Plant Responses To Abiotic Stress

Introduction
Heribert Hirt
Everywhere in the world, environmental stresses represent the most limiting fac-
tors for agricultural productivity. Besides plant-specific endogenous traits, a large
proportion of the annual crop yield is lost to pathogens (biotic stress) or the detri-
mental effects of abiotic stress conditions including extremes in temperatures,
drought, or salinity. In many cases, both biotic and abiotic factors contribute to the
severity of disease and yield losses.
All wild type plants have been selected on the basis of competition and their
performance under certain environmental conditions. In addition, the existing crop
varieties underwent man-made selection for traits such as yield, size, taste, etc.
However, all plant life is presently challenged by rapid environmental changes. As
amply discussed in the news, greenhouse gases in the form of CO2 or methane
have a tremendous impact on global environmental conditions, resulting in
changes of extreme temperatures and weather patterns in many areas of the world.
In contrast to animals, plants are sessile organisms and cannot escape changes in
ambient conditions. Greenhouse gases also influence the stratospheric ozone layer
causing much higher UV radiation levels to reach the ground. Besides resulting in
increased rates of skin cancer in humans, UV radiation also induces mutations in
plants and poses a direct danger to plant species and agricultural performance.
Another area of concern is the intense use of chemical fertilizers and artificial irri-
gation in agriculture. In many areas of the world, these practices have increased
the salinity of the soils to such an extent that the land cannot support growth of
any agriculturally important plant any more. Under these conditions, it is no won-
der that abiotic stress resistance belongs to the most wanted traits of future crop
plants. In summary, the factors discussed above, together with the growing trans-
formation of agriculturally useful land into houses, roads, and industrialized areas,
are one of the biggest challenges for future mankind with respect to a functioning
agriculture and the conservation of the existing genetic diversity of plant species.
Besides tackling these problems at the political level, science has an important
role in elucidating the limits and mechanisms of plant stress adaptation. In this re-
gard, the development of new techniques in molecular biology and genetics has
opened up novel possibilities in understanding plant physiology and development.
It comes as no surprise that the last two decades have seen major advances in the
fields of pathogen defence as well as adaptation to abiotic stresses. The advances
in the field of abiotic stress responses provided the impetus for compiling up-to-
date reviews on cold stress, heat stress, salinity, drought, heavy metals, oxidative
stress, and radiation. In addition, reviews are included on the latest plant transcrip-
tome studies and the use of the genetic model organism Synechocystis for investi-
gating abiotic stress.
Topics in Current Genetics, Vol. 4

H. Hirt, K. Shinozaki (Eds.) Plant Responses To Abiotic Stress
© Springer-Verlag Berlin Heidelberg 2003
2 Heribert Hirt
Water stress
Water is a central molecule in all physiological processes in plants, comprising be-

tween 80 and 95% of the biomass of non-woody plants. If the water status of a
plant is insufficient, the plants experience water deficit, also described as drought.
Water deficit is not only caused by lack of water but also by environmental
stresses like low temperature or salinity, thus it is not surprising that they share
many molecular compounds (see separate chapters by Chinnusamy and Zhu on
salt stress and Heino and Palva on cold stress). All of these different stresses nega-
tively impact on plant productivity, representing an intensive research area for im-
proving plant performances.
Plants have developed various mechanisms to adapt their growth to limited wa-
ter conditions. The review by Bartels and Souer focuses on the molecular genetic
aspects, which allow plants to respond and adapt to water deficit. These reactions
are dependent on the severity and duration of the water deficit but also on the de-
velopmental stage and morphological/anatomical parameters of the plants. All
species from bacteria to eukarya possess sensors, transducers, and regulators that
allow them to respond and adapt to changes in water availability. The cellular re-
sponse machinery includes solute transporters like aquaporins, transcriptional ac-
tivators, enzymes encoding compatible solutes, reactive oxygen scavengers, as
well as protective proteins. A variety of organisms have evolved highly effective
mechanisms to colonize ecological niches with limited water availability. Two
principle strategies can be realized to defend dehydration damage: either the syn-
thesis of protective molecules during the dehydration phase to prevent damage and
a repair-based mechanism during rehydration to neutralize the damage.
Dehydration tolerance is a trait that exists in seeds of most higher plants but
only in some species, such as the resurrection plant Craterostigma plantagineum,
at the whole plant level. In their review, Bartels and Souer discuss the molecular
responses to dehydration and desiccation, from sensing and signalling to the regu-
lation of gene expression, mainly focusing on the models A. thaliana and C. plan-
tagineum.
Salt stress
Soil salinity is a major abiotic stress that adversely affects crop productivity and
quality. Saline soil is characterized by toxic levels of chlorides and sulphates of
sodium. The problem of soil salinity is increasing due to irrigation, improper
drainage, seawater in coastal areas, and salt accumulation in arid and semi-arid re-
gions. Sodium is an essential micronutrient for some of the plants, but most crop
plants are natrophobic. Salinity is detrimental to plant growth as it causes nutri-
tional constraints by decreasing uptake of phosphorus, potassium, nitrate and cal-
cium, ion cytotoxicity and osmotic stress. Under salinity, ions like Na+ and Cl-
penetrate the hydration shells of proteins and interfere with the function of these
proteins. Ionic toxicity, osmotic stress, and nutritional defects under salinity lead
Introduction 3
to metabolic imbalances and oxidative stress. Plant salt tolerance mechanisms can
be grouped into cellular homeostasis (including ion homeostasis and osmotic ad-
justment), stress damage control (repair and detoxification), and growth regula-
tion. Considerable efforts have been invested to unravel plant salt tolerance
mechanisms. The success of breeding programs with the ultimate goal of improv-
ing crop productivity is limited by the lack of a clear understanding of the molecu-
lar basis of salt tolerance. Recent advances in the genetic analysis of Arabidopsis
mutants defective in salt tolerance, and molecular cloning of these loci, have given
some insight into salt stress signalling and plant salt tolerance. In their review,
Chinnusamy and Zhu discuss these developments as well as the molecular and ge-
netic evidence concerning the perception of salinity stress by plants, cellular signal
transduction, and effectors of salt stress tolerance.
Low temperature stress
One of the most severe environmental challenges to plants is low temperature.

Different plant species vary widely in their ability to tolerate low temperature
stress. Chilling-sensitive tropical species can be irreparably damaged even at tem-
peratures significantly higher than the freezing temperature of the tissues. Injuries
are caused by impairment of metabolic processes, by alterations in membrane
properties, changes in structure of proteins and interactions between macromole-
cules as well as inhibition of enzymatic reactions. Chilling tolerant but freezing
sensitive plants are able to survive temperatures slightly below zero, but are se-
verely damaged upon ice formation in the tissues. On the other hand, frost tolerant
plants are able to survive variable levels of freezing temperatures, the actual de-
gree of tolerance being dependent on the species, developmental stage, and dura-
tion of the stress.
Exposure of plants to subzero temperatures results in extracellular ice forma-
tion, efflux of water, and cellular dehydration. Therefore, freezing tolerance is
strongly correlated with tolerance to dehydration (caused by e.g. drought or high
salinity). Freeze-induced dehydration can cause various perturbations in the mem-
brane structures, including membrane fusions and phase transitions. Although
freeze-induced cellular dehydration is a central cause of freezing damage, addi-
tional factors contribute to freezing injury. Growing ice crystals can cause me-
chanical damage to cells and tissues and freezing temperatures per se or freeze-
induced dehydration can cause denaturation of proteins and disruption of macro-
molecular complexes. A common denominator in several stresses, including low
temperature is the production of reactive oxygen species (ROS), which can gener-
ate damage to different macromolecules in the cells. Low temperatures, especially
in combination with high light can cause excessive production of ROS and hence
tolerance to freezing also correlates with effective scavenging systems for ROS to
cope with oxidative stress.
Temperate plants respond to low temperature by activating a cold acclimation
program leading to enhanced tolerance to freezing temperatures. This acclimation
4 Heribert Hirt
process is accompanied by altered expression of a number of stress response genes

controlling production of proteins and metabolites that protect cellular structures
and functions from the adverse effects of freezing and freeze-induced cellular
dehydration. The changes in cold responsive gene expression are controlled by a
set of dedicated transcription factors responding to the low temperature stimulus.
Heino and Palva review the complex signal network that is required for sensing
and transduction of the low temperature signal to altered gene expression and dis-
cuss the interactions of the signal pathways involved.
ABA as abiotic stress signalling hormone
Abscisic acid (ABA) is considered a ‘stress hormone’ integrating environmental

constraints linked to changes in water activity with metabolic and developmental
programs. Plants respond to environmental challenges like drought and salt stress
by changes in ABA availability, but ABA is also an endogenous signal required
for proper development. After exceeding certain threshold levels ABA causes
complete closure of stomata and massive alteration of gene expression. ABA sig-
nalling comprises various cellular events including turgor-regulation and differen-
tial gene expression. Accordingly, a turgor-regulatory pathway can be distin-
guished from a nuclear signalling cascade. Cross-talk between ABA and other
pathways is involved in coordinating primary metabolism, cell growth, and divi-
sion.
The review by Christmann, Grill, and Meinhard on ABA signalling emphasizes
the emerging regulatory circuits of ABA hormone biosynthesis, ABA signalling,
and ABA-specific gene expression. The role of ABA in different abiotic stress re-
sponses is covered by Bartels and Souer (drought), Chinnusamy and Zhu (salt),
and Heino and Palva (cold stress).
Heat stress
Heat stress response is invoked in organisms as diverse as bacteria, fungi, plants,

and animals by sudden increases in temperature, and is characterized by elevated
synthesis of a set of proteins called heat shock proteins (hsps). Hsps comprise sev-
eral evolutionarily conserved protein families. A common feature of the heat stress
response is that an initial exposure to mild heat stress provides resistance against a
subsequent usual lethal dose of heat stress. This phenomenon is referred to as 'ac-
quired thermotolerance'. Since thermotolerant cells express high levels of hsps,
these proteins have been associated with the development of thermotolerance.
High temperature stress causes extensive denaturation and aggregation of cellular
proteins, which, if unchecked, lead to cell death. Through their chaperoning activ-
ity, hsps help cells to cope with heat-induced damage to cellular proteins. During
stress, hsps function primarily to prevent aggregation and promote proper refold-
Introduction 5
ing of denatured proteins, but because protein conformation is important right

from the time a protein is synthesized, hsps play important roles under normal
conditions as well.
In nature, temperature changes are likely to occur more rapidly than other
stress-causing factors. Due to their inability to translocate, plants are subject to
wide variations in temperature both diurnally and seasonally, and must therefore
adapt to temperature stress quickly and efficiently. The heat stress response is
characterized by inhibition of normal transcription and translation, higher expres-
sion of heat shock proteins (hsps) and induction of thermotolerance. If stress is too
severe, signalling pathways leading to apoptotic cell death are also activated. As
molecular chaperones, hsps provide protection to cells against the damaging ef-
fects of heat stress and enhance survival. The enhanced expression of hsps is regu-
lated by heat shock transcription factors (HSFs). While knowledge about hsp ex-
pression and functions has been gained, our understanding of the regulatory
mechanisms is still limited. In her review, Krishna discusses the recent progress
made in understanding the molecular mechanism of the heat shock response in
plants. Her review outlines our current knowledge of the functions of plant hsps
and the regulation of HSFs, and offers a comparative view of heat stress responses
in plants and other organisms.
Oxidative stress
For plants, as for all aerobic organisms, oxygen is a double-edged sword. It is ab-
solutely required for normal growth and development, yet continuous exposure to
oxygen can result in cellular damage and ultimately death. This is because mo-
lecular oxygen is continually reduced within cells to several forms of Reactive
Oxygen Species (ROS), in particular the superoxide free radical anion (O2 .-) and
hydrogen peroxide (H2O2), that react with various cellular components to bring
about acute or chronic damage sufficient to result in cellular death. In plant cells,
ROS are generated in high amounts by both constitutive and inducible routes, but
under normal situations, the redox balance of the cell is maintained via the consti-
tutive action of a wide range of antioxidant mechanisms that have evolved to re-
move ROS.
Various environmental stresses and endogenous stimuli perturb this redox bal-
ance via increased ROS production or reduced antioxidant activity, such that oxi-
dative stress ensues. In response to increased ROS, the expression of genes encod-
ing antioxidant proteins is induced, as well as that of genes encoding proteins
involved in a wider range of cellular rescue processes. In addition, it is increas-
ingly clear that ROS also have signalling functions outside of oxidative stress. The
review by Desikan, Hancock, and Neill gives an outline of the mechanisms that
regulate redox balance in plant cells, discuss cellular responses to ROS and the po-
tential signalling mechanisms involved, and highlight some of the developmental
and physiological processes in which ROS may participate.
6 Heribert Hirt
Heavy metal stress
Heavy metals are defined as metals with a density higher than 5 g cm-3. From a
biological perspective, this definition is not very useful because it comprises the
majority of naturally occurring elements. However, only a limited number of these
elements is soluble under physiological conditions and, thus, may become avail-
able for living cells. Among them are elements which serve plant metabolism as
micronutrients or trace elements (Fe, Mo, Mn, Zn, Ni, Cu, V, Co, W, Cr) and
which become toxic when present in excess, as well as others with no known bio-
logical functions and high phytotoxicity such as As, Hg, Ag, Sb, Cd, Pb, and U.
The regulatory limits of heavy metals in the environment are defined by national
legislation. Apart from confined natural habitats, there is growing concern about
an increasing release of heavy metals into the environment. Sources of heavy met-
als include traffic, refuse dumps, and sewage sludge. Emissions of dust, aerosols,
and ashes from metal processing industries lead to spreading of heavy metals into
rural areas. In agricultural soils, heavy metal pollution is an increasing problem
because of soil amendment with municipal sewage sludge and intense use of
phosphate fertilisers, which contain Cd as a contaminant. The long biological life-
time and retention in soils favours heavy metal accumulation in the food web with
potentially negative effects for human health. The bioavailability for heavy metals
is plant specific and depends on the demand of specific metals as micronutrients
and on the plant's ability to regulate actively metal mobilisation by exudation of
organic acids or protons into the rhizosphere. In addition, soil properties influence
the chemical mobility of metals, thereby regulating their release into the soil solu-
tion.
The ability of plants to extract metals from soil, plant internal metal allocation,
and cellular detoxification mechanisms are research areas currently attracting in-
creasing attention. The review by Polle and Schützendübel focuses on metals with
contrasting action in plants cells, discussing the chemical properties of these met-
als with respect to their toxicity and summarising current knowledge how heavy
metals interfere with cellular signalling and which signalling cascades lead to
plant adaptation or injury.
Genotoxic stress
All organisms have the capacity to dynamically respond to environmental chal-

lenges as a result of the activation of complex signalling networks. One of the
most extreme challenges is damage to the genetic information itself. The genomes
of all living organisms are under continuous assault by environmental agents (e.g.
UV irradiation and reactive chemicals) as well as by-products of endogenous
metabolic processes (e.g. reactive oxygen species and erroneous DNA replica-
tion). As a result of the perception of the genotoxic stress, the cell cycle is halted
to gain the time necessary for DNA repair, and genes required for repair and pro-
tection of other cellular components endangered by the genotoxic treatment are
Introduction 7
activated. Alternatively, particularly in multicellular eucaryotes, cells may respond

by undergoing apoptosis, thereby eliminating damaged cells.
Research on genotoxic stress perception and signalling in mammalian cells is of
particular importance due to its implications in human health and disease, includ-
ing carcinogenesis. In plants, however, owing to the static nature of their cells an-
chored by cell walls, tumourous tissue cannot metastasise and plants do not die of
cancer. On the other hand, the reproductive tissues of plants are derived from cells
that went through many rounds of DNA replication producing the entire organism,
before forming gametes. This feature makes plants particularly sensitive to the po-
tential accumulation of mutations in the germline, which finally opens the way for
the passage of somatic mutations to the next generation. In contrast to animals,
plants are sessile organisms that depend on solar radiation as the vital source of
biological energy and thus are continuously exposed to environmental mutagens,
including UV-B radiation, and tolerance to this abiotic stress factor is critical for
plant fitness. Repair of DNA damage is essential for the maintenance of genomic
integrity and substantial information is available on DNA repair processes in
plants. In contrast, knowledge on perception and signalling of DNA-damaging
threats in plants is rather limited and genetic support for proteins involved in
genotoxic signalling in Arabidopsis is only emerging. Importantly, as deduced
from the mammalian system, these might include signalling components engaged
by both “nuclear” and “non-nuclear” targets of genotoxic agents. The review by
Ulm focuses on recent advances in the identification of genetically defined com-
ponents in genotoxic stress signalling in plants.
Stress transcriptome analysis
Upon sensing of stress, cells respond and adapt to a given stress in order to sur-
vive. In almost all cases, the stress responses are based primarily on the expression
of specific stress-induced genes, followed by specific biochemical and physiologi-
cal reactions. Several genes that respond to drought, high-salinity or cold stress
have been studied at the transcriptional level. Recently, gene expression profiling
using cDNA microarrays or gene chips identified many hundred genes that are
regulated by these abiotic stresses. The products of the stress-inducible genes can
be classified into two groups: those that directly protect against environmental
stresses and those that regulate gene expression and signal transduction in the
stress response. The first group includes proteins that likely function by protecting
cells from dehydration, such as the enzymes required for biosynthesis of various
osmoprotectants, late-embryogenesis-abundant (LEA) proteins, antifreeze pro-
teins, chaperones, and detoxification enzymes. The second group of gene products
includes transcription factors, protein kinases, and enzymes involved in phospho-
inositide metabolism. Stress-inducible genes have been used to improve the stress
tolerance of plants by gene transfer and to analyze the functions of stress-inducible
genes. The review by Seki et al. reports on the recent progress on microarray gene
8 Heribert Hirt
expression studies in response to abiotic stresses discussing these findings with re-
spect to current and future strategies of improving stress tolerance of crop plants.
Stress sensors in the model organism Synechocystis
Cells perceive a particular stress and react to it by expressing specific sets of

stress-inducible genes, the gene products of which appear to play important roles
in the acclimation to the stress. In photosynthetic organisms, such as cyanobacte-
ria and plants, and in the simple eukaryote yeast, but not in animals, various two-
component systems contribute to the perception and transduction of environmental
signals. Two-component systems are minimally built up of a histidine kinase that
perceives the stress and a response regulator that transduces the stress signal. In
bacteria, a two-component system is all that is needed for signal transduction and
gene expression is usually mediated by the response regulator acting as transcrip-
tion factor. In yeast and plants, additional components are involved in the signal-
ling adding the potential of fine-tuning and cross-talk with other pathways.
What is yeast for animals is Synechocystis for higher plants. Being an easily
tractable genetic model organism that can be readily mutated and transformed,
homologous recombination is the routine in Synechocystis and not the exception
as in plants. Synechocystis only has a small genome (3.7 MBp) that is fully se-
quenced and has not more than 12 % non-coding regions. In addition, the devel-
opment of full genome based microchips allows genome-wide gene expression
analysis. Based on the screening of mutant libraries, sensors for various abiotic
stresses, nutrients, and metals were identified in Synechocystis. Mikami, Suzuki,
and Murata review the current status of these findings and their implications for
our understanding of stress signalling in plants.
1 Molecular responses of higher plants to
dehydration
Dorothea Bartels and Erik Souer
Abstract
A massive amount of data has been accumulating on the molecular responses of

plants to water deficit. In plants, dehydration activates a protective response to
prevent or repair ensuing damage to cells. The plant hormone, abscisic acid plays
a central role in this process. The genetic model Arabidopsis thaliana tolerates a
low level of dehydration. Analysis of the abscisic acid signalling pathway and of
pathways induced by dehydration in A. thaliana have made a major contribution
to our knowledge of the molecular responses of plants to dehydration. Desiccation
tolerance is a trait found in the seeds of most higher plants, but also at the level of
the whole plant in some species, such as the resurrection plant Craterostigma
plantagineum. Here, we discuss the molecular responses to dehydration and desic-
cation, from the sensing and signalling of water deficit to the regulation of gene
expression, focusing mainly on the model systems A. thaliana and C. plantagi-
neum.
1.1 Introduction
The availability of water determines the distribution of plants and their productiv-
ity. Water is central to all physiological processes in plants; at the cellular level, it
is the major medium for transporting metabolites and nutrients. Water accounts for
between 80 and 95% of the biomass of leaves and roots in non-woody plants. The
water status of a plant is described by measuring water potential and relative water
content. If the water status is unbalanced due to an insufficiency of water, the
plant experiences water deficit and subsequently suffers from water stress, often
referred to as drought. The expression 'drought' derives from the agricultural con-
text. Here, we will use 'water deficit' or 'dehydration' to mean an inadequate water
supply that has an immediate effect on cellular metabolism and negatively influ-
ences growth and development.
The movement of water molecules is determined by the water potential gradient
across the plasma membrane, which in turn is influenced by the concentrations of
solute molecules inside and outside the plant cell. Fluctuations in the availability
of extracellular water cause transmembrane water and solute fluxes that perturb
cellular structures, alter the composition of the cytoplasm, and modulate cell func-
tion. Water deficit is caused not only by a simple lack of water, but also by envi-

10 Dorothea Bartels and Erik Souer
ronmental stresses like low temperature or salinity; thus it is not surprising that re-
sponses to these various stresses involve many shared molecular components.
These different stresses have an enormous negative impact on plant productivity,
and intensive research is underway with a view to defining strategies for improv-
ing plant performance under stress. The effects of salt and cold stress on plants are
covered in separate chapters of this volume (see chapters 6 and 9)
Plants have developed many mechanisms to adapt their growth to the availabil-
ity of water. Their responses to water limitation at the whole plant level have been
described in detail recently (Black and Pritchard 2002), and these will not be dealt
with in this review. Here the focus is on molecular genetic aspects of the reactions
that allow plants to respond and adapt to water deficit. These are dependent on the
severity and duration of the water deficit, and also on the developmental stage and
morphological/anatomical parameters of the plants. In general, rapid emergency
responses and slow adaptive responses can be distinguished.
Cells across all species from bacteria to eukarya possess sensors, transducers,
and regulators that allow them to respond and adapt to changes in water availabil-
ity. The cellular response machinery includes solute transporters like aquaporins,
transcriptional activators, enzymes that synthesize compatible solutes, scavengers
of reactive oxygen species, and protective proteins. A large number of publica-
tions report on the synthesis and accumulation of such molecules, but down-
regulated processes have been comparatively neglected.
A variety of organisms has evolved highly effective mechanisms that allow
them to colonize ecological niches characterized by limited water availability.
Two main strategies can be used to restrict dehydration damage: synthesis of pro-
tective molecules during the dehydration phase to prevent damage, or activation of
repair mechanisms during rehydration to neutralize the damage incurred. Within
the plant kingdom, the first strategy seems to be preferred by higher plants; the re-
pair strategy has been reported only for bryophytes (Phillips et al. 2002). This
leads to interesting evolutionary questions, namely whether the same tolerance
mechanisms have evolved in different groups of organisms or whether different
strategies have been invented.
1.2 Plant species and experimental systems used in

molecular studies
Molecular reactions to water stress in higher plants have been studied mainly in
the genetic model system Arabidopsis thaliana, in desiccation-tolerant resurrec-
tion plants, and in some crop plants including trees. Studies on Arabidopsis have
been very informative with respect to the identification of general components in
the water stress signalling network. This knowledge has been obtained principally
from the analysis of Arabidopsis mutants that show defects in water balance
(Kirch et al. 2002; Leung and Giraudat 1998). Different ecotypes of Arabidopsis
grow in different habitats and exhibit various degrees of tolerance to water stress
1 Molecular responses of higher plants to dehydration 11
(Meyre et al. 2001). Nevertheless, Arabidopsis can only tolerate moderate water
loss, and the tissues collapse irreversibly under extreme dehydration.
In addition to studies on whole plants, research using guard cells, mainly from
Arabidopsis, has advanced our understanding of water stress-related signalling
molecules. Besides being responsible for the uptake of CO2 for photosynthesis,
guard cells control water loss via transpiration to the atmosphere. In the context of
understanding how water balance is controlled, guard cells have been instrumental
in the identification of specific calcium signatures, second messengers that regu-
late calcium levels, phosphorylation signals, specific ion channels and transport-
ers, and the dissection of the abscisic acid (ABA)-induced closure of stomata,
which is mediated by a reduction in the turgor pressure of guard cells. There are
several excellent recent reviews, which discuss these aspects of guard cell function
(e.g. see Assmann and Wang 2001; Schroeder et al. 2001). It remains to be seen
how responses at the guard cell level are integrated with responses in the whole
plant.
In contrast to Arabidopsis, seeds and a small group of vascular plants, termed
resurrection plants, can tolerate extreme water loss and endure in this desiccated,
dormant state until sufficient water is available for further growth (Black and
Pritchard 2002). These systems are being exploited with a view to understanding
the molecular basis of the phenomenon. Resurrection plants express desiccation
tolerance in all tissues, including callus. Most molecular studies on resurrection
plants have been done with Craterostigma plantagineum (Bartels and Salamini
2001). The ability to induce desiccation tolerance in callus tissue from C. plan-
tagineum by treatment with ABA allows one to study its basis in undifferentiated
cells (Bartels et al. 1990). This is an important advantage over seed systems,
where it is difficult to separate the acquisition of desiccation tolerance from other
processes involved in seed development.
In this review, we will focus on molecular studies of desiccation tolerance car-
ried out on resurrection plants and seeds, and we will attempt to place these data
within the context of the knowledge derived from Arabidopsis. Many of the regu-
latory genes involved appear to belong to closely related gene families. The as-
signment of functions to the different members of these families is probably only
possible via mutant analysis, an approach that is largely restricted to Arabidopsis.
For this reason, we will also comment on aspects of this work.
1.3 Abscisic acid (ABA)
The importance of ABA in multiple stress responses, including dehydration, is in-

disputable. Dehydration in plants leads to an increase in levels of ABA, which in
turn induces the expression of multiple genes involved in defence against the ef-
fects of water deficit. ABA triggers stoma closure, thus reducing water loss via
transpiration. In Arabidopsis, dehydration causes prompt ABA synthesis, which is
detectable within 2 hours and reaches a maximum after 10 hours (Kiyosue et al.
1994). The increase in ABA content is relatively slow, and thus ABA-induced
Fig. 1. Complexity of molecular responses to dehydration. Upon water deficit, plant cells
activate a number of pathways to regulate down-stream defence mechanisms. The earliest
events can be detected within minutes. Potentially, some pathways still need to revealed.
Some of the early events, which remain to be elucidated, lead to the biosynthesis of the
plant hormone abscisic acid (ABA). Signals coming from either the ABA-dependent or the
ABA-independent pathway activate transcriptional activators that subsequently induce the
expression of genes that encode a variety of enzymes and proteins that are required to sur-
vive dehydration. These include genes encoding molecular chaperones, reactive oxygen in-
termediate (ROI) scavenging enzymes, sucrose metabolism enzymes, and a variety of late
embryogenesis abundant (LEA) protein that are supposed to have protective functions. As
some of the pathways also influence each other (not shown), the response is more complex
than illustrated here.
genes may be correlated with adaptation mechanisms (Fig. 1). The ABA biosyn-
thetic pathway is a side-branch of the carotenoid pathway, and many enzymes of
the ABA biosynthetic pathway are upregulated by dehydration (Seo and Koshiba
2002). Most genes involved in responses to dehydration are also induced by ABA.
Therefore, the treatment of plants with exogenous ABA has been used to mimic
dehydration responses. Screens for mutants affected in seed germination or plants
that tolerate mild dehydration have led to the identification of many ABA mutants,
including ABA biosynthesis mutants, ABA-hypersensitive mutants and ABA-
insensitive mutants. Cloning of the corresponding genes identified a number of
ABA signalling compounds (Finkelstein et al. 2002; Leung and Giraudat 1998). A
challenge for the future will be to link all of these components functionally,
thereby ultimately revealing the complete ABA signalling network. It has to be
emphasized that ABA is not the only small molecule involved in water deficit sig-
nalling, since several ABA-independent pathways have also been identified (Frank
et al. 2000; Shinozaki and Yamaguchi-Shinozaki 1997). The role of ABA is dis-
cussed in detail in chapter 2.
1.4 The perception of water stress
How is dehydration sensed, and how is this perception translated into a molecular
signal? Time course experiments in several plants have shown that water deficit is
sensed very rapidly -- long before symptoms such as wilting become manifest, and
before the relative water content decreases significantly. Transcripts and proteins
indicative of a dehydration response are detectable within 60 minutes after the on-
set of dehydration in the resurrection plant C. plantagineum and in A. thaliana
(Bartels et al. 1990; Urao et al. 1994; Nakashima et al. 1997). The question of how
shifts in water availability are sensed in plants is completely open; the nature of
the physical signal and the mode of its translation into a biochemical signal are
unknown.
In classical signalling pathways, environmental stimuli are sensed by receptor
molecules. In the case of water deficit in plants, the nature of the biochemical re-
ceptor/ligand interaction, if there is any, is not yet known. Some information on
the sensing of osmotic stress is available from bacteria, and for some eukarya in-
cluding yeast. There are extremely well adapted species among these organisms.
These possess sensors, transducers, and regulators that allow them to attenuate the
cellular consequences of water deficit. However, even in these organisms, it is still
not completely clear how osmotic stress is sensed (Hohmann 2002).
1.4.1 Histidine kinases
A well studied group of sensor molecules which are undoubtedly involved in the
initial response to osmotic stress are protein histidine kinases, which form part of
so-called two-component systems that were first identified in bacteria (Wurgler-
Murphy and Saito 1997). These kinases sense environmental changes, which trig-
ger autophosphorylation of a histidine residue, and subsequently the phosphate is
transmitted to an aspartic residue in the receiver. One such histidine kinase, Sln1,
has been identified as an osmosensor in yeast (Maeda et al. 1994). In plants, his-
tidine kinases function as receptors for the plant hormones ethylene and cytokinin
(Chang and Stewart 1998; Inoue et al. 2001). In addition, the histidine kinase
AtHK1 has been shown to be involved in the response to dehydration in Arabi-
dopsis (Urao et al. 1999). AtHK1 shares significant structural homology with the
Sln1 osmosensor from yeast. Indeed, AtHK1 is able to complement the yeast sln1
mutant, allowing it to grow in high-salt medium. Moreover, Arabidopsis AtHK1 is
able to interact with and activate the yeast mitogen-activated-like protein (MAP)
kinase pathway downstream of Sln1. This implies that a similar cascade might ex-
ist in Arabidopsis. However, at the moment, the function of AtHK1 in plants is
still unclear.
1.4.2 The role of kinases and phosphatases in the response to water

deficit
Besides receptor-ligand and protein-DNA interactions, protein modification repre-

sents another potential level of control. Phosphorylation is an effective and rapid
mechanism of post-translational modification, which alters the activities of DNA-
binding factors and a plethora of intermediate molecules. Understanding the speci-
ficity of these reactions is difficult, because eukaryotes have very large numbers
of genes that encode phosphorylating and dephosphorylating enzymes. It has been
estimated that the Arabidopsis genome codes for around 120 protein phosphatases
and 90 MAP kinases (Kerk et al. 2002).
1.4.2.1 MAP kinase signalling

There are many indications that a very early step in transducing the water deficit
signal in plant cells involves MAPK pathways. For instance, a change in the fluid-
ity of the plasma membrane might induce a conformational change in a receptor
that activates a downstream kinase cascade. Most information on MAPK signal-
ling in plants is derived from work on pathogen defence reactions and on the re-
sponse to cold and salt stress (Zhang and Klessig 2001). The same MAP kinase
pathways might be used to signal dehydration, cold and salt stress, with the speci-
ficity of the response being determined by the duration of the activation state and
formation of complexes with other proteins. In alfalfa, the stress-activated MAP
kinase SAMK (also referred to as MKK4) was found to be activated by touch
(Bögre et al. 1996) and by cold and dehydration (Jonak et al. 1996). Interestingly,
SAMK is not activated by ABA, indicating that SAMK either acts in an ABA in-
dependent pathway or upstream of ABA. Recently, it was shown that a reduction
in the fluidity of the membrane is the trigger that leads to activation of SAMK
(Sangwan et al. 2002). This indicates that one way in which a plant cell senses de-
hydration is through a change in the fluidity of the cell membrane. In A. thaliana,
the levels of the MAP kinases ATMPK4 and ATMPK6 and their mRNAs remain
unaltered upon stress, but the activities of these enzymes are rapidly increased by
a variety of stresses including dehydration (Ichimura et al. 2000). Yeast two-
hybrid screening and complementation of yeast mutants led to the identification of
a MAPK pathway that involves ATMPK4, comprising a MAPKKK (AtMEKK1)
and a MAPKK (ATMKK2) (Ichimura et al. 1998). Therefore, this MAPK signal-
ling pathway seems to play an important role in the molecular response to dehy-
dration in plants. Characterization of multiple MAPK proteins should eventually
reveal how they are activated and how signals are transmitted to the specific tar-
gets that are ultimately responsible for protection against dehydration damage.
1.4.2.2 Phosphatases
One theme that is emerging from mutant analyses is that, besides kinases, phos-
phatases are essential modifiers in regulatory networks. Some kinase signals ap-
pear to act very early in the temporal hierarchy of signals, but this is not so evident
for the action of phosphatases. The involvement of phosphatases in dehydration-
stress signal transduction has been established using the ABA-insensitive Arabi-
dopsis mutants, abi1and abi2. These mutants display pleiotropic phenotypes af-
fecting seed dormancy, stoma regulation, and signal transduction during water
stress (Koornneef 1984; Merlot and Giraudat 1997). Both mutant genes encode
homologous, type 2C, Ser/Thr protein phosphatases with identical amino acid sub-
stitutions at equivalent positions, which result in reduced phosphatase activity and
a dominant-negative phenotype (Bertauche et al. 1996; Leung et al. 1997). The
phenotype of intragenic null suppressor alleles of abi1-1 and abi2-1, which exhibit
higher seed dormancy and enhanced ABA-dependent sensitivity to inhibition of
germination and stoma closure, led to the conclusion that ABI1 and ABI2 act as
negative regulators in the ABA signal transduction pathway (Gosti et al. 1999;
Merlot et al. 2001). Although the similarity between ABI1 and ABI2 suggests that
they may act in overlapping pathways, careful physiological analysis revealed that
ABI1 and ABI2 do not show complete functional equivalence (Murata et al. 2001).
A search for potential targets of the phosphatases using a yeast two-hybrid ap-
proach has identified two possible candidates. A member of the homeodomain
leucine-zipper transcription factor family (ATHB6, see below) was shown to in-
teract with the catalytic site of ABI1 (Himmelbach et al. 2002). Furthermore, a
protein kinase interacts with ABI2 and, to a lesser extent, with ABI1 (Guo et al.
2002). Double mutant analysis of abi-1 and abi-2 with a protein kinase mutant and
a calcium binding protein mutant suggests that ABI1 and ABI2 act in conjunction
with a calcium and a H2O2 signal (Guo et al. 2002). This for the first time provides
genetic evidence for a link between phosphatases and second messenger mole-
cules in the transcriptional control of genes relevant for osmotic stress responses.
The role of phosphatases in signalling pathways is also supported by the observa-
tion that a phosphatase2C from alfalfa negatively regulates a MAP kinase
(Meskiene et al. 1998) and that a MAP kinase phosphatase plays a role in the re-
sponse to genotoxic stress (Ulm et al. 2001). Comparison of the data on MAP
kinases and phosphatases suggests the following unifying hypothesis: MAP
kinases and possibly other kinases rapidly relay signals which redirect cellular me-
tabolism toward the synthesis of compounds that attenuate the effects of dehydra-
tion; phosphatases, on the other hand, repress this stress response. It is now possi-
ble through a strategic genomic approach to address the function of the many
other phosphatases encoded in the Arabidopsis genome. This should reveal
whether and how other phosphatases are involved in stress signalling.
1.4.2 Calcium signalling
Studies on animal cells first established that oscillations in cytosolic calcium con-
centrations are an important intermediate step in the activation of specific signal-
ling cascades, which then determine downstream physiological responses. In
plants, transient increases in cytosolic [Ca2+] have been reported in response to a
diverse range of abiotic and biotic stimuli (Kiegle et al. 2000; Evans et al. 2001),
but the specificity of the physiological responses is not understood. It has been
suggested that duration, magnitude, and cellular location of the changes in [Ca2+]
determine specificity (McAinsh and Hetherington 1998; Evans et al. 2001).
A change in membrane fluidity might alter the activity of Ca2+ channels, lead-
ing to a change in [Ca2+] in the cytosol. An increase in cytosolic [Ca2+] as a result
of influx from extracellular sources and/or extrusion from the vacuole has been
recognized as one of the early responses to dehydration (Sanders et al. 1999).
With respect to water balance the change in cytosolic [Ca2+] has been well studied
in guard cells (Schroeder et al. 2001). There, repetitive Ca2+ transients play a role
in both stoma opening and closure. The diverse and opposing effects of [Ca2+] are
puzzling. Presumably, the effect of the Ca2+ wave depends on the Ca2+ channel,
the cellular location, and the dynamics of the change in [Ca2+] and the availability
of downstream signalling pathways at the time the change in [Ca2+] occurs
(Sanders et al. 1999). Recent data on the closure of stomata showed that a defined
range of calcium oscillations determines stoma movements (Allen et al. 2001).
An interesting class of Ca2+ binding proteins are the Ca2+ dependent kinases
(CDPKs) that combine a calmodulin-like calcium binding module with a kinase
domain (Cheng et al. 2002). Some of these CDPKs have been shown to be induc-
ible by dehydration (Urao et al. 1994; Patharkar and Cushman 2000). Two Arabi-
dopsis CDPKs, CPK10 (AtCDPK1) and CPK11 (AtCDPK2), are induced within
10 minutes upon dehydration stress (Urao et al. 1994). CPK10 (AtCDPK1) is ca-
pable of transactivating a stress-induced promoter (Sheen 1996). The activity of
CPK10 is stimulated by 14-3-3 proteins, but this is only apparent in the presence
of Ca2+ (Camoni et al. 1998). Therefore, Ca2+ binding by CPK10 (AtCDPK1)
seems to precede the formation of the 14-3-3 protein complex. Ectopic expression
of a rice CDPK gene, OsCDPK7, increases stress tolerance in rice (Saijo et al.
2000). The identification of the target(s) of the dehydration-induced CDPKs
promises to be an important breakthrough in the understanding of dehydration
signal transduction.
1.4.3 Heterotrimeric G-proteins
Another group of signalling molecules that have an established role in signal

transduction in animal cells are the G-proteins. Evidence for the involvement of
G-proteins in the dehydration signalling cascade in plant cells is beginning to
emerge. The heterotrimeric G-proteins consist of three subunits, Gα, Gβ, and Gγ.
The G-protein interacts with a ligand-bound receptor domain in the cytoplasmic
membrane, which leads to exchange of a bound GDP nucleotide for a GTP on the
α-subunit. The trimeric G-protein then dissociates into the α-monomeric subunit
and the βγ dimer, and these two components activate downstream molecules such
as phospholipase C or phospholipase D. Active G-proteins and the activation of
phospholipases have been observed in plants, but associated receptors have not
been identified (Jones 2002a). In contrast to the situation in animals - where 41
different subunits are known - plants only have four G-protein subunits, a single
Gα, a single Gβ, and two Gγ.
Evidence for functional G-proteins in plants is mainly derived from pharmacol-
ogical approaches. G-protein mimicking compounds and antagonists have been
administered to plant systems, and subsequently putative downstream reactions
were measured. The agents most widely used for this purpose have been masto-
paran and its more potent analogue MAS7. Mastoparan is a 14-amino acid poly-
peptide isolated from wasp venom, which stimulates the replacement of bound
GDP by GTP, corresponding to the formation of active G-protein subunits. The ef-
fects of mastoparan have implicated heterotrimeric G-proteins in, among other
processes, the regulation of stoma opening and water deficit-induced phospholi-
pase D activity (Frank et al. 2000, Wang et al. 2001). In guard cells, ABA signal-
ling has been shown to require a G protein. In Arabidopsis plants carrying a mu-
tant allele of the Gα gene GPA1, ABA can no longer inhibit the closure of stomata
(Wang et al. 2001). The presence of only two different G protein complexes and
the apparent lack of an associated receptor for G-proteins in plants is puzzling. In
plants, apparently, the specificity of signal transduction is likely to be conferred
not by G proteins, but by other signalling compounds present in the cell.
1.4.4 Phospholipid signalling
The activation of phospholipid signalling in response to a variety of stresses, in-

cluding dehydration, is now well documented in plants (Munnik 2001). Phosphol-
ipase activity generates phosphatidic acid, which acts as a second messenger to ac-
tivate downstream targets. The phosphatidic acid signal is generated by two
pathways involving phospholipase C (PLC) and phospholipase D (PLD).
PLD cleaves phospholipids into a polar head group and phosphatidic acid.
Analysis of the A. thaliana genome has identified twelve PLD genes, which can
be grouped into five classes: α, β, γ, δ, and ζ (Qin and Wang 2002). Two PLD
genes, PLD1 and PLD2, have been isolated from C. plantagineum (Frank et al.
2000). In both A. thaliana and C. plantagineum, water deficit leads to a response
at two levels, PLD enzyme activity and PLD transcription. The enzymatic activa-
Fig. 2. Phylogenetic tree illustrating the relationship between all A. thaliana and two C.
plantagineum phospholipase D (PLD) genes. Both C. platagineum genes group with the A.
thaliana PLDα genes, although the expression pattern of CpPLD2 matches that of AtPLDδ.
Matching expression patterns are illustrated by different grey boxes.
tion occurs within minutes of the dehydration stimulus. In A. thaliana (Katagiri et

al. 2001) and C. plantagineum PLD enzyme activity is not activated by ABA,
suggesting that ABA signalling operates via another pathway or enters the phos-
pholipid signalling pathway further downstream. At the transcriptional level PLDδ
from A. thaliana and PLD2 from C. plantagineum are induced by dehydration
some hours after the onset of water stress, while PLDα from A. thaliana and
PLD1 from C. plantagineum are constitutively expressed. This suggests that PLD2
is the C. plantagineum orthologue of PLDδ, although phylogenetic analysis shows
that both C. plantagineum genes fall within the PLDα group (Fig. 2). In A.
thaliana plants expressing antisense PLDδ transcripts, total PLD activity was sig-
nificantly reduced during the first hours of dehydration stress, which supports a
role for PLDδ in the early signal transduction cascade (Sang et al. 2001).
The second phospholipid signalling pathway that is implicated in the response
to dehydration is the phospholipase C (PLC) pathway. PLC converts phosphatidy-
linositol 4,5-biphosphate into inositol 1,4,5-triphosphate and diacylglycerol
(DAG). Inositol 1,4,5-triphosphate causes the release of calcium into the cytosol,
while DAG is converted into the second messenger phosphatidic acid by DAG
kinase. PLC seems to account for most of the phophatidic acid generated upon ex-
posure to osmotic stress (Munnik et al. 2000). Like PLD, PLC can be activated at
both the enzymatic level and the transcriptional level by stress. The Arabidopsis
AtPLC1 gene is activated by a variety of stresses, including dehydration
(Hirayama et al. 1995). A constitutively expressed PLC gene, AtPLC2, has also
been found (Hirayama et al. 1997). PLC is activated rapidly upon dehydration
(Takahashi et al. 2001). PLC also seems to activate an ABA-independent pathway,
as PLC inhibitors block the expression of dehydration-induced, but not of ABA-
induced, target genes. PLC genes have been identified in a number of plants, in-
cluding dehydration-induced PLC genes in potato (Kopka et al. 1998).
Some of the molecular targets of phosphatidic acid, the second messenger pro-
duced by phopholipases, are now being revealed in plants. For instance, phos-
phatidic acid increases the kinase activity of a Ca2+ activated, calcium-dependent
protein kinase (Farmer and Choi 1999) and activation of a wound-induced MAP
kinase is also dependent on phosphatidic acid (Lee et al. 2001). It can be expected
that other components of the downstream signalling pathway and the mecha-
nism(s) by which phosphatidic acid acts will be identified in the near future.
1.5 Transcriptional control
One of the effects of the dehydration signal transduction cascade is the activation
of transcription factors, each of which activates a set of target genes, including
those required for the synthesis of protective molecules (Fig. 1). A number of
transcription factors that are activated by dehydration have been isolated (Table
1). Most of these factors were identified because they are differentially expressed
in untreated versus stress-treated tissue, or by virtue of their ability to bind to
promoters of dehydration-induced genes. The dehydration response seems to in-
volve members of several groups of plant transcription factors. At present, it is not
known whether closely related transcription factors from one family have overlap-
ping functions -- and thus show a certain degree of redundancy -- or whether each
family member has a distinct function. The functional analysis of transcription
factors belonging to large families is particularly difficult, and the assignment of
target genes to specific factors may not be possible even with targeted mutations.
In this part of the review, we will focus on the model systems A. thaliana and C.
plantagineum. We first describe promoter elements that are important for the de-
hydration-induced expression of genes, and then discuss the corresponding tran-
scription factors and DNA binding proteins.
Dehydration triggers high-level expression of many genes; of which the most
prominent are the so-called late embryogenesis abundant (lea) genes (see 1.6.2).
Promoters of various lea genes were initially analyzed to define sequences, which
are of general importance for dehydration-induced gene expression. The most
widely distributed and best investigated elements are the ABA response elements
(ABREs) and the dehydration response elements (DREs). However, it is becoming
Table 1. Transcription factors controlling the dehydration response in C. plantagineum and

A. thaliana
Trx Species Gene Binding site Transcription Reference

factora induced by
drought/ABAb
bZIP C. plan- ? - - -
tagineum
A. AtbZIP35 ACGTGGC Not by dehydration Choi et al.
thaliana (ABF1) ABA 2000
AtbZIP36 GGACACGTG (Not by) Dehydra- Choi et al.

(ABF2/AREB1) GCG tionc 2000
ABA Uno et al.
2000
AtbZIP37 ACGTGGC Not by dehydration Choi et al.
(ABF3) ABA 2000
AtbZIP38 GGACACGTG Dehydration Choi et al.

(ABF4/AREB2) GCG ABA 2000
Uno et al.
2000
AtbZIP39 ? ABA Finkelstein
(ABI5) Dehydration not et al. 2000
known
AtbZIP40 CACGTG ? Menkens et
(GBF4) al. 1994
AtbZIP66 ACGTG ? Uno et al.
(AREB3) 2000
ERF C. plan- ? - - -
(AP2) tagineum
A. CBF1 CCGAC Not by dehydration Stockinger
thaliana (DREB1B) Not by ABA et al. 1997
Liu et al.
1998
CBF2 ? Not by dehydration Medina et
(DREB1C) Not by ABA al. 1999
Liu et al.
1998
CBF3 TACCGACAT Not by dehydration Medina et
(DREB1A) Not by ABA al. 1999
Liu et al.
1998
CBF4 ? Dehydration Haake et al.
ABA 2002
DREB2A TACCGACAT Dehydration Liu et al.
ABA 1998
DREB2B ? Dehydration Liu et al.
ABA 1998
ABI4 ? Not by dehydration Finkelstein
Not by ABA et al. 1998
Söderman
et al. 2000
Table 1. Continued
Trx Species Gene Binding site Transcription Reference

factora induced by
drought/ABAb
SAP C. plan- CpR18 pr3.75d Dehydration Hilbricht et

tagineum ABA al. 2002
A. At5g66840 ? ? Hilbricht et
thaliana al. 2002
Myb C. plan- Cpm7 ? Dehydration Iturriaga et
tagineum Not by ABA al. 1996
A. Atmyb2 CTAACCA Dehydration Urao et al.
thaliana ABA 1993
bHLH C. plan- ? - - -
tagineum
A. AtMyc2 CACATG Dehydration Abe et al.
thaliana (rd22BP1) ABA 1997
HD-Zip C. plan- CpHB-1 CAAT(A/T)AT Dehydration Frank et al.
tagineum TG Not by ABA 2000
CpHB-2 ? Dehydration Frank et al.
ABA 2000
CpHB-3 CAAT(A/T)AT Downregulated by Deng et al.
TG dehydration and 2002
ABA
TG dehydration 2002
TG dehydration 2002
CpHB-6 CAAT(A/T)AT Dehydration Deng et al.
TG ABA 2002
CpHB-7 CAAT(A/T)AT Dehydration Deng et al.
TG ABA 2002
A. AtHB-6 ? Dehydration Soderman
thaliana ABA et al. 1999
AtHB-7 ? Dehydration Soderman
ABA et al. 1996
AtHB-12 ? Dehydration Lee and
ABA Chun 1998
a
transcription factor or DNA binding factor family
b
other abiotic stresses omitted
c
conflicting results in literature
d
a promoter element required for the ABA induced expression of the lea type gene
CDeT27-45 (GCAAGCCCAAATTTCACAGCCCGATTAACCG)
increasingly clear that these elements alone are not always sufficient to determine
stress-activated transcription of genes, and additional motifs have to be considered
(see e.g., Nelson et al. 1994). An important new line of research will be to investi-
gate how the actively transcribed genes are organised in chromatin and how they
are made accessible for transcription during stress.
1.5.1 The ABA responsive element
A promoter element that is important for dehydration- and ABA-responsive ex-

pression was first identified in the lea gene (see X.6.2) rab16A of rice (Mundy et
al. 1990). This so-called ABA responsive element (ABRE) has the core sequence
PyACGTGGC and represents a subgroup of so-called G-box elements (Williams
et al.1992). A bZIP protein, EmBP-1, was found to bind to the ABRE of the wheat
gene Em, another representative of the lea genes (Guiltinan et al. 1990). Several
bZIP transcription factors, which have recently been classified as group A bZIPs,
have been shown to be involved in ABA signalling in Arabidopsis as well (Jakoby
et al. 2002). This set of proteins has been referred to as ABA responsive element
binding factors (ABF) or ABA responsive element binding (AREB) proteins
(Menkens and Cashmore 1994; Choi et al. 2000; Finkelstein and Lynch 2000; Uno
et al. 2000). The nomenclature used for stress-induced bZIP genes is somewhat
confusing, as different names have been used for the same genes (see Table 1).
Four members of group A of the bZIP family, AtbZIP35-38, were identified as
binding to ABRE promoter elements in a yeast one-hybrid screen (Choi et al.
2000). AtbZIP36 and AtbZIP38 can activate an ABA-inducible promoter in a
transient protoplast assay (Uno et al. 2000). Ectopic expression of AtbZIP37 and
AtbZIP38 resulted in hypersensitivity to ABA and induced multiple ABA-
associated phenotypes, including increased resistance to dehydration (Kang et al.
2002). These data suggest a central role for these bZIP proteins in mediating ABA
signalling. How ABA is linked to the transcriptional activation of bZIP genes is,
however, currently unknown.
Besides the ABREs, so-called coupling elements (CEs) have been identified as
cis-regulatory promoter elements involved in ABA-mediated gene expression
(Shen et al. 1996). The core sequence of the CE1 element is CACCGC. These
elements occur in several genes from Arabidopsis, barley, maize, and other plants.
They are activated by ABA, particularly during seed maturation. Interestingly,
CE1 elements also occur in sugar response genes (Huijser et al. 2000), which indi-
cates cross-talk between ABA and sugar sensing. Recently, Niu et al. (2002)
showed that the maize homologue of the Arabidopsis AP2-domain protein ABI4
binds to the CE1 element in a number of ABA-related genes. This may imply co-
operation between bZIP-type factors and AP2-domain proteins in ABA-mediated
responses to dehydration.
1.5.2 The dehydration-responsive element
Analysis of the promoter regions of other dehydration-induced genes led to the

discovery of the dehydration-responsive element (DRE) in Arabidopsis; the same
motif, here referred to as the C-repeat (CRT), was also identified in promoters of
genes that respond to cold stress (Baker et al. 1994; Yamaguchi-Shinozaki and
Shinozaki 1994). The sequence was subsequently found in other cold and dehy-
dration inducible promoters, a finding which indicates a general role for this ele-
ment. Yeast one-hybrid screens using this CRT/DRE element led to the identifica-
tion of CRT/DRE binding factors, CBF and DREB, respectively (Table 1)

(Stockinger et al. 1997; Liu et al. 1998). Characteristic for these factors is an AP2
domain, a 60-amino acid DNA-binding motif originally identified in the product
of the floral organ identity gene APETALA2 (Jofuku et al. 1994). Other members
of this AP2-domain subfamily are involved in ethylene and jasmonate signalling,
and in pathogen defence reactions, and are now often referred to as ethylene re-
sponsive element-binding-factors or ERF proteins (Singh et al. 2002). CBF1,
CBF2, and CBF3 are transcriptionally induced by cold, but not by ABA or dehy-
dration (Medina et al. 1999). CBF4, on the other hand, is induced by dehydration
and ABA treatment. Ectopic expression of CBF4 confers increased tolerance to
cold and dehydration in Arabidopsis (Haake et al. 2002). Similarly, in tomato,
over-expression of CBF1 leads to enhanced dehydration tolerance (Hsieh et al.
2002).
The gene DREB1A and its homologues DREB1B and DREB1C are identical to
the CBF1, CBF2, and CBF3 genes (see Table 1), and are transcriptionally induced
by cold. DREB2A and DREB2B encode new ERF factors, and they are induced by
dehydration (Liu et al. 1998). Although over-expression of DREB1A seems to ac-
tivate downstream target genes and confer stress tolerance, the transformants
showed growth retardation. The negative effect on plant growth can be avoided by
using a stress inducible promoter for overexpression (Kasuga et al. 1999). When
the cold inducible DREB1A gene was overexpressed, the transformants showed
increased tolerance to dehydration and salinity in addition to cold tolerance, sup-
porting the idea that the pathways that confer protection against the different
stresses overlap.
1.5.3 The SAP domain
In C. plantagineum, detailed mapping of the promoter of one of the dehydration-

induced lea-like genes, CDeT27-45, revealed a novel element that is important for
ABA-induced expression (Michel et al. 1993; Nelson et al. 1994). Using yeast
one-hybrid interaction cloning, a gene for a SAP (SAF-A/B, Acinus, PIAS) do-
main protein, CpR18, was isolated, and its product was found to bind to this pro-
moter in vitro (Hilbricht et al. 2002). CpR18 is localized in the nucleus and, im-
portantly, it is able to activate the CDeT27-45 promoter in tobacco protoplasts.
The SAP domain is a DNA binding domain that is able to bind to scaffold or ma-
trix attachment regions (Aravind and Koonin 2000). Unlike the CDeT27-45 pro-
moter, these regions are relatively AT-rich. Therefore, it seems likely that the C-
terminal zinc finger in CpR18, and not the SAP domain, recognises and binds the
CDeT27-45 promoter. The SAP domain might be necessary to make the CDeT27-
45 promoter accessible to other transcription factors that directly regulate tran-
scription of the CDeT27-45 gene (Fig. 3). Interestingly, immediately adjacent to
the SAP binding domain in the CDeT27-45 promoter are four potential bZIP bind-
ing sites that are similar to ABA responsive elements. Therefore, binding of
CpR18 might facilitate the binding of bZIP proteins and thereby induce transcrip-
tion of the CDeT27-45 gene in response to dehydration.
Fig. 3. Model of the action of the SAP domain factor CpR18. A. Under hydrated condi-
tions, CpR18 is bound to a scaffold attachment region (SAR). The promoter of the dehydra-
tion-induced gene CDeT27-45 is not accessible for transcription factors and thus the gene is
silent. B. Dehydration leads to the binding of CpR18 to the promoter of CDeT27-45 that is
subsequently accessible for transcription factors that are able to induce transcription of
CDeT27-45. Transcriptional activation may involve bZIP transcription factors as potential
binding sites are present next to the CpR18 binding site. Model adopted from after
Hilbricht et al. (2002).
1.5.4 Myb and helix-loop-helix domains
Various Myb-type transcription factors have been isolated which are induced by
dehydration (Urao et al. 1993; Iturriaga et al. 1996; Abe et al. 1997). The AtMyb2
gene of Arabidopsis is induced by dehydration, salt, and ABA (Urao et al. 1993).
AtMYB2 was found to bind to the promoter of the dehydration-responsive gene
rd22 (Abe et al. 1997). In addition, a dehydration- and ABA-inducible helix-loop-
helix type transcription factor, AtMYC2, was found to bind the rd22 promoter.
Over-expression of both genes led to hypersensitivity to ABA and to increased
expression of rd22 (Abe et al. 2003). This indicates that both AtMYB2 and At-
MYC2 play a major role in the control of gene expression in response to water
deficit. Three Myb transcription factors have been identified in C. plantagineum,
which share high sequence homology with AtMYB2 from A. thaliana (Iturriaga et
al. 1996). The gene for one of these, cpm7, is induced in roots after dehydration
treatment. One of the lea-like genes, pcC11-24, contains a Myb binding site in its
promoter and may thus be a target for CPM7 (Velasco et al. 1998).
1.5.5 Homeodomain proteins
Various homeodomain-leucine zipper proteins (HD-Zip) are induced by a variety

of stress conditions, including dehydration (Söderman et al. 1996; Lee and Chun
1998; Söderman et al. 1999; Frank et al. 1998; Deng et al. 2002). In Arabidopsis,
the dehydration induced transcription of both ATHB-6 and ATHB-7 is completely
dependent on ABA, as no mRNA can be detected in the ABA biosynthetic mutant
aba-3 (Söderman et al. 1996; Söderman et al. 1999). In C. plantagineum, genes
for two dehydration-induced HD-ZIP proteins, CpHB-1 and CpHB-2, have been
identified. These proteins are capable of forming both homo- and heterodimers in
a yeast two-hybrid assay. While CPHB-2 is induced by ABA, CPHB-1 is not, dis-
tinguishing two pathways that are induced by dehydration, one via ABA and one
independently of ABA. The yeast two-hybrid interaction suggests that the ABA-
independent and ABA-dependent pathways can converge through these HD-Zip
proteins. The analysis of a number of other HD-Zip proteins from C. plantagi-
neum identified genes that are transcriptionally induced by dehydration, while
others are downregulated by dehydration (Deng et al. 2002). As some HD-Zip
proteins seem to function as repressors (Meijer et al. 1997; Steindler et al. 1999),
an intriguing possibility is that the latter encode repressors of dehydration-induced
genes.
1.5.6 An RNA as a signalling molecule?
Callus tissue of Craterostigma is normally not resistant to dehydration unless it is

pre-treated with ABA (Bartels et al. 1990). An activation tagging experiment that
screened for mutants that are capable of bypassing this ABA dependence identi-
fied a gene (cdt-1) with unusual characteristics (Furini et al. 1997). Only two very
small open reading frames are present in the cdt-1 RNA. Whether these small
open reading frames are of biological relevance or the cdt-1 transcript itself acts as
the active molecule remains to be established. The latter possibility is intriguing in
light of the recent breakthroughs that have identified many potential functions for
non-coding RNAs, including the numerous small RNA species that act as impor-
tant regulators via RNA interference (Matzke et al. 2001; Jones 2002b; Storz
2002). Under conditions of extreme stress, these RNAs may have a similar func-
tion to retroelements and transposons, which have been implicated in stress-
triggered alterations in gene expression (Weil and Wessler 1990). For example, it
was recently reported that retrotransposons alter the expression of adjacent genes
in wheat (Kashkush et al. 2003).
1.5.7 Positioning of signals in the network
In the preceding sections, we have described many different molecules, which are
presumed to be involved in dehydration stress signalling. The evidence for their
involvement has been derived mainly from the observation that the molecules ac-
cumulate or are modified upon dehydration. This approach identifies single com-
pounds without determining their interacting partners or their positions in the sig-
nalling network. Results are now emerging from studies on double mutants, which
allow us to determine the hierarchy of some signals. Thus, analysis of double mu-
tants deficient in the phosphatases ABI1 and ABI2 revealed a link between these
phosphatases and calcium as well as reactive oxygen signals (Guo et al. 2002).
Recently, a protein kinase (OST1) was identified which is an essential positive
regulatory element in ABA-mediated stoma opening in response to dehydration
(Mustilli et al. 2002). OST1 was shown to act downstream of ABA perception and
upstream of a reactive oxygen signal (ROS).
1.6 Dehydration-activated proteins
The last step in the dehydration signalling cascade is the activation of genes re-
sponsible for the synthesis of compounds that serve to protect cellular structures
against the deleterious effects of dehydration (Fig.1). Plants that are capable of
surviving under dry conditions have adopted a variety of different strategies. We
will discuss three mechanisms that seem important in enabling plants to withstand
dehydration: the accumulation of solutes, scavenging of reactive oxygen species
and synthesis of proteins with protective functions.
1.6.1 The accumulation of compatible solutes
In many species, dehydration leads to the accumulation of a variety of compatible

solutes. Compatible solutes are soluble molecules of low molecular weight that are
non-toxic and do not interfere with cellular metabolism. The chemical nature of
the compatible solutes differs among plant species. They include betaines includ-
ing glycine betaine, amino acids (especially proline), polyols and sugars such as
mannitol, sorbitol, sucrose, or trehalose. These compounds help to maintain turgor
during dehydration by increasing the number of particles in solution. Furthermore,
they may modulate the fluidity of membranes and keep proteins hydrated, thus
stabilizing their structure (Hoekstra et al. 2001). Ultimately the sugars replace the
water molecules, converting the cytosol into a so-called glassy state. Using trans-
genics, increases in the levels of a number of solutes have been shown to increase
tolerance to dehydration. Examples are glycine betaine (Huang et al. 2000), man-
nitol (Tarczynski et al. 1993), fructan (Pilon-Smits et al. 1995), D-ononitol
(Sheveleva et al. 1997), and trehalose (Holmström et al. 1996). However, the level
of newly synthesized solutes was in most cases not sufficient to enable the toler-
ance effect to be attributed to osmotic adjustment; therefore other mechanisms are

under discussion: such solutes may themselves act as signalling molecules to in-
duce protective pathways or function as scavengers of reactive oxygen species.
Dehydration and desiccation tolerance are associated with the presence of con-
siderable quantities of non-reducing di- and oligosaccharides, as illustrated in des-
iccation-tolerant resurrection plants (Hoekstra et al. 2001; Phillips et al. 2002). In
C. plantagineum, the unusual sugar 2-octulose is present in leaves under normal
growth conditions. This sugar is converted into sucrose upon water loss, and 2-
octulose accumulates again upon rehydration (Bianchi et al. 1991). The accumula-
tion of sucrose upon dehydration seems to be correlated with the acquisition of
desiccation tolerance, as it has been reported for a number of different species of
resurrection plants. It remains to be established whether the presence of this un-
usual sugar is really required for desiccation tolerance. The molecular mechanisms
that regulate the accumulation of sucrose are unknown. However, genes encoding
enzymes of sucrose metabolism have been found to be upregulated by dehydration
and it has been proposed that these enzymes are involved in the conversion of oc-
tulose to sucrose (Ingram and Bartels 1996).
1.6.2 Genes that encode proteins with protective functions
Many genes, which are abundantly expressed in response to dehydration, have

been isolated from numerous species by differential screening approaches using
dehydrated versus non-stressed plant tissues. In spite of the molecular characteri-
zation of so many genes, our knowledge of the biochemical functions of their
products is remarkably limited. The resurrection plant C. plantagineum and seeds
of various plants have been rich sources of genes that are expressed upon dehydra-
tion and are likely to be involved in acquired resistance to desiccation (Bartels et
al. 1990). Seeds of many species are able to survive without water for a long time,
which requires maintenance of viable embryo structures. A number of the genes
isolated from resurrection plants share sequence homologies with genes that are
expressed in maturing seeds, suggesting that the desiccation tolerance mechanisms
that operate in these situations show some similarity. The late embryogenesis
abundant or lea genes are a case in point. Their expression is correlated with de-
hydration (Galau et al. 1986). The corresponding transcripts accumulate to high
levels both in dormant seeds and in vegetative tissues of desiccation-tolerant and -
sensitive plants upon dehydration. Based on sequence characteristics, they can be
assigned to different groups, although there is some disagreement in the literature
with regard to their classification (for details see Bray 1993; Dure 1993; Close
1997). Most LEA proteins are very hydrophilic, which allows them to remain
soluble after boiling, and determines their particular biochemical properties. LEA
proteins are probably ubiquitous in higher plants. Recently a LEA protein has also
been reported to accumulate in response to desiccation in the anhydrobiotic nema-
tode Aphelenchus avenae (Browne et al. 2002). This finding corroborates the pre-
dicted protective role of LEA proteins. The genomes of some microorganisms also
contain sequences that may encode LEA-like proteins, although they have not
been shown to be expressed (Browne et al. 2002). Despite correlative evidence for
a protective function of LEA proteins during water deficit, direct biochemical evi-
dence for this is still lacking. Transgenic approaches designed to demonstrate the
protective role of LEA proteins by overexpressing them have yielded contradic-
tory results. Thus, overexpression of the barley lea gene HVA1 resulted in trans-
genic plants with increased tolerance (Xu et al. 1996). In contrast, overexpression
of C. plantagineum lea genes did not lead to enhanced tolerance (Iturriaga et al.
1992). That LEA proteins may act synergistically with non-reducing sugars to
form a glassy matrix and thus confer protection is an attractive hypothesis (Hoek-
stra et al. 2001, and references herein). This hypothesis is supported by the abun-
dance of LEA proteins and of reducing sugars in desiccation-tolerant plant tissues
and also in desiccation-tolerant nematodes (Browne et al. 2002; Phillips et al.
2002).
1.6.3 Reactive oxygen intermediates
One consequence of many stresses, including dehydration, is an increase in the

concentration of reactive oxygen intermediates (ROI) (Mittler 2002). ROI cause
irreversible damage to membranes, proteins, DNA, and RNA. However, a low
concentration of ROI is vital for the plant cell, as some ROI molecules are them-
selves essential signalling components in stress defence, as was discovered re-
cently and has been discussed in this chapter (Pei et al. 2000, Musitlli et al. 2002).
When the concentration of ROI increases because of dehydration, prevention of
concurrent damage is essential for survival. It is well known that ROI accumula-
tion is largely controlled by intrinsic antioxidant systems that include enzymatic
scavengers like superoxide dismutase, peroxidases, and catalases. Besides these
general defence strategies, dehydration seems to trigger other enzymes, which are
likely to be involved in ROI scavenging. In C. plantagineum, a gene encoding an
aldehyde dehydrogenase (Cp-ALDH) is induced by dehydration and ABA (Kirch
et al. 2001). The gene product is localised in plastids. Presumably, it functions in
the detoxification of reactive aldehydes produced by peroxidation of lipids by ROI
(Sunkar et al. 2003). An Arabidopsis homologue, Ath-ALDH3, was also identified
which exhibits a similar expression pattern. Another similar example is the ABA-
and dehydration-induced gene MsALR, which encodes an aldose/aldehyde reduc-
tase in alfalfa (Oberschall et al. 2000). Ectopic expression of MsALR in tobacco
improves tolerance to dehydration. Thus, detoxification of aldehydes seems to be
an important defence against dehydration-induced damage by ROI (Bartels 2001).
Details of the effects of oxidative stress are described in chapter 5 of this volume.
1.7 Conclusions and outlook
The analysis of differential gene expression and, more recently, analysis of global
gene expression patterns using macro- and microarray approaches have identified
a broad spectrum of transcripts, whose expression is modified in response to de-

hydration (Fowler and Thomashow 2002; Kreps et al. 2002, Seki et al. 2002).
These studies have provided a fairly comprehensive overview of the types of tran-
scripts modulated by dehydration in plants. They have shown that at least several
hundred genes are affected by dehydration and that their products can be assigned
to many pathways. This makes it difficult to prioritize genes and define primary
dehydration genes. No simple solution can be expected from a genetic approach
for two reasons: dehydration tolerance is a polygenic trait, and the resurrection
plants - the best characterized desiccation-tolerant species - do not have a diploid
genome. For this reason, no simple mutational approach has been reported for the
identification of genes involved in desiccation tolerance. Desiccation tolerance is a
complex character which cannot be dissected genetically in the same way as
monogenic resistances e.g. to some plant pathogens (Crute and Pink 1996). How-
ever, the analysis of quantitative trait loci may shed some light on the influence of
the different genetic parameters.
Progress in understanding survival under dehydration conditions may be ex-
pected from an interdisciplinary approach involving cell biology and physical bio-
chemistry. Such an approach must include studies on water structure-function re-
lationships in the context of molecules like compatible solutes and LEA proteins.
Analyses of water-solute-macromolecule-solid matrix interactions may offer new
perspectives on the requirements for maintaining the integrity of cellular structures
under otherwise lethal conditions.
We are far from being able to provide a comprehensive picture of the signalling
network necessary for a coordinated cellular response to dehydration. Large pro-
jects designed to produce collections of specific knockout mutants will shed some
light on the role of individual members of gene families encoding regulatory
molecules. This approach is at present restricted to Arabidopsis. However, one
must exercise caution in extrapolating the results obtained from Arabidopsis.
There is some diversity with respect to gene function and gene identity, as pointed
out for some examples in this review. In case of the phospholipase D genes, the
genes with the closest sequence homology between C. plantagineum and A.
thaliana do not respond in the same way to dehydration. Likewise, Arabidopsis
does not have homologues of cdt-1 genes, nor does it synthesize the same sugars
as some resurrection plants. Despite the enormous progress derived from studies
in Arabidopsis, it is necessary to keep in mind that there is diversity within the dif-
ferent plant species in their molecular response to dehydration. A comparison of
different systems will also contribute to identifying essential genes, as illustrated
by the similarities in desiccation responses between resurrection plants and certain
nematodes.
Hardly any information is available on the post-transcriptional control level, a
research area that can be addressed by proteomics approaches, which are just be-
ginning. Despite the expenditure of a great deal of effort and the application of a
variety of approaches, the identity of the molecules that sense dehydration remains
a complete mystery, and it is difficult to see how this challenge can be resolved
soon. These are research areas that should receive most attention in the near fu-
ture.
Acknowledgements
The work of D.B. on this subject is supported by grants from the European com-
mission, Deutsche Forschungsgemeinschaft (DFG) and Fonds der chemischen In-
dustrie. We thank D. Hoonhout for secretarial assistance. We would like to apolo-
gize to those whose work was not cited due to space restrictions.
References
Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis

AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in ab-
scisic acid signaling. Plant Cell 15:63-78
Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K (1997)
Role of Arabidopsis MYC and MYB homologs in drought-and abscisic acid-regulated
gene expression. Plant Cell 9:1859-1868
Allen GJ, Chu SP, Harrington CL, Schumacher K, Hoffmann T, Tang YY, Grill E, Schroe-
der JI (2001) A defined range of guard cell calcium oscillation parameters encodes
stomatal movements. Nature 411:1053-1057
Aravind L, Koonin EV (2000) SAP - a putative DNA-binding motif involved in chromo-
somal organization. Trends Biochem Sci 25:112-114
Assmann SM, Wang X-Q (2001) From milliseconds to millions of years: guard cells and
environmental responses. Curr Opin Plant Biol 4:421-428
Baker SS, Wilhelm KS, Thomashow MF (1994) The 5'-region of Arabidopsis thaliana
cor15a has cis-acting elements that confer cold-, drought- and ABA-regulated gene
expression. Plant Mol Biol 24:701-713
Bartels D (2001) Targeting detoxification pathways: an efficient approach to obtain plants
with multiple stress tolerance? Trends Plant Sci 6:284-286
Bartels D, Salamini F (2001) Desiccation tolerance in the resurrection plant Craterostigma
plantagineum A contribution to the study of drought tolerance at the molecular level.
Plant Physiol 127:1346-1353
Bartels D, Schneider K, Terstappen G, Piatkowski D, Salamini F (1990) Molecular cloning
of abscisic acid-modulated genes which are induced during desiccation of the resurrec-
tion plant Craterostigma plantagineum. Planta 181:27-34
Bertauche N, Leung J, Giraudat J (1996) Protein phosphatase activity of abscisic acid in-
sensitive 1 (ABI1) protein from Arabidopsis thaliana. Eur J Biochem 241:193-200
Bianchi G, Gamba A, Murelli C, Salamini F, Bartels D (1991) Novel carbohydrate metabo-
lism in the resurrection plant Craterostigma plantagineum. Plant J 1:355-359
Black M, Pritchard HW (2002) Desiccation and survival in plants. Drying without dying
CABI Publishing, New York
Bögre L, Ligterink W, Heberle-Bors E, Hirt H (1996) Mechanosensors in plants. Nature
383:489-490
Bray EA (1993) Molecular responses to water deficit. Plant Physiol 103:1035-1040
Browne J, Tunnacliffe A, Burnell A (2002) Plant desiccation gene found in a nematode.
Nature 416:36
Camoni L, Harper JF, Palmgren MG (1998) 14-3-3 proteins activate a plant calcium-
dependent protein kinase (CDPK). FEBS Lett 430:381-384
Chang C, Stewart RC (1998) The two-component system regulation of diverse signaling
pathways in prokaryotes and eukaryotes .Plant Physiol 117:723-731
Cheng S-H, Willmann MR, Chen H-C, Sheen J (2002) Calcium signaling through protein
kinases. The Arabidopsis calcium-dependent protein kinase gene family. Plant Physiol
129:469-485
Choi H, Hong J, Ha J, Kang J, Kim SY (2000) ABFs, a family of ABA-responsive element
binding factors. J Biol Chem 275:1723-1730
Close TJ (1997) Dehydrins: A commonalty in the response of plants to dehydration and low
temperature. Physiol Plantarum 100:291-296
Crute JR, Pink DAC (1996) Genetics and utilization of pathogen resistance in plants. Plant
Cell 8:1747-1717
Deng X, Phillips J, Meijer AH, Salamini F, Bartels D (2002) Characterization of five novel
dehydration-responsive homeodomain leucine zipper genes from the resurrection plant
Craterostigma plantagineum. Plant Mol Biol 49:601-610
Dure L (1993) Structural motifs in LEA proteins In: Timothy J, Bray CAEA (eds) Plant re-
sponses to cellular dehydration during environmental stress. American Society of Plant
Physiologists, pp 91-103
Evans NH, McAinsh MR, Hetherington AM (2001) Calcium oscillations in higher plants.
Plant Biol 4:415-420
Farmer PK, Choi JH (1999) Calcium and phospholipid activation of a recombinant cal-
cium-dependent protein kinase (DcCPK1) from carrot (Daucus carota L) Biochim Bio-
phys Acta 1434:6-17
Finkelstein RR, Gampala SSL, Rock CD (2002) Abscisic acid signaling in seeds and seed-
lings. Plant Cell 14:S15-S45
Finkelstein RR, Lynch TJ (2000) The Arabidopsis abscisic acid response gene ABI5 en-
codes a basic leucine zipper transcription factor. Plant Cell 12:599-609
Fowler S, Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that multi-
ple regulatory pathways are activated during cold acclimation in addition to the CBF
cold response pathway. Plant Cell 14:1675-1690
Frank W, Munnik T, Kerkmann K, Salamini F, Bartels D (2000) Water deficit triggers
phospholipase D activity in the resurrection plant Craterostigma plantagineum. Plant
Cell 12:111-124
Frank W, Phillips J, Salamini F, Bartels D (1998) Two dehydration-inducible transcripts
from the resurrection plant Craterostigma plantagineum encode interacting homeodo-
main-leucine zipper proteins. Plant J 15:413-421
Furini A, Koncz C, Salamini F, Bartels D (1997) High level transcription of a member of a
repeated gene family confers dehydration tolerance to callus tissue of Craterostigma
plantagineum. EMBO J 16:3599-3608
Galau GW, Hughes DW, Dure L (1986) Abscisic acid induction of cloned cotton late em-
bryogenesis abundant( LEA) messenger RNAs. Plant Mol Biol 7:155-170
Gosti F, Beaudoin N, Serizet C, Webb AA, Vartanian N, Giraudat J (1999) ABI1 protein
phosphatase 2C is a negative regulator of abscisic acid signaling. Plant Cell 11:1897-
1910
Guiltinan MJ, Marcotte WRJ, Quatrano RS (1990) A plant leucine zipper protein that rec-
ognizes an abscisic acid response element. Science 250:267-271
Guo Y, Xiong LM, Song C-P, Gong DM, Halfter U, Zhu JK (2002) A calcium sensor and
its interacting protein kinase are global regulators of abscisic acid signaling in Arabi-
dopsis. Dev Cell 3:233-244
Haake V, Cook D, Riechmann JL, Pineda O, Thomashow MF, Zhang JZ (2002) Transcrip-
tion factor CBF4 is a regulator of drought adaptation in Arabidopsis. Plant Physiol
130:639-648
Hilbricht T, Salamini F, Bartels D (2002) CpR18, a novel SAP-domain plant transcription
factor, binds to a promoter region necessary for ABA mediated expression of the
CDeT27-45 gene from the resurrection plant Craterostigma plantagineum Hochst.
Plant J 31:293-303
Himmelbach A, Hoffmann T, Leube MP, Hohener B, Grill E (2002) Homeodomain protein
ATHB6 is a target of the protein phosphatase ABI1 and regulates hormone responses
in Arabidopsis. EMBO J 21:3029-3038
Hirayama T, Mitsukawa N, Shibata D, K S (1997) AtPLC2, a gene encoding phosphoinosi-
tide-specific phospholipase C, is constitutively expressed in vegetative and floral tis-
sues in Arabidopsis thaliana. Plant Mol Biol 34:175-180
Hirayama T, Ohto C, Mizoguchi T, Shinozaki K (1995) A gene encoding a phosphatidy-
linositol-specific phospholipase C is induced by dehydration and salt stress in Arabi-
dopsis thaliana. Proc Natl Acad Sci USA 92:3903-3907
Hoekstra FA, Golovina EA, Buitink J (2001) Mechanisms of plant desiccation tolerance.
Trends Plant Sci 6:431-438
Hohmann S (2002) Osmotic stress signaling and osmoadaptation in yeasts. Microbiol Mol
Biol Rev 66:300-372
Holmström KO, Mantyla E, Welin B, Mandal A, Palva ET (1996) Drought tolerance in to-
bacco. Nature 379
Hsieh T-H, Lee J-t, Charng Y-y, Chan M-T (2002) Tomato plants ectopically expressing
Arabidopsis CBF1 show enhanced resistance to water deficit stress. Plant Physiol
130:618-626
Huang J, Hirji R, Adam L, Rozwadowski KL, Hammerlindl JK, Keller WA, Selvaraj G
(2000) Genetic engineering of Glycinebetaine production toward enhancing stress tol-
erance in plants: Metabolic limitations. Plant Physiol 122:747-756
Huijser C, Kortstee A, Pego J, Weisbeek PJ, Wisman E, Smeekens S (2000) The Arabidop-
sis Sucrose uncoupled-6 gene is identical to Abscisic acid insensitive-4: Involvement
of abscisic acid in sugar responses. Plant Journal 23:577-585
Ichimura K, Mizoguchi T, Irie K, Morris P, Giraudat J, Matsumoto K, Shinozaki K (1998)
Isolation of ATMEKK1 (a MAP Kinase Kinase Kinase)-interacting proteins and
analysis of a MAP kinase cascade in Arabidopsis. Biochem Biophys Res Comm
253:532-543
Ichimura K, Mizoguchi T, Yoshida R, Yuasa T, Shinozaki K (2000) Various abiotic
stresses rapidly activate Arabidopsis MAP kinases ATMPK4 and ATMPK6. Plant J
24:655-665
Ingram J, Bartels D (1996) The molecular basis of dehydration tolerance in plants. Annu
Rev Plant Physiol Plant Mol Biol 47:377-403
Inoue T, Higuchi M, Hashimoto Y, Seki M, Kobayashi M, Kato T, Tabata S, Shinozaki K,
Kakimoto T (2001) Identification of CRE1 as a cytokinin receptor from Arabidopsis.
Nature 409:1060-1063
Iturriaga G, Leyns L, Villegas A, Gharaibeh R, Salamini F, Bartels D (1996) A family of
novel myb-related genes from the resurrection plant Craterostigma plantagineum are
specifically expressed in callus and roots in response to ABA or desiccation. Plant Mol
Biol 32:707-716
Iturriaga G, Schneider K, Salamini F, Bartels D (1992) Expression of desiccation-related
proteins from the resurrection plant Craterostigma plantagineum in transgenic to-
bacco. Plant Mol Biol 20:555-558
Jakoby M, Weisshaar B, Droge-Laser W, Vicente-Carbajosa J, Tiedemann J, Kroj T, Parcy
F (2002) bZIP transcription factors in Arabidopsis. Trends Plant Sci 7:106-111
Jofuku KD, Boer B, Montagu MV, Okamuro JK (1994) Control of Arabidopsis flower and
seed development by the homeotic gene APETALA2. Plant Cell 6:1211-1225
Jonak C, Kiegerl S, Ligterink W, Barker PJ, Huskisson NS, Hirt H (1996) Stress signaling
in plants: A mitogen-activated protein kinase pathway is activated by cold and
drought. Prof Natl Acad Sci USA 93:11274-11279
Jones AM (2002a) G-protein-coupled signaling in Arabidopsis. Curr Opin in Plant Biol
5:402-407
Jones L (2002b) Revealing micro-RNAs in plants. Trends Plant Sci 7:473-475
Kang J-y, Choi H-i, Im M-y, Kim SY (2002) Arabidopsis basic leucine zipper proteins that
mediate stress-responsive abscisic acid signaling. Plant Cell 14:343-357
Kashkush K, Feldman M, Levy AA (2003) Transcriptional activation of retrotransposons
alters the expression of adjacent genes in wheat. Nature Genet 33:102-106
Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1999) Improving plant
drought, salt, and freezing tolerance by gene transfer of a single stress-inducible tran-
scription factor. Nat Biotechnol 17:287-291
Katagiri T, Takahashi S, Shinozaki K (2001) Involvement of a novel Arabidopsis phosphol-
ipase D, AtPLD∂, in dehydration-inducible accumulation of phosphatidic acid in stress
signalling. Plant J 26:595-605
Kerk D, Bulgrien J, Smith DW, Barsam B, Veretnik S, Gribskov M (2002) The comple-
ment of protein phosphatase catalytic subunits encoded in the genome of Arabidopsis.
Kiegle E, Moore CA, Haseloff J, Tester MA, Knight MR (2000) Cell-type-specific calcium
responses to drought, salt and cold in the Arabidopsis root. Plant J 23:267-278
Kirch HH, Nair A, Bartels D (2001) Novel ABA- and dehydration-inducible aldehyde de-
hydrogenase genes isolated from the resurrection plant Craterostigma plantagineum
and Arabidopsis thaliana. Plant J 28:555-567
Kiyosue T, Yamaguchi-Shinozaki K, Shinozaki K (1994) Cloning of cDNAs for genes that
are early-responsive to dehydration stress (ERDs) in Arabidopsis thaliana L: identifi-
cation of three ERDs as HSP cognate genes. Plant Mol Biol 25:791-798
Koornneef M (1984) The isolation and characterization of abscisic acid-insensitive mutants
of Arabidopsis thaliana. Physiol Plant 61:377
Kopka J, Pical C, Gray JE, Muller-Rober B (1998) Molecular and enzymatic characteriza-
tion of three phosphoinositide-specific phospholipase C isoforms from potato. Plant
Physiol 116:239-250
Kreps JA, Wu Y, Chang H-S, Zhu T, Wang X, Harper JF (2002) Transcriptome changes for
Arabidopsis in response to salt, osmotic, and cold stress. Plant Physiol 130:2129-2141
Lee S, Hirt H, Lee Y (2001) Phosphatidic acid activates a wound-activated MAPK in Gly-
cine max. Plant J 26:479-486
Lee YH, Chun JY (1998) A new homeodomain-leucine zipper gene from Arabidopsis
thaliana induced by water stress and abscisic acid treatment. Plant Mol Biol 37:377-
384
Leung J, Giraudat J (1998) Abscisic acid signal transduction. Annu Rev Plant Physiol Plant
Mol Biol 49:199-222
Leung J, Merlot S, Giraudat J (1997) The Arabidopsis ABSCISIC ACID-INSENSITIVE2
(ABI2) and ABI1 genes encode homologous protein phosphatases 2C involved in ab-
scisic acid signal transduction. Plant Cell 9:759-771
Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K
(1998) Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA
binding domain separate two cellular signal transduction pathways in drought- and
low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell
10:1391-1406
Maeda T, Wurgler-Murphy S, Saito H (1994) A two-component system that regulates an
osmosensing MAP kinase cascade in yeast. Nature 369:242-245
Matzke M, Matzke AJM, Kooter JM (2001) RNA: Guiding gene silencing. Science
293:1080-1083
McAinsh MR, Hetherington AM (1998) Encoding specificity in calcium signalling sys-
tems. Trends Plant Sci 3:32-36
Medina J, Bargues M, Terol J, Perez-Alonso M, Salinas J (1999) The Arabidopsis CBF
gene family is composed of three genes encoding AP2 Domain-containing proteins
whose expression is regulated by low temperature but not by abscisic acid or dehydra-
tion. Plant Physiol 119:463-470
Meijer AH, Scarpella E, van Dijk EL, Qin L, Taal AJC, Rueb S, Harrington SE, McCouch
SR, Schilperoort RA, Hoge JHC (1997) Transcriptional repression by Oshox1, a novel
homeodomain leucine zipper protein from rice. Plant J 11:263-276
Menkens A, Cashmore A (1994) Isolation and characterization of a fourth Arabidopsis
thaliana G-Box- binding factor, which has similarities to Fos oncoprotein. Proc. Natl
Acad Sci USA 91:2522-2526
Merlot S, Giraudat J (1997) Genetic analysis of abscisic acid signal transduction. Plant
Physiol 114:751
Merlot S, Gosti F, Guerrier D, Vavasseur A, Giraudat J (2001) The ABI1 and ABI2 protein
phosphatases 2C act in a negative feedback regulatory loop of the abscisic acid signal-
ling pathway. Plant J 25:295-303
Meskiene I, Bogre L, Glaser W, Balog J, Brandstotter M, Zwerger K, Ammerer G, Hirt H
(1998) MP2C, a plant protein phosphatase 2C, functions as a negative regulator of mi-
togen-activated protein kinase pathways in yeast and plants. Proc Natl Acad Sci USA
95:1938-1943
Meyre D, Leonardi A, Brisson G, Vartanian N (2001) Drought-adaptive mechanisms in-
volved in the escape/tolerance strategies of Arabidopsis Landsberg erecta and Colum-
bia ecotypes and their F1 reciprocal progeny. J Plant Physiol 158:1145-1152
Michel D, Salamini F, Bartels D, Dale P, Baga M, Szalay A (1993) Analysis of a desicca-
tion and ABA-responsive promoter isolated from the resurrection plant Craterostigma
plantagineum. Plant J 4:29-40
Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7:405-
410
Mundy J, Yamaguchi-Shinozaki K, Chua N (1990) Nuclear proteins bind conserved ele-
ments in the abscisic acid-responsive promoter of a Rice Rab gene. Prof. Natl Acad Sci
USA 87:1406-1410
Munnik T (2001) Phosphatidic acid: an emerging plant lipid second messenger. Trends
Plant Sci 6:227-233
Munnik T, Meijer HJ, Ter Riet B, Hirt H, Frank W, Bartels D, Musgrave A (2000) Hy-
perosmotic stress stimulates phospholipase D activity and elevates the levels of phos-
phatidic acid and diacylglycerol pyrophosphate. Plant J 22:147-154
Murata Y, Pei ZM, Mori IC, Schroeder J (2001) Abscisic acid activation of plasma mem-
brane Ca2+ channels in guard cells requires cytosolic NAD(P)H and is differentially
disrupted upstream and downstream of reactive oxygen species production in abi1-1
and abi2-1 protein phosphatase 2C mutants. Plant Cell 13:2513-2523
Mustilli A-C, Merlot S, Vavasseur A, Fenzi F, Giraudat J (2002) Arabidopsis OST1 protein
kinase mediates the regulation of stomatal aperture by abscisic acid and acts upstream
of reactive oxygen species production. Plant Cell 14:3089-3099
Nakashima K, Kiyosue T, Yamaguchi-Shinozaki K, Shinozaki K (1997) A nuclear gene,
erd1, encoding a chloroplast-targeted Clp protease regulatory subunit homolog is not
only induced by water stress but also developmentally upregulated during senescence
in Arabidopsis thaliana. Plant J 12:851-861
Nelson D, Salamini F, Bartels D (1994) Abscisic acid promotes novel DNA-binding activ-
ity to a desiccation- related promoter of Craterostigma plantagineum. Plant J 5:451-
458
Niu X, Helentjaris T, Bate NJ (2002) Maize ABI4 binds coupling element1 in abscisic acid
and sugar response genes. Plant Cell 14:2565-2575
Oberschall A, Deak M, Torok K, Sass L, Vass I, Kovacs I, Feher A, Dudits D, Horvath GV
(2000) A novel aldose/aldehyde reductase protects transgenic plants against lipid per-
oxidation under chemical and drought stresses. Plant J 24:437-446
Patharkar OR, Cushman JC (2000) A stress-induced calcium-dependent protein kinase from
Mesembryanthum crystallinum phosphorylates a two-component pseudo-response
regulator. Plant J 24:679-691
Pei ZM, Murata Y, Benning G, Thomine S, Klusener B, Allen GJ, Grill E, Schroeder JI
(2000) Calcium channels activated by hydrogen peroxide mediate abscisic acid signal-
ling in guard cells. Nature 406:731-734
Phillips JR, Oliver MJ, Bartels D (2002) Molecular genetics of desiccation and tolerant sys-
tems In: Black M, Pritchard HW (eds) Desiccation and survival in plants: Drying
without dying CAB International
Pilon-Smits E, Ebskamp M, Paul MJ, Jeuken M, Weisbeek PJ, Smeekens S (1995) Im-
proved performance of transgenic fructan-accumulating tobacco under drought stress.
Qin C, Wang X (2002) The Arabidopsis phospholipase D family Characterization of a cal-
cium-independent and phosphatidylcholine-selective PLDζ1 with distinct regulatory
domains. Plant Physiol 128:1057-1068
Saijo Y, Hata S, Kyozuka J, Shimamoto K, Izui K (2000) Over-expression of a single Ca2+-
dependent kinase confers both cold and salt/drought tolerance on rice plants. Plant J
23:319-327
Sanders D, Brownlee C, Harper JF (1999) Communicating with calcium. Plant Cell 11:691-
706
Sang Y, Zheng S, Li W, Huang B, Wang X (2001) Regulation of plant water loss by ma-
nipulating the expression of phospholipase Dα. Plant J 28:135-144
Sangwan V, Örvar BL, Beyerly J, Hirt H, Dhindsa RS (2002) Opposite changes in mem-
brane fluidity mimic cold and heat stress activation of distinct plant MAP kinase path-
ways. Plant J 31:629-638
Schroeder JI, Allen GJ, Hugouvieux V, Kwak JM, Waner D (2001) Guard cell signal trans-
duction. Annu Rev Plant Physiol Plant Mol Biol 52:627-658
Seki M, Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y, Kamiya A, Nakajima M, Enju
A, Sakurai T, Satou M, Akiyama K, Taji T, Yamaguchi-Shinozaki K, Carninci P,
Kawai J, Hayashizaki Y, Shinozaki K (2002) Monitoring the expression profiles of
7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-
length cDNA microarray. Plant J 31:279-292
Seo M, Koshiba T (2002) Complex regulation of ABA biosynthesis in plants. Trends Plant
Sci 7:41-48
Sheen J (1996) Ca2+-dependent protein kinases and stress signal transduction in plants. Sci-
ence 274:1900-1902
Shen Q, Zhang P, Ho T-H (1996) Modular nature of abscisic acid (ABA) response com-
plexes: Composite promoter units that are necessary and sufficient for ABA induction
of gene expression in barley. Plant Cell 8:1107-1119
Sheveleva E, Chmara W, Bohnert HJ, Jensen RG (1997) Increased salt and drought toler-
ance by D-Ononitol production in transgenic Nicotiana tabacum L. Plant Physiol
115:1211-1219
Shinozaki K, Yamaguchi-Shinozaki K (1997) Gene expression and signal transduction in
water-stress response. Plant Physiol 115:327-334
Singh KB, Foley RC, Onate-Sanchez L (2002) Transcription factors in plant defense and
stress responses. Curr Opi Plant Biol 5:430-436
Söderman E, Hjellström M, Fahleson J, Engström P (1999) The HD-Zip gene ATHB6 in
Arabidopsis is expressed in developing leaves, roots and carpels and up-regulated by
water deficit conditions. Plant Mol Biol 40:1073-1083
Söderman E, Mattsson J, Engström P (1996) The Arabidopsis homeobox gene ATHB-7 is
induced by water deficit and by abscisic acid. Plant J 10:375-381
Steindler C, Matteucci A, Sessa G, Weimar T, Ohgishi M, Aoyama T, Morelli G, Ruberti I
(1999) Shade avoidance responses are mediated by the ATHB-2 HD-zip protein, a
negative regulator of gene expression. Development 126:4235-4245
Stockinger EJ, Gilmour SJ, Thomashow MF (1997) Arabidopsis thaliana CBF1 encodes an
AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-
acting DNA regulatory element that stimulates transcription in response to low tem-
perature and water deficit. Proc Natl Acad Sci USA 94:1035-1040
Storz G (2002) An Expanding Universe of Noncoding RNAs. Science 296:1260-1263
Sunkar R, Bartels D, Kirch, HH (2003) Overexpression of a stress-inducible aldehyde de-
hydrogenase gene from Arabidopsis thaliana in transgenic plants improves stress tol-
erance. Plant J, in press
Takahashi S, Katagiri T, Hirayama T, Yamaguchi-Shinozaki K, Shinozaki K (2001) Hy-
perosmotic stress induces a rapid and transient increase in inositol 1,4,5-trisphosphate
independent of abscisic acid in Arabidopsis cell culture. Plant Cell Physiol 42:214-222
Tarczynski MC, Jensen RG, Bohnert HJ (1993) Stress protection of transgenic plants by
production of the osmolyte mannitol. Science 259:508-510
Ulm R, Revenkova E, di Sansebastiano GP, Bechtold N, Paszkowski J (2001) Mitogen-
activated protein kinase phosphatase is required for genotoxic stress relief in Arabi-
dopsis. Genes Dev 15:699-709
Uno Y, Furihata T, Abe H, Yoshida R, Shinozaki K, Yamaguchi-Shinozaki K (2000)
Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-
dependent signal transduction pathway under drought and high-salinity conditions.

