodinium glaucum branched within the large lineage
Fig. 77. Apical view. ag = apical groove. lf = longitudinal comprising Gymnodiniales, Peridiniales, Dinophysales
flagellum. lr = longitudinal rib. n = nucleus. rsb = rod-shaped and Prorocentrales but with poor support, making it
body. tf = transversal flagellum. v = food vacuole. difficult to infer the phylogenetic affinities of these
orders (Fig. 78).
Downloaded by [Fernando Gómez] at 13:26 05 April 2016

0.88 Woloszynskia pascheri EF058253

1 Woloszynskia halophila EF058252
Polarella glacialis AY179607
0.8 Symbiodinium microadriaticum M88521
Pelagodinium bei U41087
1 Togula britannica AY443010
Amphidinium corpulentum AF274252
1 Levanderina fissa AY421786
0.94 Levanderina fissa AF274261
1 Cucumeridinium coeruleum KR139785
Cucumeridinium lira KR139787
0.76 Apicoporus parvidiaboli EU293238
0.88 1 Cochlodinium sp. DQ915170
Cochlodinium polykrikoides EU418944
Amphidinium herdmanii AF274253
0.89 0.78 Karenia brevis AF352818
0.89 0.97 Karenia papilionacea HM067005
Karenia bidigitata HM067002
Brachidinium capitatum HM066998
0.85 Ceratoperidinium falcatum KP790150
0.98 Prorocentrum micans AY585526
Prorocentrum minimum DQ336072
0.98 Gyrodinium fusiforme AB120002
0.96 Gyrodinium spirale AB120001
Gyrodinium dominans FN669510
0.98 Gyrodinium helveticum AB120004
Apicoporus glaber EU293235
Aduncodinium glandula LK934662
0.83 Lepidodinium viride AF022199
0.89 Gymnodinium impudicum DQ779993
0.97
0.96 Gymnodinium dorsalisulcum DQ837534
1 Gymnodinium dorsalisulcum LC054930
0.79 Dissodinium pseudolunula FJ473378
1 Chytriodinium affine FJ473380
Chytriodinium roseum FJ663049
0.86 Gymnodinium fuscum AF022194
Pheopolykrikos beauchampii DQ371294
0.84 Gymnodinium aureolum AY999082
0.54 0.92 Warnowia sp. FJ467492
0.93 Polykrikos hartmannii AY421789
0.97 Polykrikos herdmaniae DQ975470
Polykrikos kofoidii DQ371291
0.88 Gymnodinium sp. AF274260
0.76
Uncultured marine dinoflagellate HM581765
0.64 Uncultured marine dinoflagellate JQ956286
0.98 Takayama cf. pulchellum AY800130
0.94 Takayama acrotrocha HM067010
0.95 Karlodinium veneficum AF274262
Karlodinium veneficum JN986577
0.74 1 Azadinium trinitatum KJ481803
Azadinium spinosum FJ217814
Balechina pachydermata KR139791
0.73 0.98 Ankistrodinium semilunatum AF274256
0.9 Ankistrodinium semilunatum JQ179859
0.7
Bispinodinium angelaceum AB762397
1
Uncultured marine dinoflagellate AY664920
0.73 Uncultured marine dinoflagellate EF527103
0.77
Katodinium glaucum KP790161
Katodinium glaucum KP790160 Lebouridinium gen. nov.
0.99 Katodinium glaucum KP790162
0.85 Uncultured marine dinoflagellate KJ763303
1 Akashiwo sanguinea AY421770
0.97 Akashiwo sanguinea DQ779987
Akashiwo sanguinea AJ415513
Uncultured eukaryote KJ758208
0.98 0.74 Uncultured marine dinoflagellate HQ438165
Uncultured marine dinoflagellate HQ438140
1 0.9 Torodinium robustum KP790167
Torodinium robustum KP790166
0.99 Torodinium robustum FG187 KR139784
Uncultured eukaryote KJ762990
0.9 Uncultured eukaryote KJ759393
0.02 Torodinium teredo FG21-2 KR139781
0.76 Torodinium teredo FG21-3 KR139782Torodinium
Torodinium teredo FG21-4 KR139783

