You are on page 1of 16

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/313814913

Mycobacterium tuberculosis EsxL inhibits MHC-II expression by promoting


hypermethylation in class-II transactivator loci in macrophages

Article  in  Journal of Biological Chemistry · February 2017


DOI: 10.1074/jbc.M117.775205

CITATIONS READS
7 185

11 authors, including:

Srabasti Sengupta Ishani Das


KIIT University KIIT University
5 PUBLICATIONS   53 CITATIONS    3 PUBLICATIONS   46 CITATIONS   

SEE PROFILE SEE PROFILE

Abdul Ahad Avinash Padhi


United International University KIIT University
26 PUBLICATIONS   10 CITATIONS    12 PUBLICATIONS   165 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Survival strategy of Mtb inside host cell through escaping apoptotic pathway View project

Mycobacterium View project

All content following this page was uploaded by Srabasti Sengupta on 16 May 2018.

The user has requested enhancement of the downloaded file.


cros
ARTICLE

Mycobacterium tuberculosis EsxL inhibits MHC-II expression


by promoting hypermethylation in class-II transactivator loci
in macrophages
Received for publication, January 5, 2017, and in revised form, February 13, 2017 Published, Papers in Press, February 16, 2017, DOI 10.1074/jbc.M117.775205
Srabasti Sengupta‡1, Saba Naz§, Ishani Das‡, Abdul Ahad¶, Avinash Padhi‡, Sumanta Kumar Naik‡,
Geetanjali Ganguli‡, Kali Prasad Pattanaik‡, Sunil Kumar Raghav¶, Vinay Kumar Nandicoori§,
and Avinash Sonawane‡2
From the ‡School of Biotechnology, KIIT University, Bhubaneswar, Orissa 751024, India, the §National Institute of Immunology,
New Delhi, Delhi 110067, India, and the ¶Institute of Life Science, Nalco Square, Bhubaneswar, Orissa 751023, India
Edited by Luke O’Neill

Mycobacterium tuberculosis is known to modulate the host Pathogenic bacteria employ various host immune evasion
immune responses to facilitate its persistence inside the host strategies to facilitate their survival in the host cells. One such
cells. One of the key mechanisms includes repression of class-II mechanism involves the induction of epigenetic modifications
transactivator (CIITA) and MHC-II expression in infected in the host DNA, histone proteins, and RNA by bacterial pro-

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


macrophages. However, the precise mechanism of CIITA and teins (1, 2). Various bacterial virulent proteins have been shown
MHC-II down-regulation is not well studied. M. tuberculosis to promote host chromatin and/or histone modifications via
6-kDa early secretory antigenic target (ESAT-6) is a known different signaling cascades. For example, Shigella flexneri, Lis-
potent virulence and antigenic determinant. The M. tuberculo- teria monocytogenes, and Helicobacter pylori regulate the p38
sis genome encodes 23 such ESAT-6 family proteins. We herein mitogen-activated protein kinase (MAPK) pathway by promot-
report that M. tuberculosis and M. bovis bacillus Calmette– ing histone H3 phosphorylation and acetylation processes,
Guérin infection down-regulated the expression of CIITA/ which subsequently modulate the secretion of various cyto-
MHC-II by inducing hypermethylation in histone H3 lysine 9 kines and chemokines in infected cells (3–5). S. flexneri infec-
(H3K9me2/3). Further, we showed that M. tuberculosis ESAT-6 tion inhibited MAPK-dependent histone H3 serine 10 phos-
family protein EsxL, encoded by Rv1198, is responsible for the phorylation that impaired the recruitment of nuclear factor-␬B
down-regulation of CIITA/MHC-II by inducing H3K9me2/3. (NF-␬B) at the interleukin-8 (IL-8) promoter (4). On the other
We further report that M. tuberculosis esxL induced the expres- hand, L. monocytogenes promoted histone H3 Lys-8 acetyla-
sion of nitric-oxide synthase, NO production, and p38 MAPK tion, resulting in transcriptional activation of IL-8 via the
pathway, which in turn was responsible for the increased MAPK pathway (6, 7). Similarly, H. pylori promoted NF-␬B
H3K9me2/3 in CIITA via up-regulation of euchromatic his- binding to the IL-6 promoter by inducing histone H3 Ser-10
tone-lysine N-methyltransferase 2 (G9a). In contrast, inhibition phosphorylation via ERK and p38 (5).
of nitric-oxide synthase, p38 MAPK, and G9a abrogated Tuberculosis (TB),3 caused by an intracellular pathogen,
H3K9me2/3, resulting in increased CIITA expression. A chro- Mycobacterium tuberculosis, is a life-threatening disease that
matin immunoprecipitation assay confirmed that hypermethyl- infects 9 million people and kills more than 1.5 million people
ation at the promoter IV region of CIITA is mainly responsible every year worldwide (9). According to the World Health Orga-
for CIITA down-regulation and subsequent antigen presenta- nization report, one-third of the global population is latently
tion. We found that co-culture of macrophages infected with infected with M. tuberculosis, but only 5–10% of people with
esxL-expressing M. smegmatis and mouse splenocytes led to latent TB develop into an active TB disease (10). The underlying
down-regulation of IL-2, a key cytokine involved in T-cell pro- mechanisms responsible for this adaptation are poorly under-
liferation. In summary, we demonstrate that M. tuberculosis stood. Although several reports are available on the correlation
EsxL inhibits antigen presentation by enhancing H3K9me2/3 at of other bacterial infections and epigenetics in the disease out-
the CIITA promoter, thereby repressing its expression through come, very little is known about the dynamics of epigenetic
NO and p38 MAPK activation. changes during mycobacterial infection. Macrophages, the pri-
mary host cells of M. tuberculosis, play a crucial role in recog-
nition, phagocytosis, and killing of mycobacteria. Non-patho-
This work was supported by Indian Council of Medical Research (ICMR)
Grant AMR/44/2011-ECD-I and Department of Biotechnology, Govern-
3
ment of India, Grant BT/PR5790/MED/29/602/2012 (to A. S.). The authors The abbreviations used are: TB, tuberculosis; ROS, reactive oxygen species;
declare that they have no conflicts of interest with the contents of this CIITA, class-II transactivator; BCG, bacillus Calmette–Guérin; iNOS, induci-
article. ble nitric-oxide synthase; H3K4 and H3K9, histone H3 Lys-4 and Lys-9,
1
Recipient of Department of Science and Technology, Government of India, respectively; me1, me2, and me3, mono-, di-, and trimethylation, respec-
DST-INSPIRE Fellowship IF150081. tively; PMA, phorbol 12-myristate 13-acetate; qRT-PCR, quantitative RT-
2
To whom correspondence should be addressed: School of Biotechnology, PCR; EHMT2, euchromatic histone-lysine N-methyltransferase 2; HDAC,
Campus-11, KIIT University, Bhubaneswar, Orissa 751024, India. Tel.: 91-674- histone deacetylase; pERK and pp38, phosphorylated ERK and p38, respec-
2725349; Fax: 91-674-2725732; E-mail: asonawane@kiitbiotech.ac.in. tively; RIPA, radioimmune precipitation assay.

J. Biol. Chem. (2017) 292(17) 6855–6868 6855


© 2017 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.
Role of mycobacterial EsxL in epigenetic modifications
genic mycobacteria, such as M. smegmatis, are readily killed by lated H3K9me2/3. EsxL-mediated H3K9me2/3 also resulted in
macrophages, whereas pathogenic mycobacteria (M. tubercu- inhibition of antigen presentation and secretion of interleu-
losis) are able to survive for an extended period of time by kin-2 (IL-2), a key cytokine involved in T-cell activation. In
manipulating the macrophage immune functions (11). These summary, we identified another mechanism by which M. tuber-
include prevention of phagolysosome fusion, inhibition of pha- culosis aids its persistence by repressing CIITA/MHC-II via
gosome acidification due to depletion of vesicular proton- G9a-, p38-, and NO-dependent H3K9me2/3 at promoter IV of
ATPase, evasion from toxic effects of nitric oxide (NO) and CIITA.
reactive oxygen species (ROS), suppression of protective cyto-
kine synthesis and Th-1 (T-helper-1) responses, and inhibition Results
of apoptosis (12–15). M. smegmatis EsxL shows prolonged intracellular survival in
Recently, a few reports have demonstrated that M. tubercu- RAW 264.7 and THP-1 cells
losis infection induces epigenetic modifications in host cells to
aid its replication, propagation, and protection from host M. tuberculosis ESAT-6 is known as a potent virulence as
immune responses (2, 16, 17). Mycobacterial cell wall protein, well as antigenic determinant (30, 33). Recently, we have shown
LpqH, was shown to block interferon-␥ (IFN-␥)-induced tran- that M. tuberculosis Rv2346c, a member of the ESAT-6 like
scription of class-II transactivator (CIITA) by SWI/SNF bind- family proteins, endows bacterial persistence by dampening the
ing and histone deacetylation at the CIITA promoter (18). antibacterial effector functions through genomic instability
IFN-␥ induces the expression of major histocompatibility com- and autophagy in macrophages (34). Using M. smegmatis as a
plex class II (MHC class II) by activating the transcription of surrogate model, we (34 –36) and several other groups (37, 38)
CIITA (19). Another study has shown that M. tuberculosis have proved the functions of several M. tuberculosis proteins in