Proc Natl Acad Sci USA 97:11632-11637
Urao T, Katagiri T, Mizoguchi T, Yamaguchi-Shinozaki K, Hayashida N, Shinozaki K
(1994) Two genes that encode Ca2+-dependent protein kinases are induced by drought
and high-salt stresses in Arabidopsis thaliana. Mol Gen Genet 244:331-340
Urao T, Yakubov B, Satoh R, Yamaguchi-Shinozaki K, Seki M, Hirayama T, Shinozaki K
(1999) A transmembrane hybrid-type histidine kinase in Arabidopsis functions as an
osmosensor. Plant Cell 11:1743-1754
Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K (1993) An Arabidopsis myb ho-
molog is induced by dehydration stress and its gene product binds to the conserved
MYB recognition sequence. Plant Cell 5:1529-1539
Velasco R, Salamini F, Bartels D (1998) Gene structure and expression analysis of the
drought- and abscisic acid-responsive CDeT11-24 gene family from the resurrection
plant Craterostigma plantagineum Hochst. Planta 204:459-471
Wang XQ, Ullah H, Jones AM, Assmann SM (2001) G protein regulation of ion channels
and abscisic acid signaling in Arabidopsis guard cells. Science 292:2070-2072
Weil CF, Wessler SR (1990) The effects of plant transposable element insertion on tran-
scription initiation and RNA processing. Annu Rev Plant Physiol Plant Mol Biol
41:527-552
Williams ME, Foster R, Chua NH (1992) Sequences flanking the hexameric G-Box core
CACGTG affect the specificity of protein binding. Plant Cell 4:485-496
Wurgler-Murphy SM, Saito H (1997) Two-component signal transducers and MAPK cas-
cades. Trends Biochem Sci 22:172-176
Yamaguchi-Shinozaki K, Shinozaki K (1994) A novel cis-acting element in an Arabidopsis
gene is involved in responsiveness to drought, low-temperature, or high-salt stress.
Plant Cell 6:251-264
Xu DP, Duan XL, Wang BY, Hong BM, Ho THD, Wu R (1996) Expression of a late em-
bryogenesis abundant protein gene, HVA1, from barley confers tolerance to water
deficit and salt stress in transgenic rice. Plant Physiol 110:249-257
Zhang S, Klessig DF (2001) MAPK cascades in plant defense signaling. Trends Plant Sci
6:520-527
Abbreviations
ABA: Abscisic acid

ABI: Abscisic acid insensitive
ABRE: Abscisic acid responsive element
AtHK1: Arabidopsis thaliana histidine kinase 1
bZIP: Basic region/leucine zipper
CE: Coupling element
CDPK: Calcium dependent protein kinase
CRT: C-repeat
DRE: Dehydration responsive element
HD-ZIP: Homeodomain-leucine zipper
LEA: late embryogenesis abundant
MAPK: Mitogen activated-like protein kinase
PLC: Phospholipase C
PLD: Phospholipase D
ROI: Reactive oxygen intermediates
2 Abscisic acid signalling
Alexander Christmann, Erwin Grill and Michael Meinhard
Abstract
Signalling of abscisic acid (ABA) in plants is characterized by an amazing number

of secondary messengers that are part of the pathway or modulate the specific
hormonal responses by interference with other signal transduction chains. In guard
cells, a fast turgor-regulatory pathway triggered by ABA can be distinguished
from a slower signalling pathway to the nucleus. The former is characterized by
changes in K+ and anion channel activities mediated by ABA-induced Ca2+ oscil-
lations and, subsequently, by vesicle trafficking due to alteration in cell size. The
nuclear signalling pathway involves changes in the phosphorylation status of sig-
nalling components including transcriptional regulators thereby redirecting gene
expression. Turgor- and nuclear-targeted steps of the ABA signalling cascade are
to some extent shared by common components. Recent findings emphasize the
importance of posttranscriptional regulation at the level of mRNA maturation and
protein-turnover. In addition, the concept of reciprocal feed back loops of both
pathways emerges.
2.1 Introduction
Abscisic acid (ABA) is considered a ‘stress hormone’ (Zeevaart and Creelman

1988). The phytohormone integrates environmental constraints linked to changes
in water activity with plant’s metabolic and developmental programs. Plants re-
spond to environmental challenges like drought and salt stress by changes in ABA
availability, either via re-distribution of the signal (Slovik et al. 1995, Wilkinson
and Davies 1997) or increased biosynthesis (Zeevaart and Creelman 1988), and
possibly by altering the sensitivity to the hormone signal. ABA is, however, not
only a stress hormone but also an endogenous signal required for proper develop-
ment. In the absence of environmental stress, a basal ABA level fine-tunes optimal
growth of plants (Cheng et al. 2002a) possibly by reducing growth-inhibitory eth-
ylene release (Sharp 2002). After exceeding certain threshold levels ABA precipi-
tates the stress-related effects such as complete closure of stomata and massive al-
teration of gene expression (Hoth et al. 2002, Seki et al. 2002, Rock 2000).
ABA signalling comprises the cellular events initiated by ABA that result in the
specific responses including turgor-regulation and differential gene expression.
Accordingly, a turgor-regulatory pathway can be distinguished from a nuclear sig-
nalling cascade (Webb et al. 2001, Fig. 1). ABA signalling, however, is not iso-

40 Alexander Christmann, Erwin Grill and Michael Meinhard
Fig. 1. Integration of ABA signal transduction into stress signalling and development.
Stress initiates the release of the internal signal ABA. ABA activates a signalling cascade,
which branches into several pathways including turgor-regulation and the nuclear pathway
readdressing gene expression. The ABA-induced change in the proteom feeds back to ABA
biosynthesis and ABA signalling as well as to ontogenesis of the plant.
lated but, in fact, is embedded in the transduction chains, which generate the sig-
nal in the first place, as well as in other signalling pathways that modulate and in-
terfere. The extend of ‘cross-talk’ between ABA signal transduction and other cel-
lular regulatory pathways can be envisaged as a central component of a clockwork
interlinked to other essential circuits such as primary metabolism, cell growth and
division. As a consequence, of this tight interaction it is difficult to discern a pri-
mary event from a secondary process.
Several recent reviews cover different aspects of ABA signalling such as con-
trol of germination (Finkelstein et al. 2002) or cover the role of ABA in guard
cells in a broader context (Schroeder et al. 2001, Hetherington 2001, Luan 2002).
Our contribution attempts to emphasize the emerging regulatory circuits of hor-
mone biosynthesis, ABA signalling, and ABA-specific gene expression. Further
chapters in this volume deal with the involvement of ABA in abiotic stress re-
sponses to drought (chapter 1), salt (chapter 9), and cold (chapter 6).
2.2 Systems used to study ABA signal transduction
A plethora of different experimental systems has emerged for studying ABA sig-
nal relay. In principle, any ABA-specific response provides a suitable basis, how-
ever, ABA-dependent control of seed germination (Finkelstein et al. 2002) and
2 Abscisic acid signalling 41
vegetative growth (Himmelbach et al. 1998) or stomatal closure of guard cells

(Schroeder et al. 2001) are primarily studied. The use of hormone-specific reporter
genes and transient expression systems has greatly facilitated the analysis of
ABA-signalling in plantlets (Wu et al. 1997), protoplasts (Sheen 2001), and cell
suspension cultures (Takahashi et al. 2001). Most of the work is performed with
Arabidopsis providing an extensive collection of mutants in ABA biosynthesis or
phytohormone-dependent responses (Finkelstein et al. 2002). However, there are
unique systems to study specific actions of ABA such as the interaction of ABA
and GA in barley aleurones (Shen et al. 2001) or the ABA-triggered developmen-
tal switch of the water fern Marsilea (Hsu et al. 2001).
An excellent system proved to be guard cells. Advantages of guard cells as a
model system for signal transduction include the absence of plasmatic connections
to neighbouring cells ideal for electrophysiological analysis and the sensitivity to
ABA resulting in reversible stomatal closure. In addition, the target cells are read-
ily accessible for manipulation and there are facile isolation procedures available
(Kruse et al. 1989). However, regulation of stomatal closure is not only influenced
by ABA and rather reflects the integration of internal and external stimuli for op-
timization of gas exchange (Grill and Ziegler 1998).
Different experimental systems are a prerequisite to test and generalize obser-
vations and conclusions drawn from specific analyses. ABA is just a signal and
the very same signal can generate different outputs depending on the different
‘wiring’ or competence of the target cell or tissue. This feature is frequently ob-
served in hormonal signalling. Guard cells from abaxial and adaxial surfaces of a
leaf blade differ in the response-sensitivities of inward-rectifying K+ channels
(Wang et al. 1998). With the same token, different cell types can respond in an
opposing manner to physiological ABA concentrations. Guard cells loose turgor
via outward-rectifying K+ channels in the presence of ABA (Blatt and Armstrong
1993) while cells of the mesophyll and root cortex cells keep or even increase tur-
gor pressure (Sutton et al. 2000, Roberts and Snowman 2000).
2.3 ABA biosynthesis
ABA formation is the result of C40 carotenoid cleavage in plastids by a specific

dioxygenase generating a C25 reaction product and the C15 compound xanthoxin
(Fig. 2), which is subsequently converted in the cytosol to abscisic aldehyde and
ultimately to ABA (Taylor et al. 2000). The plastidic origin of the carotenoid ar-
gues for a non-mevalonate derived biosynthesis of ABA. Carotenoid biosynthesis
in chloroplasts occurs via the alternative pathway of activated isoprene formation
starting from 1-deoxy-D-xylulose 5-phosphate (Arigoni et al. 1997, Lichtenthaler
et al. 1997) and ABA biosynthesis via the non-mevalonate pathway has been
demonstrated in tulip tree (Hirai et al. 2000). ABA biosynthesis is controlled by
substrate availability and activity of the dioxygenase, the 9-cis-epoxycarotenoid
dioxygenase (NCED), and by the reactions leading to the formation of ABA from
xanthoxin.
Fig. 2. Pathway of ABA biosynthesis in Arabidopsis. Zeaxanthin, antheraxanthin, and all-

trans-violaxanthin are the carotenoids of the xanthophyll cycle. Interconversion of these
compounds is accomplished via epoxidation or de-epoxidation reactions catalyzed by zeax-
anthin epoxidase (ABA1) and violaxanthin de-epoxidase (VDE), respectively. All-trans-
violaxanthin is converted either to 9-cis-violaxanthin or to 9-cis-neoxanthin. Both C40 caro-
tenoids are cleaved by 9-cis-epoxycarotenoid dioxygenase (NCED) to the C15 aldehyde
xanthoxin and a C25 compound. Xanthoxin is converted in a redox reaction catalyzed by the
short-chain dehydrogenase/reductase ABA2 into abscisic aldehyde, which is finally oxi-
dised to ABA by abscisic aldehyde oxidase (AAO). Proper function of AAO requires the
sulfurylated form of the molybdenum cofactor formed by the specific sulfurase ABA3. The
reaction sequences not entirely clarified yet are indicated by arrows with dotted lines.
2.3.1 Reactions generating substrates for NCED
The ABA biosynthesis pathway shares components of the xanthophyll cycle

(Siefermann-Harms 1977) in which the carotenoids zeaxanthin, antheraxanthin,
and all-trans-violaxanthin are interconvertible by the action of zeaxanthin epoxi-
dase (ZEP) and violaxanthin de-epoxidase (VDE). ZEP-deficient mutants aba1 of
Arabidopsis and aba2 of Nicotiana plumbaginifolia reveal ABA-deficiency and a
wilty phenotype (Duckham et al. 1991, Marin et al. 1996). Likewise, ectopic ex-
pression of ZEP resulted in increased ABA levels (Frey et al. 1999). ZEP tran-
script levels were upregulated in roots not in leaves under drought conditions with
enhanced ABA biosynthesis (Audran et al. 1998, Thompson et al. 2000a). All-
trans-violaxanthin conversion into all-trans-neoxanthin is catalyzed by neoxanthin
synthase (Bouvier et al. 2000).
2.3.2 NCED-catalyzed cleavage reaction
NCED catalyzes the formation of the first C15 intermediate, xanthoxin, by oxida-
tive cleavage of C40 carotenoids. Deficiency in the NCED VP14 of maize results
in precocious germination (Schwartz et al. 1997). Arabidopsis contains 5 NCEDs
homologues (AtNCED2/3/5/6/9) to VP14 (Iuchi et al. 2001). Expression analysis
of AtNCED5, AtNCED6, and AtNCED9 imply a seed-specific developmental role
in the regulation of ABA synthesis while AtNCED2 and AtNCED3 expression was
associated with lateral root formation (Tan et al. 2003). Transcript levels of all
five NCEDs, especially of AtNCED3, increased upon drought stress. NCED
overexpression resulted in elevated ABA levels in tomato (Thompson et al.
2000b), tobacco (Qin and Zeevaart 2002), and Arabidopsis while in Arabidopsis
AtNCED3 antisense lines revealed reduced ABA levels (Iuchi et al. 2001). The
VP14 homologue of Phaseolus vulgaris is rapidly induced at the mRNA and pro-
tein level prior to ABA accumulation during drought stress in accordance with a
key regulatory role of the dioxygenase in ABA biosynthesis (Qin and Zeevaart
1999). The carotenoid cleavage reaction probably occurs in plastids revealed by
the presence of a plastidic transit signal in drought-induced precursor proteins of
VP14 (Tan et al. 2001), AtNCED3 (Iuchi et al. 2001), and NCED1 of cowpea (Iu-
chi et al. 2000) that localized as a fusion protein in chloroplasts.
2.3.3 Formation of ABA from xanthoxin
The biosynthetic steps from xanthoxin (now also referred to as: 'xanthoxal') to
ABA have been debated (Cowan 2000, Milborrow 2001), till ABA2, which cata-
lyzes one of these steps, was cloned and further characterized (Cheng et al. 2002a,
González-Guzmán et al. 2002). It was then proven that ABA2, a unique short-
chain dehydrogenase/reductase in Arabidopsis converts xanthoxin to abscisic al-
dehyde in the cytosol. Abscisic aldehyde oxidase (AAO), present as four isoforms
in Arabidopsis (Seo et al. 2000a), catalyzes the final step in ABA biosynthesis, the
conversion of abscisic aldehyde to ABA. The enzymatic activity of ABA3 is re-

quired to provide the sulfurated form of a molybdenum cofactor that is necessary
for AAO to generate ABA (Bittner et al. 2001, Xiong et al. 2001b).
2.3.4 Feedback regulation of ABA biosynthesis
Expression studies of ABA biosynthetic genes revealed feedback regulation of

ABA synthesis by ABA. Increased ABA levels and drought or salt stress resulted
in enhanced expression of zeaxanthin epoxidase (ABA1, Xiong et al. 2002) and of
At-AAO3 and ABA3 (Xiong et al. 2001b, Xiong et al. 2002, Cheng et al. 2002a)
while transcript abundance of At-AAO2 was reduced by ABA (Hoth et al. 2002).
The changes are in line with an ABA-triggered mechanism to increase the capac-
ity of the plant to generate ABA. NCED expression seems not, however, to be
regulated by ABA and probably represents the rate-limiting step in ABA biosyn-
thesis.
However, the effect of ABA on expression of ABA biosynthesis genes in most
cases has not been confirmed at the protein level. Increase of At-AAO3 mRNA
under water stress conditions was not accompanied by a parallel increase in pro-
tein abundance or activity (Seo et al. 2000b). In the ABA-insensitive mutant abi1
but not in abi2 (see 4.5.1) ABA induction of ABA1 and At-AAO3 was reduced
indicating that feedback regulation of ABA synthesis was impaired (Xiong et al.
2002). However, ABA levels in response to drought in the ABA insensitive mu-
tant abi1 still seem to reach almost double the levels found in wild types (Lång et
al. 1994), emphasizing the importance of posttranscriptional regulation of ABA
turnover.
2.4. Signalling components
2.4.1 ABA- Receptor
The identification of an ABA-receptor is still at large despite a long history of

promising reports to characterize ABA-binding proteins (Hornberg and Weiler
1984, Pedron et al. 1998, Zhang et al. 2001a, Zhang et al. 2002). So far, neither
genetic nor biochemical approaches unequivocally identified candidates that fulfil
the needs for a functional receptor protein that are specific as well as saturable
binding of ABA and indispensable functionality in ABA signalling, at least for a
subset of ABA-responses.
The existence of structurally different ABA-receptors has been implied from
the observation that phaseic acid can substitute for ABA in some ABA-regulated
responses (Walker-Simmons et al. 1997) and from a study of Arabidopsis mutants
with an altered germination response in the presence of one ABA stereoisomer vs.
the other (Nambara et al. 2002). It is not clear, however, whether the stereospeci-
ficity reflects discrimination of a postulated ABA-uptake system (Wilkinson and

Davies 1997) or the hormone receptor itself.
An apoplastic perception of ABA is deducible from the capability of imperme-
able ABA-BSA conjugate to induce ABA dependent gene expression in Arabi-
dopsis cell suspension cultures (Jeannette et al. 1999, Hallouin et al 2002), from
the incapability of injected endogenous ABA to inhibit stomatal opening (Ander-
son et al. 1994), and from purification of an ABA-binding protein from Vicia faba
plasma membranes (Zhang et al. 2002).
Both the paucity of data on a plasmamembrane-localised receptor and the fail-
ure to identify such a component in diverse genetic screens have fostered the idea
of an intracellular perception site (Kushiro et al. 2003). The intracellular location
of an ABA-receptor is in line with the induction of ABA-responses by cytoplas-
mic application of ABA (Allan et al. 1994, Schwartz et al. 1994) and the identifi-
cation of ABA-binding sites in cytosolic protein fractions (Zhang et al. 2001a).
The structural similarity of ABA with retinoic acid, a hormone signal generated by
the breakdown of carotenoids in animals, stimulates the speculation that ABA
could directly regulate transcription comparable to retinoic acid that activates its
receptor, a transcription factor of the steroid receptor super family (Moriss-Kay
and Ward 1999).
2.4.2 Intracellular messengers
In many phytohormone signalling processes, Ca2+ serves as an intracellular mes-

senger including ABA-responses in which the Ca2+-signal is triggered by secon-
dary messengers like cyclic ADP ribose (cADPR), inositol 1,4,5 trisphosphate
(InsP3), or H2O2 (Schroeder et al. 2001). The elevation of cytosolic Ca2+ level
(Ca2+cyt) during the ABA response of guard cells follows a distinct pattern of reit-
erated phases of increase and decrease, the so-called Ca2+-oscillations that consti-
tute a primary regulator of the output response (Allen et al. 2001). Analysis of
ABA signalling events are frequently discerned in steps prior elevation of Ca2+cyt
and post-Ca2+ signal transduction events. We might follow this line of categoriz-
ing but like to point out that a signal component downstream of Ca2+ can affect
Ca2+-release by regulatory circuits and thereby confound the analysis. For in-
stance, a transcription factor acting downstream of Ca2+ may regulate the expres-
sion of Ca2+-upstream components and, thus, alters in a feedback loop the cytoso-
lic Ca2+ levels. These circuits are common to transduction pathways targeting gene
expression.
In addition, it should be noted that the ‘promiscuous’ Ca2+-signal of diverse
signal pathways argues for hormone-specificity provided either by a characteristic
Ca2+ signature, e.g. oscillation pattern (Klüsener et al. 2002) and/or parallel signal-
ling events triggered by the hormone receptor interaction (Himmelbach et al.
1998).
While the central role of Ca2+ in the ABA response is little debated, there is a
confounding plethora of other secondary signals involved in the transduction
process. ABA induced changes in the cytosolic compartment might also involve
alterations of the redox status (see 2.4.2.1) and elevation of pH (Irving et al. 1992,
Blatt and Armstrong 1993, Wang et al. 2001). Recently, a number of lipid-derived
secondary messengers have been identified to affect ABA-responses including
myo-inositol hexakisphosphate (InsP6, Lemtiri-Chlieh et al. 2000) and sphingos-
ine-1-phosphate (Ng et al. 2001). In other instances, activation of phospholipases
during ABA signalling is known but little is known about the identity of the cleav-
age products.
2.4.2.1 Redox signals

In the last years, a novel link between ABA perception and responses crystallized
implicating hydrogen peroxide and nitric oxide (NO) as mediators or regulators of
ABA signal transduction (Neill et al. 2002b). Both secondary messengers are as-
sociated with pathogen interaction (Klüsener et al. 2002) and are characterized by
a short biological half-life and by their impact on the redox status of the cell.
Conclusive data for the role of H2O2 in mediating ABA-induced closure was
provided by a study of Pei et al. (2000). H2O2 production in guard cells was stimu-
lated by ABA and resulted in the activation of Ca2+-permeable channels required
for stomatal closure. No activation of calcium channels by H2O2 was observed in
the gca2-1 mutant, which is insensitive to ABA-triggered stomatal closing. A
subsequent study revealed an altered Ca2+-oscillation pattern in the gca2-1 mutant
that is responsible for the observed ABA-insensitivity (Allen et al. 2001). Thus,
the altered H2O2 and ABA sensitivity of gca2-1 may reflect a modified Ca2+-
signature, which seems to be regulated by several input signals including elicitor
and pathogen interaction (Klüsener et al. 2002). Recent analyses of knockout
Arabidopsis lines with impaired functionality of NADPH-oxidases support the
role of H2O2 in mediating ABA responses (Kwak et al. 2003). In addition, H2O2
seems to mediate ABA-relayed inhibition of K+ inward channels (Zhang et al.
2001b) and also interferes with key regulators of ABA signalling by enzymatic
inactivation of the protein phosphatases ABI1 and ABI2 (Meinhard and Grill
2001, Meinhard et al. 2002). In vitro studies revealed rapid inactivation of the two
PP2Cs probably by oxidation of critical cysteine residue(s). Transient inactivation
of ABI1 and ABI2 acting as negative regulators of ABA signalling (Gosti et al.
1999, Merlot et al. 2001) would result in stimulation of ABA signalling while in
case of the recently described positive regulatory function of ABI1 (Wu et al.
2003) inactivation by H2O2 would generate a downregulation of the signalling
pathway. Apart from a role in regulating ion currents, H2O2 has also been assigned
a role in cellular responses to ABA at the level of gene regulation (Guan et al.
2000).
Nitric oxide (NO) is an important effector in animal cells. In plants, NO affects
processes related to growth and development (Beligni and Lamattina 2001) and it
seems to play a role in adjustments of physiological processes to external abiotic
influences (Durner et al. 1998). Recently, it has been reported that in guard cells
of Vicia faba (Garcia-Mata and Lamattina, 2002) or Pisum sativum (Neill et al.
2002a), NO is a component of ABA signalling. As depicted from pharmacological
experiments NO induction of stomatal closure requires cADPR and cGMP and
thus might act upstream of calcium. The analysis of Arabidopsis mutants defective
in two nitrate reductases revealed the putative source for NO development (Desi-
kan et al. 2002). In the ABA-treated guard cells from nia1, nia2 double mutant
plants both NO development and stomatal closure were greatly reduced. Interest-
ingly, NO production was not impaired in abi1 and abi2 mutants, arguing for a
role of NO and nitrate reductase upstream of or parallel to the action of the ABI1
and ABI2 protein phosphatases. A more detailed discussion covering the putative
function of nitrate reductase and the chemistry of NO in plant cells can be found
in a recent review by Garcia-Mata and Lamattina (2003).
2.4.2.2 Cyclic nucleotides

cADPR triggers ABA-mediated gene activation (Wu et al. 1997) as well as
stomatal closure via release of Ca2+ from internal stores (Lecki et al. 1998). As
stated above analyses argue for cGMP and cADPR to be components in a stomatal
ABA signalling pathway involving NO production (Neill et al. 2002a). In animal
systems, cADPR is generated by a specific Ca2+-stimulated cyclase from NAD
and the intracellular signal constitutes part of a calcium-induced-calcium release-
system in that it increases cytosolic calcium levels by activation of ryanodine-
sensitive Ca2+-channels. Such ryanodine-sensitive Ca2+-channels exist in the tono-
plast of plants (Allen et al. 1995). In this context, it is intriguing that in lower ani-
mals, in sponges, ABA, cADPR and calcium-induced-calcium release form a sig-
nal pathway mediating thermo-induced responses (Zocchi et al. 2003).
2.4.2.3 Lipid-derived signals

In guard cells, phospholipases C (PLC) and D (PLD) are activated by ABA (PLD:
Jacob et al. 1999, PLC: Lee et al. 1996, Staxen et al. 1999). Activation occurs at
the enzymatic level and for AtPLC1 of Arabidopsis a transcriptional upregulation
by ABA has been found (Hirayama et al. 1995). Phospholipase C (PLC) catalyzed
cleavage of phosphatidylinositol 4,5-bisphosphate generates the second messen-
gers diacylglycerol and InsP3. InsP3 mobilizes Ca2+-release from internal stores
into the cytosol via an InsP3-receptor localized at the vacuolar membrane (Allen et
al. 1995). The exact contribution of InsP3 or diacylglycerol to ABA responses is
still not clear, but reducing PLC expression limited ABA responses (Sanchez and
Chua 2001, Hunt et al. 2003). A central role of InsP3 is also supported by the
Arabidopsis loss of function mutant fry1. FRY1 is an inositol polyphosphate 1-
phosphatase that converts InsP3 to InsP2. fry1 plants display an enhanced sensitiv-
ity to ABA obviously due to the impaired phosphoinositide catabolism (Xiong et
al. 2001c). In agreement with that, overexpression of other InsP3 degrading en-
zymes, two inositol 5-phosphatases (At5PTase 1 and 2), resulted in ABA insensi-
tivity with respect to stomatal regulation and gene regulation in seedlings
(At5PTase 1, Burnette et al. 2003) or seed germination (At5PTase 2, Sanchez and
Chua 2001). In addition, other phosphoinositides like phosphatidylinositol 3- and
4-phosphate (Jung et al. 2002) and InsP6 (Lemtiri-Chlieh et al. 2000) interfere
with ABA signal transduction. InsP6 is transiently increased by ABA and InsP6
was found to be more potent than InsP3 to mediate ABA-linked ion channel regu-
lation (Lemtiri-Chlieh et al. 2000).
Taken all these facts into consideration, phosphoinositide metabolism seems to
play a central role in ABA signal transduction, although the actual role of single
compounds in relation to Ca2+ and other signalling cassettes are still largely un-
known.
Phosphatidic acid (PA), a phospho-diacylglycerol, is generated by PLD activity
from phospholipids. PA induced stomatal closure and inhibited stomatal opening
in epidermal peels (Jacob et al. 1999). Several studies provide further evidence for
a role of PLD in ABA signalling. ABA-mediated upregulation of gene expression
in Arabidopsis was accompanied by a transient stimulation of PLD activity (Hal-
louin et al. 2002). Antisense expression of PLD reduced ABA-induced senescence
(Fan et al. 1997). Treatment with 1-butanol, a presumed selective inhibitor of PLD
inhibited both ABA-induced production of PA and partially ABA-induced
stomatal closure (Jacob et al. 1999). Additionally, antisense lines for PLD showed
ABA insensitivity with respect to stomatal closure, while overexpression of PLD
resulted in increased drought resistance (Sang et al. 2001). These findings suggest
that PA is involved in ABA responses as a secondary messenger. Since PA treat-
ments did not increase guard cell Ca2+cyt, PLD must act either downstream of Ca2+
or in a parallel pathway (Jacob et al. 1999).
In the barley aleurone, too, ABA effects seem to be triggered by phosphatidic
acid, which is released by an ABA triggered increase in PLD activity (Ritchie et
al. 2002). The activation of PLD is claimed to be G-protein mediated and local-
ized to the plasma membrane (Ritchie and Gilroy 2000). It is not yet clear, how-
ever, if stimulation of PLD activity by ABA in general involves G proteins or if
ABA induced changes in Ca2+ oscillations are responsible for PLD activation.
Recently, another phospholipid, sphingosine-1-phosphate (S1P), was impli-
cated as secondary messenger in drought and ABA signalling (Ng et al. 2002).
The enzyme involved in S1P formation, sphingosine kinase, is activated by ABA
and sphingosine kinase inhibition impairs stomatal regulation (Coursol et al.
2003).
2.4.2.4 Calcium
Ca2+ is a major component in many signalling pathways in plants and animals. It
has been suggested that individual stimuli evoke increases of Ca2+cyt, which are
unique in terms of their spatio-temporal characteristics (Evans et al. 2001) and
such stimulus-specific Ca2+ signals have been referred to as “Ca2+ signatures”. In
general, two distinct but not exclusive types of Ca2+ increases can be observed.
One type brings along a single increase in Ca2+cyt that usually is of transient na-
ture. This may in some cases be followed by a variable number of additional tran-
sients with a defined temporal distance to each other and usually declining ampli-
tudes leading to the second type, Ca2+oscillations. Specificity of a calcium signal
depends on the compartment(s) from which Ca2+ is released and on the amplitude
and frequency of the stimulus-induced Ca2+cyt oscillations. Guard cells achieve an
optimal aperture under a certain set of environmental conditions by integrating
signals from differing stimuli. Since many of these stimuli use calcium as a second
messenger (Evans et al. 2001), integration of the signals might take place on the
levels of resulting “Ca2+ signatures”. Ca2+cyt elevations can result in opposing reac-
tions such as stomatal closure or opening, which are both preceded by a rise in
Ca2+cyt (Irving et al. 1992).
In response to ABA, cytosolic-free Ca2+ increases in guard cells and this Ca2+
increase precedes stomatal closure (McAinsh et al. 1990). Furthermore, ABA ap-
parently sensitizes Ca2+ influx to membrane potential (Grabov and Blatt 1998,
Hamilton et al. 2000). In an elegant electrophysiological study, Allen et al. (2001)
explored the specificity of Ca2+ signatures for regulation of the stomatal aperture.
Using buffer changes they artificially superimposed Ca2+ oscillations in Arabidop-
sis guard cells and found optimal parameters with respect to frequency and dura-
tion of the Ca2+ transients, finally leading to reduced steady state stomatal aper-
tures. These parameters where consistent with those observed after challenging
guard cells with ABA. Moreover, gca2, an ABA insensitive mutant, displayed
suboptimal oscillation parameters that turned out to be insufficient for prolonged
stomatal closing. When wild type oscillations were experimentally imposed in
gca2 guard cells, stomatal closure was partially restored. Interestingly, while sin-
gle Ca2+ transients already led to a rapid closure, they were not able to induce a
long-term effect, since stomata reopened after the imposed program was stopped.
This strongly argues for two distinct mechanisms driven by Ca2+. A single, tran-
sient Ca2+ increase seems to be sufficient for short time closing of stomata, for ex-
ample by inhibition of the plasma membrane H+-ATPase (Kinoshita et al. 1995),
while a long time response is dependent on oscillations with distinct frequency,
duration and amplitude.
ABA-induced increases in Ca2+cyt by activation of plasma membrane calcium
channels are reduced in the protein phosphatase mutants abi1 and abi2 (Allen et
al. 1999, Murata et al. 2001). Different mechanism of Ca2+ release (Allen et al.
2000) are responsible for generation of Ca2+ oscillations in response to different
stimuli as exemplified with the det3 mutant devoid of the C-subunit of vacuolar
ATPase (Allen et al. 2000). Ca2+ or H2O2 failed to generate Ca2+ oscillations and
to induce stomata closure in det3 whereas both ABA and cold induced Ca2+cyt os-
cillations and the proper stomatal response.
2.4.3 G-proteins
Heterotrimeric GTP-binding proteins (G-proteins) as well as small G-proteins are

involved in modulating ABA responses. GPA1, the sole typical α subunit of
trimeric G-proteins in Arabidopsis, is required for pH-independent ABA activa-
tion of slow anion channels (Wang et al. 2001). The activation was abolished in
gpa1 knockout lines not in wild type plants when ABA-induced pH changes of the
cytosol were suppressed. In essence, the data suppose that different ABA signal-
ling pathways are able to activate anion channels. Effects of S1P on stomatal regu-
lation were diminished in gpa1-1 and gpa1-2 supporting an interaction of the Gα
subunit with sphingosine-type signals (Coursol et al. 2003).
In the barley aleurone, G-protein mediates ABA induction of phospholipase D

(PLD), an effect, which is localized to the plasma membrane (Ritchie and Gilroy
2000). Other studies support this notion (Pappan and Wang 1999) while in Arabi-
dopsis cells a G protein-mediated activation of PLD was ruled out (Hallouin et al.
2002).
A monomeric G protein AtRac1 is involved in mediating ABA-triggered
stomatal closure. AtRac1 inactivation is necessary for an ABA-induced reorgani-
zation of the actin skeleton in guard cells required for stomatal closure (Lemichez
et al. 2001, Eun et al. 1997). Analyses of transgenic plant with deregulated expres-
sion of such monomeric GTPases employing constitutively active and dominant-
negative forms have revealed altered ABA responses (Yang 2002). A null mutant
of the small GTPase ROP10 (RHO-like small G protein of plants) of Arabidopsis
revealed specifically enhanced ABA responses (Zheng et al. 2002). Baxter-Burrell
et al. (2002) established a link between ROP signalling and H2O2 production. The
proposed role of H2O2 as a regulator of ABA signalling supports a function of
those GTPases as nodes of a regulatory network in which inputs from different
signalling pathways including the ABA signal transduction chain are integrated.
2.4.4. Farnesyltransferase ERA1
The ERA1 gene encodes a farnesyltranferase β-subunit with multifaceted roles,

since the loss-of-function mutant era1-2 displays a pleiotropic phenotype covering
changes in development, auxin and ABA signalling (Pei et al. 1998, Yalovsky et
al. 2000, Brady et al. 2003). The influence of ERA1 as a negative regulator of
ABA signal transduction in guard cells is exerted on the level of Ca2+cyt increases
through plasma membrane Ca2+ channels (Allen et al. 2002).
2.4.5 Protein phosphatases
2.4.5.1 Protein phosphatases ABI1, ABI2

ABI1 and ABI2 are homologous type 2C protein phosphatases with overlapping
yet distinct functions. The ABA-insensitive Arabidopsis mutants abi1-1 and abi2-
1 characterized ABI1 and ABI2 as key regulators of ABA-invoked seed dor-
mancy, stomatal closure, and vegetative growth inhibition (Koornneef et al. 1984).
The mutant abi1-1 (abi1) and abi2-1 (abi2) proteins confer a genetically dominant
ABA-insensitivity and both carry the same amino acid substitution at equivalent
positions of the catalytic PP2C domain resulting in a reduced phosphatase activity
(Leung et al. 1997, Rodriguez et al. 1998a). Despite major efforts to elucidate the
mechanism of ABI1 and ABI2 action, the precise role is still a conundrum, partly
due to the functional redundancy and to the ‘gain-of-function’ action of abi1 and
abi2. Ectopic (over)-expression of abi1 and ABI1 in transient system generated
ABA-insensitivity in agreement with a negative regulatory role of the PP2C on
ABA signalling (Sheen 1998). In line with this conclusion, intragenic revertants of
Fig. 3. Model of dual ABI1 action as a positive and negative regulator. Binding of ABA to
the ABA receptor mediates inactivation of the repressor R of ABA signal transduction by
activation of ABI1 (positive role). This step requires dephosphorylation, which is impaired
in the phosphatase-deficient abi1-repressor complex resulting in a genetically dominant
failure to activate ABA-responsive genes including induction of ABI1 expression. ABI1 is
required to form the active repressor as a repressor R-ABI1 complex that is stabilized by
protein phosphorylation (negative role). Induction of ABI1 expression by ABA results in
increased formation of repressor protein that offsets the balance towards active repressor
that results in a ABA desensitizing. Alternatively, ABI1 released from the complex exerts a
second negative control of the signalling pathway. Thus, ABI1 exerts both a positive regu-
latory role in ABA signalling as well as a negative feedback requiring ABA-induced gene
expression of ABI1. Transient analyses by microinjected ABI1 forms interfered with the
activation of ABA signalling whereas ectopic expression of ABI1 primarily generated the
ABA-desensitized phenotype.
abi1-1 exhibited an ABA hypersensitive recessive phenotype (Gosti et al. 1999,

Merlot et al. 2001). The revertant genes were assumed to be loss-of-function al-
leles though the secondary mutations in all instances inactivated only the catalytic
domain. There seems to be a clear bias against inactivation of the aminoterminal
domain that is supposed to represent a regulatory or interaction domain (Leube et
al. 1998). In addition, transient expression analyses documented the requirement
for phosphatase activity of ABI1 for mediating ABA-insensitivity, however, a dis-
tinct mutated form of ABI1 that lacked PP2C activity still inhibited ABA-
inducible transcription (Sheen 1998), suggesting interference of ABI1 with inter-
action partners of ABA signalling.
Recent protein microinjection data shed new light on ABI1 action (Wu et al.
2003). Tomato hypocotyls cells revealed an ABA-insensitive phenotype after in-
jection of abi1 protein while coinjection of ABI1 at a two- to threefold excess over
the mutant form rescued ABA-inducible transcription. Thus, ABI1 and abi1 com-
pete for common binding sites and the wild-type protein is capable to restore
proper ABA signal relay in agreement with a positive regulatory function of the
specific PP2C. The different assay systems, ectopic gene expression and transient
protein introduction, probably reveal different natures of ABI1 action. Consistent
high expression levels of ABI1 generate an ABA-insensitive phenotype, possibly
by forming more active repressor complex (Fig. 3) or via re-addressing gene ex-
pression in a feed-back loop. Short-transients of introduced abi1/ABI1 protein in-

terferes with primary ABA-signalling events in which the PP2C activity is re-
quired for ABA-signal propagation.
To reconcile the findings, the emerging mechanism of ABI1 (and possibly
ABI2) action includes a first step characterized by the requirement for ABI1 phos-
phatase activity to relay the ABA signal into the nucleus, and a second step in
which induction of ABI1 results in the desensitizing of the plant against ABA. In
this scenario, the abi1/abi2 mutant forms inhibit the first step possibly by prevent-
ing dephosphorylation of a negative regulator of ABA-signal transfer within a pro-
tein complex (Himmelbach et al. 1998). Consistent with this view, microinjection
of a phosphatase-inactive ABI1 blocked signal transduction (Wu et al. 2003).The
second action of ABI1 probably involves nuclear localization and interaction with
transcriptional regulators (Himmelbach et al. 2002, see below)
The components of the proposed ABI1-regulatory protein complex are still at
large though the association of ABI1 and ABI2 with the protein kinase PKS3 that
interacts with the Ca2+-binding proteins SCaBP5 (Ishitani et al. 2000, Guo et al.
2002) provides an intriguing paradigm of a physical interaction of a putative Ca2+-
sensor and its associated protein kinase with the PP2C. Analysis of knockout and
RNAi lines of SCaBP5 and PKS3 revealed alteration of ABA responses. In addi-
tion, studies of double mutants support the notion that the proposed complex nega-
tively interferes with ABA signal transduction.
2.4.5.2 Other protein phosphatases

Apart from ABI1 and ABI2, two other PP2Cs of Arabidopsis, AtPP2CA and
AtP2C-HA, have been implicated to regulate ABA signal transduction. Both are
transcriptionally upregulated by ABA (Tahtiharju and Palva 2001, Rodriguez et al.
1998b). AtPP2CA inhibited ABA action in maize protoplasts comparable to ABI1
(Sheen 1998) and interacts with an inward rectifying K+ channel (Cherel et al.
2002). Silencing AtPP2CA expression in Arabidopsis by an antisense approach
resulted in accelerated freezing tolerance (Tahtiharju and Palva 2001). Thus,
AtPP2CA probably acts in a negative regulatory feedback circuit.
A positive regulatory role in ABA signalling is assigned to the protein phos-
phatase 2A, RCN1 (Kwak et al. 2002). Arabidopsis rcn1 mutant plants display
ABA insensitivity with respect to stomatal opening and germination in line with
disruption of ABA induced activation of anion channels in guard cells and reduced
Ca2+ increases. Interestingly, RCN1 was formerly described to be involved in
auxin transport, gravitropic responses, and lateral root growth (Garbers et al. 1996,
Rashotte et al. 2001). These findings point to interference of regulatory networks
controlled by differing signals and reflect pleiotropic phenotypic alterations. Al-
ternatively, these regulators could exert differential roles in distinct signalling
pathways.
2.4.6 Protein kinases
The action of protein phosphatases such as ABI1 is counterbalanced by protein

kinases. Several protein kinases have been implicated in ABA responses including
Ca2+-calmodulin regulated protein kinases (Sheen 1996) and SNF1-like protein
kinases such as PKABA1 (Anderberg and Walker-Simmons 1992).
2.4.6.1 Protein kinases AAPK, PKABA1 and OST1/SRK2E

PKABA1 of wheat and barley (Anderberg and Walker-Simmons 1992, Yamauchi
et al. 2002) as well as AAPK from Vicia (Li and Assmann 1996) and
OST1/SRK2E from Arabidopsis (Mustilli et al. 2002, Yoshida et al. 2002) belong
to the protein family of SNF1-like protein kinases. All three kinases contain an N-
terminal domain similar to SNF1/AMP-regulated protein kinase of yeast (Hardie
et al. 1998) and a C-terminal domain with putative regulatory functions.
PKABA1 of wheat is ABA-induced and antagonizes GA-induced gene expres-
sion in seeds and germinating seedlings (Anderberg and Walker-Simmons 1992,
Yamauchi et al. 2002) while PKABA1 of barley aleurone cells is only involved in
GA-regulated gene expression, which suggests functional separation of paralogues
(Shen et al. 2001). PKABA1 of wheat physically interacts with the putative phos-
phorylation substrate TaABF, a basic leucine zipper transcription factor that has
high structural homology to ABI5 of Arabidopsis (Johnson et al. 2002, see below).
AAPK from Vicia is a positive regulator of ABA-induced stomatal closure pre-
sumably by mediating the activation of plasma membrane anion channels (Li et al.
2000). It can physically interact with an RNA binding protein, AKIP1 (Li et al.
2002). AAPK shares high homology in primary structure with OST1/SRK2E of
Arabidopsis (Mustilli et al. 2002, Yoshida et al. 2002) and both are rapidly acti-
vated by ABA. The recessive ost1 mutants were isolated by screening for thermal
surface differences due to altered transpiration rates (Mustilli et al. 2002), a tech-
nique elegantly applied to identify an ABA insensitive barley mutant (Raskin and
Ladyman 1988). ost1 mutants are impaired in both ABA-dependent stomatal clos-
ing and ABA-mediated inhibition of stomatal opening. Seed dormancy and the re-
sponse of germinating seedlings to ABA are not altered (Mustilli et al. 2002, Yo-
shida et al. 2002), arguing for a specific role of OST1/SRK2E in guard cell
regulation.
2.4.6.2 Mitogen-activated protein kinases

The involvement of mitogen-activated protein (MAP) kinase in ABA signal trans-
fer is still not clearly substantiated despite an earlier report (Knetsch et al. 1996).
However, MAPK cascades are involved in stress signalling throughout eukaryots
including H2O2 and pathogen signalling in plants (Kovtun et al. 2000, Jonak et al.
2002). An interference of such pathways with ABA signalling is evident consider-
ing the convergence of such pathways at the level of Ca2+-oscillations (Klüsener et
al. 2002). Recently, the MAPK AtMPK3 has been reported to participate in ABA-
evoked postgermination arrest (Lu et al. 2002).
2.4.6.3 Calcium-regulated protein kinases

The calcium-dependent protein kinases (CDPKs) comprise a family of Ca2+ sen-
sors consisting of a protein kinase domain and a carboxyterminal Ca2+-binding
calmodulin-like domain (Cheng et al. 2002b). Ca2+-mediated stimulation of kinase
activity is the proposed action of CDPKs (Huang et al. 1996, Romeis et al. 2000).
Transient expression analysis supports the involvement of a CDPK in ABA-
signalling as a positive regulator (Sheen 1996). In guard cells, CDPKs can phos-
phorylate the inward K+ channel protein KAT1 (Li et al. 1998), but the link be-
tween ABA-mediated stomatal closure and Ca2+-triggered CDPK action is not re-
solved which could involve regulation of the endoplasmatic Ca2+-pump ACA2
(Hwang et al. 2000). In addition, two other protein kinases that associate with
Ca2+-sensors regulate or modulate ABA-responses: the already mentioned PKS3,
which interacts with the Ca2+-binding proteins SCaBP5 and binds to ABI1 and
ABI2 (Ishitani et al. 2000, Guo et al. 2002), as well as CIPK3, a Ser/Thr kinase
that associates with a calcineurin B-like calcium sensor (Kim et al. 2003).
2.4.7 Transcriptional regulators
Targets of ABA signalling are preformed elements such as ion channels, the cy-
toskeleton (Eun and Lee 1997, Hwang and Lee 2001), the vesicle trafficking ma-
chinery (Leyman et al. 1999, Geelen et al. 2002), or transcription factors. The
transcription factors control ABA-regulated genes, possibly including secondary
transcription factors that activate a set of ABA-responsive genes further down-
stream in the signalling cascade. The ABA-signal massively readdresses genomic
expression as revealed by transcriptome analyses (Hoth et al. 2002, Seki et al.
2002). By random massive sequencing of transcripts more than 1300 ABA-
regulated genes were identified in Arabidopsis seedlings, approximately half of
them were upregulated and the other downregulated (Hoth et al. 2002). ABA regu-
lation of the majority of the genes (more than 90%) was impaired in the abi1 mu-
tant emphasizing the central role of this locus in ABA signal transduction. Several
cis-acting elements are known that confer regulation of gene expression by ABA
and represent interaction sites of transcriptional regulators including VP1/ABI3,
basic region/leucine zipper (bZIP), homeodomain-containing, as well as MYB-
and MYC-type transcription factors. Unfortunately, nothing is known about tran-
scriptional regulators conferring ABA-mediated downregulation. Among the ABA
regulated genes, transcripts encoding ABA signalling components like ABI1,
ABI2 and AtHB6 are upregulated, obviously reflecting adjustment of the signal-
ling machinery by negative feedback loops (Hoth et al. 2002, Himmelbach et al.
2002).
2.4.7.1 VP1/ABI3
ABI3 from Arabidopsis and its putative orthologue VIVIPAROUS 1 (VP1) from
maize contain four highly conserved domains, an acidic domain (A1) and three
basic domains capable to mediate DNA (B2, B3) or protein binding (B1) (Naka-
mura et al. 2001, Suzuki et al. 1997). VP1/ABI3 interfere with ABRE-type cis-
elements by binding to the bZIP transcription factor ABI5/TRAB1 (see below)
and this interaction is required to maintain ABA-mediated seed dormancy (Hobo
et al. 1999, Nakamura et al. 2001). Moreover, VP1 and the bZIP factor EmBP1
form a DNA binding complex together with a member of the highly conserved 14-
3-3 protein family (Schultz et al. 1998). 14-3-3 proteins have been suggested to be
fine-tuners of their targets by binding to specific phosphorylated serine residues.
Such interaction of 14-3-3 proteins with transcription factors may reflect an addi-
tional mechanism to couple ABA regulated phosphorylation/dephosphorylation
events to gene expression.
2.4.7.2 Basic region/leucine zipper (bZIP) transcription factors

The bZIP transcription factors constitutes a prominent group of ABA-response
regulators that interact with ABA-response elements (ABRE), ACGT-containing
'G-boxes' of promoter elements (Hattori et al. 2002), and usually require a second
related motif, also called coupling element, to achieve optimal ABA responsive-
ness (Busk and Pages 1998, Rock 2000). Interestingly, a dehydration-responsive
element (DRE) could serve as a coupling element (Narusaka et al. 2003). The
bZIP transcription factors with a functional role in ABA or stress signalling repre-
sent a clade within the 75 bZIP transcription factors of Arabidopsis (Jacoby et al.
2002). The subclass includes the bZIP transcription factors ABI5/TRAB1 (Finkel-
stein and Lynch 2000, Hobo et al. 1999), and the ABA-responsive element bind-
ing factors AREB1/ABF2, AREB2/ABF4, AREB3, ABF1 and ABF3 (Choi et al.
2000, Uno et al. 2000). AREB1/ABF2 and AREB2/ABF4 transactivate ABA-
regulated gene expression in dependence on ABA probably after phosphorylation
of the aminoterminal domain mediated by a specific ABA-activated protein kinase
(Uno et al. 2000). Similarly, rice TRAB1 becomes phosphorylated in response to
ABA at a specific serine residue that is required for activation of the preformed
and idle bZIP transcriptional regulator (Kagaya et al. 2002). While AREBs/ABFs
seem to play a regulatory function predominantly in vegetative tissues, ABI5 is
involved as a positive regulator in ABA signal transduction during seed and early
seedling development (Finkelstein and Lynch 2000). ABA exerts a dual effect on
ABI5, it enhances ABI5 gene expression and stabilizes the protein by mediating
ABI5 phosphorylation (Finkelstein and Lynch 2000, Lopez-Molina et al. 2001).
The proteolytic degradation of ABI5 by the 26S proteasome (Lopez Molina et al.
2003, Smalle et al. 2003) is required to overcome postembryonic growth arrest.
ABA blocks the degradation, which leads to accumulation of ABI5 and reactiva-
tion of embryonic genes (Lu et al. 2002). ABI5 is able to bind to the ABA tran-
scriptional activator ABI3 thereby possibly recruiting ABI3 to target promoters
such as the ABA-regulated late embryo abundant genes (Nakamura et al. 2001).
Deficiency of ABI3 results in the repression of ABI5 expression (Lopez-Molina et
al. 2001). These findings provide a basis to explain the ABA-insensitive pheno-
type of the loss-of-function mutants vp1 of maize and Arabidopsis abi3 and abi5.
2.4.7.3 Homeodomain-leucine zipper transcriptional regulators

ABA induces expression of several homeodomain- and leucine zipper-containing
(HD-Zip) transcriptional regulators including ATHB5 (Johannesson et al. 2003),
ATHB6 (Söderman et al. 1999), ATHB7 (Söderman et al. 1996) and ATHB12
(Lee et al. 2001). Functional characterization of ATHB5 (Johannesson et al. 2003)
and ATHB6 (Himmelbach et al. 2002) support a role in ABA signal transduction
as a positive and negative regulator, respectively. ATHB6 targets the AT-rich cis-
element CAATTATTA and physically interacts with the protein phosphatase 2C
ABI1 (Himmelbach et al. 2002). The nuclear-localised ATHB6 requires transloca-
tion of ABI1 into the nuclear compartment for interaction. Upregulation of
ATHB-6 gene expression is ABI1-dependent and results in desensitizing of guard
cells against ABA.
2.4.7.4 AP2-type transcription factors

EREBPs (ethylene-responsive element binding proteins) and AP2 (APETALA2)
are the prototypic members of a family of transcription factors unique to plants,
whose distinguishing characteristic is that they contain the so-called AP2 DNA-
binding domain. Members of this family are the dehydration-responsive element
binding proteins (DREBs, Liu et al. 1998), which recognise the drought-
responsive element (DRE, Yamaguchi-Shinozaki and Shinozaki 1994) in target
promoters. DREBs are intermediates in an ABA-independent pathway, which re-
lays drought, cold, and pathogen stress signals (Kizis et al. 2001, Park et al. 2001).
Recently, one maize DRE-binding protein has been shown to be induced by ABA
(Kizis and Pagès 2002) implying that not all DRE-binding factors function inde-
pendently from ABA. Furthermore, there exists interference between ABRE and
DRE and their transcriptional regulators in that DRE/DRE motifs are able to serve
as a coupling element of ABRE (Narusaka et al. 2003) and the maize DRE-
binding factor DBF1 is an activator of ABA-induced transcription while DBF2 an-
tagonizes the action (Kizis and Pagès 2002). ABI4 is another member of this fam-
ily, which has been implicated in a seed-specific signalling pathway (Finkelstein
1994). ABI4 interferes with ABA signal transduction by interacting with ABI3
and ABI5 (Söderman et al. 2000). The maize orthologue ZmABI4 specifically
binds to a coupling element of ABA-responsive genes (Niu et al. 2002).
2.4.7.5 Other transcription factors

133 basic helix-loop-helix (bHLH) transcriptional regulator genes have been de-
termined in Arabidopsis (Heim et al. 2003). Among them, rd22BP1 (renamed
AtMYC2) has been shown to activate ABA-inducible gene expression under
drought stress (Abe et al. 2003), while expression of three other members of the
bHLH family, BEE1, BEE2, and BEE3 which are positive regulators in brassinos-
teroid signalling is repressed by ABA.
Plant MYB transcription factors, a family with more than 100 members in
Arabidopsis with probably distinct functions, show structural similarity to the ver-
tebrate cellular proto-oncogene c-MYB (Martin and Paz-Ares 1997). ABA and
drought induce the expression of three specific MYB family members (Abe et al.
1997). While the bZIP and HD-Zip proteins seem to work as preformed targets, de
novo synthesis is required for MYB/MYC action necessitating a primary transcrip-
tional regulator of ABA action (Shinozaki and Yamaguchi-Shinozaki 2000).
Single C2H2 zinc finger protein genes comprise a gene family with approxi-
mately 30 genes in Arabidopsis (Dinkins et al. 2002). SCOF-1 is a C2H2-type
zinc finger protein from soybean, which is induced by low temperature and ab-
scisic acid (ABA) but not by dehydration or high salinity (Kim et al. 2001).
SCOF-1 does not bind to an ABA responsive element (ABRE) directly but greatly
enhanced the DNA binding activity of SGBF-1, a soybean G-box binding bZIP
transcription factor, to ABRE in vitro.
2.5 RNA and protein turnover during ABA response
Recent findings uncovered a novel facet of ABA-relayed control of gene expres-

sion at the posttranscriptional level. The control seems to be exerted by affecting
maturation of mRNA as well as stability of transcripts and proteins. In addition,
genome-wide expression analysis unravelled downregulation of transcript abun-
dance for ribosomal proteins paralleled by a concomitant upregulation of genes
involved in proteolysis (Hoth et al. 2002).
RNA-binding proteins frequently regulate turnover or access of transcripts to
the translational machinery (Fedoroff 2002b). The maize ABA-regulated and gly-
cine-rich RNA-binding protein MA16 preferentially interacts with uridine- and
guanosine-rich stretches and is associated with RNAs and several other proteins in
a sort of ribonucleoprotein (RNP) complex (Ludevid et al. 1992, Freire et al.
1995). Interestingly, in the presence of ABA the ABA-response regulator AAPK
phosphorylates the RNA-binding protein AKIP1 which thereupon partitions into
subnuclear foci and interacts with dehydrin mRNA (Li et al. 2002).
Both the mRNA cap-binding protein ABH1 (Hugovieux et al. 2001, 2002) as
well as SAD1 (Xiong et al. 2001a), likely to act as a SM-like snRNP protein in
mRNA maturation or turnover, revealed a negative regulatory role on ABA re-
sponses. The recessive sad1 and abh1 mutants are characterized by ABA hyper-
sensitivity of germination and stomatal closure to exogenous ABA. Interestingly,
the mutations affect expression of ABA-regulated genes in a targeted manner. The
molecular basis for the phenomenon is unclear but points to an ABA-regulated
posttranscriptional control of distinct RNA transcripts. Early posttranscriptional
regulation might also involve HYL1, a dsRNA binding protein (Lu and Fedoroff
2000), which may act as an integrator of auxin, cytokinin and ABA signalling at
the transcriptional or posttranscriptional level. At the posttranslational level, pro-
tein turnover establishes an additional regulatory mechanism that has gained inter-
est from the susceptibility to ABA5 to proteolytic degradation via the ubiquitin
pathway (Lopez-Molina et al. 2003, Smalle et al. 2003). The Arabidopsis SNF1-
like kinases AKIN10 and AKIN11 are complexed in the proteasome (Farras et al.
2001) but also interact with an importin-binding nuclear protein PRL1 that regu-
lates pleiotropic responses to sugars and hormones, including abscisic acid
(Nemeth et al. 1998). In addition, stability of ABA signal components or targets
might be regulated by the small ubiquitin-like modifier (SUMO; Lois et al. 2003).
These examples probably reflect only “the tip of an iceberg” (Fedoroff 2002b)
and illustrate that posttranscriptional regulatory mechanisms may address ABA
specific targets (dehydrin mRNA, ABI5) as well as knots or integrators of several
signal transduction pathways (HYL1, AKIN10/11).
2.6 Cross-talk
The different facets of ABA action such as regulation of ion status and metabo-
lism, as well as regulation of gene expression at the transcriptional and posttrans-
criptional level just mirror the complexity and cybernetic challenges of a sessile
plant to adjust to stress situations. External signals like cold, drought, or salt stress
trigger the generation of ABA as an internal signal in addition to the initiation of
an ABA-independent cascade required for stress-optimised adaptation (Shinozaki
and Yamaguchi-Shinozaki 1997, Fedoroff 2002a).
The necessity of interference between ABA signalling and other signalling
pathways is obvious just considering the growth-inhibitory action of ABA and
ethylene that antagonize the growth-promotive effect of auxin, cytokinin, and gib-
berellic acid. The cross-talk occurring between signalling of ABA and ethylene
(Ghassemian et al. 2000), auxin (Suzuki et al., 2001; Brady et al. 2003), gibberel-
lin (Gómez-Cadenas et al. 2001), pathogen interaction, and wounding (Pena-
Cortes et al. 1995, Audenaert et al. 2002; Neill et al. 2002a), or sugar sensing
(Finkelstein et al. 2002) emphasizes the tight interaction of regulatory circuits. In
light of this situation, we should be aware that our major tools for analysis of sig-
nalling, mutants and phenocopies generated by interfering gene expression, are
prone to pleiotropic alteration via cross-talk and feedback loops.
Acknowledgements
We thank the Deutsche Forschungsgemeinschaft and the “Fonds der

Chemischen Industrie” for financial support.
References

Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated

AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in ab-
scisic acid signaling. Plant Cell 15:63-78
Allan AC, Fricker MD, Ward JL, Beale MH, Trewavas AJ (1994) Two transduction path-
ways mediate rapid effects of abscisic acid in Commelina guard cells. Plant Cell
6:1319-1328
Allen GJ, Muir SR, Sanders D. (1995) Release of Ca2+ from individual plant vacuoles by
both InsP3 and cyclic ADP-ribose. Science 268:735-737
Allen GJ, Kuchitsu K, Chu SP, Murata Y, Schroeder JI (1999) Arabidopsis abi1-1 and
abi2-1 phosphatase mutations reduce abscisic acid-induced cytoplasmic calcium rises
in guard cells. Plant Cell 11:1785-1798
Allen GJ, Chu SP, Schumacher K, Shimazaki CT, Vafeados D, Kemper A, Hawke SD,
Tallman G, Tsien RY, Harper JF, Chory J, Schroeder JI (2000) Alteration of stimulus-
specific guard cell calcium oscillations and stomatal closing in Arabidopsis det3 mu-
tant. Science 289:2338-2342
Allen, GJ, Chu SP, Harrington CL, Schumacher K, Hoffmann T, Tang YY, Grill E Schroe-
der JI (2001): A defined range of guard cell calcium oscillation parameters encodes
stomatal movements. Nature 411:1053-1057
Allen GJ, Murata Y, Chu SP, Nafisi M, Schroeder JI. (2002) Hypersensitivity of abscisic
acid-induced cytosolic calcium increases in the Arabidopsis farnesyltransferase mutant
era1-2. Plant Cell 14:1649-1662
Anderberg RJ, Walker-Simmons MK (1992) Isolation of a wheat cDNA clone for an ab-
scisic acid-inducible transcript with homology to protein kinases. Proc Natl Acad Sci
USA 89:10183-10187
Anderson BE, Ward JM, Schroeder JI (1994) Evidence for an extracellular reception site
for abscisic acid in Commelina guard cells. Plant Physiol 104: 1177-1183
Arigoni D, Sagner S, Latzel C, Eisenreich W, Bacher A, Zenk MH (1997) Terpenoid bio-
synthesis from 1-deoxy-D-xylulose in higher plants by intramolecular skeletal rear-
rangement. Proc Natl Acad Sci USA 94:10600-10605
Audenaert K, De Meyer GB, Hofte MM (2002) Abscisic acid determines basal susceptibil-
ity of tomato to Botrytis cinerea and suppresses salicylic acid-dependent signaling
mechanisms. Plant Physiol 128:491-501
Audran C, Borel C, Frey A, Sotta B, Meyer C, Simonneau T, Marion-Poll A (1998) Ex-
pression studies of the zeaxanthin epoxidase gene in Nicotiana plumbaginifolia. Plant
Physiol 118:1021-1028
Baxter-Burrell A, Yang Z, Springer PS, Bailey-Serres J (2002) RopGAP4-dependent Rop
GTPase rheostat control of Arabidopsis oxygen deprivation tolerance. Science
296:2026-2028
Beligni MV, Lamattina L (2001) Nitric oxide: a non-traditional regulator of plant growth.
Bittner F, Oreb M, Mendel RR (2001) ABA3 is a molybdenum cofactor sulfurase required
for activation of aldehyde oxidase and xanthine dehydrogenase in Arabidopsis
thaliana. J Biol Chem 276:40381-40384
Blatt MR, Armstrong F (1993) Potassium channels of stomatal guard cells: abscisic acid-
evoked control of the outward rectifier mediated by cytoplasmic pH. Planta 191:330-
341
Bouvier F, D'Harlingue A, Backhaus RA, Kumagai MH, Camara B. (2000) Identification
of neoxanthin synthase as a carotenoid cyclase paralog. Eur J Biochem 267:6346-6352
Brady SM, Sarkar SF, Bonetta D, McCourt P (2003) The ABSCISIC ACID INSENSITIVE
3 (ABI3) gene is modulated by farnesylation and is involved in auxin signaling and
lateral root development in Arabidopsis. Plant J 34:67-75
Burnette RN, Gunesekera BM, Gillaspy GE (2003) An Arabidopsis inositol 5-phosphatase
gain-of-function alters abscisic acid signaling. Plant Physiol 132:1011-1019
Busk PK, Pages M (1998) Regulation of abscisic acid-induced transcription. Plant Mol Biol
37:425-435
Cheng WH, Endo A, Zhou L, Penney J, Chen HC, Arroyo A, Leon P, Nambara E, Asami
T, Seo M, Koshiba T, Sheen J (2002a) A unique short-chain dehydrogenase/reductase
in Arabidopsis glucose signaling and abscisic acid biosynthesis and functions. Plant
Cell 14:2723-2743
Cheng SH, Willmann MR, Chen HC, Sheen J (2002b) Calcium signaling through protein
kinases. The Arabidopsis calcium-dependent protein kinase gene family. Plant Physiol
129:469-485
Cheong YH, Chang HS, Gupta R, Wang X, Zhu T, Luan S (2002) Transcriptional profiling
reveals novel interactions between wounding, pathogen, abiotic stress, and hormonal
responses in Arabidopsis. Plant Physiol 129:661-677
Cherel I, Michard E, Platet N, Mouline K, Alcon C, Sentenac H, Thibaud JB (2002) Physi-
cal and functional interaction of the Arabidopsis K+ channel AKT2 and phosphatase
AtPP2CA. Plant Cell 14:1133-1146
Choi H, Hong J, Ha J, Kang J, Kim SY (2000) ABFs, a family of ABA-responsive element
binding factors. J Biol Chem 275:1723-1730
Coursol S, Fan L-M, Le Stunff H, Spiegel S, Gilroy S, Assmann SM (2003) Sphingolipid
signaling in Arabidopsis guard cells involves heterotrimeric G proteins. Nature
423:651-654
Cowan AK (2000) Is abscisic aldehyde really the immediate precursor to stress-induced
ABA? Trends Plant Sci 5:191-192
Cunningham FX Jr, Gantt E (1998) Genes and enzymes of carotenoid biosynthesis in
plants. Annu Rev Plant Physiol Plant Mol Biol 49:557-583
Desikan R, Griffiths R, Hancock J, Neill S (2002) A new role for an old enzyme: Nitrate
reductase-mediated nitric oxide generation is required for abscisic acid-induced
stomatal closure in Arabidopsis thaliana. Proc Natl Acad Sci USA 99:16314-16318
Dinkins R, Pflipsen C, Thompson A, Collins GB (2002) Ectopic expression of an Arabi-
dopsis single zinc finger gene in tobacco results in dwarf plants. Plant Cell Physiol
43:743-750
Duckham SC, Linforth RST, Taylor IB (1991) Abscisic acid-deficient mutants at the aba
gene locus of Arabidopsis thaliana are impaired in the epoxidation of zeaxanthin.
Plant Cell Environment 14:601-606
Durner J, Wendehenne D, Klessig DF (1998) Defense gene induction in tobacco by nitric
oxide, cyclic GMP, and cyclic ADP-ribose. Proc Natl Acad Sci USA 95:10328-10333
Eun SO, Lee Y (1997) Actin filaments of guard cells are reorganized in response to light
and abscisic acid. Plant Physiol 115:1491-1498
Evans NH, McAinsh MR, Hetherington AM (2001) Calcium oscillations in higher plants.
Curr Opin Plant Biol 4:415-420
Fan L, Zheng S, Wang X (1997) Antisense suppression of phospholipase D alpha retards
abscisic acid- and ethylene-promoted senescence of postharvest Arabidopsis leaves.
Farras R, Ferrando A, Jasik J, Kleinow T, Okresz L, Tiburcio A, Salchert K, del Pozo C,

Schell J, Koncz C (2001) SKP1-SnRK protein kinase interactions mediate proteasomal
binding of a plant SCF ubiquitin ligase. EMBO J 20:2742-2756
Fedoroff NV (2002a) Cross-talk in abscisic acid signaling. Sci STKE 2002/140/re10
Fedoroff NV (2002b) RNA-binding proteins in plants: the tip of an iceberg? Curr Opin
Plant Biol 5:452-459
Finkelstein RR (1994) Mutations at two new Arabidopsis ABA response loci are similar to
the abi3 mutations. Plant J 5:765-771
Finkelstein RR, Lynch TJ (2000) The Arabidopsis abscisic acid response gene ABI5 en-
codes a basic leucine zipper transcription factor. Plant Cell 12:599-609
Finkelstein RR, Wang ML, Lynch TJ, Rao S, Goodman HM (1998) The Arabidopsis ab-
scisic acid response locus ABI4 encodes an APETALA 2 domain protein. Plant Cell
10:1043-1054
Finkelstein RR, Gampala SS, Rock CD (2002) Abscisic acid signaling in seeds and seed-
lings. Plant Cell 14 Suppl:S15-S45
Frey A, Audran C, Marin E, Sotta B, Marion-Poll A (1999) Engineering seed dormancy by
the modification of zeaxanthin epoxidase gene expression. Plant Mol Biol 39:1267-
1274
Freire MA, Pages M (1995) Functional characteristics of the maize RNA-binding protein
MA16. Plant Mol Biol 29:797-807
Garbers C, DeLong A, Deruere J, Bernasconi P, Soll D (1996) A mutation in protein phos-
phatase 2A regulatory subunit A affects auxin transport in Arabidopsis. EMBO J
15:2115-2124
Garcia-Mata C, Lamattina L (2002) Nitric oxide and abscisic acid cross talk in guard cells.
Plant Physiol. 128:790-792
Garcia-Mata C, Lamattina L (2003) Abscisic acid, nitric oxide and stomatal closure - is ni-
trate reductase one of the missing links? Trends Plant Sci 8:20-26
Geelen D, Leyman B, Batoko H, Di Sansebastiano GP, Moore I, Blatt MR, Di Sansabas-
tiano GP (2002) The abscisic acid-related SNARE homolog NtSyr1 contributes to se-
cretion and growth: evidence from competition with its cytosolic domain. Plant Cell
14:387-406
Ghassemian M, Nambara E, Cutler S, Kawaide H, Kamiya Y, McCourt P (2000) Regula-
tion of abscisic acid signaling by the ethylene response pathway in Arabidopsis. Plant
Cell 12:1117-1126
Gomez-Cadenas A, Zentella R, Walker-Simmons MK, Ho TH (2001) Gibberellin/abscisic
acid antagonism in barley aleurone cells: site of action of the protein kinase PKABA1
in relation to gibberellin signaling molecules. Plant Cell 13:667-679
Gonzalez-Guzman M, Apostolova N, Belles JM, Barrero JM, Piqueras P, Ponce MR, Micol
JL, Serrano R, Rodriguez PL (2002) The short-chain alcohol dehydrogenase ABA2
catalyzes the conversion of xanthoxin to abscisic aldehyde. Plant Cell 14:1833-1846
Gosti F, Beaudoin N, Serizet C, Webb AA, Vartanian N, Giraudat J (1999) ABI1 protein
phosphatase 2C is a negative regulator of abscisic acid signaling. Plant Cell 11:1897-
1910
Grabov A, Blatt MR (1998) Membrane voltage initiates Ca2+ waves and potentiates Ca2+
increases with abscisic acid in stomatal guard cells. Proc Natl Acad Sci USA 95:4778-
4783
Grill E, Ziegler H (1998) A plant's dilemma. Science 282: 252-253
Guan LM, Zhao J, Scandalios JG (2000) Cis-elements and trans-factors that regulate ex-
pression of the maize Cat1 antioxidant gene in response to ABA and osmotic stress:
H2O2 is the likely intermediary signaling molecule for the response. Plant J 22:87-95
Guo Y, Xiong L, Song CP, Gong D, Halfter U, Zhu JK (2002) A calcium sensor and its in-
teracting protein kinase are global regulators of abscisic acid signaling in Arabidopsis.
Dev Cell 3:233-244.
Hallouin M, Ghelis T, Brault M, Bardat F, Cornel D, Miginiac E, Rona JP, Sotta B,
Jeannette E (2002) Plasmalemma abscisic acid perception leads to RAB18 expression
via phospholipase D activation in Arabidopsis suspension cells. Plant Physiol 130:265-
272
Hamilton DW, Hills A, Kohler B, Blatt MR (2000) Ca2+ channels at the plasma membrane
of stomatal guard cells are activated by hyperpolarization and abscisic acid. Proc Natl
Hardie DG, Carling D, Carlson M (1998) The AMP-activated/SNF1 protein kinase subfam-
ily: metabolic sensors of the eukaryotic cell? Annu Rev Biochem 67:821-855
Hattori T, Totsuka M, Hobo T, Kagaya Y, Yamamoto-Toyoda A (2002) Experimentally de-
termined sequence requirement of ACGT-containing abscisic acid response element.
Plant Cell Physiol 43:136-140
Heim MA, Jakoby M, Werber M, Martin C, Weisshaar B, Bailey PC (2003) The basic he-
lix-loop-helix transcription factor family in plants: a genome-wide study of protein
structure and functional diversity. Mol Biol Evol 20:735-747
Hetherington AM (2001) Guard cell signaling. Cell 107:711-714
Himmelbach A, Iten M, Grill E (1998) Signaling of abscisic acid to regulate plant growth.
Philos Trans R Soc Lond B Biol Sci 353:1439-1444
Himmelbach A, Hoffmann T, Leube M, Höhener B, Grill E (2002) Homeodomain protein
in Arabidopsis. EMBO J 21:3029-3038
Hirai N, Yoshida R, Todoroki Y, Ohigashi H (2000) Biosynthesis of abscisic acid by the
non-mevalonate pathway in plants, and by the mevalonate pathway in fungi. Biosci
Biotechnol Biochem 64:1448-1458
Hobo T, Kowyama Y, Hattori T (1999) A bZIP factor, TRAB1, interacts with VP1 and me-
diates abscisic acid-induced transcription. Proc Natl Acad Sci USA 96:15348-15353
Hornberg C, Weiler E (1984) High-affinity binding sites for abscisic acid on plasmalemma
of Vicia faba guard cells. Nature 310:321-324
Hoth S, Morgante M, Sanchez JP, Hanafey MK, Tingey SV, Chua NH (2002) Genome-
wide gene expression profiling in Arabidopsis thaliana reveals new targets of abscisic
acid and largely impaired gene regulation in the abi1-1 mutant. J Cell Sci 115:4891-
4900
Hsu TC, Liu HC, Wang JS, Chen RW, Wang YC, Lin BL (2001) Early genes responsive to
abscisic acid during heterophyllous induction in Marsilea quadrifolia. Plant Mol Biol
47:703-715
Huang JF, Teyton L, Harper JF (1996) Activation of a Ca(2+)-dependent protein kinase in-
volves intramolecular binding of a calmodulin-like regulatory domain. Biochem
35:13222-13230
Hugouvieux V, Kwak JM, Schroeder JI (2001). An mRNA cap binding protein, ABH1,
modulates early abscisic acid signal transduction in Arabidopsis. Cell 106: 477-487
Hugouvieux V, Murata Y, Young JJ, Kwak JM, Mackesy DZ, Schroeder JI (2002) Local-
ization, ion channel regulation, and genetic interactions during abscisic acid signaling
of the nuclear mRNA cap-binding protein, ABH1. Plant Physiol 130:1276-1287
Hunt L, Mills LN, Pical C, Leckie CP, Aitken FL, Kopka J, Mueller-Roeber B, McAinsh
MR, Hetherington AM, Gray JE (2003) Phospholipase C is required for the control of
stomatal aperture by ABA. Plant J 34:47-55
Hwang I, Sze H, Harper JF (2000) A calcium-dependent protein kinase can inhibit a
calmodulin-stimulated Ca2+ pump (ACA2) located in the endoplasmic reticulum of
Arabidopsis. Proc Natl Acad Sci USA 97:6224-6229
Hwang JU, Lee Y (2001) Abscisic acid-induced actin reorganization in guard cells of day-
flower is mediated by cytosolic calcium levels and by protein kinase and protein phos-
phatase activities. Plant Physiol 125:2120-2128
Irving HR, Gehring CA, Parish RW (1992) Changes in cytosolic pH and calcium of guard
cells precede stomatal movements. Proc Natl Acad Sci USA 89:1790-1794
Ishitani M, Liu J, Halfter U, Kim CS, Shi W, Zhu JK (2000) SOS3 function in plant salt
tolerance requires N-myristoylation and calcium binding. Plant Cell 12:1667-1678
Iuchi S, Kobayashi M, Yamaguchi-Shinozaki K, Shinozaki K (2000) A stress-inducible
gene for 9-cis-epoxycarotenoid dioxygenase involved in abscisic acid biosynthesis un-
der water stress in drought-tolerant cowpea. Plant Physiol 123:553-562
Iuchi S, Kobayashi M, Taji T, Naramoto M, Seki M, Kato T, Tabata S, Kakubari Y, Yama-
guchi-Shinozaki K, Shinozaki K (2001) Regulation of drought tolerance by gene ma-
nipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid bio-
synthesis in Arabidopsis. Plant J 27:325-333
Jacob T, Ritchie S, Assmann SM, Gilroy S (1999) Abscisic acid signal transduction in
guard cells is mediated by phospholipase D activity. Proc Natl Acad Sci USA
96:12192-12197
Jakoby M, Weisshaar B, Droge-Laser W, Vicente-Carbajosa J, Tiedemann J, Kroj T, Parcy
F; bZIP Research Group. (2002) bZIP transcription factors in Arabidopsis. Trends
Plant Sci 7:106-111
Jeannette E, Rona JP, Bardat F, Cornel D, Sotta B, Miginiac E (1999) Induction of RAB18
gene expression and activation of K+ outward rectifying channels depend on an ex-
tracellular perception of ABA in Arabidopsis thaliana suspension cells. Plant J 18:13-
22
Johannesson H, Wang Y, Engstrom P (2001) DNA-binding and dimerization preferences of
Arabidopsis homeodomain-leucine zipper transcription factors in vitro. Plant Mol Biol
45:63-67
Johnson RR, Wagner RL, Verhey SD, Walker-Simmons MK (2002) The abscisic acid-
responsive kinase PKABA1 interacts with a seed-specific abscisic acid response ele-
ment-binding factor, TaABF, and phosphorylates TaABF peptide sequences. Plant
Physiol 130:837-846
Jonak C, Okresz L, Bogre L, Hirt H (2002) Complexity, cross talk and integration of plant
MAP kinase signalling. Curr Opin Plant Biol 5:415-424
Jung JY, Kim YW, Kwak JM, Hwang JU, Young J, Schroeder JI, Hwang I, Lee Y (2002)
Phosphatidylinositol 3- and 4-phosphate are required for normal stomatal movements.
Plant Cell 14:2399-2412
Kagaya Y, Hobo T, Murata M, Ban A, Hattori T (2002) Abscisic acid-induced transcription

is mediated by phosphorylation of an abscisic acid response element binding factor,
TRAB1. Plant Cell 14:3177-3189
Kim JC, Lee SH, Cheong YH, Yoo CM, Lee SI, Chun HJ, Yun DJ, Hong JC, Lee SY, Lim
CO, Cho MJ (2001) A novel cold-inducible zinc finger protein from soybean, SCOF-1,
enhances cold tolerance in transgenic plants. Plant J 25:247-259
Kim KN, Cheong YH, Grant JJ, Pandey GK, Luan S (2003) CIPK3, a calcium sensor-
associated protein kinase that regulates abscisic acid and cold signal transduction in
Arabidopsis. Plant Cell 15:411-423
Kinoshita T, Nishimura M, Shimazaki K-I (1995) Cytosolic concentration of Ca2+ regulates
the plasma membrane H+-ATPase in guard cells of fava bean. Plant Cell 7:1333-1342
Kizis D, Pagès M (2002) Maize DRE-binding proteins DBF1 and DBF2 are involved in
rab17 regulation through the drought-responsive element in an ABA-dependent path-
way. Plant J 30:679-689
Kizis D, Lumbreras V, Pagès M (2001) Role of AP2/EREBP transcription factors in gene
regulation during abiotic stress. FEBS Lett. 498:187-189
Klüsener B, Young JJ, Murata Y, Allen GJ, Mori IC, Hugouvieux V, Schroeder JI (2002)
Convergence of calcium signaling pathways of pathogenic elicitors and abscisic acid in
Arabidopsis guard cells. Plant Physiol 130:2152-2163
Knetsch M, Wang M, Snaar-Jagalska BE, Heimovaara-Dijkstra S (1996) Abscisic acid in-
duces mitogen-activated protein kinase activation in barley aleurone protoplasts. Plant
Cell 8:1061-1067
Koornneef M, Reuling G, Karssen CM (1984) The isolation and characterization of abscisic
acid-insensitive mutants of Arabidopsis thaliana. Physiol Plant 61:377-383
Kovtun Y, Chiu WL, Tena G, Sheen J (2000) Functional analysis of oxidative stress-
activated mitogen-activated protein kinase cascade in plants. Proc Natl Acad Sci USA
97:2940-2945
Kruse T, Tallman G, Zeiger E (1989) Isolation of guard cell protoplasts from mechanically
prepared epidermis of Vicia faba leaves. Plant Physiology 90:1382-1386
Kushiro T, Nambara E, McCourt P (2003) Hormone evolution: The key to signalling. Na-
ture 422:122
Kwak JM, Moon JH, Murata Y, Kuchitsu K, Leonhardt N, DeLong A, Schroeder JI (2002)
Disruption of a guard cell-expressed protein phosphatase 2A regulatory subunit,
RCN1, confers abscisic acid insensitivity in Arabidopsis. Plant Cell 14:2849-2861
Kwak JM, Mori IC, Pei ZM, Leonhardt N, Torres MA, Dangl JL, Bloom RE, Bodde S,
Jones JD, Schroeder JI (2003) NADPH oxidase AtrbohD and AtrbohF genes function
in ROS-dependent ABA signaling in Arabidopsis. EMBO 22:2623-2633.
Lång V, Mäntylä E, Welin B, Sundberg B, Palva ET (1994) Alterations in water status, en-
dogenous abscisic acid content, and expression of rab18 gene during the development
of freezing tolerance in Arabidopsis thaliana. Plant Physiol 104:1341-1349
Leckie CP, McAinsh MR, Allen GJ, Sanders D, Hetherington AM (1998) Abscisic acid in-
duced stomatal closure mediated by cyclic ADP-ribose. Proc Natl Acad Sci USA
95:15837-15842
Lee Y, Choi YB, Suh S, Lee J, Assmann SM, Joe CO, Kelleher JF, Crain RC (1996) Ab-
scisic acid-induced phosphoinositide turnover in guard cell protoplasts of Vicia faba.
Lee Y, Oh H, Cheon C, Hwang I, Kim Y Chun J (2001) Structure and expression of the
Arabidopsis thaliana homeobox gene Athb-12. Biochem Biophys Res Commun
284:133–141
Lemichez E, Wu Y, Sanchez JP, Mettouchi A, Mathur J, Chua NH (2001) Inactivation of
AtRac1 by abscisic acid is essential for stomatal closure. Genes Dev 15:1808-1816
Lemtiri-Chlieh F, MacRobbie EA, Brearley CA (2000) Inositol hexakisphosphate is a
physiological signal regulating the K+-inward rectifying conductance in guard cells.
Leube MP, Grill E, Amrhein N (1998): ABI1 of Arabidopsis is a protein serine/threonine
phosphatase highly regulated by the proton and magnesium ion concentration. FEBS
Lett 424:100-104
Leung J, Merlot S, Giraudat J (1997) The Arabidopsis abscisic acid-insensitive2 (ABI2)
and ABI1 genes encode homologues protein phosphatases 2C involved in abscisic acid
signal transduction. Plant Cell 9:759-771
Leyman B, Geelen D, Quintero FJ, Blatt MR (1999) A tobacco syntaxin with a role in hor-
monal control of guard cell ion channels. Science 283:537-540
Li J, Assmann SM (1996) An abscisic acid-activated and calcium-independent protein
kinase from guard cells of fava bean. Plant Cell 8:2359-2368
Li J, Lee YR, Assmann SM (1998) Guard cells possess a calcium-dependent protein kinase
that phosphorylates the KAT1 potassium channel. Plant Physiol 116:785-795
Li J, Wang XQ, Watson MB, Assmann SM (2000) Regulation of abscisic acid-induced
stomatal closure and anion channels by guard cell AAPK kinase. Science 287:300-303
Li J, Kinoshita T, Pandey S, Ng CK, Gygi SP, Shimazaki K, Assmann SM (2002) Modula-
tion of an RNA-binding protein by abscisic-acid-activated protein kinase. Nature
418:793-797
Lichtenthaler HK (1999) The 1-deoxy-D-xylulose-5-phosphate pathway of isoprenoid bio-
synthesis in plants. Annu Rev Plant Physiol Plant Mol Biol 50:47-65
Lichtenthaler HK, Schwender J, Disch A, Rohmer M (1997) Biosynthesis of isoprenoids in
higher plant chloroplasts proceeds via a mevalonate-independent pathway. FEBS Lett
400:271-274
Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki
K.(1998) Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA
low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell.
10:1391-1406
Lois LM, Lima CD, Chua NH (2003) Small ubiquitin-like modifier modulates abscisic acid
signaling in Arabidopsis. Plant Cell 15:1347-1359
Lopez-Molina L, Mongrand S, Chua NH (2001) A postgermination developmental arrest
checkpoint is mediated by abscisic acid and requires the ABI5 transcription factor in
Lopez-Molina L, Mongrand S, Kinoshita N, Chua NH (2003) AFP is a novel negative regu-
lator of ABA signaling that promotes ABI5 protein degradation.
Genes Dev 17:410-418
Lu C, Fedoroff N (2000) A mutation in the Arabidopsis HYL1 gene encoding a dsRNA
binding protein affects responses to abscisic acid, auxin, and cytokinin. Plant Cell
12:2351-2366
Lu C, Han MH, Guevara-Garcia A, Fedoroff NV (2002) Mitogen-activated protein kinase

signaling in postgermination arrest of development by abscisic acid. Proc Natl Acad
Sci USA 99:15812-15817
Luan, S (2002): Signaling drought in guard cells. Plant Cell Environ 25:229-237
Ludevid MD, Freire MA, Gomez J, Burd CG, Albericio F, Giralt E, Dreyfuss G, Pages M
(1992) RNA binding characteristics of a 16 kDa glycine-rich protein from maize. Plant
J 2:999-1003
Marin E, Nussaume L, Quesada A, Gonneau M, Sotta B, Hugueney P, Frey A, Marion-Poll
A (1996) Molecular identification of zeaxanthin epoxidase of Nicotiana plumbaginifo-
lia, a gene involved in abscisic acid biosynthesis and corresponding to the ABA locus
of Arabidopsis thaliana. EMBO J 15:2331-2342
Martin C, Paz-Ares J (1997) MYB transcription factors in plants. Trends Genet 13:67-73
McAinsh MR, Brownlee C, Hetherington AM (1990) Abscisic acid-induced elevation of
guard cell cytosolic Ca2+ precedes stomatal closure. Nature 343:186-188
Meinhard M, Grill E (2001): Hydrogen peroxide is a regulator of ABI1, a protein phos-
phatase 2C from Arabidopsis. FEBS Lett 508:443-446
Meinhard M, Rodriguez PL, Grill E (2002) The sensitivity of ABI2 to hydrogen peroxide
links the abscisic acid-response regulator to redox signaling. Planta 214:775-782
Merlot S, Gosti F, Guerrier D, Vavasseur A, Giraudat J (2001) The ABI1 and ABI2 protein
phosphatases 2C act in a negative feedback regulatory loop of the abscisic acid signal-
ing pathway. Plant J. 25:295-303
Milborrow BV (2001) The pathway of biosynthesis of abscisic acid in vascular plants: a re-
view of the present state of knowledge of ABA biosynthesis. J Exp Bot 52:1145-1164
Morriss-Kay GM, Ward SJ (1999) Retinoids and mammalian development. Int Rev Cytol.
188:73-131
Murata Y, Pei ZM, Mori IC, Schroeder J (2001): Abscisic acid activation of plasma mem-
brane Ca(2+) channels in guard cells requires cytosolic NAD(P)H and is differentially
and abi2-1 protein phosphatase 2C mutants. Plant Cell 13: 2513-2523
Mustilli AC, Merlot S, Vavasseur A, Fenzi F, Giraudat J (2002): Arabidopsis OST1 protein
Nakamura S, Lynch TJ, Finkelstein RR (2001) Physical interactions between ABA re-
sponse loci of Arabidopsis. Plant J 26:627-635
Nambara E, Suzuki M, Abrams S, McCarty DR, Kamiya Y, McCourt P (2002) A screen for
genes that function in abscisic acid signaling in Arabidopsis thaliana. Genetics 161:
1247-1255
Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, Narusaka M, Shi-
nozaki K, Yamaguchi-Shinozaki K (2003) Interaction between two cis-acting ele-
ments, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in
response to dehydration and high-salinity stresses. Plant J 34:137-148
Neill SJ, Desikan R, Clarke A, Hancock JT (2002a) Nitric oxide is a novel component of
abscisic acid signaling in stomatal guard cells. Plant Physiol 128:13-16
Neill SJ, Desikan R, Clarke A, Hurst RD, Hancock JT (2002b) Hydrogen peroxide and ni-
tric oxide as signaling molecules in plants. J Exp Bot 53:1237-1247
Nemeth K, Salchert K, Putnoky P, Bhalerao R, Koncz-Kalman Z, Stankovic-Stangeland B,
Bako L, Mathur J, Okresz L, Stabel S, Geigenberger P, Stitt M, Redei GP, Schell J,
Koncz C (1998) Pleiotropic control of glucose and hormone responses by PRL1, a nu-
clear WD protein, in Arabidopsis. Genes Dev 12:3059-3073
Ng CK, Carr K, McAinsh MR, Powell B, Hetherington AM (2001) Drought-induced guard
cell signal transduction involves sphingosine-1-phosphate. Nature 410:596-599
Niu X, Helentjaris T, Bate NJ (2002) Maize ABI4 binds coupling element 1 in abscisic acid
and sugar response genes. Plant Cell 11:2565-2575
Pappan K, Wang X (1999) Molecular and biochemical properties and physiological roles of
plant phospholipase D. Biochim Biophys Acta 1439:151-166
Park JM, Park CJ, Lee SB, Ham BK, Shin R, Paek KH (2001) Overexpression of the to-
bacco Tsi1 gene encoding an EREBP/AP2-type transcription factor enhances resis-
tance against pathogen attack and osmotic stress in tobacco. Plant Cell. 13:1035-1046
Parry AD, Babiano MJ, Horgan R (1990) The role of cis-carotenoids in abscisc acid bio-
synthesis. Planta 182:118-128
Pedron J, Brault M, Nake C, Miginiac E (1998) Detection of abscisic acid-binding proteins
in the microsomal protein fraction of Arabidopsis thaliana with abscisic acid-protein
conjugates used as affinity probes. Eur J Biochem 252:385-391
Pei ZM, Ghassemian M, Kwak CM, McCourt P, Schroeder JI (1998) Role of farnesyltrans-
ferase in ABA regulation of guard cell anion channels and plant water loss. Science
282: 287-290
Pei ZM, Murata Y, Benning G, Thomine S, Klüsener B, Allen GJ, Grill E, Schroeder JI
ing in guard cells. Nature 406:731-734
Pena-Cortes H, Fisahn J, Willmitzer L (1995) Signals involved in wound-induced pro-
teinase inhibitor II gene expression in tomato and potato plants. Proc Natl Acad Sci
USA. 92:4106-4113
Qin X, Zeevaart JA (1999) The 9-cis-epoxycarotenoid cleavage reaction is the key regula-
tory step of abscisic acid biosynthesis in water-stressed bean. Proc Natl Acad Sci USA
96:15354-15361
Qin X, Zeevaart JA (2002) Overexpression of a 9-cis-epoxycarotenoid dioxygenase gene in
Nicotiana plumbaginifolia increases abscisic acid and phaseic acid levels and enhances
drought tolerance. Plant Physiol 128:544-551
Rashotte AM, DeLong A, Muday GK (2001) Genetic and chemical reductions in protein
phosphatase activity alter auxin transport, gravity response, and lateral root growth.
Plant Cell. 13:1683-1697
Raskin I and Ladyman JAR (1988) Isolation and characterization of a barley mutant with
abscisic acid-insensitive stomata. Planta 173:73-78
Ritchie S, Gilroy S (2000) Abscisic acid stimulation of phospholipase D in the barley aleu-
rone is G-protein-mediated and localized to the plasma membrane. Plant Physiol
124:693-702
Ritchie SM, Swanson SJ, Gilroy S (2002) From common signalling components to cell
specific responses: insights from the cereal aleurone. Physiol Plant 115: 342-351
Roberts SK, Snowman BN (2000) The effects of ABA on channel-mediated K+ transport
across higher plant roots. J Exp Bot 51:1585-1594
Rock CD (2000) Pathways to ABA-regulated gene expression. New Phytol 148:357-396
Rodriguez PL, Benning G, Grill E. (1998a) ABI2, a second protein phosphatase 2C in-
volved in abscisic acid signal transduction in Arabidopsis. FEBS Lett. 421:185-190
Rodriguez PL, Leube MP, Grill E (1998b) Molecular cloning in Arabidopsis thaliana of a
new protein phosphatase 2C (PP2C) with homology to ABI1 and ABI2. Plant Mol Biol
38:879-883.
Romeis T, Piedras P, Jones JD (2000) Resistance gene-dependent activation of a calcium-
dependent protein kinase in the plant defense response. Plant Cell 12:803-816
Sanchez JP, Chua NH (2001) Arabidopsis PLC1 is required for secondary responses to ab-
scisic acid signals. Plant Cell 13:1143-1154
Sang Y, Zheng S, Li W, Huang B, Wang X (2001) Regulation of plant water loss by ma-
nipulating the expression of phospholipase Dα. Plant J 28:135-144
Schultz TF, Medina J, Hill A, Quatrano RS (1998) 14-3-3 proteins are part of an abscisic
acid-VIVIPAROUS1 (VP1) response complex in the Em promoter and interact with
VP1 and EmBP1. Plant Cell 10:837-847
Schwartz A, Wu WH, Tucker EB, Assmann SM (1994) Inhibition of inward K+ channels
and stomatal response by abscisic acid: an intracellular locus of phytohormone action.
Proc Natl Acad Sci USA. 91:4019-4023
Schwartz SH, Tan BC, Gage DA, Zeevaart JA, McCarty DR (1997) Specific oxidative
cleavage of carotenoids by VP14 of maize. Science 276:1872-1874
Seki M, Ishida J, Narusaka M, Fujita M, Nanjo T, Umezawa T, Kamiya A, Nakajima M,
Enju A, Sakurai T, Satou M, Akiyama K, Yamaguchi-Shinozaki K, Carninci P, Kawai
J, Hayashizaki Y, Shinozaki K (2002) Monitoring the expression pattern of around
7,000 Arabidopsis genes under ABA treatments using a full-length cDNA microarray.
Funct Integr Genomics 2:282-291
Seo M, Koiwai H, Akaba S, Komano T, Oritani T, Kamiya Y, Koshiba T (2000a) Abscisic
aldehyde oxidase in leaves of Arabidopsis thaliana. Plant J 23:481-488
Seo M, Peeters AJ, Koiwai H, Oritani T, Marion-Poll A, Zeevaart JA, Koornneef M,
Kamiya Y, Koshiba T (2000b) The Arabidopsis aldehyde oxidase 3 (AAO3) gene
product catalyzes the final step in abscisic acid biosynthesis in leaves. Proc Natl Acad
Sci USA 97:12908-12913
Sharp RE (2002) Interaction with ethylene: changing views on the role of abscisic acid in
root and shoot growth responses to water stress. Plant Cell Environ 25:211-222
Sheen J (1996) Ca2+-dependent protein kinases and stress signal transduction in higher
plants. Science 274:1900-1902
Sheen J (1998) Mutational analysis of protein phosphatase 2C involved in abscisic acid
signal transduction in higher plants. Proc Natl Acad Sci USA 95: 975-980
Sheen J (2001) Signal transduction in maize and Arabidopsis mesophyll protoplasts. Plant
Physiol 127:1466-1475
Shen Q, Gomez-Cadenas A, Zhang P, Walker-Simmons MK, Sheen J, Ho TH (2001) Dis-
section of abscisic acid signal transduction pathways in barley aleurone layers. Plant
Mol Biol. 47:437-448
Shinozaki K, Yamaguchi-Shinozaki K (1997) Gene expression and signal transduction in
water-stress response.Plant Physiol 115:327-334
Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and low
temperature: differences and cross-talk between two stress signaling pathways. Curr
Opin Plant Biol 3:217-223
Siefermann-Harms D (1977) The xanthophyll cycle in higher plants. In Tevini M, Lichten-
thaler HK, eds, Lipid and lipid polymers in higher plants. Springer, Berlin, pp 218-230
Slovik S, Daeter W, Hartung W (1995): Compartmental redistribution and long-distance

transport of abscisic acid (ABA) in plants as influenced by environmental changes in
the rhizosphere - a biomathematical model. J. Exp. Bot. 46:881-894
Smalle J, Kurepa J, Yang P, Emborg TJ, Babiychuk E, Kushnir S, Vierstra RD (2003) The
pleiotropic role of the 26S proteasome subunit RPN10 in Arabidopsis growth and de-
velopment supports a substrate-specific function in abscisic acid signaling. Plant Cell
15:965-980
Söderman E, Mattsson J, Engstrom P (1996) The Arabidopsis homeobox gene ATHB-7 is
induced by water deficit and by abscisic acid. Plant J 10:375-381
Söderman E, Hjellström M, Fahleson J, Engström P (1999) The HD-Zip gene ATHB6 in
Arabidopsis is expressed in developing leaves, roots and carpels and up-regulated by
water deficit conditions. Plant Mol Biol 40:1073–1083
Söderman EM, Brocard IM, Lynch TJ, Finkelstein RR (2000) Regulation and function of
the Arabidopsis ABA-insensitive4 gene in seed and abscisic acid response signaling
networks. Plant Physiol 124:1752-1765
Staxen II, Pical C, Montgomery LT, Gray JE, Hetherington AM, McAinsh MR (1999) Ab-
scisic acid induces oscillations in guard-cell cytosolic free calcium that involve phos-
phoinositide-specific phospholipase C. Proc Natl Acad Sci USA 96:1779-1784
Sutton F, Paul SS, Wang XQ, Assmann SM (2000) Distinct abscisic acid signaling path-
ways for modulation of guard cell versus mesophyll cell potassium channels revealed
by expression studies in Xenopus laevis oocytes. Plant Physiol 124:223-230
Suzuki M, Kao CY, McCarty DR (1997) The conserved B3 domain of VIVIPAROUS1 has
a cooperative DNA binding activity. Plant Cell 9:799-807
Suzuki M, Kao CY, Cocciolone S, McCarty DR (2001) Maize VP1 complements Arabi-
dopsis abi3 and confers a novel ABA/auxin interaction in roots. Plant J 28:409-418
Tahtiharju S, Palva T (2001) Antisense inhibition of protein phosphatase 2C accelerates
cold acclimation in Arabidopsis thaliana. Plant J 26:461-470
Tan BC, Cline K, McCarty DR (2001) Localization and targeting of the VP14 epoxycarote-
noid dioxygenase to chloroplast membranes. Plant J 27:373-382
Tan BC, Joseph LM, Deng WT, Liu L, Li QB, Cline K, McCarty DR (2003) Molecular
characterization of the Arabidopsis 9-cis epoxycarotenoid dioxygenase gene family.
Plant J 35:44-56
Taylor IB, Burbidge A, Thompson AJ (2000) Control of abscisic acid synthesis. J Exp Bot
51:1563-1574
Thompson AJ, Jackson AC, Parker RA, Morpeth DR, Burbidge A, Taylor IB (2000a) Ab-
scisic acid biosynthesis in tomato: regulation of zeaxanthin epoxidase and 9-cis-
epoxycarotenoid dioxygenase mRNAs by light/dark cycles, water stress and abscisic
acid. Plant Mol Biol 42:833-845
Thompson AJ, Jackson AC, Symonds RC, Mulholland BJ, Dadswell AR, Blake PS, Bur-
bidge A, Taylor IB (2000b) Ectopic expression of a tomato 9-cis-epoxycarotenoid di-
oxygenase gene causes over-production of abscisic acid. Plant J 23:363-374
Walker-Simmons MK, Holappa LD, Abrams GD and Abrams SR (1997) ABA metabolites
induce group 3 LEA mRNA and inhibit germination in wheat. Physiol Plant 7:125-134
Wang XQ, WuW-H, Assmann SM (1998) Differential responses of abaxial and adaxial
guard cells of broad bean to abscisic acid and calcium. Plant Physiol 118:1421-1429
Wang XQ, Ullah H, Jones AM, Assmann SM (2001) G protein regulation of ion channels
and abscisic acid signaling in Arabidopsis guard cells. 292:2070-2072
Webb AA, Larman MG, Montgomery LT, Taylor JE, Hetherington AM (2001) The role of
calcium in ABA-induced gene expression and stomatal movements. Plant J 26:351-
362
Wilkinson S, Davies WJ (1997) Xylem sap pH increase: a drought signal received at the
apoplastic face of the guard cell that involves the suppression of saturable abscisic acid
uptake by the epidermal symplast. Plant Physiol 113:559-573
Wu Y, Kuzma J, Marechal E, Graeff R, Lee HC, Foster R, Chua NH (1997) Abscisic acid
signaling through cyclic ADP-ribose in plants. Science 278:2126-2130
Wu Y, Sanchez JP, Lopez-Molina L, Himmelbach A, Grill E, Chua NH (2003) The abi1-1
mutation blocks ABA signaling downstream of cADPR action. Plant J. 34:307-315
Xiong L, Gong Z, Rock CD, Subramanian S, Guo Y, Xu W, Galbraith D, Zhu JK (2001a)
Modulation of abscisic acid signal transduction and biosynthesis by an Sm-like protein
in Arabidopsis. Dev Cell 1:771-781
Xiong L, Ishitani M, Lee H, Zhu JK (2001b) The Arabidopsis LOS5/ABA3 locus encodes a
molybdenum cofactor sulfurase and modulates cold stress- and osmotic stress-
responsive gene expression. Plant Cell 13:2063-2083
Xiong L, Lee BH, Ishitani M, Lee H, Zhang C, Zhu JK (2001c) FIERY1 encoding an inosi-
tol polyphosphate 1-phosphatase is a negative regulator of abscisic acid and stress sig-
naling in Arabidopsis. Genes Dev 15:1971-1984
Xiong L, Lee H, Ishitani M, Zhu JK (2002) Regulation of osmotic stress-responsive gene
expression by the LOS6/ABA1 locus in Arabidopsis. J Biol Chem 277:8588-8596
Yalovsky S, Kulukian A, Rodriguez-Concepcion M, Young CA, Gruissem W (2000) Func-
tional requirement of plant farnesyltransferase during development in Arabidopsis.
Plant Cell. 12:1267-1278
Yamaguchi-Shinozaki K, Shinozaki K (1994) A novel cis-acting element in an Arabidopsis
gene is involved in responsiveness to drought, low-temperature, or high-salt stress.
Yamauchi D, Zentella R, Ho D (2002) Molecular analysis of the barley (Hordeum vulgare
L.) gene encoding the protein kinase PKABA1 capable of suppressing gibberellin ac-
tion in aleurone layers. Planta 215:319-326
Yang Z (2002) Small GTPases: Versatile signaling switches in plants. Plant Cell 14
Suppl:S375-388
Yoshida R, Hobo T, Ichimura K, Mizoguchi T, Takahashi F, Aronso J, Ecker JR, Shinozaki
K (2002) ABA-activated SnRK2 protein kinase is required for dehydration stress sig-
naling in Arabidopsis. Plant Cell Physiol 43:1473-1483
Zeevaart JAD, Creelman RA (1988) Metabolism and physiology of abscisic acid. Annu
Zhang DP, Chen SW, Peng YB, Shen YY (2001a) Abscisic acid-specific binding sites in
the flesh of developing apple fruit. J Experimental Botany 52:2097-2103
Zhang DP, Wu ZY, Li XY, Zhao ZX (2002): Purification and identification of a 42-
kilodalton abscisic acid-specific-binding protein from epidermis of broad bean leaves.
Zhang X, Miao YC, An GY, Zhou Y, Shangguan ZP, Gao JF, Song CP (2001b) K+ chan-
nels inhibited by hydrogen peroxide mediate abscisic acid signaling in Vicia guard
cells. Cell Res. 11:195-202.
Zheng ZL, Nafisi M, Tam A, Li H, Crowell DN, Chary SN, Schroeder JI, Shen J, Yang Z
(2002) Plasma membrane-associated ROP10 small GTPase is a specific negative regu-
lator of abscisic acid responses in Arabidopsis. Plant Cell. 14:2787-2797
Zocchi E, Basile G, Cerrano C, Bavestrello G, Giovine M, Bruzzone S, Guida L, Carpaneto
A, Magrassi R, Usai C (2003) ABA- and cADPR-mediated effects on respiration and
filtration downstream of the temperature-signaling cascade in sponges. J Cell Sci
116:629-636
3 Plant responses to heat stress
Priti Krishna
Abstract
The heat stress response is characterized by inhibition of normal transcription and

translation, higher expression of heat shock proteins (hsps) and induction of ther-
motolerance. If stress is too severe, signaling pathways leading to apoptotic cell
death are also activated. As molecular chaperones, hsps provide protection to cells
against the damaging effects of heat stress and enhance survival. The enhanced
expression of hsps is regulated by heat shock transcription factors (HSFs). Recent
advances in molecular genetic approaches have provided new insights into the
plant heat stress response. A striking characteristic of plants is that they contain
highly complex multigene families encoding HSFs and hsps. This review outlines
our current knowledge of the functions of plant hsps and the regulation of HSFs,
and offers a comparative view of heat stress responses in plants and other organ-
isms. Recent observations indicating that heat stress response overlaps with other
stress responses are also discussed.
3.1 Introduction
Heat stress response is invoked in organisms as diverse as bacteria, fungi, plants,

and animals by sudden increases in temperature, and is characterized by elevated
synthesis of a set of proteins called heat shock proteins (hsps). Hsps comprise sev-
eral evolutionarily conserved protein families, such as hsp100, hsp90, hsp70,
hsp60, and small hsps (shsps). A common feature of the heat stress response is
that an initial exposure to mild heat stress provides resistance against a subsequent
usual lethal dose of heat stress. This phenomenon is referred to as 'acquired ther-
motolerance'. Since thermotolerant cells express high levels of hsps, these proteins
have been associated with the development of thermotolerance (reviewed in
Parsell and Lindquist 1993). High temperature stress causes extensive denatura-
tion and aggregation of cellular proteins, which, if unchecked, lead to cell death.
Through their chaperoning activity, hsps help cells to cope with heat-induced
damage to cellular proteins. During stress, hsps function primarily to prevent ag-
gregation and promote proper refolding of denatured proteins, but because protein
conformation is important right from the time a protein is synthesized, hsps play
important roles under normal conditions as well. The principal role of hsps under
non-stress conditions is to assist in the synthesis, transport, and proper folding of
the target proteins. Although all hsps function as molecular chaperones, each hsp