Fig. 78. Bayesian phylogenetic tree of dinoflagellate SSU rDNA sequences, based on 1584 aligned positions. Names in bold
represent sequences obtained in this study. Numbers at nodes are posterior probabilities (values <0.50 are omitted). The scale bar
represents the number of substitutions for a unit branch length.
 Torodinium and Lebouridinium gen. nov.
Taxonomic description
Detailed study of the morphology of Katodinium glau-
cum confirmed that this species is not related to the type
species of Katodinium, K. nieuportense. Molecular and
morphological data did not support a close relationship
of K. glaucum with Torodinium, Gyrodinium or any
other known dinoflagellate genus. Therefore, a new
genus is proposed here for K. glaucum.
Lebouridinium F. Gómez, H. Takayama, D.
Moreira & P. López- García, gen. nov. (Figs 59–77)
DIAGNOSIS: Unarmoured spindle-shaped cells with
the hyposome about 1/4 of the cell length. The des-
cending cingulum was displaced by three to four
cingular widths. The cells were devoid of plastids
and the cell surface was covered with longitudinal
ribs. The apex contained a tongue-shaped notch
pointed towards the dorsal side. The apical groove
Downloaded by [Fernando Gómez] at 13:26 05 April 2016
was horseshoe-shaped and extended below the border
of the tongue-shaped notch. The proximal end of the
cingulum showed a bifurcation, alternatively inter-
preted as a short leftwards notch that transversally
divided the cingulum.
ETYMOLOGY: In honour of M.V. Lebour who first
described the type species. The suffix ‘–dinium’,
meaning ‘vortex’ is commonly applied to dinoflagel-
lates. The gender is neuter.
TYPE SPECIES: Lebouridinium glaucum (M. Lebour) F.
Gómez, H. Takayama, D. Moreira & P. López-García,
gen. & comb. nov. See description above.
BASIONYM: Spirodinium glaucum M. Lebour 1917 (J.
Mar. Biol. Ass. U.K. ser. 2, 11: 196, fig. 13).
SYNONYMS: Gyrodinium glaucum (M. Lebour) Kof. &
Swezy 1921, p. 308, fig. DD16, plate 9, fig. 94;
Massartia glauca (M. Lebour) J. Schiller 1933, p. 436,
fig. 462; Katodinium glaucum (M. Lebour) A.R. Loebl.
1965, p. 16 (non Gymnodinium glaucum W. Conrad
1926, nec Gymnodinium glaucum J. Schiller 1955).
EPITYPE: Fig. 72.
DISCUSSION
Comparison of Torodinium with previous descriptions
Our knowledge on the morphology of Torodinium has
remained almost unchanged since the original generic
description. Kofoid & Swezy (1921) contributed
greatly to the understanding of the unarmoured dino-
flagellates from specimens collected in the summer of
1917 off San Diego, California. However, in numer-
ous cases Kofoid & Swezy proposed new species
based on the observation of single or few specimens,
consequently ignoring the potential intraspecific mor-
phological variability. In addition, sometimes they
erroneously described life stages as new species
237
based exclusively on the illustrations from other
authors (i.e. Gymnodinium fulgens Kof. & Swezy,
Gyrodinium falcatum Kof. & Swezy). In the case of
Torodinium, Kofoid & Swezy (1921, p. 390) reported
‘we have found only the stouter of these two species,
Torodinium robustum, in which we include the first
two of Schütt’s figures (1895, pl. 23, figs 74, 1–3)’.
Kofoid & Swezy (1921) described the genus
Torodinium with T. teredo as type species, based on
the illustrations of Gymnodinium teredo in Schütt
(1895). However, it is questionable to propose a new
genus and species with no personal observations of
the type species. In that case, Kofoid & Swezy were
right and the SSU rDNA molecular phylogeny con-
firms that T. robustum and T. teredo are independent
species (Fig. 78).
Unarmoured dinoflagellates tend to show high mor-
phological variability, especially in the extension of
the cell body (Gómez et al., 2004, 2005). Thus, the
relative elongation is a poor diagnostic criterion for
species separation. Kofoid & Swezy (1921) estab-
lished T. teredo for specimens with a length greater
than 4 transdiameters, and less than 3.5 transdiameters
for T. robustum. The first problem of this diagnostic
criterion is the discrimination of specimens with ratios
between 3.5 and 4 length-transdiameter. In most
recent literature, this has been solved by assigning to
T. teredo specimens with cell length > 3× width
(Steidinger & Tangen, 1997). The difficulty is to
establish where the dorsoventral or lateral sides are.
Kofoid & Swezy (1921) erroneously used the term
transdiameter (= width) for the cell depth [i.e. the
length along the lateral sides (ventral to dorsal
distance)].
The distinction between the two species pro-
posed by Kofoid & Swezy was not restricted to
only one morphometric character (length-depth
ratio). They added that T. robustum possessed an
apex with the apical groove–reversed terminal api-
cal loop of the sulcus, which was absent in T.
teredo. It should be noted that apparently Kofoid
& Swezy (1921) did not examine specimens of T.
teredo and this was based on Schütt’s illustrations.
Kofoid & Swezy and later authors represented the
apical groove of T. robustum as a looping of the
sulcus in the apex, while the type species lacked
the apical groove (Figs 79–90). Elbrächter (1979)
illustrated T. robustum with the apical groove as an
anterior extension of the sulcus (Fig. 86), which
was absent in T. teredo (Fig. 85). Torodinium
teredo and T. robustum are closely related in the
SSU rDNA molecular phylogeny, so that the
absence of the apical groove in one of the species
would be very unusual. In contrast to previous
studies exclusively based on LM observations, we
have to consider that both Torodinium species may
possess an apical groove which is independent of
the sulcus (Figs 39, 44).
 F. Gómez et al. 238