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


down-regulates HLA-DR transcription and MHC-II by inhib- pathogenesis. Similarly, in this study, we ectopically expressed
iting IFN-␥-dependent histone acetylation and by recruiting one of the M. tuberculosis ESAT-6 family proteins, EsxL,
mSin3A repressor at the HLA-DR promoter (20). encoded by Rv1198, in M. smegmatis M. smegmatis esxL)
Inducible nitric-oxide synthase (iNOS) catalyzes the forma- and also constructed M. tuberculosis esxL deletion mutant
tion of nitric oxide (NO), which helps in bacterial clearance, (Mtb⌬esxL) and studied its role in pathogenesis. Fig. 1A shows
including M. tuberculosis (21, 22). It has been shown that NO genetic organization of esxL in the M. tuberculosis genome. It is
knock-out mice were more susceptible to M. tuberculosis infec- located downstream of another ESAT-6-like protein, EsxK,
tion (23). In addition to its antibacterial properties, NO also encoded by Rv1197. EsxL has previously been identified from
mediates nitration, nitrosation, and nitrosylation of key signal- the membrane fraction (39) and culture filtrates (40) of
ing molecules that determine the fate of macrophages and den- M. tuberculosis with unknown function. It is reported that
dritic cells during bacterial infection (24 –28). NO was shown to immunization of BALB/c mice with Rv1198 induced a pro-in-
induce CIITA and MHC-II inhibition by signaling cross-talks flammatory response with elevated levels of tumor necrosis fac-
along NOTCH-PKC␦-MAPK-NF␬B-KLF4 pathway during tor-␣ (TNF-␣) and IL-6, along with low induction of IFN-␥,
M. bovis BCG infection (29). IL-2, and IL-10 (41). EsxL has been assigned to the ESAT-6
M. tuberculosis early secretory antigenic target protein-6 family proteins, with Rv1793, Rv1037c, and Rv2346c as its
(ESAT-6; esxA) is a known virulent protein as well as T-cell members (42). Despite these important characteristics shown
antigenic determinant (30). M. tuberculosis ESAT-6 protein is by EsxL, its role in pathogenesis is still unknown. Comparative
involved in the cytosolic escape of bacteria by inducing pore genome analyses revealed that the M. bovis BCG genome con-
formation in the phagosomal membrane (31, 32). Previously, tains Mb1230, an orthologue of M. tuberculosis esxL, whereas
ESAT-6 protein was also reported to decrease histone H4 the M. smegmatis genome does not contain any esxL ortho-
acetylation and H3K4 methylation at the CIITA promoter (pI) logue (Tuberculist database).
(16). There are at least 23 such ESAT-6 family proteins present Because EsxL was found to be a member of the ESAT-6 fam-
in the M. tuberculosis genome. However, the functions of many ily proteins, a key virulence factor, we compared the intracellu-
of them are still unknown. Herein, we show that M. tuberculosis lar bacillary persistence of M. smegmatis harboring pSMT3
EsxL, a previously uncharacterized member of the ESAT-6-like vector (M. smegmatis pSMT3) and M. smegmatis expressing
family proteins encoded by Rv1198, suppresses antimycobacte- esxL (M. smegmatis esxL) strains in mouse macrophage RAW
rial defense mechanisms of macrophages by inhibiting the 264.7 and phorbol 12-myristate 13-acetate (PMA) differenti-
expression of CIITA and subsequently MHC-II molecules. Fur- ated THP-1 cells. The infected cells were lysed at different time
ther mechanistic studies revealed that CIITA and MHC-II points post-infection, and the bacterial survival was deter-
down-regulation by EsxL was due to induction of H3K9 hyper- mined by colony-forming unit (cfu) enumeration. The bacterial
methylation in the CIITA-IV promoter region (pIV), as deter- input and time 0 (T0) counts were determined to calculate the
mined by Western-blotting and chromatin immunoprecipita- intracellular bacterial survival. The recombinant M. smegmatis
tion (ChIP) assays. We further show that recombinant M. esxL strain showed significantly high bacterial burden in RAW
smegmatis expressing esxL (M. smegmatis esxL) induced the 264.7 (p ⱕ 0.001; Fig. 1B) and THP-1 cells (p ⱕ 0.001; Fig. 1C)
synthesis of p38 MAPK, iNOS, and NO that promoted when compared with M. smegmatis pSMT3 strain after 24 h of
H3K9me2/3 at the CIITA promoter via up-regulation of G9a infection. We did not observe any differences in the growth
(also known as euchromatic histone-lysine N-methyltrans- patterns of M. smegmatis wild-type (MsmWT), M. smegmatis
ferase 2, EHMT2), whereas the Mtb⌬esxL mutant down-regu- pSMT3, and M. smegmatis esxL strains (Fig. 1D), suggesting

6856 J. Biol. Chem. (2017) 292(17) 6855–6868


Role of mycobacterial EsxL in epigenetic modifications

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


Figure 1. Genetic organization, growth analysis, bacterial survival, and Mtb⌬esxL mutant construction. A, schematic representation of esxL in the
M. tuberculosis H37Rv genome. RAW 264.7 (B) and THP-1 (C) were infected with M. smegmatis (Msm) pSMT3 and recombinant M. smegmatis esxL strains. The
cells were lysed, and intracellular survival was determined 1, 8, and 24 h post-infection by a cfu assay. D, in vitro growth curve of the M. smegmatis WT,
M. smegmatis pSMT3, and recombinant M. smegmatis esxL was determined by growing bacteria in 7H9 medium and measuring OD (O.D600 nm). E, extracellular
expression of the esxL transcript was measured by qRT-PCR after growing M. smegmatis esxL in vitro for 4, 12, and 24 h. RNA was isolated at the respective time
points. cDNA was synthesized, and the expression of esxL was determined using qRT-PCR. Transcript levels are represented relative to mRNA -fold change of
M. smegmatis esxL at 4 h, which is assigned a value of 1. The expression values were normalized with sigA. F, intracellular expression of esxL transcript was
measured by qRT-PCR. RNA was isolated from M. smegmatis esxL-infected macrophages at different time points. cDNA was synthesized, and the expression of
esxL was determined using qRT PCR. Transcript levels are represented relative to mRNA level of M. smegmatis esxL at 4 h, which is assigned a value of 1. The
expression values were normalized with sigA. G, schematic representation of construction of Mtb⌬esxL mutant by homologous recombination. The location of
primers used for the confirmation of deletion mutant generation is depicted. H, confirmation of Mtb⌬esxL mutant generation. F1 and R2 primers were designed
beyond the flanks, whereas R1 and F2 primers anneal to sacB-hygr cassette. PCR using F1 and R1 is expected to give no product with the M. tuberculosis (lane
1) and ⬃1.3 kb with the Mtb⌬esxL (lane 2); F2-R2 primer sets were expected to give no product with M. tuberculosis and ⬃1.5 kb in Mtb⌬esxL mutant.
Amplification of udgB with gene-specific primers was performed as a control. The experiments were performed in triplicate (n ⫽ 3). Results are shown as
mean ⫾ S.D. (error bars). *, p ⱕ 0.05; **, p ⱕ 0.01; ***, p ⱕ 0.001; ns, not significant.

that the observed increased bacterial survival was not due to the cellular signaling pathways that can either support or
differences in the growth kinetics of bacteria. The extracellular inhibit the bacterial growth, depending upon the cytokine
and intracellular expressions of esxL were determined by qRT- milieu (45). Previously, ESAT-6 was shown to induce NO pro-
PCR at the 4-, 12-, and 24-h time points. As shown, esxL was duction in macrophages (46). We found significantly higher
expressed under both in vitro (Fig. 1E) and ex vivo (Fig. 1F) NO production in M. smegmatis esxL-infected RAW 264.7 cells
conditions. In conclusion, the above data showed that M. tuber- as compared with M. smegmatis pSMT3-infected cells at the
culosis esxL has a role in increased bacterial persistence inside indicated time points (p ⱕ 0.05 and p ⱕ 0.01; Fig. 2A). Similarly,
the macrophages. The generation of Mtb⌬esxL is shown in Fig. we observed an ⬃18-fold increase in iNOS at transcriptional
1, G and H. (p ⱕ 0.001; Fig. 2B) and significant increase at translational
levels (Fig. 2C) in M. smegmatis esxL-infected macrophages. Im-
EsxL induces NO production and iNOS expression in munofluorescence studies using iNOS-specific antibody also
macrophages showed significantly increased expression in M. smegmatis
iNOS, which catalyzes formation of NO, has immunomodu- esxL-infected macrophages as compared with uninfected and
latory activities that determine the outcome of M. tuberculosis M. smegmatis pSMT3-infected cells (Fig. 2D). On the contrary,
infection (43). In addition to its antibacterial properties, NO is decreased iNOS expression was observed in Mtb⌬esxL-in-
also known as a key regulator in the initiation and maintenance fected THP-1 cells when compared with M. tuberculosis-in-
of anti-TB protective immunity (44) and is known to modulate fected cells (Fig. 2E). We did not observe any significant differ-

J. Biol. Chem. (2017) 292(17) 6855–6868 6857


Role of mycobacterial EsxL in epigenetic modifications

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


Figure 2. Determination of NO production and iNOS expression in M. smegmatis pSMT3-, M. smegmatis esxL-, M. tuberculosis H37Rv-, and Mtb⌬esxL-
infected cells. A, RAW 264.7 cells were infected with M. smegmatis (Msm) pSMT3 and recombinant M. smegmatis esxL for 2 h. The production of NO was
quantified using Griess reagent 24 and 48 h after infection. B, transcript levels of iNOS in M. smegmatis pSMT3- and M. smegmatis esxL-infected macrophages
were determined by qRT-PCR 24 h post-infection. GAPDH was taken as internal control. iNOS expression was checked by Western blotting (C) and fluores-
cence-microscopic analysis (D) using iNOS-specific antibody in M. smegmatis pSMT3- and M. smegmatis esxL-infected macrophages. E, THP-1 cells were
infected with M. tuberculosis (Mtb) and Mtb⌬esxL mutant for 2 h. The level of iNOS was checked by Western blotting 24 h post-infection. The experiments were
performed in triplicate (n ⫽ 3). Results are shown as mean ⫾ S.D. (error bars). *, p ⱕ 0.05; **, p ⱕ 0.01; ***, p ⱕ 0.001.

ences in the production of ROS in infected macrophages (data M. smegmatis esxL-infected THP-1 (Fig. 3G) and RAW 264.7
not shown), indicating that M. tuberculosis esxL specifically macrophages (Fig. 3H). In agreement with previous reports, we
induces NO production in macrophages. also observed a time-dependent decrease in MHC-II expres-
sion in M. tuberculosis-infected THP-1 cells (Fig. 3I) when
EsxL down-regulates MHC-II and CIITA in macrophages compared with Mtb⌬esxL-infected cells (Fig. 3J). Altogether,
Pathogenic mycobacteria are known to down-regulate the these data suggest that M. smegmatis esxL-, M. bovis BCG-, and
surface expression of MHC-II molecules in macrophages (47). M. tuberculosis-mediated MHC-II inhibition is due to down-
The MHC-II-dependent antigen presentation is tightly regu- regulation of CIITA.
lated by a key transcription factor, CIITA. Mice deficient for
CIITA showed a marked reduction in MHC-II expression (48). M. smegmatis EsxL infection down-regulates IL-2 and IL-10
It has been shown that M. bovis BCG infection inhibited and up-regulates IL-6 and TNF-␣ production in macrophages
MHC-II expression by inducing NO production in macro- It is known that inhibition of antigen presentation prevents
phages (29). In view of these reports, we checked the expression T-cell activation (49). As mentioned above, IL-2 is a key cyto-
of MHC-II and CIITA in M. tuberculosis, Mtb⌬esxL, M. smeg- kine involved in T-cell activation (50, 51). Therefore, we
matis pSMT3, and M. smegmatis esxL-infected macrophages. checked IL-2 levels using the Bioplex cytokine analysis kit. For
As shown, M. smegmatis esxL infection abrogated CIITA this, macrophages were first infected with M. smegmatis
expression at both transcriptional (p ⱕ 0.01; Fig. 3A) and trans- pSMT3 and M. smegmatis esxL strains, followed by co-culture
lational levels (Fig. 3B). M. tuberculosis-infected THP-1 cells with BALB/c mouse splenocytes. We found significant down-
also showed a time-dependent decrease in CIITA expression regulation of IL-2 (p ⱕ 0.05; Fig. 4A) and IL-10 (p ⱕ 0.05; Fig.
(Fig. 3C), whereas increased CIITA expression was observed in 4B) cytokines in supernatant obtained from M. smegmatis
Mtb⌬esxL-infected cells (Fig. 3D). We further confirmed the esxL-infected cells as compared with M. smegmatis pSMT3
effect of CIITA on MHC-II expression. A significant decrease infection after 24 h. However, the presence of G9a inhibitor
in MHC-II expression was observed at both transcriptional UNC0638 increased production of both of the cytokines, sug-
(p ⱕ 0.01; Fig. 3E) and translational (Fig. 3F) levels in M. smeg- gesting that M. smegmatis esxL infection suppressed T-cell
matis esxL-infected RAW 264.7 macrophages when compared activation. In contrast, TNF-␣ (p ⱕ 0.01; Fig. 4C) and IL-6 (p ⱕ
with M. smegmatis pSMT3-infected cells. Flow cytometry anal- 0.01; Fig. 4D) were up-regulated in M. smegmatis esxL-infected
ysis also showed a significant decrease in MHC-II expression in cells.