74 Priti Krishna
family has a unique mechanism of action. The relative importance of individual

hsp families in stress tolerance varies from one organism to another.
In nature, temperature changes are likely to occur more rapidly than other
stress-causing factors. Due to their inability to translocate, plants are subject to
wide variations in temperature both diurnally and seasonally, and must therefore
adapt to temperature stress quickly and efficiently. Indeed, it appears from pub-
lished experimental data and in silico analyses of the fully sequenced Arabidopsis
thaliana model that plants have evolved extensive and complex mechanisms to
combat detrimental effects of heat stress. While modest knowledge about hsp ex-
pression and functions has been gained, our understanding of the regulatory
mechanisms controlling the heat shock response in plants is limited. In this re-
view, I focus on the recent progress made in understanding the molecular mecha-
nism of the heat shock response in plants.
3.2 Major families of heat shock proteins
3.2.1 Hsp100
The hsp100 family of proteins is present in both prokaryotes and eukaryotes, with
sizes ranging from 75 to 100 kDa. The bacterial hsp100 proteins, referred to as
Clp proteins, have been studied extensively as components of a 2-subunit protease
system (Squires and Squires 1992). The large subunit ClpA functions as a chaper-
one, while the small subunit ClpP is the protease. Hsp100 proteins are divided into
2 major classes; class 1 proteins contain 2 ATP-binding sites, and class 2 proteins
contain only 1 ATP-binding site (Miernyk 1999; Schirmer et al. 1996). An inter-
esting feature of the hsp100 proteins is their ability to promote dissociation of ag-
gregated proteins in an ATP-dependent manner as opposed to mainly preventing
unfolding and aggregation of proteins, as is attributed to other chaperones (Parsell
et al. 1994).
Hsp100 proteins have been identified in a number of plant species, and an
analysis of their expression has revealed that they are both developmentally regu-
lated and stress-induced (reviewed in Agarwal et al. 2001). The A. thaliana
hsp100 family of proteins consists of 8 members, of which 5 proteins have pre-
dicted plastidial localization signals (Agarwal et al. 2001). Several studies have
established that Athsp101 of the A. thaliana hsp100 family is essential for thermo-
tolerance (Hong and Vierling 2000, 2001; Queitsch et al. 2000). The yeast ho-
molog hsp104 is also required for induced thermotolerance in yeast (Sanchez and
Lindquist 1990). Since the thermotolerance defect in yeast caused by the deletion
of hsp104 gene can be complemented by plant hsp100 proteins, it is concluded
that the function of yeast and plant hsp100 proteins in thermotolerance is con-
served (Lee et al. 1994; Schirmer et al. 1994). In addition to its role in heat stress,
plant hsp101 has been demonstrated to function as a RNA-binding protein for me-
diating the translational enhancement of tobacco mosaic virus RNA and ferre-
doxin mRNA (Ling et al. 2000; Wells et al. 1998).
3 Plant responses to heat stress 75
3.2.2 Hsp90
Hsp90 is an essential molecular chaperone in eukaryotic cells, with key functions

in signal transduction networks, cell-cycle control, protein degradation, and pro-
tein trafficking. The number of identified protein targets whose functions are fa-
cilitated by hsp90 continues to grow, especially in animal systems. A critical de-
pendence on hsp90 has been established for steroid hormone receptors, several
serine/threonine and tyrosine kinases, and other distinct proteins. Two key features
regarding the mechanism of animal and yeast hsp90 have emerged over the last
decade: 1) hsp90 is an ATP-dependent chaperone, and 2) hsp90 functions in coop-
eration with other chaperones and co-chaperones that together constitute the hsp90
chaperone complex (reviewed in Buchner 1999; Young et al. 2001). Due to its
critical role in signal transduction, hsp90 has emerged as a promising drug target
(reviewed in Neckers 2002). The hsp90 inhibitor geldanamycin (GA) binds with
high specificity within the ATP-binding pocket of hsp90, inhibiting its function
and resulting in the degradation of client proteins via the ubiquitin proteasome
pathway. A derivative of GA with cancer selectivity is now in Phase I clinical trial
as an anticancer drug. New hsp90 inhibitors are being engineered to target specific
functions of hsp90 that are applicable to medical conditions other than cancer.
Further significance of hsp90 was shown in recent work in insect (Rutherford and
Lindquist 1998) and plant (Queitsch et al. 2002), suggesting that hsp90 links the
response to environmental stresses with development in a way that could influence
evolutionary change. The hypothesis is that hsp90 buffers genetic variation in na-
ture by maintaining mutant proteins in their wild type conformations. When this
buffering is compromised, for example, by temperature stress, hsp90 is diverted
from its normal clients to other partially denatured proteins and variations become
exposed, thereby allowing selection to remodel developmental processes.
Hsp90 genes have been isolated from several plant species (reviewed in
Krishna and Gloor 2001). The A. thaliana hsp90 family of proteins consists of 7
members, of which 4 constitute the cytoplasmic subfamily and the remaining 3 are
predicted to be within the plastidial, mitochondrial and endoplasmic reticulum
(ER) compartments. Although the occurrence of multiple hsp90 proteins in the cy-
toplasm and of other family members in various subcellular compartments sug-
gests a range of specific functions for these proteins, our understanding of hsp90
in plants remains relatively limited. The study of the hsp90-based chaperone com-
plex in animals has revealed that hsp90 and hsp70 and their co-chaperones Hop
(hsp70 and hsp90 organizing protein), p23, and hsp40 participate in the conforma-
tional regulation of client proteins. High molecular weight immunophilins are also
recovered in hsp90 complexes, and the co-chaperone Cdc37/p50cdc37 is predomi-
nantly found in hsp90-kinase complexes (reviewed in Pratt and Toft 1997; Richter
and Buchner 2001). An hsp90-based chaperone system is present also in plants,
and, to date, hsp90, hsp70, high molecular weight immunophilins and a Hop-like
protein have been identified in plant hsp90 complexes (Owens-Grillo et al. 1996;
Stancato et al. 1996; Pratt et al. 2001; Reddy et al. 1998; Zhang et al. 2003). Some
observations suggest that the plant hsp90 complex has evolved some unique char-
acteristics. For example, Brassica napus p23 appears to be expressed only under
76 Priti Krishna
heat stress (Z. Zhang and P. Krishna, unpublished data), unlike animal and yeast
p23 that are expressed under normal growth conditions. Furthermore, a
Cdc37/p50cdc37-related protein has not been identified in plants based on sequence
comparisons. Currently there is no published report on any plant hsp90 client pro-
tein, but since reducing hsp90 function in A. thaliana through treatment with GA
produces an array of morphological phenotypes (Queitsch et al. 2002), it appears
that hsp90 chaperones signaling proteins in plants that control plant growth and
development.
Though hsp90 is an abundant protein under non-stress conditions, its increased
expression in response to elevated temperatures suggests a protective role for
hsp90 under heat stress conditions (Krishna and Gloor 2001; Parsell and Lindquist
1993). Indeed, mammalian and yeast hsp90 can promote refolding of thermally
denatured proteins in vitro (Schumacher et al. 1994; Wiech et al. 1992), and stabi-
lize early unfolding intermediates in thermal unfolding pathway of proteins,
thereby preventing their irreversible aggregation (Jakob et al. 1995). Also, tran-
siently expressed B. napus hsp90 in A. thaliana cell suspension culture containing
stably integrated firefly luciferase as a reporter, can accelerate luciferase renatura-
tion during recovery (Forreiter et al. 1997). Thus, hsp90 has chaperoning activity
that is linked to denaturing stress. Several lines of evidence suggest that hsp90
functions as a regulator of the heat shock response; this aspect is discussed in sec-
tion 3.3.2 of this review.
3.2.3 Hsp70
Members of the hsp70 family exist in the cytosol of all eubacteria and eukaryotes,
and some archae, as well as within mitochondria, ER and plastids of eukaryotic
cells (Lin et al. 2001). In higher eukaryotes, including plants, some hsp70 family
members are expressed constitutively (Hsc70) while others are stress-inducible
(reviewed in Boston et al. 1996; Hartl and Hayer-Hartl 2002). The domain struc-
ture of hsp70 comprises of a ~45 kDa NH2-terminal ATPase domain and a ~25
kDa COOH-terminal peptide-binding domain. In higher eukaryotes, hsp70 func-
tions both co- and post-translationally. The various functions of hsp70 have been
reviewed previously (Hendrick and Hartl 1993; Parsell and Lindquist 1993). Sub-
strates in their non-native states are bound by hsp70 and successive cycles of bind-
ing and releasing coupled with ATP hydrolysis promotes protein folding. The
mechanistic details of hsp70 function are best understood for the prokaryotic ho-
molog DnaK, which requires 2 accessory proteins: DnaJ (eukaryotic counterparts
are referred to as hsp40) and the nucleotide exchange factor GrpE (Bukau and
Horwich 1998). DnaJ regulates the ATPase activity of DnaK, and GrpE facilitates
the release of ADP. In comparison to the bacterial DnaK, relatively little is known
about the hsp70 protein folding machinery in plants. A total of 89 J-domain pro-
teins were identified in the genome of A. thaliana (Miernyk 2001). Seven of these
are closely related to hsp40 and are likely to perform functions analogous to
hsp40/DnaJ proteins. A GrpE-like protein appears to be absent in eukaryotic cyto-
sol, although a structurally unrelated protein Bag-1 acts as a nucleotide exchange
factor and a regulator of hsp70 (Hohfeld and Jentsch 1997). Bag-domain proteins
are also present in plants but a description of these proteins has yet to appear in
literature. Other co-chaperones of eukaryotic hsp70, such as Hop and Hip (hsp70-
interacting protein) that affect the nucleotide-bound state of hsp70 (Frydman and
Hohfeld 1997), may also regulate the functional cycle of hsp70 proteins. Residues
critical for interaction with hsp70 are conserved in the tetratricopeptide repeat
domains of plant orthologs of Hip and Hop (Webb et al. 2001; Zhang et al. 2003),
but the details of these interactions remain to be elucidated.
The hsp70 protein family is relatively large in plants; 18 members have been
assigned to the hsp70 family in A. thaliana with distribution in the cytoplasm as
well as plastid, ER and mitochondria (Lin et al. 2001). The expression of hsp70 is
both developmentally regulated and stress-induced (Boston et al. 1996; Sung et al.
2001). A comprehensive analysis of the expression profile of the A. thaliana
hsp70 gene family indicates that individual members differ in their response to
different conditions and stimuli (Sung et al. 2001). Based on the expression pat-
terns, functions for members of the hsp70 family can be ascribed to heat and cold
stress, and to seed maturation and germination. Together, these data suggest that
plant hsp70 proteins interact with diverse substrates and take part in a plethora of
cellular processes. Clearly, the challenge for the future is to obtain detailed knowl-
edge of the specific functions of individual members. Like hsp90, hsp70 has also
been implicated in the regulation of the heat shock response. This aspect is dis-
cussed in section 3.3.2 of this review.
3.2.4 Small hsps
Shsps are a group of proteins ranging in size from 15 to 42 kDa that are ubiqui-
tously produced in prokaryotic and eukaryotic cells in response to heat stress. In
plants, shsps are the most dominant proteins produced in response to heat stress. A
total of 13 shsps belonging to 6 classes, defined on the basis of sequence related-
ness and intracellular localization, and an additional 6 open reading frames encod-
ing distantly-related proteins have been identified in the A. thaliana genome
(Scharf et al. 2001). The unusual abundance and complexity of these proteins in
plants suggest their unique significance, but a comprehensive understanding of
their roles and mechanisms awaits further revelation. Detailed descriptions of the
classification, structure, and functions of plant shsps have been provided in several
recent reviews (Boston et al. 1996; Scharf et al. 2001; Sun et al. 2002; Waters et
al. 1996). The NH2-terminal end of shsps belonging to different classes are quite
divergent, but all shsps share a conserved COOH-terminal domain referred to as
the α-crystallin domain. A common feature of shsps is their ability to form large
oligomers and changes in the oligomeric state are associated with the chaperone
activity of shsps. The molecular chaperone activity of plant shsps has been dem-
onstrated both in vitro (Lee et al. 1995a, 1997) and in vivo (Forreiter et al. 1997;
Low et al. 2000). In contrast to hsp60 and hsp70 proteins, the chaperone activity
of shsps is ATP-independent (Lee et al. 1995a). The current model for shsp chap-
erone function is that shsps bind to unfolding intermediates to protect them from
78 Priti Krishna
irreversible aggregation and to maintain them in a refolding competent state. The

captured proteins are then refolded by other molecular chaperones in an ATP-
dependent manner (Lee and Vierling 2000). The expression patterns and chaper-
one function of shsps suggest that shsp production is correlated with thermotoler-
ance. Experimental data in support of an important role of shsps in thermotoler-
ance as well as other stresses has been derived from genetic modification of the
expression of shsps in transgenic plants (Harndahl et al. 1999; Malik et al. 1999;
Sun et al. 2001). The functions of shsps extend beyond those associated with pro-
tection against heat stress as shsps are also synthesized in the absence of any envi-
ronmental stress at specific stages of development, such as germination, embryo-
genesis, pollen development and fruit maturation (reviewed in Sun et al. 2002).
Getting a clear picture of the distinct functions of shsps during stress and devel-
opmental processes is a task for the future.
3.2.5 The Chaperonins
Chaperonins comprise a diverse family of molecular chaperones that are present in

the cytoplasm, plastids, and mitochondria of eukaryotes and eubacteria (reviewed
in Boston et al. 1996; Bukau and Horwich 1998; Hill and Hemmingsen 2001).
They occur as two distinct subgroups, type I and type II, that are distantly related
in sequence. The eukaryotic type I chaperonins are localized in the chloroplast and
mitochondria and are referred to as chaperonin 60 (Cpn60). The bacterial type I
chaperonin, referred to as GroEL, has been studied extensively, and serves as a
paradigm for the type I system. Typically, these proteins consist of 2 stacked
rings, each comprised of 7 subunits (Saibil 2002), and they act in concert with co-
chaperonins GroES in bacteria, and Cpn21 and Cpn10 in eukaryotes (Saibil and
Ranson 2002). Through ATP hydrolysis, the type I chaperonins assist a large vari-
ety of proteins to reach their native states. A recent examination of the A. thaliana
genome for chaperonin sequences indicates that the chaperonin family in plants is
more diverse than previously described (Hill and Hemmingsen 2001). Nine plas-
tidic and mitochondrial Cpn60 proteins, and a previously undescribed 10 kDa po-
tential plastidic co-chaperonin were identified in this search. The presence of the
10 kDa co-chaperonin together with the previously recognized Cpn21 is intriguing
and raises the possibility of coexistence of 2 chaperonin systems in the chloroplast
(Schlicher and Soll 1996).
The plastidic Cpn60 is composed of 2 distinct subunit types, α and β. The ex-
pression of Cpn60 gene members is developmentally regulated, and some mem-
bers are heat shock-inducible while others are not (Zabaleta et al. 1994a). The
chloroplast Cpn60 plays a prominent role in the folding of plastid proteins, includ-
ing Rubisco. In accordance with this, reduced expression of Cpn60β in transgenic
tobacco resulted in abnormal phenotypes (Zabaleta et al. 1994b), and a func-
tionless Cpn60α gene led to defects in A. thaliana embryo development (Apuya et
al. 2001). The results of Apuya et al. (2001) clearly demonstrate that Cpn60α is
required for chloroplast development and that proper embryo development is de-
pendent on functional chloroplasts, but do not preclude the possibility that

Cpn60α may also be involved in the folding of some cytoplasmic proteins.
The cytoplasmic counterparts of type I chaperonins are referred to as type II
chaperonins and they too function in double-ring oligomeric complex. The eu-
karyotic complex is referred to as TCP-1 (T complex protein-1), CCT (chaperonin
containing TCP-1), or TRiC (TCP-1 ring complex). In A. thaliana, 9 coding re-
gions are predicted to encode CCT-related proteins (Hill and Hemmingsen 2001).
Study of the type II chaperonins in plants is still in its infancy.
3.3 Transcriptional regulation of hsps
The stress-inducible expression of hsps is regulated primarily at the transcriptional

level by heat shock transcription factors (Hsfs) that bind to conserved regulatory
elements located in the promoters of hsp genes, referred to as heat shock elements
(HSEs). The eukaryotic HSEs with the palidromic consensus sequence (nGAAn)
(nTTCn) are located within a few hundred base pairs of the 5' flanking regions of
heat shock genes (reviewed in Schoffl et al. 1998). Upon activation, the Hsf binds
to HSEs and interacts with proteins of the basal transcription machinery. Features
of heat shock gene transcription in other organisms involving Hsfs and compo-
nents of the chromatin remodeling and basal transcription machinery have been
reviewed (Morimoto 1998; Wu 1995), and are not discussed here. In plants, the in-
teraction of A. thaliana Hsf1 with the TATA box binding transcription factor is
the only observation reported in this direction (Reindl and Schoffl 1998).
The first plant Hsf was cloned in 1990 from Lycopersicon peruvianum (Scharf
et al. 1990). Further analysis of the tomato Hsf system revealed that in contrast to
a single Hsf in Saccharomyces cerevisiae and Drosophila melanogaster, plants
contain multiple Hsfs. An idea of the unusual complexity of the Hsf network in
plants can be obtained by examination of the A. thaliana genome sequence that
appears to encode 21 such proteins (Nover et al. 2001). This number far exceeds
the 4 Hsfs found in vertebrates (Pirkkala et al. 2001). The plant Hsf gene family is
also unique in that some of its members are heat stress-inducible, and others have
structural peculiarities. Typically, the Hsfs are composed of a conserved DNA
binding domain, an oligomerization domain, and an activation domain. The Hsfs
of higher eukaryotes are converted from a monomeric to a trimeric form in re-
sponse to stress. The activated trimeric form acquires DNA binding and transcrip-
tional activation properties. In yeast, the Hsf is bound to DNA in a trimeric form
even in the absence of stress, but becomes competent for transactivation function
during heat stress following temperature-dependent phosphorylation and confor-
mational change (Jakobsen and Pelham 1988; Sorger 1991). In contrast, human
Hsf1 is phosphorylated as an inactive monomer and becomes activated after bind-
ing to DNA in its trimeric state by heat-induced hyperphosphorylation (Cotto et al.
1996).
80 Priti Krishna
3.3.1 Structure of plant Hsfs
A detailed description of the Hsf family of proteins in plants and their structural
characteristics has recently been provided by Nover et al. (2001). At the NH2-
terminal end of plant Hsfs is a conserved helix-turn-helix DNA binding domain
(DBD) that specifically recognizes the palindromic HSE. Connected to the DBD
by a linker region of variable length and sequence is the oligomerization domain
(HR-A/B). The heptad pattern of hydrophobic residues in the HR-A/B region sug-
gests a coiled-coil structure that is likely involved in trimerization of Hsfs. Based
on differences in their flexible linker and HR-A/B regions, the plant Hsfs have
been divided into 3 classes: A, B, and C (Fig. 1). Similar to non-plant Hsfs, the
HR-A and B parts of class B Hsfs are separated by 7 amino acid residues, whereas
class A and class C Hsfs have insertions of an additional 21 and 7 amino acid resi-
dues, respectively (Nover et al. 2001). It is interesting that class C Hsfs were iden-
tified only after examination of the A. thaliana genome sequence, although EST
analysis suggests that members of this new class are well expressed in different
plant tissues. Hsfs also contain sequence motifs essential for both nuclear import
and export. The nuclear localization signals (NLS) of class A and C Hsfs lie adja-
cent to the HR-A/B region, but for most class B Hsfs, NLS is located towards the
COOH-terminal end of the protein (Fig. 1). The nucleocytoplasmic distribution of
Hsfs is also influenced by the nuclear export signal (NES). The predominant cyto-
plasmic distribution of the tomato HsfA2 is dependent on its NES (Heerklotz et al.
2001). The activation domains of Hsfs, located at the COOH-terminus, are least
conserved in size and sequence. The transcription activation function of Hsfs is
correlated with short peptide motifs referred to as AHA motifs, usually found in
the centre of the activation domain of most A. thaliana class A Hsfs (Doring et al.
2000). It is believed that these motifs constitute the sites for interaction with com-
ponents of the basal transcription machinery (Nover et al. 2001). Interestingly,
class B Hsfs lack the AHA motifs (Fig. 1). This has raised the question of whether
these proteins function in cooperation with other Hsfs. Nover and co-workers have
evidence suggesting that HsfB1 acts as a synergistic partner of HsfA1 in activating
gene transcription (Nover et al. 2001).
3.3.2 Regulation of plant Hsfs
3.3.2.1 Positive and negative regulation by Hsfs

The multiplicity of Hsfs in plants raises the question of whether different members
are functionally redundant or diverse. Experimental data describing the structural
and functional characteristics of plant Hsfs has been obtained primarily for tomato
Hsfs. Although 17 Hsfs have been identified in tomato thus far, only the constitu-
tively expressed HsfA1 has been ascribed the unique role as a master regulator of
thermotolerance in tomato (Mishra et al. 2002). In transgenic tomato plants with
strongly reduced expression of HsfA1, no other constitutively expressed Hsf could
substitute for HsfA1 as master regulator of the heat shock response. These plants
DBD HR-A/B NLS AHA NES

HsfA1a
1 50 160 262 433 482 495
DBD HR-A/B NLS

HsfB1
1 12 149 247 284
DBD HR-A/B NLS

HsfC1
1 15 123 191 330
Fig. 1. Structures of A. thaliana Hsfs belonging to classes A, B, and C. Only a single mem-
ber of each class is shown. The functional domains include: DBD, DNA binding domain;
HR-A/B, oligomerization domain (the plain grey area in HsfA1a and HsfC1 represents in-
sertion of additional amino acid residues between parts A and B); NLS, nuclear localization
signal; AHA, short motifs in the activator region that are rich in aromatic, hydrophobic, and
acidic amino acid residues; NES, nuclear export signal. Reproduced with permission from
Nover et al. (2001) Cell Stress Chaperones 6:177-189.
were highly sensitive to elevated temperature and showed reduced or no synthesis

of hsps and heat stress-inducible Hsfs. In contrast, no comparable defects in the
heat shock response were noticed in plants with strongly reduced or no expression
of the heat stress-inducible HsfA2 and HsfB1 (Mishra et al. 2002). The authors
speculate a sequential model of heat stress-induced gene expression in which the
heat-inducible HsfA2 and HsfB1 act as HsfA1-dependent enhancer or modifier of
hsp synthesis. This model is supported by the observation that the nuclear reten-
tion and activator function of HsfA2 is markedly influenced by heteroligomeriza-
tion with HsfA1 (Heerklotz et al. 2001), and that HsfB1, which has no transcrip-
tion activator function itself, can act as a strong synergistic co-activator of HsfA1
(Nover et al. 2001).
As an alternative to an activator function, it is proposed that some plant Hsfs, in
particular those belonging to class B, could function as negative regulators of the
heat stress response (Czarnecka-Verner et al. 2000). One possibility is that class B
Hsfs occupy HSEs under non-stress conditions and maintain heat shock genes in a
repressed state. The constitutive nuclear localization of tomato HsfB1 (Scharf et
al. 1998) is compatible with this model. The negative regulatory effects of these
proteins may also be exerted by forming non-functional complexes with compo-
nents of the basal transcriptional machinery or even with class A Hsfs. The com-
plexity of class B Hsfs suggests important biological functions for these proteins
and the possibility that they have evolved as co-activators or repressors of class A
Hsfs is supported by some experimental evidence. Elaborate analysis in the future
of the interactions between different Hsfs and between Hsfs and proteins of the
transcription complex will reveal how protein:protein interactions regulate the
plant heat shock response.
82 Priti Krishna
3.3.2.2 Negative regulation by hsps

With the exception of yeast, eukaryotic Hsf is maintained as an inert monomer
under non-stress conditions, and assembles into trimers only upon activation by
stress. How Hsf of higher eukaryotes is maintained in the monomeric form has
been a question of much interest. Studies from various organisms have led to the
belief that Hsf is negatively regulated, at least in part, by hsp70 (reviewed in Wu
1995). For example, mutations in yeast hsp70 result in overexpression of hsps
(Craig and Gross 1991), and results of biochemical and overexpression studies in-
dicate that hsp70 interacts with Hsf (Abravaya et al. 1992; Mosser et al. 1993;
Rabindran et al. 1994). These observations, together with the fact that the heat
shock response is transient in nature, led to the proposal that there is feedback
regulation of Hsf by hsp70. According to this model, during heat shock, when pro-
tein unfolding increases and non-native proteins accumulate, hsp70 and other mo-
lecular chaperones are recruited to prevent unfolding and stabilizing partially un-
folded intermediates. The sequestration of hsp70 by denatured proteins results in
the activation of Hsf and transcription of hsps, including hsp70. As the levels of
hsp70 increase during heat stress, hsp70 and Hsf reassociate. This leads to repres-
sion of Hsf transcriptional activity and attenuation of the heat shock response. In
metazoans, activation of Hsf1 is a multistep process, including trimerization, DNA
binding and inducible phosphorylation. Any of these events could be affected by
hsp70. Shi et al. (1998) observed that hsp70 and its co-chaperone Hdj-1/hsp40 in-
teract directly with the activation domain of Hsf1, leading to repression of heat
shock gene transcription. Since neither the DNA binding activity nor inducible
phosphorylation of Hsf1 is affected in hsp70 overexpressing cells, it is concluded
that the primary function of hsp70 as a regulator of Hsf1 is to repress its transcrip-
tional activity during attenuation of the heat shock response (Shi et al. 1998). Pre-
sumably, other events and factors are involved in dissociating trimers and convert-
ing them to the inert monomeric form. A protein that associates with Hsf1, termed
as heat shock factor binding protein 1 (HSBP1), has properties of a negative regu-
lator of Hsf1 (Satyal et al. 1998). HSBP1 interacts with only the trimeric form of
Hsf1 and with hsp70. It is proposed that during attenuation of the heat shock re-
sponse, interaction of Hsf1 with hsp70, Hdj-1/hsp40 and HSBP1 eventually leads
to dissociation of Hsf1 trimers to inert monomers (Morimoto 1998). The details of
this model remain to be worked out.
Several lines of evidence indicate that the hsp90 chaperone machinery also
regulates Hsf activity. Yeast and rat Hsfs can physically associate with hsp90
(Nadeau et al. 1993). Genetic tests in yeast revealed that hsp90 and Cpr7, a CyP-
40-type cyclophilin required for full hsp90 function in vivo, act synergistically to
repress gene expression from Hsf-dependent promoters (Duina et al. 1998). Fur-
thermore, trimeric human Hsf1 dynamically associates with an hsp90-
immunophilin (FKBP52)-p23 complex through the regulatory domain, and forma-
tion of this heterocomplex results in the repression of Hsf1 transcriptional activity
(Guo et al. 2001). It is clear from these observations that molecular chaperones
have pivotal roles in regulating the heat shock response, but the specific steps of
the Hsf inactivation/dissociation pathway at which individual chaperones act re-
HSP70
HSF
HSBP1
HSP70 ? HSP90
HSE
P
P P
Transcription
?
HSP90
No HSBP1
Transcription
HSP70
Fig. 2. Model of Hsf regulation by hsps and HSBP1. Hsf exists in the inactive monomeric
state through interaction with hsp70 or another protein(s). Following activation, Hsf local-
izes to the nucleus where it trimerizes, acquires DNA binding ability, and upon phosphory-
lation becomes transcriptionally competent. Hsp90 and its co-chaperones (not shown) bind
to Hsf trimers and maintain them in an activable state. During attenuation of the heat stress
response, hsp70 and its co-chaperones (not shown), and HSBP1 bind to Hsf, repressing its
transcriptional activity and leading to the dissociation of Hsf trimers to inert monomers.
Hsp90 and its co-chaperones may also be involved in the disassembly of Hsf trimers.
main to be worked out. Several possibilities exist for how they may exert their ef-
fects. Because hsp70 and hsp90 can be found together in the same heterocom-
plexes (Pratt and Toft 1997), it is possible that they jointly affect aspects of Hsf
regulation. Alternatively, it may be that repression of activated Hsf is mediated by
the binding of hsp70 to the activation domain of Hsf, and that the hsp90 complex
keeps the inactive Hsf in an activable state, as in the case of steroid receptors
(Pratt and Toft 1997). The repression mechanism must involve controls to ensure
that Hsf activation occurs in proportion to the severity of stress (Guo et al. 2001).
Thus, the involvement of molecular chaperones in 'controlling' Hsf hyperphos-
phorylation or disassembly also remain as attractive possibilities. The recent dem-
onstration that hsp90 and p23 help disassemble transcriptional regulatory com-
plexes (Freeman and Yamamoto 2002) warrants further studies of the effects of
these chaperones on Hsf trimer disassembly. The model shown in Figure 2 illus-
trates both possible scenarios by which hsp90 may regulate Hsf: 1) keep the
trimers in an activable state and 2) participate in the disassembly of the trimers. It
is possible that hsp90 participates in only one of these steps, or alternatively, in the
84 Priti Krishna
presence of different co-chaperones, regulates both Hsf activation and deactiva-

tion.
In plants, circumstantial evidence suggests the presence of a negative regula-
tor(s) of Hsfs. For example, overexpression of A. thaliana Hsf1 fused to β-
glucuronidase (GUS) in transgenic A. thaliana plants derepressed the heat shock
response, leading to constitutive synthesis of hsps and an increase in basal thermo-
tolerance (Lee et al. 1995b). Since overexpression of unfused Hsf1 did not pro-
duce this effect, a model was put forth suggesting that derepression may be due to
impaired recognition of Hsf1-GUS by a repressing factor. In contrast to Hsf1,
overexpression of either Hsf3 or Hsf3-GUS in transgenic plants derepressed the
heat shock response (Prandl et al. 1998), suggesting that either titration of a nega-
tive regulator of Hsf3 or just the intrinsic constitutive activity of Hsf3 is responsi-
ble for derepression. To date, very few studies have investigated the involvement
of molecular chaperones in regulating the activity of plant Hsfs. In a transgenic
approach, the time required to turn off Hsf activity during recovery from heat
stress was significantly prolonged in A. thaliana plants expressing antisense hsp70
gene as compared to wild type plants (Lee and Schoffl 1996). These results are
consistent with the involvement of hsp70 at an early stage of plant Hsf inactiva-
tion. However, since reduced levels of hsp70 in these transgenic plants did not
correlate with derepressed Hsf at normal temperature; heat stress was required for
activation, a role for hsp70 in the disassembly of Hsf trimers is favored by the au-
thors. A role for hsp70 as a regulator of Hsf activity in plant cells is further cor-
roborated by the demonstration that A. thaliana Hsf1 and hsp70 interact in vitro as
well as in yeast 2-hybrid assays (Kim and Schoffl 2002).
The recent cloning of the maize empty pericarp2 (emp2) has led to the identifi-
cation of a putative plant ortholog of HSBP1 (Fu et al. 2002). Null mutations in
emp2 result in increased expression of hsps, retarded embryo development and
early-stage abortion of embryogenesis. emp2 is a loss of function mutation of a
negative regulator of the plant heat shock response, and, therefore, shows unat-
tenuated heat shock response. The conservation of the hydrophobic heptad repeat
domains in EMP2 suggests that it functions as a negative regulator by binding to
Hsf. The developmental retardation of emp2 mutant kernels before the onset of the
heat shock response indicates that EMP2 has an additional role during embryo de-
velopment, distinct from its role in heat stress response. Further investigation of
EMP2 will expand our understanding of the roles of EMP2 during heat stress re-
sponse and embryogenesis.
3.3.2.3 Heat stress granules

During prolonged heat stress in plants, shsps aggregate to produce highly ordered
cytoplasmic complexes of 40 mM diameter. The so-called heat stress granules
(HSGs) are unique to plants and are produced in all plant species and tissues ex-
amined so far (Nover et al. 1989). HSGs comprise mainly of cytosolic shsps be-
longing to both classes I and II. An examination of the structural prerequisites of
hsps for their assembly into HSGs revealed that they first assemble into dodecam-
ers of 210-280 kDa, which, upon heat stress, become incorporated into HSG com-
plexes (Kirschner et al. 2000). Class II dodecamers alone can form HSG com-
plexes but class I dodecamers require the presence of class II proteins. An intact
COOH-terminus of class II shsp is critical for oligomerizing, aggregating into
HSGs, and recruiting class I proteins (Kirschner et al. 2000). Experimental data
suggests that HSGs represent storage and protection sites for housekeeping
mRNPs, which are released following removal of stress (Nover et al. 1989). It is
also proposed that during long-term heat stress, unfolded proteins bound to shsps
exceed the capacity of the hsp70/hsp40 refolding machinery, and that these dena-
tured protein-shsp complexes are stored transiently in HSGs (Low et al. 2000).
The heat-inducible tomato HsfA2 accumulates to high levels in the course of
prolonged heat stress and recovery periods. A study of the intracellular localiza-
tion of tomato Hsfs showed that following heat shock, HsfA2 is present as a high
salt-resistant nuclear form and as a stored form in cytoplasmic HSGs (Scharf et al.
1998). The binding of HsfA2 to HSG is specific as HsfA1 and other cytosolic pro-
teins examined did not associate with the HSG fraction. Both the HSG-bound and
the nuclear high salt-resistant forms were reversible to the soluble cytoplasmic
form after removal of stress. Incorporation of HsfA2 into HSG and its release dur-
ing recovery could be an aspect of Hsf regulation during plant heat stress re-
sponse. It remains to be seen if HsfA2 is incorporated into pre-HSG particles or
becomes associated with HSG during heat stress-induced aggregation of the dode-
camers.
3.3.2.4 Regulation of Hsfs by phosphorylation

In mammalian model systems, the DNA binding and transactivating capabilities of
Hsf1 are uncoupled and serine phosphorylation is an important determinant of the
transactivating potency of Hsf1 (reviewed in Pirkkala et al. 2001). The latent form
of mammalian Hsf1 under normal conditions is also constitutively phosphorylated.
Multisite phosphorylation-mediated regulation of Hsfs is not surprising given that
the heat shock response is both fast and flexible, and that Hsf activation has to
vary in proportion to the severity of the stress and in response to stimuli other than
heat stress in a constantly changing environment. Details of Hsf1 phosphorylation
have been slow in forthcoming, presumably due to the many potential sites of
phosphorylation that can be associated with either increases or decreases in activ-
ity. A subset of phosphorylated sites involved in Hsf1 repression have been identi-
fied, but to date only a single site, Ser230, has been linked with inducible tran-
scriptional activity (Holmberg et al. 2001). Several signaling pathways involving
glycogen synthase kinase 3β (GSK-3β), protein kinase C (PKC), extracellular sig-
nal-regulated kinase (ERK), and c-Jun N-terminal kinase (JNK) have been impli-
cated in the repression of mammalian Hsf1 (Chu et al. 1996, 1998; Dai et al. 2000;
He et al. 1998; Kim et al. 1997; Knauf et al. 1996). However, an in vivo demon-
stration of these kinases in Hsf1 regulation, as well as an understanding of how
these different kinases interact to affect Hsf1 repression are currently lacking.
Since Ser230 lies within a consensus site for calcium/calmodulin-dependent pro-
tein kinase II (CaMKII), and overexpression of CaMKII enhances both the level
of Ser230 phosphorylation and transactivation of Hsf1, Holmberg et al. (2001)
86 Priti Krishna
propose that CaMKII signaling is involved in the positive regulation of the trans-
activating capability of Hsf1. In this regard, the yeast Hsf is also inducibly serine
phosphorylated (Cotto et al. 1996), and the Drosophila Hsf undergoes phosphory-
lation at some sites and dephosphorylation at others in response to heat stress, with
no net increase in the steady state level of Hsf phosphorylation (Fritsch and Wu
1999). Since in all cases the DNA binding activity of Hsfs remains unaffected by
inducible phosphorylation, it is likely that the influence is on the transcriptional
activity of the Hsfs. It is clear from these results that Hsf regulation by phosphory-
lation is a fairly complex process.
Relatively little is known about the role of phosphorylation in plant heat stress
response. Due to the pivotal roles of mitogen-activated protein kinases (MAPKs)
in signal transduction of extracellular stimuli, such as hormone regulators and en-
vironmental stresses, in various organisms, MAPKs have also received attention in
plants. In a recent analysis of the A. thaliana genome, 20 MAPKs, 10 MAPK
kinases (MAPKK), and 60 MAPKK kinases (MAPKKK) were identified (Ichi-
mura et al. 2002). MAPK cascades in plants are activated in response to different
biotic and abiotic stresses (reviewed in Jonak et al. 2002), including cold and
drought (Jonak et al. 1996), high salt (Munnik et al. 1999), wounding (Bogre et al.
1997), and pathogen infection (Nuhse et al. 2000). Until recently, no heat shock-
activated MAPK was reported in plants. Sangwan et al. (2002) provided the first
demonstration that a MAPK immunologically related to the ERK superfamily of
protein kinases is activated by heat stress in alfalfa (Medicago sativa) cells. A
study of the mechanism leading to activation of this heat shock-activated MAPK
(HAMK) indicated that heat is sensed by changes in membrane fluidity that occur
directly, rapidly, and reversibly in response to temperature and that translate the
signal via cytoskeleton, Ca2+ fluxes and Ca2+-dependent protein kinases (CDPKs)
into activation of HAMK. While these results suggest that a temporal sequence of
events is involved in the activation of HAMK, further characterization of this en-
zyme revealed that HAMK can be heat-activated in cell-free extracts (Sangwan
and Dhindsa 2002). The integrity of cellular membranes and the partitioning of
Ca2+ are likely disrupted in cell-free extracts, which raises the intriguing question
of how HAMK is activated in cell-free extracts. Direct effects of temperature on
the conformation and activity of either HAMK or its upstream activator(s), leading
to temperature perception directly by a protein, are possibilities that need to be ex-
plored in the future. The inability of tobacco cells in which HAMK activity is
blocked to launch a heat stress response suggests that HAMK is an important
regulator of the heat stress response in plants (RS Dhindsa, personal communica-
tion).
Further support for a role of MAPKs in plant heat stress response comes from
studies in tomato. Link et al. (2002) observed a 50 kDa MAPK is activated by heat
stress in tomato cells in a Ca2+-dependent manner. A partially purified preparation
of the heat-activated MAPK could phosphorylate tomato HsfA3 but not HsfA1
even though both proteins contain several copies of consensus MAPK phosphory-
lation sites. Whether or not this substrate specificity is biologically relevant re-
mains to be seen. Heat stress induces several events in cells, including cell cycle
arrest. Thus it is not surprising that a cyclin-dependent CDC2a kinase forms a sta-
ble complex with A. thaliana Hsf1 and phosphorylates it on multiple serine resi-
dues (Reindl et al. 1997). Phosphorylation by CDC2a results in reduced DNA
binding of AtHsf1 to HSEs in vitro. Although a link between heat stress response
and cell-cycle control is suggested by these results, no further evidence confirming
this interaction or its significance has emerged following this study.
In addition to MAPKs, the GSK-3-like kinases in plants are emerging as impor-
tant regulators of development, stress, and hormone signaling (reviewed by Jonak
and Hirt 2002). In view of the fact that mammalian Hsf1 is phosphorylated by
GSK-3β (He et al. 1998), the involvement of plant GSK-3-like kinases in heat
stress response should also be explored. The role of phosphorylation in heat stress
response is not limited to Hsf activation or deactivation. Heat shock causes sig-
nificant reduction in normal transcription and translation processes, and affects the
cell at the level of proteins, nucleic acids, membrane, and the cytoskeleton. These
changes are likely to correlate with altered phosphorylation of several cellular pro-
teins. A comprehensive study of protein phosphorylation in plant heat stress re-
sponse using high throughput proteomic analysis and computer assisted method-
ology should be undertaken to formulate a systematic working hypothesis for the
future. Such an approach in mammalian cell lines allowed proteins to be grouped
based on kinetic analysis of phosphorylation by heat shock (Kim et al. 2002).
Identifying what protein kinases are activated and what proteins are phosphory-
lated in response to heat stress will serve only as a starting point in understanding
heat stress signaling. Defining the upstream and downstream components of dif-
ferent protein kinases as well as the mechanisms of cross-talk between different
cascades are the real challenges for the future.
3.4 Ca2+ and heat shock response
There is considerable evidence that Ca2+-mediated second messenger systems are

involved in the perception and reaction of plants to different environmental signals
(Bush 1995). Changes in cytosolic Ca2+ levels occur in response to cold stress
(Knight et al. 1996), mechanical stimulation (Haley et al. 1995), oxidative stress
(Price et al. 1994), salinity stress (Lynch et al. 1989), and hypo-osmotic shock
(Takahashi et al. 1997) suggesting that signaling by Ca2+ is one of the primary
mechanisms leading to molecular changes that help plants to adapt to new condi-
tions. The involvement of Ca2+ in thermotolerance in plants has also been docu-
mented. Braam (1992) observed that expression of calmodulin-related TCH genes
is regulated in response to heat shock and that external Ca2+ is required for maxi-
mal heat shock induction of TCH genes but not of hsp70 gene. Pretreatment of to-
bacco seedlings with Ca2+ increased thermotolerance of seedlings and led to a
transient increase, lasting 10 to 20 minutes, in cytoplasmic but not chloroplastic
Ca2+ (Gong et al. 1998b). A single heat stress treatment initiated a refractory pe-
riod during which additional heat treatments failed to increase cytosolic Ca2+ lev-
els, but responsiveness, measured as cytosolic Ca2+ increases, to other stimuli such
as cold shock and touch was maintained. These observations suggest that plants
88 Priti Krishna
can distinguish between different stimulus-induced increases in cytosolic Ca2+.

That Ca2+ improves thermotolerance of seedlings is further supported by studies in
A. thaliana. Treatment of A. thaliana plants with calcium chloride improved sur-
vival after severe heat treatment, whereas treatment with Ca2+ channel blockers
and calmodulin inhibitors reduced survival (Larkindale and Knight 2002). Con-
trary to the observations made in tobacco seedlings (Gong et al. 1998b), no in-
crease in cytosolic Ca2+ was detected in A. thaliana during heat treatment, al-
though transient elevation in levels were noted during recovery from heat stress.
Plants that had acquired thermotolerance through a mild heat treatment produced
larger Ca2+ peaks when exposed to a lethal heat treatment as compared to thermo-
sensitive plants (without mild heat treatment), in particular during initiation of re-
covery. Together, these results suggest a role for Ca2+ in some aspect of plant heat
stress response. Whether Ca2+ elevation during heat stress affects Hsf activity and
hsp synthesis is not clear. Some investigations on animal Hsf activity in response
to Ca2+ treatments have been made (Mosser et al. 1990; Soncin et al. 2000), but a
clear picture of the effects has not emerged. Future questions are: how Ca2+ signal
produced during heat stress is different from Ca2+ signals triggered by other stim-
uli, what components sense and transduce Ca2+ signal during heat stress, and what
are the downstream responses?
3.5 Hormones and heat stress response
Hormones control virtually all aspects of plant physiology, including stress re-
sponse. The roles of abscisic acid (ABA) in cold, salt, and drought stresses (Chan-
dler and Robertson 1994; Zhu 2002) and those of ethylene and salicylic acid (SA)
in plant defense responses (Johnson and Ecker 1998; Wang et al. 2002) are well
documented. In comparison, the effects of plant growth regulators on heat stress
response are less studied, and investigations in this direction appear to be limited
to examining hsp gene expression in response to different hormones. Hsp90 tran-
scripts or protein are induced in response to indoleacetic acid (Yabe et al. 1994),
ABA (Pareek et al. 1995) and brassinosteroid (Wilen et al. 1995). Elevated ex-
pression of hsp100 by ABA has been similarly observed (Campbell et al. 2001;
Pareek et al. 1995). The expression of a subset of shsps during embryogenesis has
generated much interest in the regulation of shsp expression by hormones, espe-
cially ABA (Almoguera and Jordano 1992; Coca et al. 1996; Kaukinen et al.
1996; Wehmeyer et al. 1996).
Convincing evidence exists for ABA and brassinosteroid action in increasing
thermotolerance in plants. A bromegrass (Bromus inermis) cell suspension culture,
without a prior mild heat treatment, had significant increase in survival rate when
it was pretreated with 75 µM ABA. The heat tolerance provided by ABA treat-
ment was first observed after 4 days of culture in the presence of ABA and
reached a maximum after 11 days of culture (Robertson et al. 1994). Typically,
thermotolerance has been associated with the accumulation of hsps during heat
stress. In case of bromegrass cell culture, ABA-responsive heat stable proteins, a
subset of which cross-reacted with anti-dehydrin and anti-Wcs120 (a cold-

responsive winter wheat protein) antibodies, were demonstrated to confer thermo-
stability in in vitro protection assays. The thermotolerance enhancing effect of
ABA has also been noted in maize (Gong et al. 1998a) and in A. thaliana (Larkin-
dale and Knight 2002). Pretreatment of A. thaliana seedlings with SA, 1-
aminocyclopropane-1-carboxylic acid (a precursor to ethylene) and ABA prior to
a usual lethal heat treatment enhanced survival by approximately 5-, 3-, and 2-
fold, respectively, and reduced heat stress-induced oxidative damage (Larkindale
and Knight 2002). In contrast to the 4 day treatment of bromegrass cell suspension
culture with ABA (Robertson et al. 1994), a 1 hour treatment of A. thaliana plants
with the growth regulators before exposure to heat stress was sufficient to increase
survival (Larkindale and Knight 2002). While it is a natural assumption that both
early and late events related to thermotolerance could be influenced by hormones,
the difference in the treatment time leading to thermotolerance in the two plant
systems is remarkable. A. thaliana mutants insensitive to ethylene and ABA, as
well as transgenic lines inhibited in SA production, showed increased susceptibil-
ity to heat, confirming the involvement of these growth regulators in plant heat
stress response. However, molecular changes mediated by these hormones that
lead to thermotolerance are presently unknown. Some progress has been made to-
wards understanding the molecular mechanism by which 24-epibrassinolide
(EBR), a brassinosteroid, promotes thermotolerance in plants. Dhaubhadel et al.
(1999) demonstrated that B. napus and tomato seedlings grown in the presence of
EBR are significantly resistant to a heat treatment that is lethal to untreated seed-
lings. Since a mild heat treatment of seedlings prior to their exposure to the usual
lethal heat stress was not required to observe this effect, it is concluded that EBR
treatment increases the basic thermotolerance of seedlings. An examination of hsp
expression before, during, and after heat stress treatment revealed that hsps accu-
mulate to higher levels in EBR-treated than in untreated seedlings following heat
stress, but not at the control temperature. Surprisingly though, the higher hsp lev-
els in treated seedlings did not correlate with higher hsp mRNA levels during the
recovery period. Further investigation into the mechanism leading to higher accu-
mulation of hsps in EBR-treated seedlings revealed that this is a result of higher
hsp synthesis in these seedlings, even when the mRNA levels are lower than in
untreated seedlings. Consistent with this finding, several translation initiation and
elongation factors were detected at significantly higher levels in treated seedlings
as compared to untreated seedlings (Dhaubhadel et al. 2002). These results sug-
gest that EBR-treatment limits the loss of some of the components of the transla-
tional apparatus during a prolonged heat stress and increases the level of expres-
sion of some of the components of the translational machinery during recovery,
which correlates with higher hsp synthesis during heat stress, a more rapid re-
sumption of cellular protein synthesis following heat stress, and a higher survival
rate. Although higher level of hsps must contribute to increased thermotolerance
in EBR-treated seedlings, factors other than hsps that may directly or indirectly
contribute to EBR-mediated increase in stress tolerance were searched for using
differential display. Four cDNAs characterized thus far that were upregulated in
treated seedlings encode 3-ketoacyl CoA thiolase, myrosinase, glycine rich protein
90 Priti Krishna
HEAT WOUNDING OXIDATIVE

STRESS STRESS STRESS
STRESS HEAT + DEHYDRATION

CONDITIONS STRESSES
HSF
OTHER
STRESSES
HSF
HSE
HSPS
NON-STRESS
CONDITIONS
GROWTH DEVELOPMENT
REGULATORS
Fig. 3. Multiple stress and non-stress conditions that induce synthesis of hsps. Although
heat shock gene expression is shown here to occur through activation of Hsf, this has not
been confirmed for all conditions; other pathways may also induce hsp synthesis.
22 (GRP22), and a hypothetical protein (S. Dhaubhadel and P. Krishna, submitted

manuscript). The thiolase transcript levels were higher in treated seedlings as
compared to untreated seedlings during heat stress, but transcripts of the other
three cDNAs were present at higher levels in treated seedlings prior to any stress.
Higher expression of 3-ketoacyl thiolase, myrosinase, and GRP22 can be linked,
at least hypothetically, to an increase in the general stress resistance of plants (S.
Dhaubhadel and P. Krishna, submitted manuscript). Thus, modified translational
machinery, coupled with increased expression of genes involved in a variety of
physiological responses, and other as yet unidentified factors in treated seedlings,
may contribute to increased overall stress tolerance in these seedlings.
3.6 Relationship between heat and other stresses
Surveys of global gene expression in response to different stresses are beginning

to point to the interaction and overlap between signaling pathways initiated by one
stress and other stimuli (Fig. 3). In a study focused on transcriptional profiling of
genes regulated by wounding it was noted that many pathogen-responsive and
osmotic and heat stress-regulated genes are highly responsive to wounding
(Cheong et al. 2002). The wound activation of hsps followed a time frame consis-
tent with the normal heat shock response. Two Hsf genes were activated within 30
minutes after wounding and this activation was followed by transcription of sev-
eral hsp genes. To determine if other stress conditions also regulate the expression
of hsps, Cheong et al. (2002) searched the A. thaliana gene expression database of
Torrey Mesa Research Institute. Their search revealed that genes encoding Hsf4,
hsp70 and hsp17.6A are activated by several stresses, including osmotic stress,
electric shock, pathogen attack, light, and plant hormones, whereas the gene en-
coding Hsf21 is specifically activated by wounding and pathogen elicitor. These
results suggest that some hsps and Hsfs may be important for a broad spectrum of
stress conditions, whereas others may be involved in specific stress responses. The
overlap of heat stress response with other stress responses is also evident from
analysis of differentially expressed genes during heat stress in cowpea (Vigna un-
guiculata) nodules. In addition to hsps, wound-induced and disease resistance pro-
teins were upregulated (Simões-Araujo et al. 2002). The complexity of signaling
events associated with sensing and acclimating to stresses is further seen when a
combination of environmental conditions are simultaneously applied to plants. A
combination of drought and heat stress on tobacco plants resulted in the suppres-
sion of photosynthesis, enhancement of respiration, induction of several defense
genes, and changes in genes involved in sugar metabolism (Rizhsky et al. 2002).
The expression of some of the genes induced solely under drought or heat stress
was suppressed when the two stresses were combined, while the expression of
others was specifically induced under combined stress conditions. These results
demonstrate that the response of plants to a combination of stresses, similar to
what may be encountered in the field, is different from the response to each of the
stresses applied individually. Some assumptions regarding functions of stress pro-
teins can be made on the basis of unique expression patterns during a combination
of stresses. For instance, the finding that the expression of dehydrin, which is
highly expressed during drought stress, is suppressed during a combination of heat
and drought stress may suggest that hsps can replace the stabilizing function of
dehydrin during this combination of stresses (Rizhsky et al. 2002).
3.7 Developmental regulation of shsps by Hsfs
A subset of shsps in plants are expressed during zygotic embryogenesis in the ab-
sence of any stress (reviewed in Schoffl et al. 1998). Deletion analyses of shsp
promoters indicates that HSEs are also required for developmental regulation in
embryos (Coca et al. 1996; Prandl and Schoffl 1996). This poses the question: if
Hsfs are involved in the developmental regulation of shsps, what mechanism(s) is
used to distinguish promoter activation during development and during heat stress
response? Recently some interesting observations have been made in this direc-
tion. In a transient promoter activation assay performed in sunflower (Helianthus
annuus) embryos, tomato HsfA2, but not HsfA1, could promote transcriptional ac-
tivation of the developmentally regulated Ha hsp 17.6 G1 promoter that is charac-
terized by an unusual low-consensus HSE (Rojas et al. 2002). Mutational analyses
of the Ha hsp 17.6 G1 promoter combined with in vitro DNA binding assays sug-
gest that the low-consensus HSE sequence is crucial for Hsf promoter selectivity,
92 Priti Krishna
but that discrimination occurs after DNA binding and may involve preferential
transcriptional activation. Specific interactions with different transcription factors
could confer functional specificity to plant Hsfs. A preliminary but crucial obser-
vation in this direction is that ABI3, a seed-specific transcription factor from A.
thaliana, and tomato HsfA1 can synergistically activate the Ha hsp 17.7 G4 pro-
moter when it contains intact proximal and distal HSEs (Rojas et al. 1999). In the
absence of either functional Hsf or HSEs, substantial activation of the promoter by
ABI3 does not occur. The activation domain of HsfA1 is necessary for promoter
activation, and a truncated ABI3 is incapable of promoter activation by Hsf. Since
ABI3 and HsfA1 can activate a minimal CaMV 35S promoter fused to Ha hsp
17.7 G4 HSEs, it is proposed that ABI3 functions as a co-activator (indirectly
binding DNA) rather than as a transcriptional activator (directly binding DNA)
through Hsfs. Though ABI3 specificity towards plant Hsfs remains to be ad-
dressed, it is possible that the co-activator function of ABI3 is limited to only
some Hsf(s). Another possibility is that one or more seed-specific Hsf is involved
in the developmental regulation of shsps during embryogenesis. The recent clon-
ing of a class A Hsf in sunflower, HaHsf9, which is specifically expressed during
embryogenesis in the absence of environmental stress (Almoguera et al. 2002),
gives much credibility to this possibility. The HaHsf9 can transactivate promoters
with poor consensus HSEs, including that of the seed-specific Ha hsp 17.6 G1
gene. Mutations that improve the HSE consensus of Ha hsp 17.6 G1 promoter im-
pair activation by HaHsf9 but do not affect heat shock-induced gene expression of
this promoter. Thus, specific HSE sequences, specific expression patterns of Hsfs,
and the interactions of Hsfs with embryo-specific factors are all possible mecha-
nisms of developmental regulation of shsps, and are not mutually exclusive.
3.8 Future directions
From this overview, it is clear that many aspects of heat stress response and sig-
naling in plants remain unexplored. Current observations of Hsfs and protein
kinases activated during the heat stress response appear only as small windows
into gaining an understanding of the complex mechanisms by which heat may be
sensed and the signal transduced to the nucleus for regulation of gene expression.
Limited data suggests that members of the extensive Hsf family in plants likely
differ in their expression patterns, promoter recognition, oligomerization behavior,
and potential as transcription activators, making regulation of the heat shock re-
sponse through Hsfs a highly complex phenomenon. At this point, very little is
known about what phosphorylation events lead to activation and attenuation of the
heat shock response in plants, and virtually nothing is known about the phosphata-
ses that may be involved in dephosphorylating protein kinases as well as Hsfs and
other transcription factors involved in this response. A multitude of signaling cas-
cades must coordinate the response during combination of heat and the other
stresses that are often concurrent in the natural environment. Alongside the identi-
fication of the pathways operating in plant heat stress response, lies the enormous
task of comprehending the cross-talk between different signaling pathways. Ge-

nomic approaches to genome-wide expression analysis have revealed that heat
stress is not limited to the synthesis of hsps. One challenge for the future is to un-
derstand the overlap between different stresses and to elucidate the roles of all
proteins where expression dramatically increases upon heat shock. Finally, the
functions of some hsps, such as hsp90, are just beginning to be addressed. The
identification of plant hsp90 interactors and of the signaling pathways controlled
by them will undoubtedly lead to novel aspects of hsp90, advancing the link be-
tween stress, development and evolution. This knowledge may present new oppor-
tunities for agricultural biotechnology, as well as providing a better understanding
of the mechanisms regulating plant growth and development, and plant responses
to environmental stresses.
Acknowledgements
I thank Professor M. Perry for many helpful suggestions on the manuscript; Dr.
R.S. Dhindsa for sharing unpublished observations; Dr. Z. Zhang for assistance in
preparation of the manuscript. Support from the Natural Sciences and Engineering
Research Council of Canada is gratefully acknowledged. Due to the extensiveness
of the research area and space limitation, I regret not directly citing all contribu-
tions in the field.
References
Abravaya K, Myers MP, Murphy SP, Morimoto RI (1992) The human heat shock protein
hsp70 interacts with HSF, the transcription factor that regulates heat shock gene ex-
pression. Genes Dev 6:1153-1164
Agarwal M, Katiyar-Agarwal S, Sahi C, Gallie DR, Grover A (2001) Arabidopsis thaliana
Hsp100 proteins: kith and kin. Cell Stress Chaperones 6:219-224
Almoguera C, Jordano J (1992) Developmental and environmental concurrent expression of
sunflower dry-seed-stored low-molecular-weight heat-shock protein and Lea mRNAs.
Plant Mol Biol 19:781-792
Almoguera C, Rojas A, Diaz-Martin J, Prieto-Dapena P, Carranco R, Jordano J (2002) A
seed-specific heat-shock transcription factor involved in developmental regulation dur-
ing embryogenesis in sunflower. J Biol Chem 277:43866-43872
Apuya NR, Yadegari R, Fischer RL, Harada JJ, Zimmerma JL, Goldberg RB (2001) The
Arabidopsis embryo mutant schlepperless has a defect in the chaperonin-60α gene.
Bögre L, Ligterink W, Meskiene I, Barker PJ, Heberle-Bors E, Huskisson NS, Hirt H
(1997) Wounding induces the rapid and transient activation of a specific MAP kinase
pathway. Plant Cell 9:75-83
Boston RS, Viitanen PV, Vierling E (1996) Molecular chaperones and protein folding in
plants. Plant Mol Biol 32:191-222
94 Priti Krishna
Braam J (1992) Regulated expression of the calmodulin-related TCH genes in cultured

Arabidopsis cells: induction by calcium and heat shock. Proc Natl Acad Sci USA
89:3213-3216
Buchner J (1999) Hsp90 & Co.- a holding for folding. Trends Biochem Sci 24:136-141
Bukau B, Horwich AL (1998) The Hsp70 and Hsp60 chaperone machines. Cell 92:351-366
Bush DS (1995) Calcium regulation in plant cells and its role in signaling. Annu Rev Plant
Physiol Plant Mol Biol 46:95-122
Campbell JL, Klueva NY, Zheng H, Nieto-Sotelo J, Ho T-HD, Nguyen HT (2001) Cloning
of new members of heat shock protein Hsp101 gene family in wheat (Triticum aesti-
vum (L.) Moench) inducible by heat, dehydration and ABA. Biochim Biophys Acta
1517:270-277
Chandler PM, Robertson M (1994) Gene expression regulated by abscisic acid and its rela-
tion to stress tolerance. Annu Rev Plant Physiol Plant Mol Biol 45:113-141
Cheong YH, Chang H-S, Gupta R, Wang X, Zhu T, Luan S (2002) Transcriptional profil-
ing reveals novel interactions between wounding, pathogen, abiotic stress, and hormo-
nal responses in Arabidopsis. Plant Physiol 129:661-677
Chu B, Soncin F, Price BD, Stevenson MA, Calderwood SK (1996) Sequential phosphory-
lation by mitogen-activated protein kinase and glycogen synthase kinase 3 represses
transcriptional activation by heat shock factor 1. J Biol Chem 271:30847-30857
Chu B, Zhong R, Soncin F, Stevenson MA, Calderwood SK (1998) Transcriptional activity
of heat shock factor 1 at 37°C is repressed through phosphorylation on two distinct ser-
ine residues by glycogen synthase kinase 3α and protein kinases Cα and Cζ. J Biol
Chem 273:18640-18646
Coca MA, Almoguera C, Thomas TL, Jordano J (1996) Differential regulation of small
heat-shock genes in plants: analysis of a water-stress-inducible and developmentally
activated sunflower promoter. Plant Mol Biol 31:863-876
Cotto JJ, Kline M, Morimoto RI (1996) Activation of heat shock factor 1 DNA binding
precedes stress-induced serine phosphorylation. J Biol Chem 271:3355-3358
Craig EA, Gross CA (1991) Is hsp70 the cellular thermometer? Trends Biochem Sci
16:135-140
Czarnecka-Verner E, Yuan C-X, Scharf K-D, Englich G, Gurley WB (2000) Plants contain
a novel multi-member class of heat shock factors without transcriptional activator po-
tential. Plant Mol Biol 43:459-471
Dai R, Frejtag W, He B, Zhang Y, Mivechi NF (2000) JNK targeting and phosphorylation
of heat shock factor-1 suppress its transcriptional activity. J Biol Chem 275:18210-
18218
Dhaubhadel S, Chaudhary S, Dobinson KF, Krishna P (1999) Treatment with 24-
epibrassinolide, a brassinosteroid, increases the basic thermotolerance of Brassica
napus and tomato seedlings. Plant Mol Biol 40:333-342
Dhaubhadel S, Browning KS, Gallie DR, Krishna P (2002) Brassinosteroid functions to
protect the translational machinery and heat shock protein synthesis following thermal
stress. Plant J 29:681-691
Doring P, Treuter E, Kistner C, Lyck R, Chen A, Nover L (2000) The role of AHA motifs
in the activator function of tomato heat stress transcription factors HsfA1 and HsfA2.
Duina AA, Kalton HM, Gaber RF (1998) Requirement for Hsp90 and a CyP-40-type
cyclophilin in negative regulation of the heat shock response. J Biol Chem 273:18974-
18978
Forreiter C, Kirschner M, Nover L (1997) Stable transformation of an Arabidopsis cell sus-

pension culture with firefly luciferase providing a cellular system for analysis of chap-
erone activity in vivo. Plant Cell 9:2171-2181
Freeman BC, Yamamoto KR (2002) Disassembly of transcriptional regulatory complexes
by molecular chaperones. Science 296:2232-2235
Fritsch M, Wu C (1999) Phosphorylation of Drosophila heat shock transcription factor. Cell
Stress Chaperones 4:102-117
Frydman J, Hohfeld J (1997) Chaperones get in touch: the Hip-Hop connection. Trends
Biochem Sci 22:87-92
Fu S, Meeley R, Scanlon MJ (2002) empty pericarp2 encodes a negative regulator of the
heat shock response and is required for maize embryogenesis. Plant Cell 14:3119-3132
Gong M, Li Y-J, Chen SZ (1998a) Abscisic acid induced thermotolerance in maize seed-
lings is mediated by Ca2+ and associated with antioxidant systems. J Plant Physiol
153:488-496
Gong M, van der Luit AH, Knight MR, Trewavas AJ (1998b) Heat-shock-induced changes
in intracellular Ca2+ level in tobacco seedlings in relation to thermotolerance. Plant
Physiol 116:429-437
Guo Y, Guettouche T, Fenna M, Boellmann F, Pratt WB, Toft DO, Smith DF, Voellmy R
(2001) Evidence for a mechanism of repression of heat shock factor 1 transcriptional
activity by a multichaperone complex. J Biol Chem 276:45791-45799
Haley A, Russell AJ, Wood N, Allan AC, Knight MR, Campbell AK, Trewavas AJ (1995)
Effects of mechanical signaling on plant cell cytosolic calcium. Proc Natl Acad Sci
USA 92:4124-4128
Harndahl U, Hall RB, Osteryoung KW, Vierling E, Bornman JF, Sundby C (1999) The
chloroplast small heat shock protein undergoes oxidation-dependent conformational
changes and may protect plants from oxidative stress. Cell Stress Chaperones 4:129-
138
Hartl FU, Hayer-Hartl M (2002) Molecular chaperones in the cytosol: from nascent chain
to folded protein. Science 295:1852-1858
He B, Meng YH, Mivechi NF (1998) Glycogen synthase kinase 3β and extracellular signal-
regulated kinase inactivate heat shock transcription factor 1 by facilitating the disap-
pearance of transcriptionally active granules after heat shock. Mol Cell Biol 18:6624-
6633
Heerklotz D, Doring P, Bonzelius F, Winkelhaus S, Nover L (2001) The balance of nuclear
import and export determines the intracellular distribution and function of tomato heat
stress transcription factor HsfA2. Mol Cell Biol 21:1759-1768
Hendrick JP, Hartl FU (1993) Molecular chaperone functions of heat-shock proteins. Annu
Rev Biochem 62:349-384
Hill JE, Hemmingsen SM (2001) Arabidopsis thaliana type I and II chaperonins. Cell
Hohfeld J, Jentsch SL (1997) GrpE-like regulation of the Hsc70 chaperone by the anti-
apoptotic protein BAG-1. EMBO J 16:6209-6216
Holmberg CI, Hietakangas V, Mikhailov A, Rantanen JO, Kallio M et al. (2001) Phos-
phorylation of serine 230 promotes inducible transcriptional activity of heat shock fac-
tor 1. EMBO J 20:3800-3810
Hong SW, Vierling E (2000) Mutants of Arabidopsis thaliana defective in the acquisition
of tolerance to high temperature stress. Proc Natl Acad Sci USA 97:4392-4397
96 Priti Krishna
Hong SW, Vierling E (2001) Hsp101 is necessary for heat tolerance but dispensable for de-
velopment and germination in the absence of stress. Plant J 27:25-35
Ichimura K, Tena G, Henry Y, Zhang Z, Hirt H, Wislon C, Morris P, Mundy J, Innes R,
Ecker J et al. (2002) Mitogen-activated protein kinase cascades in plants: a new no-
menclature. Trends Plant Sci 7:301-308
Jakob U, Lilie H, Meyer I, Buchner J (1995) Transient interaction of Hsp90 with early un-
folding intermediates of citrate synthase. J Biol Chem 270:7288-7294
Jakobsen BK, Pelham HR (1988) Constitutive binding of yeast heat shock factor to DNA in
vivo. Mol Cell Biol 8:5040-5042
Johnson PR, Ecker JR (1998) The ethylene gas signal transduction pathway: a
molecular perspective. Annu Rev Genet 32:227-254
Jonak C, Hirt H (2002) Glycogen synthase kinase 3/SHAGGY-like kinases in plants: an
emerging family with novel functions. Trends Plant Sci 7:457-461
Jonak C, Kiegerl S. Ligterink W, Barker PJ, Huskisson NS, Hirt H (1996) Stress signaling
in plants: a mitogen-activated protein kinase pathway is activated by cold and drought.
Jonak C, Ökrész L, Bögre L, Hirt H (2002) Complexity, cross talk and integration of plant
MAP kinase signaling. Curr Opin Plant Biol 5:415-424
Kaukinen KH, Tranbarger TJ, Misra S (1996) Post-germination-induced and hormonally
dependent expression of low-molecular-weight heat shock protein genes in Douglas-
fir. Plant Mol Biol 30:1115-1128
Kim B-H, Schoffl F (2002) Interaction between Arabidopsis heat shock transcription factor
1 and 70 kDa heat shock proteins. J Exp Bot 53:371-375
Kim H-J, Song EJ, Lee K-J (2002) Proteomic analysis of protein phosphorylations in heat
shock response and thermotolerance. J Biol Chem 277:23193-23207
Kim J, Nueda A, Meng Y-H, Dynan WS, Mivechi NF (1997) Analysis of the phosphoryla-
tion of human heat shock transcription factor-1 by MAP kinase family members. J Cell
Biochem 67:43-54
Kirschner M, Winkelhaus S, Thierfelder JM, Nover L (2000) Transient expression and
heat-stress-induced co-aggregation of endogenous and heterologous small heat-stress
proteins in tobacco protoplasts. Plant J 24:397-411
Knauf U, Newton EM, Kyriakis J, Kingston RE (1996) Repression of human heat shock
factor 1 activity at control temperature by phosphorylation. Genes Dev 10:2782-2793
Knight H, Trewavas AJ, Knight MR (1996) Cold calcium signaling in Arabidopsis involves
two cellular pools and a change in calcium signature after acclimation. Plant Cell
8:489-503
Krishna P, Gloor G (2001) The Hsp90 family of proteins in Arabidopsis thaliana. Cell
Larkindale J, Knight MR (2002) Protection against heat stress-induced oxidative damage
in Arabidopsis involves calcium, abscisic acid, ethylene, and salicylic
acid. Plant Physiol 128:682-695
Lee GJ, Vierling E (2000) A small heat shock protein cooperates with heat shock protein 70
systems to reactivate a heat-denatured protein. Plant Physiol 122:189-198
Lee GJ, Pokala N, Vierling E (1995a) Structure and in vitro molecular chaperone activity of
cytosolic small heat shock proteins from pea. J Biol Chem 270:10432-10438
Lee GJ, Roseman AM, Saibil HR, Vierling E (1997) A small heat shock protein stably
binds heat-denatured model substrates and can maintain a substrate in a folding-
competent state. EMBO J 16:659-671
Lee JH, Schöffl F (1996) An Hsp70 antisense gene affects the expression of
HSP70/HSC70, the regulation of HSF, and the acquisition of thermotolerance in trans-
genic Arabidopsis thaliana. Mol Gen Genet 252:11-19
Lee JH, Hübel A, Schöffl F (1995b) Derepression of the activity of genetically engineered
heat shock factor causes constitutive synthesis of heat shock proteins and increased
thermotolerance in transgenic Arabidopsis. Plant J 8:603-612
Lee YJ, Nagao RT, Key JL (1994) A soybean 101-kDa heat stress protein complements
yeast HSP104 deletion mutant in acquiring thermotolerance. Plant Cell 6:1889-1897
Lin B-L, Wang J-S, Liu H-C, Chen R-W, Meyer Y, Barakat A, Delseny M (2001) Genomic
analysis of the Hsp70 superfamily in Arabidopsis thaliana. Cell Stress Chaperones
6:201-208
Ling J, Wells DR, Tanguay RL, Dickey LF, Thompson WF, Gallie DR (2000) Heat shock
protein Hsp101 binds to the Fed-1 internal light regulatory element and mediates its
high translational activity. Plant Cell 12:1213-1227
Link V, Sinha AK, Vashista P, Hofmann MG, Proels RK, Ehness R, Roitsch T (2002) A
heat-activated MAP kinase in tomato: a possible regulator of the heat stress response.
FEBS Lett 531:179-183
Löw D, Brändle K, Nover L, Forreiter C (2000) Cytosolic heat-stress proteins Hsp17.7
class I and Hsp17.3 class II of tomato act as molecular chaperones in vivo. Planta
211:575-582
Lynch J, Polito VS, Lauchli A (1989) Salinity stress increases cytoplasmic Ca2+ activity in
maize root protoplasts. Plant Physiol 90:1271-1274
Malik MK, Slovin JP, Hwang CH, Zimmerman JL (1999) Modified expression of a carrot
small heat shock protein gene, Hsp17.7, results in increased or decreased thermotoler-
ance. Plant J 20:89-99
Miernyk JA (1999) Protein folding in the plant cell. Plant Physiol 121:695-703
Miernyk JA (2001) The J-domain proteins of Arabidopsis thaliana: an unexpectedly large
and diverse family of chaperones. Cell Stress Chaperones 6:209-218
Mishra SK, Tripp J, Winkelhaus S, Tschiersch B, Theres K, Nover L, Scharf K-D (2002) In
the complex family of heat stress transcription factors, HsfA1 has a unique role as
master regulator of thermotolerance in tomato. Genes Dev 16:1555-1567
Morimoto RI (1998) Regulation of the heat shock transcriptional response: cross talk be-
tween a family of heat shock factors, molecular chaperones, and negative regulators.
Genes Dev 12:3788-3796
Mosser DD, Kotzbauer PT, Sarge KD, Morimoto RI (1990) In vitro activation of heat
shock transcription factor DNA-binding by calcium and biochemical conditions that
affect protein conformation. Proc Natl Acad Sci USA 87:3748-3752
Mosser DD, Duchaine J, Massie B (1993) The DNA-binding activity of the human heat
shock transcription factor is regulated in vivo by hsp70. Mol Cell Biol 13:5427-5438
Munnik T, Ligterink W, Meskiene I, Calderini O, Beyerly J, Musgrave A, Hirt H (1999)
Distinct osmosensing protein kinase pathways are involved in signaling moderate and
severe hyperosmotic stress. Plant J 20:381-388
Nadeau K, Das A, Walsh CT (1993) Hsp90 chaperonins possess ATPase activity and bind
heat shock transcription factors and peptidyl prolyl isomerases. J Biol Chem 268:1479-
1487
Neckers L (2002) Hsp90 inhibitors as novel cancer chemotherapeutic agents. Trends Mol
Med 8:S55-61
98 Priti Krishna
Nover L, Scharf K-D, Neumann D (1989) Cytoplasmic heat shock granules are formed
from precursor particles and are associated with a specific set of mRNAs. Mol Cell
Biol 9:1298-1308
Nover L, Bharti K, Döring P, Mishra SK, Ganguli A, Scharf K-D (2001) Arabidopsis and
the heat stress transcription factor world: how many heat stress transcription factors do
we need? Cell Stress Chaperones 6:177-189
Nühse T, Peck SC, Hirt H, Boller T (2000) Microbial elicitors induce activation and dual
phosphorylation of the Arabidopsis MAP kinase AtMPK6. J Biol Chem 275:7521-
7526
Owens-Grillo JK, Stancato LF, Hoffmann K, Pratt WB, Krishna P (1996) Binding of im-
munophilins to the 90 kDa heat shock protein (hsp90) via a tetratricopeptide repeat
domain is a conserved protein interaction in plants. Biochemistry 35:15249-15255
Pareek A, Singla SL, Grover A (1995) Immunological evidence for accumulation of two
high-molecular-weight (104 and 90 kDa) HSPs in response to different stresses in rice
and in response to high temperature stress in diverse plant genera. Plant Mol Biol
29:293-301
Parsell DA, Lindquist S. (1993) The functions of heat-shock proteins in stress tolerance:
degradation and reactivation of damaged proteins. Annu Rev Genet 27:437-496
Parsell DA, Kowal AS, Singer MA, Lindquist S (1994) Protein disaggregation mediated by
heat stress protein 104. Nature 372:475-478
Pirkkala L, Nykanen P, Sistonen L (2001) Roles of the heat shock transcription factors in
regulation of the heat shock response and beyond. FASEB J 15:1118-1131
Prändl R, Schöffl F (1996) Heat shock elements are involved in heat shock promoter activa-
tion during tobacco seed maturation. Plant Mol Biol 31:157-162
Prändl R, Hinderhofer K, Eggers-Schumacher G, Schöffl F (1998) HSF3, a new heat shock
factor from Arabidopsis thaliana, derepresses the heat shock response and confers
thermotolerance when overexpressed in transgenic plants. Mol Gen Genet 258:269-
278
Pratt WB, Toft DO (1997) Steroid receptor interactions with heat shock protein and im-
munophilin chaperones. Endocr Rev 18:306-360
Pratt WB, Krishna P, Olsen LJ (2001) Hsp90-binding immunophilins in plants: the protein
movers. Trends Plant Sci 6:54-58
Price AH, Taylor A, Ripley SJ, Griffiths A, Trewavas AJ, Knight MR (1994) Oxidative
signals in tobacco increase cytosolic calcium. Plant Cell 6:1301-1310
Queitsch C, Hong S-W, Vierling E, Lindquist S (2000) Heat shock protein 101 plays a cru-
cial role in thermotolerance in Arabidopsis. Plant Cell 12:479-492
Queitsch C, Sangster TA, Lindquist S (2002) Hsp90 as a capacitor of phenotypic variation.
Nature 417:618-624
Rabindran SK, Wisniewski J, Li L, Li GC, Wu C (1994) Interaction between heat shock
factor and hsp70 is insufficient to suppress induction of DNA-binding activity in vivo.
Mol Cell Biol 14:6552-6560
Reddy RK, Kurek I, Silverstein AM, Chinkers M, Breiman A, Krishna P (1998) High mo-
lecular weight FK506-binding proteins are components of heat shock protein 90 het-
erocomplexes in wheat germ lysate. Plant Physiol 118:1395-1401
Reindl A, Schöffl F (1998) Interaction between the Arabidopsis thaliana heat shock tran-
scription factor HSF1 and the TATA binding protein TBP. FEBS Lett 436:318-322
Reindl A, Schöffl F, Schell J, Koncz C, Bako L (1997) Phosphorylation by a cyclin-

dependent kinase modulates DNA binding of the Arabidopsis heat-shock transcription
factor HSF1 in vitro. Plant Physiol 115:93-100
Richter K, Buchner J (2001) Hsp90: chaperoning signal transduction. J Cell Physiol
188:281-290
Rizhsky L, Liang H, Mittler R (2002) The combined effect of drought stress and heat shock
on gene expression in tobacco. Plant Physiol 130:1143-1151
Robertson AJ, Ishikawa M, Gusta LV, MacKenzie SL (1994) Abscisic acid-induced heat
tolerance in Bromus inermis Leyss cell-suspension cultures. Heat-stable, abscisic acid-
responsive polypeptides in combination with sucrose confer enhanced thermostability.
Rojas A, Almoguera C, Jordano J (1999) Transcriptional activation of a heat shock gene
promoter in sunflower embryos: synergism between ABI3 and heat shock factors.
Plant J 20:601-610
Rojas A, Almoguera C, Carranco R, Scharf K-D, Jordano J (2002) Selective activation of
the developmentally regulated Ha hsp17.6 G1 promoter by heat stress transcription
factors. Plant Physiol 129:1207-1215
Rutherford SL, Lindquist S (1998) Hsp90 as a capacitor for morphological evolution. Na-
ture 396:336-342
Saibil H (2000) Molecular chaperones: containers and surfaces for folding, stabilizing or
unfolding proteins. Curr Opin Struct Biol 10:251-258
Saibil HR, Ranson NA (2002) The chaperonin folding machine. Trends Biochem Sci
27:627-632
Sanchez Y, Lindquist S (1990) HSP104 is required for induced thermotolerance. Science
248:1112-1115
Sangwan V, Dhindsa RS (2002) In vivo and in vitro activation of temperature-responsive
plant map kinases. FEBS Lett 531:561-564
Sangwan V, Orvar BL, Beyerly J, Hirt H, Dhindsa RS (2002) Opposite changes in mem-
brane fluidity mimic cold and heat stress activation of distinct plant MAP kinase path-
ways. Plant J 31:629-638
Satyal SH, Chen D, Fox SG, Kramer JM, Morimoto RI (1998) Negative regulation of the
heat shock transcriptional response by HSBP1. Genes Dev 12:1962-1974
Scharf K-D, Rose S, Zott W, Schoffl F, Nover L (1990) Three tomato genes code for heat
stress transcription factors with a region of remarkable homology to the DNA-binding
domain of the yeast HSF. EMBO J 9:4495-4501
Scharf K-D, Heider H, Höhfeld I, Lyck R, Schmidt E, Nover L (1998) The tomato Hsf sys-
tem: HsfA2 needs interaction with HsfA1 for efficient nuclear import and may be lo-
calized in cytoplasmic heat stress granules. Mol Cell Biol 18:2240-2251
Scharf K-D, Siddique M, Vierling E (2001) The expanding family of Arabidopsis thaliana
small heat stress proteins and a new family of proteins containing α-crystallin domains
(Acd proteins). Cell Stress Chaperones 6:225-237
Schirmer EC, Lindquist S, Vierling E (1994) An Arabidopsis heat stress protein comple-
ments a thermotolerance defect in yeast. Plant Cell 6:1899-1909
Schirmer EC, Glover JR, Singer MA, Lindquist S (1996) HSP100/Clp proteins: a common
mechanism explains diverse functions. Trends Biochem Sci 21:289-295
Schlicher T, Soll J (1996) Molecular chaperones are present in the thylakoid lumen of pea
chloroplasts. FEBS Lett 379:302-304
100 Priti Krishna
Schöffl F, Prändl R, Reindl A (1998) Regulation of the heat-shock response. Plant Physiol
117:1135-1141
Schumacher RJ, Hurst R, Sullivan WP, McMahon NJ, Toft DO, Matts RI (1994) ATP-
dependent chaperoning activity of reticulocyte lysate. J Biol Chem 269:9493-9499
Shi Y, Mosser DD, Morimoto RI (1998) Molecular chaperones as HSF1-specific transcrip-
tional repressors. Genes Dev 12:654-666
Simoes-Araujo JL, Rodrigues RL, de A Gerhardt LB, Mondego JMC, Alves-Ferreira M,
Rumjanek NG, Margis-Pinheiro M (2002) Identification of differentially expressed
genes by cDNA-AFLP technique during heat stress in cowpea nodules. FEBS Lett
515:44-50
Soncin F, Asea A, Zhang X, Stevenson MA, Calderwood SK (2000) Role of calcium acti-
vated kinases and phophatases in heat shock factor-1 activation. Int J Mol Med 6:705-
710
Sorger PK (1991) Heat shock factor and the heat shock response. Cell 65:363-366
Squires C, Squires CL (1992) The Clp proteins: proteolysis regulators or molecular chaper-
ones? J Bacteriol 174:1081-1085
Stancato LF, Hutchison KA, Krishna P, Pratt WB (1996) Animal and plant cell lysates
share a conserved chaperone system that assembles the glucocorticoid receptor into a
functional heterocomplex with hsp90. Biochemistry 35:554-561
Sun W, Bernard C, van de Cotte B, van Montagu M, Verbruggen N (2001) At-HSP17.6A,
encoding a small heat-shock protein in Arabidopsis, can enhance osmotolerance upon
overexpression. Plant J 27:407-415
Sun W, van Montagu M, Verbruggen N (2002) Small heat shock proteins and stress toler-
ance in plants. Biochim Biophys Acta 1577:1-9
Sung DY, Vierling E, Guy CL (2001) Comprehensive expression profile analysis of the
Arabidopsis Hsp70 gene family. Plant Physiol 126:789-800
Takahashi K, Isobe M, Knight MR, Trewavas AJ, Muto S (1997) Hypo-osomotic shock in-
duces increases in cytosolic Ca2+ in tobacco suspension-culture cells. Plant Physiol
113:587-594
Wang KL-C, Li H, Ecker JR (2002) Ethylene biosynthesis and signaling networks. Plant
Cell Supp S131-S151
Waters ER, Lee GJ, Vierling E. (1996) Evolution, structure and function of the small heat
shock proteins in plants. J Exp Bot 47:325-338
Webb MA, Cavaletto JM, Klanrit P, Thompson GA (2001) Orthologs in Arabidopsis
thaliana of the Hsp70 interacting protein Hip. Cell Stress Chaperones 6:247-255
Wehmeyer N, Hernandez LD, Finkelstein RR, Vierling E (1996) Synthesis of small heat
shock proteins is part of the developmental program of late seed maturation. Plant
Physiol 112:747-757
Wells DR, Tanguay RL, Le H, Gallie DR (1998) Hsp101 functions as a specific transla-
tional regulatory protein whose activity is regulated by nutrient status. Genes Dev
12:3236-3251
Wiech H, Buchner J, Zimmermann R, Jakob U (1992) Hsp90 chaperones protein folding in
vitro. Nature 358:169-170
Wilen RW, Sacco M, Gusta LV, Krishna P. (1995) Effects of 24-epibrassinolide on freez-
ing and thermotolerance of bromegrass (Bromus inermis) cell cultures. Physiol Plant
95:195-202
Wu C (1995) Heat shock transcription factors: structure and regulation. Annu Rev Cell Dev
Biol 11:441-469
Yabe N, Takahashi T, Komeda Y (1994) Analysis of tissue-specific expression of Arabi-

dopsis thaliana Hsp90-family gene HSP81. Plant Cell Physiol 35:1207-1219
Young JC, Moarefi I, Hartl FU (2001) Hsp90: a specialized but essential protein-folding
tool. J Cell Biol 154:267-273
Zabaleta E, Assad N, Oropeza A, Salerno G, Herrera-Estrella L (1994a) Expression of one
of the members of the Arabidopsis chaperonin 60β gene family is developmentally
regulated and wound-repressible. Plant Mol Biol 24:195-202
Zabaleta E, Oropeza A, Assad N, Mandel A, Salerno G, Herrera-Estrella L (1994b) An-
tisense expression of chaperonin 60β in transgenic tobacco plants leads to abnormal
phenotypes and altered distribution of photoassimilates. Plant J 6:425-432
Zhang Z, Quick MK, Kanelakis KC, Gijzen M, Krishna P (2003) Characterization of a
plant homolog of Hop, a cochaperone of Hsp90. Plant Physiol 131:525-535
Zhu J-K (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol
53:247-273
4 Sensors of abiotic stress in Synechocystis
Koji Mikami, Iwane Suzuki and Norio Murata
Abstract
Systematic mutagenesis of histidine kinases in combination with DNA microarray

technology has allowed us to identify sensors for cold, hyperosmotic stress, so-
dium chloride, phosphate, and metal ions in Synechocystis sp. PCC 6803. His
kinase 33 (Hik33) senses both cold and hyperosmotic stress and regulates the ex-
pression of different sets of genes when cells are exposed to each respective stress.
Salt stress is perceived by Hik33, Hik34, and Hik16, each of which regulates the
expression of a different set of genes. Hik7 has been identified as a sensor of
phosphate deficiency. Moreover, manganese deficiency and an excess of nickel
ions are sensed by Hik27 (ManS) and Hik30 (NrsS), respectively. The genomes of
six strains of cyanobacteria all include genes for Hik33, Hik34, and Hik7, suggest-
ing that these three histidine kinases might be important for the perception of
stress in many or even all cyanobacteria.
4.1 Introduction
Abiotic stresses, such as an abnormally high or low temperature, high osmolarity,

high salinity and limited or excessive nutrient availability have negative effects on
the growth and development of cells. Cells perceive a particular stress and react to
it by expressing a specific set of stress-inducible genes, which appear to play im-
portant roles in the acclimation of the cells to the various types of stress (Shino-
zaki and Yamaguchi-Shinozaki 2000; Knight and Knight 2001; Sakamoto and
Murata 2002; Xiong et al. 2002).
In photosynthetic organisms, such as cyanobacteria and plants, various two-
component systems contribute to the perception and transduction of environmental
signals (Mizuno et al. 1996; Hwang et al. 2002). A His kinase (Hik) perceives the
stress and a response regulator (Rre) transduces the stress signal. The genome of
Synechocystis sp. PCC 6803 (hereafter, Synechocystis) appears to include 44 genes
for Hiks and 42 genes for Rres (Kaneko et al. 1996; Mount and Chang 2002; also
see http://www.kazusa.or.jp/cyanobase/Synechocystis/index.html), whereas that of
Arabidopsis thaliana contains 11 genes for Hiks and 22 genes for Rres (the Arabi-
dopsis Genome Initiative 2000). Moreover, Hiks that perceive ethylene are found
both in A. thaliana (Chang et al. 1993; Hua et al. 1995) and in Synechocystis
(Mount and Chang 2002), suggesting the possibility that the Hiks and Rres in A.
thaliana might have originated from cyanobacteria (Mount and Chang 2002).