Rh
79 80 82 83 84
sulc. rod.
c
Cp gir. epi.

pus. rod.
81 n.
sulc.
gir. hyp.
gir.
qG tr. fl.
qF hyp.
long. fl.

gir.
hyp.
Downloaded by [Fernando Gómez] at 13:26 05 April 2016

85 86 87 88 89 90

Figs 79–90. Line drawings of Torodinium teredo and T. robustum in the literature. Fig. 79. Gymnodinium teredo redrawn from
Paulsen (1908). Figs 80–82. T. robustum redrawn from Kofoid & Swezy (1921). Fig. 80. Ventral view. Fig. 81. Dextro-lateral view.
Fig. 82. Sinistro-lateral view. Fig. 83. T. teredo redrawn from Kofoid & Swezy (1921). Fig. 84. T. robustum redrawn from Lebour
(1925). Fig. 85. T. teredo redrawn from Elbrächter (1979). Fig. 86. T. robustum redrawn from Elbrächter (1979). Fig. 87. T. robustum
redrawn from Dodge (1982). Fig. 88. T. robustum redrawn from Sournia (1986). Fig. 89. T. robustum redrawn from Hansen & Larsen
(1992). Fig. 90. T. teredo redrawn from Steidinger & Tangen (1997).

Kofoid & Swezy (1921) reported also that both
species of Torodinium lacked striae on the cell
surface. However, the surface of the episome is
covered with prominent longitudinal ribs as is
even revealed by light microscopy (Fig. 23).
Some micrographs in the literature also showed
the ribs in the episome (Sournia, 1986; Gárate-
Lizárraga & Muciño-Márquez, 2013). The pigmen-
tation of Torodinium is another controversial mat-
ter. Elbrächter (1979) reported that the chloroplasts
were greenish-yellow to pale brown for T. teredo,
and brown for T. robustum. In contrast, Steidinger
& Tangen (1997) reported that the pigmentation
was brown and green for T. teredo and T. robus-
tum, respectively. In our observations, some
specimens showed scarce pigmentation (Figs 2, 6,
25), while it was greenish in others (Fig. 18). The
first micrograph of Torodinium under epifluores-
cence microscopy showed a specimen with few
long longitudinal plastids restricted to the ventral
side of the cell (Fig. 16).
The occurrence of three grooves in the episome
of Torodinium was not reported in previous stu-
dies. The anterior extension of the cingulum is
short and it very probably went unnoticed in
studies based on light microscopy. An anterior
extension of the cingulum has been reported in
some species of Gymnodinium, Cochlodinium F.
Schütt and Warnowia Lindemann (Takayama,
1985, 1998). To the best of our knowledge,
 Torodinium and Lebouridinium gen. nov. 239