6858 J. Biol. Chem. (2017) 292(17) 6855–6868


Role of mycobacterial EsxL in epigenetic modifications

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


Figure 3. Expression of CIITA and MHC-II in M. smegmatis pSMT3-, M. smegmatis esxL, M. tuberculosis H37Rv-, and Mtb⌬esxL-infected macrophages.
A, RAW 264.7 cells were infected with M. smegmatis (Msm) pSMT3 and recombinant M. smegmatis esxL for 2 h. The transcript level of CIITA was quantified using
qRT-PCR 24 h post-infection. Uninfected cells were used as control. B, RAW 264.7 cells were infected with M. smegmatis pSMT3 and recombinant M. smegmatis
esxL for 2 h. Cell lysates were prepared at the indicated time points (12, 24, and 48 h). CIITA expression was checked by Western blotting. C, the level of CIITA after
M. tuberculosis (Mtb) infection was checked by Western blotting. Expression of CIITA protein was determined in M. tuberculosis H37Rv-infected THP-1 cells by
Western blotting using an antibody specific to CIITA after 24, 48, and 72 h of infection. D, Western-blotting analysis to check expression of CIITA in THP-1 cells
infected with M. tuberculosis and Mtb⌬esxL after 48 h of infection. The expression level of MHC-II was checked at both transcriptional (E) and translational (F)
levels in RAW 264.7 cells infected with M. smegmatis pSMT3 and recombinant M. smegmatis esxL strains 24 h post-infection. THP-1 (G) and RAW 264.7 cells (H)
were infected with M. smegmatis pSMT3 and recombinant M. smegmatis esxL strains for 2 h. Flow cytometry analysis of MHC-II expression was determined by
using anti-MHCII antibody and analyzed through 10,000 gated cells 24 h post-infection. I, expression of MHCII protein was determined in M. tuberculosis
H37Rv-infected THP-1 cells by Western blotting using an antibody specific to MHCII after 24, 48, and 72 h post-infection. J, the level of MHCII was checked in
M. tuberculosis H37Rv- and Mtb⌬esxL-infected THP-1 cells by Western blotting after 24 and 48 h post-infection. For qRT-PCR, GAPDH was taken as an internal
control. The experiments were performed in triplicate (n ⫽ 3). Results are shown as mean ⫾ S.D. (error bars); **, p ⱕ 0.01.

M. smegmatis EsxL induces histone modification (H3K9 H3K4me3 and total H3 in M. smegmatis pSMT3- and M. smeg-
hypermethylation) in macrophages matis esxL-infected macrophages (Fig. 5C), indicating that esxL
A few studies have shown that pathogenic mycobacteria and induces H3K9me2/3 in macrophages.
its antigens induce epigenetic changes to evade host immune
responses (16, 18, 51). We hypothesized that EsxL might render M. bovis BCG and M. tuberculosis infection induces
repressive epigenetic modifications at the CIITA promoter that H3K9me2/3 in macrophages
subsequently inhibit MHC-II-dependent antigen presentation. To further confirm the role of EsxL in inducing repressive his-
H3K9me2/3 is involved in transcriptional repression (52). tone modification, we analyzed the expression of H3K9me2/3 in
Therefore, we analyzed the status of H3K9me2/3 in infected M. bovis BCG-, M. tuberculosis-, and Mtb⌬esxL-infected macro-
macrophages. Indeed, immunoblotting (Fig. 5A) and immuno- phages. Concordantly, Western-blotting analysis showed in-
fluorescence (Fig. 5B) analysis showed significantly elevated creased levels of H3K9me2/3 in M. bovis BCG (Fig. 5D)- and
levels of H3K9me2/3 in M. smegmatis esxL-infected macro- M. tuberculosis (Fig. 5E)-infected macrophages, suggesting that
phages as compared with control cells. A significant increase in M. tuberculosis and BCG may down-regulate CIITA expression
H3K9me2/3 puncta was observed in M. smegmatis esxL-in- by inducing H3K9me2/3 in macrophages. In contrast, de-
fected cells. We did not observe any significant differences in creased H3K9me2/3 expression was observed in Mtb⌬esxL-in-

J. Biol. Chem. (2017) 292(17) 6855–6868 6859


Role of mycobacterial EsxL in epigenetic modifications

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


Figure 4. Cytokine analysis. Analysis of IL-2, IL-6, IL-10, and TNF-␣ cytokines in RAW 264.7 (M) and splenocyte (S) co-cultured cells (M ⫹ S) infected with
M. smegmatis (Msm) pSMT3 and recombinant M. smegmatis esxL strains. The level of IL-2 (A), IL-10 (B), TNF-␣ (C), and IL-6 (D) cytokines was determined by using
the Bioplex cytokine analysis kit. Infected RAW 264.7 cells were co-cultured with splenocytes isolated from BALB/c mice in the presence and absence of G9a
inhibitor (UNC0638), and cell supernatants were collected 24 h post-infection. The experiments were performed in triplicate (n ⫽ 3). Results are shown as
mean ⫾ S.D. (error bars); *, p ⱕ 0.05; **, p ⱕ 0.01.

fected THP-1 cells when compared with M. tuberculosis-in- To assess whether CIITA down-regulation during M.
fected cells (Fig. 5F). smegmatis esxL infection is dependent on G9a-mediated
H3K9me2/3, we checked the expression of CIITA in untreated
M. smegmatis esxL and M. bovis BCG induce H3K9me2/3 and G9a inhibitor-treated macrophages. Immunoblotting anal-
modification by up-regulating EHMT2 methyltransferase ysis showed that pretreatment with G9a inhibitor severely
activity reduced the capacity of M. smegmatis esxL to inhibit CIITA
To further investigate the mechanism of H3K9me2/3 induc- expression in macrophages (Fig. 5I), indicating that observed
tion, we studied the activity of methyltransferases in infected CIITA down-regulation was due to G9a-mediated induction of
macrophages. Several H3K9-specific lysine methyltransferases, H3K9me2/3 in infected macrophages.
such as Eset, KMT1E, and G9a, are involved in H3K9 methyla-
tion (53). Among them, G9a, also known as EHMT2, is a dom- ChIP analysis shows that H3K9 hypermethylation occurs at the
inant histone methyl transferase responsible for methylation promoter IV region of CIITA
of H3K9 (54). Transcriptional analysis showed a significant A ChIP assay was performed to check H3K9me2/3 in the
increase in G9a level in M. smegmatis esxL (p ⱕ 0.01; Fig. 5G)- CIITA promoter. Sequence analysis revealed the presence of
and M. tuberculosis (p ⱕ 0.001; Fig. 5H)-infected THP-1 cells, three promoter regions (CIITApI, CIITApIII, and CIITApIV)
whereas Mtb⌬esxL infection down-regulated G9a expression in CIITA (16). As shown, M. smegmatis esxL down-regulated
(p ⱕ 0.001; Fig. 5H). Otherwise, treatment with G9a inhibi- CIITA expression by inducing H3K9me2/3 at the promoter IV
tor (UNC0638) subdued the expression of H3K9me2/3 in region of CIITA (p ⱕ 0.001; Fig. 5J), whereas no such modifica-
M. smegmatis esxL-infected macrophages when compared tion was observed at CIITApI and CIITApIII promoters (data
with untreated cells (Fig. 5I). Similar results were obtained not shown). Moreover, we did not observe any H3K9me2/3
with M. bovis BCG infection, where BCG infection increased enrichment in M. smegmatis pSMT3-infected cells. Impor-
the level of H3K9me2/3, whereas treatment with G9a inhib- tantly, inhibition of G9a significantly decreased H3K9 hyper-
itor reduced H3K9me2/3 level (Fig. 5D). Collectively, these methylation at CIITA promoter IV in M. smegmatis esxL-in-
results indicate that M. smegmatis esxL, M. tuberculosis, and fected macrophages (p ⱕ 0.01; Fig. 5K). These results clearly
M. bovis BCG induce H3K9me2/3 via G9a methyltransferase. indicate that M. smegmatis esxL down-regulates G9a-depen-