104 Koji Mikami, Iwane Suzuki and Norio Murata
However, little is known about the two-component systems in plants and cyano-
bacteria that are involved in the perception and transduction of abiotic stresses,
such as high and low temperatures, high osmolarity, and high salinity.
Gene-targeted mutagenesis and gene transfer have become routine techniques
in studies of Synechocystis because of the capacity of this microorganism for ho-
mologous recombination. Moreover, the genome of Synechocystis is relatively
small (3.7 Mbp) and the proportion of non-coding regions to coding regions in the
genome is also small (12%). Thus, it is rather easy to generate mutant libraries in
which each gene for a Hik or an Rre has been separately inactivated by the inser-
tion of an antibiotic-resistance gene cassette into the coding region of the respec-
tive gene. Such mutant libraries can then be screened for stress sensors or signal
transducers by monitoring the effects of each mutation on gene expression (Suzuki
et al. 2000). In addition, the development of DNA microarray techniques, using
microarrays based on the complete sequence of the genome of Synechocystis, has
provided a new tool for the analysis of genome-wide patterns of transcription. Ap-
plication of this technique to the screening of mutant libraries is rapidly increasing
our understanding of sensors of abiotic stress and signal transducers. This review
describes the characterization of Hiks as sensors of cold, hyperosmotic stress, salt
stress, and levels of phosphate and metal ions in Synechocystis.
4.2 Hik33 as a cold sensor
The cold-inducible genes of Synechocystis include the des genes for fatty acid de-
saurases and these genes have been studied in great detail (Murata and Wada
1995; Los and Murata 1998). In this cyanobacterium, there are four desaturases,
namely, the ∆12, ∆15, ∆9, and ∆6 desaturases, which are encoded, respectively,
by the desA, desB, desC, and desD genes (Murata and Wada 1995; Los and Mu-
rata 1998). The expression of the desD, desA, and desB genes is induced by cold
stress (Los et al. 1997) and a cold sensor, Hik33 (Sll0698) was originally identi-
fied as a positive regulator of the expression of these genes by monitoring the
cold-induced activity of luciferase (LuxAB) that resulted from the cold-induced
expression of a desB promoter-luxAB gene fusion in a library of mutants with in-
activated Hiks (Suzuki et al. 2000). DNA microarray analysis using a mutant of
the hik33 gene indicated that Hik33 regulates, either fully or to a limited extent,
the expression of 28 of 45 cold-inducible genes (Suzuki et al. 2001; Mikami et al.
2002). As shown in Figure 1, Hik33 regulates the expression of genes that are in-
volved in the regulation of gene expression, in the regulation of photosynthesis
and in the maintenance of the structure and function of the cell wall and cell
membranes. Since 17 of the 45 cold-inducible genes are not regulated by Hik33
(Fig. 1), we can assume that Synechocystis must also have at least one other cold
sensor.
The probable contribution of membrane fluidity to the perception of cold stress
was suggested several years ago (Murata and Los 1997; Vigh et al. 1998; Los and
Murata 2000) and, recently, we obtained evidence for such a contribution from
4 Sensors of abiotic stress in Synechocystis 105
Fig. 1. Involvement of Hik33 in the regulation of expression of cold-inducible and hy-

perosmotic stress-inducible genes. Circles include genes whose expression is induced by
cold stress or hyperosmotic stress, as indicated, and the overlapping region of the two cir-
cles encloses genes whose expression is induced by both cold stress and hyperosmotic
stress. Rectangles with the circles include genes whose stress-inducible expression is regu-
lated by Hik33. It is likely that genes shown outside rectangles are regulated by as yet uni-
dentified sensors. Products of genes can be found in the Cyanobase
(http://www.kazusa.or.jp/cyano/).
experiments in which membrane fluidity was manipulated by genetic engineering

of the fatty acid desaturases in Synechocystis. We inactivated both the desA and
the desD gene by targeted mutagenesis, generating desA-/desD- cells that con-
tained only monounsaturated lipid molecules (Tasaka et al. 1996). Fourier trans-
form infrared (FTIR) spectrometory demonstrated that the replacement of polyun-
saturated membrane lipids by monounsaturated membrane lipids, as a result of the
desA-/desD- mutation, rigidified the membrane lipids (Szalontai et al. 2000). Sub-
sequent DNA microarray analysis demonstrated that, in desA-/desD- mutant cells,
a larger number of genes were induced by cold than in wild-type cells (Inaba et al.
2003). These observations suggested that the rigidification of membrane lipids
might enhance the cold inducibility of gene expression. Indeed, the cold inducibil-
ity of some genes, such as the hliA, hliB and sigD genes, was inhibited in a triple
mutant, namely, the desA-/desD-/hik33- (Inaba et al. 2003). Thus, it seems likely
that Hik33 senses the rigidification of membrane lipids to regulate the expression
of cold-inducible genes, as postulated previously (Los and Murata 2000; Saka-
moto and Murata 2002). Taken together, our observations indicate that a change in
membrane fluidity is a primary signal when cells are exposed to cold stress and
that this change is perceived by cold sensors.
4.3 Hik33 as a sensor of hyperosmotic stress
Screening of a Synechocystis library with mutations in Hiks allowed us to identify

Hik33 as an osmosensor (Mikami et al. 2002). Hik33 acts positively to regulate,
either fully or partially, the expression of 210 of 257 osmostress-inducible genes,
whose products are involved in the structural maintenance of the cell wall and cell
membranes, in photosynthesis, in gene expression, in phosphate-transport system
and in the folding and turnover of proteins (Fig. 1; Mikami et al. 2002). Despite
the major contribution of Hik33 to the regulation of osmostress-inducible genes,
Hik33 does not regulate all the osmostress-inducible genes in Synechocystis (Fig.
1) so it is very likely that this cyanobacterium has additional osmosensors (Mi-
kami et al. 2002).
An increase in the anisotropy of fluorescence polarization with 1,6-diphenyl-
1,3,5-hexatriene was observed when Escherichia coli and Saccharomyces cere-
visiae were exposed to hyperosmotic stress (Yamazaki et al. 1989; Laroche et al.
2001), suggesting a decrease in membrane fluidity as a result of hyperosmotic
stress. The activity of two sensors of hyperosmotic stress in E. coli, KdpD and
EnvZ (Mizuno et al. 1982; Voelkner et al 1993), is affected by the changes in the
physical state of membrane lipids that occur upon exposure of cells to procaine, a
membrane fluidizer (Sugiura et al. 1994; Lu et al. 1996; Rampersaud and Inouye
1991). Moreover, membrane-bound Hiks, such as Sln1, DocA, and MokA, have
been identified as osmosensors in S. cerevisiae, Dictyostelium discoidium, and
Myxococcus xanthus, respectively (Maeda et al. 1994, 1995; Schuster et al. 1996;
Kimura et al. 2001). A membrane-bound Hik, AtHK1, was identified as a candi-
date for an osmosensor in A. thaliana (Urao et al. 1999). These findings suggest
that the sensor of hyperosmotic stress, specifically Hik33, might recognize
changes in membrane fluidity as the primary signal that occurs when cells are ex-
posed to hyperosmotic stress. However, experimental evidence is required to
prove this possibility.
4.4 Perception of multiple stresses by Hik33
Results from DNA microarray analysis indicate that cold stress and hyperosmotic
stress might induce different sets of genes but a small group of genes is induced
by both kinds of stress (Fig. 1). There are three distinct sets of genes whose cold-
inducible or hyperosmotic stress-inducible expression is regulated by Hik33 (Fig.
1). These observations suggest that Hik33 might sense cold stress and hyperosmo-
tic stress in different ways and might regulate the expression of distinct genes in a
stress-specific manner (Mikami et al. 2002).
A putative homolog of Hik33 was recently identified in Synechococcus elega-
tus PCC 7942 as a sensor of strong light and nutrient stress (NblS; van Waasber-
gen et al. 2002). Moreover, Hik33 was originally identified as DspA, a chemical
sensor of certain drugs, such as inhibitors of photosynthesis (Bartsevich and
Shestakov 1995). These results suggest that Hik33 might be a “multi-stress” sen-
Fig. 2. A hypothetical model for the activation of Hik33 under stress conditions. Under
normal conditions, Hik33 is inactive and exists as monomers. Cold stress and hyperosmotic
stress induce the dimerization of Hik33 via intramolecular structural changes in the HAMP
region, with the resultant activation of Hik33. TM, Transmembrane region; HAMP, the
HAMP region; LZ, leucine zipper domain; PAS, the PAS domain; HK, histidine kinase
domain.
sor, recognizing strong light, nutrient stress, and certain chemicals in addition to
cold and hyperosmotic stress. However, it remains to be determined whether
Hik33 regulates the expression of different sets of genes in a stress-specific man-
ner in each case.
The structure of Hik33 can be divided into an amino-terminal signal-input do-
main and a carboxy-terminal kinase domain. Between these two domains, there
are a HAMP region (Aravind and Ponting 1999; also known as a type-P linker;
Williams and Stewart 1999), a leucine zipper domain, and a PAS domain (Fig. 2).
The HAMP region, which is located immediately downstream of the second
transmembrane region, consists of two helical subregions in tandem. It has been
proposed that, in E. coli and Salmonella enterica (Park and Inouye 1997; Butler
and Falke 1998; Appleman and Stewart 2003), the HAMP region transduces ex-
tracellular signals via intramolecular structural changes. Such changes might in-
volve intermolecular dimerization via interactions between the two helical regions
(Aravind and Ponting 1999; Williams and Stewart 1999). Thus, it is possible that a
conformational change in the HAMP region, induced by cold or osmotic stress,
might generate a dimeric form of Hik33, with resultant activation of the kinase
domain (Fig. 2). However, both (i) the way in which Hik33 perceives different
kinds of stress and responds by dimerization and (ii) the way in which Hik33
transmits the stress signal to the appropriate signal-transduction pathway for in-
duction of expression of the appropriate set of genes remain to be determined.
4.5 Hik16, Hik33, and Hik34 as salt sensors
There is some confusion about the terms “salt stress” and “hyperosmotic stress”,
and salt-inducible genes have sometimes been reported to as osmostress-inducible
genes in the literature. We have found that responses to salt stress and to os-
mostress are clearly different when whole-genome patterns of transcription and
changes in cell volume are compared in Synechocystis under these types of stress
(Kanesaki et al. 2002). Salt stress due to 0.5 M NaCl and hyperosmotic stress due
to 0.5 M sorbitol induced the expression of a total of 156 and 257 genes, respec-
tively (Kanesaki et al. 2002; Mikami et al. 2002). The genes whose expression is
regulated by salt stress, by hyperosmotic stress, and by both kinds of stress com-
prise distinct and separate groups. It is likely that Na+ and Cl- ions penetrate the
plasma membranes through K+ (Na+) channels and Cl- channels to produce strong
ionic effects, although salt stress also produces slight and transient hyperosmotic
effects (Kanesaki et al. 2002). However, Synechocystis senses these two types of
effect in different ways.
Hik16 (Slr1805), Hik33, and Hik34 (Slr1285) were identified as putative salt
sensors and Hik41 (Sll1229) was identified as a putative signal transducer by
screening of a library of cells with mutations in Hiks with DNA microarrays
(Marin et al. 2003). These three salt sensors act separately to regulate the expres-
sion of different sets of genes. We were surprised to find that a mutation in either
Hik16 or Hik41 eliminated the inducibility by salt of three genes, namely, slr0967,
sll0938, and sll0939, which encode proteins of unknown function. Since Hik41
contains a receiver domain in its amino-terminal region, it is very likely that these
two kinases constitute a signal-transduction pathway in which Hik16 is the sensor
and Hik41 is the transducer of salt stress (Marin et al. 2003).
Genes whose expression is regulated by Hik33, Hik34, Hik16, or Hik41 actu-
ally correspond to only about one-fifth of all salt-inducible genes (Marin et al.
2003). The remaining salt-inducible genes are regulated by as yet unidentified salt
sensors. Since such sensors were not identified during screening of our library of
hik mutants (Marin et al. 2003), it is possible that these unidentified salt sensors
differ from Hiks in Synechocystis.
4.6 Hik7 and Rre29 as the sensor and signal transducer of

a phosphate deficit
Phosphate is very important in various cellular processes and, in particular, in the

synthesis of nucleic acids and membrane lipids. Since phosphate forms insoluble
salts with calcium, iron, and aluminium, the supply of free phosphate from the
natural environment is very limited. Thus, cells have developed mechanisms for
the incorporation of free phosphate from the environment into the cytoplasm for
maintenance of an appropriate concentration of phosphate. Under phosphate-
limiting conditions, alkaline phosphatase is synthesized and released outside cells
to generate free phosphate in the cell’s surroundings. In bacteria, this process in-
volves the induction of genes that encode alkaline phosphatase and subunits of a
phosphate-specific transporter (Pst) system (Torriani-Gorini et al. 1994). In
Synechocystis, expression of the gene for alkaline phosphatase (Sll0654) and of
two different operons that encode subunits of the Pst system, namely, a phosphate-
binding protein, PstS, PstC, PstA, and PstB (Sll0679-Sll0683 and Slr1247-
Slr1250), is induced under phosphate-limiting conditions (Hirani et al. 2001).
A search for homologies between Hiks of Synechocystis and two known phos-
phate sensors, SphS and PhoR, in Synechococcus sp. PCC 7942 and Synechococ-
cus sp. WH7803, respectively (Aiba et al. 1993; Watson et al. 1996), identified
Hik7 (Sll0337) as a candidate for a phosphate sensor in Synechocystis. A similar
procedure identified Rre29 (Slr0081) as a candidate for a response regulator in-
volved in phosphate signalling. In this case, a search was made for a protein simi-
lar to the response regulator SphR, which acts in concert with the phosphate sen-
sor SphS in Synechococcus (Aiba et al. 1993).
In Synechocystis, mutants in which the hik7 gene and/or the rre29 gene had
been inactivated by gene-targeted mutagenesis were defective in the production of
alkaline phosphatase and in the uptake of phosphate under phosphate-limiting
conditions, demonstrating that Hik7 is a positive regulator of genes whose expres-
sion is induced under phosphate-limited conditions (Hirani et al. 2001). Since
SphR is a DNA-binding transcription factor (Aiba et al.1994; Nagaya et al. 1994),
it is possible that Rre29 might also be a transcription factor that can bind to the
promoter regions of genes that are induced by phosphate deficiency. DNA mi-
croarray analysis of the phosphate deficiency-induced expression of genes in cells
with mutations in Hik7 and/or Rre29 should prove most informative.
4.7 Sensors of metal ions
Despite their toxicity at high levels, metal ions such as Ni2+, Co2+, Zn2+, and Mn2+
are essential for the regulation of the activity of numerous enzymes. For instance,
Ni2+ ions act as cofactors in reaction catalyzed by glyoxalase I, by peptide defor-
mylases, by methyl-coenzyme M reductase, by urease, by superoxide dismutases
and by hydrogenases (Ermler et al. 1998), whereas Mn2+ ions are required for
formation of the catalytic centre of the oxygen-evolving machinery in the photo-
system II complex (Yocum and Pecoraro 1999) and act as cofactors in reaction
catalyzed by enzymes such as Mn superoxide dismutase and Mn catalase
(Borgstahl et al. 2000; Barynin et al. 2001). Cells maintain appropriate internal
concentrations of these metal ions by sensing extracellular or intracellular concen-
trations and by regulating the transport of these ions into or out of the cytoplasm.
Recent data suggest the involvement of two-component systems in the regulation
of expression of genes for the transporters of metal ions that control intracellular
levels of metal ions in Synechocystis.
4.7.1 Hik27 and Rre16 as the sensor and signal transducer of

manganese deficiency
When Synechocystis is grown at low concentration of Mn2+ ions, the expression of

the mntCAB operon (sll1598-1600), which contains the genes for the manganese
transporter (MntABC), is induced. The MntABC system takes up Mn2+ ions from
the cell’s environment and maintains an appropriate concentration of Mn2+ ions in
the cytoplasm (Bartsevich and Pakrasi 1995, 1996).
Yamaguchi et al. (2002) screened a knockout library of Hiks using the DNA
microarrays and found a mutant of Hik27 (Slr0640) in which the expression of the
mntCAB operon was specifically enhanced under normal culture conditions. A re-
sponse regulator, Rre16 (Slr1873), was also identified by screening of a library of
rre mutants for cells in which the mntCAB operon was constitutively expressed
(Yamaguchi et al. 2002). The level of expression of the mntCAB operon in cells
with mutation in the hik27 gene or in the rre16 gene was unaffected by the ab-
sence of Mn2+ ions from the growth medium. Moreover, purified Rre16 bound
specifically to the promoter region of the mntCAB operon. These findings indi-
cated that the expression of the mntCAB operon was specifically induced by man-
ganese deficiency and that reversal of the deficiency required only Hik27 and
Rre16. Thus, Hik27 and Rre16 were identified as the sensor and signal transducer
of manganese deficiency (Yamaguchi et al. 2002). Hik27 and Rre16 were re-
named ManS (manganase sensor) and ManR (manganese regulator), respectively
(Yamaguchi et al. 2002). ManS and ManR were also identified by monitoring the
activation of the mntCAB promoter under normal culture conditions after random
mutagenesis of the Synechocystis genome (Ogawa et al. 2002).
Intracellular levels of Mn2+ ions increased in cells with mutations in ManS
and/or ManR and these mutations resulted in the inhibition of the growth of cells
in the presence of high levels of Mn2+ ions in the growth medium (Yamaguchi et
al. 2002). Since the repression of the mntCAB operon requires the activity of the
Fig. 3. Hypothetical models for the regulation of expression of genes in the mntCAB and
nrsBACD operons and of the activity of their products. A, Regulation of the mntCAB op-
eron by ManS (Hik27). ManS senses a manganese deficiency. It is active when concentra-
tion of Mn2+ ions in the cell is adequate and it acts negatively to regulate the expression of
the mntCAB operon. When the cell lacks adequate Mn2+ ions, ManS is inactivated and re-
leases the mntCAB operon from the negative regulation by ManR (Rre16). The ManABC
complex transports Mn2+ ions from the periplasm to the cytoplasm. B, Regulation of the
nrsBACD operon by NrsS (Hik30). NrsS senses an excess of Ni2+ ions in the cell. It is ac-
tive and regulates, positively, the expression of the nrsBACD operon via NrsR (Rre33)
when the concentration of Ni2+ ions in the cell is excessive. The NrsABCD complex pumps
Ni2+ ions out of the cytoplasm. PM, Plasma membrane.
ManSR two-component system under normal growth conditions, it is likely that

the ManSR two-component system acts negatively to regulate the expression of
the mntCAB operon in an Mn2+-dependent manner (Fig. 3A). Thus, ManR is a rep-
ressor that loses its activity when ManS is inactivated by a manganese deficit.
However, the way in which ManS (Hik27) senses the concentration of Mn2+ ions
remains to be determined.
4.7.2 Hik30 and Rre33 as the sensor and signal transducer of an

excess of Ni2+ ions
The nickel-resistance operon (nrsBACD; slr0793-slr0796) of Synechocystis con-

tains genes that are required for the export of Ni2+ ions from the cytoplasm (Gar-
cía-Domínguez et al. 2000). However, it is likely that Ni2+ ions themselves are
imported into cells by non-specific transporters of cations. Expression of the
nrsBACD operon is induced by an increase in the concentration of Ni2+ ions in the
growth medium (García-Domínguez et al. 2000).
An operon that contains genes for Rre33 (NrsR; Sll0797) and Hik30 (NrsS;
Sll0798) is located 118 bp upstream of the nrsBACD operon and is transcribed in
the opposite direction. When these two genes are inactivated by gene-targeted
mutagenesis, the Ni2+-dependent inducibility of the nrsBACD operon disappears
and cells become very sensitive to high concentrations of Ni2+ ions (López-Maury
et al. 2002). Moreover, purified NrsR binds to the promoter region of the
nrsBACD operon (López-Maury et al. 2002). Therefore, it appears that the NrsSR
two-component system acts positively to regulate the Ni2+-dependent expression
of the nickel-resistance operon (Fig. 3B).
A periplasmic region of NrsS includes amino acid sequences that are highly
homologous to the Ni2+-binding sites of methyl-coenzyme M reductases from
other bacteria (Ermler et al. 1997), but there is no experimental evidence for the
binding of Ni2+ ions to the periplasmic region of NrsS. Thus, the way in which
NrsS senses the concentration of Ni2+ ions and transduces the excess-Ni2+ signal
remains to be determined.
4.8 Comparative analysis of histidine kinases (Hiks) in

cyanobacteria
The functional significance of Hiks can be addressed by a comparative study of

the Hiks found in various strains of cyanobacteria. To date, the complete se-
quences of the genomes of six strains, including Synechocystis, have been deter-
mined. Synechocystis contains 44 Hiks, but only five to six Hiks appear to be en-
coded in the genomes of three strains of marine cyanobacteria, Prochlorococcus
marinus MED4 (http://bahama.jgi-psf.org/prod/bin/microbes/pmarmed/home.
pmarmed.cgi), Prochlorococcus marinus MIT9313 (http://bahama.jgi-
psf.org/prod/bin/microbes/pmarmit/home.pmarmit.cgi) and Synechococcus sp.
strain WH8102 (http://bahama.jgi-psf.org/prod/bin/microbes/syn/home.syn.cgi).

The genome of the thermophilic cyanobacterium Thermosynechococcus elongates
BP-1 encodes 19 Hiks (Nakamura et al. 2002) and that of the filamentous nitro-
gen-fixing microorganism Anabaena sp. PCC 7120 encodes 129 Hiks (Kaneko et
al. 2001). The number of genes for Hiks appears to be related to the size of ge-
nome. For example, marine cyanobacteria, which are major photosynthetic pro-
karyotes in the world’s oceans (Partensky et al. 1999), have small genomes (ap-
proximately 1.7 - 2.4 Mbp) and the smallest numbers (5 or 6) of Hiks. The
nutritional environment in the ocean may be poor but it is more stable than that on
land or in fresh water. This stability might explain why these organisms have such
small genomes and such small numbers of Hiks.
We found that five Hiks are conserved among the six cyanobacteral strains
whose genomes have been sequenced. They are Hik33, Hik34, Hik7, Hik2,
(Slr1147) and Hik8 (Sll0750). As mentioned above, Hik33 senses clod stress and
hyperosmotic stress (Suzuki et al. 2000; Mikami et al. 2002); Hik34 is a salt sen-
sor (Marin et al. 2003) and Hik7 senses phosphate deficiency (Hirani et al. 2001).
A homolog of Hik33, Ycf26, has also been found to be encoded in the genomes of
the plastids in the red algae Porphyra purpurea and Cyanidium caldarium, but the
functions of these proteins in these plastids remain to be characterized (Glöckner
et al. 2000).
Hik8 is a homolog of SasA, which is associated with a circadian clock-related
protein KaiC in Synechococcus sp. PCC 7942 (Iwasaki et al. 2000; Kageyama et
al. 2003). This observation suggests that Hik8 might be involved in the regulation
of circadian rhythm in Synechocystis. In addition, our DNA microarray indicates
that Hik2 might be the second cold sensor that we mentioned above (our unpub-
lished results). The conservation of Hik8 and Hik2 in all six strains of cyanobacte-
ria examined suggests that these two Hiks might also play essential roles in
cyanobacteria.
4.9 Future perspectives
In Synechocystis, seven Hiks, namely, Hik33, Hik34, Hik16, Hik41, Hik7, Hik27,
and Hik30 have been identified as sensors of abiotic stress and Rre29, Rre16, and
Rre33 have been identified as transducers of the signals perceived by Hik7, Hik27,
and Hik30, respectively, in the respective two-component systems. However, the
functions of 37 Hiks and 39 Rres are unknown. It is difficult to predict the func-
tions of these Hiks and Rres from their structural features and their homology to
proteins in other organisms. Since we have already generated libraries of hik mu-
tants and rre mutants, DNA microarray analysis using these mutants should help
us to determine the functions of at least some of these Hiks and Rres.
Cyanobacteria have large numbers of signalling proteins that resemble eu-
karyotic enzymes, such as receptor serine/threonine (S/T) kinases and S/T phos-
phatases (Zang et al. 1998; Wang et al. 2002). In plants and other eukaryotes, S/T
kinases are often found as components of signal transduction pathways, for exam-
ple, the membrane-bound brassinosteroid receptor BRI1, in A. thaliana (Li and

Chory, 1997), and a phosphorylation cascade that includes Hog1 mitogen-
activated protein kinase in yeast, the activity of which is regulated by the Sln1-
Ypd1-Ssk1 phospho-relay system for osmostress signalling (Maeda et al. 1994,
1995). Since Synechocystis cells contain a total of 13 membrane-bound or soluble
S/T kinases (Zang et al. 1998), it is possible that this microorganism exploits S/T
kinases as sensors or signal transducers. However, little is known about the signal
transduction pathways in which the individual S/T kinases might be involved and
the nature of the genes that are regulated by the transduced signals.
Synechocystis cells contain nine different sigma factors (Goto-Seki et al. 1999;
Imamura et al. 2003) that direct the selection of promoters by RNA polymerases
under various stress conditions (Ishihama 1993). It has been suggested that each
individual sigma factor might be involved in the regulation of the expression of
specific stress-inducible genes. SigE does, indeed, regulate the expression of a
gene for type III glutamine synthetase under nitrogen-starvation conditions (Muro-
Pastor et al. 2001). Moreover, since the expression of the genes for SigD and SigB
is induced by strong light and by heat, respectively (Imamura et al. 2003), it seems
likely that these sigma factors might regulate the expression of strong light-
inducible or heat-inducible genes. However, the stress-inducible genes regulated
by each sigma factor remain to be identified.
Construction of libraries of mutants with mutations in the genes for all S/T
kinases and sigma factors and the analysis, using DNA microarrays, of the stress-
inducible genes whose expression is affected by mutations of the various signal-
transducing components should provide important information. Such analysis will
help us to understand further details of the mechanisms responsible for the percep-
tion and signal transduction of abiotic stresses in Synechocystis in terms of stress-
specific signal-transduction pathways and their associated sensors, transducers and
sigma factors, as well as the cross-talk among the various pathways.
Acknowledgements
This work was supported in part by a Grant-in-Aid for Scientific Research (S) (no.
13854002) and by a Grant-in-Aid for Scientific Research on Priority Areas (2)
(no. 14086207) to N.M.; by a Grant-in-Aid for Scientific Research (C) (no.
14540606) to K.M.; and by a Grant-in-Aid for Scientific Research on Priority Ar-
eas (C) (“Genome Biology”; no. 13206081) and a Grant-in-Aid for Exploratory
Research (no. 14654169) to I.S. All the cited grants were awarded by the Ministry
of Education, Culture, Sports, Science and Technology of Japan.
References
Aiba H, Nagaya M, Mizuno T (1993) Sensor and regulator proteins from the cyanobacte-
rium Synechococcus species PCC7942 that belong to the bacterial signal-transduction
protein families: implication in the adaptive response to phosphate limitation. Mol Mi-
crobiol 8:81-91
Aiba H, Mizuno T (1994) A novel gene whose expression is regulated by the response-
regulator, SphR, in response to phosphate limitation in Synechococcus species
PCC7942. Mol Microbiol 13:25-34
Appleman JA, Stewart V (2003) Mutational analysis of a conserved signal-transducing
element: the HAMP linker of the Escherichia coli nitrate sensor NarX. J Bacteriol
185:89-97
Aravind L, Ponting CP (1999) The cytoplasmic helical linker domain of receptor histidine
kinase and methyl-accepting proteins is common to many prokaryotic signalling pro-
teins. FEMS Microbiol Lett 176:111-116
Bartsevich VV, Pakrasi HB (1995) Molecular identification of an ABC transporter complex
for manganese: analysis of a cyanobacterial mutant strain impaired in the photosyn-
thetic oxygen evolution process. EMBO J 14:1845-1853
Bartsevich VV, Pakrasi HB (1996) Manganese transport in the cyanobacterium Synecho-
cystis sp. PCC 6803. J Biol Chem 271:26057-26061
Bartsevich VV, Shestakov SV (1995) The dspA gene product of the cyanobacterium
Synechocystis sp. strain PCC 6803 influences sensitivity to chemically different
growth inhibitors and has amino acid similarity to histidine protein kinases. Microbiol-
ogy 141:2915-2920
Barynin VV, Whittaker MM, Antonyuk SV, Lamzin VS, Harrison PM, Artymiuk PJ,
Whittaker JW (2001) Crystal structure of manganese catalase from Lactobacillus plan-
tarum. Structure (Cambridge) 9:725-738
Borgstahl GE, Pokross M, Chehab R, Sekher A, Snell EH (2000) Cryo-trapping the six-
coordinate, distorted-octahedral active site of manganese superoxide dismutase. J Mol
Biol 296:951-959
Butler SL, Falke JJ (1998) Cysteine and disulfide scanning reveals two amphiphilic helices
in the linker region of the aspartate chemoreceptor. Biochemistry 37:10746-10756
Chang C, Kwok SF, Bleecker AB, Meyerowitz EM (1993) Arabidopsis ethylene-response
gene ETR1: Similarity of product to two-component regulators. Science 262:539-544
Ermler U, Grabarse W, Shima S, Goubeaud M, Thauer RK (1998) Active sites of transi-
tion-metal enzymes with a focus on nickel. Curr Opin Struct Biol 8:749-758
García-Domínguez M, Lopez-Maury L, Florencio FJ, Reyes JC (2000) A gene cluster in-
volved in metal homeostasis in the cyanobacterium Synechocystis sp. strain PCC 6803.
J Bacteriol 182:1507-1514
Glöckner G, Rosenthal A, Valentin K (2000) The structure and gene repertoire of an an-
cient red algal plastid genome. J Mol Evol 51:382-390
Goto-Seki A, Shirokane M, Masuda S, Tanaka K, Takahashi H (1999) Specificity crosstalk
among group 1 and group 2 sigma factors in the cyanobacterium Synechococcus sp.
PCC7942: in vitro specificity and a phylogenetic analysis. Mol Microbiol 34:473-484
Hirani TA, Suzuki I, Murata N, Hayashi H, Eaton-Rye JJ (2001) Characterization of a two-
component signal transduction system involved in the induction of alkaline phos-
phatase under phosphate-limiting conditions in Synechocystis sp. PCC 6803. Plant Mol
Biol 45:133-144
Hua J, Chang C, Sun Q, Meyerowitz EM (1995) Ethylene insensitivity conferred by Arabi-
dopsis ERS gene. Science 269:1712-1714
Hwang I, Chen HC, Sheen J (2002) Two-component signal transduction pathways in
Arabidopsis. Plant Physiol 129:500-515
Imamura S, Yoshihara S, Nakano S, Shiozaki N, Yamada A, Tanaka K, Takahashi H,

Asayama M, Shirai M (2003) Purification, characterization, and gene expression of all
sigma factors of RNA polymerase in a cyanobacterium. J Mol Biol 325:857-872
Inaba M, Suzuki I, Szalontai B, Kanesaki Y, Los DA, Hayashi H, Murata N (2003) Gene-
engineered rigidification of membrane lipids enhances the cold inducibility of gene
expression in Synechocystis. J Biol Chem 278:12191-12198
Ishihama A (1993) Protein-protein communication within the transcription apparatus. J
Bacteriol 175:2483-2489
Iwasaki H, Williams SB, Kitayama Y, Ishiura M, Golden SS, Kondo T (2000) A KaiC-
interacting sensory histidine kinase, SasA, necessary to sustain robust circadian oscil-
lation in cyanobacteria. Cell 101:223-233
Kageyama H, Kondo T, Iwasaki H (2003) Circadian formation of clock protein complexes
by KaiA, KaiB, KaiC, and SasA in cyanobacteria. J Biol Chem 278:2388-2395
Kanesaki Y, Suzuki I, Allakhverdiev SI, Mikami K, Murata N (2002) Salt stress and hy-
perosmotic stress regulate the expression of different sets of genes in Synechocystis sp.
PCC 6803. Biochem Biophys Res Commun 290:339-348
Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y, Miyajima N, Hirosawa
M, Sugiura M, Sasamoto S, Kimura T, Hosouchi T, Matsuno A, Muraki A, Nakazaki
N, Naruo K, Okumura S, Shimpo S, Takeuchi C, Wada T, Watanabe A, Yamada M,
Yasuda M, Tabata S (1996) Sequence analysis of the genome of the unicellular cyano-
bacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire
genome and assignment of potential protein-coding regions. DNA Res 3:109-136
Kaneko T, Nakamura Y, Wolk CP, Kuritz T, Sasamoto S, Watanabe A, Iriguchi M, Ishi-
kawa A, Kawashima K, Kimura T, Kishida Y, Kohara M, Matsumoto M, Matsuno A,
Muraki A, Nakazaki N, Shimpo S, Sugimoto M, Takazawa M, Yamada M, Yasuda M,
Tabata S (2001) Complete genomic sequence of the filamentous nitrogen-fixing
cyanobacterium Anabaena sp. strain PCC 7120. DNA Res 8:205-213
Kimura Y, Nakano H, Terasaka H, Takegawa K (2001) Myxococcus xanthus mckA encodes
a histidine kinase-response regulator hybrid sensor required for development and os-
motic tolerance. J Bacteriol 183:1140-1146
Knight H, Knight MR (2001) Abiotic stress signalling pathways: specificity and cross-talk.
Laroche C, Beney L, Marechal PA, Gervais P (2001) The effect of osmotic pressure on the
membrane fluidity of Saccharomyces cerevisiae at different physiological tempera-
tures. Appl Microbiol Biotechnol 56:249-254
Li J, Chory J (1997) A putative leucine-rich repeat receptor kinase involved in brassinos-
teroid signal transduction. Cell 90:929-938
Lopez-Maury L, García-Domínguez M, Florencio FJ, Reyes JC (2002) A two-component
signal transduction system involved in nickel sensing in the cyanobacterium Synecho-
cystis sp. PCC 6803. Mol Microbiol 43:247-256
Los DA, Ray MK, Murata N (1997) Differences in the control of the temperature-
dependent expression of four genes for desaturases in Synechocystis sp. PCC 6803.
Mol Microbiol 25:1167-1175
Los DA, Murata N (1998) Structure and expression of fatty acid desaturases. Biochim Bio-
phys Acta 1394:3-15
Los DA, Murata N (2000) Regulation of enzymatic activity and gene expression by mem-
brane fluidity. Science’s STKE http://stke.sciencemag.org/cgi/content/full/oc_sig-
trans;2000/62/pe1
Lu Q, Park H, Egger LA, Inouye M (1996) Nucleoside-diphosphate kinase-mediated signal

transduction via histidyl-aspartyl phosphorelay systems in Escherichia coli. J Biol
Chem 271:32886-32893
Maeda T, Wurgler-Murphy SM, Saito H (1994) A two-component system that regulates an
osmosensing MAP kinase cascade in yeast. Nature 369:242-245
Maeda T, Takekawa M, Saito H (1995) Activation of yeast PBS2 MAPKK by MAPKKKs
or by binding of an SH3-containing osmosensor. Science 269:554-558
Marin K, Suzuki I, Yamaguchi K, Ribbeck K, Yamamoto H, Kanesaki Y, Hagemann M,
Murata N (2003) Identification of histidine kinases that act as sensors in the perception
of salt stress in Synechocystis sp. PCC 6803. Proc Natl Acad Sci USA 100:9061-9066
Mikami K, Kanesaki Y, Suzuki I, Murata N (2002) The histidine kinase Hik33 perceives
osmotic stress and cold stress in Synechocystis sp. PCC 6803. Mol Microbiol 46:905-
915
Mizuno T, Wurtzel ET, Inouye M (1982) Cloning of the regulatory genes (ompR and envZ)
for the matrix proteins of the Escherichia coli outer membrane. J Bacteriol 150:1462-
1466
Mizuno T, Kaneko T, Tabata S (1996) Compilation of all genes encoding bacterial two-
component signal transducers in the genome of the cyanobacterium, Synechocystis sp.
strain PCC 6803. DNA Res 3:407-414
Mount SM, Chang C (2002) Evidence for a plastid origin of plant ethylene receptor genes.
Murata N, Wada H (1995) Acyl-lipid desaturases and their importance in the tolerance and
acclimation to cold of cyanobacteria. Biochem J 308:1-8
Murata N, Los LA (1997) Membrane fluidity and temperature perception. Plant Physiol
115:875-879
Muro-Pastor AM, Herrero A, Flores E (2001) Nitrogen-regulated group 2 sigma factor
from Synechocystis sp. strain PCC 6803 involved in survival under nitrogen stress. J
Bacteriol 183:1090-1095
Nagaya M, Aiba H, Mizuno T (1994) The sphR product, a two-component system response
regulator protein, regulates phosphate assimilation in Synechococcus sp. strain PCC
7942 by binding to two sites upstream from the phoA promoter. J Bacteriol 176:2210-
2215
Nakamura Y, Kaneko T, Sato S, Ikeuchi M, Katoh H, Sasamoto S, Watanabe A, Iriguchi
M, Kawashima K, Kimura T, Kishida Y, Kiyokawa C, Kohara M, Matsumoto M, Ma-
tsuno A, Nakazaki N, Shimpo S, Sugimoto M, Takeuchi C, Yamada M, Tabata S
(2002) Complete genome structure of the thermophilic cyanobacterium Thermo-
synechococcus elongatus BP-1. DNA Res 9:123-130
Ogawa T, Bao DH, Katoh H, Shibata M, Pakrasi HB, Bhattacharyya-Pakrasi M (2002) A
two-component signal transduction pathway regulates manganese homeostasis in
Synechocystis 6803, a photosynthetic organism. J Biol Chem 277:28981-28986
Park H, Inouye M (1997) Mutational analysis of the linker region of EnvZ, an osmosensor
in Escherichia coli. J Bacteriol 179:4382-4390
Partensky F, Hess WR, Vaulot D (1999) Prochlorococcus, a marine photosynthetic pro-
karyote of global significance. Microbiol Mol Biol Rev 63:106-127
Rampersaud A, Inouye M (1991) Procaine, a local anesthetic, signals through the EnvZ re-
ceptor to change the DNA binding affinity of the transcriptional activator protein
OmpR. J Bacteriol. 173:6882-6888
Sakamoto T, Murata N (2002) Regulation of the desaturation of fatty acids and its role in
tolerance to cold and salt stress. Curr Opin Microbiol 5:206-210
Schuster SS, Noegel AA, Oehme F, Gerisch G, Simon MI (1996) The hybrid histidine
kinase DokA is part of the osmotic response system of Dictyostelium. EMBO J
15:3880-3889
Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and low
temperature: differences and cross-talk between two stress signaling pathways. Curr
Sugiura A, Hirokawa K, Nakashima K, Mizuno T (1994) Signal-sensing mechanisms of the
putative osmosensor KdpD in Escherichia coli. Mol Microbiol 14:929-938
Suzuki I, Los DA, Kanesaki Y, Mikami K, Murata N (2000) The pathway for perception
and transduction of low-temperature signals in Synechocystis. EMBO J 19:1327-1334
Suzuki I, Kanesaki Y, Mikami K, Kanehisa M, Murata N (2001) Cold-regulated genes un-
der control of the cold sensor Hik33 in Synechocystis. Mol Microbiol 40:235-244
Szalontai B, Nishiyama Y, Gombos Z, Murata N (2000) Membrane dynamics as seen by
Fourier transform infrared spectroscopy in a cyanobacterium, Synechocystis PCC
6803. The effects of lipid unsaturation and the protein-to-lipid ratio. Biochim Biophys
Acta 1509:409-419
Tasaka Y, Gombos Z, Nishiyama Y, Mohanty P, Ohba T, Ohki K, Murata N (1996) Tar-
geted mutagenesis of acyl-lipid desaturases in Synechocystis: evidence for the impor-
tant roles of polyunsaturated membrane lipids in growth, respiration and photosynthe-
sis. EMBO J 15:6416-6425
The Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flower-
ing plant Arabidopsis thaliana. Nature 408:796-815
Torriani-Gorini A, Yagil E, Silver S (1994) Phosphate in microorganisms: cellular and mo-
lecular biology. ASM Press, Washington DC
van Waasbergen LG, Dolganov N, Grossman AR (2002) nblS, a gene involved in control-
ling photosynthesis-related gene expression during high light and nutrient stress in
Synechococcus elongatus PCC 7942. J Bacteriol 184:2481-2490
Vigh L, Maresca B, Harwood JL (1998) Does the membrane’s physical state control the
expression of heat shock and other genes? Trends Biochem Sci 23:369-374
Voelkner P, Puppe W, Altendorf K (1993) Characterization of the KdpD protein, the sensor
kinase of the K+-translocating Kdp system of Escherichia coli. Eur J Biochem
217:1019-1026
Wang L, Sun YP, Chen WL, Li JH, Zhang CC (2002) Genomic analysis of protein kinases,
protein phosphatases and two-component regulatory systems of the cyanobacterium
Anabaena sp. strain PCC 7120. FEMS Microbiol Lett 217:155-165
Watson GM, Scanlan DJ, Mann NH (1996) Characterization of the genes encoding a phos-
phate-regulated two-component sensory system in the marine cyanobacterium
Synechococcus sp. WH7803. FEMS Microbiol Lett 142:105-109
Williams SB, Stewart V (1999) Functional similarities among two-component sensors and
methyl-accepting chemotaxis proteins suggest a role for linker region amphipathic
helices in transmembrane signal transduction. Mol Microbiol 33:1093-1102
Xiong L, Schumaker KS, Zhu JK (2002) Cell signaling during cold, drought, and salt
stress. Plant Cell 14 Suppl: S165-S183
Yamaguchi K, Suzuki I, Yamamoto H, Lyukevich A, Bodrova I, Los DA, Piven I,

Zinchenko V, Kanehisa M, Murata N (2002) A two-component Mn2+-sensing system
negatively regulates expression of the mntCAB operon in Synechocystis. Plant Cell
14:2901-2913
Yamazaki M, Ohnishi S, Ito T (1989) Osmoelastic coupling in biological structures: de-
crease in membrane fluidity and osmophobic association of phospholipid vesicles in
response to osmotic stress. Biochemistry 28:3710-3715
Yocum CF, Pecoraro VL (1999) Recent advances in the understanding of the biological
chemistry of manganese. Curr Opin Chem Biol 3:182-187
Zhang CC, Gonzalez L, Phalip V (1998) Survey, analysis and genetic organization of genes
encoding eukaryotic-like signaling proteins on a cyanobacterial genome. Nucleic Ac-
ids Res 26:3619-3625
5 Oxidative stress signalling
Radhika Desikan, John T. Hancock and Steven J. Neill
Abstract
Oxidative stress arises from an imbalance in the generation and removal of reac-
tive oxygen species (ROS) within cells. ROS are produced during photosynthesis
and respiration, as by-products of metabolism, or via dedicated enzymes. Cells are
equipped with a range of efficient antioxidant mechanisms to remove ROS.
Changes in the cellular redox balance result from exposure to various abiotic and
biotic stresses, with induction of both ROS generation and removal mechanisms.
Recent transcriptomic analyses indicate that the expression of many genes is regu-
lated by ROS. These include genes encoding antioxidants, cell rescue/defence pro-
teins, and signalling proteins. Genetic studies have begun to elucidate the biologi-
cal roles of ROS. These include programmed cell death, stomatal closure, and
gravitropism. Further work will no doubt reveal new functions for ROS as signal-
ling molecules.
5.1 Introduction
For plants, as for all aerobic organisms, oxygen is a double-edged sword. It is ab-
solutely required for normal growth and development, yet continuous exposure to
oxygen can result in cellular damage and ultimately death. This is because mo-
lecular oxygen is continually reduced within cells to several forms of Reactive
Oxygen Species (ROS; sometimes referred to as Active Oxygen Species, AOS), in
particular the superoxide free radical anion (O2.-) and hydrogen peroxide (H2O2),
that react with various cellular components to bring about acute or chronic damage
sufficient to result in cellular death (Finkel and Holbrook 2000; Scandalios
2002a). In plant cells, ROS are generated in high amounts by both constitutive and
inducible routes, but under normal situations, the redox balance of the cell is
maintained via the constitutive action of a wide range of antioxidant mechanisms
that have evolved to remove ROS. Various environmental stresses and endoge-
nous stimuli perturb this redox balance via increased ROS production or reduced
antioxidant activity, such that oxidative stress ensues (Fig. 1). In response to in-
creased ROS, the expression of genes encoding antioxidant proteins is induced, as
well as that of genes encoding proteins involved in a wider range of cellular rescue
processes. In addition, it is increasingly clear that ROS also have signalling func-
tions outside of oxidative stress (Fig. 1). Here, we outline the mechanisms that
regulate redox balance in plant cells, describe and discuss cellular responses to

122 Radhika Desikan, John T. Hancock and Steven J. Neill
Fig. 1. Redox balance within a cell is determined by the relative rates of generation and re-
moval of ROS. If generation exceeds removal (increased generation and/or decreased re-
moval) then oxidative stress may result. ROS are perceived in cells via as yet-
uncharacterised mechanisms. ROS perception and signalling induce the transcription of an-
tioxidant genes, the products of which may restore redox balance and ameliorate the dam-
aging effects of ROS. In addition, ROS also induce the expression of genes not obviously
involved with oxidative stress but that may be induced by other stresses, as well as mediat-
ing other physiological and developmental processes. NE1, NE2: non-enzymatic sources of
ROS; E1, E2: enzymes generating ROS as side-products. RE1, RE2: dedicated ROS-
generating enzymes; A1, A2: non-enzymatic and enzymatic antioxidants.
ROS and the potential signalling mechanisms involved, and highlight some of the
developmental and physiological processes in which ROS may participate.
5.2 Reactive oxygen species (ROS)
Oxygen is normally reduced by four electrons to produce water, a reaction cata-

lysed by complex IV (cytochrome oxidase) of the mitochondrial electron transport
chain. However, molecular oxygen is also converted to ROS by a single electron
reduction to the superoxide anion (equation 1).
(1) O2 + e - Î O2 z-
(2) O2 z- + O2 z- + 2H+ Î H2O2
(3) O2z- + H+ Î HO2z
5 Oxidative stress signalling 123
(4) H2O2 + O2 z- Î O2 + OH- + OHz

(5) O2 z-+ NOz Î OONO-
As the extra electron is in an unpaired state in the outer orbital, superoxide is a
free radical. It is relatively unstable, being either converted back to molecular
oxygen, or to H2O2, either spontaneously, or in a reaction catalysed by the enzyme
superoxide dismutase (SOD) (equation 2). H2O2 is a non-charged molecule, can
diffuse through both aqueous and lipid environments and has a longer half-life
than superoxide, and is thus a more likely signalling molecule than superoxide. As
superoxide is a charged molecule, it is unlikely to permeate membranes. However,
it can be protonated to form the non-charged perhydroxyl radical (equation 3).
Superoxide and hydrogen peroxide can together react to generate the hydroxyl
radical, in the Haber-Weiss or Fenton reaction, catalysed by transition metal ions
such as iron or copper (equation 4). The hydroxyl radical is highly reactive and
thus less likely to act as a signalling molecule. Another relevant reaction is that
between superoxide and nitric oxide, to produce peroxynitrite (equation 5). Per-
oxynitrite is very reactive, and undoubtedly causes cellular damage. It may have a
direct signalling role, and an indirect one by virtue of removing nitric oxide (see
section 5.5.1).
ROS and peroxynitrite react to varying degrees with biomolecules causing oxi-
dative damage, with the hydroxyl radical being particularly harmful. Oxidation
targets include proteins, DNA, and lipids. In addition, ROS, in particular H2O2,
have come to function as signalling molecules, with regulated synthesis, specific
effects and a range of removal mechanisms. The evolution of photosynthesis and
aerobic metabolism inevitably led to the development of ROS-generating proc-
esses in chloroplasts, mitochondria, and peroxisomes. It seems likely that antioxi-
dant mechanisms evolved to counter-act the damaging effects of these ROS
(Scandalios, 2002a). As environmental stresses increase ROS generation, there
would have been evolutionary pressure for selection of ROS signalling mecha-
nisms that induce genes encoding antioxidant and cellular defence proteins. This
‘defence’ role for ROS and such proteins may be one reason why the induction of
many cellular defence/rescue genes is a common response to several environ-
mental stresses and oxidative stress, and help to explain acclimation and cross-
tolerance, in which previous exposure to the same stress or a different stress in-
duces tolerance to subsequent exposure (Bowler and Fluhr, 2000). Protective roles
for ROS may also have been the driver for the evolution of enzymes such as
NADPH oxidase for which the key reaction appears to be ROS generation per se,
and for which enzyme activity can be regulated by environmental stresses. Thus,
biotic and abiotic environmental stresses not only enhance ROS generation via
non-specific mechanisms, but also trigger defence signalling mechanisms that, if
successful, start with induction of ROS generation, continue with induction of de-
fence responses, and end in removal of ROS to restore redox balance and cell sur-
vival. The ubiquity of ROS and the elaboration of ROS signalling mechanisms
within cells may also have driven the adoption of ROS for broader signalling
processes, such that controlled synthesis of ROS, and subsequent perception and
signal transduction, came to form part of discrete signalling processes such as

stomatal closure and root development.
5.3 Redox balance and the generation and removal of

ROS
5.3.1 Redox balance
Several sources of ROS occur within plant cells, in different sub-cellular loca-
tions. Similarly, there also exist a number of antioxidant mechanisms, again found
in various locations (Bray et al. 2000; Neill et al. 2002c). Under normal physio-
logical conditions, cellular compartments may have a particular redox balance, de-
termined by the relative rates of ROS generation and removal. Any stimulus that
increases ROS and/or decreases antioxidant activity will disturb the redox balance
and therefore induce oxidative stress (Fig. 1). In addition to damaging effects,
oxidative stress may alter the cellular redox potential (recently termed the ‘redox
environment’ (Schafer and Buettner 2001)). The intracellular environment is
maintained within a range of voltages, usually lower than -200mV, a value com-
plementing that of the reductants NADPH and NADH. The electronegativity of
the cell is maintained by the millimolar concentrations of reduced glutathione
(GSH). It is possible that signalling proteins have thiol groups, with mid-point po-
tentials within the physiological range, that can exist in reduced or oxidised states,
with the protein adopting a conformation commensurate with the state of reduc-
tion (see section 5.4.2.2). Altered conformations may modify protein function, for
example, activating or inactivating the protein. Oxidative stress will cause the in-
tracellular redox environment to become more electro-positive. This may induce a
shift in the redox environment away from the physiological range for thiol groups,
and thus potentially interfere with signalling pathways.
5.3.2. ROS generation
ROS are generated from both electron transport and enzymatic sources. ROS pro-
duction is increased by stresses that include excessive light energy, wounding,
ozone, drought, UV-irradiations, pathogen challenge, low and high temperatures,
and heavy metals (Fig. 2; Dat et al. 2000; Bray et al. 2002; Neill et al. 2002c;
Vranova et al. 2002b). It is difficult to discern the levels of ROS in control and
stressed cells; a wide range of concentrations (µM to mM: see Neill et al. 2002c)
has been estimated. There can be no doubt however, that various stresses do in-
crease H2O2 generation substantially. Determination of the relative contributions
of different cellular H2O2 sources and the impact of H2O2 on cell signalling will be
greatly facilitated by the development of robust and quantitative means to monitor
intracellular ROS concentrations.
Fig. 2. Regulation, removal, and cellular effects of hydrogen peroxide (H2O2). Various
abiotic and biotic stresses cause an increase in H2O2 within cells. Various antioxidants
within the cell act as redox buffers to maintain the redox balance. Perception of H2O2 leads
to activation of cellular responses such as reversible protein phosphorylation, release of cal-
cium, direct modification of proteins on thiols and regulation of gene expression. These cel-
lular changes result in biological responses, which include programmed cell death (PCD),
stomatal closure and gravitropism.
ROS generation occurs via electron transport reactions in both chloroplasts and
mitochondria. The Mehler reaction in chloroplasts generates superoxide that is
readily converted to H2O2 (Polle 1996). Stresses such as high light intensity,
drought stress, extreme temperatures, heavy metals, and UV radiations all enhance
photosynthetic ROS generation (Dat et al. 2000). Superoxide also arises from
electron leakage in mitochondria.
H2O2 is generated via several enzyme-mediated reactions in which it is likely
that H2O2 is not the main ‘raison d’etre’. These include glycollate oxidase, produc-
ing glyoxylate and H2O2 during photorespiration, and acyl CoA oxidase, produc-
ing H2O2 during the β oxidation of lipids, in peroxisomes (Wojtaszek 1997; Cor-
pas et al. 2001). However, the effects of various stresses on H2O2 generation via
these enzymatic routes are not yet clear.
H2O2 is also generated from dedicated enzymes, for which the key function ap-
pears to be H2O2 (or superoxide) synthesis. The best characterised of these is
NADPH oxidase (sometimes referred to as rboh [for respiratory burst oxidase
homologue]). In mammals, NADPH oxidase is a plasma membrane–located en-
zyme, initially isolated from phagocytic cells, and made up of several membrane
and cytosolic sub-units that assemble at the phagocyte plasma membrane follow-
ing cell stimulation. The key subunit is a large glycosylated flavin- and haem-
containing protein (gp91) that transfers electrons from NADPH to molecular oxy-
gen to generate O2.- (and subsequently H2O2) that, directly or indirectly, are mi-
crobicidal (Reeves et al. 2002). Associated with the O2.- generation is a respiratory
burst (reflecting a hugely increased demand for oxygen). Homologues of the gp91
sub-unit (rboh genes and proteins) have been isolated from plants, but no genes
encoding potential homologues of the NADPH oxidase cytosolic sub-units have
been found. In fact, it may be that non-phagocytic animal cells also utilise the
gp91 protein by itself to generate low levels of H2O2 for signalling purposes
(Lambeth 2002).
The initial work on ROS generation in plants via NADPH oxidase-like en-
zymes started with plant-pathogen interactions, focussing on the “oxidative burst”
(Doke 1983). The oxidative burst leading to the generation of H2O2 is typically in-
duced in plants and cell cultures following challenge with either pathogens or
elicitor molecules derived from them, and numerous studies have provided evi-
dence for NADPH oxidase being the source of H2O2 (Lamb and Dixon 1997;
Bolwell 1999). Recent data implicate NADPH oxidase as also being the source of
H2O2 generated during drought and ozone exposure, or following ABA treatment,
via inhibition of H2O2 generation by diphenylene iodonium (DPI) (Pei et al. 2000;
Zhang et al. 2001c; Jiang and Zhang 2002; Wohlgemuth et al. 2002). It should be
noted that DPI is not a specific inhibitor of NADPH oxidase, and may inhibit
other flavin-containing enzymes (Bestwick et al. 1999).
There is now considerable molecular evidence for NADPH oxidase (rboh)
genes in plants. rboh genes have been cloned from Arabidopsis (Desikan et al.
1998a; Keller et al. 1998; Torres et al. 1998); tomato (Amicucci et al. 1999), to-
bacco (Simon-Plas et al. 2002), and potato (Yoshioka et al. 2001). Moreover, six
to eight rboh genes are present in Arabidopsis, with differential expression pat-
terns (Torres et al. 1998; The Arabidopsis Genome Initiative, 2000), suggesting
different biological functions. Some of the rboh genes are induced by H2O2 itself
and by biotic stresses (Desikan et al. 1998a; Yoshioka et al. 2001; Simon-Plas et
al. 2002).
rbohA is a 105 kDa plasma membrane protein (Keller et al. 1998), with six
membrane –spanning domains (Fig. 3). NAD(P)H and FAD binding domains are
conserved at the C-terminus and the haem binding domains are located between
two histidine residues in the membrane spanning regions III and V (Keller et al.
1998; Torres et al. 1998). The plant protein does not seem to be heavily glycosy-
lated (Keller et al. 1998), and contains an EF hand (a calcium binding domain) at
the N-terminus (Desikan et al. 1998a; Keller et al. 1998; Torres et al. 1998), which
has been shown to bind calcium in vitro (Keller et al. 1998). Direct calcium acti-
vation was demonstrated for tobacco and tomato plasma membrane NADPH oxi-
dases, and the activity was increased by pathogen challenge (Sagi and Fluhr
2001). Expression of a calmodulin gene in tobacco resulted in elevated levels of
Fig. 3. Predicted structure of Rboh (NADPH oxidase) in Arabidopsis (derived from Torres
et al. (1998)). The six transmembrane domains, position of EF hand in the N-terminal and
FAD/NAD(P)H binding domains in the C-terminal regions are indicated.
NADPH and increased H2O2 generation following elicitor/pathogen challenge, po-

tentially via activation of a calmodulin-dependent NAD kinase that affects
NADPH availability and hence activity of NADPH oxidase (Harding et al. 1997).
In Arabidopsis, intracellular calcium increased concomitant with H2O2 production
during an incompatible plant-pathogen interaction (Grant M et al. 2000). How-
ever, DPI inhibited bacteria-induced ROS production but not calcium release,
placing calcium upstream of H2O2 production. Thus, it seems likely that NADPH
oxidase is regulated by calcium during biotic stresses. It is not yet known whether
calcium also regulates NADPH oxidase activity increased by abiotic stresses (Rao
et al. 1996; A-H- Mackerness et al. 1999b; Jiang and Zhang 2002; Wohlgemuth et
al. 2002).
Pharmacological data implicate reversible protein phosphorylation and the ac-
tion of G proteins in the regulation of NADPH oxidase activity during plant-
pathogen responses (Lamb and Dixon 1997). Recent genetic and biochemical data
have identified a protein kinase required for H2O2 synthesis following ABA treat-
ment in Arabidopsis guard cells (Mustilli et al. 2002), and highlighted a role for
Rac and Rho GTP-binding proteins in regulating NADPH oxidase activity during
PCD and anoxia responses in rice and Arabidopsis respectively (Kawasaki et al.
1999; Baxter-Burrell et al. 2002).
An essential requirement for NADPH oxidase during pathogen-induced H2O2
production has been demonstrated recently by functional genomic experiments.
Using a reverse genetic approach, rboh knock-out mutants were identified in an
Arabidopsis T-DNA insertion population (Tissier et al. 1999). Characterisation of
single and double mutants subsequently demonstrated that AtRbohD is largely re-
sponsible for H2O2 produced in response to bacterial challenge, whereas AtrbohF
appears more important for fungal HR. Although it seems clear that a lack of rboh
genes compromises H2O2 production, the effects on defence responses are less
clear. Simon-Plas et al. (2002) generated antisense tobacco cells to reduce the ex-
pression of NtRbohD. These antisense cell lines had reduced H2O2 production af-
ter elicitation, indicating the requirement for NADPH oxidase. However, medium
alkalinisation still occurred, demonstrating that NADPH oxidase functions down-

stream of extracellular alkalinisation. NADPH oxidase knock-out and knock-down
mutants will be very useful tools to dissect the roles of individual rboh proteins in
mediating cellular responses to various stimuli. Moreover, cloning, mutagenesis
and expression of the individual genes may reveal biochemical information re-
garding potential activation mechanisms.
Bolwell’s group has proposed an alternative, and perhaps complementary, regu-
lated source of H2O2, at least during the oxidative burst – a cell wall peroxidase
(Bolwell et al. 2002). In suspension cultures of French bean cells, the fungal elic-
ited oxidative burst is not inhibited by DPI, but is inhibited by peroxidase inhibi-
tors, and a cell wall peroxidase has been purified (Blee et al. 2001). Furthermore,
this oxidative burst is entirely dependent on extracellular alkalinisation, as the
oxidative burst does not occur when using a cell culture medium of pH 6. More-
over, simultaneous release of a reductant also occurs, the identity of which is not
yet clear. Importantly, Arabidopsis plants transformed with an antisense construct
to the bean peroxidase are hypersensitive to bacterial and fungal pathogens
(Bolwell et al. 2002), indicating a biological role for this enzyme.
Another source of H2O2, oxalate oxidase, converts oxalate and oxygen to H2O2
and carbon dioxide. Germin-like oxalate oxidases in barley mediate H2O2 produc-
tion in response to attack by a fungal pathogen (Zhang et al. 1995). Copper-
containing amine oxidases located in the cell wall have been proposed as a source
of ROS in elicitor-treated epidermal cells of tobacco (Allan and Fluhr 1997).
Amine oxidases catalyse the oxidation of various amines to yield ammonia and
H2O2 (Wojtaszek 1997). Further work is required to elucidate the role of oxalate
oxidases and amine oxidases in ROS generation in response to different stresses.
5.3.3 Removal of ROS
Redox imbalance can also result from a reduction in antioxidant activity. Antioxi-
dant defences are both constitutive and inducible by oxidative stress. Plant cells
are particularly rich in antioxidants, and their activity and location will affect the
concentration of H2O2 at any given time and place. Thus, high antioxidant levels
might localise H2O2 within cellular microdomains, emanating from the point of
origin or entry of H2O2 (Neill et al. 2002c).
ROS can be removed either via non-enzymatic or enzymatic mechanisms. Non-
enzymatic antioxidants include vitamin C (ascorbate), vitamin E (tocopherol), glu-
tathione, flavonoids, alkaloids, and carotenoids (Bray et al. 2002). Millimolar con-
centrations of ascorbate and glutathione are found in chloroplasts and other cellu-
lar compartments, as well as the apoplast (Noctor and Foyer 1998; Smirnoff,
2000), buffering cells against oxidative damage (Horemans et al. 2000). The
Arabidopsis vtc-1 mutant, deficient in ascorbate biosynthesis, has increased sensi-
tivity to ozone, UV-B, and sulphur dioxide (Conklin et al. 1996). However, other
ascorbate-deficient mutants are not hypersensitive to ozone (Conklin et al. 2000).
The tripeptide glutathione (γ-Glu-Cys-Gly, GSH) is a major redox buffer ubiq-
uitous in aerobic cells (Foyer et al. 2001). Glutathione reacts with H2O2, being
oxidised to GSSG, and functions in the ascorbate-glutathione cycle (see below).

Increased levels of GSH have been found following chilling, heat shock, pathogen
attack and drought stress (Noctor et al. 2002), and the activity of GSH biosyn-
thetic enzymes is increased during environmental stress (Vanacker et al. 2000;
Vernoux et al. 2002). Manipulation of GSH content via alteration of the activity of
enzymes regulating GSH synthesis is a key research priority for enhancing oxida-
tive stress tolerance.
Relatively little detail is known concerning flavonoids and carotenoids in ROS
removal in plants. However, overexpression of β-carotene hydroxylase in Arabi-
dopsis, leading to increased chloroplast xanthophyll content, resulted in enhanced
tolerance towards oxidative stress induced in high light (Davison et al. 2002).
Enzymatic ROS scavenging mechanisms in plants include SOD (superoxide
dismutase), present in many cellular compartments; catalase, located in perox-
isomes; and the ubiquitous ascorbate-glutathione cycle. SOD catalyses the dismu-
tation of superoxide to H2O2, and is thus one of the primary mediators of H2O2
production from intracellular sources of superoxide. Unlike most organisms,
plants have multiple forms of the different types of SODs encoded by multiple
genes (Scandalios 2002a). The various forms of SOD that occur in cells are cate-
gorised by the metal co-factor of the enzyme, e.g. Cu/Zn, Mn, Fe(III), or Ni
(II/III). Catalase removes H2O2 by degrading it to water and oxygen. Catalase is
located mainly in peroxisomes, where H2O2 synthesis occurs (see section 5.3.2).
Catalase is thus well-positioned to remove excess H2O2 before it can leak out into
other parts of the cell.
The ubiquity of the ascorbate-glutathione (Asc-GSH) cycle and the high con-
centrations of ascorbate and glutathione indicate the critical importance of this cy-
cle as a regulator of cellular oxidative balance (Noctor and Foyer 1998). The Asc-
GSH cycle involves metabolism of H2O2 via interactions between the antioxidant
enzymes ascorbate peroxidase (APX), glutathione reductase (GR), and dehy-
droascorbate reductase (DHAR) (see Polle 1996). Dehydroascorbate is reduced by
GSH to ascorbate, mediated by DHAR (and GSH becomes oxidised to GSSG).
GSSG is then reduced to GSH requiring the action of GR and the consumption of
NADPH, whilst ascorbate is oxidised to dehydroascorbate via APX, which also
reduces H2O2 to water. Therefore, these enzymes are key targets for manipulating
levels of ROS within cells.
Antioxidant enzyme activity can be modulated by different stimuli. Gibberellin
decreases antioxidant activity (catalase, SOD and APX) in barley aleurone cells,
thus increasing H2O2 levels and initiating cell death (Fath et al. 2001). On the
other hand, antioxidant activity was increased by drought stress in several plant
species (Zhu and Scandalios 1994; Gogorcena et al. 1995). Exposure of plants to
high intensity light also led to an accumulation of transcripts encoding SOD
(Tsang et al. 1991; Mishra et al. 1995) and APX (Karpinski et al. 1999), and heat
tolerance was associated with increased SOD activity in tobacco (Tsang et al.
1991).
Specific roles for antioxidant enzymes have been explored via transgenic ap-
proaches. Over-expression of tobacco chloroplastic Cu/Zn SOD did not alter tol-
erance towards oxidative stress, suggesting that other antioxidant mechanisms
might be limiting (Allen 1995). However, expression of a pea chloroplastic Cu/Zn

SOD in tobacco did result in increased resistance to methyl-viologen-induced
membrane damage (Allen 1995). It is possible that intracellular location is impor-
tant for physiological effects. That SOD can protect against oxidative stress is ap-
parent from the work of Zhu and Scandalios (1992). Yeast cells lacking MnSOD,
and thus susceptible to oxidative stress, became more resistant to oxidative stress
after transformation and expression of maize MnSOD, implying functional con-
servation between species.
Catalase was found to be indispensable for oxidative stress tolerance in trans-
genic tobacco. Willekens et al. (1997) showed that plants antisensed to catalase
generated enhanced levels of H2O2 in response to both abiotic and biotic stresses.
Reduced catalase activity resulted in the induction of other antioxidants (APX and
GPX), suggesting a compensatory mechanism. Recently, Rizhsky et al. (2002)
found that plants lacking both APX and catalase were less sensitive to oxidative
stress, as assessed by paraquat-induced cell death, when compared to plants an-
tisensed to catalase alone. Moreover, these double antisense plants were not com-
pensated by an increase in the levels of other antioxidants. However, their photo-
synthetic activity was decreased, suggesting that reduction in the two key
antioxidant enzymes result in the suppression of ROS production via chloroplasts
(Rizhsky et al. 2002). Thus, suppression of photosynthetic activity during periods
of environmental stress may offer a novel approach to oxidative stress tolerance.
The phenomena of acclimation and cross-tolerance have been linked to oxida-
tive stress (Bowler and Fluhr, 2000). Increased ROS generation and induction of
antioxidant genes during stress do indicate an involvement of oxidative stress, and
it will be informative to determine whether acclimation still occurs in the absence
of such oxidative stress, for example, in rboh knock-out mutants or in plants over-
expressing antioxidant enzymes. The fact that some cellular defence genes are in-
duced by several stresses, apparently independently of as well as via ROS, sug-
gests that cellular responses are complex. Moreover, in field situations, plants are
likely to be exposed to a number of stresses concurrently, e.g. cold, UV,
heat/drought etc., and the interactions of such stresses with endogenous processes
are yet to be unravelled.
5.4 Cellular responses
5.4.1 Effects on gene expression
Several studies have indicated a requirement for ROS signalling in the induction
of genes induced by a range of stimuli such as pathogen challenge or exposure to
UV or ozone (Neill et al. 2002b; Vranova et al. 2002b). Most data relate to H2O2,
although there are some suggesting that O2.- is the key molecule (Jabs et al. 1997).
These experiments, using treatments that inhibit H2O2 production or facilitate its
removal with scavengers such as catalase, have identified genes encoding antioxi-
dant enzymes such as APX as well as those encoding cellular defence proteins
such as pathogenesis-related (PR) proteins, glutathione S-transferase (GST) and

phenylalanine ammonia-lyase (PAL) (e.g. Levine et al. 1994; Desikan et al.
1998b; Karpinski et al. 1999). Alternatively, direct effects of H2O2 on gene ex-
pression have been determined. Clearly, H2O2 application may not induce the
same responses as when generated internally – exogenous H2O2 is degraded very
rapidly, H2O2 that enters the cell may not reach the same sub-cellular compart-
ment(s) in which is it is generated or in which it accumulates following stimula-
tion, and H2O2 challenge in the absence of other intracellular events that might
normally be co-stimulated along with H2O2 production may not accurately reflect
cellular responses during stress. Nevertheless, exposure to H2O2 has identified
genes such as a receptor kinase (Desikan et al. 2000), annexin (Gidrol et al. 1996)
as well as a peroxisome biogenesis gene (Lopez-Huertas et al. 2000) as being di-
rectly inducible by H2O2. Induction of peroxisome biogenesis suggests that perox-
isome proliferation may be a key response to oxidative stress.
More recent experiments have used cDNA profiling and DNA microarray ap-
proaches to analyse large-scale gene expression in response to ROS. In order to
clarify the role of ROS in pathogen-defence signalling, Durrant et al. (2000) per-
formed a cDNA-AFLP analysis of tobacco genes that were induced by fungal
challenge, in the presence or absence of DPI. Most of the pathogen-induced genes
did not require ROS production, although direct induction of these genes by ROS
was not assessed (Durrant et al. 2000). This implies that even during a defence re-
sponse where ROS generation is a key step, cellular responses that ensue are not
solely determined by ROS.
Using Arabidopsis suspension cultures, Desikan et al. (2001b) found that 1-2 %
of the genes on the microarray utilised were altered in their expression following
exposure to H2O2. Of the 175 genes that were regulated, 113 were induced and 62
repressed by H2O2. Genes encoding proteins with antioxidant properties were in-
duced as well as a substantial number encoding proteins that had functions in
other non-oxidative stress and cell defence processes. Signalling genes that were
induced include those encoding a calmodulin, protein kinase, tyrosine phos-
phatase, histidine kinase, and small GTP binding protein. The expression of genes
encoding transcription factors was also increased by H2O2, suggesting that down-
stream genes are also likely to be regulated. Expression analysis of a small sub-set
of the H2O2-induced genes showed that some of them were also induced by other
stimuli that involve oxidative stress, e.g. ABA, UV-B and elicitor treatments, re-
vealing that expression of these genes occurred both via, and independently of,
H2O2 (Desikan et al. 2001b).
Oxidative stress has also been shown to regulate the expression of some of the
yeast genome (Gasch et al. 2000). Exposure of yeast cells to H2O2 induced the ex-
pression of genes involved in detoxification of ROS (such as catalase and SOD),
as well as those involved in cellular redox reactions (such as thioredoxins and glu-
tathione reductase). Interestingly, the use of yeast mutants deficient in transcrip-
tion factors showed that most of the ROS-induced genes were dependent for their
induction on the redox-active transcription factor, Yap1. Comparison of oxidative
stress genes in yeast and plants may reveal common mechanisms.
Acclimation tolerance develops when a plant is exposed to sub-lethal doses of

one stress that subsequently protects it from a further, normally lethal, dose of the
same stress. It has been suggested that oxidative stress responses are essential to
both abiotic and biotic stress tolerance in plants (Bowler and Fluhr 2000). How-
ever, the molecular mechanisms by which plants acclimate to oxidative stress are
not very clear. Vranova et al. (2002a) pre-treated tobacco plants with sub-lethal
doses of methyl viologen (MV, which generates superoxide), followed by a larger
dose of MV, and followed global changes in gene expression using both mRNA
differential display and microarray techniques. Approximately 2 % of the tobacco
genes were altered in their expression in acclimated leaves, including several not
previously associated with oxidative stress. Genes with predicted cytoprotective or
detoxifying functions (such as an ABC transporter) and signal transduction (such
as a calcium sensor-interacting protein kinase) were up-regulated in acclimated
leaves, implying a variety of cellular responses during acclimation tolerance.
H2O2 has also been implicated as a signal mediating systemic resistance to both
abiotic and biotic stresses. Karpinski et al. (1999) showed that exposure of plants
harbouring a transgenic APX2-LUC gene to high intensity light caused an in-
crease in APX2-LUC expression. Moreover, a systemic signal involving H2O2,
was also generated, inducing an acclimatory response in untreated parts of the
plant, a phenomenon termed “systemic acquired acclimation” (Karpinski et al.
1999). H2O2 generation also occurs both locally and systemically in response to
wounding (Orozco-Cardenas and Ryan 1999), and recent work has shown that this
requires H2O2 as a second messenger, mediating the expression of various de-
fence-related genes in systemic parts of tomato plants (Orozco-Cardenas et al.
2001). Previously, Alvarez et al. (1998) had showed that the oxidative burst in
pathogen challenged Arabidopsis leaves activates a secondary systemic burst in
distal parts of the plant, leading to systemic immunity via the expression of de-
fence-related genes. It is possible that H2O2 is not the primary signal that is trans-
mitted, and interactions with other signalling intermediates such as salicylic acid
(SA) could also be involved.
Heterologous systems have also been used to elucidate the function of oxidative
stress tolerance in plants. The H2O2 inducible annexin-like protein identified in
Arabidopsis rescued E. coli oxyR mutants from oxidative stress (Gidrol et al.
1996). OxyR is a transcriptional regulator of oxidative stress-induced defence
genes in E. coli; thus, mutants lacking this gene are unable to grow at high H2O2
concentrations (Gidrol et al. 1996). Although the exact mechanisms by which an-
nexin counteracts oxidative stress in plants are not known, the presence of do-
mains in the protein also present in plant peroxidases suggested some form of an-
tioxidative role (Gidrol et al. 1996). In other work, Belles-Boix et al. (2000)
identified the Arabidopsis CEO1 protein, which protected yeast against oxidative
damage. CEO1 appears to be part of a gene family unique to plants and was not
induced by oxidative stress. Whether the annexin and CEO1 proteins have similar
physiological functions in plants remains to be seen.
Direct effects of H2O2 on the proteome have been demonstrated. Godon et al.
(1999) identified the “H2O2 stimulon” in yeast, which included several heat shock
proteins and antioxidant enzymes; as well as enzymes involved in protein degra-
dation pathways. The effects of oxidative stress on the Arabidopsis mitochondrial

proteome have been reported by Sweetlove et al. (2002). Sub-sets of proteins were
identified that were up-regulated, down-regulated, or degraded following exposure
of Arabidopsis cells to H2O2. Two classes of antioxidant defence proteins, per-
oxiredoxins and protein disulphide isomerase, were found to be increased by oxi-
dative stress. Proteins associated with the TCA cycle were down-regulated, proba-
bly reflecting down-regulation of ATP synthesis. This is the first study to
characterise the effects of oxidative stress on the protein profile of a sub-cellular
organelle. It will be important to repeat this for other organelles as well as the
whole cell, in order to compare and contrast the global effects of oxidative stress
on cellular function.
Potential new insights into ROS signalling may be inferred from a recent mi-
croarray study by Moseyko et al. (2002). The expression of many genes was al-
tered in Arabidopsis roots in response to gravity, and over 20% associated with
oxidative stress and plant defence. Research elsewhere has implicated H2O2 as a
mediator of gravitropic responses (Joo et al. 2001); thus, these data may reflect
endogenous H2O2 synthesis and action. In other work, Swidzinski et al. (2002)
identified several oxidative stress-related genes that were up-regulated following
heat-treatment of Arabidopsis cells, potentially reflecting the involvement of ROS
in heat responses. It is possible that further transcriptomic studies will identify
novel genes whose functions were not previously associated with oxidative stress.
An alternative approach to study the effects of oxidative stress on the transrip-
tome is to induce oxidative stress by a reduction of antioxidant activity. Gene ex-
pression profiles were monitored in tobacco plants antisensed to either catalase or
ascorbate peroxidase (AS-CAT, AS-APX) or double antisense plants (dAS;
Rizhsky et al. 2002). Both the single antisense plants had elevated expression of
Cu/Zn SOD and glutathione reductase (GR), whereas the dAS plants had elevated
expression of monodehydroascorbate reductase (MDAR), an enzyme involved in
the regeneration of ascorbate. An increase in expression of enzymes involved in
removing ROS could reflect a compensatory mechanism to cope with the oxida-
tive stress. In similar work, tobacco plants deficient in catalase, that had elevated
ROS levels in high light, accumulated genes encoding pathogen-responsive pro-
teins, resulting in enhanced disease resistance (Chamnongpol et al. 1998).
These antioxidant-deficient plants offer an excellent tool to study the effects of
oxidative stress on transcription and other cellular and whole plant responses.
Even so, increased ROS due to depletion of one scavenging mechanism, e.g. per-
oxisomal catalase, may not have exactly the same effects as ROS induced at an-
other cellular location, e.g. by plasma membrane NADPH oxidase. It is clear from
these few large-scale gene expression experiments carried out so far that oxidative
stress/ROS do alter the expression of much larger number of genes than had hith-
erto been identified. These genes include those encoding antioxidant enzymes, in-
dicating a protective cellular response. Genes associated with other stress re-
sponses are also induced, suggesting a co-ordinating and complementary role for
H2O2 in stress responses. Finally, signalling and other genes are also induced, per-
haps reflecting a broader signalling role for H2O2.
Gene expression in response to oxidative stress may be co-ordinated via the in-
teraction of transcription factors (TFs) with cis-elements common to the regula-
tory regions of these genes. There is some evidence for oxidative stress-responsive
cis-elements in plants. The microarray analysis of H2O2-induced gene expression
in Arabidopsis indicated potential H2O2-responsive cis-elements in genes regu-
lated by H2O2 (Desikan et al. 2001b). One of these elements, the as-1 promoter
element, has high homology with the redox-sensitive AP-1 box (a cis-element) in
mammals (Karin et al. 1997), and has also been found in other H2O2-inducible
genes in plants (Desikan et al. 2001b), although recent experiments using trans-
genic plants over-expressing the as-1 element indicate that oxidative species other
than H2O2 activate this promoter (Garreton et al. 2002). Identification of H2O2-
specific cis-elements in genes in plants is a research priority. Further bioinformatic
analyses of all the H2O2 -responsive genes identified via transcriptomic analysis
may indicate such regulatory sequences, and functional studies will be required to
confirm their H2O2-responsiveness in vivo.
5.4.2 Signalling
5.4.2.1 Transcription
Although H2O2 is a signal molecule capable of effecting large changes in the tran-
scriptome, it is not known whether it is actually the signal per se, or whether oxi-
dation of molecular substrates by H2O2 (or other ROS) is required to generate an
intracellular signal. Certainly, increased ROS in cellular compartments such as the
mitochondrion or chloroplast results in new transcriptional profiles, so there must
be signalling between these organelles and the nucleus. This might involve direct
effects of H2O2 on TFs, activation by H2O2 of signalling pathways that result in al-
tered activity of specific TFs and/or generation of secondary (and further) signal-
ling molecules that in turn affect signalling pathways that then alter the activity or
formation of TFs (Fig. 4).
Redox modulation of TF activity could potentially involve modifications of
thiol residues altering protein conformation and therefore activity (see section
5.4.2.2). Such thiol modifications by H2O2 have been demonstrated in vitro for the
yeast TF YAP-1 (Delauney et al. 2000); the situation in vivo is not yet known. TFs
could also be activated by H2O2 via the activation of signalling proteins, such as
protein kinases. A well-known signalling cascade in which signal perception leads
to the activation of TF and thus alteration in gene expression is that involving mi-
togen activated protein kinases (MAPKs). Various groups have shown that H2O2
activates specific MAPKs in Arabidopsis and other species (Desikan et al. 1999;
2001a; Grant JJ et al. 2000; Kovtun et al. 2000; Samuel et al. 2000). However,
neither the mechanism of activation nor the downstream targets of these MAPKs
are yet known. Nevertheless, it seems likely that H2O2 activation of MAPKs is a
central phenomenon mediating cellular responses to multiple stresses. Indeed,
Kovtun et al. (2000) have shown that this can be the case. H2O2 activates the
MAPKs AtMPK3 and AtMPK6 via the MAPK kinase kinase (MAPKKK) enzyme
Fig. 4. Regulation of gene expression by H2O2. H2O2 can activate transcription by oxidising
H2O2-responsive transcription factors (TFs), either via oxidation of individual cysteine
thiols to yield thiol derivatives, or via oxidation of two adjacent thiols to form a disulfide
bridge (Cooper et al. 2002). H2O2 can also activate a signalling protein such as a protein
kinase that then phosphorylates a TF. The modified TF subsequently interacts with a “H2O2
response element” leading to regulation of gene expression.
ANP1, and moreover, plants over-expressing ANP1 were tolerant to heat shock,
freezing and salt stress. In related work, Moon et al. (2002) have shown recently
that H2O2 increased expression of the Arabidopsis NDP kinase 2, a kinase found
to interact with the H2O2- activated MAPKs AtMPK3 and AtMPK6. Over-
expression of AtNDPK2 down-regulated the accumulation of H2O2, which in turn
enhanced tolerance to multiple stresses including cold, salt, and oxidative stress.
The authors suggested that AtNDPK2 activated antioxidant genes that in turn me-
diated multiple stress tolerance. Together, these data suggest a scenario in which
various stresses induce H2O2 generation, that in turn activates a MAPK signalling
cascade that subsequently induces expression of antioxidant genes, thereby reduc-
ing H2O2 levels and restoring cellular homeostasis.
5.4.2.2 Effects of H2O2 on cell signalling

Whilst the above studies do indicate that oxidative stress has a significant impact
on the genome, there is relatively little known about how the signal is transduced
to alter gene expression. Recent work with yeast has indicated that a two compo-
nent histidine kinase module can function as a peroxisensor (Singh 2000). Yeast
mutants lacking the Sln1 histidine kinase gene were highly susceptible to H2O2
(Singh 2000). Similar two-component systems are already known as redox sensors
in bacteria (Vranova et al. 2002b). Plants contain a range of histidine kinases and
hybrid histidine kinases similar to Sln1 (which contains both a histidine kinase
transmitter domain and a receiver domain). In Arabidopsis, some of these have
been assigned functions as sensors and receptors for stimuli such as osmotic
stress, ethylene, and cytokinin (Hwang et al. 2002). Whether some of these pro-
teins can function as peroxisensors is currently under investigation.
Genetic approaches based on H2O2 sensitivity screens may help to find H2O2
sensors. An Arabidopsis mutant has been identified recently that has reduced ex-
pression of a H2O2-responsive marker gene, an enhanced oxidative burst in re-
sponse to pathogen challenge, is hypersensitive to low titres of avirulent bacteria,
and lacks a stomatal response to H2O2 (L Mur et al. pers. comm.). Using a genetic
screen for altered root growth responses to H2O2, He et al. (2002) have also identi-
fied an Arabidopsis mutant lacking in H2O2 responsiveness. Preliminary data indi-
cate that this mutant has increased antioxidant activity, suggesting that the lack of
responses may reflect enhanced H2O2 generation.
Because H2O2 is a mild oxidant that can oxidise thiol (-SH) residues, it is pos-
sible that H2O2 is sensed via such thiol modification, potentially in proteins with a
wide range of functions. Such modification depends on the pKa of the thiol group
and the molecular environment around the protein (Finkel 2000; Rhee et al. 2000;
Danon 2002). Protein thiol groups that can be reversibly modified by ROS and re-
active nitrogen species have recently been described as “nanotransducers” (Coo-
per et al. 2002), and potentially represent a very important cell signalling mecha-
nism. Recent work has identified the Arabidopsis protein phosphatase 2C enzymes
ABI1 and ABI2 as targets for H2O2 modification of cysteine residues in vitro
(Meinhard et al. 2001; 2002). Identification of other H2O2-reactive proteins, per-
haps using thiol-specific fluorescent dyes (Wu et al. 1998), followed by purifica-
tion and mass spectrometric analysis, must be on the research agenda.
H2O2 interaction with the ubiquitous signalling messenger calcium is likely.
Regulation of H2O2 homeostasis by calcium is complex, as H2O2 is positioned
both upstream and downstream of calcium. In an in vitro study, Yang and
Poovaiah (2002) have shown that calcium/calmodulin binds to and activates cata-
lase. As calmodulin is present in peroxisomes, the cellular location of catalase, it
is possible that calmodulin binding in vivo enhances degradation of H2O2 by acti-
vating calcium. In some signalling pathways such as in the guard cell response to
ABA (see section 5.5.2), H2O2 activates calcium channels, thereby positioning cal-
cium downstream of H2O2 (Pei et al. 2000). The activity of K+ channels and
H+ATPases is also affected by H2O2 (Zhang et al. 2001a, b), but the mechanisms
are not known.
Although to date most studies of H2O2 signalling, like those generally, have
adopted a reductionist approach, it is well-recognised, that cell signalling is com-
plex, with many parallel and interconnecting pathways. Indeed, it is already clear
that H2O2 interacts closely with nitric oxide (see section 5.5), and probably with
salicylic acid (SA) and jasmonic acid (JA) (A-H-Mackerness et al. 1999a).
5.5 H2O2 biology