91 92 93 94 95

96 97
Downloaded by [Fernando Gómez] at 13:26 05 April 2016

98 99 100

Figs 91–100. Line drawings of Katodinium nieuportense, Lebouridinium glaucum, Gymnodinium vestificii and Amphidinium
extensum. Fig. 91. Katodinium nieuportense redrawn from Conrad (1926). Fig. 92. Spirodinium glaucum redrawn from Lebour
(1917). Fig. 93. Gyrodinium glaucum redrawn from Lebour (1925). Fig. 94. G. glaucum redrawn from Kofoid & Swezy (1921).
Fig. 95. K. glaucum redrawn from Elbrächter (1979). Fig. 96. Gyrodinium glaucum redrawn from Dodge (1982). Fig. 97. K. glaucum
redrawn from Steidinger & Tangen (1997). Fig. 98. Gymnodinium vestificii redrawn from Paulsen (1908). Fig. 99. G. vestificii
redrawn from Kofoid & Swezy (1921). Fig. 100. Amphidinium extensum redrawn from Lebour (1925).

Torodinium is the only known genus with exten-
sions of both sulcus and cingulum in the episome
(Figs 35, 52). Another distinctive character of
Torodinium is the sulcal lip (Figs 26–27). A ten-
tatively analogous feature has been reported as a
tube-like structure in the genus Takayama de
Salas, Bolch, L. Botes & Hallegr. (de Salas
et al., 2003).
Kofoid & Swezy (1921, p. 391) reported that
‘From the anterior flagellar pore there runs ante-
riorly at the left of the nucleus a slender canal,
the anterior pusule’. The lateral canal was erro-
neously reported in further literature as reaching
the cingulum, reaching the anterior flagellar pore
or being confused with the sulcus (Figs 64–70).
All previous studies have illustrated the lateral
canal in contact with the cingulum (Lebour, 1925;
Elbrächter, 1979; Dodge, 1982; Sournia, 1986).
Kofoid & Swezy denoted the lateral canal as a
pusule (Fig. 63). Several functions have been attrib-
uted to the dinoflagellate pusule, including the
incorporation of particles (Klut et al., 1987). The
distribution of Torodinium in oligotrophic surface
oceanic waters, the scarce chloroplasts, the presence
of food vacuoles and the body extension suggest
that Torodinium is indeed able to ingest particulate
matter (Gómez, 2009). We have not yet observed
the mechanism of prey capture and ingestion. The
body extension was noticed only in specimens that
were fixed immediately after collection (Gómez,
2009; Fig. 12). During observations of live speci-
mens the body extension could be retracted due to
manipulation stress. The projection of a body exten-
sion from the hyposome is a feature known in other
 F. Gómez et al.
gymnodinioid dinoflagellates (Persson et al., 2013).
Gymnodinioid dinoflagellates typically ingest their
prey by direct engulfment through the sulcal area in
the hyposome [e.g. Gyrodinium spirale (Bergh)
Kof. & Swezy; Hansen, 1992]. However,
Torodinium has a minute hyposome and posterior
sulcus, probably insufficient for the ingestion of
large prey. The lateral canal is a structure unknown
in any other dinoflagellate and its function remains
uncertain. It can be hypothesized that the body
extension that emerged from the hyposome may
facilitate prey capture and the subsequent ingestion
through the lateral canal (Figs 33, 35).
The apex of Torodinium is also highly distinctive.
Schütt (1895) illustrated a group of plastids around a
central plastid or oil globule forming a star of eight or
nine rays, further re-drawn by other authors (Figs 60,
63–65). This unusual star-shaped distribution of the
plastids coincides with the apical ribs that form the
bill-like projection (Fig. 48). In one of the earliest
Downloaded by [Fernando Gómez] at 13:26 05 April 2016
dinoflagellate studies, Schütt (1895) was probably
confusing the apical ribs with plastids. The function
of the bill-like projection is unknown.
Previous observations of Lebouridinium
Our observations of Lebouridinium glaucum unequi-