6860 J. Biol. Chem. (2017) 292(17) 6855–6868


Role of mycobacterial EsxL in epigenetic modifications

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


Figure 5. Expression of H3K9me2/3 in macrophages. RAW 264.7 cells were infected with M. smegmatis (Msm) pSMT3 and recombinant M. smegmatis esxL for
2 h. The expression of H3K9me2/3 was determined by Western blotting (A) and immunofluorescence microscopy (B) 24 h post-infection. C, Western-blotting
analysis of H3K4me3 and total H3 was performed in M. smegmatis pSMT3 and recombinant M. smegmatis esxL-infected macrophages 24 h post-infection. D,
expression of H3K9me2/3 was determined in M. bovis BCG-infected RAW 264.7 cells in the presence and absence of G9a inhibitor (UNC0638) 24 h post-
infection. E, the level of H3K9me2/3 was determined in M. tuberculosis (Mtb) H37Rv-infected THP-1 by Western blotting using an antibody specific to
H3K9me2/3 24, 48, and 72 h post-infection. F, differentiated THP-1 cells were infected with M. tuberculosis and Mtb⌬esxL for 4 h. The level of H3K9me2/3 was
checked by Western blotting 24 and 48 h post-infection. The level of G9a expression was checked in M. smegmatis pSMT3- and recombinant M. smegmatis
esxL-infected RAW 264.7 cells (G) and M. tuberculosis- and Mtb⌬esxL-infected THP-1 cells (H) by qRT-PCR. I, RAW 264.7 cells were treated with UNC0638 (G9a
inhibitor), followed by infection with M. smegmatis pSMT3 and recombinant M. smegmatis esxL. Expressions of CIITA and H3K9me2/3 were checked by Western
blotting 24 h post-infection. A ChIP assay was performed to check the H3K9me2/3 enrichment at the CIITA promoter (pIV) after infecting RAW 264.7 cells with
M. smegmatis pSMT3 and recombinant M. smegmatis esxL without treatment (J) and after treatment with G9a inhibitor (K) 24 h post-infection. Quantification
of the data was done by qRT-PCR using specific ChIP primers. The GAPDH promoter was taken as an additional negative control for ChIP qRT-PCR. For qRT-PCR,
GAPDH was taken as an internal control. The experiments were performed in triplicate (n ⫽ 3). Results are shown as mean ⫾ S.D. (error bars); *, p ⱕ 0.05; **, p ⱕ
0.01; ***, p ⱕ 0.001; ns, not significant.

dent CIITA expression by promoting H3K9me2/3 in the pro- Increased MAPK leads to recruitment of histone deacetylases
moter IV region of CIITA. (HDACs), leading to gene repression (58). Mycobacteria, in
addition to selective antigens, are known to induce MAPK sig-
M. smegmatis esxL triggers H3K9me2/3-mediated CIITA naling in macrophages (59). In this context, we addressed the
inhibition by inducing the MAPK-signaling pathway role of the MAPK-signaling pathway in the regulation of
NO acts as a key intermediate in regulation of cell-fate deci- H3K9me2/3 and CIITA expression. We found that M. smeg-
sions by modulating several signaling pathways in the host cells matis esxL infection triggered the activation of pp38 (Fig. 6A)
(55, 56). Hence, we postulated that signaling cascades that reg- and pERK (Fig. 6B) when compared with control conditions.
ulate NO production could act as a focal point in M. smegmatis Similarly, M. tuberculosis infection also induced pp38 expres-
esxL infection-triggered histone modification that subse- sion when compared with Mtb⌬esxL-infected THP-1 cells (Fig.
quently leads to inhibition of MHC-II or CIITA. MAPK path- 6C). Importantly, pretreatment with p38 inhibitor (SB203580)
ways are known to regulate eukaryotic gene expression by mod- abrogated the M. smegmatis esxL-induced inhibition of CIITA
ulating the chromatin structure of regulatory elements (57). (Fig. 6D, top). Similarly, treatment with SB203580 down-regu-

J. Biol. Chem. (2017) 292(17) 6855–6868 6861


Role of mycobacterial EsxL in epigenetic modifications

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


Figure 6. Role of p38, ERK, and iNOS in CIITA and H3K9me3 expression. RAW 264.7 cells were infected with M. smegmatis (Msm) pSMT3 and recombinant
M. smegmatis esxL for 2 h. The expression of pp38 (A) and pERK (B) was estimated by Western blotting 24 h post-infection. C, THP-1 cells were infected with
M. tuberculosis (Mtb) and Mtb⌬esxL for 2 h, and the level of pp38 was determined by Western blotting 24 h post-infection. The expression of CIITA and H3K9me3
were checked in M. smegmatis pSMT3- and recombinant M. smegmatis esxL-infected cells after treatment with SB203580 (p38 inhibitor) (D) and U0126 (ERK
inhibitor) (E) by Western blotting 24 h post-infection. F, the expression of CIITA, H3K9me3, and iNOS were checked in M. smegmatis pSMT3- and recombinant
M. smegmatis esxL-infected RAW 264.7 cells after treatment with 1400W (iNOS inhibitor). The experiments were performed in triplicate (n ⫽ 3).

lated the expression of H3K9me2/3 in M. smegmatis esxL-in- CFP-10, lipoproteins, and PE/PPE (proline-glutamic acid/
fected macrophages (Fig. 6D, middle). On the other hand, inhi- proline-proline-glutamic acid) proteins, are known to be in-
bition of pERK by the pharmacological inhibitor U0126 did volved in the establishment of the infection process (60 – 67).
not show any effect on the expression of either CIITA or Herein, we reported that M. tuberculosis esxL represses
H3K9me2/3 during M. smegmatis esxL infection when com- CIITA/MHC-II expression by inducing H3K9me2/3 in the
pared with untreated macrophages (Fig. 6E). These results CIITA promoter. Previously, we and several others have
clearly suggest that the M. smegmatis esxL-triggered p38 MAPK- used M. smegmatis as a surrogate model to elucidate the
signaling pathway holds the capacity to modulate H3K9me2/3 function of M. tuberculosis proteins in pathogenesis. For
expression to regulate CIITA/MHC-II expression. example, expression of M. tuberculosis Mce4A protein in
M. smegmatis esxL-induced NO production regulates non-pathogenic Escherichia coli increased invasion in HeLa
induction of H3K9me2/3 and inhibition of CIITA expression cells (68), whereas expression of M. tuberculosis PE proteins in
M. smegmatis increased its virulence properties (69). Based on
Next, we assessed the role of iNOS/NO during M. smegmatis
this evidence, we expressed M. tuberculosis esxL in an M. smeg-
esxL infection in modulating the expression of H3K9me3 and
matis strain and also deleted esxL from the M. tuberculosis
CIITA. For this, macrophages were infected with M. smegmatis
genome (Mtb⌬esxL) and proved its function using a macro-
pSMT3 and M. smegmatis esxL strains and then treated with an
phage infection model.
iNOS inhibitor, 1400W. Treatment with the 1400W inhibitor
The M. smegmatis genome does not contain esxL ortho-
severely down-regulated the expression of H3K9me2/3 in
M. smegmatis esxL-infected macrophages (Fig. 6F). On the logue; therefore, the observed phenotypes can be attributed to
other hand, inhibition of iNOS led to increased expression of the ectopic expression of esxL in M. smegmatis. Using human
CIITA when compared with untreated conditions (Fig. 6F). and mice macrophage infection models, we showed that
These results confirm the crucial role of NO in repression of recombinant M. smegmatis esxL strain survives more as com-
CIITA by increasing hypermethylation of H3K9. pared with control strains, indicating that EsxL is involved in
bacillary persistence in macrophages. It is well established that
Discussion pathogenic M. tuberculosis facilitates its survival by modulating
M. tuberculosis adopts various strategies to evade the host ROS and NO production (70 –73). We observed that M. smeg-
defense mechanisms to facilitate its survival. One such mecha- matis esxL strain increased NO and iNOS production in
nism involves epigenetic modifications in the host proteins to infected macrophages, whereas inhibition of iNOS decreased
dampen antibacterial effector functions of host cells. In this the intracellular survival of M. smegmatis esxL. On the con-
context, various M. tuberculosis proteins, including ESAT-6, trary, Mtb⌬esxL reduced iNOS expression. The role of NO as

6862 J. Biol. Chem. (2017) 292(17) 6855–6868


Role of mycobacterial EsxL in epigenetic modifications
an antimicrobial agent has been extensively studied in the con- the expression of KLF4 transcription factor. KLF4 acts as a reg-
text of host defense mechanisms. Nevertheless, a previous ulatory switch and inhibits CIITA expression (29).
study (74) has provided evidence that reactive nitrogen inter- In summary, we have studied a mechanism in detail that
mediate helps in proliferation of M. tuberculosis, suggesting a leads to repression of CIITA/MHC-II during M. tuberculosis
bacteriostatic effect of reactive nitrogen intermediate on infection. Fig. 7 shows a schematic representation of a mecha-
M. tuberculosis. In addition to antimicrobial properties, NO/ nism that leads to repression in antigen presentation and T-cell
iNOS are also known to modulate several signaling cascades activation by inducing H3K9me2/3 in promoter IV region of
that regulate cell fate decisions of host cells (54, 56). Previous CIITA via NO, p38 MAPK, and G9a during infection.
studies have shown that M. tuberculosis down-regulates
CIITA, thus altering antigen presentation (75). However, the Experimental procedures
specific M. tuberculosis protein responsible for observed down- Chemicals, reagents, and cell culture conditions
regulation is not known. Our study has provided sufficient data Mycobacterium smegmatis mc2155 was grown in Middle-
that EsxL could be responsible for CIITA down-regulation. brook’s 7H9 broth medium (Difco) containing 0.05% Tween 80,
Studies have shown that epigenetic modifications are involved 0.5% glucose, and 0.5% albumin at 37 °C on a shaker at 120 rpm.
in regulating CIITA expression (47, 76, 77). Studies also showed M. tuberculosis H37Rv and M. bovis BCG were grown in
that M. tuberculosis proteins like LpqH and ESAT-6 cause Middlebrook’s 7H9 broth medium (Difco) containing 0.05%
CIITA inhibition by decreasing histone H3K4 methylation level Tween 80, 0.5% glucose, 0.5% albumin, and oleic albumin dex-
and acetylation levels (16,18). Our study has unambiguously trose catalase at 37 °C on a shaker at 120 rpm. E. coli XL-10
shown that M. tuberculosis esxL induced H3K9me2/3 in host Gold (Stratagene) was grown in Luria-Bertani (LB) broth sup-
cells. H3K9me1/2/3 is known for transcriptional repression of plemented with 20 ␮g/ml tetracycline. pSMT3 vector was a