5.5.1 Oxidative burst and PCD
The oxidative burst, in which large amounts of H2O2 are generated, is induced by
pathogen challenge (Lamb and Dixon 1997) as well as by abiotic stresses such as
ozone and UV (Rao et al. 1996; Wohlgemuth et al. 2002). During plant-pathogen
interactions, the oxidative burst is part of a concerted series of events that involves
induction of several defence responses including phytoalexin production and the
Hypersensitive Response (HR; Lamb and Dixon 1997). Cell death occurring dur-
ing the HR, potentially limiting the spread of disease from the infection point, is a
genetically defined, programmed process (Programmed Cell Death, PCD; Green-
berg 1997). During incompatible reactions (which result in HR), biphasic H2O2
production is observed, with one very rapid, and one prolonged burst of H2O2.
However, during compatible interactions only the first burst of H2O2 occurs
(Baker and Orlandi 1995). It is not yet known whether two different sources of
H2O2 mediate these two distinct bursts, or the contribution of each burst to down-
stream events. The NADPH oxidase and peroxidase mutants will be helpful here.
It is possible that pathogens themselves are capable of ROS generation and re-
moval. For example, recent data indicate that the slyA gene is required for viru-
lence and protection from oxidative stress in the phytopathogenic bacterium Pseu-
domonas syringae (Lindgren et al. 2002).
Although the oxidative burst is a primary response following pathogen chal-
lenge leading to cell death (Bolwell 1999), there is some data indicating that H2O2
is not required for PCD (Glazener et al. 1996; Ichinose et al. 2001). However,
H2O2 does induce PCD in various systems (Levine et al. 1994; Desikan et al.
1998b; Solomon et al. 1999). A “presentation time” for exposure of cells to H2O2
is required, during which period transcription and translation are necessary (Desi-
kan et al. 1998b; Solomon et al. 1999). Pharmacological data indicate that removal
of H2O2 during pathogen or elicitor challenge reduces PCD (Levine et al. 1994;
Desikan et al. 1998b). Arabidopsis knock-outs lacking functional rboh genes dis-
played reduced H2O2 generation and HR cell death following bacterial challenge
(Torres et al. 2002). Tobacco plants that were antisense to either catalase or ascor-
bate peroxidase showed increased cell death to low doses of bacteria, compared to
wild type plants (Mittler et al. 1999).
PCD occurs not only as a result of the oxidative burst following pathogen chal-
lenge, but also following exposure to abiotic stresses such as ozone. The ozone –
induced oxidative burst results in a cell death process similar to the HR during
plant-pathogen interactions. Ozone-induced cell death was inhibited by DPI in
both Arabidopsis and tomato leaves (Wohlgemuth et al. 2002), suggesting a role
for endogenous ROS. Interestingly, different Arabidopsis accessions appeared to
generate either superoxide or H2O2. Developmentally-induced PCD has also been
found to be driven by changes in redox balance. GA-induced PCD in barley aleu-
rone was associated with increased ROS; however, this was due to a reduction in
the antioxidant capacity rather than ROS generation (Fath et al. 2001). Thus, it is
obvious that a close interplay between the oxidative and antioxidative capacity of
the cell determines the cellular outcome of a physiological stimulus.
H2O2-induced PCD requires gene expression (Desikan et al. 1998b), but it is
not yet known whether any PCD-specific genes exist that are regulated by H2O2. It
remains to be seen whether any of the genes regulated by oxidative stress in
Arabidopsis and tobacco are functionally involved in PCD (Desikan et al. 2001b;
Vranova et al. 2002a). Identification and analysis of knock-out mutants in Arabi-
dopsis insertion libraries should facilitate an analysis of the role of individual
genes in PCD. Moreover, analysis of gene expression profiles in rboh mutants fol-
lowing exposure to pathogen challenge might identify those PCD-related requiring
endogenous H2O2. Swidzinski et al. (2002) found oxidative stress-related genes
up-regulated during heat-induced PCD in Arabidopsis cells, suggesting the in-
volvement of ROS/ H2O2.
The parallels between animal and plant PCD are not clear. However, expression
of animal cell death suppressor genes (Bcl-xl and Ced-9) in tobacco plants re-
sulted in a suppression of oxidative stress-induced cell death (Mitsuhara et al.
1999). A role for mitochondria in H2O2-induced PCD is possible. Mitochondrial
H2O2 production was increased by exposure of Arabidopsis cells to H2O2, result-
ing in altered mitochondrial function and PCD (Tiwari et al. 2002). Maxwell et al.
(2002) reported that inhibition of mitochondrial electron transport or exposure to
H2O2 induced intracellular H2O2 production and the expression of several PCD-
associated genes. Expression of these genes was inhibited by an inhibitor of mito-
chondrial permeability pore formation, implying mitochondrion-nuclear signalling
during H2O2-induced PCD. MAPK activation may also be linked to H2O2 genera-
tion and PCD. Over-expression of the MAPK kinases AtMEK4 and AtMEK5 in
transgenic Arabidopsis plants induced HR-like cell death, preceded by the activa-
tion of endogenous MAPKs and ROS generation (Ren et al. 2002).
PCD regulation by H2O2 is likely to be complex, with interaction with other
signalling intermediates and redox-active molecules such as nitric oxide (NO).
Delledonne et al. (1998) showed that NO generation also occurs during the HR,
with synergistic effects on cell death. Further work indicated that a critical ratio of
H2O2 to NO is essential for PCD to occur in soybean cells. Reaction of O2.- with
NO giving rise to peroxynitrite prevented PCD, and the rate of conversion of O2.-
to either peroxynitrite or H2O2 determined the extent to which PCD occurred
(Delledonne et al. 2000). Bacterial challenge also elicited NO and H2O2 produc-
tion in Arabidopsis cells. Here, however, cell death in the presence of H2O2 and
NO was additive (Clarke et al. 2000), possibly reflecting differences in antioxidant
capacity. For example, Arabidopsis protoplasts are more sensitive to H2O2 than
are cells, reflecting their antioxidant status (Neill et al. 2002b).
5.5.2 H2O2 and stomata
Recent work has shown that H2O2 is an essential signal mediating stomatal closure
induced by ABA. ABA is an endogenous anti-transpirant, synthesised in response
to drought stress and inducing a range of survival responses including stomatal
closure. Earlier work had shown that H2O2 induces stomatal closure (McAinsh et
al. 1996) and that guard cells synthesise H2O2 in response to elicitor challenge
(Allan and Fluhr 1997; Lee et al. 1999). The data of Pei et al. (2000) demonstrated
that H2O2 is an endogenous component of ABA signalling in Arabidopsis guard
cells. ABA increased H2O2 synthesis (via a putative NADPH oxidase, as observed
by DPI inhibition of stomatal closure and requirement for NAD(P)H [Murata et al.
2001]), which induced stomatal closure, probably via activation of plasma mem-
brane calcium channels (Pei et al. 2000). ABA-induced H2O2 production in guard
cells has also been demonstrated for other species. Zhang et al. (2001c) showed
that ABA-induced H2O2 synthesis occurs in Vicia faba, and suggested two sources
of H2O2 – one located in the plasma membrane and another in the chloroplast. Pea
guard cells also generate H2O2 in response to ABA, and ABA-induced stomatal
closure is inhibited by removal of H2O2 (via catalase) or inhibition of synthesis
(via DPI); NADPH oxidase-like genes are expressed in guard cells, and dark-
induced closure also requires H2O2 synthesis (Desikan et al. unpublished). Identi-
fication and manipulation of guard cell sources of H2O2 is clearly important.
Various Arabidopsis mutants have been used to dissect ABA and H2O2 signal-
ling in guard cells. In the gca2 mutant, ABA increased H2O2 synthesis, but H2O2-
induced calcium channel activation and stomatal closure were lacking (Pei et al.
2000), suggesting that the GCA2 protein is involved in H2O2 signalling. The two
Arabidopsis H2O2 signalling mutants described in section 5.4.2.2 are deficient in
guard cell H2O2 responses and will no doubt prove to be useful research tools. Re-
versible protein phosphorylation is central to guard cell signalling. Murata et al.
(2001) used the ABA-insensitive abi1 and abi2 mutants, mutated in the ABI1 and
ABI2 protein phosphatase 2C enzymes, to dissect H2O2 signalling in Arabidopsis.
ABA-induced H2O2 generation was deficient in abi1, whereas abi2 mutants syn-
thesised H2O2 but could not respond to it, placing ABI1 upstream and ABI2
downstream of H2O2 synthesis. As mentioned earlier, the ABI1 and ABI2 proteins
can be oxidised in vitro by H2O2, but whether this happens in guard cells is not yet
known.
The ABA, H2O2 and guard cell story has recently expanded to include a protein
kinase between ABA perception and H2O2 synthesis. Mustilli et al. (2002) identi-
fied an ABA responsive mutant and isolated the gene, OST1, by positional clon-
ing. The gene encodes a protein kinase that is activated by ABA in both roots and
guard cell protoplasts from wild type but not ost1 plants. ABA-induced H2O2 syn-
thesis was absent in ost1 plants, although ost1 stomata still closed in response to
H2O2. It will be interesting to determine whether OST1 actually interacts with
NADPH oxidase, leading to generation of H2O2 in guard cells.
As with other signalling systems, H2O2 is likely to interact with various signal-
ling intermediates in guard cells. The recent findings that NO is a novel signal
mediating ABA-induced stomatal closure (Neill et al. 2002a) indicate that, as with
PCD, both H2O2 and NO appear to be made and to act in tandem.
5.5.3 H2O2 and roots
A new role for H2O2 in auxin signalling and gravitropism in maize roots was re-
vealed recently by Joo et al. (2001). Gravity and asymmetric auxin application in-
duced H2O2 generation, and moreover, asymmetric application of H2O2 promoted
gravitropism. An intracellular source of H2O2 was indicated, as catalase applica-
tion had no effect on gravitropism. The identification of Arabidopsis gravitropism-
induced genes related to oxidative stress (Moseyko et al. 2002) may be indicative
of a wider role for H2O2 in gravistimulation. NO has also been implicated in auxin
effects on root growth (Pagnussat et al. 2002), suggesting, yet again, cross-talk be-
tween H2O2 and NO.
5.5.4 Anoxia and H2O2
Plants are commonly exposed to anoxic and hypoxic conditions due to flooding
and poor soil drainage. Recent work by Baxter-Burrell et al. (2002) shows that
regulation of H2O2 content by Rops (Rho-like small G proteins) is critical for oxy-
gen deprivation tolerance in Arabidopsis seedlings. Rops have previously been
shown to regulate various signalling processes in plants, including H2O2 genera-
tion (Yang 2002). The data by Baxter-Burrell et al. (2002) suggest a model in
which oxygen deprivation activates Rop signalling to activate NADPH oxidase
and hence H2O2 synthesis, resulting in the expression of oxygen deprivation-
tolerance genes such as alcohol dehydrogenase. H2O2 also induces the expression
of a gene encoding RopGAP, leading to the deactivation of Rop and subsequent
reduction in H2O2. In previous work, Amor et al. (2000) had shown that pre-
exposure of soybean cells to anoxic conditions protect against subsequent H2O2-
induced cell death, via activation of peroxidases and alternate oxidase. It is possi-
ble that in soybean cells anoxia induces H2O2 synthesis that in turn induced per-
oxidases that were protective against subsequent H2O2 exposure.
5.6 Conclusions
Oxidative stress occurs as a consequence of several environmental factors that

perturb the redox balance of plant cells. At its worst, oxidative stress causes cellu-
lar damage to biomolecules that may induce cell death. On the other hand, oxida-
tive stress induces a range of cellular defence responses that are protective against
various stresses, such that these responses may be key components of acclimation
and cross-tolerance. ROS such as H2O2, and perhaps oxidative stress per se, due to
the alterations in cellular redox environment, function as signals in plant cells,
modulating cellular processes that may or may not directly operate as part of a
stress response. Thus, oxidative stress activates cell signalling pathways that alter
protein activities and transcription profiles. Developments in post-genomics tech-
nologies will drive the identification of more ROS-sensitive proteins and genes,
and functional genomics approaches will facilitate analyses of the roles of these
proteins and their regulation in cellular functions.
References
A-H-Mackerness S, Surplus SL, Blake P, John CF, Buchanan-Wollaston V, Jordan BR,

Thomas B (1999a) Ultraviolet-B-induced stress and changes in gene expression in
Arabidopsis thaliana:role of signalling pathways controlled by jasmonic acid, ethylene
and reactive oxygen species. Plant Cell Environ 22:1413-1423
A-H-Mackerness S, Thomas B (1999b) Effects of UV-B radiation on plants:gene expres-
sion and signal transduction pathways. In Plant Responses to Environmental Stress.
Smallwood MF, Calvert CM, Bowles DJ (eds), Bios Scientific Publishers, UK.
Allan CA, Fluhr R (1997) Two distinct sources of elicited reactive oxygen speices in to-
bacco epidermal cells. Plant Cell 9:1559-1572
Allen RD (1995) Dissection of oxidative stress tolerance using transgenic plants. Plant
Physiol 107:1049-1054
Alvarez ME, Lamb C (1997) Oxidative burst-mediated defense responses in plant disease
resistance. In:Oxidative Stress and the Molecular Biology of Antioxidant Defenses
(ed:Scandalios JG), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY,
pp 815-839
Alvarez ME, Pennell RI, Meijer P-J, Ishikawa A, Dixon RA, Lamb C (1998) Reactive oxy-
gen intermediates mediate a systemic signal network in the establishment of plant im-
munity. Cell 92:773-784
Amicucci E, Gaschler K, Ward JM (1999) NADPH oxidase genes from tomato (Lycopersi-
con esculentum) and curly-leaf pondweed (Potamogeton crispus). Plant Biol 1:524-
528
Amor Y, Chevion M, Levine A (2000) Anoxia pretreatment protects soybean cells against
H2O2-induced cell death:possible involvement of peroxidases and of alternative oxi-
dase. FEBS Lett 477:175-180
Baker CJ, Orlandi EW (1995) Active oxygen in plant pathogenesis. Annu Rev Phytopathol
33:299-321
Baxter-Burrell A, Yang Z, Springer PS, Bailey-Serres J (2002) RopGAP4-dependent Rop

GTPase rheostat control of Arabidopsis oxygen deprivation tolerance. Science
296:2026-2028
Belles-Boix E, Babiychuk E, Van Montagu M, Inze D, Kushnir S (2000) CEO1, a new pro-
tein from Arabidopsis thaliana, protects yeast against oxidative damage. FEBS Lett
482:19-24
Bestwick C, Bolwell P, Mansfield J, Nicole M, Wojtaszek P (1999) Generation of the oxi-
dative burst – scavenging for the truth. Trends Plant Sci 4:88-89
Blee KA, Jupe SC, Richard G, Zimmerlin A, Davies DR, Bolwell GP (2001) Molecular
identification and expression of the peroxidase responsible for the oxidative burst in
French bean (Phaseolus vulgaris L.) and related members of the gene family. Plant
Mol Biol 47:607-620
Bolwell GP (1999) Role of active oxygen species and NO in plant defence responses. Curr
Bolwell GP, Bindschedler LV, Blee KA, Butt VS, Davies DR, Gardner SL, Gerrish C,
Minibayeva F (2002) The apoplastic oxidative burst in response to biotic stress in
plants:a three-component system. J Exp Bot 53:1367-1376
Bowler C, Fluhr R (2000) The role of calcium and activated oxygens as signals for control-
ling cross-tolerance. Trends Plant Sci 5:241-245
Bray EA, Bailey-Serres J, Weretilnyk E (2000) Responses to Abiotic Stress. In Biochemis-
try and Molecular Biology of Plants (eds:Buchanan B, Gruissem W, Jones, R) Ameri-
can Society of Plant Biologists, Rockville, USA, pp 1158-1203
Chamnongpol S, Willekens H, Moeder W, Langebartels C, Sandermann H Jr, Van Montagu
M, Inze D, Van Camp W (1998) Defense activation and enhanced pathogen tolerance
induced by H2O2 in transgenic tobacco. Proc Natl Acad Sci USA 95:5818-5823
Clarke A, Desikan R, Hurst RD, Hancock JT, Neill SJ (2000) NO way back:nitric oxide
and programmed cell death in Arabidopsis thaliana suspension cultures. Plant J
24:667-677
Conklin PL, Williams EH, Last RL (1996) Environmental stress sensitivity of an ascorbic
acid-deficient Arabidopsis mutant. Proc Natl Acad Sci USA 93:9970-9974
Conklin PL, Saracco SA, Norris SR, Last RL (2000) Identification of ascorbic acid-
deficient Arabidopsis thaliana mutants. Genetics 154:847-856
Cooper CE, Patel RP, Brookes PS, Darley-Usmar VM (2002) Nanotransducers in cellular
redox signalling:modification of thiols by reactive oxygen and nitrogen species.
Trends Biochem Sci 27:489-492
Corpas FJ, Barroso JB, del Rio LA (2001) Peroxisomes as a source of reactive oxygen spe-
cies and nitric oxide signal molecules in plant cells. Trends Plant Sci 6:145-150.
Czernic P, Visser B, Sun W, Savoure A, Deslandes L, Marco Y, Van Montagu M, Ver-
bruggen N (1999) Characterisation of an Arabidopsis thaliana receptor-like protein
kinase gene activated by oxidative stress and pathogen attack. Plant J 18:321-327
Danon A (2002) Redox reactions of regulatory proteins:do kinetics promote specificity?
Trends Biochem Sci 27:197-203
Dat J, Vandenabeele S, Vranova E, Van Montagu M, Inze D, Van Breusegem FV (2000)
Dual action of the active oxygen species during plant stress responses. CMLS Cell Mol
Life Sci 57:779-795
Davison PA, Hunter CN, Horton P (2002) Overexpression of β carotene hydroxylase en-
hances stress tolerance in Arabidopsis. Nature 418:203-206
Delaunay A, Isnard A-D, Toledano MB (2000) H2O2 sensing through oxidation of the Yap1
transcription factor. EMBO J 19:5157-5166
Delledonne M, Xia Y, Dixon RA, Lamb C (1998) Nitric oxide functions as a signal in plant
disease resistance. Nature 394:585-588
Delledonne M, Zeier J, Marocco A, Lamb C (2001) Signal interactions between nitric oxide
and reactive oxygen intermediates in the plant hypersensitive disease resistance re-
sponse. Proc Natl Acad Sci USA 98:13454-13459
Desikan R, Burnett E, Hancock JT, Neill SJ (1998a) Harpin and hydrogen peroxide induce
the expression of a homologue of gp91-phox in Arabidopsis thaliana suspension cul-
tures. J Exp Bot 49:1767-1771
Desikan R, Reynolds A, Hancock JT, Neill SJ (1998b) Harpin and hydrogen peroxide both
initiate programmed cell death but have differential effects on gene expression in
Arabidopsis suspension cultures. Biochem J 330:115-120
Desikan R, Clarke A, Hancock JT, Neill SJ (1999) H2O2 activates a MAP kinase-like en-
zyme in Arabidopsis thaliana suspension cultures. J Exp Bot 50:1863-1866
Desikan R, Neill SJ, Hancock JT (2000) Hydrogen peroxide-induced gene expression in
Arabidopsis thaliana. Free Rad Biol Med 28:773-778
Desikan R, Hancock JT, Ichimura K, Shinozaki K, Neill SJ (2001a) Harpin induces activa-
tion of the Arabidopsis mitogen-activated protein kinases AtMPK4 and AtMPK6.
Desikan R, A-H Mackerness S, Hancock JT, Neill SJ (2001b) Regulation of the Arabidop-
sis transcriptome by oxidative stress. Plant Physiol 127:159-172
Doke N (1983) Involvement of superoxide anion generation in the hypersensitive response
of potato tuber tissues to infection with an incompatible race of Phytophthora infestans
and to the hyphal wall components. Physiol Plant Pathol 23:345-357
Durrant WE, Rowland P, Piedras P, Hammond-Kosack KE, Jones JDG (2000) cDNA-
AFLP reveals a striking overlap in race-specific resistance and wound-response gene
expression profiles. Plant Cell 12:963-977
Fath A, Behke PC, Jones RL (2001) Enzymes that scavenge reactive oxygen species are
down-regulated prior to gibberellic acid-induced programmed cell death in barley aleu-
rone. Plant Physiol 126:156-166
Finkel T (2000) Redox-dependent signal transduction. FEBS Letts 476:52-54
Finkel T, Holbrook NJ (2000) Oxidants, oxidative stress and the biology of ageing. Nature
408:239-247
Foyer CH, Theodoulou FL, Delrot S (2001) The functions of inter- and intracellular glu-
tathione transport systems in plants. Trends Plant Sci 6:486-492
Garreton V, Carpinelli J, Jordana X, Holuigue L (2002) The as-1 promoter element is an
oxidative stress-responsive element and salicylic acid activates it via oxidative species.
Gasch A, Spellman P, Kao C, Harel O, Eisen M, Storz G, Botstein D, Brown P (2000) Ge-
nomic expression programs in the response of yeast cells to environmental changes.
Mol Biol Cell 11:4241-4257
Gidrol X, Sabelli PA, Fern YS, Kush AK (1996) Annexin-like protein from Arabidopsis
thaliana rescues oxyR mutant of Escherichia coli from H2O2 stress. Proc Natl Acad Sci
USA 93:11268-11273
Glazener JA, Orlandi EW, Baker CJ (1996) The active oxygen response of cell suspensions
to incompatible bacteria is not sufficient to cause hypersensitive cell death. Plant
Physiol 110:759-763
Godon C, Lagniel G, Lee J, Buhler J-M, Kieffer S, Perrot M, Boucherie H, Toledano MB,
Labarre J (1998) The H2O2 stimulon in Saccharomyces cerevisiae. J Biol Chem 34;
22480-22489
Gogorcena Y, Iturber-Ormaetxe I, Escuredo PR, Becana M (1995) Antioxidant defenses
against activated oxygen in pea nodules subjected to water stress. Plant Physiol
108:753-759
Grant JJ, Yun B-W, Loake GJ (2000) Oxidative burst and cognate redox signalling reported
by luciferase imaging:identification of a signal network that functions independently of
ethylene, SA and Me-JA but is dependent on MAPKK activity. Plant J 24:569-582
Grant M, Brown I, Adams S, Knight M, Ainslie A, Mansfield J (2000) The RPM1 plant
disease resistance gene facilitates a rapid and sustained increase in cytosolic calcium
that is necessary for the oxidative burst and hypersensitive cell death. Plant J 23:441-
450
Greenberg JT(1997) Programmed cell death in plant-pathogen interactions. Annu Rev Plant
Guan LM, Zhao J, Scandalios JG (2000) Cis-elements and trans-factors that regulate ex-
pression of the maize Cat1 antioxidant gene in response to ABA and osmotic
stress:H2O2 is the likely intermediary signaling molecule for the response. Plant J
22:87-95
Harding SA, Oh S-H, Roberts DM (1997) Transgenic tobacco expressing a foreign
calmodulin gene shows an enhanced production of active oxygen species. EMBO J
16:1137-1144
He J-h, Dong F-C, An G-y, Song C-P (2002) Isolation and characterisation of reactive oxy-
gen species-insensitive mutants in Arabidopsis thaliana. Xibei Zhiwu Xuebao 22:496-
504
Hernandez JA, Corpas FJ, Gomez M, del Rio LA, Sevilla F (1993) Salt-induced oxidative
stress in chloroplasts of pea plants. Plant Physiol 89:103-110
Horemans N, Foyer CH, Asard H (2000) Transport and action of ascorbate at the plant
plasma membrane. Trends Plant Sci 5:263-267
Hwang I, Chen H-C, Sheen J (2002) Two-component signal transduction pathways in
Arabidopsis. Plant Physiol 129:500-515
Ichinose Y, Andi S, Doi R, Tanaka R, Taguchi F, Sasabe M, Toyoda K, Shiraishi T, Ya-
mada T (2001) Generation of hydrogen peroxide is not required for harpin-induced
apoptotic cell death in tobacco BY-2 cell suspension cultures. Plant Physiol Biochem
39:771-776
Jabs T, Tschope M, Collinge C, Hahlbrock K, Scheel D (1997) Elicitor-stimulated ion
fluxes and O2.- from the oxidative burst are essential components in triggering defense
gene activation and phytoalexin synthesis in parsley. Proc Natl Acad Sci USA
94:4800-4805
Jiang M, Zhang J (2001) Effect of abscisic acid on active oxygen species, antioxidant de-
fence system and oxidative damage in leaves of maize seedlings. Plant Cell Physiol
42:1265-1273
Jiang M, Zhang J (2002) Involvement of plasma membrane NADPH oxidase in abscisic
acid- and water stress-induced antioxidant defense in leaves of maize seedlings. Planta
215:1022-1030
Joo JH, Bae YS, Lee JS (2001) Role of auxin-induced reactive oxygen species in root
gravitropism. Plant Physiol 126:1055-1060
Karin M, Liu Z, Zandi E (1997) AP-1 function and regulation. Curr Opin Cell Biol 9:240-
246
Karpinski S, Reynolds H, Karpinska B, Wingsle G, Creissen G, Mullineaux P (1999) Sys-
temic signaling and acclimation in response to excess excitation energy in Arabidopsis.
Science 284:654-657
Kawasaki T, Henmi K, Ono E, Hatakeyama S, Iwano M, Satoh H, Shimamoto K (1999)
The small GTP-binding protein Rac is a regulator of cell death in plants. Proc Natl
Acad Sci USA 96:10922-10926
Keller T, Damude HG, Werner D, Doerner P, Dixon RA, Lamb C (1998) A plant homolog
of the neutrophil NADPH oxidase gp91-phox subunit gene encodes a plasma mem-
brane protein with Ca2+ binding motifs. Plant Cell 10:255-266.
Kovtun Y, Chiu W-L, Tena G, Sheen J (2000) Functional analysis of oxidative stress-
97:2940-2945
Lamb C, Dixon RA (1997) The oxidative burst in plant disease resistance. Annu Rev Plant
Lambeth JD (2002) Nox/Duox family of nicotinamide adenine dinucleotide (phosphate)
oxidases. Curr Opin Hematol 9:11-17
Lee S, Choi H, Suh S, Doo I-S, Oh K-Y, Choi EJ, Taylor ATS, Low PS, Lee Y (1999) Oli-
gogalacturonic acid and chitosan reduce stomatal aperture by inducing the evolution of
reactive oxygen species from guard cells of tomato and Commelina communis. Plant
Physiol 121:147-152
Levine A, Tenhaken R, Dixon R, Lamb C (1994) H2O2 from the oxidative burst orches-
trates the plant hypersensitive disease resistance response. Cell 79:583-593
Lindgren PB, Jaokbek JL, Boutt EA, Libby SJ (2002) The slyA gene of the bacterial plant
pathogen Pseudomonas syringae is required for virulence. Abstracts of the American
Society for Microbiology 102:66-67
Lopez-Huertas E, Charlton WL, Johnson B, Graham IA, Baker A (2000) Stress induces
peroxisome biogenesis genes. EMBO J 19:6770-6777
Maxwell DP, Nickels R, McIntosh L (2002) Evidence of mitochondrial involvement in the
transduction of signals required for the induction of genes associated with pathogen at-
tack and senescence. Plant J 29:269-279
McAinsh MR, Clayton H, Mansfield TA, Hetherington AM (1996) Changes in stomatal
behaviour and guard cell cytosolic free calcium in response to oxidative stress. Plant
Physiol 111:1031-1042
Meinhard M, Grill E (2001) Hydrogen peroxide is a regulator of ABI1, a protein phos-
phatase 2C from Arabidopsis. FEBS Letts 508:443-446
Meinhard M, Rodriguez PL, Grill E (2002) The sensitivity of ABI2 to hydrogen peroxide
links the abscisic acid-response regulator to redox signalling. Planta 214:775-782
Mishra NP, Fatma T, Singhal GS (1995) Development of antioxidative defense systems of
wheat seedlings in response to high light. Physiol Plant 95:77-82
Mitsuhara I, Malik KA, Miura M, Ohashi Y (1999) Animal cell-death suppressors Bcl-
xLand Ced-9 inhibit cell death in tobacco plants. Curr Biol 9:775-778
Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7:405-
410
Mittler R, Herr EH, Orvar BL, van Camp W, Willekens H, Inze D, Ellis BE (1999) Trans-
genic tobacco plants with reduced capability to detoxify reactive oxygen intermediates
are hyperresponsive to pathogen infection. Proc Natl Acad Sci USA 96:14165-14170
Moon H, Lee B, Choi G, Shin D, Prasad T, Lee O, Kwak S-S, Kim DH, Nam J, Bahk J,
Hong JC, Lee SY, Cho MJ, Lim CO, Yun D-J (2003) NDP kinase 2 interacts with two
oxidative stress-activated MAPKs to regulate cellular redox state and enhances multi-
ple stress tolerance in transgenic plants. Proc Natl Acad Sci USA 100:358-363
Murata Y, Pei Z-M, Mori IC, Schroeder J (2001) Abscisic acid activation of plasma mem-
brane Ca2+ channels in guard cells requires cytosolic NAD(P)H and is differentially
and abi2-1 protein phosphatase 2C mutants. Plant Cell 13:2513-2523
Mustilli A-C, Merlot S, Vavasseur A, Fenzi F, Giraudat J (2002) Arabidopsis OST1 protein
Neill SJ, Desikan R, Clarke A, Hancock JT (2002a) Nitric oxide is a novel component of
abscisic acid signalling in stomatal guard cells. Plant Physiol 128:13-16
Neill SJ, Desikan R, Clarke A, Hurst RD, Hancock JT (2002b) Hydrogen peroxide and ni-
tric oxide as signalling molecules in plants. J Exp Bot 53:1237-1247
Neill S, Desikan R, Hancock J (2002c) Hydrogen peroxide signalling. Curr Opin Plant Biol
5:388-395
Noctor G, Foyer CH (1998) Ascorbate and glutathione:keeping active oxygen under con-
trol. Annu Rev Plant Physiol Plant Mol Biol 49:249-279
Noctor G, Gomez L,Vanacker H, Foyer CH (2002) Interactions between biosynthesis,
compartmentation and transport in the control of glutathione homeostasis and signal-
ling. J Exp Bot 53:1283-1304
Orozco-Cardenas ML, Ryan C (1999) Hydrogen peroxide is generated systemically in plant
leaves by wounding and systemin via the octadecanoid pathway. Proc Natl Acad Sci
USA. 96:6553-6557
Orozco-Cardenas ML, Narvaez-Vasquez J, Ryan CA (2001) Hydrogen peroxide acts as a
second messenger for the induction of defense genes in tomato plants in response to
wounding, systemin, and methyl jasmonate. Plant Cell 13:179-191
Pagnussat GC, Simontacchi M, Puntarulo S, Lamattina L (2002) Nitric oxide is required for
root organogenesis. Plant Physiol 129:954-956
Pei Z-M, Murata Y, Benning G, Thomine S, Klusener B, Allen GJ, Grill E, Schroeder JI
(2000) Calcium channels activated by hydrogen peroxide mediate abscisic signalling
in guard cells. Nature 406:731-734
Polle A (1996) Mehler reaction:friend or foe in photosynthesis? Botanica Acta 109:84-89
Rao MV, Paliyath G, Ormrod DP (1996) Ultraviolet-B- and ozone-induced biochemical
changes in antioxidant enzymes Arabidopsis thaliana. Plant Physiol 110:125-136
Reeves EP, Lu H, Lortat H, Jacobs L, Messina CGM, Bolsover S, Gabella G, Potma EO,
Warley A, Roes J, Segal AW (2002) Killing activity of neutrophils is mediated
through activation of proteases by K+ flux. Nature 416:291-297
Ren D, Yang H, Zhang S (2002) Cell death mediated by MAPK is associated with hydro-
gen peroxide production in Arabidopsis. J Biol Chem 277:559-565
Rhee SG, Bae YS, Lee S-R, Kwon J (2000) Hydrogen peroxide:a key messenger that
modulates protein phosphorylation through cysteine oxidation. Science’s STKE
http://stke.sciencemag.org/cgi/content/full/OC_sigtrans;2000/53/pe1
Rizhsky L, Hallak-Herr E, Van Breusegem F, Rachmilevitch S, Barr JE, Rodermel S, Inze
D, Mittler R (2002) Double antisense plants lacking ascorbate peroxidase and catalase
are less sensitive to oxidative stress than single antisense plants lacking ascorbate per-
oxidase or catalase. Plant J 32:329-342
Sagi M, Fluhr R (2001) Superoxide production by plant homologues of the gp91phox

NADPH oxidase. Modulation of activity by calcium and by tobacco mosaic virus in-
fection. Plant Physiol 126:1281-1290
Samuel MA, Miles GP, Ellis BE (2000) Ozone treatment rapidly activates MAP kinase sig-
nalling in plants. Plant J 22:367-376
Scandalios JG (2002a) The rise of ROS. Trends Biochem Sci 27:483-486
Scandalios JG (2002b) Oxidative stress responses – what have genome-scale studies taught
us? Genome Biol 3:1019.1-1019.6
Schafer FQ, Buettner GR (2001) Redox environment of the cell as viewed through the re-
dox state of the glutathione disulfide/glutathione couple. Free Rad Biol Med 11:1191-
1212
Simon-Plas F, Elmayan T, Blein J-P (2002) The plasma membrane oxidase NtrbohD is re-
sponsible for AOS production in elicited tobacco cells. Plant J 31:137-147
Singh KK (2000) The Saccharomyces cerevisiae SLN1P-SSK1P two-component system
mediates response to oxidative stress and in an oxidant-specific fashion. Free Rad Biol
Med 29:1043-1050
Smirnoff N (2000) Ascorbic acid:metabolism and functions of a multi-facetted molecule.
Solomon M, Belenghi B, Delledonne M, Menachem E, Levine A (1999) The involvement
of cysteine proteases and protease inhibitor genes in the regulation of programmed cell
death in plants. Plant Cell 11:431-443
Sweetlove LJ, Heazlewood JL, Herald V, Holtzapffel R, Day DA, Leaver CJ, Millar AH
(2002) The impact of oxidative stress on Arabidopsis mitochondria. Plant J 32:891-904
Swidzinski JA, Sweetlove LJ, Leaver CJ (2002) A custom microarray analysis of gene ex-
pression during programmed cell death in Arabidopsis thaliana. Plant J 30:431-446
The Arabidopsis Genome Initiative (2000) Analysis of the genome of the flowering plant
Arabidopsis thaliana. Nature 408:796-815
Tissier AF, Marillonnet S, Klimyuk V, Patel K, Torres MA, Muphy G, Jones JDG (1999)
Multiple independent defective suppressor-mutator transposon insertions in Arabidop-
sis:a tool for functional genomics. Plant Cell 11:1841-1852
Tiwari BS, Belenghi B, Levine A (2002) Oxidative stress increased respiration and genera-
tion of reactive oxygen species, resulting in ATP depletion, opening of mitochondrial
permeability transition, and programmed cell death. Plant Physiol 128:1271-1281
Torres MA, Onouchi H, Hamada S, Machida C, Hammond-Kossack KE, Jones JDG (1998)
Six Arabidopsis thaliana homologues of the human respiratory burst oxidase (gp91-
phox). Plant J 14:365-370
Torres MA, Dangl JL, Jones JDG (2002) Arabidopsis gp91phox homologues AtrbohD and
AtrbohF are required for accumulation of reactive oxygen intermediates in the plant
defense response. Proc Natl Acad Sci USA 99:517-522
Tsang EWT, Bowler C, Herouart D, Van Camp W, Villarroel R, Genetello C et al (1991)
Differential regulation of superoxide dismutases in plants exposed to environmental
stress. Plant Cell 3:783-792
Vanacker H, Carver TLW, Foyer CH (2000) Early H2O2 accumulation in mesophyll cells
leads to induction of glutathione during the hypersensitive response in the barley-
powdery mildew interaction. Plant Physiol 123:1289-1300
Vernoux T, Sanchez-Fernandez R, May M (2002) Glutathione biosynthesis in plants.

In:Inze D, Montagu MV (eds) Oxidative stress in plants. Taylor and Francis, London,
pp 297-311
Vranova E, Atichartpongkul S, Villarroel R, Van Montagu M, Inze D, Van Camp W
(2002a) Comprehensive analysis of gene expression in Nicotiana tabacum leaves ac-
climated to oxidative stress. Proc Natl Acad Sci USA 99:10870-10875
Vranova E, Inze D, Van Breusegem F (2002b) Signal transduction during oxidative stress. J
Exp Bot 53:1227-1236
Willekens H, Chamnongpol S, Davey M, Schraudner M, Langebartels C, Van Montagu M,
Inze D, Van Camp W (1997) Catalase is a sink for H2O2 and is indispensable for stress
defence in C-3 plants. EMBO J 16:4806-4816
Wohlgemuth H, Mittelstrass K, Kschieschan S, Bender J, Weigel H-J, Overmyer K, Kan-
gasarvi J, Sandermann H, Langebartels C (2002) Activation of an oxidative burst is a
general feature of sensitive plants exposed to the air pollutant ozone. Plant Cell Env
25:717-726
Wojtaszek P (1997) Oxidative burst:an early plant response to pathogen infection. Biochem
J 322:681-692
Wu Y, Kwon K-S, Rhee SG (1998) Probing cellular protein targets of H2O2 with fluo-
rescein-conjugated iodoacetamide and antibodies to fluorescein. FEBS Lett 440:111-
115
Yang Z (2002) Small GTPases:versatile signaling switches in plants. Plant Cell S375-S388
Yang T, Poovaiah BW (2002) Hydrogen peroxide homeostasis:Activation of plant catalase
by calcium/calmodulin. Proc Natl Acad Sci USA 99:4097-4102
Yoshioka H, Sugie K, Park HJ, Maeda H, Tsuda N, Kawakita K, Doke N (2001) Induction
of plant gp91phox homologue by fungal cell wall arachidonic acid, and salicylic acid
in potato. Mol Plant-Microbe Interact 14:725-736
Zhang X, Dong FC, Cao JF, Song CP (2001a) Hydrogen peroxide-induced changes in in-
tracellular pH of guard cells precede stomatal closure. Cell Res 11:37-43
Zhang X, Miao YC, An GY, Zhou Y, Shangguan ZP, Gao JF, Song CP (2001b) K+ chan-
nels inhibited by hydrogen peroxide mediate abscisic acid signalling in Vicia guard
cells. Cell Res 11:195-202
Zhang X, Zhang L, Dong F, Gao J, Galbraith DW, Song C-P (2001c) Hydrogen peroxide is
involved in abscisic acid-induced stomatal closure in Vicia faba. Plant Physiol
126:1438-1448
Zhang Z, Collinge DB, Thordal-Christensen H (1995) Germin-like oxalate oxidase, a H2O2-
producing enzyme, accumulates in barley attacked by the powdery mildew fungus.
Plant J 8:139-145
Zhu D, Scandalios JG (1992) Expression of the maize MnSOD (Sod3) gene in MnSOD-
deficient yeast rescues the mutant yeast under oxidative stress. Genetics 131:803-809
Zhu D, Scandalios JG (1994) Differential accumulation of manganese-superoxide dismu-
tase transcripts in maize in response to abscisic acid and high osmoticum. Plant
Physiol 106:173-178
Abbreviations
ABA: abscisic acid

AFLP: amplified fragment length polymorphism

AOS: active oxygen species
APX: ascorbate peroxidase
DHAR: dehydroascorbate reductase
DPI: diphenylene iodonium
GR: glutathione reductase
GST: glutathione S-transferase
HR: hypersensitive response
LUC: luciferase
MAPK: mitogen activated protein kinase
MDAR: monodehydroascorbate reductase
PAL: phenylalanine ammonia-lyase
PCD: programmed cell death
rboh: respiratory burst oxidase homologue
ROS: reactive oxygen species
SA: salicylic acid
SOD: superoxide dismutase
6 Signal transduction in plant cold acclimation
Pekka Heino and E. Tapio Palva
Abstract
Temperate plants respond to low temperature by activating a cold acclimation

program leading to enhanced tolerance to freezing temperatures. This acclimation
process is accompanied by altered expression of a number of stress response genes
controlling production of proteins and metabolites that protect cellular structures
and functions from the adverse effects of freezing and freeze-induced cellular de-
hydration. The changes in cold responsive gene expression are controlled by a set
of dedicated transcription factors responding to the low temperature stimulus. We
review the complex signal network that is required for sensing and transduction of
the low temperature signal to altered gene expression and discuss the interactions
of the signal pathways involved.
6.1 Introduction
6.1.1 Low temperature stress
Plants, due to their sessile and poikilothermic nature, are constantly exposed to a
variety of biotic and abiotic stresses. This has led to evolution of adaptive mecha-
nisms that enable plant cells to sense the environmental changes and activate re-
sponses that increase their tolerance to subsequent stresses. One of the most severe
environmental challenges to plants is low temperature, which not only affects the
growth and distribution of plants but also causes serious damage to a number of
crops. Different plant species vary widely in their ability to tolerate low tempera-
ture stress (Levitt 1980; Sakai and Larcher 1987). Chilling-sensitive tropical spe-
cies can be irreparably damaged even at temperatures significantly higher than the
freezing temperature of the tissues. Injuries are caused by impairment of metabolic
processes, by alterations in membrane properties, changes in structure of proteins
and interactions between macromolecules as well as inhibition of enzymatic reac-
tions. Chilling tolerant but freezing sensitive plants are able to survive tempera-
tures slightly below zero, but are severely damaged upon ice formation in the tis-
sues. On the other hand, frost tolerant plants are able to survive variable levels of
freezing temperatures, the actual degree of tolerance being dependent on the spe-
cies, developmental stage, and duration of the stress.
Exposure of plants to subzero temperatures results in extracellular freezing of
tissues, due to the higher freezing point and presence of more active ice nucleators

152 Pekka Heino and E. Tapio Palva
in the extracellular solution compared to the cell sap. Extracellular ice formation
reduces the water potential outside the cell leading to efflux of water from the
symplast and cellular dehydration. Therefore, on the cellular level, freezing stress
is accompanied by dehydration stress and consequently, freezing tolerance is
strongly correlated with tolerance to dehydration (caused by e.g. drought or high
salinity). Freeze-induced dehydration can cause various perturbations in the mem-
brane structures, including membrane fusions and lamellar to hexagonal II phase
transitions (Steponkus and Webb 1992). Indeed, such membrane lesions appear to
be the main cause of freezing damage (Levitt 1980, Steponkus 1984, Steponkus
and Webb 1992, Steponkus et al. 1993). Although freeze-induced cellular dehy-
dration is a central cause of freezing damage, additional factors contribute to
freezing injury. Growing ice crystals can cause mechanical damage to cells and
tissues. Furthermore, freezing temperatures per se or freeze-induced dehydration
can have direct effects on cellular processes due to e.g. denaturation of proteins
and disruption of macromolecular complexes.
A common denominator in several stresses, including low temperature is the
production of reactive oxygen species (ROS), which can generate damage to dif-
ferent macromolecules in the cells (McKersie and Bowley 1998). Low tempera-
tures, especially in combination with high light can cause excessive production of
ROS and hence tolerance to freezing also correlates with effective scavenging sys-
tems for ROS to cope with this oxidative stress (Inzé and Van Montagu 1995)
6.1.2 Cold acclimation
The plant species native to temperate and boreal regions are regularly encounter-
ing and need to survive subzero temperatures. These species often employ envi-
ronmental cues, mainly low temperature, as signals to increase their freezing tol-
erance. This adaptive process known as cold acclimation has been the focus for
intensive studies since the beginning of this century, but only recently has the
knowledge about the molecular details underlying the acclimation capacity started
to accumulate. Plants need to adjust to both daily and seasonal fluctuations in
temperature, seasonal acclimation being typical for overwintering herbaceous and
woody plants. In overwintering woody plants, acclimation is normally a two-step
process. Initially, the shortening of the photoperiod below a critical value causes
growth cessation, development of dormancy and leads to a moderate increase in
freezing tolerance. The second phase of acclimation is triggered by subsequent
exposure to low temperature and is required for development of full frost hardi-
ness (Weiser 1970, Welling et al. 1997). Although independent exposure to short
photoperiod or low temperature can trigger some development of freezing toler-
ance (Welling et al. 2002) the full cold, acclimation response requires synergistic
action of both factors (Puhakainen, Boije-Malm, Li, Heino and Palva, personal
communication). The perception of the photoperiod, presumably involving phyto-
chrome A (PhyA) (Olsen et al. 1999), is the critical component of this type of ac-
climation as demonstrated by the altered timing of acclimation in different latitu-
dinal ecotypes of the same plant species (Junttila 1980, Li et al. 2002, 2003).
6 Signal transduction in plant cold acclimation 153
In annual and many overwintering herbaceous plants, low temperature alone is

able to trigger full acclimation, regardless of the photoperiod. However, recent
studies have implicated that phytochrome mediated processes can have a role in
the acclimation process also in herbaceous plants (Tepperman et al. 2001, Kim et
al. 2002). Furthermore, controlled photosynthesis is necessary for acclimation,
partly because the acclimation process requires energy provided by photosynthesis
(Wanner and Junttila 1999) and partly to prevent formation of excess exitation en-
ergy, which would otherwise lead to photoinhibition and formation of reactive
oxygen species (Foyer et al. 1994).
The close association of freezing to other stresses resulting in water deficit,
such as drought or high salinity suggests that adaptations to these stresses could
share common components. Increase in the level of the phytohormone abscisic
acid (ABA) is one of the early responses to water deficit stress (Ingram and
Bartels 1996). Indeed, there is also a transient increase in the level of ABA during
cold acclimation (Chen et al. 1983, Lalk and Dörffling 1985, Ryu and Li 1994,
Lång et al. 1994). Even if the direct involvement of ABA in cold acclimation is
not unequivocally demonstrated, other lines of evidence support a role for this
hormone in the acclimation process: (i) Increased freezing tolerance can be
achieved by application of ABA to the plants at normal growth temperatures
(Chen et al. 1983, Lång et al. 1989). (ii) Both ABA-deficient and ABA-insensitive
mutant of Arabidopsis (Koornneef et al. 1982, 1984) appear to be impaired in their
ability to cold acclimate (Heino et al. 1990, Gilmour and Thomashow 1991, Män-
tylä et al. 1995). Recently, Llorente et al. (2000) and Xiong et al. (2001a) isolated
Arabidopsis mutants deficient in acclimation and expression of low temperature
responsive genes. The mutations, frs1 and los5, respectively were found to be alle-
lic to each other and to the aba3 mutation, and lead to ABA deficiency.
FRS1/LOS5/ABA3 has a central role in ABA biosynthesis; it is involved in the
generation of the sulphurated form of a molybdenum cofactor needed for the func-
tion of the aldehyde oxidase catalyzing the last step in ABA biosynthesis. How-
ever, the loss of low temperature responsiveness in los5 seems not to be due to
ABA deficiency, because ABA addition did not restore the cold inducibility of
gene expression (Xiong et al. 2001a). It appears that in addition to its role in ABA
biosynthesis, LOS5 has another, currently unknown function in cold acclimation.
The ability to cold acclimate is a polygenic trait, controlled by a number of
genes, each likely having a small but additive effect on freezing tolerance devel-
opment. Environmentally controlled expression of these genes is in turn leading to
a number of physiological, cellular and molecular alterations, including changes in
membrane lipid composition, accumulation of compatible solutes, changes in phy-
tohormone and antioxidant levels and synthesis of novel proteins (Fig. 1) (Graham
and Patterson 1982, Guy 1990, Thomashow 1999, Xin and Browse 2000). For the
most part, the alterations are derived from altered gene expression. Moreover, re-
cent studies have started to define the molecular basis of these changes and this
has led to the characterization of a large number of genes induced by low tempera-
ture (Thomashow 1998, 1999). A recent estimate is that close to 25 % of the tran-
scriptome of Arabidopsis is affected in low non-freezing temperature (Kreps et al.
2002). The current challenge in cold acclimation research is to define, which of
Fig. 1. Several environmental cues may trigger expression of cold acclimation related
genes. The acclimation process is accompanied by alterations in protein and metabolite pro-
files, including changes in components involved in protection against low temperature per
se or against freeze induced dehydration as well as components allowing growth at a lower
temperature regime
these genes are actually involved in development of freezing tolerance. Cold re-
sponsive genes identified so far fall into two distinct main categories. Firstly,
genes encoding enzymes or structural components of the cells, that are believed to
participate in direct protection the cells against freezing damage (Thomashow
1998, 1999, Palva and Heino 1997, Hiilovaara-Teijo and Palva 1998). Secondly,
genes encoding transcription factors and other regulatory proteins, that are be-
lieved to regulate the low temperature responses either transcriptionally or post-
transcriptionally (Thomashow 1998, 1999, 2001, Nuotio et al. 2001, Viswanathan
and Zhu 2002). Despite recent progress, we have only started to understand the
molecular details of the regulatory mechanisms controlling low temperature re-
sponses. The complexity of the cold responsive transcriptome and the multitude of
stimuli triggering acclimation suggest that plants have several parallel and inter-
acting pathways that can lead to enhanced freezing tolerance. The presence of
these multiple pathways was already suggested by the fact that several low tem-
perature responsive genes, whose expression correlates with increased freezing
tolerance, are also responsive to exogenous ABA (Palva 1994). Early gene expres-
sion studies by utilizing the aba1 and abi1 mutants of Arabidopsis demonstrated
that the expression of a subset of the low temperature and drought responsive
genes is ABA dependent, whereas some of them are activated through both ABA-
independent and ABA-mediated pathways (Nordin et al. 1991, Gilmour and
Thomashow 1991, Lång and Palva 1992, Palva 1994). Current studies in several
laboratories have led to identification of components of such signal pathways (re-
cently reviewed by Viswanathan and Zhu 2002) and this has started to clarify how
plants perceive the low temperature signal and transduce this information into the
nucleus to activate specific gene expression leading to enhanced freezing toler-
ance.
6.1.3 Molecular dissection of cold acclimation
A combination of several types of approaches has been instrumental in identifying

components and elucidating molecular mechanisms of cold acclimation. These in-
clude pharmacological dissection of signal pathways, molecular analysis of cold
responsive genes and their expression (reviewed by Viswanathan and Zhu 2002)
and more recently expression profiling of the cold responsive transcriptome (Seki
et al. 2001, Fowler and Thomashow 2002, Kreps et al. 2002). One of the most
powerful approaches to elucidate the cold acclimation process in the model plant
Arabidopsis has been isolation of mutants. Several mutational screens have been
employed to explore the mechanisms of freezing tolerance and signal transduction
pathways leading to low temperature responsive gene expression. Warren and col-
leagues isolated Arabidopsis mutants that fail to develop full freezing tolerance af-
ter cold acclimation and thus should be very informative for understanding the
cold acclimation response (McKown et al. 1996, Warren et al. 1996). Most of the
seven isolated sfr (sensitive to freezing) mutants did not compromise induction of
previously characterized low temperature responsive genes, even if they are defi-
cient in their cold acclimation capacity. These mutants may thus define novel
components involved in freezing tolerance development. However, one of the mu-
tants, sfr6, was shown to be deficient in induction of a subset of cold regulated
genes. SFR6 appears to specifically affect the cold induction of genes whose acti-
vation is mediated by the DRE/CRT-element in their promoter. This element is the
binding site for the CBF/DREB1 family of transcription factors (see 6.5.2) and
consequently sfr6 appears to be deficient in CBF-mediated target gene activation
(Knight et al. 1999). Interestingly SFR6 appears also to be involved in ABA regu-
lation of gene expression mediated by the abscisic acid response element (ABRE),
because ABA induction of the kin1 gene (Kurkela and Borg-Franck 1992) was
also abolished in this mutant (Knight et al. 1999). Positional cloning of the sfr
genes should enlighten their role in cold acclimation.
In a related screen, Xin and Browse have isolated Arabidopsis mutants that are
constitutively freezing tolerant (Xin and Browse 1998). One of the mutants, es-
kimo1 (esk1) exhibited constitutive freezing tolerance of about 80% of the toler-
ance level of fully acclimated wild type plants, and enhanced tolerance of accli-
mated mutant plants. However, this mutant did not show a general constitutive
expression of cold induced genes. Only the transcript of RAB18 (Lång and Palva
1992) was 2-3 fold elevated both in non-acclimated as well as in acclimated plants
(Xin and Browse 1998). Instead, esk1 had elevated levels of sugars and constitu-
tively high proline content, which was also correlating with highly increased ex-
pression of the gene encoding ∆1-pyrroline-5-carboxylate synthase, catalyzing the
first committing step in proline biosynthesis (Xin and Browse 1998). It is possible
that the increased proline content is directly contributing to the freezing tolerance
of the esk1.
Zhu and colleagues have developed an efficient and sophisticated screen to iso-
late mutants in stress signal transduction (Ishitani et al. 1997). They generated a
transgenic Arabidopsis line harbouring a chimeric gene construct, containing the
firefly luciferase gene connected to the DRE/CRT and ABRE containing promoter
of the cold, drought and ABA responsive RD29A/LTI78 gene. The transgenic
plants exhibit stress and ABA responsive bioluminescence and signalling mutants
can be isolated by screening for alterations in bioluminescence. Seeds of trans-
genic plants were mutagenized with ethyl methanesulfonate (EMS) and more re-
cently by T-DNA mutagenesis, and the M2 seedlings screened for altered biolumi-
nescence. The screens resulted in isolation of several mutants, which could be
divided in three categories; cos for constitutive expression of osmotically respon-
sive genes, los for low expression of osmotically responsive genes and hos for
high expression of osmotically responsive genes (Ishitani et al. 1997). The cloning
and analysis of the mutated genes is providing a wealth of information regarding
regulation of gene expression in response to abiotic stresses.
The rapid progress in cold acclimation research has recently been described in
several excellent reviews (Thomashow 1998, 1999, Shinozaki and Yamaguchi-
Shinozaki 2000, Nuotio et al. 2001, Viswanathan and Zhu 2002). The current re-
view is focused on discussing the recent progress in understanding the mecha-
nisms of cellular signalling leading to activation of low temperature responsive
genes and development of freezing tolerance.
6.2 Signal perception and low temperature sensing
6.2.1 Perception of cold
Theoretically, changes in temperature could be recognized in any part of the cell

but the cellular components that are most likely directly affected by fluctuations in
temperature are membranes and proteins. Thus, a temperature induced alteration
in e.g. structure, folding, or compartmentalization of a protein could either initiate
or modulate a signal transduction cascade activating the expression of cold re-
sponsive target genes. In plants, one of the transcriptional regulators for low tem-
perature responsive genes, CBF1, is exhibiting cold-dependent denaturation on re-
gions outside its DNA binding domain (Kanaya et al 1999). This structural
alteration has been proposed to alter the function of the protein by facilitating its
interaction with other components of the transcriptional activation complex
(Kanaya et al. 1999).
Membrane receptors and ion channel proteins provide other potential targets
that could be affected by temperature. Ding and Pickard (1993) have identified a
mechanosensitive calcium channel exhibiting temperature dependent modulation
and suggested that this protein could act as a low temperature sensor. A major
class of membrane receptors is constituted of receptor protein kinases, in which
ligand binding to the extracellular domain induces the kinase activity on the cyto-
plasmic side of the receptor. Theoretically, the lack of ligand would not support
the existence of a receptor kinase in low temperature sensing. However, low tem-
perature could cause an alteration of the structure of the sensory domain of the
protein, either directly or through structural changes in the membrane. Such
changes could either activate the kinase domain directly or allow protein-protein
interactions needed for activation. Interestingly, receptor-like protein kinase genes
have recently been demonstrated to be upregulated in response to low temperature
in Arabidopsis (Hong et al. 1997, Kreps et al. 2002). Whether receptor-like
kinases are involved in temperature sensing or mediating other, unknown, re-
sponses involved in low temperature, signalling remains to be seen.
Two component regulatory systems, composed of a membrane bound sensor
histidine kinase and a corresponding response regulator protein, are central to
sensing of environmental cues in prokaryotes. In Synecocystis PCC6803 a his-
tidine kinase, Hik33, has been identified as a putative low temperature sensor (Su-
zuki et al. 2000). Hik33 autophosphorylation is induced by membrane rigidifica-
tion caused by low temperature and this leads to activation of a subset of low
temperature responsive genes, including genes for fatty acid desaturases (Suzuki
et al. 2000, 2001). Interestingly, two component systems have been identified as
components of ethylene and cytokinin signal transduction pathways in plants
(Chang et al. 1993, Inoue et al. 2001, Urao et al. 2000) and recently a two compo-
nent sensor kinase, AtHK1 from Arabidopsis was associated with osmoregulation
(Urao et al.1999). AtHK1 was shown to complement the sln mutant and mediate
osmosensing in yeast (Urao et al. 2000). Consequently, Urao et al. (2000) pro-
posed that the AtHK1 kinase might act as an osmosensor in Arabidopsis. Interest-
ingly, the corresponding gene is also responsive to low temperature.
6.2.2 Membrane rigidification
Membrane fluidity is directly affected by changes in temperature, and may hence

be involved in low temperature sensing. Murata and Los (1997) suggested that a
primary signal upon a change in temperature might be a change in membrane flu-
idity, which is one of the most rapid effects of temperature on the plasma mem-
brane. Pd-catalyzed hydrogenation of the membrane lipids - a treatment expected
to reduce membrane fluidity - rapidly induced expression of the desA gene encod-
ing a fatty acid desaturase in Synchocystis PCC6803 (Vigh et al. 1993). The in-
volvement of membrane rigidification in activation of low temperature responsive
genes in Synecocystis PCC6803 was further confirmed by studies utilizing a dou-
ble mutant desA/desD. This mutant only synthesizes a saturated C16 fatty acid and
a mono-unsaturated C18 fatty acid and consequently the cells have more rigid
membranes even at physiological temperatures (Inaba et al. 2003). This rigidifica-
tion enhanced the cold induction of a set of low temperature responsive genes but
had no effect on heat induction of gene expression (Inaba et al. 2003). The mecha-
nism by which reduction in membrane fluidity leads to gene activation in Syneco-
cystis appears to be at least partly mediated by activation of the plasma membrane

histidine kinase receptor Hik33 (Suzuki et al. 2000).
Örvar et al. (2000) have recently demonstrated that membrane rigidification,
connected with structural changes in cytoskeleton could be involved in thermo-
sensing also in higher plants. They demonstrated that treatment of alfalfa suspen-
sion cultures with either the membrane rigidifier DMSO or the actin microfila-
ment destabilizer cytochalasin D (CD) resulted in cold acclimation and expression
of the low temperature responsive gene CAS30 even at normal growth tempera-
ture. Conversely, treatments with the membrane fluidizer benzyl alcohol (BA) or
the actin filament stabilizer jasplakinolide (JK) were shown to prevent cold accli-
mation and induction of the CAS30 gene in these cell cultures at 4oC (Örvar et al.
2000). One of the early events in cold acclimation is temperature dependent cal-
cium influx to the cytosol (Knight et al. 1991, Monroy et al. 1993, Plieth et al.
1999). By analyzing the Ca2+-influx into alfalfa cells after treatments with DMSO,
CD, BA, or JK Örvar et al. also showed that DMSO and CD led to a Ca2+-influx at
25oC, whereas BA and JK treatments inhibited the low temperature induced Ca2+-
influx at 4oC (Örvar et al. 2000). Recently, Sangwan et al. (2001) have confirmed
the results using transgenic Brassica napus seedlings harbouring a GUS fusion to
the promoter of the low temperature responsive gene BN115. They showed that
GUS production was induced with DMSO, the microfilament destabilizer latrun-
culin B and microtubule destabilizers oryzalin and colchicine at 25oC, whereas
BA, JK and the microtubule stabilizer taxol inhibited the activation of the BN115
promoter at 4oC (Sangwan et al. 2001). Furthermore, they showed that treatment
of plants with gadolinium, a mechanosensitive Ca2+-channel blocker, prevents the
induction of the BN115 promoter after low temperature, DMSO, latrunculin B,
oryzalin or cholchicine treatments (Sangwan et al. 2001). Consequently, they pro-
posed that low temperature induced membrane rigidification, that might occur in
distinct microdomains of the membrane (Murata and Los 1997), could lead to re-
organization of the cytoskeleton and activation of mechanosensitive Ca2+-
channels. The resulting Ca2+-influx could then trigger further events in signal
transduction pathways leading to specific gene expression (Fig. 2) (Örvar et al.
2000, Sangwan et al 2001).
6.3 Role of Ca2+ in cold acclimation
Calcium is frequently involved as a second messenger in plant responses to exter-

nal stimuli (Trewavas and Malhó 1997). Several lines of evidence suggest that
calcium is also acting as a second messenger in low temperature signal transduc-
tion. A transient increase in cytosolic Ca2+-levels has been demonstrated in re-
sponse to cold shock (Knight et al. 1991, 1996, Polisensky and Braam 1996, Plieth
et al. 1999). Monroy and Dhindsa (1995) have demonstrated that in alfalfa cells,
low temperature triggers an influx of calcium into the cytosol. Treatment of cells
with calcium chelators or Ca2+-channel blockers prevented the calcium influx as
well as the expression of low temperature responsive cas15 gene and the devel-
Fig. 2. A model showing initial events in cold signalling. Low temperature causes mem-
brane rigidification, which leads to cytoskeletal rearrangements and subsequent Ca2+-influx.
Increased cytosolic Ca2+-concentration is recognized by Ca2+-binding proteins, including
calmodulin, and leads to CDPK activation. See text for details.
opment of freezing tolerance (Monroy et al. 1993, Monroy and Dhindsa 1995,
Sangwan et al. 2001). When Ca2+ influx in alfalfa cells or Brassica napus leaves
was artificially increased by using a ionophore or a Ca2+-channel agonist, cold ac-
climation specific genes were induced and freezing tolerance increased at 25oC
(Monroy and Dhindsa 1995, Sangwan et al. 2001). In analogous studies, Ca2+-
channel blockers and a Ca2+ chelator were found to inhibit the low temperature ac-
tivation of kin genes in Arabidopsis (Knight et al. 1996, Tähtiharju et al. 1997).
However, in Arabidopsis, these treatments caused only a partial inhibition of cold
induced Ca2+-influx and low temperature responsive gene expression, suggesting
that also an intracellular Ca2+ source might be involved.
Inositol trisphosphate (IP3) and cyclic adenosine 5´-diphosphate ribose
(cADPR) are able to release calcium from beet storage root vacuoles (Allen et al.
1995). Both IP3 and cADPR have been implicated as regulators of Ca2+-channels
in response to low temperature (Knight et al. 1996, Sangwan et al. 2001, Xiong et
al. 2001b). By using single cell based analysis in tomato Wu et al. (1997) demon-
strated that cADPR can mediate activation of low temperature responsive genes,
indicating that Ca2+-release from intracellular stores is also involved in acclima-
tion. They microinjected tomato hypocotyl cells with contructs, where promoters
of two cold- and ABA-responsive Arabidopsis genes LTI78/COR78/RD29A (Nor-
din et al. 1991, Gilmour and Thomashow 1991, Yamaguchi-Shinozaki and Shino-
zaki 1993) or KIN2 (Kurkela and Borg-Franck 1992) were coupled to the reporter
gene uidA (GUS) and monitored their activation in response to ABA and specific
pharmacological agents known to modulate Ca2+-homeostasis in the cytocol. Ex-
ternal application of ABA or coinjection with Ca2+ activated the two stress-
responsive genes. Coinjection with cADPR or ADP-ribocyl cyclase was sufficient
to activate the genes in the absence of ABA, whereas coinjection with 8-amino-
cADPR, a competitive inhibitor of cADPR, prevented the activation of the genes,
even when ABA was present (Wu et al.1997). Sangwan et al. (2001) have recently
shown that cADPR treatment can induce cold acclimation and activate the low
temperature responsive BN115 gene in Brassica napus seedlings at 25oC, indicat-
ing that cADPR could indeed be involved in generation of the Ca2+-influx during
low temperature exposure.
Wu et al. (1997) also studied the effect of IP3 in activation of the RD29A/LTI78
and KIN2 genes. Coinjection of the reporter constructs with IP3 activated the
genes and the activation was inhibited by heparin, a specific blocker of IP3 recep-
tors. However, heparin had no effect on ABA-induced expression of the reporter
genes, indicating that IP3 is not the primary mediator of intracellular Ca2+ release
in ABA responses (Wu et al.1997). However, IP3 has been suggested to have a
role in low temperature signalling (Knight et al. 1996). IP3 is produced by hy-
drolysis of phosphatidyl-inositol-4,5-bisphosphate (PIP2). PIP2 is synthesized by
phosphatidylinositol 4-phosphate 5-kinase and an Arabidopsis gene encoding this
enzyme has been shown to be induced by osmotic stress and ABA (Mikami et al.
1998). Hydrolysis of PIP2 is mediated by an activated phosphoinoside-specific
phpspholipase C (PI-PLC) (Trewavas and Malhó 1997). A stress and ABA re-
sponsive gene encoding a PI-PLC, whose activity is depending of Ca2+ has been
isolated from Arabidopsis (Hirayama et al. 1995). Thus, regulation of both pro-
duction and activity of PI-PLC, as well as the availability of its substrate PIP2 dur-
ing stress might control the IP3-mediated signalling. Recently, a direct connection
between phosphoinositide metabolism and stress signal transduction was shown
by Xiong et al. (2001b). They mutagenized transgenic Arabidopsis plants harbour-
ing a luciferase fusion to the promoter of the RD29A/LTI78/COR78 gene and iso-
lated a mutant, fiery1 (fry1), that showed enhanced constitutive expression of low
temperature induced genes and super-induction of them in response to cold, ABA,
salt and osmotic stress (Xiong et al. 2001b). Interestingly, even if low temperature
responsive gene expression is enhanced in the fry1 mutant, the plants are unable to
cold acclimate. Positional cloning of the FRY1 revealed that it encodes an inositol
polyphosphate 1-phosphatase, an enzyme that mediates the catabolism of IP3. The
fry1 mutant plants were shown to contain significantly higher basal level of IP3
compared to the wild type plants. In the wild type IP3 level markedly increased af-
ter 1 min of ABA treatment and returned to the basal level after 10 min of treat-
ment, whereas in the fry1 mutant accumulation of IP3 was detected after 30 min of
treatment (Xiong et al. 2001b). These results demonstrate that IP3 is involved in
mediating ABA and stress signalling and indicates that a critical issue of tolerance
development could be the ability to attenuate the IP3 signal, which otherwise could
lead to disturbances in Ca2+-homeostasis (Xiong et al. 2001b).
One of the critical issues in Ca2+-mediated processes in cells is the transient na-
ture of Ca2+ increase. Ca2+- channels in the plasma membrane or in the intracellu-
lar membranes are responsible for the Ca2+-influx, whereas Ca2+-ATPases and
Ca2+/H+ antiporters are mediating the Ca2+-efflux from cytosol to maintain Ca2+
homeostasis. Genes encoding Ca2+-ATPases have been cloned from Arabidopsis
(Sanders et al. 1999), but their role in maintaining Ca2+-homeostasis during stress
is not clear. Recently, Puhakainen et al. (1999) have shown that low temperature
treatment increases the activity of Ca2+-ATPase activity in leaves of winter rye.
Furthermore, overexpression of an Arabidopsis Ca2+/H+ antiporter in tobacco re-
sulted in sensitivity to cold shock, indicating that antiporter activity is needed for
low temperature adaptation (Hirschi 1999).
Cytosolic Ca2+-levels have been found to change in response to a variety of dif-
ferent stimuli in addition to cold, such as light, growth regulators, pathogen attack,
wind, and touch (Gilroy and Trewavas 1994). A central question is where is the
specificity in the signal? One answer could lie in information encoded in the am-
plitude, frequency, and spatial localization of the changes in Ca2+ concentration in
the cell (Gilroy and Trewavas 1994, McAinsh and Hetherington 1998). Stress in-
duced changes in cytosolic Ca2+ levels exhibit enormous variability in amplitude
and temporal and spatial distribution. For example, touch, wind, and cold shock all
cause sharp spikes in cytosolic calcium levels in tobacco seedlings within 15 sec-
onds (Knight et al. 1991, 1996), whereas oxidative and salt stresses cause rela-
tively low Ca2+ transients, lasting for several minutes (Price et al. 1994). These
differences may allow plant cells to distinguish one kind of stress from another
and to induce distinct gene expression required for adaptation to a particular
stress. Ratio- and confocal imaging have indeed revealed spatially and temporally
localized changes in calcium levels, implying that different parts of the cytoplasm
may be regulated differently in response to a stimulus. Consequently, plant cells
can distinguish between different stimulus-induced increases in cellular calcium.
The experiments of Gong et al. (1998) with transgenic, aequorin-expressing to-
bacco seedlings have demonstrated that heat shock increases cytosolic Ca2+. How-
ever, after the initial shock there was a refractory period in which additional heat
shock signals failed to increase the Ca2+-level. Throughout this refractory period,
cells retained full responsiveness to other stimuli and for example responded to
cold shock by a Ca2+ influx. Kinetics of the cytosolic Ca2+ increase after a cold
shock was similar in both cold sensitive tobacco and cold tolerant Arabidopsis.
However, tobacco was able to recover its ability to respond to cold shock 30 min-
utes after the initial shock, whereas Arabidopsis was not (Knight et al. 1996). The
authors suggest that this altered response to repeated cold stimulation is important
in the cold acclimation process.
How are the cold acclimation related Ca2+ signatures recognized? Signal trans-
duction initiated by Ca2+-influx is generally mediated through Ca2+-binding pro-
teins. Calmodulin is a highly conserved protein that has been considered as the
primary sensor for changes in cytosolic Ca2+-levels (Rudd and Frankling-Tong
1999). In Arabidopsis, environmental stimuli, including low temperature, trigger
rapid activation of genes encoding CaM and CaM related proteins. This low tem-
perature responsive expression of CaM genes is partially regulated by Ca2+
(Polisensky and Braam 1996). Studies by Monroy et al. (1993) showing that
treatment of alfalfa cells with a CaM antagonist prevented cold acclimation and
reduced expression of cold regulated genes, indicate a role for CaM in low tem-
perature signalling. On the other hand, Townley and Knight (2002) have shown
that overexpression of a gene encoding CaM in Arabidopsis leads to reduced ex-
pression of cold responsive genes, suggesting that CaM might have a role as a
negative regulator during cold acclimation. Recent studies by Zhu and colleagues
have implicated another type of Ca2+-sensor in stress signalling. Liu and Zhu
(1997) first identified an Arabidopsis mutant, sos3, which was hypersensitive to
Na+. Cloning of the SOS3 gene revealed that it encoded a protein highly similar to
the regulatory B subunit of Ca2+/calmodulin dependent phosphatase calcineurin in
animals and yeast (Liu and Zhu 1998). This calcineurin B-like (CBL) protein was
shown to mediate salt stress signalling in Arabidopsis by activating a specific pro-
tein kinase, SOS2, which then activates SOS1, a Na+/H+ antiporter (Halfer et al.
2000, Liu et al. 2000, Shi et al. 2000, Zhu 2002). A gene family encoding CBLs in
Arabidopsis was recently characterized and one of the genes, AtCBL1, shown to
be responsive to low temperature, drought and wounding (Kudla et al. 1999).
CBLs appear to be Ca2+-sensors that activate a specific family of protein kinases
called CIPKs (CBL-interacting protein kinases) and AtCBL1 has been shown to
interact with the constitutively expressed CIPK1 in calcium dependent manner
(Shi et al. 1999). Both CBLs and CIPKs are encoded by a multigene family in
Arabidopsis, but the specific functions of the corresponding proteins are mostly
unknown.
In conclusion, it seems clear that Ca2+- influx to the cytosol is part of the initial
response to low temperature. The Ca2+-signal appears to be recognized by distinct
Ca2+-binding proteins, which then transmit the signal further by activating pro-
teins, at least part of which appear to be protein kinases.
6.4 Protein phosphorylation
6.4.1 Protein kinases
It is now well established that protein phosphorylation/dephosphorylation is in-

volved in signal transduction during cold acclimation. Monroy et al. (1993) origi-
nally demonstrated that in alfalfa cell suspension cultures changes in the phos-
phorylation pattern of pre-existing proteins are part of the low temperature
response. W7, an antagonist of Ca2+-dependent protein kinases (CDPKs), was
shown to inhibit low temperature responsive gene expression and development of
freezing tolerance in both Arabidopsis (Tähtiharju et al. 1997) and alfalfa (Monroy
et al., 1993). Two CDPK encoding genes in alfalfa have been demonstrated to be
responsive to low temperature, supporting a role in cold signalling (Monroy and
Dhindsa 1995). Furthermore, Martin and Busconi (2001) have characterized a
membrane bound CDPK, whose activity is enhanced by low temperature treat-
ment. Recently, overexpression of a cold and salt stress inducible CDPK encoding
gene, OsCDPK, has been shown to enhance low temperature tolerance of chilling
sensitive rice plants (Saijo et al. 2000). Taken together, these studies indicate that
CDPKs could play a central role in mediating Ca2+-signals during acquisition of
cold of chilling tolerance. As described above, CBLs are calcium-binding proteins
that transmit Ca2+-signals by activating CIPKs. Recently Kim et al. (2003) have
shown that the gene encoding one of the members of the CIPK family, CIPK3, is
responsive to low temperature, drought, salt, and ABA. By isolating and analyzing
a T-DNA insertion mutant of CIPK3, they demonstrated that CIPK3 is regulating
stress- and ABA responsive gene expression. Interestingly, CIPK3 appears only to
regulate cold, salt, and ABA responses, because drought induction of genes was
not affected in the cipk3 mutant (Kim et al. 2003). The ABA induction of several
different classes of ABA responsive genes was also inhibited in the cipk3 mutant
and consequently Kim et al. (2003) suggested that CIPK is acting downstream the
Ca2+-signal but upstream from transcription factors that regulate low temperature
and ABA responsive promoters. Consequently, CIPK3 appears to define a compo-
nent involved in cross-talk between cold and ABA signalling during acclimation
(Kim et al. 2003).
Mitogen activated protein kinase (MAPKs) are mediators in several signal
transduction pathways in eukaryotic cells, including responses to a variety of envi-
ronmental stresses. A MAP kinase cascade involves three protein kinases.
MAPKKKs are the primary signal receivers, which upon activation phosphorylate
and activate MAPKKs. Active MAPKKs are dual specificity protein kinases,
which phosphorylate MAPKs at both tyrosine and threonine residues in the con-
served TXY motif. MAPKs in turn regulate transcription factors to generate spe-
cific responses. Components of several MAP kinase cascades have been isolated
from plants (Mizoguchi et al.1997). Jonak et al. (1996) characterized components
of a low temperature and drought regulated MAP kinase cascade in alfalfa. They
isolated a cDNA corresponding to a gene encoding for a MAPK, MMK4. MMK4
mRNA accumulated in response to low temperature and although the MMK4 pro-
tein levels were not affected by cold, the kinase activity of the protein was
strongly enhanced after 10 min of low temperature treatment, reaching maximum
activity after 60 min, and then returning to the basal level after 120 min (Jonak et
al. 1996). Recently, it was shown that the cold activation of the MMK4 (also
known as SAMK, for stress-activated MAP kinase) is mediated by membrane ri-
gidification and cytoskeletal remodelling. SAMK activity was induced in alfalfa
cell cultures at 25oC after treatment with a membrane rigidifier, DMSO, whereas a
membrane fluidizer, BA, inhibited the cold responsive activation of the SAMK
(Sangwan et al. 2002). Pre-treatment of cells with either the microfilament stabi-
lizer jasplakinolide or the microtubule stabilizer taxol inhibited low temperature
mediated activation of SAMK, whereas both microfilament and microtubul desta-
bilizers, latrunculin B, and oryzelin, respectively, activated the SAMK at 25oC.
Furthermore, cold- DMSO-, latrunculin B- and oryzalin-induced activation could
be inhibited by Ca2+-chelators EGTA and BAPTA and by Ca2+-channel blockers
lanthanum and gadolinium, demonstrating that Ca2+-influx is needed for SAMK
activation and that the Ca2+-influx is downstream from the cytoskeleton remodel-
ling (Sangwan et al. 2002).
Transcripts for a MAPK kinase kinase, ATMEKK1, and a MAPK, ATMPK3

have been shown to accumulate rapidly in Arabidopsis in response to low tem-
perature (Mizoguchi et al. 1996). An H2O2 activated MAPKKK, ANP1, has been
shown to be in the same kinase cascade as ATMPK3 and overexpression of NPK1,
a tobacco ortholog of ANP1, rendered transgenic tobacco plants more cold tolerant
(Kovtun et al. 2000). In Arabidopsis, the AtMPK4 and AtMPK6 are activated rap-
idly in response to low temperature (Ichimura et al. 2000). AtMPK4 has been
placed in a cascade comprising ATMEKK1, MEK1/ATMKK2, and ATMPK4
(Mizoguchi et al. 1998). The molecular targets for these kinase cascades remain to
be elucidated. Therefore, despite the obvious involvement of MAPK cascades in
environmental signalling in plants, their exact role in cold acclimation is still un-
known.
6.4.2 Protein phosphatases
Pharmacological studies were first used to demonstrate a role for protein phos-
phatases in cold signalling and cold acclimation. In alfalfa cells, protein phos-
phatase inhibitor okadaic acid induced the low temperature responsive CAS15
gene at 25°C but had no effect on its expression at 4°C (Monroy et al. 1998). The
protein kinase inhibitor staurosporine, on the other hand, had no effect on the non-
induced level of CAS15 transcripts at 25°C but prevented induction of the gene by
low temperature. Similarly, treatments with genistein, H7, and wortmanin, inhibit-
ing tyrosine kinases, protein kinase C and phosphoinositide kinase, respectively,
were shown to prevent the activation of the BN115 promoter and prevent devel-
opment of freezing tolerance in B. napus leaves (Sangwan et al. 2001). Con-
versely, treatment of B. napus leaves with okadaic acid or calyculin A, inhibiting
protein phosphatases 1 and 2A (PP1 and PP2A), respectively, activated the BN115
promoter and conferred freezing tolerance even at 25oC (Sangwan et al. 2001). In
a previous study, Wu et al. (1997) demonstrated that treatment with ocadaic acid
was activating reporter constructs driven by the RD29A or KIN2 promoters in
microinjected tomato hypocotyls, even in the absence of ABA, whereas treatments
with protein kinase inhibitors K252a and staurosporine inhibited the ABA-,
cADPR-, and Ca2+-mediated activation of RD29A or KIN2 promoters (Wu et al
1997). On the other hand, PP2A activity has been shown to decrease dramatically
at 4°C (Monroy et al. 1998). A protein that interacts with the catalytic subunit of
an Arabidopsis PP2A was recently identified (Harris et al. 1999). This protein is a
homolog of the yeast TAP42 protein, involved in the target-of-rapamycin (TOR)
signalling pathway, presumably regulating protein synthesis. Interestingly, the
gene for the PP2A interactor is induced with by temperature (Harris et al. 1999).
However, the function of the target PP2A is currently not known and the signifi-
cance of the interaction in cold signalling remains to be elucidated.
As discussed above, the ABA-insensitive mutant abi1 of Arabidopsis exhibits
delayed cold acclimation. In addition, the abi mutation prevents low temperature
activation of the RAB18 gene in Arabidopsis (Lång and Palva 1992, Mäntylä et al.
1995). The ABI1 gene has been shown to encode a protein related to type 2C pro-
tein phosphatase (PP2C) (Leung et al. 1994, Meyer et al. 1994), which acts as
negative regulator in ABA signalling (Gosti et al. 1999, Merlot et al. 2001). The
gene encoding ABI1 has also been shown to be transiently induced by low tem-
perature (Tähtiharju and Palva 2001) indicating that the ABI1 phosphatase could
be involved in ABA signalling during cold acclimation. Tähtiharju and Palva
(2001) characterized the role of a related PP2C, AtPP2CA, in Arabidopsis. The
AtPP2CA gene was shown to be cold responsive, but while the induced expression
of the ABI1 was transient, the cold induced expression of AtPP2C remained on
elevated level (Tähtiharju and Palva 2001). They also showed that transgenic
plants expressing AtPP2C in antisense orientation exhibited superinduction of low
temperature responsive genes during cold acclimation. In addition, cold acclima-
tion was also accelerated in antisense plants. Therefore, AtPP2C appears to be a
negative regulation of cold acclimation acting through an ABA-dependent path-
way (Tähtiharju and Palva 2001).
It is evident that protein phosphorylation is involved in the signal transduction
pathways leading to cold acclimation and several different types of kinases and
phosphatases appear to be involved in the process. However, the exact position of
the kinases in the signalling pathways and the substrates for the
kinases/phosphatases are not known. One possibility is that the Ca2+-signature
generated in the early stages of signal transduction could be used to activate
CDPKs, which then, directly or indirectly, could activate a MAP-kinase cascade.
Active MAPK could then activate a transcription factor, which triggers altered
gene expression.
6.5 Regulation of gene expression in response to low

temperature
6.5.1 Gene expression in response to cold
Cold acclimation is accompanied by altered expression of a number of genes,

some of which are likely to play a critical role in development of freezing toler-
ance. The cold responsive genes seem to exhibit a temporally complex pattern of
expression involving both transcriptional and post-transcriptional controls
(Hughes and Dunn 1996) The cold-responsive genes (LTI/COR/CAS/KIN/
ERD/RD) are often also responsive to other stress-related stimuli, such as drought,
salt, and ABA (Thomashow 1999, Shinozaki and Yamaguchi-Shinozaki 2000,
Nuotio et al. 2001, Zhu 2001). Recent studies utilizing expression profiling have
confirmed that a large amount of changes in gene expression is indeed involved in
plant response to low temperature (Seki et al. 2001, Fowler and Thomashow 2002,
Kreps et al. 2002). Kreps et al. (2002) have shown that out of the ~8000 Arabi-
dopsis genes analyzed 2086 were responding to cold, 42% of those being induced,
when the level of change in expression compared to the untreated control was at
least 2-fold. This indicates that about 25% of the Arabidopsis transcriptome could
be responding to low temperature.
Earlier expression studies with limited number of genes have already indicated
clearly distinct temporal patterns of cold-induced gene expression. In Arabidopsis,
many of the low temperature responsive transcripts are detectable after 1-2 hours
of low temperature exposure and the transcript levels remain high as long as the
plants are kept at low temperature, and rapidly return to low basal levels upon re-
turn to normal growth temperatures (Palva 1994, Thomashow 1999). However,
many of the cold responsive genes are only transiently induced in the early and
middle phases of cold acclimation. The recent expression profiling studies have
expanded the previous work and underlined the complexity of the expression pat-
terns. From the 2086 changes that Kreps et al. detected most were only transient.
Similarly, Fowler and Thomashow (2002) have also profiled the expression of
~8000 Arabidopsis genes in response to low temperature. Out of the 218 genes
that were found to be at least three-fold induced in response to low temperature,
156 showed only transient induction (Fowler and Thomashow 2002). The profil-
ing studies clearly demonstrate that low temperature responses involve altered ex-
pression of a large set of genes and these genes differ in their temporal expression
pattern. However, which of these genes are actually involved in cold acclimation
and what is the role of the corresponding proteins in the acclimation process and
in development of freezing tolerance is mostly unknown.
6.5.2 CRT/DRE/LTRE regulated gene expression
Understanding gene regulation during cold acclimation requires definition of the

cis-elements that are required for the low temperature responsiveness of the genes
and characterization of the trans-acting factors that bind to these sequences and
mediate the response. The first suggestion for the identity of a low temperature re-
sponsive element (LTRE) was given for the LTI78 promoter (Nordin et al. 1993).
The role of this element in activation of genes during stress was subsequently
demonstrated by Yamaguchi-Shinozaki and Shinozaki (1994). They performed
deletion analysis of the RD29A/LTI78/COR78 promoter and showed that the 9-bp
element, TACCGACAT, with a core sequence of CCGAC, confers responsiveness
to low temperature, drought, and high salinity, but not to ABA (Yamaguchi-
Shinozaki and Shinozaki 1994). This low-temperature and dehydration-responsive
element (DRE/LTRE) occurs also in several other promoters and was also charac-
terized as the C-repeat (CRT) (Baker et al. 1994).
A transcription factor binding to the DRE/CRT element and activating cold in-
duced gene expression was first identified by Stockinger et al. (1997). They em-
ployed yeast one-hybrid screening and were able to isolate an Arabidopsis gene
encoding a DRE/CRT binding protein, CBF1 (C-repeat binding factor 1), belong-
ing to the APETALA2/EREBP-family of transcription factors. Five additional
genes encoding CBF1 homologs, called DREBs (DRE binding proteins) and two
additional CBFs, CBF2, and CBF3 were subsequently cloned from Arabidopsis
(Fig. 3) (Liu et al. 1998, Gilmour et al. 1998). The DREB genes could be divided
into two distinct groups according to their responsiveness to low temperature and
drought. The DREB1 genes, DREB1A, DREB1B, and DREB1 constitute a structur-
Fig. 3. Cold induced genes are members of more than one regulon. The promoter region of
the RD29A/LTI78/COR78 gene contains cis-elements recognized by different transcription
factors, allowing the induction of the gene in response to different stimuli.
DRE/LTRE/CRT elements are binding sites for CBF/DREB and ABRE binding site for
ABF/AREB transcription factors, respectively.
ally homologous group of genes responsive to low temperature but not to drought,
while the DREB2 genes, DREB2A and DREB2B, were responsive to drought but
not to low temperature (Liu et al. 1998). CBF1 is identical with DREB1B and
CBF2 and CBF3 are identical with DREB1C and DREB1A, respectively. Recent
studies have resulted in isolation of an additional CBF homolog, CBF4 (Haake et
al. 2002). Interestingly, the CBF4 gene is induced by drought but not by low tem-
perature, indicating that also CBF4 might regulate drought responses in Arabidop-
sis (Haake et al. 2002). In addition to Arabidopsis CBF/DREB1, orthologs have
been identified in other plant species, including B. napus (Jaglo et al. 2001, Gao et
al. 2002), wheat, rye, tomato (Jaglo et al. 2001), barley, rice (Choi et al. 2002),
and birch, Betula pendula, (Aalto, Ojala, Puhakainen, Heino and Palva, personal
communication). Similar to Arabidopsis, the CBF/DREB1 genes in other plant
species also appear to consist of a small gene family. Jaglo et al. (2001) have iso-
lated two B. napus and three rye cDNA clones encoding CBF/DREB1 orthologs
and shown that they are low temperature responsive. Recently Gao et al. (2002)
isolated four CBF/DREB1 genes from B. napus and demonstrated that the genes
were responsive to low temperature and could activate reporter gene expression
driven by LTRE/DRE/CRT elements in yeast. This demonstrates that the em-
ployment of CBF/DREB1 like transcription factors in activation of low tempera-
ture responsiveness of genes is highly conserved in the plant kingdom. The pres-
ence of low temperature responsive CBF/DREB1 orthologs also in tomato indicate
that the CBF/DREB1 pathway is not limited to plants that have the ability to cold
acclimate (Jaglo et al. 2001).
Overexpression of CBF1/DREB1B, CBF3/DREB1A, or CBF4 leads to constitu-
tive expression of genes with promoters containing the DRE/CRT/LTRE element
and to improved freezing and drought tolerance in non-acclimated plants (Jaglo-
Ottosen et al. 1998, Kasuga et al. 1999, Haake et al. 2002). In addition, the over-
expression of CBF3 leads to elevated levels of proline and sugars that are nor-
mally associated with cold acclimation (Gilmour et al. 2000). CBFs have been
shown to activate reporter genes carrying CRT/DRE-elements in their promoters

in yeast (Stockinger et al. 1997, Gilmour et al. 1998).
Recently, CBF1 activity in yeast was shown to be dependent on Gcn5, Ada2
and Ada3, which all are part of Ada and SAGA complexes in yeast and act as his-
tone acetyltranserase (Gcn5) and transcriptional adapters (Ada2 and Ada3) (Stock-
inger et al. 2001). Cloning of Arabidopsis homologues of yeast Gcn5 (AtGCN5)
and Ada2 (AtADA2a and AtADA2b) revealed that AtGCN5 had indeed histone
acetyltransferase activity and interacted with AtADA2a and AtADA2b. In addi-
tion, CBF1 was shown to interact with all three proteins (Stockinger et al. 2001).
This indicates that CBF1 functions through Ada or SAGA like complexes in
Arabidopsis.
CBF/DREB1 genes are themselves transiently regulated by low temperature
(Gilmour et al. 1998, Liu et al. 1998, Medina et al.1999). The expression of all
three CBF genes was detected after 30 min of low temperature exposure; the
mRNA levels were highest after 1 hour and declined to the basal level by 6 hours
(Medina et al. 1999). What are the factors and signal component controlling this
cold induced expression of CBFs? Recently, an Arabidopsis mutant, hos1, which
exhibited enhanced induction of the CBF2 and CBF3 genes, was isolated (Ishitani
et al. 1998, Lee et al. 2001). In hos1, the levels of CBF mRNAs were significantly
higher after 3 hours of low temperature exposure and they remained elevated up to
48 hours (Lee et al. 2001). Accordingly, target genes for CBFs were shown to be
superinduced in the hos1 mutant. Positional cloning of the hos1 gene revealed that
it encodes a novel RING finger protein that exhibited low temperature induced ac-
cumulation to the nucleus (Lee et al. 2001). Recently, RING finger proteins have
been found to contain E3 ubiquitin ligase activity by which they transfer ubiquitin
to proteins directing them to degradation (Yang et al. 2000). Because HOS1 is
transferred to nucleus upon low temperature treatment and it can negatively regu-
late the expression of the CBF genes it is tempting to speculate that HOS1 is di-
rectly regulating the turnover of the hypothetical ICE protein (inducer of CBF ex-
pression), originally suggested by Thomashow to regulate CBF expression (Lee et
al. 2001, Gilmour et al. 1998, Thomashow 2001). Interestingly, the hos1 mRNA
level was shown to decline transiently in response to low temperature, being al-
most undetectable after 30 min of treatment and raising to the basal level after 1
hour (Lee et al. 2001). If the HOS1 is indeed mediating degradation of the hypo-
thetical ICE protein, then the low expression during the initial stages of cold
treatment would allow ICE activation and subsequent transient induction of the
CBF genes.
The RD29A/LTI78 promoter seems to be the target of additional transcription
factors. Sakamoto et al. (2000) have isolated three low temperature responsive
genes encoding C2H2 type zinc finger proteins in Arabidopsis. Two of these, AZF1
and AZF3, were novel genes, and the third STZ/ZAT10 has been previously iso-
lated and shown to rescue the salt sensitive phenotype of yeast calcineurin mutants
and confer tolerance to elevated concentrations of Na+ and Li+ in wild type yeast
(Lippuner et al. 1996). Recently, The STZ/ZAT10 has been shown to repress the
general activator mediated induction of genes and this repression was shown to be
dependent on the EAR motif in the C-terminal part of the STZ/ZAT10 (Ohta et al.
2001). By using a 35S-STZ/ZAT10 effector and RD29A-luc reporter constructs in a

transient expression assay, Lee et al. (2002) have shown that STZ/ZAT10 can re-
press the activity of the RD29A promoter.
By screening for alterations in the expression of the RD29A-luc transgene in re-
sponse to low temperature Lee et al. (2002) isolated a mutant, los2, where the cold
induction of the RD29A is highly reduced. While the endogenous low temperature
responsive genes also exhibited reduced expression during cold, the los2 mutation
had no effect on expression of CBF2 (Lee et al. 2002). The LOS2 gene was cloned
and it was shown to encode a protein having enolase activity. Interestingly, LOS2
was shown to be a bi-functional protein and to have analogously with previously
characterized enolases from animals and fungi as well as DNA binding activity
(Lee et al. 2002) and the ability to bind the promoter of the STZ/ZAT10 gene. The
expression of STZ/ZAT10 in response to low temperature was enhanced and pro-
longed in the hos2 mutant (Lee et al. 2002), suggesting that LOS2 is a negative
regulator of STZ/ZAT10. Thus, the decreased expression of low temperature re-
sponsive genes in the los2 mutant would be due to the increased expression of the
negative regulator STZ/ZAT10 (Lee et al. 2002).
6.5.3 ABRE mediated gene expression
A set of characterized low temperature responsive genes do not carry the