vocally correspond to the taxon described as
Spirodinium glaucum by Lebour (1917, 1925)
(Figs 92–93). However, L. glaucum have been
reported earlier in the literature because it is a common
species (Lebour, 1917). Schütt (1895) described
Gymnodinium vestificii F. Schütt with a larger epi-
some, lacking the surface striae and with an intrusion
of the sulcus into the episome (Fig. 98). Later, Kofoid
& Swezy (1921), in the absence of personal observa-
tions, added surface striations to the illustration of G.
vestificii (Fig. 99). Lebour (1925, p. 50) reported on G.
vestificii ‘This species is not sufficiently defined, but
bears so strong a resemblance to Gyrodinium glaucum
if turned upside down that one does not feel justified in
regarding it as a Gymnodinium until the flagella have
been described’. Even assuming that the orientation of
G. vestificii was turned upside down and it is covered
with surface striations, the prominent anterior exten-
sion of the sulcus and the low cingular displacement
do not indicate L. glaucum. Amphidinium extensum A.
Wulff was described from four illustrations in dorsal
view, lacking information on the sulcus or flagella
(Lebour, 1925) (Fig. 100). Due to the poor descrip-
tions, it is difficult to determine whether G. vestificii or
A. extensum corresponded to the earlier observations
of L. glaucum and, consequently, if any of these taxa
have priority versus Spirodinium glaucum.
Kofoid & Swezy (1921) and Elbrächter (1979)
illustrated Lebouridinium glaucum with an intrusion
of the sulcus in the episome (Figs 94–95). However,
we did not observe that feature (Figs 75–76). We
240
observed by light and scanning electron microscopy
(Figs 63, 71–72) that the proximal end of the cingu-
lum showed a short bifurcation or, alternatively, a
leftwards notch that transversally divided the cingu-
lum (Figs 75–76). This feature was not reported in the
literature. The tongue-shaped notch (Figs 94–95) was
first reported by Takayama (1985, 1998; Fig. 97).
Evolutionary affinities of Lebouridinium
The morphology of Lebouridinium glaucum is very
different from the type of Katodinium, K. nieupor-
tense (Fig. 91), an insufficiently described species
that is only known from the original description
(Conrad, 1926). Some morphological features such
as the cingular displacement, longitudinal ribs, tricho-
cysts, rod-shaped and refractile bodies and a capsule
that surrounded the spherical nucleus resemble the
type of Gyrodinium (Hansen & Daugbjerg, 2004;
Takano & Horiguchi, 2004). However, other features
such as the apical groove, tongue-shaped notch or the
cingular structure, as well as the molecular data, do
not support a relationship between Lebouridinium and
Gyrodinium (Fig. 78; Kim & Kim, 2007). Since the
earlier studies, the small hyposome of L. glaucum
invited consideration of a relationship with
Torodinium (Lebour, 1917; Kofoid & Swezy, 1921).
Reñé et al. (2015) reported that Torodinium robustum
and L. glaucum branched together in the SSU rDNA
phylogenetic analysis, although with weak statistical
support (bootstrap value < 80%). In our SSU rDNA
phylogeny, including more sequences of Torodinium
and environmental clones, we did not find a relation-
ship between Torodinium spp. and L. glaucum
(Fig. 78). The detailed study of the morphology of
Torodinium and Lebouridinium does not reveal simi-
larities in the distinctive diagnostic characters
between the two genera. Morphological features
such as the reduced hyposome or the cell surface
covered with longitudinal ribs are common characters
in the unarmoured dinoflagellates (Takano &
Horiguchi, 2004; Gómez et al., 2015).
DISCLOSURE STATEMENT
No potential conflict of interest was reported by the
author(s).
FUNDING