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


the gene, which undergoes modification at its promoter region kind gift from Dr. Rakesh Sharma (Institute of Genomics and
(41, 52). We have further proved that induction of H3K9me2/3 Integrative Biology, Delhi, India). The murine RAW 264.7
by EsxL is mediated via G9a, which is a known histone methyl- macrophage cell line was cultured in DMEM (HiMedia, Mum-
transferase responsible for H3K9 methylation. Inhibition of bai, India) supplemented with 10% fetal bovine serum, 1% pen-
G9a down-regulated H3K9me2/3 and simultaneously resulted icillin-streptomycin solution, and 1% L-glutamine. THP-1 cells
in up-regulation of CIITA, indicating that G9a methyltrans- (78) were grown in RPMI 1640 (Gibco) supplemented with 10%
ferase is responsible for H3K9 hypermethylation in the CIITA FBS, 10 mM HEPES, 1 mM sodium pyruvate, and penicillin-
promoter. Indeed, a ChIP assay showed that M. tuberculosis streptomycin solution. The cells were seeded onto 24-well cul-
esxL promoted H3K9me2/3 at the promoter IV region of the ture dishes at a density of 2 ⫻ 105 cells/ml and treated overnight
CIITA gene, which led to the transcriptional repression of with 20 nM PMA (Sigma) for 24 h. Cells were then washed three
CIITA that subsequently perturbed antigen presentation and times with PBS and incubated for one more day before per-
T-cell activation. The level of H3K9me2/3 was also found forming the experiment. Anti-iNOS, anti-H3K9me3, anti-
to be increased in M. bovis BCG- and M. tuberculosis-infected phospho-p38, anti-phospho-ERK1/2, anti- histone H3, anti-␤-
macrophages, whereas levels of H3K9me2/3, CIITA, MHC-II, actin, anti-GAPDH, and secondary goat anti-rabbit and goat
iNOS, and p38 were down-regulated in Mtb⌬esxL-infected anti-mouse antibodies were purchased from Cell Signaling
macrophages. M. bovis BCG contains the esxL orthologue Technologies. Anti-CIITA antibody was purchased from
Mb1230. Therefore, M. bovis BCG-induced H3K9me2/3 could Abcam (Cambridge, UK). Anti-MHC-II and anti-mouse IgG
be attributed to this protein. were procured from Santa Cruz Biotechnology, Inc. FITC-la-
The MAPK-signaling pathway plays a crucial role in myco- beled anti-human MHCII antibody was purchased from Invit-
bacterial infection. M. tuberculosis 38-kDa protein was shown rogen. Secondary antibodies including goat anti-mouse IgG,
to induce TNF-␣ and IL-6 through the MAPK pathway to facil- Alexa Fluor 633, goat anti-rabbit IgG, and Alexa Fluor 488 were
itate mycobacterial infection (41). As shown before, MAPK purchased from Thermo Fisher Scientific. Mounting solution
components ERK and p38 are known to alter gene transcription with DAPI was purchased from DAKO. All of the pharmaco-
by altering chromatin structure (57). The recruitment of logical inhibitors were purchased from Sigma and Calbiochem
HDACs at the promoter site of the gene is known to be facili- and reconstituted in DMSO (Himedia, Mumbai, India) or ster-
tated by MAPK (58). In this study, we found that M. smegmatis ile H2O at the following concentrations: 1400W (100 ␮M),
esxL infection up-regulated ERK and p38 levels in macro- U0126 (10 ␮M), SB203580 (10 ␮M), and UNC0638 hydrate (5
phages. However, inhibition of p38 down-regulated the expres- ␮M).
sion of H3K9me2/3 and CIITA, indicating that EsxL-induced
H3K9me2/3 is mediated via p38 signaling pathway. Previous Cloning and expression of esxL
studies have shown the involvement of p38 in repressive epige- M. tuberculosis esxL was PCR-amplified using gene-specific
netic modification. M. tuberculosis LpqH activates p38, which primers (Table 1) and M. tuberculosis genomic DNA as tem-
in turn facilitates the recruitment of HDAC to the promoter of plate. The PCR-amplified products were gel-purified, double-
CIITA, thus repressing gene transcription (18). We further digested with PstI and HindIII, and cloned into pSMT3 shuttle
showed that EsxL-induced H3K9me2/3 is dependent on NO vector. The recombinant constructs were transformed into
production. There are reports suggesting the involvement of competent E. coli XL-10 gold. The positive clones were selected
NO/iNOS in down-regulation of CIITA. A study has shown on LB agar plates supplemented with 20 ␮g/ml tetracycline and
that BCG infection increased NO production that up-regulated 50 ␮g/ml hygromycin. The positive clones were confirmed by

J. Biol. Chem. (2017) 292(17) 6855–6868 6863


Role of mycobacterial EsxL in epigenetic modifications

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


Figure 7. Schematic representation showing the role of M. tuberculosis esxL in induction of hypermethylation of H3K9, which down-regulates the
expression of CIITA, the major co-activator of MHCII. Thus, H3K9 hypermethylation results in down-regulation of MHCII expression and reduced production
of IL-2.

Table 1 fragments from pYUB1471 to generate allelic exchange sub-


Oligonucleotides used in this study strate. Allelic exchange substrate was packaged into phAE159
Serial no. Primer name Sequence (5ⴕ–3ⴕ) phasmid (a kind gift from Dr. William Jacob’s laboratory), and
1 esxL FP GTCCCTGCAGGATGACCATCAACTATC high-titer phages were generated and transduced into M. tuber-
2 esxL RP GTCCAAGCTTTCAGGCCCAGCTGGAG
3 iNOS FP TTC CAA GAG CCT TGC TGT TT culosis H37Rv harboring pNit-ET plasmid as described earlier
4 iNOS RP GTA GGT AAG GGC GTT GGT CA (79).
5 CIITA FP ACGCTTTCTGGCTGGATTAGT
6 CIITA RP TCAACGCCAGTCTGACGAAGG
7 MHCII FP TGGGCACCATCTTCATCATTC Intracellular bacterial survival assay
8 MHCII RP GGTCACCCAGCACACCACTT
9 GAPDH FP GAGAGGCCCTATCCCAACTC M. smegmatis harboring plasmid pSMT3 (M. smegmatis
10 GAPDH RP TTCACCTCCCCATACACACC pSMT3) and recombinant M. smegmatis expressing M. tuber-
11 esxL qRT FP GTTGACCGCGAGTGACTTTT
12 esxL qRT RP GGTTTGCGCCATGTTGTT
culosis esxL (M. smegmatis esxL) strains were grown to mid-
13 SigA FP CCAAGGGCTACAAGTTCTCG exponential phase. Then bacterial cultures were pelleted,
14 SigA RP TGGATCTCCAGCACCTTCTC washed in 1⫻ PBS, and resuspended in DMEM to a final A600 of
0.1. Bacterial clumps were broken by ultrasonication for 5 min,
colony PCR and sequencing using gene-specific primers. followed by a low-speed centrifugation for 2 min. RAW 264.7
Finally, the recombinant constructs were transformed into macrophages (2 ⫻ 105 cells/well) were seeded on 24-well tissue
electrocompetent M. smegmatis. The positive colonies were culture plates with medium containing no antibiotic solution
selected on 7H9 medium containing 50 ␮g/ml hygromycin B. and grown for 18 –20 h. Cells were infected with M. smegmatis
The positive transformants were confirmed by colony PCR and pSMT3 and M. smegmatis esxL strains at a multiplicity of infec-
sequencing using gene-specific primers. tion of 10, and intracellular survival was determined by lysing
the infected macrophages with 0.5% Triton X-100 at different
Generation of M. tuberculosis esxL mutant time points. Bacterial survival was determined by plating the
A temperature-sensitive phage-based transduction method- serially diluted samples onto 7H9 plates. The equal input and
ology was used for the generation of M. tuberculosis esxL dele- time 0 (T0) counts of infecting bacilli were determined to cal-
tion mutant (Fig. 1, G and H). Upstream (814-bp) and down- culate the percentage survival, % survival ⫽ cfu at required
stream (812-bp) flank regions were PCR-amplified, and the time/cfu of bacteria added ⫻ 100. For the THP-1 infection
amplicons were digested with PflMI restriction enzyme. Flanks assay, cells were first treated with 20 nM PMA in RPMI medium,
were ligated with the compatible sacB⫹hygr and oriE⫹␭cos and the infection assay was performed as described above.

6864 J. Biol. Chem. (2017) 292(17) 6855–6868


Role of mycobacterial EsxL in epigenetic modifications
Extracellular expression of esxL malized to the transcript levels of GAPDH, and the relative
M. smegmatis esxL strain was grown in vitro for 24 h in 7H9 -fold changes were calculated.
broth supplemented with 0.05% Tween 80 under shaking con-
Western-blotting analysis
ditions. Cell pellets were harvested, followed by RNA isolation
and cDNA synthesis. qRT-PCR was performed using gene-spe- RAW 264.7 cells were infected with M. smegmatis pSMT3
cific primers and cDNA as template. sigA was used as an inter- and M. smegmatis esxL. After 24 h of infection, protein samples
nal control. were prepared by cell lysis using RIPA buffer (HiMedia) con-
taining 5 mM EDTA, 5 mM EGTA, 1 mM PMSF, protease inhib-
Intracellular expression of esxL itor mixture, 50 mM NaF, 1 mM DTT, 1 mM sodium orthovana-
date. Proteins were electrophoresed in 12% SDS-PAGE and
RAW 264.7 macrophages were infected with M. smegmatis
transferred to polyvinylidene difluoride (PVDF) membrane
esxL, and RNA was isolated at the 4-, 12-, and 24-h time points,
(GE Healthcare) overnight at 28 V. Then the blots were blocked
followed by cDNA synthesis. qRT-PCR was performed using
with 5% BSA or skimmed milk in TBST (20 mM Tris-HCl, pH
the cDNA as templates using gene-specific primers (Table 1).
7.4, 137 mM NaCl, and 0.1% Tween 20) for 60 min. Then blots
sigA was used as an internal control.
were incubated with primary antibodies (1:1000) overnight at
Infection with M. tuberculosis H37Rv and Mtb⌬esxL 4 °C and then with HRP-conjugated anti-rabbit or anti-mouse
IgG secondary antibodies in 5% BSA or skimmed milk (1:1000)
THP1 cells were maintained in RPMI 1640 supplemented for 2 h at room temperature. The membrane was washed using
with 10% heat-inactivated FBS and differentiated using PMA. 1⫻ TBST, and X-ray film was developed using standard chemi-
The infection experiment with M. tuberculosis H37Rv and luminescent solvent. ␤-Actin and GAPDH were used as loading