DRE/CRT/LTRE element in their promoters, e.g. the Arabidopsis LTI6/RCI2A
gene (Capel et al. 1997, Nylander et al. 2001), indicating that also other elements
confer cold responsiveness. Furthermore, most of the low temperature responsive
genes are also induced by exogenous ABA. Consequently, their promoters should
contain cis-elements mediating this response. Indeed, sequences closely resem-
bling ABA response elements (ABREs) exist in the promoters of several low tem-
perature responsive genes (Lång and Palva 1992, Baker et al. 1994, Yamaguchi-
Shinozaki and Shinozaki 1994). The ABREs, cis-elements with the consensus se-
quence (C/T)ACGTGGC, have been shown to confer ABA-regulated expression
of many genes when present in more that one copy (Guiltinan et al. 1990, Leung
and Giraudat 1998).
Several regulatory proteins that can specifically bind to ABREs have been re-
ported (e.g. Guiltinan et al. 1990). They contain the basic domain/leucine zipper
(bZIP) motif found in many transcription factors. Two bZIP proteins that bind
specifically to the ABRE elements mediating dehydration and ABA responsive-
ness of the Arabidopsis RD29B/LTI65 gene were recently characterized (Uno et al.
2000). The genes encoding AREB1 and AREB2 (ABA-responsive element bind-
ing protein) are drought, salt and ABA induced but not responsive to low tempera-
ture. The AREB proteins can function as transcription factors, but need ABA for
their activation. In another study, a family of four ABRE binding factors (ABFs),
ABF1, 2, 3, and 4, was characterized also from Arabidopsis (Choi et al. 2000).
One of these ABF proteins corresponds to AREB2 and the others are highly ho-
mologous to AREBs, indicating that at least five distinct transcription factors con-
trol stress-induced expression of ABRE containing genes (Fig. 3). The ABF genes
respond differently to various environmental stresses, suggesting that they may act
in different stress-response pathways. All ABFs are responsive to ABA but only
the expression of the ABF1 is also enhanced by low temperature (Choi et al.
2000). Recently, Kang et al. (2002) have shown that overexpression of ABF3 and
ABF4 in transgenic plants leads to constitutive activation of ABA responsive
genes and enhanced drought tolerance. However, freezing tolerance of the plants
was not measured in this study and further studies are needed to elucidate the role
of ABFs, especially ABF1, in activating ABA responsive genes during cold ac-
climation.
Kim et al. (2001a) have isolated a cold and ABA responsive gene that encodes
a C2H2- type zinc finger protein SCOF1 in soybean. Overexpression of SCOF1 in
transgenic Arabidopsis resulted in constitutive expression of the low temperature
responsive genes COR15A, COR47, and RD29B/LTI65, and increased freezing
tolerance in non-acclimated plants (Kim et al. 2001a). SCOF1 is induced after 3
hours of low temperature treatment and the expression level is increasing at least
up to 7 days. The temporal pattern of SCOF1 expression and the constitutive ex-
pression of low temperature responsive genes in transgenic Arabidopsis, suggested
that SCOF1 may act synergistically with CBF/DREB1 proteins and maintain the
expression of CBF/DREB1 target genes after CBF/DREB1 expression is de-
creased. However, the SCOF1 protein was not found to bind to either the
DRE/CRT or ABRE sequences present in the promoters of COR15a, COR47 (both
elements), or RD29B (only ABRE) (Kim et al. 2001a). Interestingly, SCOF1 was
shown to interact with the bZIP protein SGBF-1 in the yeast two-hybrid system
(Kim et al. 2001). SGBF-1 in soybean has been shown to bind to the G-box, which
shares the core sequence ACGT with the ABRE (Hong et al. 1995) and SCOF1
was shown to enhance the DNA binding activity of SGBF-1 to the ABRE se-
quence in a gel shift assay (Kim et al. 2001a). The fact that SGBF-1 was also
shown to be responsive to low temperature and ABA suggests that SCOF1 acts
through interaction with SGBF-1 to regulate low temperature responsive genes
through the cis-element ABRE (Kim et al. 2001a).
6.5.4 Regulation of transcription factors
The genes encoding transcription factors, such as CBF/DREB or ABF/AREB,

shown to be involved in regulation of cold or ABA induced genes are themselves
regulated by these stimuli. This raises the question how the initial stress signal is
converted to altered gene expression. By definition, the primary signal acceptor in
nucleus has to be present in non-stressed conditions being turned to an active form
upon stress. Gilmour et al (1998) first hypothesized that an unknown transcription
factor, designated ICE, would be activated in response to cold. ICE would then act
on the CBF/DREB1 promoters and activate the genes (see below). Recently, Guo
et al. (2002) have demonstrated that all components needed for activation of
CBF/DRB1 genes are indeed present in non-acclimated plants. By screening a
mutagenized population of Arabidopsis for reduced expression of the RD29A-luc
fusion after low temperature treatment, they isolated a mutant, los1-1, in which the
expression of the CBF/DREB1 target genes was highly reduced. Interestingly, the
genes encoding all three CBFs were superinduced in response to low temperature
(Guo et al. 2002). The cloning of the LOS1 gene revealed that it encodes a transla-
tion elongation factor 2-like protein. In vivo protein labelling studies indicated that
protein synthesis was specifically inhibited at low temperature. Thus, the los1-1
mutant carries a low temperature sensitive allele of the LOS1 gene (Guo et al.
2002). The fact that CBF/DREB1 gene expression was not inhibited shows that
protein synthesis is not needed for the low temperature activation of these genes.
Interestingly, the CBF/DREB1 genes were clearly super-induced by cold. This in-
dicates that either CBF/DREB1 proteins are feedback inhibiting their own expres-
sion or that one of their target genes is mediating the inhibition (Guo et al. 2002).
Alternatively, protein synthesis might be needed to regulate the level of the hypo-
thetical ICE protein. If e.g. the HOS1 is regulating the level of the ICE protein
then inhibition of protein synthesis leads to reduced amount of HOS1 and subse-
quent increase in stability of ICE (Fig. 4).
The promoter regions of DREB1 genes contain sequences similar to the ABRE
and MYB and MYC recognition motifs (Shinwari et al. 1998). However, because
DREB1 genes are not responsive to ABA, it appears that the ABRE motifs are not
active in the context of DREB1 promoters. MYC and MYB type of transcription
factors, RD22BP1/AtMYC2 and AtMYB2, respectively, have been shown to acti-
vate ABA and drought stress responsive gene expression of the RD22 gene (Abe
et al. 1997). The transcripts for these factors are also induced by ABA and dehy-
dration stress, but not by cold treatment (Urao et al. 1993, Abe et al. 1997). Re-
cently, by using transgenic plants overexpressing AtMYC2 or AtMYB2 Abe et al.
(2003) have shown that the expression of several ABA regulated genes is en-
hanced in these plants. Furthermore, a transposon insertion in the AtMYC2 gene
reduced the ABA responsive expression of the RD22 and AtADH1 genes (Abe et
al. 2003). This indicates that AtMYC2 and AtMYB2 are regulating genes in re-
sponse to ABA. Recently, the first evidence of the involvement of MYC/MYB
type of transcription factors in activation of gene expression in response to low
temperature has been obtained. Zhu and colleagues have achieved identification of
the gene encoding a putative ICE protein (Zhu, personal communication). By
screening for mutations leading to altered expression of the CBF1-luc reporter
gene in transgenic Arabidopsis, they isolated a mutant, where the low temperature
induction of CBF1 was highly reduced. The cloning of the corresponding gene re-
vealed that it encodes a MYC type bHLH transcription factor that has affinity to
the CBF promoters. As expected, the ICE gene is constitutively expressed (Fig. 4).
A novel putative negative regulator of CRT/DRE genes was recently identified
(Xiong et al. 2002, Koiwa et al. 2002). By screening for altered responsiveness of
the RD29A-luc reporter construct to stress in T-DNA mutagenized transgenic
plants, Koiwa et al. (2002) isolated two mutants, clp1 and clp3, where the
luciferase activity was superinduced in response to cold ABA and salt (clp1) or
only ABA (clp3). Slightly enhanced expression was also found for the endogenous
RD29A gene and by nuclear run-on transcription, they showed that the increased
expression was not due to more efficient initiation of transcription (Koiwa et al.
2002). The CLP1 and CLP3 genes are encoding proteins with high similarity to
Fig. 4. A model for CBF-mediated expression of low temperature responsive genes. See
text for details
CTD phosphatases, which dephosphorylate the conserved heptapeptide repeat of

the carboxy-terminal domain (CTD) of RNA polymerase II. Phosphorylation
status of CTD is known to regulate the promoter clearance and elongation stages
of transcription; RNAP II with unphosphorylated CTD is entering the preinitiation
complex, and subsequent phosphorylation of CTD is needed for turning the initia-
tion complex into an elongation complex. While phosphorylated during the elon-
gation phase, the CTD is again dephosphorylated at the end of transcription. Both
AtCLP1 and AtCLP3 were shown to have phosphatase activity in vitro. In an
analogous study using chemically mutagenized RD29A-luc plants, Xiong et al.
(2002) isolated a mutant fiery2 (fry2), which is allelic to the clp1 mutant. The fry2
mutant showed enhanced accumulation of several stress induced transcripts in re-
sponse to low temperature, ABA and NaCl. The enhanced expression appeared to
be restricted to genes that are regulated by CBFs/DREBs, as the mRNA levels for
the RD22 and RD19 genes were not affected and the plants showed no apparent
phenotype in non-stressed conditions (Xiong et al. 2002). The mRNAs for
DREB2A and CBF1, 2, and 3 also accumulated to higher levels in the mutant after
NaCl and low temperature treatments, respectively. Xiong et al. (2002) have sug-
gested that FRY2 acts as a negative regulator for the CBF/DREB regulated genes
and the repression seems to take place at the level of CBF/DREB transcription
(Fig. 4) (Xiong et al. 2002). Surprisingly, the fry2 mutant had reduced cold accli-
mation capacity as compared with the wild type, even if the CBFs and their target
genes were superinduced. This is in contrast with studies showing that constitutive
overproduction of CBFs leads to enhanced expression of its target genes and in-
creased freezing tolerance in transgenic plants (Jaglo-Ottosen et al. 1998, Liu et al.
1998, Kasuga et al. 1999). Interestingly, also the fry1 mutant was shown to be de-
ficient in acclimation, even if the expression of CBF2 and several stress respon-
sive genes was elevated (Xiong et al. 2001b) (see 6.3). This indicates that either
fry1 and fry2 mutations have pleiotropic effects on processes involved in cold ac-
climation or that the downregulation of the CBF-genes is essential.
Recently, Gong et al. (2002) identified another positive regulator for the CBF
genes. They isolated a mutant, los4, where the cold induction of the RD29A-luc
reporter construct as well as endogenous low temperature responsive genes was
reduced. The reduced expression of cold induced genes was reflecting the lower
expression levels of the CBF genes (Gong et al. 2002). The LOS4 gene encodes a
DEAD-box RNA helicase, indicating that it functions in regulation of RNA me-
tabolism. As expected, the los4 mutant was deficient in cold acclimation. Interest-
ingly los4 was also found to be chilling sensitive, and the chilling sensitivity was
greatly enhanced in darkness. Both chilling sensitivity and acclimation deficiency
could be complemented by overexpression of CBF3 (Gong et al. 2002) indicating
that the CBF target genes are, in addition to development of freezing tolerance
also required for chilling tolerance.
Light has previously been shown to be required for development of freezing
tolerance, but not for expression of CBF-regulated target genes during cold accli-
mation (Wanner and Junttila 1999). However, by using transgenic plants harbour-
ing a reporter construct where the GUS-gene was connected to four copies of
DRE/CRT element, Kim et al. (2002) were able to demonstrate that the activation
of gene expression through this element is requiring light and active PhyB. These
results indicate that the expression of at least a subset of the CBF/DREB1 regu-
lated genes in the absence of light is activated through a pathway not involving
CBF/DREB1-factors. PhyA appears also to be needed for expression of the CBF2
gene, at least under some conditions. Transient accumulation of the CBF2 tran-
script has been shown in response to far red light, and this accumulation was
found to be PhyA dependent (Tepperman et al. 2001). Crossatti et al. (1999) have
also shown that the low temperature induction of the barley COR14A gene is re-
quiring light. Taken together, it appears that light is a component regulating low
temperature responsive gene expression and cold acclimation.
6.5.5 Post-transcriptional regulation of gene expression
Several lines of evidence indicate that some low temperature responsive genes ap-
pear to be regulated also at the post-transcriptional level. Crossatti et al. (1999)
have shown that, in addition to be needed for full induction of gene expression,
light also regulates the stability of the COR14b protein in barley. Results of Phil-
lips et al. (1997) indicate that mRNA stability is modulated by a low-temperature-
dependent protein factor. Interestingly, it has also been shown that the stability of
the mRNA for the transcription factor SCOF-1 is regulated by low temperature
(Kim et al. 2001b). By constitutive overexpression of SCOF-1 from 35S-promoter

in transgenic tobacco, they showed that the amount of the SCOF-1 transcript was
elevated several fold when the plants were exposed to low temperature, even if the
35S-promoter itself is not responding to cold. Furthermore, they showed that deg-
radation of the SCOF-1 mRNA during deacclimation in soybean is depending on
active gene expression, because treatment of cells with a transcription inhibitor,
cordycepin, resulted in stabilization of the mRNA (Kim et al. 2001b).
An emerging theme in eukaryotic gene expression is the involvement of altered
mRNA metabolism. Several RNA-binding proteins, which might stabilize or acti-
vate mRNA, have been found to be low temperature responsive e.g. in Arabidop-
sis, barley, leafy spurge, and potato (Carpenter et al. 1994, Dunn et al. 1996, Hor-
wath and Olson 1998, Baudo et al. 1999). In prokaryotes, exposure to low
temperature is causing a general repression of protein synthesis, but accumulation
of a specific set of small proteins collectively known as cold shock proteins
(CSPs). E.g. in Escherichia coli, the synthesis of the major CSP, CspA, can ac-
count up to 10% of total protein synthesis in early stages of low temperature expo-
sure (Phadtare et al. 1999). CSPs are small polypeptides, consisting of two RNA
binding domains RNP1 and RNP2 and they have likely functions as RNA chaper-
ons and/or transcriptional antiterminators allowing translation and transcription of
cold regulated genes (Phadtare et al. 1999, Jiang et al. 1997, Bae et al. 2000, We-
ber et al. 2002). A nucleic acid binding domain very similar to the CSPs has been
identified in several eukaryotic proteins (Weber et al. 2002). This cold shock do-
main (CSD), together with auxiliary RNA binding domains, is regulating different
processes by specific RNA/DNA binding (Graumann and Marahiel 1998). In
plants, cold shock domain proteins have been identified in a variety of species, in-
cluding lower plants, and both herbaceous and woody plants (Karlson and Imai
(2003). In plants, the CSD-containing proteins can be divided in two classes: i)
proteins with size and sequence highly similar to the prokaryotic CSPs, so far
these have only been identified in barley and wheat and ii) proteins where the
CSD is connected to auxiliary domains. The auxiliary domains appear to consist
of a glycine rich region containing two or more copies of the CCHC-type of Zn2+-
fingers, originally identified as the RNA binding structures in retroviral capsid
proteins (Karlson and Imai 2003). Recently Karlson et al. (2002) isolated a cDNA
encoding a low temperature responsive CSD-protein in wheat. The WCSD1 pro-
tein contains a N-terminal CSD and a glycine rich domain containing three
CCHC-type Zn2+-fingers (Karlson et al. 2002). The WCSD1 transcript was accu-
mulating after 10 and 6 hours of low temperature treatment in shoots and roots of
wheat, respectively and the induction was specific for low temperature, for no
mRNA accumulation was seen after ABA, drought, or salt treatments (Karlson et
al. 2002). By binding assays WCSD1 was shown to bind both ssDNA and dsDNA
as well as RNA. Accordingly, Karlson et al. (2002) suggested that the WCSD1
could either participate in regulation of cold induced genes of be involved in re-
covery from translational arrest. Arabidopsis genome contains four genes encod-
ing CSD-proteins all of them containing a glycine rich region and two or seven
CCHC Zn2+-fingers. The genes also appear to have altered expression pattern in
response to low temperature (Karlson and Imai 2003, von Numers, Palva and
Heino, personal communication). The role of these CSD-proteins in cold acclima-

tion remains to be elucidated.
6.6 Conclusions
The use of extensive mutant screens is providing a steadily increasing amount of

information regarding the genes identifying factors that are involved in regulation
of low temperature responsive genes. These approaches, combined with bio-
chemical and molecular approaches will give us, in near future, a comprehensive
picture of the molecular events leading to cold acclimation and development of
freezing tolerance. It is now clearly demonstrated that the initial events in cold
signalling include membrane rigidification and alterations in the cytoskeletal
component of the cells, which is followed by Ca2+-release from both extra- and in-
tracellular sources and activation of protein kinase cascades, eventually leading to
activation of transcription factors (Fig. 2). It is also evident that signal transduc-
tion in cold acclimation is following several independent, but interacting and con-
verging pathways, which may involve cascades of transcription factors. The chal-
lenge for future research is to elucidate the molecular details of these pathways
and analyze the cross-talk between them. This task will be greatly facilitated by
analysis of alterations of transcriptomes and proteomes in response to stress. By
using genome wide expression profiling or, in smaller scale, analyzing the expres-
sion patterns of selected set of genes by microarray-based techniques the global al-
terations in gene expression during acclimation can be analyzed and compared to
the expression profiles in different mutants and transgenic plants. This will also
aid in dissection of the different regulons involved in cold acclimation. Seki et al.
(2001) and Fowler and Thomashow (2002) have already started to define the
CBF/DREB1 regulon by performing expression profiling of 1300 and 8000
Arabidopsis genes, respectively, in transgenic plants overexpressing DREB1A
(Seki et al. 2001) or CBF1, CBF2, or CBF3 (Fowler and Thomashow (2002). The
analysis of transcriptome and proteome changes in response to low temperature
will not only aid in determining the components of different regulons, thereby
providing tools for genetic engineering, but also give valuable information of the
target genes of these regulons, thereby giving an opportunity for metabolic profil-
ing to predict and analyze the physiological changes that ultimately lead to in-
creased freezing tolerance.
The elucidation of the signalling network leading to the activation of the differ-
ent regulons involved in cold acclimation will also provide tools for regulon engi-
neering. Low temperature stress is causing severe damage to a variety of crops
each year and development of low temperature/freezing tolerant varieties would
have a major impact in agriculture. Cold acclimation is a polygenic trait where a
large number of gene products are contributing to achieve maximal freezing toler-
ance. Therefore, it is not likely that alteration of the expression pattern of one or
few target genes would bring very significant changes in freezing tolerance. On
the other hand, by genetic manipulation of signal transduction pathways or their
end points, transcription factors, it is possible to simultaneously affect the expres-

sion of large amount of genes and consequently, obtain a major increase in toler-
ance. The power of regulon engineering has already been demonstrated in several
studies. Transgenic Arabidopsis plants overexpressing CBF/DREB1 genes have
been shown to constitutively express CBF/DREB1 target genes and exhibit consti-
tutive freezing tolerance (Jaglo-Ottosen 1998, Liu et al. 1998, Kasuga et al. 1999,
Gilmour et al. 2000). Jaglo et al. (2001) have also expressed CBF1, CBF2, and
CBF3 in B. napus and shown that this leads to enhanced expression of low tem-
perature responsive BN115 and BN28 genes and increased freezing tolerance. In
the future, the possible use of multiple transcription factors, activating several dis-
tinct regulons will further enhance the biotechnological applications of cold ac-
climation research.
Acknowledgements
The work in the authors’ laboratory is supported by the Finnish Academy, Biocen-
trum Helsinki, and the National Technology Agency of Finland. We thank Dr.
Jian-Kang Zhu for providing unpublished information and members of our lab for
critical reading of the manuscript. We are grateful to MSc Elina Helenius for pre-
paring the figures for the manuscript.
References
Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosakawa D and Shinozaki K (1997)

Abe H, Urao T, Ito T, Seki M, Shinozaki K and Yamaguchi-Shinozaki K (2003) Arabidop-
sis AtMYC2 (bHLH) and At MYB2 (MYB) Function as transcriptional activators in
abscisic acid signaling. Plant Cell 15:63-78
Allen GJ, Muir SR and Sanders D (1995) Release of Ca2+ from individual plant vacuoles by
both InsP3 and cyclic ADP-ribose. Science 268:735-737
Bae W, Xia B, Inouye M and Severinov K (2000) Escherichia coli CspA-family RNA
chaperones are transcription antiterminators. Proc Natl Acad Sci USA 97:7784-7789
Baker SS, Wilhelm, KS and Thomashow MF (1994) The 5’-region of Arabidopsis thaliana
cor15a has cis-acting elements that confer cold-, drought- and ABA-regulated gene
expression. Plant Mol. Biol 24:701-713
Baudo MM, Meza-Zepeda LA, Palva ET and Heino P (1999) Isolation of a cDNA corre-
sponding to a low temperature- and ABA-responsive gene encoding a putative glycine
rich RNA-binding protein in Solanum commersonii. J Exp Bot 50:1867-1868
Capel J, Jarillo JA, Salinas J and Martinez-Zapater JM (1997) Two homologous low-
temperature-inducible genes from Arabidopsis encode highly hydrophobic proteins.
Carpenter CD, Kreps JA and Simon AE (1994) Genes encoding glycine-rich Arabidopsis
thaliana proteins with RNA-binding motifs are influenced by cold treatment and an
endogenous circadian rhythm. Plant Physiol 104:1015-1025
Chang C, Kwok SF, Bleecker AB and Meyerowitz EM (1993) Arabidopsis ethylene-
response gene ETR1: similarity of product to two-component regulators. Science
262:539-544
Chen HH, Li, PH and Brenner ML (1983) Involvement of abscisic acid in potato cold ac-
climation. Plant Physiol 71:362-365
Choi D-W, Rodriguez EM and Close TJ (2002) Barley Cbf3 gene identification, expression
pattern, and map location. Plant Physiol 129:1781-1787
Choi H, Hong J, Ha J, Kang J and Kim SY (2000) ABFs, a family of ABA-responsive ele-
ment binding factors. J Biol Chem 275:1723-1730
Crosatti C, de Laureto PP, Bassi R and Cattivelli L (1999) The interaction between cold
and light controls the expression of the cold-regulated barley gene cor14b and the ac-
cumulation of the corresponding protein. Plant Physiol 119:671-680
Ding JP and Pickard BG (1993) Modulation of mechanosensitive calcium-selective chan-
nels by temperature. Plant J 3:713-720
Dunn MA, Brown K, Lightowlers RL and Hughes MA (1996) A low-temperature- respon-
sivegene from barley encodes a protein with single stranded nucleic acid binding activ-
ity which is phosphorylated in vitro. Plant Mol Biol 30:947-959
Fowler S and Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that
multiple regulatory pathways are activated during cold acclimation in additon to the
CBF cold response pathway. Plant Cell 14:1675-1690
Foyer CH, Lelandais M and Kunert KJ (1994) Photooxidative stress in plants. Physiol Plant
92:696-717
Gao M-J, Allard G, Byass L, Flanagan AM and Singh J (2002) Regulation and characteri-
zation of four CBF transcription factors from Brassica napus. Plant Mol Biol 49:459-
471
Gilmour S and Thomashow MF (1991) Cold acclimation and cold regulated gene expres-
sion in ABA mutants of Arabidopsis thaliana. Plant Mol Biol 17:1233-1240
Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP, Houghton JM and Thomashow MF
(1998) Low temperature regulation of the Arabidopsis CBF family of AP2 transcrip-
tional activators as an early step in cold-induced COR gene expression. Plant J 16:433-
442
Gilmour SJ, Sebolt AM, Salazar MP, Everard JD and Thomashow MF (2000) Overexpres-
sion of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical
changes associated with cold acclimation. Plant Physiol 124:1854-1865
Gilroy S and Trewavas A (1994) A decade of plant signals. BioEssays 16:677-682
Gong M, van der Luit AH, Knight MR and Trewavas AJ (1998) Heat-shock-induced
changes in intracellular Ca2+ level in tobacco seedlings in relation to thermotolerance.
Gong Z, Lee H, Xiong L, Jagendorf A, Stevenson B and Zhu J-K (2002) RNA helicase-like
protein as an early regulator of transcription factors for plant chilling and freezing tol-
erance. Proc Natl Acad Sci USA 99:11507-11512
Gosti F, Beaudoin N, Serizet C, Webb AAR and Vartanian N (1999) ABI1 protein phos-
phatase 2C is a negative regulator of abscisic acid signaling. Plant Cell 11 1897-1909
Graham D and Patterson BD (1982) Responses of plants to low, nonfreezing temperatures:
proteins, metabolism and acclimation. Annu Rev Plant Physiol 33:347-372
Graumann PL and Marahiel MA (1998) A superfamily of proteins that contain the cold-
shock domain. Trends Biochem Sci 23:286-290
Guiltinan, M.J., Marcotte, W.R. and Quatrano, R.S. 1990. A plant leucine zipper protein
that recognizes an abscisic acid response element. Science 250:267-271.
Guo Y, Xiong L, Ishitani M and Zhu J-K (2002) An Arabidopsis mutation in translation
elongation factor causes superinduction of CBF/DREB1 transcription factor genes but
blocks the induction of their downstream targets under low temperature. Proc Natl
Guy CL (1990) Cold acclimation and freezing stress tolerance: role of protein metabolism.
Annu Rev Plant Physiol Plant Mol Biol 41:187-223
Haake V, Cook D, Riechmann JL, Pinede O, Thomashow MF and Zhang JZ (2002) Tran-
scription factor CBF4 is a regulator of drought adaptation in Arabidopsis. Plant
Physiol 130:639-648
Halfter U, Ishitani M and Zhu J-K (2000) The Arabidopsis SOS2 protein kinase physically
interacts with and is activated by the calcium-binding protein SOS3. Proc Natl Acad
Sci USA 97:3735-3740
Harris DM, Myrick TL and Rundle SJ (1999) The Arabidopsis homolog of yeast TAP42
and mammalian α4 binds to the catalytic subunit of protein phosphatase 2A and is in-
duced by chilling. Plant Physiol 121:609-617
Heino P, Sandman G, Lång V, Nordin K and Palva ET (1990) Abscisic acid deficiency
prevents development of freezing tolerance in Arabidopsis thaliana (L.) Heynh. Theor
Appl Genet 79:801-809
Hirschi KD (1999) Expression of Arabidopsis CAX1 in tobacco: altered calcium homeosta-
sis and increased stress sensitivity. Plant Cell 11:2113-2122
Hiilovaara-Teijo M and Palva ET (1998) Molecular responses in cold adapted plants. In:
Margesin R and Schinner F eds Cold-Adapted Organisms: Ecology, physiology, en-
zymology and molecular biology. Springer-Verlag, Heidelberg, pp 349-384
Hirayama, T, Ohto C, Mizoguchi T and Shinozaki K (1995) A gene encoding a phosphati-
dylinositol-specific phospholipase C is induced by dhydration and salt stress in Arabi-
Hong JC, Cheong YH, Nagao RT, Bahk JD, Key JL and Cho MJ (1995) Isolation of two
soybean G-box binding factors which interact with a G-box sequence of an auxin-
responsive gene. Plant J 8:199-211
Hong SW, Jon JH, Kwak JM and Chua N-H (1997) Identification of a receptor-like protein
kinase gene rapidly induced by abscisic acid, dehydration, high salt and cold treat-
ments in Arabidopsis thaliana. Plant Physiol 113:1203-1212
Horwath DP and Olson PA (1998) Cloning and characterization of cold-regulated glycine-
rich RNA-binding protein genes from leafy spurge (Euphorbia esula L.) and compari-
son to heterologous genomic clones. Plant Mol Biol 38:531-538
Hughes, MA and Dunn, MA (1996) The molecular biology of plant acclimation to low
temperature. J Exp Bot 47:291-305
Ichimura K, Mizoguchi T, Yoshida R, Yuasa T and Shinozaki K (2000) Various abiotic
24:655-665
Inaba M, Franchescelli S, Suzuki I, Szalontai B, Kanesaki Y, Los DA, Maresca B, Hayashi
H and Murata N (2003) J Biol Chem (In Press) DOI 10.1074/jbc.M212204200
Ingram J and Bartels D (1996) The molecular basis of dehydration tolerance in plants.
Annu Rev Plant Physiol Plant Mol Biol 47:377-403
Inoue T, Hihuchi M, Hashimoto Y, Seki M, Kobayashi M, Kato T, Tabata S, Shinozaki K

and Kakimoto T (2001) Identification of CRE1 as a cytokinin receptor from Arabidop-
sis. Nature 409:1060-1063
Inzé D and Van Montagu M (1995) Oxidative stress in plants. Curr Opin Biotech 6:153-
158
Ishitani M, Xiong L, Stevenson B and Zhu J-K (1997) Genetic analysis of osmotic and cold
stress signal transduction in Arabidopsis: Interactions and convergence of abscisic
acid-dependent and abscisic acid-independent pathways. Plant Cell 9:1935-1949
Ishitani M, Xiong L, Lee H, Stevenson B and Zhu J-K (1998) HOS1, a genetic locus in-
volved in cold-responsive gene expression in Arabidopsis. Plant Cell 10:1151-1161
Jaglo KR, Kleff S, Amundsen KL, Zhang X, Haake V, Zhang JZ, Deits T and Thomashow
MF (2001) Components of the Arabidopsis C-repeat/dehydration-responsive element
binding factor cold-response pathway are conserved in Brassica napus and other plant
species. Plant Physiol 127:910-917
Jaglo-Ottosen KR, Gilmour S, Zarka DG, Schabenberger O and Thomashow MF (1998)
Arabidopsis CBF1 overexpression induces COR genes and enhances freezing toler-
ance. Science 280:104-106
Jonak C, Kiegerl S, Ligternik W, Barkel PJ, Huskisson NS and Hirt H (1996) Stress signal-
ing in plants: A mitogen-activated protein kinase pathway is activated by cold and
drought. Proc Natl Acad Sci USA 93:11274-11279
Junttila O (1980) Effect of photoperiod and temperature on apical growth cessation in two
ecotypes of Salix and Betula. Physiol Plant 48:347-352
Kanaya E, Nakajima N, Morikawa K, Okada K and Shimura Y (1999) Characterization of
the transcriptional activator CBF1 from Arabidopsis thaliana. Evidence for cold dena-
turation in regions outside the DNA binding domain. J Biol Chem 274:16068-16076
Kang J-y, Choi H-i, Im M-y and Kim SY (2002) Arabidopsis basic leusine zipper proteins
that mediate stress-responsive abscisic acid signaling. Plant Cell 14:343-357
Karlson D and Imai R (2003) Conservation of the cold shock domain protein family in
plant. Plant Physiol 131:12-15
Karlson D, Nakaminami K, Toyomasu T and Imai R (2002) A cold regulated nucleic acid-
binding protein of winter wheat shares a domain with bacterial cold shock proteins. J
Biol Chem 277:35248-35256
Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K and Shinozaki K (1999) Improving
plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible
transcription factor. Nature Biotechnol 17:287-291
Kim JC, Lee SH, Cheong YH, Yoo C-M, Lee SI, Chun HJ, Yun D-J, Hong JC, Lee SY,
Lim CO and Cho MJ (2001a) A novel cold-inducible zink finger protein from soybean,
SCOF1, enhances cold tolerance in transgenic plants. Plant J 25:247-259
Kim JC, Jeong JC, Park HC, Yoo JH, Koo YD, Yoon HW, Koo SC, Lee S-H, Bahk JD and
Cho MJ (2001b) Cold accumulation of SCOF-1 transcripts is associated with transcrip-
tional activation and mRNA stability. Mol Cells 12:204-208
Kim H-J, Kim Y-K, Park J-Y and Kim J (2002) Light signaling mediated by phytochrome
plays an important role in cold-induced gene expression through the C-
repeat/dehydration responsive element (C/DRE) in Arabidopsis thaliana. Plant J
29:693-704
Kim K-N, Cheong YH, Grant JJ, Pandey GK and Luan S (2003) CIPK3, a calcium sensor-
associated protein kinase that regulates abscisic acid and cold signal transduction in
Arabidopsis. Plant Cell 15:411-423
Knight MR, Campbell AK, Smith SM and Trewavas AJ (1991) Transgenic plant aequorin
reports the effects of touch and cold-shock and elicitors on cytoplasmic calcium. Na-
ture 352:524-526
Knight H, Trwavas AJ and Knight MR (1996) Cold calcium signaling in Arabidopsis in-
volves two cellular pools and a change in calcium signature after acclimation. Plant
Cell 8:489-503
Knight H, Veale EL, Warren GJ and Knight MR (1999) The sfr6 mutation in Arabidopsis
suppresses low-temperature induction of genes dependent on the CRT/DRE sequence
motif. Plant Cell 11:875-886
Koiwa H, Barb AW, Xiong L, Li F, McCully MG, Lee B-h, Sokolchik I, Zhu J, Gong Z,
Reddy M, Sharkhuu A, Manabe Y, Yokoi S, Zhu J-K, Bressan RA and Hasegava PM
(2002) C-terminal domain phosphatase-like family members (AtCPLs) differentially
regulate Arabidopsis thaliana abiotic stress signaling, growth, and development. Proc
Natl Acad Sci USA 99:10893-10898
Koornneef M, Jorna ML, Brinkhorst-van der Swan DLC and Karssen CM (1982) The isola-
tion of abscisic acid (ABA) deficient mutants by selection of induced revertants in
non-germinating gibberellin sensitive lines of Arabidopsis thaliana (L.) Heynh. Theor
Appl Genet 61:385-393
Koornneef M, Reuling G and Karssen CM (1984) The isolation of abscisic acid-insensitive
mutants of Arabidopsis thaliana. Physiol Plant 61:377-383
Kovtun Y, Chiu W-L, Tena G and Sheen J (2000) Functional analysis of oxidative-stress
activated mitogen-activated protein kinase cascafe in plants. Proc Natl Acad Sci USA
97:2940-2945
Kreps JA, Wu Y, Chang H-S, Zhu T, Wang X and Harper JF (2002) Transcriptome changes
for Arabidopsis in response to salt, osmotic and cold stress. Plant Physiol 130:2129-
2141
Kudla J, Xu Q, Harter K, Gruissem W and Luan S (1999) Genes for calcineurin B-like pro-
teins in Arabidopsis are differentially regulated by stress signals. Proc Natl Acad Sci
USA 96:4718-4723
Kurkela S and Borg-Franck M (1992) Structure and expression of kin2, one of two cold-
and ABA-induced genes in Arabidopsis thaliana. Plant Mol Biol 19:689-692
Lalk I and Dörffling K (1985) Hardening, abscisic acid, proline and freezing resistence in
two winter wheat varieties. Physiol Plant 61:287-292
Lee H, Xiong L, Gong Z, Stevenson B and Zhu J-K (2001) The Arabidopsis HOS1 gene
negatively regulates cold signal transduction and encodes a RING finger protein that
displayes cold-regulated nucleo-cytoplasmic partitioning. Genes Dev 15:912-924
Lee H, Guo Y, Ohta M, Xiong L, Stevenson B and Zhu J-K (2002) LOS2, a genetic locus
required for cold responsive gene transcription encodes a bi-functional enolase. EMBO
J 21:2692-2702
Leung J, Bourvier-Durant, M, Morris P-C, Guerrier D, Chefdor F and Giraudad J (1994)
Arabidopsis ABA response gene ABI1: Features of a calcium-modulated protein phos-
phatase. Science 264:1448-1452
Leung, J. and Giraudat, J. 1998. Abscisic acid signal transduction. Annu. Rev. Plant.
Physiol. Plant Mol. Biol. 49:199-222.
Levitt J (1980) Responses of Plants to Environmental Stresses: Chilling, Freezing and High
Temperature Stresses. 2nd ed Academic Press New York
Li C, Puhakainen T, Welling A, Viherä-Aarnio A, Ernstsen A, Junttila O, Heino P and

Palva ET (2002) Cold acclimation in silver birch (Betula pendula). Development of
freezing tolerance in different tissues and climatic ecotypes. Physiol Plant 116:478-488
Li C, Viherä-Aarnio A, Puhakainen T, Junttila O, Heino P and Palva ET (2003) Ecotype
dependent control of growth, dormancy and freezing tolerance under seasonal changes
in Betula pendula Roth. Trees 17:127-132
Lippuner V, Cyert MS and Gasser CS (1996) Two classes of plant cDNA clones differen-
tially complement yeast calcineurin mutants and increase salt tolerance of wild-type
yeast. J Biol Chem 271:12859-12866
Liu J and Zhu J-K (1997) An Arabidopsis mutant that requires increased calcium for potas-
sium nutrition and salt tolerance. Proc Natl Acad Sci USA 94:14960-14964
Liu J and Zhu J-K (1998) A calcium sensor homolog required for plant salt tolerance. Sci-
ence 280:1943-1945
Liu J, Ishitani M, Halfter U, Kim CS and Zhu J-K (2000) The Arabidopsis thaliana SOS2
gene encodes a protein kinase that is required for salt tolerance. Proc Natl Acad Sci
USA 97:3730-3734
Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K and Shinozaki K.
(1998) Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA
10:1391-1406
Llorente F, Oliveros JC, Martinez-Zapater JM and Salinas J (2000) A freezing sensitive
mutant of Arabidopsis, frs1, is a new aba3 allele. Planta 211:648-655.
Lång V, Heino P and Palva ET (1989) Low temperature acclimation and treatment with ex-
ogenous abscisic acid induce common polypeptides in Arabidopsis thaliana (L.)
Heynh. Theor Appl Genet 77:729-734
Lång V and Palva ET (1992) The expression of a rab-related gene, rab18, is induced by ab-
scisic acid during the cold acclimation process of Arabidopsis thaliana (L.) Heynh.
Plant Mol Biol 20: 951-962
Lång V, Mäntylä E, Welin B, Sundberg B and Palva ET (1994) Alterations in water status,
endogenous abscisic acid content and expression of rab18 gene during the develop-
ment of freezing tolerance in Arabidopsis thaliana. Plant Physiol 104:1341-1349
Martin ML and Busconi L (2001) A rice membrane-bound calcium-dependent protein
kinase is activated in response to low temperature. Plant Physiol 125:1442-1449
McKersie BD and Bowley SR (1998) Active oxygen and freezing tolerance in transgenic
plants. In Plant Cold Hardiness (Li PH and Chen T eds Plenum Press New York pp
203-212
McAinsh MR and Hetherington AM (1998) Encoding specificity in Ca2+ signaling systems.
McKown R, Kuroki G and Warren G (1996) Cold responses of Arabidopsis mutants im-
paired in freezing tolerance. J Exp Bot 47:1919-1925
Medina J, Bargues M, Terol J, Pérez-Alonso M and Salinas J (1999) The Arabidopsis CBF
gene family is composed of three genes encoding AP domain-containing proteins
whose expression is regulated by low temperature but not by abscisic acid or dehydra-
tion. Plant Physiol 119:463-469
Merlot S, Gosti F, Guerrier D, Vavasseur A and Giraudad J (2001) The ABI1 and ABI2
protein phosphatases 2C act in a negative feedback regulatory loop of the abscisic acid
signaling pathway. Plant J 25:315-324
Meyer, K, Leube MP and Grill E (1994) A protein phosphatase 2C involved in ABA signal
transduction in Arabidopsis thaliana. Science 264:1452-1455
Mikami K, Katagiri, T, Luchi S, Yamaguchi-Shinozaki K and Shinozaki K (1998) A gene
encoding phosphatidylinositol 4-phosphate 5-kinase is induced by water stress and ab-
scisic acid in Arabidopsis thaliana. Plant J 15:563-568
Mizoguchi T, Irie K, Hirayama T, Hayashida N, Yamaguchi-Shinozaki K, Matsumoto K
and Shinozaki K (1996) A gene encoding a mitogen-activated protein kinase kinase
kinase is induced simultaneously with genes for a mitogen-activated protein kinase and
an S6 ribosomal protein kinase by touch, cold and water stress in Arabidopsis thaliana.
Mizoguchi T, Ichimura K and Shinozaki K (1997) Environmental stress response in plants:
the role of mitogen-activated protein kinases. Trends Biotechnol 15:15-19
Mizoguchi T, Ichimura K, Irie K, Morris PC, Giraudad J, Matsumoto K and Shinozaki K
(1998) Identification of a possible MAP kinase cascade in Arabidopsis thaliana based
on pairwise yeast two-hybrid analysis and the functional complementation tests of the
yeast mutants. FEBS Lett 437:56-60
Monroy AF and Dhindsa RS (1995) Low temperature signal tranduction: Induction of cold-
acclimation specific genes of alfalfa by calcium at 25°C. Plant Cell 7:321-331
Monroy AF, Sarhan F and Dhindsa RS (1993) Cold induced changes in freezing tolerance,
protein phosphorylation and gene expression: Evidence for a role of calcium. Plant
Physiol 102:1227-1235
Monroy AF, Sangwan V and Dhindsa RS (1998) Low temperature signal transduction dur-
ing cold acclimation: protein phosphatase 2A as an early target for cold inactivation.
Plant J 13:653-660
Murata N and Los DA (1997) Membrane fluidity and temperature perception. Plant Physiol
115:875-879
Mäntylä E, Lång V and Palva ET (1995) Role of abscisic acid in drought-induced freezing
tolerance, cold acclimation and accumulation of LTI78 and RAB18 proteins in Arabi-
dopsis thaliana. Plant Physiol 107:141-148
Nordin K, Heino P and Palva ET (1991) Separate signal pathways regulate the expression
of a low-temperature-induced gene in Arabidopsis thaliana (L.) Heynh. Plant Mol Biol
16:1061-1071
Nordin K, Vahala T and Palva ET (1993) Differential expression of two related, low-
temperature-induced genes in Arabidopsis thaliana (L.) Heynh. Plant Mol Biol
21:641-653
Nuotio S, Heino P and Palva ET (2001) Signal transduction under low-temperature stress.
In: Basra AB ed Crop Responses and Adaptations to Temperature Stress. Food Prod-
ucts Press, Binghamton, New York, pp151-176
Nylander M, Heino P, Helenius E, Palva ET, Ronne H and Welin BV (2001) The low tem-
perature- and salt-induced RCI2A gene of Arabidopsis complements the sodium sensi-
tivity caused by a deletion of the homologous yeast gene SNA1. Plant Mol Biol
45:341-352
Ohta M, Matsui K, Hiratsu K, Shinshi H and Ohme-Takagi M (2001) Repression domains
of class II ERF transcriptional repressors share an essential motif for active repression.
Plant Cell 13:1959-1968
Olsen JE, Junttila O, Nilsen J, Eriksson ME, Martinussen I, Olsson O, Sandberg G and
Moriz T (1997) Ectopic expression of oat phytochrome A in hybrid aspen changes
critical daylength for growth and prevents cold acclimatization. Plant J 12:1339-1350
Palva ET (1994) Gene expression under low temperature stress. In: Basra AS ed Stress In-
duced Gene Expression in Plants. Harwood Academic Publishers, New York, pp103-
130
Palva ET and Heino P (1998) Molecular mechanism of plant cold acclimation and freezing
tolerance. In: Li PH and Chen THH eds Plant Cold Hardiness. Plenum, New York,
pp3-14
Phadtare S, Alsina J and Inouye M (1999) Cold-shock response and cold-shock proteins.
Curr Opin Microbiol 2:175-180
Phillips JR, Dunn MA and Hughes MA (1997) mRNA stability and localization of the low-
temperature-responsive barley gene family blt14. Plant Mol Biol 33:1013-1023
Plieth C, Hansen U-P, Knight H and Knight M (1999) Temperature sensing in plants: the
primary characteristics of signal perception and calcium response. Plant J 18:491-497
Polisensky DH and Braam J (1996) Cold-shock regulation of the Arabidopsis TCH genes
and the effects of modulating intracellular calcium levels. Plant Physiol 111:1271-
1279
Price AH, Taylor A, Ripley SJ, Griffiths A, Trewavas AJ and Knight MR (1994) Oxidative
signals in tobacco increase cytosolic calcium. Plant Cell 6:1301-1310
Puhakainen T, Pihakaski-Maunsbach K, Widell S and Sommarin M (1999) Cold acclima-
tion enhances the activity of plasma membrane Ca2+ ATPase in winter rye leaves.
Plant Physiol Biochem 37:231-239
Rudd JJ and Franklin-Tong VE (1999) Calcium signaling in plants. Cell Mol Life Sci
55:214-232
Ryu SB and Li PH (1994) Potato cold hardiness development and abscisic acid. II. De novo
protein synthesis is required for the increase in free abscisic acid during potato (So-
lanum commersonii) cold acclimation. Physiol Plant 90:21-26
Saijo Y, Hata S, Kyozuka J, Shimamoto K and Izui K (2000) Over-expression of a single
Ca2+-dependent protein kinase confrs both cold and salt/drought tolerance on rice
plants. Plant J 23:319-327
Sakai A and Larcher W (1987) Frost Survival of Plants: Responses and Adaptation to
Freezing Stress. Springer-Verlag Berlin
Sakamoto H, Araki T, Meshi T and Iwabuchi M (2000) Expression of a subset of the
Arabidopsis Cys2/His2-type zink-finger protein gene family under water stress. Gene
248:23-32
Sanders D, Brownlee C and Harper JF (1999) Communicating with calcium. Plant Cell
11:691-706
Sangwan W, Foulds, I, Singh J and Dhindsa RS (2001) Cold-activation of Brassica napus
BN115 promoter is mediated by structural changes in membranes and cytoskeleton,
and requires Ca2+ influx. Plant J 27:1-12
Sangwan V, Örvar BL, Beyerly J, Hirt H and Dhindsa RS (2002) Opposite changes in
membrane fluidity mimic cold and head stress activation of distinct plant MAP kinase
pathways. Plant J 31:629-638
Seki M, Narusaka M, Abe H, Kasuga M, Yamaguchi-Shinozaki K and Shinozaki K (2001)
Monitoring the expression pattern of 1300 Arabidopsis genes under drought and cold
stresses by using a full-length cDNA microarray. Plant Cell 13:61-72
Shi J, Kim KN, Ritz O, Albrecht V,Gupta R, Harter K, Luan S and Kudla J (1999) Novel
protein kinases associated with calcineurin B-like calcium sensors in Arabidopsis.
Plant Cell 11:2393-2406
Shi H, Ishitani M, Kim C and Zhu J-K (2000) The Arabidopsis thaliana salt tolerance gene
SOS1 encodes a putative Na+/H+ antiporter. Proc Natl Acad Sci USA 97:6896-6901
Shinozaki K and Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and
low temperature: differences and cross-talk between two stress signaling pathways.
Shinwari ZK, Nakashima K, Miura S, Kasuga M, Seki M, Yamaguchi-Shinozaki K and
Shinozaki K (1998) An Arabidopsis gene family encoding DRE/CRT binding proteins
involved in low-temperature-responsive gene expression. Biochem Biophys Res
Commun 250:161-170
Steponkus PL (1984) Role of the plasma membrane in freezing injury and cold acclimation.
Annu Rev Plant Physiol 35:543-584
Steponkus PL, Uemura M and Webb MS (1993) Membrane destabilization during freeze-
induced dehydration. Curr Topics Plant Physiol 10:37-47
Stockinger EJ, Gilmour SJ and Thomashow MF (1997) Arabidopsis thaliana CBF1 en-
codes an AP2 domain-containing transcriptional activator that binds to the C-
repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in re-
sponse to low temperature and water deficit. Proc Natl Acad Sci USA 94:1035-1040
Stockinger EJ, Mao Y, Regier MK, Triezenberg SJ and Thomashow MF (2001) Transcrip-
tional adaptor and histone acetyltransferase proteins in Arabidopsis and their interac-
tions with CBF1, a transcriptional activator involved in cold-regulated gene expres-
sion. Nucl Acids Res 29:1524-1533
Suzuki I, Los DA, Kanesaki Y, Mikami K and Murata N (2000) The pathway for percep-
tion and transduction of low-temperature signals in Synechocystis. EMBO J 19:1327-
1334
Suzuki I, Kanesaki Y, Mikami K, Kanehisa M and Murata N (2001) Cold-regulated genes
under control of the cold sensor Hik33 in Synecocystis. Mol Microbiol 40:235-244
Tähtiharju S and Palva E T (2001) Antisense inhibition of protein phosphatase 2C acceler-
ates cold acclimation in Arabidopsis thaliana. Plant J 26: 461-470
Tähtiharju S, Sangwan V, Monroy AF, Dhindsa RS and Borg M (1997) The induction of
kin genes in cold-acclimating Arabidopsis thaliana. Evidence for a role of calcium.
Planta 203: 442-447
Tepperman JM, Zhu T, Chang H-S, Wang X and Quail PH (2001) Multiple transcription-
factor genes are early targets for phytochrome A signaling. Proc Natl Acad Sci USA
98:9437-9442
Thomasow MF (1998) Role of cold-responsive genes in plant freezing tolerance. Plant
Physiol 118:1-7
Thomashow MF (1999) Plant cold acclimation: freezing tolerance genes and regulatory
mechanisms. Annu Rev Plant Physiol 50:571-599
Thomashow MF (2001) So what’s new in the field of cold acclimation? Lots! Plant Physiol
125:89-93
Townley HH and Knight MR (2002) Calmodulin as potential a negative regulator of Arabi-
dopsis COR gene expression. Plant Physiol 128:1169-1172
Trewavas AJ and Malhó R (1997) Signal perception and transduction: the origin of the
phenotype. Plant Cell 9:1181-1195
Uno Y, Furihata T, Abe H, Yoshida R, Shinozaki K and Yamaguchi-Shinozaki K (2000)
Proc Natl. Acad Sci USA 97:11632-11637
Urao T, Yamaguchi-Shinozaki, K, Urao S and Shinozaki K (1993) An Arabidopsis myb

homolog is induced by dehydration stress and its gene product binds to the conserved
MYB recognition sequence. Plant Cell 5:1529-1539
Urao T, Yakubov B, Satoh R, Yamaguchi-Shinozaki K, Seki M, Hirayama T and Shinozaki
K (1999) A transmembrane hybrid-type histidine kinase in Arabidopsis thaliana func-
tions as an osmosensor. Plant Cell 11:1743-1754
Urao T, Yamaguchi-Shinozaki K and Shinozaki K (2000) Two-component systems in plant
signal transduction. Trends Plant Sci 5:67-74
Vigh L, Los D, Horváth I and Murata N (1993) The primary signal in the biological percep-
tion of temperature: Pd-catalyzed hydrogenation of membrane lipids stimulated the
expression of the desA gene in Synecocystis PCC6803. Proc Natl Acad Sci USA
90:9090-9094
Viswanathan C and Zhu J-K (2002) Molecular genetic analysis of cold-regulated gene tran-
scription. Phil Trans R Soc Lond B 357:877-886
Wanner LA and Junttila O (1999) Cold-induced freezing tolerance in Arabidopsis. Plant
Physiol 120:391-399
Warren G, McKown R, Martin AL and Teutonico V (1996) Isolation of mutations affecting
the development of freezing tolerance in Arabidopsis thaliana (L.) Heynh. Plant
Physiol 111:1011-1019
Weber MHW, Fricke I, Doll N and Marahiel MA (2002) CSDBase: an interactive database
for cold shock domain-containing proteins and bacterial cold shock response. Nucl Ac-
ids Res 30:375-378
Weiser CJ (1970) Cold resistance and injury in woody plants. Science 169:1269-1278
Welling A, Kaikuranta P and Rinne P (1997) Photoperiodic induction of dormancy and
freezing tolerance in Betula pubescens. Involvement of ABA and dehydrins. Physiol
Plant 100:119-125
Welling A, Moriz T, Palva ET and Junttila O (2002) Independent activation of cold accli-
mation by low temperature and short photoperiod in hybrid aspen. Plant Physiol
129:1633-1641
Wu Y, Kuzma J, Maréchal E, Graeff R, Lee HC, Foster R and Chua N-H (1997) Abscisic
acid signaling in plants through cyclic ADP-ribose in plants. Science 278:2126-2130
Xin Z and Browse J (1998) eskimo1 mutants of Arabidopsis are constitutively freezing-
tolerant. Proc Natl Acad Sci USA 95:7799-7804
Xin Z and Browse J (2000) Cold comfort farm: the acclimation of plants to freezing tem-
peratures. Plant Cell Environ 23:893-902
Xiong L, Ishitani M, Lee H and Zhu J-K (2001a) The Arabidopsis LOS5/ABA3 locus en-
codes a molybdenum cofactor sulfurase and modulates cold stress- and osmotic stress-
responsive gene expression. Plant Cell 13:2063-2083
Xiong L, Lee BH, Ishitani M, Lee H, Zhang C and Zhu J-K (2001b) FIERY1 encoding an
inositol polyphosphate 1-phosphatase is a negative regulator of abscisic acid and stress
signaling in Arabidopsis. Genes Dev 15:1971-1984
Xiong L, Lee H, Ishitani M, Tanaka Y, Stevenson Becky, Koiwa H, Bressan RA, Hasegawa
PM and Zhu J-K (2002) Repression of stress-responsive genes by FIERY2, a novel
transcriptional regulator in Arabidopsis. Proc Natl Acad Sci USA 99:10899-10904
Yamaguchi-Shinozaki K and Shinozaki K (1993) Arabidopsis DNA encoding two desicca-
tion-responsive rd29 genes. Plant Physiol 101:1119-1120
Yamaguchi-Shinozaki K and Shinozaki K (1994) A novel cis-acting element in an Arabi-

dopsis gene is involved in responsiveness to drought, low-temperature, or high-salt
Yang Y, Fang S, Jensen JP, Weissman AM and Ashwell JD (2000) Ubiquitin protein ligase
activity of IAPs and their degradation in proteasomes in response to apoptotic stimuli.
Science 288:874-877
Zhu J-K (2001) Cell signaling under salt, water and cold stresses. Curr Op in Plant Biol 4:
401-406
53:247-273
Örvar BL, Sangwan V, Omann F and Dhindsa RS (2000) Early steps in cold sensing by
plant cells: the role of actin cytoskeleton and membrane fluidity. Plant J 23:785-794
7 Heavy metal signalling in plants: linking cellular
and organismic responses
Andrea Polle and Andres Schützendübel
Abstract
Heavy metals are required in plants as essential micronutrients or act as toxic

compounds. How do plants perceive heavy metals and which signalling cascades
are triggered leading to plant adaptation or injury? Copper (Cu) and cadmium (Cd)
are reviewed as examples for heavy metals with contrasting physicochemical
properties and functions in plants. Cu is an essential ligand for the catalytic activ-
ity of many enzymes. Its uptake and trafficking are tightly regulated and mediated
by specific transporters and chaperones. Cu serves as a signalling intermediate for
ethylene reception. Excess Cu is sensed by binding to transcription factors,
thereby, activating an arsenal of abiotic stress defences including increased ex-
pression of metallothioneins, phytochelatins, and antioxidants which contribute to
remove "free" Cu and to re-establish cellular ion and redox homeostasis. In con-
trast to Cu, no specific uptake systems are known for Cd. Cd enters cells by metal
transporters with broad substrate specificities and probably also via Ca channels. It
is toxic because of its high reactivity with sulphhydryl groups and causes oxida-
tive stress by depletion of antioxidative systems and stimulation of H2O2-
producing enzymes. As a result, Cd triggers stress signalling pathways similar to
those activated by Cu including cascades leading to programmed cell death. Im-
portant cross-talk exists between heavy metal and other abiotic stress signalling
pathways (drought, oxidative stress). Excess heavy metals affect root functions at
multiple levels and cause accumulation of abscisic acid (ABA). We propose a
model how ABA and Cd signalling may interact at the organismic level to influ-
ence plant water status. Cytokinins act as antagonists of Cd indicating that the
plant internal hormonal status may critically affect heavy metal tolerance.
7.1 Introduction
Heavy metals are defined as metals with a density higher than 5 g cm-3 (Weast
1984). From a biological perspective, this definition is not very useful because it
comprises the majority of naturally occurring elements. However, only a limited
number of these elements is soluble under physiological conditions and, thus, may
become available for living cells. Among them are elements which serve plant

188 Andrea Polle and Andres Schützendübel
Table 1. Regulatory limits for heavy metal concentrations in soil1 (EU-Richtlinie

91/692/EWG, ABI EG, 31. Dec. 1991 Nr. L377, p. 48) and KSVO2, 1992
Element Regulatory limit1 mean soil concen- limit in sludge for
(mg kg-1 DM) tration2 farm land2
(mg kg-1 DM) (mg kg-1 DM)
Cadmium 1-3 0.1-0.5 1.5
Copper 50-140 2-40 60
Nickel 30-75 5-50 50
Lead 50-130 2-60 100
Zinc 150-300 10-80 200
Mercury 1-1.5 0.02-0.5 1
Chromium not determined 5-100 100
metabolism as micronutrients or trace elements (Fe, Mo, Mn, Zn, Ni, Cu, V, Co,
W, Cr) and which become toxic when present in excess, as well as others with no
known biological functions and high phytotoxicity such as As, Hg, Ag, Sb, Cd,
Pb, and U (Godbold and Hüttermann 1985, Breckle 1991, Nies 1999).
The regulatory limits of heavy metals in the environment are defined by na-
tional legislation. Current regulations in the European communities have been
summarised in table 1. Heavy metal concentrations in soils show regional differ-
ences and may locally exceed regulatory limits 10- to 50-fold (Lantzy and Mack-
ensie 1979, Galloway et al. 1982, Jackson and Alloway 1991, Wagner 1993, An-
gelone and Bini 1992, Haag-Kerwer et al. 1999). Soils covering ore-bearing rocks
or near slag heaps naturally contain heavy metals in amounts, which are toxic to
most plant species. On such sites, specialised plant communities of "chemo-
ecotypes" have evolved providing opportunities to investigate traits of heavy
metal resistance. Well-known examples are Silene vulgaris, Caradaminopsis
halleri (now Arabidopsis halleri), Agrostis tenuis, and Minuartia verna (Ernst
1990). However, apart from such confined natural habitats, there is growing con-
cern about an increasing release of heavy metals into the environment.
Sources of heavy metals include traffic, refuse dumps, and sewage sludge.
Emissions of dust, aerosols, and fly ashes from metal processing industries, e.g. in
electroplating and galvanising, or metal-mining and smelting lead to spreading of
heavy metals into rural areas. In agricultural soils heavy metal pollution is an in-
creasing problem because of soil-amendment with municipal sewage sludge (Ta-
ble 1) and intense use of phosphate fertilisers, which contain Cd as a contaminant
(Hüttermann et al. 1999). The long biological lifetime and retention in soils fa-
vours heavy metal accumulation in the food web with potentially negative effects
for human health (Wagner 1993). The bioavailability for heavy metals is plant
specific and depends on the demand of specific metals as micronutrients and on
the plant's ability to regulate actively metal mobilisation by exudation of organic
acids or protons into the rhizosphere (Marschner 1995, Hinsinger 1998, McLaugh-
lin et al. 1998, Hinsinger 2001). In addition, soil properties influence the chemical
mobility of metals, thereby, regulating their release into the soil solution (Juste et
al. 1985, Juste and Solida 1988).
7 Heavy metal signalling in plants: linking cellular and organismic responses 189
The ability of plants to extract metals from soil, plant internal metal allocation,
and cellular detoxification mechanisms are research areas currently attracting in-
creasing attention. These topics have recently been covered by excellent reviews
(Salt et al. 1998, Sanita di Toppi and Gabrielli 1999a, Clemens 2001, Cobbett and
Goldsbrough 2002, Hall 2002; Schützendübel and Polle 2002) and will only be
treated briefly here. In the present paper, we have chosen to focus on metals with
contrasting action in plants cells. We will discuss chemical properties of these
metals with respect to their toxicity and summarise current knowledge how heavy
metals may interfere with cellular signalling and which signalling cascades they
trigger leading to plant adaptation or injury. An attempt will be made to integrate
cellular and long distance signalling in the context of organismic reactions.
7.2 Chemical properties, toxicity, and stress signalling of

heavy metals with contrasting functions in plants
7.2.1 Copper
Cu is an important micronutrient with a critical deficiency level in the range of 1 -

5 mg kg-1, an adequate range from 6 - 12 mg kg-1, and toxicity above 20 – 30 mg
kg-1 dry mass (Marschner 1995). However, there are huge species-specific differ-
ences in the ability to tolerate Cu. Certain metallophytes may even accumulate up
to 1000 mg Cu kg-1 in leaves (Morrison et al. 1981).
Cu is a transition metal with an electrochemical potential of -260 mV, which is
well within the cellular redox range of aerobic cells from -420 mV to +800 mV. It
participates as an important redox component in cellular electron transport chains,
for example as cofactor of enzymes, especially of oxidases. Autoxidation of "free"
Cu+ results in O2.- formation and subsequently in H2O2 and OH• production via
Fenton-type reactions. Oxidative injury by transitions metals such as Cu+ and Fe2+
is well documented in microbes, plants, and animals (reviewed by Stohs and
Baghi 1995, Nies 1999, Schützendübel and Polle 2002). Excess Cu seems to in-
duce programmed cell death because markers (HIN1, HSR203J), whose expres-
sion is typically activated in cells committed to hypersensitive cell death, are also
found in response to excess Cu (Pontier et al. 1999).
Since free metals are potentially dangerous, their uptake and cellular concentra-
tions must be strictly regulated. Cu has a high affinity for peptide and sulphhydryl,
carboxylic, and phenolic groups. Therefore, Cu is usually present in living cells in
bound forms. Recent calculations led to the conclusion that the concentration of
free copper in yeast is less than one ion per cell in the face of an overall concentra-
tion of 70 µM; in other words, unbound Cu does essentially not exist (Rae et al.
1999). This implies a tight co-regulation between Cu uptake and the provision of
Cu-binding sites. Inside the cell, Cu is transported via chaperones (see section
7.3.2). It is possible that superoxide dismutases (SOD), which contain Cu/Zn, Fe,
or Mn in their reaction centre, play a dual role in preventing metal toxicity: on the
one hand they scavenge O2.- radicals, thus, maintaining reactive oxygen species at
low concentrations and on the other hand they seem to be involved in preventing
accumulation of free metals. Yeast lacking Fe-SODs and/or Mn SODs showed
elevated levels of "free" iron (Srinivasan et al. 2000) emphasising the importance
of SODs for Fe-binding. In a similar line of evidence it was shown that, exposure
to excess Cu caused increases in Cu/Zn SOD activities (Chongpraditnum et al.
1992, Kurepa et al. 1997). Kurepa et al. (1997) suggested that Cu/Zn-SOD was
under Cu-mediated transcriptional control. Whether these increases in SOD,
which have so far solely been interpreted as a means to prevent oxidative injury,
are also important to control the level of "free" copper needs to be investigated.
Cu and Cd (see below) activate the formation of phytochelatins (PC) and metal-
lothioneins (MT), both cysteinyl-rich compounds with functions in heavy metal
sequestration (Cobbett and Goldsbrough 2002). MTs are a family of ubiquitous
small proteins. The promoter regions of MT carry MRE elements (metal respon-
sive elements: GCGCGCA) leading to increased MT accumulation because of
heavy metal exposure (Cobbett and Goldsbrough 2002). PCs are produced enzy-
matically from the tri-peptide precursor GSH (γ-glutamyl cysteinyl glycine). In re-
sponse to heavy metals γECS (γ-glutamyl cysteinyl synthase), the first and limit-
ing enzyme in GSH biosynthesis (Noctor et al. 1998) is activated transcriptionally
(Lee and Korban 2002) and leads to PC accumulation (Rauser 1999). Metals
bound to GSH or PCs are transported into the vacuole via ABC transporters (Rea
1999). Analysis of mutants and transgenic plants provided compelling evidence
that the ability to synthesise glutathione is crucial for protection from heavy met-
als and failure to do so leads to increased sensitivity (Howden et al. 1995, Zhu et
al. 1999a,b). Still, the significance of metal sequestration by MTs and PCs as a
universal defence mechanism to protect the cell against these metals is controver-
sial. It has frequently been shown that cellular concentrations of GSH and/or PC
are not correlated with heavy metal tolerance. It is likely that additional independ-
ent traits also contribute to mediate heavy metal tolerance. For example, when PC
and GSH synthesis was blocked in hypertolerant species of Silene vulgaris,
Thlaspi caerulescens, Holcus lanatus, and Agrostis castellana, Cu sensitivity was
not increased (Schat et al. 2002). This suggests that Cu-sequestration by PCs is not
essential for constitutive tolerance or hypertolerance. With respect to Cd, a differ-
ential behaviour was observed. Cd sensitivity was increased in non-hypertolerant
but not in hypertolerant plants indicating that adaptive hypertolerance is not based
on PC-sequestration of Cd (Schat et al. 2002).
7.2.2 Cadmium
In contrast to copper, Cd has no known biological function in higher plants. The

critical tissue concentration, at which the metal causes decreases in biomass, is in
the range of 3 – 10 mg kg-1 dry mass (Bahlsberg-Pahlson 1989).
Cd has higher affinity to thiol groups than other metallic micronutrients, e.g. a
three-fold higher affinity for sulphhydryls than Cu (Schützendübel and Polle
2002). This feature is probably also the major basis for its toxicity. Cadmium di-
rectly affects the sulphhydryl homeostasis and inhibits SH-bearing, redox regu-
lated enzymes in living organisms (Canesi et al. 1998, Chrestensen et al. 2000,
Hall 2002, Schützendübel and Polle 2002). Cd can also bind to other functional
groups containing nitrogen or oxygen (Nieboer and Richardson 1980). When Cd
binding was analysed by x-ray absorption spectroscopy interaction with O and N-
ligands was found in the xylem and with S in roots (Salt et al. 1995).
Although Cd does not participate directly in cellular redox reactions, it is well
established that Cd exposure leads to oxidative injury such as lipid peroxidation
and protein carbonylation (Gallego et al. 1996, Chaoui et al. 1997, Romero-Pueras
et al. 2002, Schützendübel et al. 2002). Cd-exposed Arabidopsis show a fast
upregulation of HSP70, a chaperone involved in re-folding of denatured protein,
probably in an attempt to rescue cell metabolism (Suzuki et al. 2001). Protein de-
naturation and also displacement of other divalent cations such as Zn and Fe from
proteins cause the release of "free" ions (Stohs et al. 2000). It is, therefore, con-
ceivable that Cd may increase the level of free transition metals and cause oxida-
tive injury via free Fe/Cu-catalysed Fenton reactions (Fig. 1).
Cd disturbs the cellular redox balance. One of the most prominent responses to
Cd, and also to other heavy metals, is an initial transient depletion in GSH, which
is probably because of an increased demand of this precursor for PC synthesis
(Grill et al. 1987, De Vos et al. 1992, Vögeli-Lange and Wagner 1996, Gallego et
al. 1996, Sanita di Toppi et al. 1998, Xiang and Oliver 1998, Madhava Rao and
Sresty 2000, Schützendübel et al. 2001). During prolonged Cd exposure, the GSH
pools recover. The reason is that under such conditions the demand for sulphur in-
creases, which in turn leads to increased expression of a high affinity sulphate
transporter and, thus, in increased sulphate uptake (Nocito et al. 2002).
The initial depletion of the GSH level was temporally correlated with an inhibi-
tion of antioxidant systems (Schützendübel and Polle 2002). Furthermore, it was
shown that Cd triggers H2O2 accumulation (Piqueras et al. 1999, Romero-Pueras
et al. 1999, Schützendübel et al. 2001, Schützendübel et al. 2002). The sources of
this H2O2 are not known yet. Model calculations suggest that the inhibition of an-
tioxidant systems by Cd would be sufficient to cause significant H2O2 accumula-
tion (Schützendübel and Polle 2002). However, stimulation of H2O2-producing
enzymes analogous to pathogen responses may also be involved. As a defence
against pathogens, plasma membrane localised NADPH-oxidases are activated to
trigger an oxidative burst resulting in transient H2O2 accumulation (Levine et al.
1994, Tenhaken and Rübel 1999). To date, evidence is still lacking whether this
system is also involved in Cd-responses. However, it is tempting to speculate
about a participation of NADPH-oxidases in Cd-responses, because the plant
gp91phox NADPH oxidase homologue is regulated by Ca2+ (Sagi and Fluhr 2001).
Ca2+ is readily displaced by Cd2+ (Das et al. 1997) suggesting that effects of Cd on
Ca-dependent enzymes systems are likely (Fig. 1). This is also supported by the
observation that the Cd-induced oxidative burst was abolished by Ca in BY2 to-
bacco cell cultures (Piqueras et al. 1999).
In contrast to NADPH-oxidases, whose role in Cd-responses is speculative, the
participation of oxalate oxidases in Cd-mediated H2O2 formation has been shown
Fig. 1. Possible routes of cadmium and copper stress signalling. Cd causes H2O2 accumula-
tion either by stimulation of H2O2-forming enzymes (OXO = oxalate oxidase, NADPH OX
= NADPH oxidase) or indirectly by displacement of transition metals from chaperones
(Me+ Cha) or enzymes (Me+ enzymes). This leads to unfolding of the enzymes and, if not
rescued by metallochaperones, to protein degradation. The released transition metals will
result in oxidative stress. H2O2 triggers the MAPK cascade probably involving histidine
kinases (His Kin) and activates transcription of defence genes. Free transition metals also
activate genes required for protection such as chaperones, metallothioneins (MT), and en-
zymes for GSH biosynthesis. GSH binds Cd directly or will be used for phytochelatin syn-
thesis (PC) and transport of sequestered Cd into the vacuole. The MTs and metallochaper-
ones combat the effects of metal displacement and oxidative stress. Excess Cu causes
oxidative stress by stimulation of oxalate oxidase or by electron transfer to molecular oxy-
gen. Subsequent cellular responses are similar to those caused by Cd.
in transgenic tobacco expressing a wheat germin gene (Berna and Bernier 1999).
Oxalate oxidase, gf-2.8, a member of the germin gene family was stimulated upon
exposure to heavy metals including copper and cadmium. The gf-2.8 expression
wasalso upregulated by pathogens, developmental and hormonal signals (Berna
and Bernier 1999). Thus, it is evident that cross-talk between developmental, other
stress signalling pathways and Cd, respective heavy metal signalling, must exist.
gf-2.8 homologues have also been identified in Arabidopsis (Membré et al. 1997).
Nevertheless, it is still an open question whether the Cd-induced H2O2 formation
in planta is generally mediated by members of this enzyme family or by other not
yet identified systems.
For a long time H2O2 has been considered mainly a harmful oxidant, whose ac-
cumulation in response to stresses leads to unspecific oxidation and necrosis.
However, now it has been recognised that H2O2 also acts as a secondary signalling
compound inducing defence pathway including e.g. the MAPK cascade (Kovtum
et al. 2000). A comparison of global transcriptome analysis of Arabidopsis genes-
responding to H2O2 (microarray data, Desikan et al. 2001) and Cd-responsive
genes (differential display data, Suzuki et al. 2001) shows that a suite of common
genes responded to both stimuli. Among the genes identified were transcription
factors, e.g. DREB2A, rd29A, and OBF5 (Suzuki et al. 2001), which have roles in
abiotic stress responses. OBF5 is a DNA binding protein, which can recognise the
upstream region of a glutathione-S-transferase (GST, Chen et al. 1996), an en-
zyme also activated via the MAPK signalling cascade by H2O2 (Kovtun et al.
2000). GSTs are necessary for xenobiotic detoxification and may be involved in
the transport of GSH-conjugates to vacuole (Marrs and Walbot 1997). It is not
known whether GSTs are important for Cd-detoxification. It is surprising that mi-
croarray analysis of Arabidopsis challenged by H2O2 has shown little evidence for
significant upregulation of oxidative stress related genes, e.g. those encoding en-
zymes of the glutathione-ascorbate pathway (Desikan et al. 2001). Xiang and
Oliver (1998) suggested an independent transcriptional regulation of genes encod-
ing GSH-synthesising enzymes by H2O2 and Cd. The GSH biosynthetic pathway,
however, was activated by jasmonate pointing to cross-talk between general stress
signalling and heavy metal signalling, respectively.
7.3 Uptake and sensing of heavy metals: regulation of

metal homeostasis
7.3.1 Extracellular cellular processes and biotrophic interactions
In whole plants, roots are the primary site to which heavy metals gain access. The
dissolved ions move apoplastically with the inflowing water. In general, a large
fraction of Cd or Cu is retained by the roots and only comparatively small
amounts (about 10%) are transported to the shoots (Hogan and Rauser 1981,
Cataldo et al. 1983, Lolkema and Vooijs 1986, Arduini et al. 1996, 1998, Simon
1998, Liao et al. 2000, Vassilev et. 1999). Although Cd is not a nutrient, an active
transport of this element across the Casparian strip must be postulated since cell
walls in the vascular bundle of roots contained higher Cd concentrations than
those of cortex cells (Polle and Fritz, unpublished data). Analysis of the subcellu-
lar localisation of Cd by analytical electron microscopy showed that Cd and Cu
were enriched in cell walls compared with the cytosol (Arduini et al. 1996). Be-
cause of their negative charges, cell walls have significant capacities for retention
of Cd and Cu (Weigel and Jäger 1980, Lolkema and Vooijs 1986, Rauser 1987,
Hart et al. 1998). The binding properties of cell walls and their role for metal tol-
erance are still a controversial issue. Taking cell walls as a "dead" compartment, it
is clear that their chemical binding capacity would be limited and, thus, protection
against excess heavy metals restricted. In contrast to this view, cell walls have
been recognised in recent years as a compartment of active metabolism, e.g. as a
source of signalling molecules in pathogen interactions, and as a location, where
heavy metals can be bound to protein or silicates (Bringezu et al. 1999). Blinda et
al. (1997) showed that exposure to heavy metals (Cd, Ni) was followed by a sig-
nificant de novo synthesis of proteins released into the apoplastic space. This sug-
gests that walls have more than a passive role in environmental sensing. However,
more work needs to be done to elucidate the function of the extracellular com-
partment in heavy metal signal transmission and detoxification.
In natural environments, most plants have symbiotic associations with mycobi-
onts, which modify host nutrient relationships (Jenschke and Godbold 2000).
These symbiotic interactions are important since they generally increase heavy
metal tolerance (Jenschke and Godbold 2000, Schützendübel and Polle 2002).
Several mechanisms have been suggested to explain the ameliorative influence of
mycorrhiza on plants exposed to heavy metals and all involve exclusion or restric-
tion of metal movement by the fungus to host roots. Since mycorrhizal fungi form
a hyphal mantle around the root tip, they prevent the physical contact of the root
tip with the surrounding medium. With their large surface area, mycorrhizal fungi
can immobilise significant concentrations of Cd in cell walls, thus, decreasing the
portion available to plants. This was found for ectomycorrhizal as well as for ar-
buscular mycorrhizal symbioses (Jenschke et al. 1999, Frey et al. 2000, Rivera-
Becerril et al. 2002). Furthermore, mycorrhizal fungi such as Paxillus involutus
sequester huge concentrations of Cd in the vacuole (Blaudez et al. 2000), which
correlate with the vacuolar sulphur concentrations (Ott et al. 2002). Mycorrhizal
fungi also activate MTs upon heavy metal exposure. Heterologuous complementa-
tion assays with yeast confirmed that GmarMT1, a MT-like polypetide, conferred
tolerance against Cu and Cd (Lanfranco et al. 2002).
Mycorrhizal symbiots probably also affect plant-inherent tolerance. For exam-
ple, Schützendübel and Polle (2002) reported that mycorrhiza showed a significant
increase in host-derived phenolics. Phenolics can act as a pre-formed defences be-
cause heavy metals, e.g. Cu, have high affinities to such secondary metabolites.
With respect to aluminium, a protective function of phenolics has already been
demonstrated (Yamamoto et al. 1998). Thus, in addition to providing a barrier
against excess heavy metals mycorrhiza can also stimulate the host defence and
may contribute to increase physiological metal tolerance. It will be a challenging
future task to unravel signalling networks between symbiotic organisms, which

lead to synergistic increases in heavy metal tolerance of the host plant.
7.3.2 Cellular signalling of copper – means to maintain homeostasis
Uptake of essential micronutrients like Cu, Zn, or Fe is normally regulated at tran-

scriptional and posttranscriptional levels involving selective and non selective
cation channels. These include the heavy metal CPx ATPases (members of P-type
ATPase, which generate a proton gradient across the membrane required to drive
efflux carrier), Nramps (natural resistance macrophage protein with the function
of multispecific metal transporters with roles in manganese and iron homeostasis),
the CDF (cation diffusion facilitator, which mediate cation efflux and contain His-
rich regions which affect metal specificity and have major roles in Zn and Co re-
sistance), and the ZIP family (Zn and iron transporters, with metal binding His-
rich sequences) (reviewed by Guerinot 2000, Williams et al. 2002). Analysis of
bacteria, fungi, plants, and animals suggests that the systems involved in metal up-
take and sensing are evolutionary conserved (Mäser et al. 2001). In plants, the pic-
ture of metal uptake and sensing is complicated and incomplete due to the high
number of putative transporters identified by genomic approaches (Mäser et al.
2001). At an organismic level, the situation will be more complex because of
biotrophic interactions as outlined above. Virtually nothing is known about the
molecular biology of metal transporters in mycorrhizal fungi and how they inter-
act with the plant regulatory network for metal uptake. However, yeast systems
are well characterised. Because of the similarities of transport systems across the
microbial and plant kingdom, yeast Cu-transport and intracellular trafficking sys-
tems will be compared with those of plants.
In S. cerevisae, copper transporters (CTR) have been detected, which are regu-
lated at the level of gene transcription, by posttranscriptional events and protein
trafficking (Puig et al. 2002). A homologue COPT1 has been found in Arabidop-
sis, which reconstituted a yeast Cu-uptake mutant (Kampfenkel et al. 1995). This
indicates that COPT1 encodes a copper transporter (Kampfenkel et al. 1995).
Since its expression has only been found in stems and leaves but not in roots, spe-
cific systems for Cu uptake from the soil remain to be identified. It is also possible
that root uptake occurs mainly via non selective cation channels, and that intracel-
lular metal concentrations are regulated by activation of efflux carriers like in bac-
teria (Silver 1996).
In cells, "free" copper is apparently absent (see above). Under normal, i.e. Cu-
limiting conditions, three Cu-chaperones have been identified in yeast, which are
essential for intracellular binding and transport of Cu: ATX1 and Cox17 deliver
Cu into the Golgi vesicle and mitochondria, respectively, while Lys7 is important
for the Cu metallation of cytoplasmatic superoxide dismutase (SOD) (Lin et al.
1997, Glerum et al. 1997, Culotta et al. 1997, Portnoy et al. 2001). ATX1 is a
ubiquitous metallochaperone with homologues found in plants, microbes, and
animals that functions in copper transfer to an integral membrane cation transport-
ing P-type ATPase (Huffman and O´Halloran 2000). In yeast, this ATPase,
Fig. 2. Model for the role of Cu in ethylene signalling and hypothetical interference of Cd
with this pathway. Cu is taken up by a Cu-specific transporter, transported by chaperones to
various destinations e.g. to superoxide dismutases (Cu/Zn-SOD), mitochondria, and is
pumped into post-Golgi vesicles. In these vesicles, complementation of ethylene receptors
takes place and the functional units are delivered to the plasma membrane. In the absence
of ethylene, they function as negative regulators of ethylene-activated genes. When ethyl-
ene binding inactivates the receptor, downstream signalling pathways are derepressed and
activate hormone responses (after Hirayama et al. 1999) such as metallothionein (MT) tran-
scription. Excess Cu mediates MT expression by activation of transcription factors. The
role of Cd is speculative. By its ability to displace cations like Cu, Cd might inactivate the
functional receptor and, thereby, activate the constitutive ethylene phenotype like in RAN1
mutants.
denominated as Ccc2, pumps copper into the lumen of the Golgi vesicles (Culotta
et al. 1997). The Arabidopsis homologue of ATX1 was involved in the intracellu-
lar trafficking of copper facilitating the connection to an acceptor molecule
(Himelblau et al. 1998). RAN1, the Arabidopsis homologue to Ccc2, is involved
in the transfer of copper into Golgi vesicles (Hirayama et al. 1999). It was surpris-
ing that RAN1-cosuppressed plants showed a constitutive ethylene response phe-
notype indicating a link between Cu and ethylene signalling. Hirayama et al.
(1999) proposed a model according to which RAN1 was necessary to deliver Cu
to form functional ethylene receptors. The functional receptors are targeted to the
plasma membrane (Fig. 2). Receptors containing Cu are active in the absence of
the hormone and negatively regulate down-stream signalling pathways. In the
presence of ethylene, the receptors are inactivated, presumably by suppressing his-
tidine kinase/phosphatase activity. This in turn results in a suppression of the
downstream pathway controlling components activating the ethylene phenotype.
This means that Cu is not only triggering signalling pathways but is also a signal
transducing molecule. It is notable that the promotor of a MT gene in Lycopersi-
con esculentum contains ethylene- and MRE motifs (Whitelaw et al. 1997) indi-
cating that this protein can be regulated independently by excess Cu and other
stress signals.
In yeast, signalling of excess Cu involves activation of transcription factors
(TFs). The TF Ace1 was activated directly by free copper binding to cysteinyl
residues within a Cu-regulatory binding domain (Beaudouin and Labbe 2001).
The transcriptional activation of downstream genes involves cis-acting metal-
responsive elements found in multiple copies in gene promoters, and metal-
responsive transcription factors (Thiele 1992). Downstream located genes acti-
vated by these TFs have several functions in protecting cells against copper toxic-
ity among them activation of genes encoding metallothioneins and superoxide
dismutase. The co-regulation of metallothioneins and SOD is suspicious because
both are important to prevent oxidative injury catalysed by free transitions metals
(see above). These results indicate that the Cu level in yeast cells will be main-
tained stable by sensing Cu directly via metal responsive TFs. Under normal con-
ditions copper will be always be bound and transported by proteins to its place of
action. Excess Cu will switch on defences. Comparable signalling networks have
been elucidated for iron and zinc sensing in yeast, emphasising the strict regula-
tion of intercellular levels of "free" metals.
It is not known yet which TFs are involved in sensing of Cu and regulation of
its cellular concentrations in plants. However, it can be expected that genomic
analyses of Cu-responsive gene expression will give answers soon. The isolation
of several MT genes from different plant species induced by heavy metals like Cu,
Zn and also Cd suggests that regulatory pathways similar those operating in yeast
may exist in plant cells (Tommey et al 1990, Zhou and Goldsbrough 1994, Robin-
son et al. 1996). It will be interesting to see whether plant Cu/Zn-SODs are acti-
vated by Cu-metallochaperones analogous to those of yeast and mammalians
(Schmidt et al. 1999). Post-transcriptional regulation of plant and fungal SODs
would explain why discrepancies between measured SOD activities and transcript
levels have repeatedly been observed after heavy metal challenge (Kampfenkel et
al. 1995, Jacob et al. 2001, Schützendübel et al. 2001).
7.3.3 Cellular signalling of cadmium
In contrast to essential metals, specific transporters for Cd have not been un-
equivocally demonstrated in plants although biochemical evidence suggests that
such systems may exist in some specialised ecotypes (Zhao et al. 2002). Cd uptake
occurs via Zn and Fe-transporters, which also have low affinities for Cd. ZRC1, a
member of the CDF family of yeast involved in Zn transport, is localised in
vacuolar membrane suggesting that this protein may also be involved in effluxing
Cd from the cytosol into the vacuole (Li and Kaplan 1998). In plants, a zinc trans-
porter (ZNT1) also mediated low affinity Cd-uptake (Pence et al. 2000). Yeast
ZRC1 deletion mutants showed increased sensitivity to Zn and Cd (Conklin et al
1994). Complementation of these mutants with homologues from the Zn-
hyperaccumulator plant, Thaspi goesingense, increased the resistance to Cd, Co,
Ni, and Zn (Mäser et al. 2001). In Schizosaccharomyces pombe, deletion of Zhf, a
CDF involved in Zn transfer to the endoplasmatic reticulum, rendered the mutants
significantly more Cd tolerant but Zn sensitive (Clemens et al. 2002). The protec-
tive effect against Cd was independent of the phytochelatin pathway since PC syn-
thase-deficient cells also showed significant increases in Cd tolerance when Zhf
was inactivated.
Ectopic expression of Arabidopsis AtNramps (contribute to iron homeostasis)
in yeast increased Cd sensitivity and accumulation (Thomine et al. 2000). In
Arabidopsis, disruption of AtNramp3 leads to increased Cd resistance, whereas
overexpression confers slightly higher Cd sensitivity (Thomine et al. 2000). IRT1,
an Arabidopsis transporter of the ZIP family, which is expressed in roots of Fe-
deficient plants (Korshunova et al 1999), is inhibited by Cd. Expression of IRT1
in yeast results in increased Cd sensitivity suggesting that IRT1 also mediates Cd
uptake (Rogers et al. 2000). At the organismic level, it has been shown that suffi-
cient Fe supply had beneficial effect on the Cd tolerance of plants, whereas Fe de-
ficiency increased Cd susceptibility (Siedlecka and Krupa 1999).
Ca2+ channels have also been suggested to be involved in Cd uptake (White,
2000). Clemens et al. (1998) reported that a wheat Ca-transporter (LCT1) ex-
pressed in yeast also mediated Cd uptake. However, this uptake system may be
species-specific, since homologues have not been found in Arabidopsis. Because
specific transport systems for Cd seem to be lacking, one can assume that no Cd-
specific signalling mechanisms exist to control its uptake. Nevertheless, Cd is
immediately sensed because it affects the cellular redox status; it interferes with
Ca signalling pathways, and disturbs uptake of other divalent cations such as Zn or
Fe.
Identification of Cd-responsive genes in Arabidopsis by differential display re-
vealed 31 clones among them 8 with no homologies to known functions of pro-
teins (Suzuki et al. 2001). The others were assigned the following functions: signal
transduction (protein kinases, transcription factors, calcium binding), protein fold-
ing, sulphur metabolism, metal binding, and abiotic stress responding. The tempo-
ral profiles of transcript accumulation showed early responses for kinases and
transcription factors and with some delay also upregulation of genes encoding
stress responsive proteins (chaperones, metal transporters) (Suzuki et al. 2001).
This suggests that Cd rapidly activates signal transduction pathways including the
protein phosphorylation cascade. Among the kinases, identified MEKK1 is of par-
ticular interest because it conferred increased Cd resistance to transfected yeast
(Suzuki et al 2001). Cross-talk exists between Cd signalling and pathogen defence
signalling because increased transcript levels of homologues to the transcription
factors bZIP and WRKY were also found (Suzuki et al. 2001). Although pathways
of Cd signalling in plants are not complete, the emerging picture suggests that
plants employ a net of existing signalling cascades to "report" imbalances in cellu-
lar homeostasis to the nucleus, where a diverse array of responses will be acti-
vated. It is likely that the necessity of plants to cope with ever changing environ-
mental conditions and co-evolving micro-organisms makes it more advantageous
to transmit specific stress signals into a net of pleiotropic responses than to chan-
nel these signals to specific defence responses with a greater likelihood of failure.
7.4 Stress signals triggering plant growth and

development at the organismic level
7.4.1 Links between cellular heavy metal signalling and inhibition of

root growth
A common response to heavy metal exposure is a significant reduction in plant

growth (Balsberg Pahlsson 1989, Kahle 1993, Sanita di Toppi and Gabrielli
1999a). Normal growth is the result of cell division, elongation, and differentiation
including also programmed cell death in certain tissues like the xylem. Numerous
reports show that heavy metals almost instantaneously affect root elongation
(Hunter and Welkie 1976, Hogan and Rauser 1981, Godbold and Hüttermann
1985, Liao et al. 2000, Schützendübel et al. 2001) accompanied by significant de-
creases in mitotic activity (Jiang et al. 2001) and damage to nucleoli in the tip
meristem (Liu et al. 1995). It has recently been shown that the cellular redox state,
especially the concentration of GSH, regulates cell division (May et al 1998). The
cell cycle consists of alternating phases of DNA replication (S phase) and mitotic
stadiums (M phase) separated by gaps (G phase). An important checkpoint, the
transition between the gap phase 1 (G1) and the S phase, is regulated by the intra-
cellular GSH level (Vernoux et al. 2000). Evidence was obtained by showing that
the ROOT MERISTEMLESS Arabidopsis mutant lacked a functional gene for γ-
ECS, whose activity is decisive for cellular GSH concentrations (Noctor et al.
1998). Blockers of GSH synthesis also abolished cell division (Vernoux et al.
2000). In situ, analysis confirmed that proliferating root cells contain high GSH
concentrations, whereas cellular GSH levels declined towards the quiescent centre
in root tips (Sanchez-Fernandez et al. 1997). Cd and excess Cu caused an immedi-
ate decline in the overall GSH concentration of roots tips (Rauser et al. 1991,
Meuwly and Rauser 1992, De Vos et al. 1992, Heiss et al. 1999, Schützendübel et
al. 2001, Schützendübel et al. 2002). Addition of GSH reduces the inhibition of
root growth (Chen and Kao 1995). Therefore, one likely mechanism of heavy
metals is to block the cell cycle via effects on the GSH status. However, this effect
will not persist because GSH concentrations recover during prolonged Cd expo-
sure, whereas growth does not (Schützendübel et al. 2001).
Cd also suppresses cell expansion. In shoots, Cd inhibited a proton pump re-
sponsible to build up turgor (Aidid and Okamoto 1992). It is likely that this occurs
in other plant organs as well. Furthermore, roots exposed to Cd show increased
ethylene production, a hormone, which inhibits cell expansion (reviewed by John-
son and Ecker 1998). Cd also leads to significant accumulation of H2O2 (see sec-
tion 7.2.1), which causes cell wall stiffening (Ros Barcelo 1997), thus preventing
further extensibility of the walls. Thus, growth inhibition of roots is probably a
pleiotropic effect caused by direct inhibition of important enzymes as well as by
interference of Cd with cellular signalling.
H2O2, which accumulates in response to heavy metals, is involved as secondary
messenger in abiotic and biotic stress signalling pathways leading to cellular sui-
cide (reviewed by Beers and McDowell 2001). Suspension cultures of tobacco
cells exposed to Cd show apoptotic-like symptoms (Fojtova and Kovarik 2000).
Anatomical analysis of Cd-exposed roots indicates that the response may be cell
specific and that only "competent" cells may undergo PCD because the tips
showed no evidence for a general increase in cell death but formation of protoxy-
lem elements in the zone, which normally constitutes the elongation zone
(Schützendübel et al. 2001). First, this observation indicates that only localised
cell death takes place. Second, it may afford an explanation for the finding that the
inhibition of elongation persists, even when the plants are transferred to Cd-free
medium. If cells in the elongation zone were already committed to differentiate
according to their future functions (e.g. as cortex cells, endodermis, xylem, etc),
the loss of turgor necessary for elongation would stop growth but apparently not
the ability to develop further according to their destination. Consequently, xy-
lematic structures differentiate in the root tip and the vital functions of the root tip
are lost. Apparently, the morphogenetic gradient of hormones (auxin, gibberillins)
is also destroyed because further symptoms developed at sub-lethal Cd-
concentrations resemble those of root tip decapitation, i.e., significant formation of
side roots (Greger and Lindberg 1986, Schützendübel, unpublished data). The ad-
vantage for the plant is obvious and the strategy resembles that against pathogens.
An attacked plant sacrifices a small part of an infested organ by switching to the
cellular suicide programme. These cells then form a barrier preventing spreading
of the invading organism and protect the remaining parts. At the same time, im-
munisation is found (Alvarez et al. 1998). For Cd and Cu, increased tolerance has
also been observed after pre-treatment with low concentrations of these metals
(Talanova et al. 2000). It will be a challenging future task to analyse the molecular
basis of acquired resistance to heavy metals.
Fig. 3. A tentative model for the integration of cellular and long distance signalling of Cd.
Cd is taken up and strongly retained by roots. Its detoxification and sequestration in the
vacuole consumes GSH. The depletion in GSH leads to a halt of the cell cycle and to H2O2
accumulation, which triggers programmed cell death (PCD). Water uptake becomes limit-
ing causing abscisic acid (ABA) formation. ABA, Cd, and perhaps others signalling mole-
cules are transported to the leaves. ABA mediates stomatal closure via a signalling pathway
involving H2O2 formation by NADPH-oxidase (OX) and activation of Ca channels. Cd is
transported into the cells by Ca channels, where it will cause additional H2O2 formation,
thus, aggravating the ABA response.
7.4.2 Long distance signalling and shoot responses to heavy metals
Long distance signals mediate the communication between roots and shoots (Fig.
3). Plant hormones (auxins, ethylene, gibberillins, abscisic acid (ABA)) as well as
nutrient supply (carbohydrates, nitrogen) play decisive roles in this respect. The
complex network of interactions of hormone and nutrient factors is not fully un-
derstood but there is ample evidence that both Cd and excess Cu have significant
effects on most of these compounds. For example, Cd induces the biosynthesis of
ABA and ethylene in roots (Fuhrer 1982, Poschenrieder et al. 1989, Chen and Kao
1995, Hollenbach et al. 1997, Schlagnhaufer et al. 1997, Sanita di Toppi et al.
1998, Munoz et al. 1998, Sanita di Toppi et al. 1999b, Chen et al. 2001). These are
transmittable signals, which evoke stress responses in the shoot. Ethylene inhibits
cell expansion and plays a role in positional signalling of cells (reviewed by John-
son and Ecker 1998). ABA plays a major role in plant adaptation to drought stress
promoting stomatal closure by altering ion fluxes in guard cells (reviewed by
Leung and Giraudat 1998). Plants exposed to Cd or excess Cu show responses,
which can typically also be evoked by plant "stress" hormones such as significant
reduction in expansion growth of leaves and diminished cell size (ethylene re-
sponse) as well as symptoms of water deficit such as decreased stomatal conduc-
tance, and diminution of transpiration (ABA response) (Lolkema and Vooijs 1986,
Barcelo and Poschenrieder 1990, Costa and Morel 1994, Moustakas et al. 1997,
Haag-Kerwer et al. 1999, Perfus-Barbeoch et al. 2002).
It is still a matter of debate to what extent direct toxic effects of heavy metals or
transmitted signals and cross-talk with other stress reactions evoke these symp-
toms. In the case of Cd, water uptake in roots is disturbed, the hydraulic conduc-
tivity decreased and, thereby, water supply to the shoots diminished (Marchiol et
al. 1996). The transport of Cd to the shoot is driven by transpiration and can be re-
duced by application of ABA (Rubio et al 1994, Salt et al. 1995). The influence of
excess Cu on water relations is less clear but symptoms such as loss in water use
efficiency and accumulation of proline, a general marker of drought stress, have
been reported (Lolkema and Voijs 1986, Maksymiec and Baszynski 1996, Chen et
al. 2001, Vinit-Dunant et al. 2002). Proline biosynthesis was also found in Cd-
stressed plants (Schat et al. 1997, Sha and Dubey 1998, Talanova et al. 2000). The
accumulation of these metabolites is important for Cd-tolerance, because the sur-
vival rate of algae overexpressing proline was drastically enhanced (Siripornadul-
sil et al. 2002). Glutathione rescued photosynthesis (El Shintinavy 1999).
Cross-talk exists between drought-induced and Cd-induced signalling pathways
and involves ABA signalling because independently osmotic stress, ABA, and Cd
induced the formation of MTs in chicken pea (Munoz et al. 1998). At the first
glance, induction of MTs by drought stress might appear surprising. However,
Moran et al. (1994) observed in drought-stressed pea seedlings a release of transi-
tion metals, which would on the one hand induce oxidative stress and on the other
hand result in activation of MT-encoding genes as outlined before (see section
7.3.2). MTs contribute to control the concentration of "free" metals and reactive
oxygen species would activate defences, e.g. via the MAPK cascade (Fig. 1).
These responses would help to regain cellular oxidant and metal homeostasis.
The ABA signalling pathway in guard cells, which leads to stomatal closure,
has been shown to occur via induction of H2O2 synthesis, which in turn activates
Ca-channels and blocks K+-inward current (Pei et al. 2000, Murata et al. 2001). In
the ABA-insensitive ABI1-1 mutant, the stimulation of H2O2 was interrupted and,
thus, signal transduction resulting in stomatal closure was blocked (Pei et al.
2000). Cd-induced stomatal closure is independent from ABA-signalling because
it occurs in the ABI1-1 mutant (Perfus-Barbeoch et al. 2002). Perfus-Barbeoch et
al. (2002) provided evidence that Cd enters the guard cells via Ca-channels and
that this leads to stomatal closure. Ca-channel blockers abolished Cd-induced
stomatal closure, whereas the ABI1-1 mutant displayed stomatal closure upon Cd-
exposure similar to that found in controls (Perfus-Barbeoch et al. 2002). Since Cd
causes H2O2 accumulation (see section 7.2.2), and H2O2 is a necessary signal
transducer for stomatal closure, we can infer that Cd must be taken up by the cell
and acts inside to stimulate H2O2-producing systems. Whether H2O2 itself is ac-
cumulated outside, inside, or at multiple sites is not known. Chloroplasts have
been discussed as potential H2O2-sources for stomatal closure (Neill et al. 2002).
However, this is highly unlikely because the chloroplasts are equipped with pow-
erful antioxidant systems (Polle 2001). In addition, there is no evidence for injury
to the light-driven reactions of photosynthesis (Haag-Kerver et al. 1999, Baryla et
al. 2001, Vinit-Dunand et al. 2002). This means that NADPH production in
chloroplasts is unlikely to be limited. Taken together, the data strongly suggest
that Cd acts downstream of the ABA-signal and prior to the H2O2 signal. The ob-
servation that application of ABA and Cd together aggravate the effects on plant
performance compared with Cd alone (Moya et al. 1995) supports the idea that
both ABA and Cd act synergistically. In addition, this finding shows that not all
plant responses to heavy metals are "strategically" directed to counteract negative
consequences of toxic compounds.
There is probably no general answer to the question whether stomatal closure
and the associated losses in water use efficiency and net photosynthesis are pri-
marily a result of direct negative effects of toxic ions or an indirect effect medi-
ated via ABA or other long-distance signals. Both mechanisms are likely to occur.
Which of them is the first to evoke responses will depend on the capacity of roots
to retain heavy metals, the sensitivity of the systems to produce ABA (and other
hormones?), the transport kinetics of these compounds, and the sensitivity of the
target organs. Detailed ecophysiological studies have shown that the effects of Cd
and Cu in shoots depend on the growth stage and physiological age of leaves
(Skorzynska-Polit and Baszynski 1997, Krupa and Moniak 1998, Vinit-Dunand et
al. 2002). For example, stomatal conductance, net photosynthetic activity, and also
the maximal photochemical yield remained unaffected in young leaves of Cucumis
sativa, even though expansion growth was inhibited by Cu (Vinit-Dunand et al.
2002). Mature leaves accumulated less copper, maintained maximum photochemi-
cal yield but nevertheless showed strong diminution of stomatal conductance and
a corresponding decline in net photosynthesis as well as stronger accumulation of
starch than the expanding leaves (Vinit-Dunand et al. 2002). Similar observations
have been reported for cadmium: smaller cell size, less leaf area, starch accumula-
tion in chloroplasts and diminished stomatal conductance but no effects on the
properties of the photosynthetic electron transport (Moya et al. 1995, Haag-Kerver