F.G. is supported by the Brazilian Conselho Nacional de
Desenvolvimento Científico e Tecnológico (grant number
BJT 370646/2013–14). We acknowledge financial support
from the French CNRS, the European Research Council
under the European Union’s Seventh Framework Program
ERC Grant Agreement 322669 ‘ProtistWorld’, and Ile de
France (SESAME project 13016398 ‘Unicell’).
 Torodinium and Lebouridinium gen. nov.
AUTHOR CONTRIBUTIONS
F. Gómez: collection, isolation, light microscopy and drafting;
H. Takayama: collection, isolation, light and electron micro-
scopy; P. López-García: molecular analysis; D. Moreira: phy-
logenetic analysis.
REFERENCES
Calado, A.J. (2011). On the identity of the freshwater dinoflagellate
Glenodinium edax, with a discussion on the genera Tyrannodinium
and Katodinium, and the description of Opisthoaulax gen. nov.
Phycologia, 50: 641–649.
Conrad, W. (1926). Recherches sur les flagellates de nos eaux
saumâtres. 1e partie: dinoflagellates. Archiv für Protistenkunde,
55: 63–100.
Daugbjerg, N., Hansen, G., Larsen, J. & Moestrup, Ø. (2000).
Phylogeny of some of the major genera of dinoflagellates based
on ultrastructure and partial LSU rDNA sequence data, including
the erection of three new genera of unarmoured dinoflagellates.
Phycologia, 39: 302–317.
De Salas, M.F., Bolch, C.J.S., Botes, L., Nash, G., Wright, S.W. &
Hallegraeff, G.M. (2003). Takayama gen. nov. (Gymnodiniales,
Dinophyceae), a new genus of unarmoured dinoflagellates with
sigmoid apical grooves, including the description of two new
Downloaded by [Fernando Gómez] at 13:26 05 April 2016
species. Journal of Phycology, 39: 1233–1246.
Dodge, J.D. (1982). Marine dinoflagellates of the British Isles. Her
Majesty’s Stationery Office, London.
Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with
high accuracy and high throughput. Nucleic Acids Research, 32:
1792–1797.
Elbrächter, M. (1979). On the taxonomy of unarmoured dinophytes
(Dinophyta) from the Northwest African upwelling region.
“Meteor” Forschungs-Ergebnisse, Reihe D, 31: 1–22.
Gárate-Lizárraga, I. & Muciño-Márquez, R.E. (2013). New data on
the distribution of Torodinium robustum and T. teredo
(Dinophyceae: Gymnodiniales) in the Gulf of California. Check
List, 9: 809–812.
Gómez, F. (2009). Torodinium and Pavillardia (Gymnodiniales,
Dinophyceae): two unarmoured dinoflagellates with a body exten-
sion, collected from the open Pacific Ocean. Protistology, 6: 131–135.
Gómez, F., Nagahama, Y., Fukuyo, Y. & Furuya, K. (2004).
Observations on Ceratoperidinium (Dinophyceae). Phycologia,
43: 416–421.
Gómez, F., Nagahama, Y., Takayama, H. & Furuya, K. (2005). Is
Karenia a synonym of Asterodinium–Brachidinium? (Gymno-
diniales, Dinophyceae). Acta Botanica Croatica, 64: 263–274.
Gómez, F., López-García, P., Takayama, H. & Moreira, D. (2015).
Balechina and the new genus Cucumeridinium gen. nov.
(Dinophyceae), unarmoured dinoflagellates with thick cell cover-
ings. Journal of Phycology 51: 1088–1105.
Hansen, G. (1995). Analysis of the thecal plate pattern in the dino-
flagellate Heterocapsa rotundata (Lohmann) comb. nov.
(=Katodinium rotundatum (Lohmann) Loeblich). Phycologia,
34: 166–170.
Hansen, G. & Larsen, J. (1992). Dinoflagellater i danske farvande. In
Plankton i de indre danske farvande (Thomsen, H.A., editor), 45–
155. Havforskning fra Miljøstyrelsen, n. 11, Copenhagen.
Hansen, G. & Daugbjerg, N. (2004). Ultrastructure of Gyrodinium
spirale, the type species of Gyrodinium (Dinophyceae), including
a phylogeny of G. dominans, G. rubrum and G. spirale deduced
from partial LSU rDNA sequences. Protist, 155: 271–294.
Hansen, P.J. (1992). Prey size selection, feeding rates and growth
dynamics of heterotrophic dinoflagellates with special emphasis