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


Mtb⌬esxL strains was performed as described earlier (8). For controls.
the lysate preparation, 8 ⫻ 106 cells were seeded in 10-cm cell
culture dishes, and the infection was performed at a 1:5 multi- Immunofluorescence
plicity of infection. At different time points, cells were washed For immunofluorescence studies, RAW 264.7 macrophages
with PBS and lysed by using 600 ␮l of RIPA buffer, vortexed for (5 ⫻ 104) were seeded on coverslips. After infecting the cells
30 s, and kept in ice. The procedure was repeated three times, with M. smegmatis pSMT3 and M. smegmatis esxL, cells were
and the cell lysates were clarified at 13,000 rpm (Sigma 3-30K, fixed with acetone/methanol (1:1) for 20 min at ⫺20 °C and
12154) at 4 °C. then blocked with 5% BSA for 1 h at room temperature and
stained with primary anti-iNOS and anti-H3K9me3 antibodies
Free NO estimation
overnight in the dark. Then the coverslips were stained with
RAW 264.7 cells (2 ⫻ 105 cells/well) were seeded on 24-well secondary antibodies for 2 h at room temperature. Finally, the
plates. Next day, the cells were infected with M. smegmatis cells were mounted in mounting solution with DAPI, and the
pSMT3 and M. smegmatis esxL strains for 24 h. The accumula- images were analyzed using a BX61 Olympus fluorescence
tion of nitrite was measured by mixing 100 ␮l of culture super- microscope and Cytovision software version 7.2.
natants with an equal volume of Griess reagent (1% sulfanila-
mide, 0.1% naphthylethylenediamine dihydrochloride in 5% Flow cytometry analysis
concentrated H3PO4) in 96-well plates. The plates were incu- For flow cytometry analysis, THP-1 (2 ⫻ 105) and RAW
bated for 10 min at room temperature, and absorbance was 264.7 (2 ⫻ 105) cells were seeded onto 24-well cell culture
measured at 550 nm in a microtiter plate reader (EPOCH, plates. Cells were infected with M. smegmatis pSMT3 and
BioTek). The nitrite concentrations (in ␮mol/sample) were M. smegmatis esxL for 24 h. The cells were then harvested and
determined by a least-square linear regression analysis using blocked with 0.1% BSA for 15 min on ice. The cells were then
sodium nitrite as a standard (5–100 ␮M range). The values were centrifuged at 2500 rpm (Sigma 3-30K, 12154) for 5 min, fol-
averaged from three independent experiments. lowed by staining with primary FITC-labeled anti-human
MHC-II (FITC) and anti-mouse MHC-II (APC) antibodies for
RNA isolation and quantitative real-time RT-PCR 30 min on ice and then with secondary antibodies. Uninfected
Total RNA was isolated from infected or uninfected macro- cells were taken as negative control. Flow cytometry was per-
phages using TRIzol reagent (Invitrogen) as per the manufactu- formed by analyzing 10,000 gated cells using a FACS Canto II
rer’s protocol. The cDNA synthesis kit (Thermo Fisher Scien- flow cytometer and FACS Diva software.
tific) was used for reverse transcription according to the
manufacturer’s protocol. Quantitative real-time RT-PCR ChIP assay
amplification using the SYBR Green PCR mixture (KAPA Bio- For the ChIP assay, RAW 264.7 (1 ⫻ 107) cells were seeded
systems) was performed for quantification of target gene onto 100-mm tissue culture disks. Cells were infected with
expression in a Real Plex master cycler (Eppendorf, Hamburg, M. smegmatis pSMT3 and M. smegmatis esxL. For the ChIP
Germany) with initial denaturation at 95 °C for 10 min, final assay with G9a inhibition, RAW 264.7 cells were infected with
denaturation at 95 °C for 30 s, annealing at 52 °C for 30 s, and M. smegmatis esxL and then treated with G9a inhibitor,
extension at 72 °C for 30 s to generate 200-bp amplicons. All UNC0638. After 24 h of infection, cells were washed twice with
reactions were repeated at least three times independently to 1⫻ PBS and then cross-linked with 11% formaldehyde solution
ensure reproducibility of the result. The mRNA levels were nor- for 15 min, followed by 2.5 M glycine treatment for quenching

J. Biol. Chem. (2017) 292(17) 6855–6868 6865


Role of mycobacterial EsxL in epigenetic modifications
Table 2 Statistical analysis
Oligonucleotides used in ChIP assay
All experiments were performed at least three times (n ⫽ 3).
Serial no. Primer name Sequence (5ⴕ–3ⴕ)
Statistical analyses were performed using the Mann-Whitney U
1 CIITApI FP GCATAGCAGATGCAAAACCA
2 CIITApI RP GGGCAGATTATTACAGATTAGTTGC
test (two-tailed, equal variances). Significance is shown as fol-
3 CIITApIII FP ACGTCCAGAGAAACTCAATGC lows: *, p ⱕ 0.05; **, p ⱕ 0.01; ***, p ⱕ 0.001.
4 CIITApIII RP AGAGCTGTTAGGGACATGGTG
5 CIITApIV FP CTACTGGCTCAAATCTGTCGTC
6 CIITApIV RP CAGGCAGATCTCACTTAGACCA Author contributions—S. S. planned the experimental setup, per-
7 GAPDHpromoter FP GGATAGAATGTAGCCCTGGACTT formed the experiments, analyzed the data, and wrote the manu-
8 GAPDHpromoter RP TGTGCATGTATCTTTATTGGCTCT
script. I. D., A. P., S. K. N., G. G., and K. P. P. analyzed the experi-
ments and provided technical assistance. S. N. constructed the esxL
knockout (Mtb⌬esxL) mutant and performed the M. tuberculosis
formaldehyde solution. The cells were then washed with ice- infection assay. V. K. N. supervised the construction of the knock-
cold 1⫻ PBS twice. The cells were then harvested by scrapping out mutant and provided the BSL3 laboratory facility. A. A. con-
using ice-cold 1⫻ PBS and centrifuged at 2500 rpm (Sigma tributed in performing the ChIP assay experiments and analysis of
3-30K, 12154) for 5 min at 4 °C, followed by washing with 1⫻ data. S. K. R. supervised the ChIP assay experiments and contrib-
PBS. The pellets were then resuspended with 1 ml of ice-cold uted in analyzing the data. A. S. planned the experimental setup
Farnham buffer and then centrifuged at 2000 rpm (Sigma and data analysis, wrote the manuscript, and provided all of the
3-30K, 12154) for 5 min at 4 °C. The pellet was resuspended necessary resources and support for the completion of the study.
with 300 ␮l of RIPA buffer and then kept on ice for 10 min, All authors reviewed the results and approved the final version of
the manuscript.
followed by sonication in a Bioruptor at the high setting for a

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


total time of 40 min, 30 s on, 30 s off at 4 °C. The chromatin Acknowledgments—We thank members of the Sonawane laboratory
length was then verified, and processed for further steps. The for fruitful discussions and critical reading of the manuscript.
sonicated mixture was centrifuged at 14,000 rpm (Sigma
3⫺30K, 12154) for 15 min at 4 °C. The supernatant was col-
References
lected and quantified, and the volume was adjusted with RIPA
buffer so that each reaction has 150 ␮g/ml chromatin. The sus- 1. Barros, S. P., and Offenbacher, S. (2014) Modifiable risk factors in peri-
odontal disease: epigenetic regulation of gene expression in the inflamma-
pension was then incubated with previously prepared Protein tory response. Periodontol. 2000 64, 95–110
A-Sepharose beads for 1 h at 4 °C in a rotator. After centrifuga- 2. Esterhuyse, M. M., Linhart, H. G., and Kaufmann, S. H. (2012) Can the
tion at 1500 rpm (Sigma 3⫺30K, 12154) for 2 min at 4 °C, the battle against tuberculosis gain from epigenetic research? Trends Micro-
supernatant was taken and incubated overnight with 6 ␮g of biol. 20, 220 –226
antibodies against H3K9me2/3 and mouse IgG per immuno- 3. Hamon, M. A., and Cossart, P. (2008) Histone modifications and chroma-
tin remodeling during bacterial infections. Cell Host Microbe 4, 100 –109
precipitation at 4 °C for overnight rotation. The next day, the 4. Saccani, S., Pantano, S., and Natoli, G. (2002) p38-dependent marking of
suspensions were again incubated with Protein A-Sepharose inflammatory genes for increased NF-␬B recruitment. Nat. Immunol. 3,
beads at 4 °C for 2 h in a rotator and then centrifuged at 2000 69 –75
rpm (Sigma 3⫺30K, 12154) for 1 min. The pellets were then 5. Basak, C., Pathak, S. K., Bhattacharyya, A., Pathak, S., Basu, J., and Kundu,
M. (2005) The secreted peptidyl prolyl cis, trans-isomerase HP0175 of
washed using LiCl wash buffer (7– 8 times) and TE buffer
Helicobacter pylori induces apoptosis of gastric epithelial cells in a TLR4-
(once). The pellet was then dissolved in immunoprecipitation and apoptosis signal-regulating kinase 1-dependent manner. J. Immunol.
elution buffer for 30 min at room temperature, and then the 174, 5672–5680
supernatants were left at 65 °C overnight for reverse cross-link- 6. Schmeck, B., Beermann, W., van Laak, V., Zahlten, J., Opitz, B., Witzen-
ing. The next day, the RNA and protein were digested with rath, M., Hocke, A. C., Chakraborty, T., Kracht, M., Rosseau, S., Suttorp,
N., and Hippenstiel, S. (2005) (2005) Intracellular bacteria differentially
RNase and Proteinase K to obtain purified DNA. The DNA (150
regulated endothelial cytokine release by MAPK-dependent histone mod-
␮g) isolated from 1 ⫻ 107 cells was further processed for quan- ification. J. Immunol. 175, 2843–2850
titative PCR using specific primers for CIITApI, CIITApIII, CII- 7. Hamon, M. A., Batsché, E., Régnault, B., Tham, T. N., Seveau, S., Mucha-
TApIV, and GAPDH promoter. The quantitative PCR data were rdt, C., and Cossart, P. (2007) Histone modifications induced by a family of
then normalized to input DNA. Primers for GAPDH promoter bacterial toxins. Proc. Natl. Acad. Sci. U.S.A. 104, 13467–13472
8. Soni, V., Upadhayay, S., Suryadevara, P., Samla, G., Singh, A., Yogeeswari,
and antibody against mouse IgG both were used as negative
P., Sriram, D., and Nandicoori, V. K. (2015) Depletion of M. tuberculosis
controls (Table 2). GlmU from infected murine lungs effects the clearance of the pathogen.
PLoS Pathog. 11, e1005235
Cytokine profiling 9. World Health Organization (2014) Tuberculosis. www.who.int/media-
centre/factsheets/fs104/en/, World Health Organization, Geneva
RAW 264.7 cells (2 ⫻ 105) were seeded onto a 24-well tissue 10. Boshoff, H. I., and Barry, C. E., 3rd. (2005) Tuberculosis: metabolism and
culture plate and infected with M. smegmatis pSMT3 and respiration in the absence of growth. Nat. Rev. Microbiol. 3, 70 – 80
M. smegmatis esxL. After 2 h of infection, 20 mg/ml gentamycin 11. Pieters, J. (2001) Entry and survival of pathogenic mycobacteria in macro-
containing DMEM was added to kill the extracellular bacteria. phages. Microbes. Infect. 3, 249 –255
After 1 h, the cells were then co-cultured with splenocytes iso- 12. Cole, S. T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D.,
Gordon, S. V., Eiglmeier, K., Gas, S., Barry, C. E., 3rd, Tekaia, F., Badcock,
lated from BALB/c mice. After 24 h, the supernatant was har- K., Basham, D., Brown, D., Chillingworth, T., et al. (1998) Deciphering the
vested, and cytokine levels were estimated using the Bioplex kit biology of Mycobacterium tuberculosis from the complete genome se-
assay (Bio-Rad). quence. Nature 393, 537–544