et al. 1999, Baryla et al. 2001). Starch and sucrose accumulation lead to inhibition
of photosynthesis via feedback mechanisms (Koch 1996, Morcuende et al. 1997,
Paul and Pellny 2003). Application of gibberillins reversed the inhibitory effect of
Cd on growth and resulted in remobilization of carbohydrates (Moya et al. 1995,
Ghorbanli et al. 1999), whereas the auxin indolacetic acid had no protective effect
(Hunter and Welkie 1977, Moya et al. 1995). Molecular analyses of these interac-
tions are yet completely missing. However, the observation that the juvenility of
an organ affects its sensitivity towards heavy metals is intriguing and deserves fur-
ther attention.
7.5 Conclusions and implication for future research
Copper and cadmium are heavy metals with contrasting physicochemical proper-
ties and functions in plants. At the organismic level, uptake of heavy metals into
plant cells is modulated by biotrophic interactions and by plant-inherent features
such as their capacity to retain heavy metals in the roots, for example by binding
to cell wall components. Little is known about the physiology and molecular biol-
ogy of these processes despite their importance for mediating metal tolerance in
natural environments. Mycorrhizal fungi are especially intriguing in this respect.
Given the similarities of fungal (yeast) and plant copper uptake and intercellular
trafficking, the time seems ripe to find out how these systems are regulated in
symbiotic associations affording higher protection to the host.
Plant cells take up Cu by specific transport systems. Inside the cell, chaperones
serve intracellular Cu transport to vesicular storage sites and to target enzymes
such as Cu/Zn-SOD, ethylene receptors, etc. "Free" Cu is extremely dangerous
because it will reduce molecular oxygen leading to increased formation of super-
oxide, hydrogen peroxide, and hydroxyl radicals switching normal metabolism to
programmed cell death.
Specific uptake systems for Cd have not been found. Cd seems to enter the cell
via Fe and Zn transporters and probably also via Ca channels. It does not partici-
pate directly in cellular redox reactions but inactivates redox sensitive enzymes by
binding to thiol-group. Its strong affinity to sulphhydryl-groups leads to a deple-
tion in GSH similar to that induced by excess Cu and results in H2O2 accumula-
tion. Since Cd is known to displace divalent cations such as Ca, Cu, Fe, we sus-
pect that Cd may also cause oxidative stress by increasing "free" transition metal
concentrations. This would explain that sensing systems which report redox im-
balances caused by excess transition metals can also be activated by Cd. Free Cu
probably binds to TFs, which in turn activate transcription of metal-binding
ligands such as MTs and enzymes required for GSH and phytochelatin biosynthe-
sis. The latter compounds serve sequestration of free metals, thereby, re-
establishing the cellular ion homeostasis. The protection afforded by this reaction
seems to be limited as there is increasing evidence that hypertolerance is mediated
by additional independent traits with unknown molecular basis. First data obtained
with mutants in metal transporters suggest that limitation of metal entry into cells
may contribute to tolerance. However, the large number of putative transporters
identified by genome analysis together with their suspected functions in micronu-
trient uptake will make it difficult to increase Cd tolerance via modulation of
transport systems.
Despite different uptake routes and properties, Cd and Cu stimulate partly the
same signalling cascades leading to activation of abiotic stress defences. Cross-
talk exists between heavy metal and other stress signalling pathways (drought,
oxidative stress), probably employing H2O2 and ABA as signal transducing com-
pounds. Current data suggest that plants employ a net of existing signalling cas-
cades to "report" imbalances in cellular homeostasis to the nucleus, where a di-
verse array of responses will be activated. Perhaps, it is an evolutionary advantage
to cope with ever-changing environmental conditions, if specific stress signals
were "translated" into common cellular response signals. These can be transduced
in a net of multiple signalling pathways and evoke pleiotrophic defences. Such a
defence system may be less prone to failure but implies that not all responses ob-
served upon stress impact must be essential for adaptation and survival.
H2O2 seems to play a central role as signalling intermediate for heavy metal
stress. Functional analysis of H2O2 during heavy metal signal transduction is yet
missing. It will be an important goal of future research to unravel the identity of
heavy metal-induced H2O2 sources and to analyse their functional role in mutants.
The combination of molecular and physiological data led us to propose a tentative
model integrating cellular and organismic responses to heavy metals. Not yet in-
cluded in this model is the surprising observation that the hormonal status of a leaf
critically determines its heavy metal susceptibility. To date, some physiological
and pharmacological experiments suggest that cytokinins are major antagonistic
players. These observations open interesting perspectives for future research.
Acknowledgements
The authors are grateful to the European Community and the German Science
Foundation for continuous support.
References
Aidid SB, Okamoto H (1992) Effects of lead, cadmium and zinc on the electric membrane
potential at the xylem /symplast interface and cell elongation of Impatiens balsamina.
Environm Exp Bot 32:439-448
Alvarez ME, Pennell R, Meijer P-J, Ishikawa A, Dixon RA, Lamb C (1998) Reactive oxy-
gen intermediates mediate a systemic signal network in the establishment of plant
immunity. Cell 92:773-784
Angelone M, Bini C (1992) Trace elements concentrations in soils and plants of western
europe. In:Adriano DC (ed.) Biogeochemistry of Trace Metals. Lewis Publishers, Boca
Raton, FL, pp 19–60
Arduini I, Godbold DL, Onnis A (1996) Cadmium and copper uptake and distribution in
Mediterranean tree seedlings. Physiol Plant 97:111-117
Arduini I, Godbold DL, Onnis A, Stefani A (1998) Heavy metals influence mineral nutri-
tion of tree seedlings. Chemosphere 36:739-744
Balsberg Pahlsson A-M (1989) Toxicity of heavy metals (Zn, Cu, Cd, Pb) to vascular
plants. Water Air Soil Poll 47:287-319
Barcelo J, Poschenrieder C (1990) Plant water relations as affected by heavy metal stress:a
review. J Plant Nutr 13:1-37
Baryla A, Carrier P, Franck F, Coulomb C, Sahut C, Havaux M (2001) Leaf chlorosis in oil
seed rape plants (Brassica napus) grown on cadmium-polluted soil:causes and conse-
quences for photosynthesis and growth. Planta 212:696-709
Beaudoin J, Labbe S (2001) The fission yeast copper-sensing transcription factor Cuf1
regulates the copper transporter gene expression through an Ace1/Amt1-like recogni-
tion sequence. J Biol Chem 276:15472-15480
Beers E, McDowell JM (2001) Regulation and execution of programmed cell death in re-
sponse to pathogens, stress and environmental cues. Curr Opin Plant Biol 4:561-567
Berna A, Bernier F (1999) Regulation by biotic and abiotic stress of a wheat germin gene
encoding oxalate oxidase, a H2O2 producing enzyme. Plant Mol Biol 39:539-549
Blaudez D, Botton B, Chalot M (2000) Cadmium uptake and subcellular compartmentation
in the ectomycorrhizal fungus Paxillus involutus. Microbiol 146:1109-1117
Blinda A, Koch B, Ramanjulu S, Dietz KJ (1997) De novo synthesis and accumulation of
apoplastic proteins in leaves of heavy metal exposed barley seedlings. Plant Cell Envi-
ronm 20:969-981
Breckle CW (1991) Growth under heavy metals. In:Waisel Y, Eshel A, Kafkafi U (eds.)
Plant roots:the hidden half. Marcel Dekker, New York, NY, pp 351 –3 73
Bringezu K, Lichtenberger O, Leopold I, Neimann D (1999) Heavy metal tolerance of Si-
lene vulgaris. J Plant Physiol 154:536-546
Canesi L, Ciacci C, Piccoli G, Stocchi V, Viarengo A, Gallo G (1998) In vitro and in vivo
effects of heavy metals on mussel digestive gland hexokinase activity:The role of glu-
tathione. Comp Biochem Physiol Pharmacol Toxicol Endocrinol 120:261-268
Cataldo DA, Garland TR, Wildung RE (1983) Cadmium uptake kinetics in intact soybean
plants. Plant Physiol 73:844-848
Chaoui A, Mazhoudi S, Ghorbal MH, El Ferjani E (1997) Cadmium and zinc induction of
lipid peroxidation and effects on antioxidant enzyme activities in bean (Phaseolus vul-
garis L.). Plant Sci 127:139-147
Chen SL, Kao CH (1995) Glutathione reduces the inhibition of rice seedling root growth
caused by cadmium. Plant Growth Reg 16:249-252
Chen SL, Kao CH (1995) Prior temperature exposure affects subsequent Cd-induced ethyl-
ene production in rice leaves. Plant Sci 104:135-138
Chen W, Chao G, Singh KB (1999) The promotor of a H2O2-inducible, Arabidopsis glu-
tathione-S-transferase gene contains closely linked OBF- and OBP1-binding sites.
Plant J 6:955-966
Chen CT, Chen LM, Lin CC, Kao CH (2001) Regulation of proline accumulation in de-
tached rice leaves exposed to excess copper. Plant Sci 160:283-290
Chongpraditnum P, Mori S, Chino M (1992) Excess copper induces a cytosolic Cu, Zn-
superoxide dismutase in soybean root. Plant Cell Physiol 33:239 – 244
Chrestensen CA, Starke DW, Mieyal JJ (2000) Acute cadmium exposure inactivates thiol-
transferase (glutaredoxin), inhibits intracellular reduction of protein-glutathionyl-
mixed disulfides, and initiates apoptosis. J Biol Chem 275:26556 – 26565
Clemens S (2001) Molecular mechanisms of plant metal tolerance and homeostasis. Planta
212:475-486
Clemens S, Antosiewicz DM, Ward JM, Schachtman DP, Schroeder JI (1998) The plant
cDNA LCT1 mediates the uptake of calcium and cadmium in yeast. Proc Natl Acad
Sci, USA 95:12043-12048
Clemens S, Bloss T, Vess C, Neumann D, Nies DH, zu Nieden U (2002) A transporter in
the endoplasmatic reticulum of Schizosaccharomyces pombe cells mediates zinc stor-
age and differentially affects transition metal tolerance. J Biol Chem 277:18215-18221
Cobbett C, Goldsbrough PB (2002) Phytochelatins and metallothioneins:roles in Heavy
Metal Detoxification and Homeostasis. Annu. Rev. Plant Biol. 53:159–182
Conklin DS, Culbertson MR, Kung C (1994) Interactions between gene products involved
in divalent cation transport in Saccharomyces cervisae. Mol Gen Genet 244:303-311
Costa G and Morel JL (1994) Water relations, gas exchange and amino acid content in Cd-
treated lettuce. Plant Physiol Biochem 32:561-570
Culotta VC, Klomp LWJ, Strain J, Casareno RLB, Krems B, Gitlin, JD (1997) The copper
chaperone for superoxide dismutase. J Biol Chem 272:23469-23472
Das P, Samantaray S, Rout GR (1997) Studies on cadmium toxicity in plants:a review.
Environm Poll 98:29-36
De Vos RCH, Vonk MJ, Vooijs R, Schat H (1992) Glutathione depletion due to copper-
induced phytochelatin synthesis causes oxidative stress in Silene cucubalus. Plant
Physiol 98:853-858
Desikan R, A-H-Mackerness S, Hancock J, Neill S (2001) Regulation of the Arabidopsis
transcriptome by oxidative stress. Plant Physiol 127:159-172
El Shintinavy (1999) Glutathione counteracts the inhibitory effect induced by cadmium on
photosynthetic process in soy bean. Photosynth 36:171-179
Ernst WHO (1990) Mine vegetation in Europe. Heavy metal tolerance in
plants:evolutionary aspects. In:Shaw AJ (ed.) CRC Press, Boca Raton, p.21
Fojtova M, Kovarik A (2000) Genotoxic effect of cadmium is associated with apoptotic
changes in tobacco cells. Plant Cell Environm 23:531-537
Frey B, Zierold K, Brunner I (2000) Extracellular complexation of Cd in the Hartig net and
cytosolic Zn sequstration in the fungal mantle of Picea abies – Hebeloma crustulini-
forme ectomycorrhizas. Plant Cell Environm 23:1257-1265
Fuhrer J (1982) Ethylene biosynthesis and cadmium toxicity in leaf tissue of bean (Phaseo-
lus vulgaris L.). Plant Physiol 70:162-167
Gallego SM, Benavides MP, Tomaro ML (1996) Effect of heavy metal ion excess on sun-
flower leaves:evidence for involvement of oxidative stress. Plant Sci 121:151-159
Galloway JN, Thornton JD, Norton SA, Volcho HL, McLean RA (1982) Trace metals in
atmospheric deposition:a review and assessment. Atm Environm 16:1677
Ghorbanli M, Kaveh SH, Sepehr MF (1999) Effects of cadmium and gibberellin on growth
and photosynthesis of Glycine max. Photosynth 37:627-631
Glerum DM, Shtanko A, Tzagoloff A (1997) Characterization of C0X17, a yeast gene in-
volved in copper metabolism and assembly of cytochrome oxidase. J Biol Chem
271:14504-14509
Godbold DL, Hüttermann A (1985) Effect of zinc, cadmium and mercury on root elonga-
tion of Picea abies (Karst.) seedlings, and the significance of these metals to forest die-
back. Environm Poll 38:375-381
Greger M, Lindberg S (1986) Effects of Cd and EDTA on young suger beets (Beta vul-
garis) I. Cd uptake and sugar accumulation. Physiol Plant 66:69-74
Grill E, Winnacker E-L, Zenk MH (1987) Phytochelatins, a class heavy-metal-binding pep-
tides from plants, are functional analogous to metallothioneins. Proc Natl Acad Sci
USA 8:439-443
Guerinot ML (2000) The ZIP family of metal transporters. Biochim Biophy Ac 1465:190-
198
Haag-Kerwer A, Schäfer HJ, Heiss S, Walter C, Rausch T (1999) Cadmium exposure in
Brassica juncea causes a decline in transpiration rate and leaf expansion without effect
on photosynthesis. J Exp Bot 50:1827-1835
Hall JL (2002) Cellular mechanisms for heavy metal detoxification and tolerance. J Exp
Bot 366:1-11
Hart JJ, Welch RM, Norvell WA, Sullivan LA, Kochian LV (1998) Characterization of
cadmium binding, uptake, and translocation in intact seedlings of bread and durum
wheat cultivars. Plant Physiol 116:1413-1420
Heiss S, Schaefer HJ, Kerwer AH, Rausch T (1999) Cloning sulfur assimilation genes of
Brassica juncea L.:cadmium differentially affects the expression of a putative low af-
finity sulfate transporter and isoforms of APS sulfurylase and APS reductase. Plant
Mol Biol 39:847-857
Himelblau E, Mira H, Lin SJ, Culotta V, Penarrubia L, Amasino RM (1998) Identification
of a functional homolog of the yeast copper homeostasis gene ATX1 from Arabidopsis.
Plant Physiol 117:1227–1234
Hinsinger P (1998) How do plant roots acquire mineral nutrients? Chemical processes in-
volved in the rhizosphere. Adv Agron 64:225-265
Hinsinger P (2001) Bioavailability of soil inorganic P in the rhizosphere as affected by root
induced chemical changes:a review. Plant and Soil 237:173-195
Hirayama T, Kieber JJ, Hirayama N, Kogan M, Guzman P, Nourizadeh S, Alonso JM,
Dailey WP, Dancis A, Ecker JR (1999) Responsive-to-antagonist1, a Menkes/Wilson
disease-related copper transporter, is required for ethylene signaling in Arabidopsis.
Cell 97:383-393
Hogan GD, Rauser WF (1981) Role of copper binding, absorption, and translocation in
copper tolerance of Agrostis-gigantea Roth. J Exp Bot 32:27-36
Hollenbach B, Schreiber L, Hartung W, Dietz KJ (1997) Cadmium leads to stimulated ex-
pression of the lipid transfer protein genes in barley:implication for the involvement of
lipid tansfer proteins in wax assembly. Planta 203:9-19
Howden R, Andersen C, Goldsbrough PB, Cobett CS (1995) A cadmium-sensitive, glu-
tathione deficient mutant of Arabidopsis thaliana. Plant Physiol 107:1067-1073
Huffman DL, O'Halloran TV (2000) Energetics of copper trafficking between the Atx1
metallochaperone and the intracellular copper transporter, Ccc2. J Biol Chem
275:18611-18614
Hunter R, Welkie GW (1977) Growth of copper treated corn roots as affected by EDTA,
IAA, succinic acid-2,2dimethyl hydrazide, vitamins and potassium. Environm Exp Bot
17:19-26
Hüttermann A, Arduini I, Godbold DL (1999) Metall pollution and Forest decline.

In:Prasad MNV, Hagemeyer J (eds.) Heavy metall stress in plants. Springer Verlag,
Berlin. pp. 253-272
Jackson AP, Alloway BJ (1991) The transfer of cadmium from sewage sludge amended
soils into the edible component of food crops. Water Air Soil Poll 57:873-881
Jacob C, Courbot M, Brun A, Steinman HM, Jacquot JP, Botton B, Chalot M (2001)
Molecular cloning characterization and regulation by cadmium of a superoxide
dismutase from the ectomycorrhizal fungus Paxillus involutus. Eur J Biochem
Jenschke
268:3223-3232
G, Godbold DL (2000) Metal toxicity and ectomycorrhizas. Physiol Plant
109:107-116
Jenschke G, Winter S, Godbold DL (1999) Ectomycorrhizas and cadmium toxicity in Nor-
way spruce seedlings. Tree Physiol 19:23-30
Jiang W, Liu D, Liu X (2001) Effects of copper on root growth, cell division, and nucleolus
of Zea mays. Biologia Plant 44:105-109
Johnson P, Ecker J (1998) The ethylene gas signal transduction pathway:a molecular
perspective. Annu Rev Genet 32:227-254
Juste C, Soldan P, L'Hermite P (1985) Factors influencing heavy metal availability in field
experiments with sewage sludges. In:Leschber R, Davis RD (eds.); Chemical methods
for assessing bioavailable metals in sludge and soils. Elsevier Applied Science Pub-
lishers; Barking, Essex; pp. 82-89
Juste C, Solida P (1988) Influence de l'addition de differentes matieres fertilisantes sur la
biodisponibilite du cadmium, du manganese, du nickel et du zinc contenus dans un sol
sableux amende par des boues de station d'epuration. Agron 8:897-904
Kahle H (1993) Response of roots to heavy metals. Environm Exp Bot 33:99-119
Kampfenkel K, Kushnir S, Babiychuk E, Inze D, Van Montagu M (1995) Molecular char-
acterization of a putative Arabidopsis thaliana copper transporter and its yeast homo-
logue. J Biol Chem 270:28479-28486
Koch KE (1996) Carbohydrate modulated gene expression in plants. Ann Rev Plant Physiol
Mol Biol 47:509-540
Korshunova YO, Eide D, Clark G, Guerinot ML, Pakrasi HB (1999) The IRT1 protein from
Arabidopsis thaliana is a metal transporter with a broad substrate range. Plant Mol
Biol 40:37-44
activated mitogen-activated protein kinase cascade in plants. Proc Natl Acad Sci, USA
97:2940-2945
Krupa Z, Moniak M (1998) The stage of leaf maturity implicates the response of the photo-
synthetic apparatus to cadmium toxicity. Plant Sci 138:149-156
Kurepa J, van Montagu M, Inze D (1997) Expression of of sodCp and sodB genes in Nico-
tiana tabacum:effects of light and copper excess. J Exp Bot 48:2007-2014
Lanfranco L, Bolchi A, Ros EC, Ottonello S, Bonfante P (2002) Differential expression of
a metallothionein gene during the presymbiotic versus the symbiotic phase of an ar-
buscular mycorrhizal fungus. Plant Physiol 130:58-67
Lantzy RJ, Mackenzie FT (1979) Atmospheric trace metals:global cycles and assessment of
man‘s impact. Geochim Cosmochim Ac 43:511
Lee S, Korban SS (2002) The trancriptional regulation of Arabidopsis thaliana (L.) Heynh.
Planta 215:689-693
Leita L, DeNobili M, Cesco S, Mondini C (1996) Analysis of intercellular cadmium forms
in roots and leaves of bush bean. J Plant Nutr 19:527-533
Leung J, Giraudaut J (1998) Abscisic acid signal transduction. Annu Rev Plant Physiol
Plant Mol Biol 49:199-222
Levine A, Tenhaken R, Dixon R, Lamb C (1994) H2O2 from the oxidative burst orches-
trates the plant hypersensitive disease resistance response. Cell 79:583-593
Li L, Kaplan J (1998) Defects in the yeast high affinity iron transport system result in in-
creased metal sensitivity because of the increased expression of transporters with a
broad transition metal specificity. J Biol Chem 273:22181-22187
Liao MT, Hedley MJ, Woolley DJ, Brooks RR, Nichols MA (2000) Copper uptake and
translocation in chicory (Cichorium intybus L. cv. Grasslands Puna) and tomato (Ly-
copersicon esculentum Mill. cv. Rondy) plants grown in NFT system. I. Copper uptake
and distribution in plants. Plant Soil 221:135-142
Lin S-J, Pufahl RA, Dancis A, O'Halloran TVO, Culotta VC (1997) A role for the Sac-
charomyces cerevisiae ATX1 gene is copper trafficking and iron transport. J. Biol.
Chem 272:9215-9220
Liu D, Jiang W, Wang W, Zhai L (1995) Evaluation of metal toxicity on root tip cells by
the Allium test. Is J Plant Sci 43:125-133
Lolkema PC, Vooijs R (1986) Copper tolerance in Silene-Cucubalus – subcellular distribu-
tion of copper and its effects on chloroplasts and plastocyanin synthesis. Planta
167:30-36
Madhava Rao KV, Sresty TVS (2000) Antioxidative parameters in the seedlings of pigeon-
pea (Cajanus cajan (L.) Millspaugh) in response to Zn an Ni stresses. Plant Sci
157:113-128
Maksymiec W, Baszynski T (1996) Chlorophyll fluorescence in primary leaves of excess
Cu treated runner bean plants depends on their growth stages and the duration of Cu-
action. J Plant Physiol 149:196-200
Marchiol L, Leita L, Martin M, Peresotti A, Zerbi G (1996) Physiological responses of two
soybean cultivars to cadmium. J Environm Qual 25:562-566
Marrs KA, Walbot V (1997) Expression and RNA splicing of the maize glutathione-S-
transferase Bronze2 gene is regulted by cadmium and other stresses. Plant Physiol
113:93-102
Marschner H (1995) Mineral nutrition of higher plants. Academic Press, New York, pp.
889
Mäser P, Thomine S, Schroeder J, Ward JM, Hirschi K, Sze H, Talke IN, Amtmann A,
Maathius FJM, Sanders D, Harper JF, Tchieu J, Gribskov M, Persans MW, Salt DE,
Kim SA, Guerinot ML (2001) Phylogenetic relationships within cation tranporter
families of Arabidopsis. Plant Physiol 126:1646-1667
May M, Vernoux T, Leaver C, van Montagu M, Inze D (1998) Glutathione homeostasis in
plants:implications for environmental sensing and plant development. J Exp Bot
49:649-667
McLaughlin MJ, Smolders E, Merckx R, Checkai RT (1998) Soil-root inter-
face:physicochemical processes. In:Huang PM, Adriano DC, Logan TJ (eds.) Soil
chemistry and ecosystem health. SSSA Special Publication Number 52; Soil Science
Society of America Inc. Madison, pp. 233-277
Membré AN, Berna A, Neutelings A, David H, Staiger D, Vasquez JS, Raynal M, Delseny
M, Bernier F 1997. cDNA sequence, genome organization and differential expression
of three Arabidopsis genes for germin/oxalate oxidase-like proteins. Plant Mol Biol
35:459–469
Meuwly P, Rauser W (1992) Alteration of thiol pools in roots and shoots of maize seed-
lings exposed to cadmium. Plant Physiol 99:8-15
Moran JF, Becana Iturbe-Ormaetxe I, Frechilla S, Klucas R, Aparicio-Tejo P (1994)
Drought induces oxidative stress in pea plants. Planta 194:346-352
Morcuende R, Perez P, Martinez-Carrasco R (1998) Short-term feedback inhibition of pho-
tosynthesis in wheat leaves supplied with sucrose and glycerol at two temperatures.
Photosynth 33:179-188
Morrison RS, Brooks RD, Reeves RD, Malaise F, Horowitz P, Aronson M, Merriam GR
(1981) The diverse chemical forms of heavy metals in tissue extracts of some metallo-
phytes from Shaba province, Zaire. Phytochem 20:455-458
Moustakas M, Ouzounidou G, Symeeonidis L, Karatagalis S (1997) Field studies of the ef-
fect of excess copper on wheat photsynthesis and productivity. Soil Sci Plant Nutr
43:531-539
Moya JL, Ros R, Picazo I (1995) Heavy metal-hormone interactions in rice plants – effects
on growth, net photosynthesis, and carbohydrate distribution. J Plant Growth Reg
14:61-67.
Munoz FJ, Ullan RV, Labrador E, Dopico B (1998) Increased expression of two cDNAs
encoding metallothionein-like proteins during growth of Cicer arietinum epicotyls
Physiol Plant 104:273-279
Murata Y, Pei ZM, Mori IC, Schroeder J (2001) Abscisic acid activation of plasma mem-
brane Ca2+ channels in guard cells require cytosolic NAD(P)H and is differentially dis-
rupted upstream and down stream of reactive oxygen species production in abi1-1 and
abi2-1 phosphatase 2C mutants. Plant Cell 13:2513-2523
Neill S, Desikan R, Hancock J (2002) Hydrogen peroxide signaling. Curr Op Plant Biol
5:388-395
Nieboer E, Richardson DHS (1980) The replacement of the nondescript term “ heavy
metal” by a biologically significant and chemically significant classification of metal
ions. Environm Poll B1:3-26
Nies DH (1999) Microbial heavy-metal resistance. Appl Microbiol Biotechnol 51:730-750
Nocito FF, Pirovano L, Coccuci M, Sacchi GA (2002) Cadmium induced sulfate uptake in
maize roots. Plant Physiol 129:1872-1879
Noctor G, Arisi ACM, Jouanin L, Kunert KJ, Rennenberg H (1998) Glu-
tathione:biosynthesis, metabolism and relationship to stress tolerance explored in
transformed plants. J Exp Bot 49:623-647
Ott T, Fritz E, Polle A, Schützendübel A (2002) Characterisation of antioxidative systems
in the ectomycorrhiza-building basidiomycete Paxillus involutus (Bartsch.) FR. and its
reaction to cadmium. FEMS Microbiol Ecol 42:359-366
Paul M, Pellny TK (2003) Carbon metabolite feedback regulation of leaf photosynthesis
and development. J Exp Bot 54:539-547
Pei ZM, Murata Y, Benning G, Thomine S, Klusener B, Allen GJ, Grill E, Schroeder JM
Pence NS, Larson PB, Ebbs SD, Letham DLD Lasat MM Garvin DF Eide D, Kochian LV
(2000) The molecular physiology of heavy metal transport in the Zn/Cd hyperaccumu-
lator Thlaspi caerulescens. Proc Natl Acad Sci, USA 97:4956-4960
Perfus-Barbeoch L, Leonhardt N, Vavasseur A, Forestier C (2002) Heavy metal toxic-
ity:cadmium permeates through calcium channels and disturbs the plant water status.
Plant J 32:539-548
Piqueras A, Olmos, E, Martinez-Solano JR, Hellin E (1999) Cd-induced oxidative burst in

Tobacco BY2 Cells:Time course, subcellular location and antioxidant response. Free
Rad Res 31:33-38
Polle A (2001) Dissecting the superoxide dismutase-ascorbate-glutathione pathway by
metabolic modeling:computer analysis as a step towards flux analysis. Plant Physiol
126:445-462
Pontier D, Gan S, Amasino R, Roby D, Lam E (1999) Markers for hypersensitive response
and senescence show distinct pattern of expression. Plant Mol Biol 39:1243-1255
Portnoy ME, Schmidt PJ, Rogers RS, Culotta VC (2001) Metal transporters that contribute
copper to metallochaperones in Saccharomyces cerevisiae. MGG Mol Gen Gen
265:873-882
Poschenrieder C, Gunse B, Barcelo J (1989) Influence of cadmium on water relations,
stomatal resistance and abscisic acid content in expanding bean leaves. Plant Physiol
90:1365-1371
Puig S Lee J Lau M Thiele DJ (2002) Biochemical and genetic analyses of yeast and hu-
man high affinity copper transporters suggest a conserved mechanism for copper up-
take. J Biol Chem 277:26021-26030
Rae TD, Schmidt PJ, Pufahl RA, Culotta VC, O´Halloran TV (1999) Undetectable
intracellular free copper: the requirement of a copper chaperone for superoxide
dismutase. Science 284:805-808
Rauser W (1999) Structure and function of metal chelators produced by plants. Cell Bio-
chem Biophys 31:19-48
Rauser W, Schupp R, Rennenberg H (1991) Cysteine, γ-glutamylcysteine, and glutathione
levels in maize seedlings. Distribution and translocation in normal and cadmium-
exposed plants. Plant Physiol 97:128-138
Rauser WE (1987) Compartmental efflux analysis and removal of extracellular cadmium
from roots. Plant Physiol 85:62-65
Rea P (1999) MRP subfamily ABC transporters from plants and yeast. J Exp Bot 50:895-
913
Rivera-Becerril F, Calantzi C, Turnau K, Caussanel JP, Belimov AA, Gianazzi S, Strasser
R, Gianinazzi-Pearson V (2002) Cadmium accumulation and buffering of cadmium-
induced stress by arbuscular mycorrhiza in three Pisum sativum L. genotypes. J Exp
Bot 53:1177-1185
Robinson NJ, Wilson JR, Turner JS (1996) Expression of the type 2 metallonthionein-like
gene MT2 from Arabidopsis thaliana in Zn2C-metallothionein-deficient Synechococ-
cus PCC 7942:putative role for MT2 in Zn2C metabolism. Plant Mol. Biol. 30:1169–
1179
Rogers EE, Eide DJ, Guerinot ML (2000) Altered selectivity in an Arabidopsis metal trans-
porter. Proc Natl Acad Sci USA 97:12356-12360
Romero-Pueras MC, Palma JM, Gomez LA, del Rio LA, Sandalio LM (2002) Cadmium
causes oxidative modification of proteins in plants. Plant Cell Environm 25:677-686
Romero-Puertas MC, McCarthy I, Sandalio LM, Palma JM, Corpas FJ, Gomez M, Del Rio
LA. 1999. Cadmium toxicity and oxidative metabolism of pea leaf peroxisomes. Free
Rad Res 31:S25-S31
Ros Barcelo A (1997) Lignification in plant cell walls. Int Rev Cytol 176:87-132
Rubio MI, Escrig I, Martinezcortina C, Lopezbenet FJ, Sanz A (1994) Cadmium and nickel
accumulation in rice plants - effects on mineral-nutrition and possible interactions of
abscisic and gibberellic acids. Plant Growth Reg 14:151-157
Sagi and Fluhr R (2001) Superoxide production by plant homologues of the gp91phox
NADPH oxidase. Modulation of activity by calcium and by tobacco mosaic virus in-
fection. Plant Physiol 126:1281-1290
Salt DE, Prince RC, Pickering IJ, Raskin I (1995) Mechanism of cadmium mobility and ac-
cumulation in Indian Mustard. Plant Physiol 109:1472-1433
Salt DE, Smith RD, Raskin I (1998) Phytoremediation. Annu Rev Plant Physiol Plant Mol
Biol. 49:643-668
Sanchez-Fernandez R, Fricker M, Corben LB, White NS, Sheard N, Leaver CJ, Van Mon-
tagu M, Inze D, May MJ (1997) Cell proliferation and hair tip growth in the Arabidop-
sis roots are under mechanistically different forms of redox control. Proc Natl Acad
Sci USA 94:2745-2750
Sanita di Toppi L and Gabrielli R (1999a) Response to cadmium in higher plants. Envi-
ronm Exp Bot 41:105-130
Sanita di Toppi L, Lambardi M, Pecchioni N, Pazzagli L, Durante M, Gabrielli M, di Toppi
LS (1999b) Effects of cadmium stress on hairy roots of Daucus carota. J Plant Physiol
1999:385-391
Sanita di Toppi LS, Lambardi M, Pazzagli L, Cappugi G, Durante M, Gabbrielli R (1998)
Response to cadmium in carrot in vitro plants and cell suspension cultures. Plant Sci
137:119-129
Schat H, Llugany M, Vooijs R, Hartley-Whitaker J, Bleeker PM (2002) The role of
phytochelatins in constituive and adaptive heavy metal tolerrance in in
hyperaccumulator and non-hyperaccumulator metallophytes. J Exp Botany 53:2381-
Schat2392
H, Sharma SS, Vooijs R (1997) Heavy metal-induced accumulation of free proline in
a metal tolerant and a non-tolerant ecotype of Silene vulgaris. Physiol Plant 101:477-
482
Schlagnhaufer CD, Arteca R, Pell EJ (1997) Sequential expression of two 1-
aminocyclopropane-1-carboxylate synthase genes in response to biotic and abiotic
stresses in potato (Solanum tuberosum L.) leaves. Plant Mol Biol 35:683-688
Schmidt PJ, Ramos GM, Culotta VC (1999) A gain of superoxide dismutase (SOD) activity
obtained with CCS, the copper metallochaperone for SOD1. J Biol Chem 274:36952-
36956
Schützendübel A, Polle A (2002) Plant responses to abiotic stresses:heavy metal-induced
oxidative stress and protection by mycorrhization. J Exp Bot 53:1351-1365
Schützendübel A, Nikolova P, Rudolf C, Polle A (2002) Cadmium and H2O2-induced oxi-
dative stress in Populus x canescens roots. Plant Physiol Biochem 40:577-584
Schützendübel A, Schwanz P, Teichmann T, Gross K, Langenfeld-Heyser R, Godbold D,
Polle A (2001) Cadmium–induced changes in antioxidative systems, H2O2 content and
differentiation in pine (Pinus sylvestris) roots. Plant Physiol 127:887-898
Sha K, Dubey RS (1998) Effect of cadmium on proline accumulation and ribonuclease
activity in rice seedlings:role of proline as possible enzyme protectant. Biol Plant
40:121-130
Siedlecka A, Krupa Z (1999) Cd/Fe interaction in higher plants – its consequences for the
photosynthetic apparatus. Photosynth 36:321-331
Silver S (1996) Bacterial resistance to toxic metal ions – a review. Gene 179:9-19
Simon L (1998) Cadmium accumulation and distribution in the sunflower plant. J Plant Nu-
trition 21:341-352
Siripornadulsil S, Traina S, Verma DP, Sayre RT (2002) Molecular mechanisms of proline-

mediated tolerance to toxic heavy metals in transgenic microalgae. Plant Cell 14:2837-
2847
Skórzynska-Polit E, Baszynski T (1997) Differences in sensitivity of the photosynthetic
apparatus in Cd-stressed runner bean plants in relation to their age. Plant Sci 128:11-21
Srinivasan C, Liba A, Imlay J, Valentine JS, Gralla EB (2000) Yeast lacking superoxide
dismutase(s) show elevated levels of "free iron" as measured by whole cell electron
paramagnetic resonance. J Biol Chem 275:29187-29192
Stohs SJ, Bagchi D (1995) Oxidative mechanisms in the toxicity of metal ions. Free Rad
Biol Med 18:321-336
Stohs SJ, Bagchi D, Hassoun E, Bagchi M (2000) Oxidative mechanisms in the toxicity of
chromium and cadmium ions. J Environm Pathol Toxicol Oncol 19:201-213
Suzuki N, Koizumi N, Sano H (2001) Screening of cadmium-responsive genes in Arabi-
dopsis thaliana. Plant Cell Environm 24:1177-1188
Talanova VV, Titov AF, Boeva NP (2000) Effect of increasing concentrations of lead and
cadmium on cucumber seedlings. Biologia Plant 43:441-444
Tenhaken R and Rübel C (1999) Cloning of putative subunits of the soy bean plasma mem-
brane NADPH Oxidase involved in the oxidative burst by antibody expression screen-
ing. Protoplasma 205:21-28
Thiele DJ (1992) Metal-regulated transcription in eukaryotes. Nucleic Acids Res. 20:1183–
1191
Thomine S, Wang R, Ward JM, Crawford NM. Schroeder JI (2000) Cadmium and iron
transport by members of a plant metal transporter family in Arabidopsis with homol-
ogy to Nramp genes. Proc Natl Acad Sci USA 97:4991-4996
Tommey AM, Shi J, Lindsay WP, Urwin PE, Robinson NJ (1991) Expression of the pea
gene PsMTa in E. coli—metal binding properties of the expressed protein. FEBS Lett.
292:48-52
Vassilev A, Tsonev T, Yordanov I (1999) Physiological response of barley (Hordeum vul-
gare) to cadmium containing soil during ontogensis. Environm Poll 103:287-293
Vernoux T, Wilson RC;, Seeley KA, Reichheld JP, Muroy S, Brown S, Maughan SC, Cob-
bett CS, Van Montagu M, Inze D, May MJ, Sung ZR. 2000. The ROOT
MERISTEMLESS1/CADMIUM SENSITIVE2 gene defines a glutathione-dependent
pathway involved in initiation and maintenance of cell division during postembryonic
root development. Plant Cell 12:97-109
Vinit-Dunand F, Epron D, Alaoui-Sosse B, Badot PM (2002) Effects of copper on growth
and on photosynthesis of mature and expanding leaves in cucumber plant. Plant Sci
163:53-58
Vögeli-Lange R, Wagner GW (1996) Relationship between cadmium, glutathione and
cadmium-binding peptides (phytochelatins) in leaves of intact tobacco seedlings. Plant
Sci 114:11-18
Wagner GJ (1993) Accumulation of cadmium in crop plants and its consequences to human
health. Adv Agron 51:173-212
Weast RC (1984) CRC Handbook of Chemistry and Physics, 64 edn., Boca Raton, CRC
Weigel HJ, Jäger HJ (1980) Subcellular distribution and chemical form of cadmium in bean
plants. Plant Physiol 65:480-482
White P (2000) Calcium channels in higher plants. Biophys Biochim Ac 1465:171-189
Whitelaw CA, Le Huquet JA, Thurman DA, Tomsett AB (1997) The isolation and charac-
terisation of type II metallothionein-like genes from tomato (Lycopersicon esculentum
L.) Plant Mol Biol 33:503-511
Williams LE, Pittman JK, Hall JL (2002) Emerging mechanisms for heavy metal transport
in plants. Biochim Biophys Ac Biomembranes 1465:104-126
Xiang C, Oliver DJ (1998) Glutathione metabolic genes coordinately respond to heavy
metals and jasmonic acid in Arabidopsis. Plant Cell 10:1539-1550
Yamamoto Y, Hachia A, Hamada H, Matsumoto H (1998) Phenylpropanoids as a protec-
tant of aluminium toxicity in cultured tobacco cells. Plant Cell Physiol 39:950-957
Zhao FJ, Hamon RE, Lombi E, McLaughlin MJ, McGrath SP (2002) Characteristics of
Cadmimum uptake in two contrasting ecotypes of the hyperaccumulator Thlaspi
caerulescens. J Exp Bot 53:535-543
Zhou J, Goldsbrough PB (1994) Functional homologs of animal and fungal metallothionein
genes from Arabidopsis. Plant Cell 6:875-884
Zhu YL, Pilon-Smits E, Jouanin L, Terry N (1999a) Overexpression of glutathione syn-
thetase in Indian mustard enhances cadmium accumulation and tolerance. Plant
Physiol 119:73-79
Zhu YL, Pilon-Smits E, Tarun AS, Weber S, Jouanin L, Terry N (1999b) Cadmium toler-
ance and accumulation in Indian mustard is enhanced by overexpressing gamma-
glutamylcysteine synthetase. Plant Physiol 121:1169-1177
8 Molecular genetics of genotoxic stress
signalling in plants
Roman Ulm
Abstract
Cells are under constant threat by endogenous and exogenous factors affecting
DNA integrity. In response, complex signalling networks are activated and appro-
priate countermeasures are taken. Although plants are inevitably exposed to di-
verse DNA damaging agents (genotoxins) due to their sessile life-style and de-
pendence on sunlight for photosynthesis, plant signalling components activated by
confronting genotoxic stress are largely unknown. However, recent genetic and
biochemical analyses have advanced our understanding of genotoxic stress signal-
ling. In particular, as deduced from mammalian model systems, players of both
the postulated “nuclear”- and “non-nuclear”-target-mediated signal transduction
chains were identified. Importantly, components of both pathways are crucial for
plant tolerance to genotoxic stress.
8.1 Introduction
All organisms have the capacity to dynamically respond to environmental chal-

lenges as a result of the activation of complex signalling networks. One of the
most extreme challenges is damage to the genetic information itself. The genomes
of all living organisms are under continuous assault by environmental agents (e.g.
UV irradiation and reactive chemicals) as well as by-products of endogenous
metabolic processes (e.g. reactive oxygen species and erroneous DNA replica-
tion). As a result of the perception of the genotoxic stress, the cell cycle is halted
to gain the time necessary for DNA repair, and genes required for repair and pro-
tection of other cellular components endangered by the genotoxic treatment are
activated. Alternatively, particularly in multicellular eucaryotes, cells may respond
by undergoing apoptosis, thereby eliminating damaged cells.
Research on genotoxic stress perception and signalling in mammalian cells is of
particular importance due to its implications in human health and disease, includ-
ing carcinogenesis. In plants, however, owing to the static nature of their cells an-
chored by cell walls, tumourous tissue cannot metastasise and plants do not die of
cancer. On the other hand, their reproductive tissues are derived from cells that
went through many rounds of DNA replication producing the entire organism, be-
fore forming gametes. This feature makes plants particularly sensitive to the po-
tential accumulation of mutations in the germline, which finally opens the way for

218 Roman Ulm
the passage of somatic mutations to the next generation (Walbot 1996). As the
somatic phenotype might be influenced by inherent or environmentally induced
genomic change, beneficial mutations may in some cases be directly made use of,
thus, a kind of selection might occur before the gametes are formed. Moreover,
plants possess a characteristic life cycle that includes a diploid sporophytic and a
haploid gametophytic phase, the latter providing a mechanism to eliminate delete-
rious alleles, even when recessive. In further contrast to animals, plants are sessile
organisms that depend on solar radiation as the vital source of biological energy
and thus are continuously exposed to environmental mutagens, including ultravio-
let-B (UV-B) radiation, and tolerance to this abiotic stress factor is critical for
plant fitness (Rozema et al. 1997; Jansen et al. 1998).
Repair of DNA damage is essential for the maintenance of genomic integrity
and substantial information is available on DNA repair processes in plants (e.g.
Britt 1996; Gorbunova and Levy 1999; Tuteja et al. 2001; Britt 2002), including
genetically defined roles in Arabidopsis of components involved in the major re-
pair pathways: photoreactivation (PHR), base excision repair (BER), nucleotide
excision repair (NER), non-homologous end-joining (NHEJ) and homologous re-
combination (HR) (see Table 1). In contrast, knowledge on perception and signal-
ling of DNA-damaging threats in plants is rather limited and genetic support for
proteins involved in genotoxic signalling in Arabidopsis is only emerging. Impor-
tantly, as deduced from the mammalian system, they might include signalling
components engaged by both “nuclear” and “non-nuclear” targets of genotoxic
agents. This review will be focused on recent advances in the identification of ge-
netically defined components in genotoxic stress signalling in plants and will not
address the topic of DNA damage repair, for which the reader is referred to sev-
eral recent reviews (e.g. Britt 1996; Gorbunova and Levy 1999; Tuteja et al. 2001;
Britt 2002).
8.2 What is genotoxic stress?
Diverse modifications of the molecular structure of the genetic material can arise
as a result of errors introduced during replication, recombination, and repair itself.
Other base alterations can result from the intrinsic instability of the specific
chemical bonds and from the ability of DNA to readily react with a wide range of
chemical and physical agents. Genotoxic stress results from agents (so-called
genotoxins or mutagens) that are capable of damaging the nuclear and extranu-
clear genetic material of cells, i.e. they are “toxic to the genome”. Thus, the unify-
ing characteristic of genotoxins is the ability to damage DNA. The agents used in
the laboratory to analyse the response of organisms to this type of stress are of dif-
ferent physical and chemical nature with varying DNA-damaging capabilities,
making cross-comparisons particularly difficult. They include, for example, ultra-
violet (UV) radiation (particularly UV-B and UV-C), the alkylating agent methyl
methanesulfonate (MMS), reactive oxygen species (ROS), and ionizing radiation
8 Molecular genetics of genotoxic stress signalling in plants 219
Table 1. A non-exhaustive list of components required for genotoxic stress responses in

Arabidopsis
Mutant Affected gene Sensitivity Reference

“Sunscreen”
tt4 CHS (chalcone synthase) UV-B Landry et a. 1995
tt5 CHI (chalcone isomerase) UV-B Landry et a. 1995
fah1 FAH1 (ferulic acid hydroxylase 1) UV-B Landry et a. 1995
DNA repair
uvr2 PHR1 (CPD photolyase, PHR) UV-B Landry et al. 1997
uvr3 (6-4 photolyase, PHR) UV-B Nakajima et al.
1998
ros1 ROS1 (DNA glycosylase/lyase, MMS, ROS Gong et al. 2002
BER)
uvh1 RAD1/XPF (NER) UV-B, UV-C, Fidantsef et al.
IR 2000; Gallego et al.
2000; Liu et al.
2000
uvh3/uvr1 RAD2/XPG (NER) UV-B, UV-C, Liu et al. 2001
IR, ROS
xpb1 XPB1/RAD25 (NER) MMS Costa et al. 2001
ku70 KU70 (NHEJ) MMS, IR Bundock et al.
2002; Riha et al.
2002
ku80 KU80 (NHEJ) ROS, bleomy- West et al. 2002
cin
rad50 RAD50 (HR/NHEJ) MMS Gallego et al. 2001
mre11 MRE11 (HR/NHEJ) IR, MMS Bundock and
Hooykaas 2002
mim MIM (SMC-like, HR) MMS, MMC, Mengiste et al. 1999
UV-C, IR
Signalling
mkp1 MKP1 (MAP kinase phosphatase) UV-C, MMS Ulm et al. 2001
atm ATM (PI3K-like) MMS, IR Garcia et al. 2003
myb4 MYB4 (Myb transcription factor) UV-B Jin et al. 2000
uvr8 UVR8 (RCC1-like) UV-B Kliebenstein et al.
2002
(IR). All these agents cause a wide array of different DNA lesions, the most preva-
lent of which are briefly introduced below.
MMS is a monofunctional alkylating agent that induces mostly N-
methylpurines, the removal of which results in apurinic sites preventing DNA rep-
lication (Friedberg et al. 1995). Furthermore, they can indirectly lead to double-
strand breaks, for example as a result of repair processes, hence the radiation mim-
icking effect of MMS (e.g. Menke et al. 2001).
IR damages DNA as a consequence of both direct and indirect effects, that is,
either as a result of direct interaction of the radiation energy with DNA or as a re-
sult of the interaction of DNA with radiation-generated ROS. IR can evoke dam-
220 Roman Ulm
age to all cellular components and causes a variety of DNA lesions, such as vari-
ous types of base damage and, particularly, DNA strand breaks (Friedberg et al.
1995).
DNA is considered a major cellular target for UV radiation, with peak absorp-
tion at around 260 nm determined by its component nucleotides. UV radiation in-
duces oxidative damage (pyrimidine hydrates), DNA-protein and DNA-DNA
crosslinks and most prevalently various pyrimidine dimers, in particular cyclobu-
tane pyrimidine dimers (CPD) that constitute about 75% of UV-induced DNA le-
sions and pyrimidine [6-4] pyrimidinone dimers (6-4 photoproduct) that make up
the majority of the remainder (Britt 1996). The UV radiation spectrum has been
subdivided into three wavelength bands designated as UV-C (<280 nm), UV-B
(280-320 nm), and UV-A (320-400 nm). Solar UV radiation reaching the earth
consists only of UV-A and UV-B, since penetration of the atmospheric ozone
layer drops dramatically for wavelengths below 320 nm and declines to zero be-
low 295 nm. However, UV-C induces at high rate lesions equivalent to those gen-
erated by UV-B and is extensively used to explore biological responses to this
class of DNA damaging radiation (Friedberg et al. 1995).
Oxidative damage to DNA due to attack by ROS must be considered as an im-
portant source of spontaneous DNA damage (Marnett and Plastaras 2001). There
are various intra- and extracellular sources for ROS. Radiation in particular has, in
addition to the direct interaction of radiation energy with DNA, an indirect effect
on genetic information through the formation of ROS and their potential to dam-
age DNA and other cellular constituents. Free radicals may cripple DNA in a vari-
ety of ways, resulting, for example, in fragmentation, base loss, base changes and
strand breaks (Friedberg et al. 1995).
However, these genotoxic agents by no means damage exclusively DNA
(“mutagenic effect”). Rather, they have a complex impact on cellular metabolism
(“cytotoxic effect”) as a consequence of damage conferred to other cellular con-
stituents, including proteins and lipids. It should also be noted that living organ-
isms are rarely exposed to the DNA-damaging agents that are most conveniently
studied in the laboratory. Nonetheless, these agents have proved to be instrumental
in deciphering genotoxic stress responses including perception, signalling, and re-
pair in all organisms, among them Arabidopsis (Table 1).
The multitude of modifications evoked by genotoxic agents constitutes the sub-
strate for a manifold of cellular responses particularly well-known in yeast and
animal systems that will be outlined briefly here, in order to provide a frame of
reference for recent advances in plant systems. For more detailed information on
non-plant systems, the reader is referred to the literature cited and references
therein. Concerning responses in the plant system, the effects of UV-B responses
will be discussed in part separately from the other genotoxic stresses.
Fig. 1. Signalling in response to genotoxic agents.
8.3 Genotoxic stress signalling
In mammals, two major signalling pathways link genotoxic stress perception to

adequate responses (Fig.1, Liu et al. 1998). The cellular responses result either di-
rectly from DNA damage (“nuclear” target-mediated) or are initiated outside the
nucleus and do not involve DNA damage directly (“non-nuclear”). In the former
case, key players include transcription factor p53 and the ATM/ATR sensor
kinases. In the latter case, a major signalling pathway involves the activation of
members of the mitogen-activated protein (MAP) kinase family. The separation of
genotoxic signalling into DNA-damage-mediated and non-DNA-damage-
mediated pathways will be followed in this review as a guideline; however, nu-
merous exceptions to the generalities can be found. Moreover, it should be noted
that the two pathways are not isolated from each other but rather interact at several
levels (Fig. 1, Rotman and Shiloh 1999).
8.3.1 From inside the nucleus
8.3.1.1 Nuclear-target-mediated signalling in non-plant systems

The sensor proteins that directly recognize DNA damage are not yet precisely
known. However, prime suspects are members of a group of checkpoint proteins
and a pair of large protein kinases, the phosphatidylinositol 3-kinase (PI3K)-like
ATM (Ataxia telangiectasia mutated) and ATR (ATM and Rad3-related; Rotman
and Shiloh 1999; Kastan and Lim 2000; Abraham 2001; Melo and Toczyski 2002,
and references therein). In spite of their PI3K-like domains, ATM, and ATM-
related proteins (see Table 2) are not lipid kinases but serine/threonine protein
222 Roman Ulm
kinases (Kim et al. 1999). Defects in ATM give rise to ataxia telangiectasia (A-T),
a rare human neurodegenerative, and cancer predisposition disease with a complex
clinical phenotype. ATM has both nuclear and cytoplasmic functions that may
contribute to the pleiotropic nature of A-T (Abraham 2001). However, its nuclear
role is central to very early stages of DNA damage signalling (Rotman and Shiloh
1999; Kastan and Lim 2000; Abraham 2001). Consistently, cells from A-T pa-
tients show increased sensitivity to IR and radiomimetic chemicals, but are profi-
cient in their response to UV radiation. Thus, ATM is crucial in signalling DNA
double-strand breaks that may occur as a consequence of cellular metabolism dur-
ing replication and repair, or after exposure to specific DNA-damaging agents
(Rotman and Shiloh 1999; Abraham 2001). ATR on the other hand, seems to be
involved in the response to other types of DNA damage as well, such as those
evoked by exposure to UV radiation. Mutations in ATR are associated with em-
bryonic lethality and chromosomal fragmentation (Brown and Baltimore 2000). In
mammalian cells, activation of these “sensor kinases” is central to DNA damage-
induced checkpoint responses (Abraham 2001). It is presently not clear why these
kinases share homology to PI3Ks; their activation in response to DNA damage,
however, initiates a protein phosphorylation cascade resulting in the activation of
the effector checkpoint kinases (CHK1, CHK2) and other key players, including
the Nijmegen breakage syndrome protein NBS1 (a member of the MRE11-
nuclease complex), the breast cancer associated protein BRCA1, the non-receptor
tyrosine kinase c-ABL, the tumour suppressor gene product p53, and its regulator
MDM2 (reviewed by Rotman and Shiloh 1999; Colman et al. 2000; Kastan and
Lim 2000; Abraham 2001; Appella and Anderson 2001; Melo and Toczyski
2002). This complex DNA damage-responsive signal transduction pathway finally
regulates cell cycle transitions, apoptosis and DNA repair, altogether increasing
the faithful transmission of genetic information and, consequently, survival of the
organism.
The DNA damage response pathways mediated by kinase cascades have been
conserved through eukaryotic evolution, as shown by the existence and function of
the yeast ATM and ATR orthologs Tel1p (S. cerevisiae and S. pombe) and
Mec1p/Rad3p (S. cerevisiae/ S. pombe), respectively (Melo and Toczyski 2002,
see also Table 2). mec1 single mutant strains, but not tel1, are sensitive to DNA-
damaging agents and fail to arrest the cell cycle in response to DNA damage.
Global gene expression analysis revealed the requirement of Mec1p function in
the regulation of several genes in response to DNA damaging agents (Gasch et al.
2001). Tel1p function appears to be redundant with Mec1p as tel1mec1 double
mutant strains are more sensitive to genotoxic agents than mec1 single mutants
and TEL1 overexpression partially suppresses the mec1 hypersensitive phenotype
in response to DNA damage (Morrow et al. 1995; Craven et al. 2002). Further-
more, similar to the situation in mammals, these two large members of the PI3K
family phosphorylate multiple replication, repair, and checkpoint proteins.
Amongst these are the two checkpoint kinases Rad53p/Cds1p (S. cerevisiae/ S.
pombe) and Chk1p (S. cerevisiae and S. pombe) (Melo and Toczyski 2002). Yeast
cells mutated in components of this pathway are impaired in cell-cycle check-
Table 2. ATM and related proteins in eukaryotes
S. S. pombe C. Drosophila Vertebrate Arabidopsis Ref

cerevisiae elegans
Tel1p Tel1p ATM TEL1 ATM ATM (1)
Mec1p Rad3p ATL1 MEI41 ATR ATR (2)
DNA-PKcs
Tor1p Tor1p TOR TOR TOR/FRAP TOR (3)
Tor2p Tor2p
References for Arabidopsis homologs : (1) (Garcia et al. 2000); (2) (Perry and Kleckner
2003); (3) (Menand et al. 2002)
points and gene expression changes, and exhibit hypersensitivity to genotoxic

stress treatments (Gasch et al. 2001; Melo and Toczyski 2002).
8.3.1.2 Nuclear-target-mediated signalling in plant systems

In plants, ATM and ATR homologs are encoded in the fully sequenced Arabidop-
sis genome (Table 2); however, genetic data on genotoxic signalling presumably
initiated in the nucleus through the perception of damaged DNA is presently lim-
ited to the Arabidopsis ATM homolog (Garcia et al. 2003). The 440 kDa protein
encoded by AtATM contains a carboxy-terminal PI3K-like domain flanked by two
loosely conserved domains termed FAT (FRAP, ATM, TRRAP) and FATC (the
“C” indicates carboxy-terminal) (Garcia et al. 2000; Garcia et al. 2003), as found
in other members of the ATM family as well (Abraham 2001). Moreover, recent
protein sequence analysis described the non-kinase domain of AtATM as com-
posed of HEAT (huntingtin, elongation factor 3, A subunit of PP2A and TOR1)
repeats, similarly identified in ATMs, ATRs and related proteins from diverse or-
ganisms, suggesting a conserved biochemical mechanism of action amongst the
different family members (Perry and Kleckner 2003).
A reverse genetic approach identified two T-DNA tagged atm mutants whose
phenotype suggests that ATM function is conserved in Arabidopsis and that
AtATM may play a critical role in DNA damage-responsive cell cycle check-
points (Garcia et al. 2003). Consistently, the atm mutants are hypersensitive to
both IR and the radiomimicking MMS, but not to UV-B, suggesting a critical
function of AtATM in the response to DNA strand breaks. In addition, the IR-
mediated transcriptional induction of genes involved in the cellular response to
DNA strand breaks (AtRAD51, AtPARP1, AtGR1 and AtLIG4) is defective in atm
mutant plants. This indicates an important role of AtATM in the signal transduc-
tion cascade resulting in the transcriptional gene activation of a group of genes
following exposure to IR (Garcia et al. 2003). AtATM itself is constitutively ex-
pressed and not induced by IR (Garcia et al. 2000). In contrast to hypersensitivity
to genotoxic stress, atm mutant plants apparently possess a normal vegetative de-
velopment, a feature that differs from the complex pleiotropic phenotype of hu-
man A-T patients. However, Arabidopsis atm mutants are partially sterile due to a
defect in female gametophyte development resulting from post-meiotic arrest. In
224 Roman Ulm
addition, atm mutants have a reduced number of viable pollen grains. The meiotic
defect in atm meiocytes was shown to include a number of anomalies, such as
bridges between paired chromosomes and chromosome fragmentation (Garcia et
al. 2003). This defect corroborates a common meiotic function of ATM conserved
among eukaryotes. However, apparent meiotic recombination frequencies in atm
are similar to wild type and the developmentally regulated meiotic recombination
genes (AtRAD51, AtSPO11 and AtDMC1) are expressed at normal levels (Garcia
et al. 2003). Thus, at present, the exact function of AtATM in meiosis and meiotic
recombination remains to be determined. Moreover, as noted by the authors, the
absence of meiotic arrest in various other meiotic mutants in Arabidopsis puts to
doubt the existence of a functional meiotic checkpoint (Garcia et al. 2003). Thus,
it remains to be established if an AtATM-dependent meiotic checkpoint exists in
Arabidopsis.
It will be particularly interesting to determine the further conservation and plant
specificity of the nuclear genotoxic stress pathways. Analysis of the Arabidopsis
genome indicates the existence of several conserved components
(http://www.tigr.org/~jeisen/Arabidopsis_Repair/Repair.table.html and
http://ag.arizona.edu/dnametab/tables/ESTTable.xls), including an ATR homolog
(Table 2). The possible involvement of AtATR in genotoxic stress signalling (par-
ticularly UV-B) remains to be established. However, a prominent absentee in
Arabidopsis is a p53 homolog, and the existence of p53-related pathways is a mat-
ter of debate (Whittle et al. 2001). The tumour suppressor protein p53 is a tran-
scription factor that integrates DNA damage checkpoint signals with normal and
aberrant (oncogenic) mitogenic signalling in animals, deciding if the cells will
grow, arrest or die (Appella and Anderson 2001; Wahl and Carr 2001). It is note-
worthy, that the presence and absence of p53 in animals and yeast, respectively, is
suggested to reflect the different priorities of multi- versus unicellular organisms
in response to DNA damage. In other words, members of the animal kingdom - in
contrast to unicellular organisms - can tolerate a dead cell, but one proliferating
uncontrollably may be lethal (Wahl and Carr 2001). Plants, on the other hand, are
not killed by uncontrolled tumourous cell growth. Thus, it will be interesting to
determine whether or not plants have a functional equivalent to p53, and if they
do, how that pathway differs from its animal counterpart. In this regard, however,
it should be noted that apoptosis-like responses after UV irradiation have been de-
tected in plants (Danon and Gallois 1998; Mitsuhara et al. 1999), indicating the
conservation of programmed removal of cells in response to unbearable levels of
genotoxic stress.
Substrates of AtATM and their function in plants remain to be identified. Muta-
tions of known components of the predicted MRE11/RAD50/NBS1-complex im-
plicated in DNA repair processes lead to genotoxic stress hypersensitivity in
Arabidopsis (Gallego et al. 2001; Bundock and Hooykaas 2002). NBS1 and its
homolog Xrs2p are substrates of ATM and Mec1p in mammals and yeast, respec-
tively. However, no Arabidopsis homolog of NBS1/Xrs2p is currently known,
most likely due to low sequence conservation as already indicated by the low ho-
mology between mammalian NBS1 and yeast Xrs2p (D'Amours and Jackson
2002). Furthermore, the Arabidopsis mre11 and rad50 mutants exhibit aberrant te-
lomere length regulation (Gallego et al. 2001; Gallego and White 2001; Bundock
and Hooykaas 2002), as do their counterparts in other eukaryotes (D'Amours and
Jackson 2002). Hence, AtATM might be involved in telomere maintenance, and
general conservation of ATM signalling to the MRE11 complex during meiosis
and DNA damage response is suggested.
8.3.2 From the cell periphery
8.3.2.1 Non-nuclear-target-mediated signalling in non-plant systems

A second pathway triggered by genotoxic agents originates outside the nucleus
and exploits signal transduction cascades normally used for other cellular re-
sponses, including growth factor signalling (reviewed by Herrlich et al. 1997; Liu
et al. 1998; Shaulian and Karin 2002). In the case of UV radiation, this pathway
involves clustering and activation of several growth factor and cytokine receptor
tyrosine kinases at the cell membrane (Devary et al. 1992; Sachsenmaier et al.
1994; Rosette and Karin 1996) or, as in the case of MMS, an unknown down-
stream component (Liu et al. 1996). UV irradiation indeed induces tyrosine phos-
phorylation of receptor tyrosine kinases (e.g. Sachsenmaier et al. 1994; Knebel et
al. 1996; Rosette and Karin 1996; Kitagawa et al. 2002). However, it is not exactly
known how UV activates the cell surface receptors in mammalian cells. It was
suggested that UV irradiation might perturb the cell surface or alter receptor con-
formation leading to receptor multimerization, clustering, and activation (Rosette
and Karin 1996). Alternatively, the inhibition of a membrane-bound protein tyro-
sine phosphatase was proposed as a genotoxic stress target, thereby preventing
dephosphorylation of the receptor tyrosine kinases (Knebel et al. 1996). Further-
more, a central element in the response to diverse genotoxins appears to be the
generation of ROS in the affected cells (Friedberg et al. 1995) and considerable
evidence suggests that many genotoxic agents trigger their effects on signalling
pathways through a mechanism involving oxidative stress (Devary et al. 1992; Liu
et al. 1998). Whatever the exact mechanism of signal initiation, this signal trans-
duction pathway involves activation of MAP kinase cascades. The core of MAP
kinase pathways that is conserved in all eukaryotes consists of a three-tiered
kinase module, composed of a MAP kinase kinase kinase (MAPKKK), a MAP
kinase kinase (MAPKK) and a terminal MAP kinase (MAPK) that relays signals
by sequential phosphorylation and activation (Fig. 2). Upon their activation, a pool
of the MAP kinases is translocated from the cytoplasm to the nucleus. Thus,
downstream targets comprise cytoplasmic and nuclear proteins, including other
protein kinases, phosphatases, phospholipases, cytoskeleton-associated proteins,
and a number of transcription factors (reviewed by Widmann et al. 1999; Kyriakis
and Avruch 2001). Phosphorylation of transcription factors leads to appropriate
reprogramming of gene expression in response to activating stimuli, contributing
to a particular readout of the MAPK cascade.
226 Roman Ulm
Fig. 2. MAP kinase signalling.
Members of three distinct MAP kinase subfamilies, namely the extracellular

signal-regulated kinases (ERK), c-jun N-terminal kinases (JNKs), and p38 kinases
have been implicated in response to genotoxic insults, resulting in the induction of
many target genes through the activation of transcription factors such as activator
protein-1 (AP-1; Jun/Fos) (reviewed, for example, by Liu et al. 1998; Shaulian
and Karin 2002). The activation of JNK and the induction of two UV-responsive
transcription factors, AP-1 and nuclear factor (NF)-κB, were fully functional in
enucleated cells, providing evidence that the UV response does not require a sig-
nal generated in the nucleus, but is likely to be initiated by membrane proximal
events (Devary et al. 1993). It is, however, not excluded that there is additional
retrograde DNA damage-dependent activation of the growth factor signalling
components, including MAP kinases (discussed in Liu et al. 1998). Intriguingly,
the activation of NF-κB by UV irradiation is mediated sequentially by DNA dam-
age-independent and -dependent mechanisms (Bender et al. 1998).
An important feature that determines the outcome of the cellular reaction is the
magnitude and duration of MAPK activation (Marshall 1995), which is regulated
by the balance between phosphorylating and activating MAPKKs and dephos-
phorylating and deactivating phosphatases (Fig. 2). These negative regulators in-
clude serine-threonine phosphatases, tyrosine phosphatases, and the dual-
specificity phosphatases known as MAP kinase phosphatases (MKPs). Members
of the MKP family are potent and specific inactivators of MAPKs through
dephosphorylation of both the threonine and the tyrosine in the Thr-x-Tyr motif in
their activation loop (Camps et al. 2000; Theodosiou and Ashworth 2002).
A recognized function of JNK in response to UV radiation includes regulation
of the stress-induced apoptotic signalling mechanism. Consistently, simultaneous
disruption of all functional Jnk genes or their upstream activators (Mkk4 and
Mkk7) resulted in protection against UV- and MMS-induced apoptosis in fibro-
blasts, due to a defect in an early mitochondrial response to JNK activation

(Tournier et al. 2000; Tournier et al. 2001). Given the central role of MAP kinases
in genotoxic stress responses, their inactivation might be crucial for signal attenua-
tion (Liu et al. 1998). It has been hypothesized that UV-induced transient activa-
tion of JNK leads to stress relief, while sustained activity results in apoptotic cell
death (Chen et al. 1996; Franklin et al. 1998). In agreement with this assumption,
conditional expression of human MKP-1 influenced genotoxic stress relief in a
stably-transformed leukemic cell line through the inhibition of UV-induced JNK
activity resulting in cytoprotection against UV-induced apoptosis (Franklin et al.
1998). Consistently with this function, MKP-1 gene expression is induced by UV-
C radiation as well as by MMS treatment, temporarily coinciding with a decline in
JNK activity. In addition, the constitutive expression of MKP-1 inhibits JNK ac-
tivity and reduces the UV-C- and MMS-induced activation of transcription factor
AP-1-dependent reporter genes (Liu et al. 1995; Liu et al. 1998). However, genetic
ablation of MKP-1 function in mouse did not have any reported phenotypic con-
sequences, which is most likely attributable to functional redundancy (Dorfman et
al. 1996).
What is the role of MAP kinases in the non-apoptotic UV response? While de-
tails of similarities of the genes and signalling pathways that are activated by UV
radiation and mitogens are rapidly emerging, the understanding of the exact
physiological function of the UV response remained only fragmentary. Recent
evidence, however, points to an important role of p38 in the initiation of a G2/M
checkpoint after UV irradiation (Bulavin et al. 2001), indicating that the DNA in-
tegrity checkpoint pathways initiated as a result of DNA damage perception and
the stress kinase (SAPK/JNK and p38) pathways activated through membrane
proximal events interact to modulate cell cycle control (Pearce and Humphrey
2001; Bulavin et al. 2002). It is speculated that this provides a prophylactic re-
sponse under conditions in which DNA damage is inevitable and thereby serves to
minimize genetic damage resulting from cell cycle progression under these cir-
cumstances. As a result, cells are allowed to enter mitosis only after appropriate
stress recovery (Bulavin et al. 2001). In addition, a recent report on c-Jun, the
eponymous target protein of JNK kinases, shed some light on the paradoxical ac-
tivation of a mitogenic signalling pathway by agents that inhibit rather than stimu-
late cell proliferation. As for p38 described above, a direct impact on the cell cycle
mechanism and DNA damage checkpoints was postulated. In particular, it was
found that the function of c-Jun lies in its stimulation of cell cycle re-entry after
p53-imposed growth arrest in response to UV irradiation (Shaulian et al. 2000;
Shaulian and Karin 2002).
Interestingly, a homologous UV response pathway independent of DNA dam-
age response exists in yeast (Engelberg et al. 1994; Herrlich et al. 1997). In S. cer-
evisiae, the transcriptional activation of the histidine biosynthesis genes HIS3 and
HIS4 by the Gcn4 transcription factor (AP-1 family member, functional homolog
of c-Jun) is triggered by UV irradiation in a Ras-dependent fashion (Ras is small
GTP-binding protein, an upstream activator of MAP kinase pathways). Impor-
tantly, the UV-resistance of yeast correlates with the level of Ras activity and
Gcn4 function (Engelberg et al. 1994). Furthermore, in fission yeast, UV irradia-
228 Roman Ulm
tion activates the Spc1 MAP kinase, and spc1 mutants are hypersensitive to killing
by UV and MMS. In contrast to different checkpoint mutants known in yeast that
fail to arrest cell division in response to DNA damage, spc1 mutants are defective
in resuming division after the genotoxic insult (Degols and Russell 1997), demon-
strating a key function of this MAP kinase in survival of UV-irradiated cells.
8.3.2.2 Non-nuclear-target-mediated signalling in plant systems

Similar to the case of yeast and mammals, it was recently shown that the induction
of plant signal transduction pathways by genotoxic stress is most probably initi-
ated at the cell periphery and includes activation of MAP kinases (Stratmann et al.
2000; Ulm et al. 2001; Miles et al. 2002), lending strong support to the existence
of a UV response equivalent in plants, as debated before (Herrlich et al. 1997). An
initial piece of evidence was the finding that UV irradiation induces the expression
of several plant defence genes (including proteinase inhibitors I and II) in a octa-
decanoid pathway-dependent manner in tomato, as indicated by using the JL-5
mutant that is deficient in jasmonate synthesis (Conconi et al. 1996). Similarly to
the UV response in mammals and yeast, a MAP kinase-like activity was detected
after UV irradiation in tomato, suggesting the activation of MAP kinase pathways
in response to this environmental cue in plants as well (Stratmann et al. 2000). In a
direct approach to test whether a UV response equivalent exists in plants, the ex-
pression of the Arabidopsis HIS4 homolog HDH (encoding a histidinol dehydro-
genase) was monitored and found to be UV-B-inducible in Arabidopsis seedlings
(Zimmermann et al. 1999). Furthermore, an Arabidopsis cDNA encoding a nu-
cleotide diphosphate kinase (NDPKIa) was identified that complements the gcn4
yeast mutant. NDPKIa specifically binds the HIS4 promoter in vitro and induces
HIS4 transcription in yeast. In addition, the expression of NDPKIa is induced by
UV-B in Arabidopsis (Zimmermann et al. 1999). Interestingly, a recent report
linked this NDPK to oxidative stress and MAP kinase signalling in Arabidopsis
(Moon et al. 2003)
Genetic data on genotoxic stress signalling in Arabidopsis presumably initiated
at the cell periphery is limited to the MAP kinase phosphatase homolog AtMKP1
(Ulm et al. 2001; Ulm et al. 2002). The T-DNA knock-out mutant mkp1, deficient
in AtMKP1, was recently identified in a forward genetic screen for genotoxic
stress hypersensitivity. mkp1 is affected in response to both MMS and UV-C, in-
dicating a role of AtMKP1 in the signal transduction pathway activated by these
rather distinct genotoxic agents (Ulm et al. 2001).
It was postulated that AtMKP1 regulates a 49 kD MAP kinase in planta, a no-
tion that was further supported by the identification of the AtMKP1-interacting
MAP kinase AtMPK6 and its AtMKP1-dependent genotoxic stress-responsive ac-
tivity in vivo. Activation of AtMPK6, as determined by immunokinase assays,
was highest in the AtMKP1-deficient mkp1, intermediate in the wild type control
and suppressed in an AtMKP1-overexpressing line (Ulm et al. 2002). Thus, the
level of AtMKP1 determines the activation level of AtMPK6, establishing
AtMKP1 as a regulator of AtMPK6 in response to genotoxic stress in vivo. Ex-
trapolating from mammals (see Sect. 3.1.2), transient and low-level MAPK activa-
tion may contribute to genotoxic stress relief, whereas prolonged and high-level
activation may trigger cell death. It is thus tempting to speculate that the loss of
phosphatase in mkp1 and the resulting elevated activation of AtMPK6 might tip
the balance towards cell death at a stress level permissive for the wild type. The
genotoxic stress hypersensitivity of mkp1 and the elevated activation of AtMPK6
are in agreement with this notion (Ulm et al. 2002). However, next to AtMPK6,
yeast two-hybrid analysis also identified AtMPK3 and AtMPK4 as possible
AtMKP1-interacting MAPKs, among nine AtMPKs 1-9 tested (Ulm et al. 2002).
As there is a total of 20 MPKs encoded in the Arabidopsis genome (Ichimura et al.
2002), the panel of AtMKP1-interactors and genotoxic stress-activated MAP
kinases might be even larger and the basis for the cellular response might be more
complex.
In plants, several intra- and extracellular cues activate MAP kinase pathways
and a number of pathway components have been identified on the basis of se-
quence conservation (Tena et al. 2001; Ichimura et al. 2002; Jonak et al. 2002).
Surprisingly, all plant MAP kinases are classified as PERKs (plant ERKs) belong-
ing to the extracellular signal-regulated (ERK) subfamily (Tena et al. 2001), the
mammalian members of which are mainly responsible for the transduction of mi-
togenic signals (Widmann et al. 1999). Thus, no other classes comprising stress-
activated protein kinases (SAPK; JNK or p38 kinases) present in other organisms
are recognizable in the genomic sequence of Arabidopsis.
At present, putative MAP kinase functions in Arabidopsis are assigned only to
the stress-activated AtMPKs 3, 4, and 6 (Tena et al. 2001; Jonak et al. 2002). For
example, immunokinase assays revealed that AtMPK4 and 6 are enzymatically ac-
tivated by similar environmental stresses such as cold, low humidity, touch,
wounding, high salinity, and osmolarity, but also by microbial elicitors (Tena et al.
2001; Jonak et al. 2002, and references therein). In addition, AtMPK6 but not
AtMPK4 activity is increased in response to ROS (Yuasa et al. 2001). Further-
more, transient expression experiments in protoplasts indicated the involvement of
AtMPK3 and AtMPK6 in responses to oxidative stress (Kovtun et al. 2000). Thus,
compelling evidence points to diverse stress-related functions of plant MAPKs,
suggesting that certain plant ERKs have evolved the capacity to signal adverse en-
vironmental conditions to compensate for the absence of plant SAPKs. Interest-
ingly, AtMKP1 interacts specifically with the three stress-related MAP kinases in
Arabidopsis, suggesting a function as a regulator of diverse environmental
stresses. Supporting this notion is the increased resistance of the mkp1 mutant to
elevated salinity, making AtMKP1 a negative regulator of plant salt tolerance next
to its positive regulatory role in genotoxic stress responses (Ulm et al. 2002).
However, the exact mechanism of the apparent salt resistance in mkp1 remains to
be identified. It is of note that a connection between genotoxic stress responses
and salt signalling pathways had already been postulated based on the phenotypes
of the uvs66 mutant (Albinsky et al. 1999). However, as the responsible mutation
is not identified yet, the insight on this phenotypic link at the molecular level is
limited.
In addition to the post-translational activation of MAP kinases, it is known that
a subgroup is also regulated at the gene expression level in plants (Ichimura et al.
230 Roman Ulm
2002). AtMPK3 is transcriptionally induced in response to various abiotic stresses

(Mizoguchi et al. 1996), including ROS and UV-B (Desikan et al. 2001). Further-
more, it was shown that AtMPK3 and, to a lesser extent, AtMPK4 are transcrip-
tionally activated in response to UV-C radiation; this is, however, independent of
AtMKP1 (Ulm et al. 2002). At present, it is not known how AtMKP1 itself is
regulated, but unlike the majority of mammalian MKPs that are immediate early
genes, no transcriptional regulation of AtMKP1 has been found.
It is quite interesting that, in a way distinct from the case of other environ-
mental stress treatments, AtMPK6 is activated by genotoxic stress treatments in
Arabidopsis without the concomitant triggering of AtMPK4 (Ulm et al. 2002). In
tobacco, it was found that UV-C activates the AtMPK6 homolog NtSIPK, but not
the AtMPK3 homolog NtWIPK (Miles et al. 2002). It is remarkable that ROS ac-
tivate AtMPK6, but not AtMPK4 (Yuasa et al. 2001), and furthermore, NtSIPK
activation by UV-C was found to be reliant on ROS (Miles et al. 2002), indicative
of a prominent role of ROS generation in the genotoxic stress signalling in plants,
similarly to the situation in mammals (Devary et al. 1992; Liu et al. 1998). It is
noteworthy, that both the overexpression and the suppression of NtSIPK in to-
bacco render plants sensitive to ROS-stress (Samuel and Ellis 2002); however, al-
tered resistance to UV-C or other genotoxic agents was not reported. On the other
hand, the mkp1 mutant is hypersensitive to UV-C and MMS, but displays wild
type phenotype in response to exogenous ROS (Ulm et al. 2001; Ulm et al. 2002).
In addition to ROS-dependence, it is suggested that NtSIPK activation in re-
sponse to UV-C in tobacco cell cultures relies on Ca2+ ions as well, as indicated by
a pharmacological approach (Miles et al. 2002). In addition, suramin, an inhibitor
of growth factor/cytokine interactions with their corresponding cell surface recep-
tor tyrosine kinases in animal cells, blocks the activation of MAPK by UV-C,
ozone and hydrogen peroxide to a similar extent, suggesting a common signalling
pathway (Miles et al. 2002). Similarly, it was shown that suramin blocks UV-B-
mediated alkalisation and MAP kinase activation in tomato suspension-cultured
cells (Yalamanchili and Stratmann 2002). This is comparable to the situation in
mammalian model systems (Sachsenmaier et al. 1994, see also Sect. 3.2.1.) and
indicates signal initiation at the cell membrane; however, the possible receptor
targets of suramin in plants are elusive.
The exact cellular function of genotoxic stress-responsive MAP kinase path-
ways in plants is not known at present; however, like in other eukaryotes, it might
have a prophylactic function under conditions when DNA damage is to be antici-
pated. Importantly, mutant analysis indicates that this pathway is required for
genotoxic stress tolerance in Arabidopsis (Ulm et al. 2001).
8.3.3 Transcriptional response to genotoxic stress in plants
An important output of signal transduction pathways includes changes in gene ex-

pression. Not surprisingly, exposure of plant cells to treatments that damage DNA
equally evokes gene induction and repression (e.g. Conconi et al. 1996; Ulm et al.
2002; Garcia et al. 2003). However, it remains to be determined which of the
aforementioned signalling pathways induces which particular transcriptional re-

sponses to genotoxic stress treatments. For example, a crucial role for AtATM was
suggested in the signalling pathway that leads to the transcriptional response to IR
in the case of a particular set of genes (Garcia et al. 2003, see also Sect. 3.1.2.).
Moreover, gene expression profiling of wild type, mkp1 mutant, and an AtMKP1-
overexpressing line identified a subset of UV-C-induced genes that probably
represents targets of AtMKP1 regulation. It was suggested that AtMKP1 is a nega-
tive regulator of this specific group of genes under standard growth conditions,
whereas it is a positive regulator of gene induction in response to UV-C (Ulm et
al. 2002). It remains to be determined whether this transcriptional readout is due to
deregulated activity of AtMPK6 or to another, not yet identified mechanism.
Furthermore, it was found that UV-C irradiation transcriptionally induces EDS5
(a member of the multidrug and toxin extrusion [MATE] transporter family) and
induction is dependent on the pathogen response lipase-like proteins EDS1, PAD4
and the small membrane-associated NDR1 (Nawrath et al. 2002). Thus, it is indi-
cated that the signal transduction pathways of the responses to UV-C irradiation
and pathogen infection share common elements. However, even though UV-C ir-
radiation results in the accumulation of salicylic acid and this plant hormone in-
duces EDS5 transcription, the UV-C responsive EDS5 induction was not altered in
a salicylic acid induction-deficient mutant or in transgenic plants engineered to
degrade salicylic acid (Nawrath et al. 2002).
8.3.4 UV-B signalling
In a natural setting, plants are exposed to chronically high levels of sunlight, in-
cluding its UV-B portion. Depletion of the stratospheric ozone layer leads to ele-
vated terrestrial UV-B levels. Increases in solar UV-B radiation may have substan-
tial effects on the growth and development of many plant species (Rozema et al.
1997; Jansen et al. 1998). On the molecular level, several transcriptionally induced
plant genes are known (e.g. Zimmermann et al. 1999; Desikan et al. 2001; Jenkins
et al. 2001; Brosche and Strid 2003). Components involved in transducing UV-B
perception to gene expression include ROS, Ca2+/calmodulin, reversible protein
phosphorylation, and various plant hormones (reviewed, for example, in Brosche
and Strid 2003). In addition, in tomato suspension-cultured cells, MAP kinases
and other, molecularly unidentified signalling elements of the polypeptide wound
signal systemin are suggested to be employed in the response to UV-B (Yalaman-
chili and Stratmann 2002).
Different genetic screens were carried out using genotoxic levels of UV-B, as
indicated by a number of mutants impaired in DNA repair components (Table 1,
and references therein). Genetic support for specific signal transduction pathways
by which UV-B regulates gene expression is rather limited at present. However, a
number of Arabidopsis mutants are known that fail to synthesize UV-protective
phenylpropanoid pigments due to defects in their biosynthesis, resulting in UV
hypersensitivity (Table 1). The importance of signalling UV-B stress perception to
increase “sunscreen” components is supported by the hypersensitive uvr8 and the
232 Roman Ulm
hyposensitive myb4 mutants, identifying UVR8 functions as positive regulator and

the transcription factor AtMYB4 as negative regulator of phenylpropanoid me-
tabolism in response to UV-B (Jin et al. 2000; Kliebenstein et al. 2002). The myb4
mutant is deficient in the R2R3 MYB transcription factor AtMYB4 resulting in
enhanced UV-B tolerance due to elevated production of sinapate esters, an impor-
tant UV-B protecting sunscreen (Jin et al. 2000). AtMYB4 functions as a repressor
of its target gene C4H encoding cinnamate 4-hydroxylase, whereas UV-B-
mediated downregulation of AtMYB4 expression leads to derepression of C4H and
consequently synthesis of protecting sinapate esters. Consistently, AtMYB4-
overexpression results in UV-B sensitivity (Jin et al. 2000). In contrast, a mutation
in the UVR8 gene reduces the induction of flavonoids and chalcone synthase ex-
pression in response to UV-B. The uvr8 mutant is hypersensitive to UV-B stress
and shows enhanced induction of PR1 and PR5 proteins. Interestingly, the UVR8
gene encodes a protein similar to the human regulator of chromatin condensation 1
(RCC1) (Kliebenstein et al. 2002), a nuclear guanine nucleotide exchange factor
for the small GTPase Ran, which is involved in several essential cellular proc-
esses, including nucleocytoplasmic transport, mitotic spindle formation, the regu-
lation of cell cycle progression and nuclear envelope assembly (Dasso 2002). Ran
GTPases and interacting proteins are present in Arabidopsis, indicating conserva-
tion of the Ran regulatory mechanism (Haizel et al. 1997). However, it will be in-
teresting to elucidate the mechanism of action of UVR8 in response to UV-B
stress and the functional significance of the similarity between UVR8 and RCC1
also remains to be established.
It is noteworthy that a specific UV-B photoreceptor is postulated in plants but
not yet identified at the molecular level (e.g. Jenkins et al. 2001; Brosche and Strid
2003), which conceptually provides another parallel to the mammalian and yeast
“non-DNA” pathways. Related support is provided by the photomorphogenic re-
sponses to UV-B that are independent of the damaging effects (Kim et al. 1998;
Boccalandro et al. 2001). It remains to be determined how these non-damaging re-
sponses are initiated and signalled and how these events relate to UV-B stress re-
sponses.
8.4 Rapid genomic change in plants?
In addition to the obvious mutagenic effect of genotoxic agents, a variety of these

factors seem to have a rather indirect impact on the plant’s genome as well, owing
to the induction of somatic recombination (e.g. Lebel et al. 1993; Puchta et al.
1995; Ries et al. 2000; Kovalchuk et al. 2001). Surprisingly, general abiotic stress
factors like heat and salinity, as well as biotic stress seem to increase somatic re-
combination in plants (Lebel et al. 1993; Puchta et al. 1995; Lucht et al. 2002). In
addition, several instances have been documented in which the genome does alter
in response to the environment (McClintock 1984; Walbot and Cullis 1985; Wal-
bot 1999). These observations pose the question if these environmental stresses
also have the capacity to damage DNA. Alternatively, the plant’s genomic re-
sponse to environmental threats might be programmed, involving particular signal

transduction chains culminating in genomic change, possibly enabling a fast and
flexible adaptation of plant populations to the changing environment. It is tempt-
ing to speculate that the components involved in signalling genotoxic stress in
plants may provide a clue to signalling diverse environmental stresses to heritable
DNA alterations.
8.5 Conclusions
The response of cells to genotoxic agents is multifaceted and closely linked with
regulatory pathways controlling cell growth and division. It is well conceivable
that the specific combination of pathways that is induced by a particular genotoxin
dictates the fate of the cell after genotoxic stress. In addition, the integration with
diverse internal and environmental signals will influence the outcome. Not sur-
prisingly, the first glances into genotoxic stress signalling venues in plants imply
similar complexity and impact on basic cellular functions. The Arabidopsis mu-
tants impaired in genotoxic stress responses provide the tools to dissect the under-
lying signalling pathways and their interactions in this genetically tractable model
organism. Furthermore, they provide an entry point into understanding plant re-
sponses to DNA damaging threats and their links to other stress responses. Given
the fundamentally different life strategies of plants versus higher animals, the
study of genotoxic stress perception and signalling will certainly profit from a
comparison of the two systems.
Acknowledgements
I apologize to researchers in the field for not being able to include all relevant pa-
pers. I would like to thank Alexander Baumann, Erzsebet Fejes, Nikki Holbrook,
Ferenc Nagy, Jurek Paszkowski, and Alain Tissier for critical reading and helpful
comments on the manuscript. This work was supported by the Wolfgang Paul
Award to Ferenc Nagy.
References
Abraham RT (2001) Cell cycle checkpoint signaling through the ATM and ATR kinases.
Genes Dev 15:2177-2196
Albinsky D, Masson JE, Bogucki A, Afsar K, Vass I, Nagy F, Paszkowski J (1999) Plant
responses to genotoxic stress are linked to an ABA/salinity signaling pathway. Plant J
17:73-82
Appella E, Anderson CW (2001) Post-translational modifications and activation of p53 by
genotoxic stresses. Eur J Biochem 268:2764-2772
234 Roman Ulm
Bender K, Gottlicher M, Whiteside S, Rahmsdorf HJ, Herrlich P (1998) Sequential DNA

damage-independent and -dependent activation of NF-kappaB by UV. EMBO J
17:5170-5181
Boccalandro HE, Mazza CA, Mazzella MA, Casal JJ, Ballare CL (2001) Ultraviolet B ra-
diation enhances a phytochrome-B-mediated photomorphogenic response in Arabidop-
sis. Plant Physiol 126:780-788
Britt A (2002) Repair of damaged bases. In: Somerville CR, Meyerowitz EM (eds) The
Arabidopsis Book. American Society of Plant Biologists, Rockville, MD,
doi/10.1199/tab.0005, http://www.aspb.org/publications/arabidopsis
Britt AB (1996) DNA damage and repair in plants. Annu Rev Plant Physiol Plant Mol Biol
47:75-100
Brosche M, Strid A (2003) Molecular events following perception of ultraviolet-B radiation
by plants. Physiol Plant 117:1-10
Brown EJ, Baltimore D (2000) ATR disruption leads to chromosomal fragmentation and
early embryonic lethality. Genes Dev 14:397-402
Bulavin DV, Amundson SA, Fornace AJ (2002) p38 and Chk1 kinases: different conduc-
tors for the G(2)/M checkpoint symphony. Curr Opin Genet Dev 12:92-97
Bulavin DV, Higashimoto Y, Popoff IJ, Gaarde WA, Basrur V, Potapova O, Appella E,
Fornace AJ, Jr. (2001) Initiation of a G2/M checkpoint after ultraviolet radiation re-
quires p38 kinase. Nature 411:102-107
Bundock P, Hooykaas P (2002) Severe developmental defects, hypersensitivity to DNA-
damaging agents, and lengthened telomeres in Arabidopsis MRE11 mutants. Plant Cell
14:2451-2462
Bundock P, van Attikum H, Hooykaas P (2002) Increased telomere length and hypersensi-
tivity to DNA damaging agents in an Arabidopsis KU70 mutant. Nucleic Acids Res
30:3395-3400
Camps M, Nichols A, Arkinstall S (2000) Dual specificity phosphatases: a gene family for
control of MAP kinase function. FASEB J 14:6-16
Chen YR, Wang X, Templeton D, Davis RJ, Tan TH (1996) The role of c-Jun N-terminal
kinase (JNK) in apoptosis induced by ultraviolet C and gamma radiation. Duration of
JNK activation may determine cell death and proliferation. J Biol Chem 271:31929-
31936
Colman MS, Afshari CA, Barrett JC (2000) Regulation of p53 stability and activity in re-
sponse to genotoxic stress. Mutat Res 462:179-188
Conconi A, Smerdon MJ, Howe GA, Ryan CA (1996) The octadecanoid signalling path-
way in plants mediates a response to ultraviolet radiation. Nature 383:826-829
Costa RM, Morgante PG, Berra CM, Nakabashi M, Bruneau D, Bouchez D, Sweder KS,
Van Sluys MA, Menck CF (2001) The participation of AtXPB1, the XPB/RAD25
homologue gene from Arabidopsis thaliana, in DNA repair and plant development.
Plant J 28:385-395
Craven RJ, Greenwell PW, Dominska M, Petes TD (2002) Regulation of genome stability
by TEL1 and MEC1, yeast homologs of the mammalian ATM and ATR genes. Genet-
ics 161:493-507
D'Amours D, Jackson SP (2002) The Mre11 complex: at the crossroads of DNA repair and
checkpoint signalling. Nat Rev Mol Cell Biol 3:317-327
Danon A, Gallois P (1998) UV-C radiation induces apoptotic-like changes in Arabidopsis
thaliana. FEBS Lett 437:131-136
Dasso M (2002) The Ran GTPase: theme and variations. Curr Biol 12:R502-R508
Degols G, Russell P (1997) Discrete roles of the Spc1 kinase and the Atf1 transcription fac-
tor in the UV response of Schizosaccharomyces pombe. Mol Cell Biol 17:3356-3363
Desikan R, A-H-Mackerness S, Hancock JT, Neill SJ (2001) Regulation of the Arabidopsis
Devary Y, Gottlieb RA, Smeal T, Karin M (1992) The mammalian ultraviolet response is
triggered by activation of Src tyrosine kinases. Cell 71:1081-1091
Devary Y, Rosette C, DiDonato JA, Karin M (1993) NF-kappa B activation by ultraviolet
light not dependent on a nuclear signal. Science 261:1442-1445
Dorfman K, Carrasco D, Gruda M, Ryan C, Lira SA, Bravo R (1996) Disruption of the
erk/mkp-1 gene does not affect mouse development: normal MAP kinase activity in
ERP/MKP-1-deficient fibroblasts. Oncogene 13:925-931
Engelberg D, Klein C, Martinetto H, Struhl K, Karin M (1994) The UV response involving
the Ras signaling pathway and AP-1 transcription factors is conserved between yeast
and mammals. Cell 77:381-390
Fidantsef AL, Mitchell DL, Britt AB (2000) The Arabidopsis UVH1 gene is a homolog of
the yeast repair endonuclease RAD1. Plant Physiol 124:579-586
Franklin CC, Srikanth S, Kraft AS (1998) Conditional expression of mitogen-activated pro-
tein kinase phosphatase-1, MKP-1, is cytoprotective against UV-induced apoptosis.
Friedberg EC, Walker GC, Siede W (1995) DNA repair and mutagenesis. ASM Press,
Washington, D.C.
Gallego F, Fleck O, Li A, Wyrzykowska J, Tinland B (2000) AtRAD1, a plant homologue
of human and yeast nucleotide excision repair endonucleases, is involved in dark repair
of UV damages and recombination. Plant J 21:507-518
Gallego ME, Jeanneau M, Granier F, Bouchez D, Bechtold N, White CI (2001) Disruption
of the Arabidopsis RAD50 gene leads to plant sterility and MMS sensitivity. Plant J
25:31-41
Gallego ME, White CI (2001) RAD50 function is essential for telomere maintenance in
Garcia V, Bruchet H, Camescasse D, Granier F, Bouchez D, Tissier A (2003) AtATM is
essential for meiosis and the somatic response to DNA damage in plants. Plant Cell
15:119-132
Garcia V, Salanoubat M, Choisne N, Tissier A (2000) An ATM homologue from Arabi-
dopsis thaliana: complete genomic organisation and expression analysis. Nucleic Ac-
ids Res 28:1692-1699
Gasch AP, Huang M, Metzner S, Botstein D, Elledge SJ, Brown PO (2001) Genomic ex-
pression responses to DNA-damaging agents and the regulatory role of the yeast ATR
homolog Mec1p. Mol Biol Cell 12:2987-3003
Gong Z, Morales-Ruiz T, Ariza RR, Roldan-Arjona T, David L, Zhu J-K (2002) ROS1, a
repressor of transcriptional gene silencing in Arabidopsis, encodes a DNA glycosy-
lase/lyase. Cell 111:803-814
Gorbunova VV, Levy AA (1999) How plants make ends meet: DNA double-strand break
repair. Trends Plant Sci 4:263-269
Haizel T, Merkle T, Pay A, Fejes E, Nagy F (1997) Characterization of proteins that inter-
act with the GTP-bound form of the regulatory GTPase Ran in Arabidopsis. Plant J
11:93-103
236 Roman Ulm
Herrlich P, Blattner C, Knebel A, Bender K, Rahmsdorf HJ (1997) Nuclear and non-nuclear