on Gyrodinium spirale. Marine Biology, 114: 327–334.
Kang, N.S., Jeong, H.J., Moestrup, Ø., Jang, T.Y., Lee, S.Y. & Lee,
M.J. (2015). Aduncodinium gen. nov. and A. glandula comb. nov.
241
(Dinophyceae, Pfiesteriaceae), from coastal waters off Korea: mor-
phology and molecular characterization. Harmful Algae, 41: 25–37.
Kim, K.-Y. & Kim, C.-H. (2007). Phylogenetic relationships among
diverse dinoflagellate species occurring in coastal waters off Korea
inferred from large subunit ribosomal DNA sequence data. Algae,
22: 57–67.
Klut, M.E., Bisalputra, T. & Antia, N.J. (1987). Some observations
on the structure and function of the dinoflagellate pusule.
Canadian Journal of Botany, 65: 736–744.
Kofoid, C.A. & Swezy, O. (1921). The free-living unarmoured
Dinoflagellata. Memoirs of the University of California, 5: 1–562.
Lebour, M.V. (1917). The Peridiniales of Plymouth Sound from the
region beyond the breakwater. Journal of the Marine Biological
Association, Plymouth, 11: 183–200.
Lebour, M.V. (1925). The Dinoflagellates of Northern Seas. Marine
Biological Association of the United Kingdom, Plymouth.
López-García, P., Rodríguez-Valera, F., Pedrós-Alió, C. & Moreira,
D. (2001). Unexpected diversity of small eukaryotes in deep-sea
Antarctic plankton. Nature, 409: 603–607.
Murray, S., de Salas, M., Luong-Van, J. & Hallegraeff, G. (2007).
Phylogenetic study of Gymnodinium dorsalisulcum comb. nov.
from tropical Australian coastal waters (Dinophyceae).
Phycological Research, 55: 176–184.
Paulsen, O. (1908). Peridiniales. In Nordisches Plankton (Brandt,
K. & Apstein, C., editors), 1–124. Lepsius & Tischer, Leipzig.
Persson, A., Smith, B.C., Morton, S., Shuler A. & Wikfors, G.
H. (2013). Sexual life stages and temperature dependent morpho-
logical changes allow cryptic occurrence of the Florida red tide
dinoflagellate Karenia brevis. Harmful Algae, 30: 1–9.
Philippe, H. (1993). MUST, a computer package of management
utilities for sequences and trees. Nucleic Acids Research, 21:
5264–5272.
Pouchet, G. (1885). Nouvelle contribution á l´histoire des
Péridiniens marins. Journal de l´Anatomie et de la Physiologie
Normale et Pathologique de l´Homme et des Animaux, Paris,
21: 28–88.
Reñé, A., Camp, J. & Garcés, E. (2015). Diversity and phylogeny of
Gymnodiniales (Dinophyceae) from the NW Mediterranean Sea
revealed by a morphological and molecular approach. Protist, 166:
234–263.
Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling,
A., Höhna, S., Larget, B., Liu, L., Suchard, M.A. & Huelsenbeck,
J.P. (2012). MrBayes 3.2: efficient Bayesian phylogenetic infer-
ence and model choice across a large model space. Systematics
Biology, 61: 539–542.
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Molecular Biology
and Evolution, 4: 406–425.
Schütt, F. (1895). Die Peridinien der Plankton-Expedition.
Ergebnisse der Plankton-Expedition der Humboldt-Stiftung, 4:
1–170.
Sournia, A. (1986). Atlas du phytoplancton marin. Volume I:
Cyanophycées, Dictyophycées, Dinophycées, Raphidophycées.
Éditions du CNRS, Paris.
Steidinger, K.A. & Tangen, K. (1997). Dinoflagellates. In
Identifying Marine Phytoplankton (Tomas, C.R., editor), 387–
598. Academic Press, San Diego, CA.
Takano, Y. & Horiguchi, T. (2004). Surface ultrastructure and mole-
cular phylogenetics of four unarmored heterotrophic dinoflagel-
lates, including the type species of the genus Gyrodinium
(Dinophyceae). Phycological Research, 52: 107–116.
Takayama, H. (1985). Apical grooves of unarmored dinoflagellates.
Bulletin of the Plankton Society of Japan, 32: 129–137.
Takayama, H. (1998). Morphological and taxonomical studies on
the free-living unarmored dinoflagellates occurring in the Seto
Inland Sea and adjacent waters. Ph.D. dissertation, The
University of Tokyo, Tokyo.