6866 J. Biol. Chem. (2017) 292(17) 6855–6868


Role of mycobacterial EsxL in epigenetic modifications
13. Rahman, M. A., Sobia, P., Dwivedi, V. P., Bhawsar, A., Singh, D. K., 31. Manzanillo, P. S., Shiloh, M. U., Portnoy, D. A., and Cox, J. S. Mycobacte-
Sharma, P., Moodley, P., Van Kaer, L., Bishai, W. R., and Das, G. (2015) rium tuberculosis activates the DNA-dependent cytosolic surveillance
Mycobacterium tuberculosis TlyA protein negatively regulates T helper pathway within macrophages. Cell Host Microbe 11, 469 – 480
(Th) 1 and Th17 differentiation and promotes tuberculosis pathogenesis. 32. Simeone, R., Bobard, A., Lippmann, J., Bitter, W., Majlessi, L., Brosch, R.,
J. Biol. Chem. 290, 14407–14417 and Enninga, J. (2012) Phagosomal rupture by Mycobacterium tuberculo-
14. Hickman, S. P., Chan, J., and Salgame, P. (2002) Mycobacterium tubercu- sis results in toxicity and host cell death. PLoS Pathog. 8, e1002507
losis induces differential cytokine production from dendritic cells and 33. Geluk, A., van Meijgaarden, K. E., Franken, K. L., Subronto, Y. W., Wieles,
macrophages with divergent effects on naive T cell polarization. J. Immu- B., Arend, S. M., Sampaio, E. P., de Boer, T., Faber, W. R., Naafs, B., and
nol. 168, 4636 – 4642 Ottenhoff, T. H. (2002) Identification and characterization of the ESAT-6
15. Briken, V., and Miller, J. L. (2008) Living on the edge: inhibition of host cell homologue of Mycobacterium leprae and T-cell cross-reactivity with My-
apoptosis by Mycobacterium tuberculosis. Future Microbiol. 3, 415– 422 cobacterium tuberculosis. Infect. Immun. 70, 2544 –2548
16. Kumar, P., Agarwal, R., Siddiqui, I., Vora, H., Das, G., and Sharma, P. 34. Mohanty, S., Jagannathan, L., Ganguli, G., Padhi, A., Roy, D., Alaridah, N.,
(2012) ESAT6 differentially inhibits IFN-␥-inducible class II transactiva- Saha, P., Nongthomba, U., Godaly, G., Gopal, R. K., Banerjee, S., and
tor isoforms in both a TLR2-dependent and -independent manner. Im- Sonawane, A. (2015) A mycobacterial phosphoribosyltransferase pro-
munol. Cell Biol. 90, 411– 420 motes bacillary survival by inhibiting oxidative stress and autophagy path-
17. Siddle, K. J., Deschamps, M., Tailleux, L., Nédélec, Y., Pothlichet, J., Lugo- ways in macrophages and zebrafish. J. Biol. Chem. 290, 13321–13343
Villarino, G., Libri, V., Gicquel, B., Neyrolles, O., Laval, G., Patin, E., Bar- 35. Padhi, A., Naik, S. K., Sengupta, S., Ganguli, G., and Sonawane, A. (2016)
reiro, L. B., and Quintana-Murci, L. (2014) A genomic portrait of the Expression of Mycobacterium tuberculosis NLPC/p60 family protein
genetic architecture and regulatory impact of microRNA expression in Rv0024 induce biofilm formation and resistance against cell wall acting
response to infection. Genome Res. 24, 850 – 859 anti-tuberculosis drugs in Mycobacterium smegmatis. Microbes Infect. 18,
18. Pennini, M. E., Pai, R. K., Schultz, D. C., Boom, W. H., and Harding, C. V. 224 –236
(2006) Mycobacterium tuberculosis 19-kDa lipoprotein inhibits IFN-in- 36. Mohanty, S., Dal Molin, M., Ganguli, G., Padhi, A., Jena, P., Selchow, P.,
duced chromatin remodeling of MHC2TA by TLR2 and MAPK signaling. Sengupta, S., Meuli, M., Sander, P., and Sonawane, A. (2016) Mycobacte-

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


J. Immunol. 176, 4323– 4330 rium tuberculosis EsxO (Rv2346c) promotes bacillary survival by inducing
19. Boehm, U., Klamp, T., Groot, M., and Howard, J. C. (1997) Cellular re- oxidative stress mediated genomic instability in macrophages. Tuberculo-
sponses to interferon-␥. Annu. Rev. Immunol. 15, 749 –795 sis 96, 44 –57
37. Yaseen, I., Kaur, P., Nandicoori, V. K., and Khosla, S. (2015) Mycobacteria
20. Wang, Y., Curry, H. M., Zwilling, B. S., and Lafuse, W. P. (2005) Mycobac-
modulate host epigenetic machinery by Rv1988 methylation of a non-tail
teria inhibition of IFN-␥ induced HLA-DR gene expression by up-regu-
arginine of histone H3. Nat. Commun. 6, 8922
lating histone deacetylation at the promoter region in human THP-1
38. Sethi, D., Mahajan, S., Singh, C., Lama, A., Hade, M. D., Gupta, P., and
monocytic cells. J. Immunol. 174, 5687–5694
Dikshit, K. L. (2016) Lipoprotein, LprI, of Mycobacterium tuberculosis acts
21. Rich, E. A., Torres, M., Sada, E., Finegan, C. K., Hamilton, B. D., and
as a lysozyme inhibitor. J. Biol. Chem. 291, 2938 –2953
Toossi, Z. (1997) Mycobacterium tuberculosis (MTB)-stimulated produc-
39. Gu, S., Chen, J., Dobos, K. M., Bradbury, E. M., Belisle, J. T., and Chen,
tion of nitric oxide by human alveolar macrophages and relationship of
X. (2003) Comprehensive proteomic profiling of the membrane con-
nitric oxide production to growth inhibition of MTB. Tuber. Lung. Dis. 78,
stituents of a Mycobacterium tuberculosis strain. Mol. Cell Proteomics
247–255
2, 1284 –1296
22. Shiloh, M. U., and Nathan, C. F. (2000) Reactive nitrogen intermediates
40. Målen, H., Berven, F. S., Fladmark, K. E., and Wiker, H. G. (2007) Com-
and the pathogenesis of Salmonella and mycobacteria. Curr. Opin. Micro-
prehensive analysis of exported proteins from Mycobacterium tuberculo-
biol. 3, 35– 42
sis H37Rv. Proteomics 7, 1702–1718
23. Yang, C. S., Yuk, J. M., and Jo, E. K. (2009) The role of nitric oxide in
41. Pandey, H., Tripathi, S., Srivastava, K., Tripathi, D. K., Srivastava, M., Kant,
mycobacterial infections. Immune Netw. 9, 46 –52
S., Srivastava, K. K., and Arora, A. (2017) Characterization of culture fil-
24. Ehrt, S., Schnappinger, D., Bekiranov, S., Drenkow, J., Shi, S., Gingeras, trate proteins Rv1197 and Rv1198 of ESAT-6 family from Mycobacterium
T. R., Gaasterland, T., Schoolnik, G., and Nathan, C. (2001) Reprogram- tuberculosis H37Rv. Biochim. Biophys. Acta 1861, 396 – 408
ming of the macrophage transcriptome in response to interferon-␥ and 42. Alderson, M. R., Bement, T., Day, C. H., Zhu, L., Molesh, D., Skeiky, Y. A.,
Mycobacterium tuberculosis: signaling roles of nitric-oxide synthase-2 and Coler, R., Lewinsohn, D. M., Reed, S. G., and Dillon, D. C. (2000) Expres-
phagocyte oxidase. J. Exp. Med. 194, 1123–1140 sion cloning of an immunodominant family of Mycobacterium tuberculo-
25. Jagannath, C., Actor, J. K., and Hunter, R. L., Jr. (1998) Induction of nitric sis antigens using human CD4(⫹) T cells. J. Exp. Med. 191, 551–560
oxide in human monocytes and monocyte cell lines by Mycobacterium 43. Bose, M., Farnia, P., Sharma, S., Chattopadhya, D., and Saha, K. (1999)
tuberculosis. Nitric Oxide 2, 174 –186 Nitric oxide dependent killing of Mycobacterium tuberculosis by human
26. MacMicking, J., Xie, Q. W., and Nathan, C. (1997) Nitric oxide and macro- mononuclear phagocytes from patients with active tuberculosis. Int. J. Im-
phage function. Annu. Rev. Immunol. 15, 323–350 munopathol. Pharmacol. 12, 69 –79
27. Nicholson, S., Bonecini-Almeida Mda, G., Lapa e Silva, J. R., Nathan, C., 44. Bogdan, C. (2001) Nitric oxide and the immune response. Nat. Immunol.
Xie, Q. W., Mumford, R., Weidner, J. R., Calaycay, J., Geng, J., Boechat, N., 2, 907–916
Linhares, C., Rom, W., and Ho, J. L. (1996) Inducible nitric oxide synthase 45. Kanangat, S., Meduri, G. U., Tolley, E. A., Patterson, D. R., Meduri, C. U.,
in pulmonary alveolar macrophages from patients with tuberculosis. J. Pak, C., Griffin, J. P., Bronze, M. S., and Schaberg, D. R. (1999) Effects of
Exp. Med. 183, 2293–2302 cytokines and endotoxin on the intracellular growth of bacteria. Infect.
28. Serbina, N. V., Salazar-Mather, T. P., Biron, C. A., Kuziel, W. A., and Immun. 67, 2834 –2840
Pamer, E. G. (2003) TNF/iNOS-producing dendritic cells mediate innate 46. Singh, G., Singh, B., Trajkovic, V., and Sharma, P. (2005) Mycobacterium
immune defense against bacterial infection. Immunity 19, 59 –70 tuberculosis 6 kDa early secreted antigenic target stimulates activation of
29. Ghorpade, D. S., Holla, S., Sinha, A. Y., Alagesan, S. K., and Balaji, K. N. J774 macrophages. Immunol. Lett. 98, 180 –188
(2013) Nitric oxide and KLF4 protein epigenetically modify class II trans- 47. Pai, R. K., Convery, M., Hamilton, T. A., Boom, W. H., and Harding, C. V.
activator to repress major histocompatibility complex II expression dur- (2003) Inhibition of IFN-␥-induced class II transactivator expression by a
ing Mycobacterium bovis bacillus Calmette-Guerin infection. J. Biol. 19-kDa lipoprotein from Mycobacterium tuberculosis: a potential mecha-
Chem. 288, 20592–20606 nism for immune evasion. J. Immunol. 171, 175–184
30. Brodin, P., Rosenkrands, I., Andersen, P., Cole, S. T., and Brosch, R. (2004) 48. Chang, C. H., Guerder, S., Hong, S. C., van Ewijk, W., and Flavell, R. A.
ESAT-6 proteins: protective antigens and virulence factors? Trends Mi- (1996) Mice lacking the MHC class II transactivator (CIITA) show tissue-
crobiol. 12, 500 –508 specific impairment of MHC class II expression. Immunity 4, 167–178

J. Biol. Chem. (2017) 292(17) 6855–6868 6867


Role of mycobacterial EsxL in epigenetic modifications
49. Nelson, B. H. (2004) IL-2, regulatory T cells, and tolerance. J. Immunol. acting activity that is not found in its ortholog from non-pathogenic My-
172, 3983–3988 cobacterium smegmatis. J. Biol. Chem. 287, 44184 – 44191
50. Boyman, O., and Sprent, J. (2012) The role of interleukin-2 during home- 65. Marongiu, L., Donini, M., Toffali, L., Zenaro, E., and Dusi, S. (2013)
ostasis and activation of the immune system. Nat. Rev. Immunol. 12, ESAT-6 and HspX improve the effectiveness of BCG to induce human
180 –190 dendritic cells-dependent Th1 and NK cells activation. PLoS One 8,
51. Pennini, M. E., Liu, Y., Yang, J., Croniger, C. M., Boom, W. H., and Har- e75684
ding, C. V. (2007) CCAAT/enhancer-binding protein ␤ and ␦ binding to 66. Fishbein, S., van Wyk, N., Warren, R. M., and Sampson, S. L. (2015) Phy-
CIITA promoters is associated with the inhibition of CIITA expression in logeny to function: PE/PPE protein evolution and impact on Mycobacte-
response to Mycobacterium tuberculosis 19-kDa lipoprotein. J. Immunol. rium tuberculosis pathogenicity. Mol. Microbiol. 96, 901–916
179, 6910 – 6918 67. Chumduri, C., Gurumurthy, R. K., Zadora, P. K., Mi, Y., and Meyer, T. F.
52. Bannister, A. J., Zegerman, P., Partridge, J. F., Miska, E. A., Thomas, J. O., (2013) Chlamydia infection promotes host DNA damage and proliferation
Allshire, R. C., and Kouzarides, T. (2001) Selective recognition of methy-
but impairs the DNA damage response. Cell Host Microbe 13, 746 –758
lated lysine 9 on histone H3 by the HP1 chromo domain. Nature 410,
68. Saini, N. K., Sharma, M., Chandolia, A., Pasricha, R., Brahmachari, V., and
120 –124
Bose, M. (2008) Characterization of Mce4A protein of Mycobacterium
53. Fritsch, L., Robin, P., Mathieu, J. R., Souidi, M., Hinaux, H., Rougeulle, C.,
tuberculosis: role in invasion and survival. BMC Microbiol. 8, 200
Harel-Bellan, A., Ameyar-Zazoua, M., and Ait-Si-Ali, S. (2010) A subset of
69. Tiwari, B. M., Kannan, N., Vemu, L., and Raghunand, T. R. (2012) The
the histone H3 lysine 9 methyltransferases Suv39h1, G9a, GLP, and
Mycobacterium tuberculosis PE proteins Rv0285 and Rv1386 modulate
SETDB1 participate in a multimeric complex. Mol. Cell 37, 46 –56
54. Tachibana, M., Sugimoto, K., Nozaki, M., Ueda, J., Ohta, T., Ohki, M., innate immunity and mediate bacillary survival in macrophages. PLoS One
Fukuda, M., Takeda, N., Niida, H., Kato, H., and Shinkai, Y. (2002) G9a 7, e51686
histone methyltransferase plays a dominant role in euchromatic histone 70. Kumar, A., Farhana, A., Guidry, L., Saini, V., Hondalus, M., and Steyn, A. J.
H3 lysine 9 methylation and is essential for early embryogenesis. Genes (2011) Redox homeostasis in mycobacteria: the key to tuberculosis con-
Dev. 16, 1779 –1791 trol? Expert Rev. Mol. Med. 13, e39

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


55. Kapoor, N., Narayana, Y., Patil, S. A., and Balaji, K. N. (2010) Nitric oxide 71. Voskuil, M. I., Bartek, I. L., Visconti, K., and Schoolnik, G. K. (2011) The
is involved in Mycobacterium bovis bacillus Calmette-Guerin-activated response of Mycobacterium tuberculosis to reactive oxygen and nitrogen
Jagged1 and Notch1 signaling. J. Immunol. 184, 3117–3126 species. Front. Microbiol. 2, 105
56. Bansal, K., and Balaji, K. N. (2011) Intracellular pathogen sensor NOD2 72. Lamichhane, G. (2011) Mycobacterium tuberculosis response to stress
programs macrophages to trigger Notch1 activation. J. Biol. Chem. 286, from reactive oxygen and nitrogen species. Front. Microbiol. 2, 176
5823–5835 73. Firmani, M. A., and Riley, L. W. (2002) Reactive nitrogen intermediates
57. Vermeulen, L., Vanden Berghe, W., Beck, I. M., De Bosscher, K., and have a bacteriostatic effect on Mycobacterium tuberculosis in vitro. J. Clin.
Haegeman, G. (2009) The versatile role of MSKs in transcriptional regu- Microbiol. 40, 3162–3166
lation. Trends Biochem. Sci. 34, 311–318 74. Harding, C. V., and Boom, W. H. (2010) Regulation of antigen presenta-
58. Yang, S. H., Vickers, E., Brehm, A., Kouzarides, T., and Sharrocks, A. D. tion by Mycobacterium tuberculosis: a role for Toll-like receptors. Nat.
(2001) Temporal recruitment of the mSin3A-histone deacetylase core- Rev. Microbiol. 8, 296 –307
pressor complex to the ETS domain transcription factor Elk-1. Mol. Cell 75. Pattenden, S. G., Klose, R., Karaskov, E., and Bremner, R. (2002) Interfer-
Biol. 21, 2802–2814 on-induced chromatin remodeling at the CIITA locus is BRG1 dependent.
59. Schorey, J. S., and Cooper, A. M. (2003) Macrophage signalling upon my- EMBO J. 21, 1978 –1986
cobacterial infection: the MAP kinases lead the way. Cell Microbiol. 5, 76. Zika, E., Greer, S. F., Zhu, X. S., and Ting, J. P. (2003) Histone deacetylase
133–142 1/mSin3A disrupts interferon-induced CIITA function and major histo-
60. de Jonge, M. I., Pehau-Arnaudet, G., Fretz, M. M., Romain, F., Bottai, D., compatibility complex class II enhanceosome formation. Mol. Cell Biol.
Brodin, P., Honoré, N., Marchal, G., Jiskoot, W., England, P., Cole, S. T.,
23, 3091–3102
and Brosch, R. (2007) ESAT-6 from Mycobacterium tuberculosis dissoci-
77. Jung, S. B., Yang, C. S., Lee, J. S., Shin, A. R., Jung, S. S., Son, J. W., Harding,
ates from its putative chaperone CFP-10 under acidic conditions and ex-
C. V., Kim, H. J., Park, J. K., Paik, T. H., Song, C. H., and Jo, E. K. (2006) The
hibits membrane-lysing activity. J. Bacteriol. 189, 6028 – 6034
mycobacterial 38-kilodalton glycolipoprotein antigen activates the mito-
61. Renshaw, P. S., Lightbody, K. L., Veverka, V., Muskett, F. W., Kelly, G.,
gen-activated protein kinase pathway and release of proinflammatory cy-
Frenkiel, T. A., Gordon, S. V., Hewinson, R. G., Burke, B., Norman, J.,
Williamson, R. A., and Carr, M. D. (2005) Structure and function of the tokines through Toll-like receptors 2 and 4 in human monocytes. Infect.
complex formed by the tuberculosis virulence factors CFP-10 and Immun. 74, 2686 –2696
ESAT-6. EMBO J. 24, 2491–2498 78. Jena, P., Mohanty, S., Mohanty, T., Kallert, S., Morgelin, M., Lindstrøm, T.,
62. Derrick, S. C., and Morris, S. L. (2007) The ESAT6 protein of Mycobacte- Borregaard, N., Stenger, S., Sonawane, A., and Sørensen, O. E. (2012)
rium tuberculosis induces apoptosis of macrophages by activating caspase Azurophil granule proteins constitute the major mycobactericidal pro-
expression. Cell Microbiol. 9, 1547–1555 teins in human neutrophils and enhance the killing of mycobacteria in
63. Choi, H. H., Shin, D. M., Kang, G., Kim, K. H., Park, J. B., Hur, G. M., Lee, macrophages. PLoS One 7, e50345
H. M., Lim, Y. J., Park, J. K., Jo, E. K., and Song, C. H. (2010) Endoplasmic 79. Jain, P., Hsu, T., Arai, M., Biermann, K., Thaler, D. S., Nguyen, A.,
reticulum stress response is involved in Mycobacterium tuberculosis pro- González, P. A., Tufariello, J. M., Kriakov, J., Chen, B., Larsen, M. H., and
tein ESAT-6-mediated apoptosis. FEBS Lett. 584, 2445–2454 Jacobs, W. R., Jr. (2014) Specialized transduction designed for precise
64. De Leon, J., Jiang, G., Ma, Y., Rubin, E., Fortune, S., and Sun, J. (2012) high-throughput unmarked deletions in Mycobacterium tuberculosis.
Mycobacterium tuberculosis ESAT-6 exhibits a unique membrane-inter- MBio 5, e01245–14

6868 J. Biol. Chem. (2017) 292(17) 6855–6868


Mycobacterium tuberculosis EsxL inhibits MHC-II expression by promoting
hypermethylation in class-II transactivator loci in macrophages
Srabasti Sengupta, Saba Naz, Ishani Das, Abdul Ahad, Avinash Padhi, Sumanta Kumar
Naik, Geetanjali Ganguli, Kali Prasad Pattanaik, Sunil Kumar Raghav, Vinay Kumar
Nandicoori and Avinash Sonawane
J. Biol. Chem. 2017, 292:6855-6868.
doi: 10.1074/jbc.M117.775205 originally published online February 16, 2017

Access the most updated version of this article at doi: 10.1074/jbc.M117.775205

Alerts:
• When this article is cited
• When a correction for this article is posted

Downloaded from http://www.jbc.org/ by guest on May 16, 2018


Click here to choose from all of JBC's e-mail alerts

This article cites 77 references, 31 of which can be accessed free at


http://www.jbc.org/content/292/17/6855.full.html#ref-list-1

View publication stats