targets of genotoxic agents in the induction of gene expression. Shared principles in
yeast, rodents, man and plants. Biol Chem 378:1217-1229
Ichimura K, Shinozaki K, Tena G, Sheen J, Henry Y, Champion A, Kreis M, Zhang S, Hirt
H, Wilson C, Heberle-Bors E, Ellis BE, Morris P, Innes RW, Ecker JR, Scheel D,
Klessig DF, Machida Y, Mundy J, Ohashi Y, Walker JC (2002) Mitogen-activated
protein kinase cascades in plants: a new nomenclature. Trends Plant Sci 7:301-308
Jansen MAK, Gaba V, Greenberg BM (1998) Higher plants and UV-B radiation: balancing
damage, repair and acclimation. Trends Plant Sci 3:131-135
Jenkins GI, Long JC, Wade HK, Shenton MR, Bibikova TN (2001) UV and blue light sig-
nalling: pathways regulating chalcone synthase gene expression in Arabidopsis. New
Phytol 151:121-131
Jin H, Cominelli E, Bailey P, Parr A, Mehrtens F, Jones J, Tonelli C, Weisshaar B, Martin
C (2000) Transcriptional repression by AtMYB4 controls production of UV-protecting
sunscreens in Arabidopsis. EMBO J 19:6150-6161
Jonak C, Okresz L, Bogre L, Hirt H (2002) Complexity, cross talk and integration of plant
MAP kinase signalling. Curr Opin Plant Biol 5:415
Kastan MB, Lim D-S (2000) The many substrates and functions of ATM. Nat Rev Mol
Cell Biol 1:179-186
Kim BC, Tennessen DJ, Last RL (1998) UV-B-induced photomorphogenesis in Arabidop-
sis thaliana. Plant J 15:667-674
Kim ST, Lim D-S, Canman CE, Kastan MB (1999) Substrate specificities and identifica-
tion of putative substrates of ATM kinase family members. J Biol Chem 274:37538-
37543
Kitagawa D, Tanemura S, Ohata S, Shimizu N, Seo J, Nishitai G, Watanabe T, Nakagawa
K, Kishimoto H, Wada T, Tezuka T, Yamamoto T, Nishina H, Katada T (2002) Acti-
vation of extracellular signal-regulated kinase by ultraviolet is mediated through Src-
dependent epidermal growth factor receptor phosphorylation. Its implication in an anti-
apoptotic function. J Biol Chem 277:366-371
Kliebenstein DJ, Lim JE, Landry LG, Last RL (2002) Arabidopsis UVR8 regulates ultra-
violet-B signal transduction and tolerance and contains sequence similarity to human
regulator of chromatin condensation 1. Plant Physiol 130:234-243
Knebel A, Rahmsdorf HJ, Ullrich A, Herrlich P (1996) Dephosphorylation of receptor tyro-
sine kinases as target of regulation by radiation, oxidants or alkylating agents. EMBO J
15:5314-5325
Kovalchuk O, Titov V, Hohn B, Kovalchuk I (2001) A sensitive transgenic plant system to
detect toxic inorganic compounds in the environment. Nat Biotechnol 19:568-572
97:2940-2945
Kyriakis JM, Avruch J (2001) Mammalian mitogen-activated protein kinase signal trans-
duction pathways activated by stress and inflammation. Physiol Rev 81:807-869
Landry LG, Chapple CC, Last RL (1995) Arabidopsis mutants lacking phenolic sunscreens
exhibit enhanced ultraviolet-B injury and oxidative damage. Plant Physiol 109:1159-
1166
Landry LG, Stapleton AE, Lim J, Hoffman P, Hays JB, Walbot V, Last RL (1997) An
Arabidopsis photolyase mutant is hypersensitive to ultraviolet-B radiation. Proc Natl
Lebel EG, Masson J, Bogucki A, Paszkowski J (1993) Stress-induced intrachromosomal

recombination in plant somatic cells. Proc Natl Acad Sci USA 90:422-426
Liu Y, Gorospe M, Holbrook NJ, Anderson CW (1998) Posttranslational mechanisms lead-
ing to mammalian gene activation in response to genotoxic stress. In: Nickoloff JA,
Hoekstra MF (eds) DNA damage and repair, Vol. 2: DNA repair in higher eukaryotes.
Humana Press Inc., Totowa, NJ, pp 263-298
Liu Y, Gorospe M, Yang C, Holbrook NJ (1995) Role of mitogen-activated protein kinase
phosphatase during the cellular response to genotoxic stress. Inhibition of c-Jun N-
terminal kinase activity and AP-1-dependent gene activation. J Biol Chem 270:8377-
8380
Liu Z, Hall JD, Mount DW (2001) Arabidopsis UVH3 gene is a homolog of the Saccharo-
myces cerevisiae RAD2 and human XPG DNA repair genes. Plant J 26:329-338
Liu Z, Hossain GS, Islas-Osuna MA, Mitchell DL, Mount DW (2000) Repair of UV dam-
age in plants by nucleotide excision repair: Arabidopsis UVH1 DNA repair gene is a
homolog of Saccharomyces cerevisiae Rad1. Plant J 21:519-528
Liu ZG, Baskaran R, Lea-Chou ET, Wood LD, Chen Y, Karin M, Wang JY (1996) Three
distinct signalling responses by murine fibroblasts to genotoxic stress. Nature 384:273-
276
Lucht JM, Mauch-Mani B, Steiner HY, Metraux JP, Ryals J, Hohn B (2002) Pathogen
stress increases somatic recombination frequency in Arabidopsis. Nat Genet 30:311-
314
Marnett LJ, Plastaras JP (2001) Endogenous DNA damage and mutation. Trends Genet
17:214-221
Marshall CJ (1995) Specificity of receptor tyrosine kinase signaling: transient versus sus-
tained extracellular signal-regulated kinase activation. Cell 80:179-185
McClintock B (1984) The significance of responses of the genome to challenge. Science
226:792-801
Melo J, Toczyski D (2002) A unified view of the DNA-damage checkpoint. Curr Opin Cell
Biol 14:237-245
Menand B, Desnos T, Nussaume L, Berger F, Bouchez D, Meyer C, Robaglia C (2002) Ex-
pression and disruption of the Arabidopsis TOR (target of rapamycin) gene. Proc Natl
Mengiste T, Revenkova E, Bechtold N, Paszkowski J (1999) An SMC-like protein is re-
quired for efficient homologous recombination in Arabidopsis. EMBO J 18:4505-4512
Menke M, Chen I, Angelis KJ, Schubert I (2001) DNA damage and repair in Arabidopsis
thaliana as measured by the comet assay after treatment with different classes of
genotoxins. Mutat Res 493:87-93
Miles GP, Samuel MA, Ellis BE (2002) Suramin inhibits oxidant signalling in tobacco sus-
pension-cultured cells. Plant Cell Environ. 25:521-527
Mitsuhara I, Malik KA, Miura M, Ohashi Y (1999) Animal cell-death suppressors Bcl-x(L)
and Ced-9 inhibit cell death in tobacco plants. Curr Biol 9:775-778
Mizoguchi T, Irie K, Hirayama T, Hayashida N, Yamaguchi-Shinozaki K, Matsumoto K,
Shinozaki K (1996) A gene encoding a mitogen-activated protein kinase kinase kinase
is induced simultaneously with genes for a mitogen-activated protein kinase and an S6
ribosomal protein kinase by touch, cold, and water stress in Arabidopsis thaliana. Proc
Moon H, Lee B, Choi G, Shin D, Prasad DT, Lee O, Kwak SS, Kim DH, Nam J, Bahk J,
Hong JC, Lee SY, Cho MJ, Lim CO, Yun DJ (2003) NDP kinase 2 interacts with two
238 Roman Ulm
ple stress tolerance in transgenic plants. Proc Natl Acad Sci USA 100:358-363
Morrow DM, Tagle DA, Shiloh Y, Collins FS, Hieter P (1995) TEL1, an S. cerevisiae ho-
molog of the human gene mutated in ataxia telangiectasia, is functionally related to the
yeast checkpoint gene MEC1. Cell 82:831-840
Nakajima S, Sugiyama M, Iwai S, Hitomi K, Otoshi E, Kim ST, Jiang CZ, Todo T, Britt
AB, Yamamoto K (1998) Cloning and characterization of a gene (UVR3) required for
photorepair of 6-4 photoproducts in Arabidopsis thaliana. Nucleic Acids Res 26:638-
644
Nawrath C, Heck S, Parinthawong N, Metraux JP (2002) EDS5, an essential component of
salicylic acid-dependent signaling for disease resistance in Arabidopsis, is a member of
the MATE transporter family. Plant Cell 14:275-286
Pearce AK, Humphrey TC (2001) Integrating stress-response and cell-cycle checkpoint
pathways. Trends Cell Biol 11:426-433
Perry J, Kleckner N (2003) The ATRs, ATMs, and TORs are giant HEAT repeat proteins.
Cell 112:151-155
Puchta H, Swoboda P, Hohn B (1995) Induction of intrachromosomal homologous recom-
bination in whole plants. Plant J 7:203-210
Ries G, Heller W, Puchta H, Sandermann H, Seidlitz HK, Hohn B (2000) Elevated UV-B
radiation reduces genome stability in plants. Nature 406:98-101
Riha K, Watson JM, Parkey J, Shippen DE (2002) Telomere length deregulation and en-
hanced sensitivity to genotoxic stress in Arabidopsis mutants deficient in Ku70.
EMBO J 21:2819-2826
Rosette C, Karin M (1996) Ultraviolet light and osmotic stress: activation of the JNK cas-
cade through multiple growth factor and cytokine receptors. Science 274:1194-1197
Rotman G, Shiloh Y (1999) ATM: a mediator of multiple responses to genotoxic stress.
Oncogene 18:6135-6144
Rozema J, van de Staaij J, Björn LO, Caldwell M (1997) UV-B as an environmental factor
in plant life: stress and regulation. Trends Ecol Evol 12:22-28
Sachsenmaier C, Radler-Pohl A, Zinck R, Nordheim A, Herrlich P, Rahmsdorf HJ (1994)
Involvement of growth factor receptors in the mammalian UVC response. Cell 78:963-
972
Samuel MA, Ellis BE (2002) Double jeopardy: both overexpression and suppression of a
redox-activated plant mitogen-activated protein kinase render tobacco plants ozone
sensitive. Plant Cell 14:2059-2069
Shaulian E, Karin M (2002) AP-1 as a regulator of cell life and death. Nat Cell Biol
4:E131-136
Shaulian E, Schreiber M, Piu F, Beeche M, Wagner EF, Karin M (2000) The mammalian
UV response: c-Jun induction is required for exit from p53-imposed growth arrest. Cell
103:897-907
Stratmann JW, Stelmach BA, Weiler EW, Ryan CA (2000) UVB/UVA radiation activates a
48 kDa myelin basic protein kinase and potentiates wound signaling in tomato leaves.
Photochem Photobiol 71:116-123
Tena G, Asai T, Chiu WL, Sheen J (2001) Plant mitogen-activated protein kinase signaling
cascades. Curr Opin Plant Biol 4:392-400
Theodosiou A, Ashworth A (2002) MAP kinase phosphatases. Genome Biol
3:REVIEWS3009
Tournier C, Dong C, Turner TK, Jones SN, Flavell RA, Davis RJ (2001) MKK7 is an es-
sential component of the JNK signal transduction pathway activated by proinflamma-
tory cytokines. Genes Dev 15:1419-1426
Tournier C, Hess P, Yang DD, Xu J, Turner TK, Nimnual A, Bar-Sagi D, Jones SN, Flavell
RA, Davis RJ (2000) Requirement of JNK for stress-induced activation of the cyto-
chrome c-mediated death pathway. Science 288:870-874
Tuteja N, Singh MB, Misra MK, Bhalla PL, Tuteja R (2001) Molecular mechanisms of
DNA damage and repair: progress in plants. Crit Rev Biochem Mol Biol 36:337-397
Ulm R, Ichimura K, Mizoguchi T, Peck SC, Zhu T, Wang X, Shinozaki K, Paszkowski J
(2002) Distinct regulation of salinity and genotoxic stress responses by Arabidopsis
MAP kinase phosphatase 1. EMBO J 21:6483-6493
Ulm R, Revenkova E, di Sansebastiano GP, Bechtold N, Paszkowski J (2001) Mitogen-
activated protein kinase phosphatase is required for genotoxic stress relief in Arabi-
dopsis. Genes Dev 15:699-709
Wahl GM, Carr AM (2001) The evolution of diverse biological responses to DNA damage:
insights from yeast and p53. Nat Cell Biol 3:E277-286
Walbot V (1996) Sources and consequences of phenotypic and genotypic plasticity in flow-
ering plants. Trends Plant Sci 1:27-32
Walbot V (1999) UV-B damage amplified by transposons in maize. Nature 397:398-399
Walbot V, Cullis CA (1985) Rapid genomic change in higher plants. Ann Rev Plant
Physiol 36:367-396
West CE, Waterworth WM, Story GW, Sunderland PA, Jiang Q, Bray CM (2002) Disrup-
tion of the Arabidopsis AtKu80 gene demonstrates an essential role for AtKu80 pro-
tein in efficient repair of DNA double-strand breaks in vivo. Plant J 31:517-528
Whittle C-A, Beardmore T, Johnston MO (2001) Is G1 arrest in plant seeds induced by a
p53-related pathway? Trends Plant Sci 6:248-251
Widmann C, Gibson S, Jarpe MB, Johnson GL (1999) Mitogen-activated protein kinase:
conservation of a three-kinase module from yeast to human. Physiol Rev 79:143-180
Yalamanchili RD, Stratmann JW (2002) Ultraviolet-B activates components of the sys-
temin signaling pathway in Lycopersicon peruvianum suspension-cultured cells. J Biol
Chem 277:28424-28430
Yuasa T, Ichimura K, Mizoguchi T, Shinozaki K (2001) Oxidative stress activates
ATMPK6, an Arabidopsis homologue of MAP kinase. Plant Cell Physiol 42:1012-
1016
Zimmermann S, Baumann A, Jaekel K, Marbach I, Engelberg D, Frohnmeyer H (1999)
UV-responsive genes of Arabidopsis revealed by similarity to the Gcn4-mediated UV
response in yeast. J Biol Chem 274:17017-17024
Abbreviations
ATM: Ataxia telangiectasia-mutated

ATR: ATM and Rad3-related
BER: Base excision repair
HR: Homologous recombination
IR: Ionizing radiation
JNK: c-jun amino-terminal protein kinase
240 Roman Ulm
MAPK: Mitogen-activated protein kinase

MKP: MAP kinase phosphatase
MMS : Methyl methanesulfonate
MPK: Mitogen-activated protein kinase (gene name)
NER : Nucleotide excision repair
NHEJ: Non-homologous end-joining
PHR: Photoreactivation
PI3K: Phosphatidylinositol 3-kinase
ROS: Reactive oxygen species
SAPK : Stress-activated protein kinase
SIPK: Salicylic acid-induced protein kinase
TOR: Target of rapamycin
UV: Ultraviolet
WIPK: Wound-induced protein kinase
9 Plant salt tolerance
Viswanathan Chinnusamy and Jian-Kang Zhu
Abstract
Soil salinity adversely affects crop productivity and quality. The success of breed-
ing programs aimed at salinity tolerant crop varieties is limited by the lack of a
clear understanding of the molecular basis of salt tolerance. Recent advances in
genetic analysis of Arabidopsis mutants defective in salt tolerance, and molecular
cloning of these loci, have showed some insight into salt stress signaling and plant
salt tolerance. Salt stress-induced cytosolic calcium signals are perceived by
SOS3, which is a calcium sensor protein. SOS3 is constitutively myristoylated and
associated with the plasma membrane. The SOS3 activates SOS2, a ser/thr protein
kinase, in a calcium dependent manner. The active SOS3-SOS2 kinase complex
activates SOS1, a Na+/H+ antiporter on the plasma membrane and also upregulates
SOS1 gene expression; this results in Na+ efflux and ion homeostasis. Transgenic
analysis showed a tonoplast-located Na+/H+ antiporter mediates sodium sequestra-
tion into the vacuole, and this forms an important part of the salt tolerance mecha-
nism. Evidence also implicates a putative osmosensory histidine kinase (AtHK1)-
MAPK cascade and its negative regulators (AtMKP1) in salt stress signaling that
probably leads to osmotic homeostasis and ROS scavenging. ABA-mediated regu-
lation of stress proteins and plant growth are also important for plant salt toler-
ance, but the signaling pathway is poorly understood.
9.1 Introduction
Soil salinity predates human civilization and is probably a cause of the breakdown
of the ancient Sumerian civilization (Jacobson and Adams 1958). Today salinity
remains a major abiotic stress that adversely affects crop productivity and quality
(Boyer 1982). Saline soil is characterized by toxic levels of chlorides and sulfates
of sodium. The electrical conductivity of saturation extracts of saline soil is more
than 4.0 dS/m (≈ 40mM NaCl; Marschner 1995). The problem of soil salinity is
increasing owing to 1) the use of poor quality water for irrigation, 2) improper
drainage in canal-irrigated wetland agro-ecosystems, 3) entry of seawater during
cyclones in coastal areas, and 4) salt accumulation in the root zone in arid and
semi-arid regions due to high evaporative demand and insufficient leaching of
ions as the rainfall is inadequate.
Sodium is an essential micronutrient for some of the C4 photosynthetic plants,
which import pyruvate into mesophyll chloroplasts by a Na+/pyruvate co-
Topics
Topics in in Current
Current Genetics,
Genetics, Vol.
Vol. 4 4
H.H. Hirt,
Hirt, K.K. Shinozaki
Shinozaki (Eds.)
(Eds.) Plant
Plant stress responses
Responses To Abiotic Stress
©© Springer-Verlag
Springer-Verlag Berlin
Berlin Heidelberg
Heidelberg 2003
2003
242 Viswanathan Chinnusamy and Jian-Kang Zhu
transporter (Ohnishi et al. 1990). However, most crop plants are natrophobic. Sa-
linity is detrimental to plant growth as it causes 1) nutritional constraints by de-
creasing uptake of phosphorus, potassium, nitrate and calcium, 2) ion cytotoxicity
mainly due to Na+, Cl- plus SO4-, and 3) osmotic stress (reviewed by Zhu 2001,
2002). Na+ competes with K+ in biochemical reactions, which is inimical to cellu-
lar processes. Under salinity, ions like Na+ and Cl- penetrate the hydration shells
of proteins and interfere with the non-covalent interactions between amino acids
of proteins. This leads to conformational changes and loss of function of proteins.
Ionic toxicity, osmotic stress, and nutritional defects under salinity may lead to
metabolic imbalances, which result in oxidative stress (Zhu 2001). Plant salt toler-
ance mechanisms can be grouped into 1) cellular homeostasis which includes ion
homeostasis and osmotic adjustment, 2) stress damage control and repair, or de-
toxification, and 3) growth regulation (Zhu, 2001). Considerable efforts have been
made to unravel plant salt tolerance mechanisms with the ultimate goal of improv-
ing the crop productivity in saline soils. Here we discuss molecular and genetic
evidence concerning the perception of salinity stress by plants, cellular signal
transduction, and effectors of salt stress tolerance.
9.2 Sodium entry into plant cells
The membrane potential difference at the plasma membrane of plant cells is -140
mV, which favors passive transport of Na+ into cells, especially with high ex-
tracellular Na+ concentrations. Excess extracellular Na+ enters the cell through
both the transporter HKT1 and non-selective cation channels/transporters, which
results in a decrease in the K+/Na+ ratio in the cytosol. The wheat high affinity K+
transporter HKT1 appears to act as a low affinity Na+ transporter (Rubio et al.
1995; Gorham et al. 1997). Expression of the Arabidopsis homolog of wheat
HKT1 (ATHKT1) in Xenopus oocytes mediated Na+ influx, which suggested that
ATHKT1 might be involved in Na+ influx in plants (Uozumi et al. 2000). Euca-
lyptus EcHKT1 and EcHKT2 when expressed in oocytes showed both Na+ and K+
uptake, but the permeability to Na+ was greater than that for K+ when the extracel-
lular concentration of Na+ and K+ were equal (Liu et al. 2001). These results sug-
gest that in plants in general, HKT1 might be involved in low affinity Na+ influx.
In rice, the contribution of carrier protein-mediated Na+ uptake is less significant
than the apoplastic pathway under high salinity conditions (Yadav et al. 1996;
Garcia et al. 1997). Quantitative trait loci (QTL) and inheritance analysis in rice
revealed that genes that control Na+ uptake are different from that of K+ uptake
(Garcia et al. 1997; Koyama et al. 2001). Silica deposition in the endodermis and
rhizodermis, and the polymerization of silicate via colloidal silica to silica gel or
polysilicic acid throughout the root apoplast, appears to block Na+ uptake through
the apoplastic pathway in the roots of rice (Yeo et al. 1999). Hence, the entry of
Na+ in rice under salinity is expected to be regulated significantly by genes that af-
fect root development and silicon uptake. However, in wheat, sodium/potassium
selectivity by carrier proteins in the root appears to be a major determinant of salt
9 Plant salt tolerance 243
tolerance (Gorham et al. 1997). Thus, the entry of Na+ into plant root cells can be
affected by the regulation of K+/Na+ transporter HKT1 and non-selective cation
channels, and by regulation of genes involved in root development and silicon po-
lymerization-mediated blockage of the apoplastic route. Plant species-specific dif-
ferences and the regulatory mechanism of Na+ entry into plant roots under salinity
need to be understood.
9.3 Input signals of salt stress
Salt stress affects cellular ion homeostasis as well as osmotic homeostasis. Excess
Na+ and Cl- ions may lead to conformational changes in protein structure and/or
changes in the plasma membrane electrical potential, while osmotic stress leads to
turgor loss and cell volume change. Hence, excess ions (Na+ and Cl-) and osmotic
stress-induced turgor change may act as inputs for salt stress signaling. The candi-
date sensors of ionic stress may include ion channels/transporters and ion binding
proteins on the plasma membrane or at intracellular locations (Zhu 2002). Under
High Na+ concentrations, Na+ may enter cells through non-specific ion channels,
which might cause membrane depolarization. A change in membrane polarization
could also signal salt stress, as it is known to activate Ca2+ channels (Sanders et al.
1999). Loss of turgor leads to a cell volume change and retraction of the plasma
membrane from the cell wall. As the membrane retracts from the cell wall, mem-
brane bound receptor kinases, ion transporters/channels, transmembrane proteins
that are in contact with cell wall, and integrin-like proteins may undergo confor-
mational changes or cluster together, and hence these proteins may act as sensors
of osmotic stress. Integrins and the F-actin cytoskeleton have been implicated in
the sensing of cell volume changes in mammalian cells. Regulation of microtubule
organization by turgor pressure was shown in Spirogyra sp. (Iwata et al. 2001).
Microtubules and microfilaments of the cytoskeleton have been implicated in sig-
naling under cold stress in plants (reviewed by Viswanathan and Zhu 2002), and
the pattern of microtubular organization under cold stress differs from that of
ABA (Wang and Nick 2001). Since the cytoskeleton connects different organelles
of the cell with the plasma membrane, it can sense cell volume change under os-
motic stress and transduce it to internal Ca2+ channels or other signaling compo-
nents. Salinity induces the biosynthesis and accumulation of the plant stress hor-
mone abscisic acid (ABA; Jia et al. 2002) and also induces accumulation of
reactive oxygen species (ROS; Smirnoff 1993; Gomez et al. 1999; Hernandez et
al. 2001). Current evidence suggests that the primary salt stress signals (ionic and
osmotic stress) are transduced through Ca2+ as well as receptor kinase pathways,
while the secondary salt stress signals such as ABA and H2O2 also regulate plant
salt tolerance.
9.3.1 Calcium signalling
Cytosolic Ca2+ oscillations, generated from extracellular and/or intracellular Ca2+

stores, act as a second messenger in cold, drought, and salt stresses (Sanders et al.
1999; Knight 2000). Calcium oscillations in plant cells vary, depending upon the
type of stress (Kiegle et al. 2000), rate of stress development (Plieth et al. 1999),
previous experience of stresses/cycles (Knight et al. 1997), and tissue type (Kiegle
et al. 2000). Cytosolic Ca2+ oscillations occur within 5-10 seconds of salt stress,
persist up to 1 to 10 minutes and, hence, are thought to be one of the earliest
events in salt signaling (Lynch et al. 1989; Knight et al. 1997). Therefore, it is es-
sential to analyze how such Ca2+ signatures are generated by a salt stress signal,
and what are the components downstream that decode salt stress-specific Ca2+ sig-
natures.
Cytosolic Ca2+ signatures can be the net result of influx and efflux of Ca2+. Cal-
cium efflux occurs through Ca2+ ATPases and H+/Ca2+ antiporters, while influx is
controlled by Ca2+ permeable ion channels (Sanders et al. 1999). In animal cells,
ligand-gated Ca2+ channels are regulated by inositol (1,4,5)-triphosphate (IP3), cy-
clic adenosine 5’diphosphate ribose (cADPR), and nicotinic acid adenine dinu-
cleotide phosphate (NAADP+). In plants, IP3 and cADPR-gated Ca2+ channels are
found in vacuolar and endoplasmic reticulum membranes (Allen et al. 1995; Wu
et al. 1997), and NAADP-gated Ca2+ channels are found in the endoplasmic re-
ticulum membrane (Navazio et al. 2000). In Arabidopsis, osmotic stress (NaCl or
sorbitol) induces the synthesis of IP3 to significantly higher levels within 1 minute
of stress initiation, and it continues to increase for more than 30 minutes. Phos-
pholipase C (PLC) hydrolyses phosphotidylinositol-4,5 bisphosphate into diacyl
glycerol and IP3, which are activators of protein kinase and calcium channels, re-
spectively. Treatment with U-73122, an inhibitor of PLC, blocked IP3 accumula-
tion. The temporal pattern of IP3 accumulation is similar to that observed for
stress-induced calcium mobilization, implicating IP3 in salt stress-induced Ca2+
signaling (DeWald et al. 2001; Takahashi et al. 2001). In cell cultures of Arabi-
dopsis, a few seconds of osmotic stress (dehydration, mannitol or NaCl) caused a
rapid and transient increase in IP3 and expression of dehydration-inducible genes
(RD29A/LTI78/COR78 & RD17/COR47). This response was abolished when the
cells were treated with inhibitors of PLC, such as neomycin and U73122, indicat-
ing the involvement of PLC and IP3 in hyper-osmotic stress signaling (Takahashi
et al. 2001).
Osmotic stress caused by NaCl/mannitol/sorbitol significantly increases cellular
PtdIns(4,5)P2 synthesis (Pical et al. 1999; DeWald et al. 2001), which is the sub-
strate for cleavage by PLC to produce IP3 (DeWald et al. 2001). Consistent with
this, it has been shown that a PLC gene is also upregulated by osmotic stress (Hi-
rayama et al. 1995). Salt stress-induced phosphatidyInositol (4,5)P2 synthesis and
cleavage into IP3 may help in delayed Ca2+ signaling. Genetic evidence for the
implication of IP3 signaling in abiotic stresses including salinity came from the
analysis of the FRY1 locus of Arabidopsis (Table 1). FRY1 encodes an inositol
polyphosphate 1-phosphatase, which functions in the catabolism of IP3. Upon
ABA treatment, fry1 mutant plants accumulated more IP3 than did the wild type
Table 1. Arabidopsis mutants impaired in salt stress response
Mutant Function Salt tolerance Reference

Salt overly sensitive Ca2+ sensor Hypersensitive Liu and Zhu
3 (sos3) 1998
Salt overly sensitive Protein kinase Hypersensitive Liu et al. 2000
2 (sos2)
Salt overly sensitive Plasma membrane Na+H+ Hypersensitive Shi et al. 2000
1 (sos1) antiporter
Salt overly sensitive pyridoxal kinase Hypersensitive Shi et al. 2002b
4 (sos4)
High affinity K Plasma membrane Na+ Suppresses salt Rus et al. 2001a
transporter 1 transporter sensitivity of sos3
(hkt1) mutant
Fiery1 (fry1) Inositol polyphosphate 1- Hypersensitive Xiong et al.
phosphatase 2001b
Low expression of Molybdenum cofactor Hypersensitive Xiong et al.
osmotically respon- sulfurase 2001a
sive genes 5
(los5)/ABA defi-
cient 3 (aba3)
Low expression of zeaxanthin epoxidase Tolerant during Xiong et al.
osmotically respon- germination 2002a
sive genes 6 (los6)
/ABA deficient 1
(aba1)
SALOBREÑO ABA insensitive 4 Tolerant during Quesada et al.
(sañ5)/abi4 germination 2000
osm1 A protein similar to Hypersensitive to Zhu et al. 2002
SNARE type mammalian salt and osmotic
syntaxins stress
mkp1 MAPK phosphatase 1 Enhanced salt tol- Ulm et al. 2002
erance
photoautotrophic Not yet cloned Enhanced salt tol- Tsugane et al.
salt tolerance1 (pst1) erance 1999
t365 S-adenosyl-L-methionine Hypersensitive Mou et al. 2002
phosphoethanolamine N-
methyltransferase
plants. In wild type, IP3 accumulation was transiently induced by ABA, while in
fry1 IP3 accumulation was sustained, which suggest that IP3 catabolism is medi-
ated by FRY1. The fry1 mutant is hypersensitive to ABA and salinity stress
(Xiong et al. 2001b). The Arabidopsis SAL1 gene, a homolog of FRY1 conferred
increased salt tolerance to yeast cells (Quintero et al. 1996). These results showed
that IP3 transient induced by salt and ABA is necessary for stress tolerance. In ad-
dition to IP3-gated Ca2+ channels, stretch/mechanosensitive Ca2+ channels may
also be involved in primary Ca2+ oscillations (Knight et al. 1997), as these Ca2+
channels can be activated immediately by a change in cell volume/turgor in salt
stressed cells. Hence, salt stress-induced IP3 oscillations are an integral part of
Fig. 1. The SOS pathway for ion homeostasis regulation under salt stress. Salt stress in-
duced Ca2+ signals are perceived by SOS3, which activates the SOS2 kinase. Activated
SOS2 kinase phosphorylates the SOS1 Na+ /H+ antiporter, which then pumps Na+ out of the
cytosol. The SOS3-SOS2 kinase complex also regulates the transcript level of SOS1 and
other genes. The SOS3-SOS2 kinase complex may regulate Na+ compartmentation by acti-
vating NHX1, and also may restrict Na+ entry into the cytosol, e.g. by inhibiting the plasma
membrane Na+ transporter HKT1 activity.
Ca2+ signaling in salt stress. Engineered alterations in intracellular Ca2+ levels due
to overexpression of the Arabidopsis vacuolar Ca2+/H+ antiporter gene (CAX1) in
tobacco (Hirschi 1999), and the ionotrophic glutamate receptor (GluR2) in Arabi-
dopsis (Kim et al. 2001) resulted in hypersensitivity to salt stress and other devel-
opmental abnormalities. This evidence strongly suggests that oscillations in intra-
cellular Ca2+ levels form an integral part of plant salt tolerance.
9.3.2 Calcium sensors
Three major families of calcium binding proteins sense Ca2+ signals in plants (Liu
and Zhu 1998; Harmon et al. 2000): 1) Calmodulins (CaM), which do not have
enzymatic activity but transduce signals to CaM interacting proteins. Calmodulins
contain four EF-hand domains responsible for Ca2+ binding, 2) Calcium dependent
protein kinases (CDPKs), which contain CaM-like Ca2+-binding domains and a
kinase domain in a single protein, and 3) SOS3 and SOS3-like calcium-binding
proteins (SCaBPs) (Liu and Zhu 1998; Guo et al. 2001). The specificity of Ca2+
signals may be achieved by the multiplicity of calcium sensors and their intracel-
lular localization. The first genetic evidence for a calcium sensor protein mediated
Ca2+ signaling in salt stress came from the analysis of the salt overly sensitive 3
(sos3) mutant of Arabidopsis (Table 1, Fig. 1; Liu and Zhu 1998). The SOS3 me-
diated salt stress signaling in cellular ion homeostasis is discussed in the later part
of this review.
The Arabidopsis AtGSK1 gene, which encodes a protein similar to glycogen
synthase kinase3, complemented yeast mutant DHT22-1a that is defective in both
calcineurin (SLN1 and SHO1) genes. Expression of AtGSK1 in the yeast mutant
DHT22-1a also restored salt stress-induced expression of a Na+-ATPase (PMR2A)

gene. Moreover, AtGSK1 is upregulated under ABA and salt stresses in Arabidop-
sis, suggesting the possible involvement of AtGSK1 in phosphoprotein-dependent
salt stress signaling (Piao et al. 1999; Charrier et al. 2002).
The CDPK family of protein kinases contains a myristoylation and a calcium
binding EF hand domain. The Arabidopsis AtCDPK1 and AtCDPK2 genes are in-
duced by salinity and drought but not by low/high temperatures, suggesting that
these two ATCDPKs might be involved in osmotic stress signaling (Urao et al.
1994). The involvement of CDPKs in stress-induced gene transcription was shown
by Sheen (1996) in a maize leaf protoplast system transiently expressing barley
HVA1 promoter-driven synthetic green fluorescent protein. The barley HVA1
gene, encoding a class 3 late embryogenesis-abundant protein, is induced by
abiotic stresses such as drought, cold, heat, salinity, and ABA. Expression of
HVA1-SGFP was significantly increased in the protoplasts incubated with Ca2+
and Ca2+ ionophore (ionomycin or A23187), but not by Ca2+ alone, indicating that
Ca2+ entry is essential for HVA1 expression. Further, maize protoplasts co-
expressing the HVA1-LUC reporter and truncated AtCDPK1 or AtCDPK1a (trun-
cation of the regulatory domain of ATCDPKs results in Ca2+ independent, consti-
tutive protein kinase activity) showed constitutive expression of HVA1::LUC. Mu-
tated AtCDPK1, which lacks ATP binding activity, was unable to induce the
HVA1 promoter. These data indicate that protein kinase activity of AtCDPK1 is
essential to activate the HVA1 promoter. The Ca+ requirement for induction of the
abiotic stress responsive HVA1 promoter in maize protoplasts suggests the in-
volvement of AtCDPK1 in decoding Ca2+ signals under abiotic stresses in plants
(Sheen 1996). Transgenic analysis showed that rice OsCDPK7 is a positive regula-
tor of cold and salt/drought stress signaling. Rice transgenics overexpressing
OsCDPK7 under the control of the CaMV 35S promoter showed enhanced induc-
tion of a stress-responsive gene RAB16A in response to salinity/drought, and
higher salt/drought stress tolerance, while transgenic lines in which OsCDPK7 was
suppressed were hypersensitive to salt/drought stress (Saijo et al. 2000).
The RAB16 (Skriver et al. 1991) and HVA1 (Shen et al. 1996) genes have a G-
box type ABRE cis element, which can be activated by bZIP transcription factors
(Leung and Giraudat 1998). Overexpression of the catalytic domain of ABI1 PP2C
inhibited the induction of HVA1 transcription by ABA and ATCDPK1 (Fig. 2;
Sheen 1996). These results suggest that the upregulation of RAB16 and HVA1 is
mediated by CDPKs, probably through bZIP transcription factors, and is nega-
tively regulated by the PP2C, ABI1. In addition to the activation of LEA-like
genes, CDPKs also regulate transport proteins (aquaporins, ion channels and H+-
ATPase), which play pivotal roles in osmoregulation during osmotic and ionic
stresses (Li et al. 1998; Lino et al. 1998). The Ca2+ requirement for activation of
vacuolar chloride (VCL) and malate transporters in guard cells by CDPK was
overcome by a constitutively active CDPK mutant (Pei et al. 1996).
In the common ice plant, CSP1 (a substrate protein for McCDPK1) was identi-
fied using yeast two-hybrid assays and wheat germ interaction assays. The phos-
phorylation of CSP1 in vitro by McCDPK1 required calcium. The deduced CSP1
amino acid sequence is similar to that of pseudo-response regulator-like proteins
that have a highly conserved DNA binding helix-loop-helix domain and a C-

terminal activation domain. Salt stress induced co-localization of McCDPK1 and
CSP1 in the nucleus of ice plants, but the targets of McCDPK1-CSP1 are not
known (Patharkar and Cushman 2000). This study supports the possible involve-
ment of CDPKs in salt stress signaling, which regulates ion homeostasis and gene
expression.
9.3.3 Hybrid two-component receptor kinases
Two-component systems, consisting of a sensory histidine kinase and a response

regulator, function as osmosensors in bacteria and yeast. The yeast Sln1, a trans-
membrane osmosensory histidine kinase, transfers the phosphoryl group to a His
residue in an intermediary component Ypd1, and finally to an Asp residue in the
response regulator, Ssk1, to inactivate it. High osmotic stress inhibits the auto-
phosphorylation of Sln1 and hence the active non-phosphorylated form of Ssk1
accumulates, which in turn activates the Hog1 (high-osmolarity glycerol response
1) MAPK cascade. This leads to glycerol accumulation and osmoprotection as the
Hog1 MAPK cascade positively regulates genes involved in glycerol biosynthesis.
In addition to Sln1, another transmembrane osmosensor, Sho1, which is not a two-
component system, is also known to regulate the Hog1 MAPK cascade under os-
motic stress. Sln1 and Sho1 operate at different osmotic stress levels (Wurgler-
Murphy and Saito 1997; Chang and Stewart 1998).
These studies gave the impetus to clone an osmosensory hybrid histidine
kinase, ATHK1, from Arabidopsis (Urao et al. 1999). ATHK1 consists of both
kinase and receiver domains in the same molecule, and complements the yeast
mutant sln1-ts defective in osmosensing. Substitution in ATHK1 of the putative
phosphorylation sites, either His within the kinase domain (His-508 to Val) or Asp
within the receiver domain (Asp-1074 to Glu), caused it to fail to complement the
yeast sln1-ts mutant. ATHK1 confers high-osmolarity tolerance to the yeast double
mutant (sln1∆ sho1∆) lacking both osmosensors. This demonstrates that ATHK1
is active at low osmolarity, and is changed to the inactive form in response to high
osmolarity, which activates the Hog1 MAPK pathway in yeast. Thus, ATHK1 has
both structural and functional similarities to the yeast Sln1, suggesting that in
plants ATHK1 acts as an osmosensor to transmit the stress signal to a downstream
MAPK cascade. The transcript abundance of ATHK1 is higher in roots than in
other tissues under control conditions. ATHK1 is upregulated under salt (250 mM
NaCl) and low temperature (4°C) stresses. If the mechanism of osmosensing is a
high osmotic pressure induced conformational change preventing autophosphory-
lation of ATHK1, newly synthesized ATHK1 under stress may be in the non-
phosphorylated state leading to activation of a downstream signaling pathway,
which is probably a MAPK cascade (Fig. 2; Urao et al. 1999).
In Arabidopsis, phosphorelay intermediates with His-containing phosphotrans-
fer domains have been cloned (ATHP1-3). All three ATHPs can complement the
yeast ypd1 mutant, which implies that all ATHPs can transfer a phosphoryl group
from SLN1 to SSK1 in yeast. Further, ATHP3 (=AHP1) transfers a phosphoryl
Fig. 2. Osmotic homeostasis and ROS detoxification under salt stress. Ca2+ signals sensed
by CDPKs are transduced through unknown signaling intermediates, which induce genes
encoding LEA-like proteins. ABA induced Ca2+ signals are perceived by SCaBPs, which
activate PKS. The ABA signaling pathway upregulates osmolyte biosynthesis and genes
encoding LEA-like proteins under salt stress. Ca2+ signaling through CDPKs and SCaBPs is
under negative control of Protein Phosphatase 2C (ABI 1/2). High osmolarity may be per-
ceived by AtHK1, which presumably transduces the signal through a MAPK pathway. Salt
stress and reactive oxygen species (ROS) activated MAPK (ANP1 & AtMEKK1 =
MAPKKK; AtMEK1=MAPKK; AtMPK3, 4 & 6 = MAPK) cascade may regulate oxidative
stress management (Broken arrows indicate unknown signaling intermediates).
group from its His to the receiver domain of the putative two-component response
regulators ARR3 and ARR4 in vitro. Thus, the phosphorelay intermediate,
ATHP3, has the ability to accept a phosphoryl group from the osmosensor,
ATHK1, and transfer its phosphoryl group to a response regulator, ARR4. Al-
though functional complementation in yeast shows that Arabidopsis has ATHK1-
ATHP3-ARR4 as a phosphorelay system (Miyata et al. 1998; Suzuki et al. 1998 &
2001; Urao et al. 1999), the MAPK cascade that transduces the osmotic stress sig-
nal and the target genes regulated by this putative hybrid two-component osmo-
sensor system in higher plants are yet to be identified.
9.3.4 MAPK pathway
A canonical mitogen activated protein kinase (MAPK) module consists of a

MAPK kinase kinase (MAPKKK), which activates a MAPK kinase (MAPKK) by
phosphorylation of Ser or Thr residues (Ser-X-X-X-Ser/Thr) within the catalytic

core. Activated MAPKK activates MAPK by phosphorylation of both Thr and Tyr
within the TXY consensus sequence in MAPK. Plant MAPKs are implicated in
signaling development, cell division, hormones, biotic, and abiotic stresses. Salt
stress quickly (within 5-10 minutes) activates MAPKs from alfalfa (salt stress in-
duced MAPK, SIMK; Munnik et al. 1999), tobacco (salicylic acid induced
MAPK, SIPK; Hoyos and Zhang 2000; Mikolajczyk et al. 2000), and Arabidopsis
(ATMPK3, ATMPK4 and ATMPK6; Mizoguchi et al. 1996; Ichimura et al.
2000). The SIPK is also induced by salicylic acid and osmotic stress. The activa-
tion of SIPK is calcium and ABA independent (Hoyos and Zhang 2000). Alfalfa
SIMK-interacting SIMKK (=MAPKK) was identified using the yeast two hybrid
screen. SIMKK activated SIMK and the activation was enhanced by salinity
(Kiegerl et al. 2000). It appears that SIMK activation by SIMKK does not require
an upstream MAPKKK, and SIMKK transduces both salt and pathogen elicitor
stress signals (Cardinale et al. 2002). Salt stress activates Arabidopsis MAPKKK
(ATMEKK1) and upregulates its gene expression (Ichimura et al. 1998). Co-
expression of ATMEKK1 with MAPKKs (ATMKK2 and MEK1) complemented the
growth defect of the yeast pbs2 mutant, while co-expression of ATMPK4 and
MEK1 complemented growth defects of the yeast mpk1 and bck1 mutants, sug-
gesting that ATMEKK1, ATMKK2/MEK1, and ATMPK4 may constitute a MAP
kinase cascade in Arabidopsis (Fig. 2; Ichimura et al. 1998).
Correlative evidence suggests that the ROS mediated signaling under salt stress
occurs through MAPKs. H2O2 appears to act as an intermediate in ABA signaling
in guard cells (Pei et al. 2000). H2O2 induced oxidation of Cys residues of proteins
may bring conformational changes in signaling intermediates. In Arabidopsis,
H2O2 induces the expression of genes involved in signaling such as calmodulin,
CDPKs, His kinase, Tyr phosphatase, putative protein kinases such as ATMPK3,
and genes involved in transcriptional activation such as Zn finger proteins, heat
shock transcription factor, DREB2A, RING Zn finger protein, myb-related tran-
scription factor, etc. (Desikan et al. 2001). ATMPK6 is activated by osmotic
stresses, cold, and ROS stress imposed by H2O2, KO2, paraquat and 3-amino-
1,2,4-triazole (a catalase inhibitor) in Arabidopsis (Yuasa et al. 2001). An Arabi-
dopsis MAPKKK, ANP1, is activated by H2O2. ANP1 initiates a phosphorylation
cascade involving two MAPKs, AtMPK3 and AtMPK6. Expression of a constitu-
tively active tobacco ANP1 orthologue, NPK1, in transgenic tobacco provided en-
hanced tolerance to multiple environmental stress conditions including salinity,
suggesting that ANP1/NPK1 is involved in oxidative stress signaling under abiotic
stresses (Fig. 2; Kovtun et al. 2000). Constitutively active ANP1 activates the
MAPK cascade that activates promoters of stress-responsive genes such as GST6
and HSP but not RD29A (Kovtun et al. 2000). This indicates that ANP1/NPK1
does not regulate DREB1, DREB2, and bZIP transcription factors, which are tran-
scriptional activators of RD29A and other COR genes.
Nucleoside Diphosphate Kinase participates in hormone-dependent signal
transduction pathways by activating guanine nucleotide-binding proteins involved
in regulation of cell growth and differentiation. Transgenic analysis of NDPK2
(Nucleoside Diphosphate Kinase2) suggests that MAPK signaling regulates the
oxidative stress management and growth regulation under abiotic stresses. The
NDPK2 gene in Arabidopsis (AtNDPK2) is induced by H2O2. Transgenic plants
overexpressing AtNDPK2 accumulated lower levels of ROS, while AtNDPK2 mu-
tants accumulated higher levels of ROS than wild type. AtNDPK2 interacts with
ATMPK3 and ATMPK6. These two MAPKs are activated by H2O2 but this re-
sponse was drastically reduced in an atndpk2 mutant. Transgenic Arabidopsis
overexpressing AtNDPK2 showed an enhanced tolerance to multiple environ-
mental stresses that elicit ROS accumulation, suggests that AtNDPK2 may posi-
tively regulate H2O2-mediated MAPK signaling in plants (Moon et al. 2003).
MAPKs can be inactivated by dephosphorylation. Arabidopsis phosphotyrosine
phosphatase (AtPTP1) inactivates ATMPK4 in vitro (Huang et al. 2000). The
AtPTP1 gene is regulated by abiotic stresses such as drought, heat shock, wound-
ing, high salt, and cold temperature. High salt conditions increased the expression
level of AtPTP1, while cold significantly downregulates the AtPTP1 gene (Xu et
al. 1998). The Arabidopsis mkp1 mutant is resistant to salinity but hypersensitive
to genotoxic stress induced by UV-C and methyl methanesulphonate. MKP1 en-
codes a MAPK phosphatase 1 (MKP1). A yeast two-hybrid screen showed that
MKP1 could interact with three Arabidopsis MAPKs: MPK6, MPK3, and MPK4
and the interaction was strongest with MPK4 (Ulm et al. 2002). These three
MAPKs have been implicated in salt stress signaling (Mizoguchi et al. 1996;
Ichimura et al. 2000). The activity of MPK6 is regulated by MKP1 in vivo. Mutant
analysis revealed that either MKP1 deletion or loss of MKP1 phosphatase activity
results in enhanced salt tolerance. This suggests that MKP1 is a negative regulator
of salt stress signaling through MAPK, while it functions as positive regulator in
genotoxic stress tolerance (Ulm et al. 2002). Microarray analysis showed an in-
creased mRNA level of a putative Na+/H+-exchanger (AT4G23700) gene in the
mkp1 mutant under salt stress (Ulm et al. 2002), which suggests that AT4G23700
may be upregulated by a MAPK cascade that is under the negative control of
MPK1. It is not known whether increased salt tolerance of the mpk1 mutant is due
to increased expression of the putative Na+/H+-exchanger. Overexpression of
SOS1, a plasma membrane Na+/H+-exchanger (Shi et al. 2003) and AtNHX1, a
vacuolar Na+/H+-exchanger (Apse et al. 1999; Zhang and Blumwald 2001; Zhang
et al. 2001) resulted in enhanced salt stress tolerance. The AT4G23700 gene is lo-
cated on chromosome 4 and hence is different from SOS1 (located on chromo-
some 2) and AtNHX1 (located on chromosome 5) (Ulm et al. 2002). This suggests
that a salt stress-responsive MAPK cascade in Arabidopsis may involve ANP1,
MKK1, MPK3, 4, and/or 6, and their negative regulator MKP1(Fig. 2).
9.4 ABA-mediated salt stress signaling
ABA plays an important role in many aspects of plant growth and development
from germination to seed development, and also plays a pivotal role in abiotic
stress resistance. Salt stress induces ABA accumulation and the amount of the in-
crease depends upon the tissue type. In maize, salt stress increased ABA accumu-
lation up to 10-fold in roots but only 1-fold in leaf tissues. Salt stress induced
ABA accumulation appears to be due to both ionic and osmotic stresses in roots,
while that in the leaf is mainly due to osmotic stress (Jia et al. 2002). Turgor loss
caused by osmotic stress leads to ABA synthesis and accumulation, which in turn
regulates part of the cellular response to osmotic stress under salinity. ABA regu-
lates cell water balance through stomatal regulation and genes involved in osmo-
lyte biosynthesis, while it imparts dehydration tolerance through LEA-like genes
(Hasegawa et al. 2000; Shinozaki and Yamaguchi-Shinozaki 2000; Zhu 2002).
ABA signaling for stomatal closure and gene expression is transduced through
Ca2+ (Leung and Giraudat 1998; Schroeder et al. 2001). The importance of ABA
mediated stomatal regulation in salt tolerance was revealed by the analysis of
OSM1 locus of Arabidopsis. Root growth of the Arabidopsis T-DNA insertion
mutant, osm1 (for osmotic stress–sensitive mutant), was hypersensitive to NaCl or
mannitol stress. Molecular cloning revealed that OSM1 encodes a protein similar
to SNARE type mammalian syntaxins (Zhu et al. 2002). SNARE proteins are re-
quired for fusion vesicle trafficking, control membrane Ca2+ and Cl-channel activ-
ity and guard cell volumes (Schroeder et al. 2001). Consistent with this, ABA-
mediated guard cell function is impaired in the osm1 mutant. OSM1 is strongly
expressed in roots and leaf guard cells. The osm1 mutant showed enhanced wilting
and decreased survival when salt or drought stress was imposed on soil grown
plants. Thus, OSM1 plays a critical role in root growth and in ABA regulation of
stomatal responses under osmotic stresses (Zhu et al. 2002).
Osmotic stress responsive genes and ion transporters are regulated by ABA un-
der salt stress. ABA induces several LEA-like stress responsive proteins, which
are known as RD (responsive to dehydration), ERD (early responsive to dehydra-
tion), KIN (cold inducible), and RAB (responsive to ABA). Transient expression
studies in isolated protoplasts showed that IP3 and cADPR gated calcium channels
are involved in ABA induced Ca2+ signatures. The expression of the stress respon-
sive genes RD29A and KIN2 is activated by ABA signaling through Ca2+ (Wu et
al. 1997). ABA induces AtPLC1 expression. Transgenic plants expressing AtPLC1
in antisense and sense orientation showed that ABA induced expression of RD22,
RD29A and KIN2 requires AtPLC1 but it is not sufficient for maximal induction
of stress responsive genes (Sanchez and Chua 2001). The RD29A::LUC reporter
genetic screen facilitated isolation of abiotic stress and ABA signaling mutants in
Arabidopsis (Ishitani et al. 1997). Two of these mutants, los5 and los6, were im-
paired in the expression of stress responsive genes, such as RD29A, COR15A,
COR47, RD22, and P5CS, under salt and osmotic stresses. Salt induced
RD29A::LUC expression was restored to the wild type level by exogenous appli-
cation of ABA. These mutants were also defective in osmotic stress induced ABA
biosynthesis. Molecular cloning revealed that LOS5 encodes a molybdenum cofac-
tor sulfurase, which is allelic to ABA3 (Xiong et al. 2001a), while LOS6 encodes
zeaxanthin epoxidase, which is allelic to ABA1 (Xiong et al. 2002a). These results
demonstrate that stress responsive gene expression under salinity is mediated by
ABA. Salt stress and ABA upregulate a vacuolar Na+/H+ antiporter, AtNHX1,
which was reduced in ABA deficient mutants (aba2-1 and aba3-1), but not in salt
overly sensitive mutants (sos1, sos2 or sos3) mutants. The abi1-1 but not in abi2-1
mutation decreased ABA and salt-induced AtNHX1 expression. AtNHX1 contains

putative ABRE elements between –736 to –728 from the initiation codon. These
results suggest that transcriptional upregulation of AtNHX1 under salt stress is par-
tially dependent on ABA biosynthesis and ABA signaling through the 2C type
protein phosphatase ABI1 (Fig. 2; Shi and Zhu 2002).
ABA-deficient los5/aba3 and los6/aba1 mutants are more tolerant to salt stress
at germination but at the vegetative stage los5/aba3 is hypersensitive to salt stress
(Xiong et al. 2001a & 2002a). Arabidopsis T-DNA insertion mutant sañ5
(SALOBREÑO) is tolerant to osmotic stress (NaCl, KCl, and mannitol) and ABA
during germination. This mutation is allelic to abi4 (Quesada et al. 2000). The
quantitative trait loci (QTL) for the most effective ABA response at germination
were mapped very close to the QTL for salt tolerance in germination (Mano and
Takeda 1997). The QTLs for salt tolerance at germination were different from
those of QTLs controlling salt tolerance at the seedling stage, indicating that salt
tolerance at germination and at the seedling stage are regulated by different
mechanisms (Mano and Takeda 1997; Quesada et al. 2002). Salt sensitivity in
germinating seeds is mainly due to inhibition of germination by salt stress-induced
ABA.
9.5 The SOS signaling pathway of ion homeostasis
Cellular ion homeostasis under salinity is achieved by the following strategies: 1)

Exclusion of Na+ from the cell by plasma membrane-bound Na+/H+ antiporters or
by limiting the Na+ entry, 2) Utilization of Na+ for osmotic adjustment by com-
partmentation of Na+ into the vacuole through tonoplast Na+/H+ antiporters, and 3)
Na+ secretion. Thus, regulation of ion transport systems is fundamental to plant
salt tolerance. Genetic analysis of salt overly sensitive (sos) mutants of Arabidop-
sis, led to the identification of the SOS pathway, which regulates cellular ion ho-
meostasis and salt tolerance (Fig. 1; Zhu 2002).
The Arabidopsis sos3 mutant is hypersensitive to salt stress. Molecular cloning
revealed that the SOS3 encodes a Ca2+ binding protein homologous to the regula-
tory subunit of yeast calcineurin and animal neuronal calcium sensors. It has an N-
myristoylation motif and three calcium binding EF hands. SOS3 senses salt stress-
induced increases in cytosolic Ca2+ concentration in plants (Liu and Zhu 1998;
Ishitani et al. 2000). Myristoylated SOS3 is recruited to the plasma membrane
(Quintero et al. 2002). Mutations that disrupt either myristoylation (G2A) or cal-
cium binding (sos3-1) cause salt stress hypersensitivity to Arabidopsis plants.
Since myristoylation of SOS3 is essential for salt tolerance, it is likely that mem-
brane recruitment of SOS3 is essential for its function. Membrane localization of
SOS3 may help in the regulation of its target ion transporters (Ishitani et al. 2000).
Identification of additional SOS loci (SOS2 and SOS1) revealed that the SOS
pathway regulates cellular ion homeostasis under salt stress. Arabidopsis sos1 and
sos2 mutants are also hypersensitive to salt stress and sos1, sos2, and sos3 muta-
tions do not show an additive effect, implying that they are in the same pathway of
salt stress response. SOS2 is a ser/thr protein kinase with an N-terminal kinase
catalytic domain and a C-terminal regulatory domain. The SOS2 C-terminal regu-
latory domain consists of the SOS3-binding, autoinhibitory FISL motif (Liu et al.
2000). Binding of SOS3 activates the SOS2 protein kinase (Halfter et al. 2000).
Deletion of the FISL motif from SOS2 leads to constitutive activation of the
kinase (Guo et al. 2001). Molecular genetic analysis of the sos1 mutant led to the
identification of a target for the SOS3-SOS2 kinase complex. SOS1 encodes a
plasma membrane Na+/H+ antiporter (Shi et al. 2000). The sos1 mutant accumu-
lates high levels of Na+ in tissues under salt stress, and isolated plasma membrane
vesicles from sos1 mutants showed significantly less Na+/H+ exchange activity
than the wild type, suggesting that the SOS1 Na+/H+ antiporter is located on the
plasma membrane (Qiu et al. 2002). The sos3 and sos2 mutants accumulate higher
levels of Na+ than wild type plants. Isolated plasma membranes vesicles from
these mutants also showed significantly less Na+/H+ exchange activity, and this
could be restored to the wild type levels by the addition of activated SOS2. The
SOS3-SOS2 kinase complex activates SOS1 by phosphorylation (Quintero et al.
2002). SOS1 complemented yeast mutants defective in Na+ transporters. Co-
expression of SOS2 and SOS3 significantly increased SOS1-dependent Na+ toler-
ance of the yeast mutant (Quintero et al. 2002). These results show that SOS1 is a
Na+/H+ antiporter involved in Na+ efflux, which is activated by the SOS3-SOS2
kinase complex (Fig.1 1; Qiu et al. 2002; Quintero et al. 2002). Constitutive ex-
pression of a CaMV 35S promoter driven active form of SOS2 could rescue sos2
and sos3 mutants under salt stress (Xiong et al. 2002b).
The expression of SOS1 is stronger in cells bordering the xylem. Under salt
stress (100 mM NaCl), a higher concentration of Na+ accumulates in shoots of
sos1 mutants than in those of the wild type. These results suggest that SOS1 might
retrieve Na+ from the xylem, thereby preventing excess Na+ accumulation in the
shoot (Shi et al. 2002a). Transgenic Arabidopsis plants overexpressing SOS1
showed improved salt tolerance and accumulated less Na+ in the xylem transpira-
tional stream as well as in the shoot compared to the wild type plants. This dem-
onstrated that Na+ efflux from the root cells and long distance Na+ transport within
the plant under salt stress are regulated by SOS1 (Shi et al. 2003), which in turn is
regulated by the SOS3-SOS2 kinase complex. In addition to the activation of
Na+/H+ antiporter activity of SOS1, SOS3-SOS2 kinase complex also is involved
in salt stress induced upregulation of SOS1 expression (Fig. 1; Shi et al. 2000). In
the sos3 mutant salt, stress could not induce SOS1 expression, while the sos2 mu-
tant is impaired in SOS1 expression only in roots, but not in shoots. Interestingly,
SOS1 overexpressing transgenic Arabidopsis showed a significantly higher steady
state level of SOS1 mRNA under salt stress than that grown under normal condi-
tions. Since SOS1 was overexpressed under the control of the CaMV 35S pro-
moter, its higher mRNA abundance under salt stress might be due to an increase in
SOS1 transcript stability (Shi et al. 2003).
In addition to positive control of Na+ exclusion from the cytosol, the SOS
pathway may also negatively regulate Na+ influx systems. Expression of plant
high affinity K+ transporters, AtHKT1, EcHKT1, and EcHKT2, in Xenopus laevis
oocytes showed that they could mediate Na+ uptake. Transgenic wheat plants ex-
pressing the wheat HKT1 in antisense orientation under control of a ubiquitin

promoter showed significant downregulation of the native HKT1 transcript. These
lines showed significantly less 22Na uptake and enhanced growth under salinity
when compared with the control (Laurie et al. 2002). These results suggest that
HKT1 mediates sodium uptake under salinity, and salt tolerance can be improved
by downregulation of HKT1 expression. Consistent with this observation, a sup-
pressor genetic screen for the sos3 mutation revealed that functional disruption of
AtHKT1 could suppress the salt-sensitive phenotype of sos3. In addition, the
athkt1 mutation alleviates the K+-deficient phenotype of the sos3 mutant (Rus et
al. 2001a), which suggests that the K+-deficient phenotype of the sos3 mutant
might be due to an excess of cytoplasmic Na+, as sos3 impairs the Na+ efflux me-
diated by SOS1. These results suggest that ATHKT1 might function as low affin-
ity Na+ transporter that is involved in Na+ influx under salinity. Significant
amounts of Na+ enter plant roots through voltage independent channels, which are
probably regulated by Ca2+ concentrations (Tyerman and Skerret 1999). We do
not know whether activity of these channels and their gene expression are also
regulated by the calcium dependent SOS3-SOS2 kinase complex. Thus, the SOS3-
SOS2 kinase complex positively regulates Na+ efflux by activating SOS1 and
upregulating the SOS1 transcript level, and may negatively regulate Na+ influx by
downregulating low affinity Na+ transporter (HKT1) genes to restore cellular ion
homeostasis under salt stress in plants (Fig. 1; Zhu 2002)
9.6 Osmotic stress management
Plant survival depends on maintaining a positive turgor, which is indispensable for

expansion growth of cells and stomatal opening. A decrease in water availability
under soil salinity causes osmotic stress, which leads to decreased turgor. Osmotic
adjustment is one of the vital cellular tolerance process to osmotic stress, con-
served in both halophytic and glycophytic plants. Osmotic stress may induce ion
(Na+ & K+) uptake and compartmentalization into the vacuole, and synthesis of
organic compatible solutes such as proline, betaine, polyols, and soluble sugars.
Use of ions for osmotic adjustment may be energetically more favorable than or-
ganic osmolyte biosynthesis under stress, as ion uptake and sequestration into the
vacuole may cost only 3-4 moles of ATP compared with the 30-50 moles of ATP
needed for synthesis of one mole of organic osmolytes (Raven 1985).
9.6.1 Sodium sequestration into the vacuole
Cytoplasmic ion homeostasis by exclusion of excess Na+ from the cytoplasm may
necessitate the plant to synthesize compatible osmolytes to reduce the osmotic po-
tential, which is required for water uptake under salt stress. Hence, compartmenta-
tion of Na+ in the vacuole is an important strategy for plants, to maintain a lower
Na+ concentration at the sites of biochemical reactions in the cytosol, and yet
maintain a lower overall osmotic potential. Active transport of solutes across bio-
logical membranes utilizes the electrochemical gradient generated by P-type H+-
ATPases (plasma membrane H+-ATPases), V-type H+-ATPases (vacuolar H+-
ATPase) and H+-pyrophosphatase (vacuolar H+-PPase). The sodium efflux plasma
membrane Na+/H+ antiporters use a proton electrochemical gradient generated by
the plasma membrane H+-ATPase, which is upregulated under salinity. A salt-
tolerant mutant of rice showed higher induction of the plasma membrane H+-
ATPase gene OSA3 in roots than that of the wild type (Zhang et al. 1999). Influx
of Na+ into the vacuole occurs through Na+/H+ antiporters, which use the proton
gradient generated by V-type H+-ATPase and H+-PPase (Apse et al. 1999). Thus,
Na+ sequestration into the vacuole depends upon the expression and activity of
Na+/H+ antiporters as well as V-type H+-ATPase and H+-PPase. Salinity upregu-
lates the expression of a V-type H+-ATPase gene (Golldack and Dietz 2001) and a
vacuolar Na+/H+ antiporter gene (Gaxiola et al. 1999; Shi and Zhu 2002). To in-
vestigate the role of tonoplast H+-PPase in salinity tolerance, the AVP1 gene
(vacuolar H+-pyrophosphatase) was overexpressed in Arabidopsis. The transgen-
ics showed increased sequestration of Na+ into the vacuole, maintained higher
relative water content in leaves and were more tolerant to salt and drought stress
than the wild type was (Gaxiola et al. 2001).
In Arabidopsis, the AtNHX1 gene encodes a tonoplast Na+/H+ antiporter. Ex-
pression of AtNHX1 in the yeast nhx1 mutant suppressed some of the mutant phe-
notypes. Salinity induces NHX1 expression in Arabidopsis (Gaxiola et al. 1999;
Shi and Zhu 2002) and rice (Fukuda et al. 1999). Transgenic Arabidopsis plants
that overexpress AtNHX1 showed significantly higher salt tolerance than wild type
plants (Apse et al. 1999). Similarly, transgenic tomato and canola (Brassica
napus) plants overexpressing AtNHX1 accumulated high concentrations of sodium
in leaves but not in fruits/seeds. These transgenics were shown to be highly toler-
ant to salt stress at the same time they maintained the quality of fruit in tomato and
oil in canola (Zhang and Blumwald 2001; Zhang et al. 2001). These studies con-
firm that sequestration of Na+ into the vacuole is an important trait of salt tolerance
in plants.
9.6.2 K+ Uptake
Plants maintain a high cytosolic K+/Na+ ratio under optimal conditions. Salt stress
induced decrease in the K+/Na+ ratio is inimical to cellular biochemical processes.
In addition to this, K+ provides necessary osmotic potential for water uptake by
plant cells (Keller and Van Volkenburgh 1996; Claussen et al. 1997). Thus, K+ up-
take is pivotal for cell turgor and maintenance of biochemical processes under sa-
linity. In plants, Na+ competes with K+ for uptake under saline conditions. The
Mesembryanthemum crystallinum K+ transporter genes, McHAK1 and McHAK2,
are upregulated under K+ starvation and NaCl stress in both roots and leaves (Su et
al. 2002). Low K+ concentration in the growth medium inhibits the growth of sos
mutants. The sos3 mutant could be rescued by increasing Ca2+ in a low K+ me-
dium (Zhu et al. 1998). Hence, expression of transport systems specific for K+ up-
take might help in maintaining ionic balance.
Overexpression of AtHAL3a (a regulator of K+ transport) in yeast and Arabi-
dopsis conferred increased salt tolerance (Espinosa-Ruiz et al. 1999), as did trans-
genic melon plants expressing the HAL1 gene (Bordás et al. 1997). To investigate
the role of HAL1 in vivo, tomato plants were engineered to overexpress the yeast
HAL1 gene. This transgenic plant showed increased K+ accumulation under NaCl
stress (Rus et al. 2001b). Transgenics showed better salt tolerance than the control
plants (Gisbert et al. 2000; Rus et al. 2001b), suggesting that K+ accumulation is
an important trait of salt tolerance. Further, the Arabidopsis sos4 mutant defective
in the pyridoxal kinase gene showed hypersensitive-root growth under NaCl and
KCl stresses and accumulated more Na+ but less K+. Pyridoxal-5-phosphate and
its derivatives act as ligands for P2X receptor ion channels in animals. ATP is re-
quired for K+ channel activity and a cyclic nucleotide-binding site is required for
K+ channel (KAT1) function. Thus regulation of K+ and Na + channels or trans-
porters by pyridoxal-5-phosphate and its derivatives may be important in plant salt
tolerance (Table 1; Shi et al. 2002b)
9.6.3 Osmoprotectant biosynthesis
Organic compatible solutes/osmoprotectants protect plants from stress by (1) os-

motic adjustment which helps in turgor maintenance (2) detoxification of reactive
oxygen species and (3) stabilization of the quaternary structure of proteins
(Yancey et al. 1982; Bohnert and Jensen 1996). Genes involved in osmoprotectant
biosynthesis are upregulated under salt and drought stresses (Zhu 2002; Xiong et
al. 2001a). Enhanced tolerance to salt stress was observed in transgenic plants en-
gineered to over-accumulate mannitol (Tarczynski et al. 1993; Karakas et al.
1997; Sheveleva et al. 1997; Shen et al. 1997), glycine betaine (Holmstrom et al.
2000; Hayashi et al. 1997; Sakamoto et al. 1998; Kishitani et al. 2000; Prasad et
al. 2000), and proline (Kishor et al. 1995; Zhu et al. 1998; Nanjo et al. 1999; Hong
et al. 2000). Transgenic rice plants expressing a peroxisomal betaine aldehyde de-
hydrogenase of barley accumulated fewer Na+ and Cl - ions and more K+ ions (Ki-
shitani et al. 2000).
Further evidence for the involvement of osmoprotectants in salt tolerance came
from analysis of the Arabidopsis mutant, t365, in which the S-adenosyl-L-
methionine phosphoethanolamine N-methyltransferase (PEAMT) gene is silenced
(Table 1). The PEAMT protein catalyzes all three methylation steps required to
convert phosphoethanolamine to phosphocholine, which is a precursor of choline
biosynthesis. Some plants synthesize the osmoprotectant glycinebetaine from cho-
line. The t365 mutants produced significantly less choline and showed hypersensi-
tivity to salinity in addition to temperature-sensitive male sterility (Mou et al.
2002), which supports the importance of osmoprotectant in salt tolerance. The ec-
topic expression studies showed that osmoprotectants increase salt stress tolerance
mainly by protection of membranes and proteins against reactive oxygen species
(ROS) rather than by increasing osmotic adjustment. ABA regulates the P5CS
gene involved in proline biosynthesis under osmotic stress (Xiong et al. 2001a). A
signaling cascade similar to that of the yeast MAPK HOG1 pathway may also
regulate osmolyte biosynthesis.
9.7 Stress damage control and repair
9.7.1 Salt stress induced proteins
In higher plants, osmotic stress induces several proteins in vegetative tissues,

which are related to late-embryogenesis-abundant (LEA) proteins. The correlation
between LEA protein accumulation in vegetative tissues and stress tolerance in
various plant species indicates its protective role under dehydration stress (re-
viewed by Ingram & Bartels 1996). Engineered rice plants overexpressing a barley
LEA gene, HVA1, under control of the rice actin 1 promoter showed better stress
tolerance under 200 mM NaCl and drought stress than did the wild type (Xu et al.
1996). Arabidopsis LEA-like stress proteins are encoded by COR genes (RD29A,
COR47, COR15, KIN1, KIN2) which are induced by cold, dehydration (due to wa-
ter deficit or high salt), or ABA. Promoter analysis of the COR genes showed that
many of them contain dehydration responsive elements (DRE) or C-Repeat
(CRT), as well as ABA-responsive elements or ABREs. Transcription factors that
regulate the LEA-like genes include CBFs (C-repeat Binding Proteins, also known
as Dehydration Responsive Element Binding Proteins, DREBs) and bZIP proteins.
The expression of COR genes is regulated by both ABA dependent and independ-
ent pathways (Ishitani et al. 1997; Shinozaki and Yamaguchi-Shinozaki 2000).
Constitutive overexpression of CBF3 or stress induced expression of CBF3 driven
by the RD29A promoter resulted in enhanced expression of COR genes under
cold, dehydration, and salt stresses in transgenic Arabidopsis and also conferred
higher osmotic stress tolerance (Kasuga et al. 1999). CBF3-overexpression in
Arabidopsis also resulted in elevated accumulation of proline and total soluble
sugars, including sucrose, raffinose, glucose, and fructose. The increase in proline
levels was due to increased expression of the key proline biosynthetic enzyme ∆1-
pyrroline-5-carboxylate synthase (Gilmour et al. 2000). Thus, LEA-like proteins
appear to protect plants under salt stress. Osmotic or salt stress-induced calcium
signals may activate the LEA-like genes through DREB2 transcription factors,
while salt stress induced ABA accumulation appears to induce the genes through
ABA responsive element binding factors (Xiong et al. 2002b; Zhu 2002).
The Alfin1 gene of Medicago sativa encodes a member of the zinc-finger fam-
ily transcription factors, and its expression is correlated with NaCl tolerance
(Winicov and Bastola 1999; Winicov 2000). In vitro, Alfin1 binds to the promoter
of MsPRP2, which encodes a salt stress inducible root-specific cell wall protein.
The Alfin1 gene appears to be conserved in alfalfa, rice, and Arabidopsis. The role
of Alfin1 in salt stress tolerance was examined in transgenic alfalfa expressing Al-
fin1 driven by the CaMV 35S promoter in the sense and antisense orientations. Al-
though overexpression lines did not show any growth defect, the antisense trans-
genic plants grew poorly in soil in a normal environment, demonstrating that Al-
fin1 expression is essential for normal plant development. Alfin1 overexpression
enhanced the root growth significantly both under normal and saline conditions,
while the antisense plants showed poor root growth (Winicov and Bastola 1999;
Winicov 2000). The tobacco-stress-induced-gene 1 (Tsi1) encodes a DNA-binding
protein with an EREBP/AP2 DNA binding motif, which is involved in defense-
and drought-responsive gene expression. Tsi1 gene expression was rapidly in-
duced by salt stress but not by drought or ABA. Overexpression of TSI1 in tobacco
enhanced retention of chlorophyll content when the leaves were floated on 400
mM NaCl solution for 48 or 72 hr (Park et al. 2001). Further studies are needed to
assess the role of Alfin1 and TSI1 in salt stress tolerance, as it is not clear at pre-
sent whether these proteins and their targets are involved in ion/osmotic homeo-
stasis or in detoxification.
9.8 Oxidative stress management
Reactive oxygen species (ROS) namely, superoxide radicals (O2.–), hydrogen per-
oxide (H2O2), and hydroxyl radicals (OH.) are produced in aerobic cellular proc-
esses such as mitochondrial and chloroplast electron transport, or oxidation of gly-
colate (photorespiration), xanthine, and glucose. Due to metabolic disturbance
under stress conditions, ROS production increases under abiotic stresses including
salinity (Smirnoff 1993; Gomez et al. 1999; Hernandez et al. 2001). The ROS
causes oxidative damage to membrane lipids, proteins and nucleic acids. Hence,
ROS detoxification forms an important defense against abiotic stresses. The anti-
oxidants employed by plants are ascorbate, glutathione, -tocopherol, and carote-
noids. Detoxifying enzymes include superoxide dismutase (SOD), catalase, and
enzymes of the ascorbate- glutathione cycle. The Arabidopsis salt tolerant mutant
pst1 (for photoautotrophic salt tolerance1) is more tolerant to oxidative stress than
is the wild type (Table 1). The pst1 mutant did not differ in proline accumulation
or monovalent cation (sodium, potassium) accumulation when compared to the
wild type. Under salt stress, the pst1 mutant showed significantly higher activity of
superoxide dismutase and ascorbate peroxidase than that of wild type Arabidopsis
(Tsugane et al. 1999). Overexpressing the tobacco NtGST/GPX gene (encoding an
enzyme with both glutathione S-transferase and glutathione peroxidase activity) in
transgenic tobacco plants improved salt and chilling stress tolerance due to en-
hanced ROS scavenging and prevention of membrane damage (Roxas et al. 1997;
Roxas et al. 2000). Transgenic tobacco plants expressing the constitutively active
MAPKKK, ANP1, show an activated MAPK cascade that activates the glutathione
S-transferase 6 (GST6) gene promoter. These transgenic plants were also tolerant
to salt and other abiotic stresses (Kovtun et al. 2000). Components of MAPK cas-
cades are activated by ROS and salinity as discussed earlier. Thus, it appears ROS
management under salt stress through the induction of genes encoding antioxidant
enzymes may be controlled by a MAPK signaling cascade (Fig. 2).
9.9 Growth regulation
Maintenance of root growth at low water potential is an adaptive trait of osmotic

stress tolerance. In maize roots, salt stress increased ABA accumulation up to 10-
fold (Jia et al. 2002). Root elongation at low water potential might be achieved by
an increase in the activity of the putative wall loosening enzyme xyloglucan en-
dotransglycosylase (Wu et al. 1994) and proline accumulation (Ober and Sharp
1994), which are regulated by ABA.
Root elongation at low water potential was impaired in the vp5 mutant, or by a
chemical inhibitor of ABA biosynthesis (fluridone) in maize. However, this could
be restored by treatment of roots with a chemical that inhibits ethylene biosynthe-
sis or action. Moreover, treatment of seedlings with fluridone resulted in an in-
crease in the rate of ethylene production. These data suggested that ABA-mediated
root cell elongation under osmotic stress might be due to its inhibition of ethylene
biosynthesis (Spollen et al. 2000).
In Arabidopsis, a null allele of the Gα gene impaired cell division (Ullah et al.
2001) and ABA inhibition of stomatal closure (Wang et al. 2001). A loss-of-
function allele of another ABA signaling locus encoding a SNARE protein, osm1,
also showed impaired root growth under salt and osmotic stress (Zhu et al. 2002).
This suggests that ABA may regulate cell division under osmotic stress. Consis-
tent with this, the transcripts of a cyclin-dependent kinase (AtCDC2a) and two mi-
totic cyclin (AtCycB1 and AtCycA2) genes were diminished initially but induced
subsequently in the shoot apex during salt stress adaptation (Burssens et al. 2000).
SIMK is activated and translocated into the nucleus in suspension-cultured alfalfa
cells under salt stress (Baluska et al. 2000). In the root elongation zone, epidermal
cells contained much higher SIMK protein than in cortex cells. SIMK showed a
cell cycle phase-dependent localization, being predominantly nuclear in interphase
but associating with the cell plate and the newly formed cell wall in telophase and
early G1 phase (Baluska et al. 2000). It is not clear whether cell divi-
sion/elongation is regulated through MAPK signaling under salt stress.
In the root tips of Arabidopsis, AtCDC2a, AtCycA2 and AtCycB1 expression
were diminished concomitant with inhibition of root growth under salt stress
(Burssens et al. 2000). The activity of CDC2a is negatively regulated by a cyclin-
dependent protein kinase inhibitor, ICK1. The expression of ICK1 is upregulated
by ABA in Arabidopsis (Wang et al. 1998). The knowledge of tissue- and plant
species-specific regulation of cell division/elongation by ABA under salt stress is
still in its infancy.
9.10 Conclusions and perspectives
Although a salt stress sensor is yet to be identified, some of the components of salt
stress signaling and plant salt tolerance are known today. Genetic evidence dem-
onstrated that a salt stress induced calcium signal is transduced at least in part
through the SOS3-SOS2 kinase complex, which activate SOS1, a plasma mem-
brane Na+/H+ antiporter. In addition, the SOS3-SOS2 kinase complex positively

regulates the SOS1 transcript level. Correlative evidence implicates the involve-
ment of a putative osmosensory histidine kinase (AtHK1) and a MAPK cascade in
osmoprotectant biosynthesis under salt stress. Responses to ion toxicity, osmotic
stress and oxidative stress may be integrated by signaling pathways including
MAPK and its negative regulator MAPK phosphatase. Except for the SOS path-
way, salt stress signaling pathways are not yet understood in terms of their com-
ponents and targets. Moreover, the evidence summarized here is mainly derived
from studying Arabidopsis, a glycophytic plant and hence further analysis of salt
tolerance mechanisms in halophytic plants is also warranted. Characterization of
chloride and sulfate transporters and their regulation under salt stress is also the
need of the hour. Salt tolerance varies with plant development, and it is imperative
to understand the tissue and developmental specificity of salt stress tolerance.
Availability of whole genome sequences in Arabidopsis and rice, as well as the
use of microarrays to analyze the transcriptome response will facilitate the identi-
fication of genes involved in salt tolerance, which can be validated by RNA inter-
ference and/or T-DNA/transposon/EMS mutational studies. Continued genetic and
biochemical dissection of salt tolerance in the near future may provide us a clear
picture of salt tolerance in plants, which will help to engineer agronomically use-
ful salt tolerant crop varieties.
Acknowledgements
Our work has been supported by grants from United States Department of Agri-
culture – National Research Initiative, Binational Agricultural Research and De-
velopment Fund, Southwest Consortium on Plant Genetics and Water Resources,
National Science foundation, and National Institutes of Health. We are thankful
to Prof. André Jagendorf, Department of Plant Biology, Cornell University, for his
critical reading of the manuscript and suggestions.
References
Allen GJ, Muir SR, Sanders D (1995) Release of Ca2+ from individual plant vacuoles by
InsP3 and cyclic ADP-ribose. Science 268:735-737
Apse MP, Aharon GS, Snedden WS, Blumwald E (1999) Salt tolerance conferred by over-
expression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 285:1256-1258
Baluska F, Ovecka M, Hirt H (2000) Salt stress induces changes in amounts and localiza-
tion of the mitogen-activated protein kinase SIMK in alfalfa roots. Protoplasma
212:262-267
Bohnert HJ, Jensen RG (1996) Strategies for engineering water stress tolerance in plants.
Trends in Biotechnol 14:89–97
Bordas M, Montesinos C, Dabauza M, Salvador A, Roig V, Serrano R, Moreno V (1997)

Transfer of the yeast salt tolerance gene HAL1 to Cucumis melo L. cultivars and in vi-
tro evaluation of salt tolerance. Transgenic Research 6:41-50
Boyer JS (1982) Plant productivity and environment. Science 218:443-448
Burssens S, Himanen K, Van B, Beeckman T, Van M, Inze D, Verbruggen N (2000) Ex-
pression of cell cycle regulatory genes and morphological alterations in response to
salt stress in Arabidopsis thaliana. Planta 211: 632-640
Cardinale H, Meskiene I, Ouaked F, Hirt H (2002) Convergence and divergence of stress-
induced mitogen-activated protein kinase signaling pathways at the level of two dis-
tinct mitogen-activated protein kinase kinases. Plant Cell 14:703-711
Chang C, Stewart RC (1998) The two-component system. Plant Physiol 117:723-731
Charrier B, Champion A, Henry Y, Kreis M (2002) Expression profiling of the whole
Arabidopsis shaggy-like kinase multigene family by real-time reverse transcriptase-
polymerase chain reaction. Plant Physiol 130:577-590
Claussen M, Luthen H, Blatt M, Bottger M (1997) Auxin induced growth and its linkage to
potassium channels. Planta 201:227-234
Desikan R, Mackerness SA-H, Hancock JT, Neill SJ (2001) Regulation of the Arabidopsis
DeWald DB, Torabinejad J, Jones CA, Shope JC, Cangelosi AR, Thompson JE, Prestwich
GD, Hama H (2001) Rapid accumulation of phosphatidylinositol 4,5-bisphosphate and
inositol 1,4,5-trisphosphate correlates with calcium mobilization in salt-stressed
Arabidopsis. Plant Physiol. 126:759-769
Espinosa-Ruiz A, Belles JM, Serrano R, Culianez-Macla V (1999) Arabidopsis thaliana
AtHAL3: a flavoprotein related to salt and osmotic tolerance and plant growth. Plant J
20:529-39
Fukuda A, Nakamura A, Tanaka Y (1999) Molecular cloning and expression of the Na+/H+
exchanger gene in Oryza sativa. Biochim Biophys Acta 1446:149-155
Garcia A, Rizzo CA, Ud-Din J, Bartos SL, Senadhira D, Flowers TJ, Yeo AR (1997) So-
dium and potassium transport to the xylem are inherited independently in rice and the
mechanism of sodium:potassium selectivity differs from rice and wheat. Plant Cell
Environ 20:1167-1174
Gaxiola RA, Li J, Undurraga S, Dang V, Allen GJ, Alper SL, Fink GR (2001) Drought- and
salt-tolerant plants result from overexpression of the AVP1 H+-pump. Proc Natl Acad
Sci USA 98:11444-11449
Gaxiola RA, Rao R, Sherman A, Grisafi P, Alper SL, Fink GR (1999) The Arabidopsis
thaliana proton transporters, AtNhx1 and Avp1, can function in cation detoxification
in yeast. Proc Natl Acad Sci USA 96:1480-1485
Gilmour SJ, Sebolt AM, Salazar MP, Everard JD, Thomashow MF (2000) Overexpression
of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical
changes associated with cold acclimation. Plant Physiol 124:1854-1865
Gisbert C, Rus AM, Bolarín MC, López-Coronado JM, Arrillaga I, Montesinos C, Caro M,
Serrano R, Moreno V (2000) The Yeast HAL1 gene improves salt tolerance of trans-
genic tomato. Plant Physiol 123:393-402
Golldack D, Dietz KJ (2001) Salt-induced expression of the vacuolar H+-ATPase in the
common ice plant is developmentally controlled and tissue specific. Plant Physiol
125:1643-1654
Gomez JM, Hernandez JA, Jimenez A, del Rio LA, Sevilla F (1999) Differential response
of antioxidative enzymes of chloroplast and mitochondria to long term NaCl stress of
pea plants. Free Radic Res 31:S11-S18.
Gorham J, Bridges J, Dubcovsky J, Dvorak J, Hollington PA, Luo MC, Khan JA (1997)
Genetic analysis and physiology of a trait for enhanced K+/Na+ discrimination in
wheat. New Phytol 137:109-116
Guo Y, Halfter U, Ishitani M, Zhu J-K (2001) Molecular characterization of functional do-
mains in the protein kinase SOS2 that is required for plant salt tolerance. Plant Cell
13:1383-1400
Halfter U, Ishitani M, Zhu J-K (2000) The Arabidopsis SOS2 protein kinase physically in-
teracts with and is activated by the calcium-binding protein SOS3. Proc Natl Acad Sci
USA 97:3735-3740
Harmon AC, Gribskov M, Harper JF (2000) CDPKs-A kinase for every Ca2+ signal?
Hasegawa PM, Bressan RA, Zhu J-K, Bohnert HJ (2000) Plant cellular and molecular re-
sponses to high salinity. Annu Rev Plant Mol Plant Physiol 51:463-499
Hayashi HA, Mustardy L, Deshnium P, Ida M, Murata N (1997) Transformation of Arabi-
dopsis thaliana with the codA gene for choline oxidase: accumulation of glycine be-
taine and enhanced tolerance to salt and cold stress. Plant J 12:133-142
Hernández JA, Ferrer MA, Jiménez A, Barceló AR, Sevilla F (2001) Antioxidant systems
and O2.-/H2O2 production in the apoplast of pea leaves. Its relation with salt-induced
necrotic lesions in minor veins. Plant Physiol 127:817 – 831
Hirschi KD (1999) Expression of Arabidopsis CAX1 in tobacco: altered calcium homeosta-
sis and increased stress sensitivity. Plant Cell 11:2113-2122
Holmstrom KO, Somersalo S, Mandal A, Palva TE, Welin B (2000) Improved tolerance to
salinity and low temperature in transgenic tobacco producing glycine betaine. J Exp
Bot 51:177-185
Hong Z, Lakkineni K, Zhang Z, Verma DPS (2000) Removal of feedback inhibition of 1-
pyrroline-5-carboxylate synthetase results in increased proline accumulation and pro-
tection of plants from osmotic stress. Plant Physiol 122:1129-1136
Hoyos ME, Zhang S (2000) Calcium-independent activation of salicylic acid-induced pro-
tein kinase and a 40-kilodalton protein kinase by hyperosmotic stress. Plant Physiol
122:1355-1364
Huang Y, Li H, Gupta R, Morris PC, Luan S, Kieber JJ (2000) ATMPK4, an Arabidopsis
homolog of mitogen-activated protein kinase, is activated in vitro by AtMEK1 through
threonine phosphorylation. Plant Physiol 122:1301–1310
Ichimura K, Mizoguchi T, Irie K, Morris P, Giraudat J, Matsumoto K, Shinozaki K (1998)
Isolation of ATMEKK1 (a MAP kinase kinase kinase)-interacting proteins and analy-
sis of a MAP kinase cascade in Arabidopsis. Biochem Biophys Res Commun 253:532-
543
Ichimura K, Mizoguchi T, Yoshida R, Yuasa T, Shinozaki K (2000) Various Abiotic
24:655-665
Ingram J, Bartels D (1996) The molecular basis of dehydration tolerance in plants. Annu
Ishitani M, Liu J, Halfter U, Kim C-S, Shi W, and Zhu, J-K (2000) SOS3 function in plant
salt tolerance requires N-myristoylation and calcium-binding. Plant Cell 12:1667-1677
Ishitani M, Xiong L, Stevenson B, Zhu J-K (1997) Genetic analysis of osmotic and cold
stress signal transduction in Arabidopsis thaliana: Interactions and convergence of ab-
scisic acid-dependent and abscisic acid-independent pathways. Plant Cell 9:1935-1949
Iwata K, Tazawa M, Itoh T (2001) Turgor pressure regulation and the orientation of cortical
microtubules in Spirogyra cells. Plant Cell Physiol 42:594-598
Jacobsen T, Adams RM (1958) Salt and silt in ancient Mesopotamian agriculture. Science
128:1251-1258
Jia W, Wang Y, Zhang S, Zhang J (2002) Salt-stress-induced ABA accumulation is more
sensitively triggered in roots than in shoots. J Exp Bot 53:2201-2206
Karakas B, Ozias-Akins P, Stushnoff C, Suefferheld M, Rieger M (1997) Salinity and
drought tolerance of mannitol-accumulating transgenic tobacco. Plant Cell Environ 20:
609¯616
scription factor. Nature Biotech 17:287¯291
Keller CP, Volkenburgh EV (1996) Osmoregulation by oat coleoptile protoplasts (Effect of
Auxin). Plant Physiol 110:1007-1016
Kiegerl S, Cardinale F, Siligan C, Gross A, Baudouin E, Liwosz A, Eklof S, Till S, Bogre
L, Hirt H, Meskiene I (2000) SIMKK, a mitogen-activated protein kinase (MAPK)
kinase, is a specific activator of the salt stress induced MAPK, SIMK. Plant cell
12:2247-2258
Kiegle E, Moore CA, Haseloff J, Tester MA, Knight MR (2000) Cell-type-specific calcium
responses to drought, salt and cold in the Arabidopsis root. Plant J 23:267-278
Kim SA, Kwak JM, Jae SK, Wang MH, Nam HG (2001) Overexpression of the AtGluR2
gene encoding an Arabidopsis homolog of mammalian glutamate receptors impairs
calcium utilization and sensitivity to ionic stress in transgenic plants. Plant Cell
Physiol 42:74-84
Kishitani S, Takanami T, Suzuki M, Oikawa M, Yokoi S, Ishitani M, Alvarez-Nakase AM,
Takabe T, Takabe T (2000) Compatibility of glycinebetaine in rice plants: evaluation
using transgenic rice plants with a gene for peroxisomal betaine aldehyde dehydro-
genase from barley. Plant Cell Environ 23:107-114
Kishor PBK, Hong Z, Miao GH, Hu CAA, Verma DPS (1995) Overexpression of [delta]-
pyrroline-5-carboxylate synthetase increases proline production and confers osmotol-
erance in transgenic plants. Plant Physiol 108:1387-1394
Knight H (2000) Calcium signaling during abiotic stress in plants. International Rev Cytol
195:269-325
Knight H, Trewavas AJ, Knight MR (1997) Calcium signaling in Arabidopsis thaliana re-
sponding to drought and salinity. Plant J 12:1067–1078
Kovtun Y, Chiu W-L, Tena G, Sheen J (2000) Functional analysis of oxidative stress-
97:2940-2945.
Koyama ML, Levesley A, Koebner RMD, Flowers TJ, Yeo AR (2001) Quantitative trait
loci for component physiological traits determining salt tolerance in rice. Plant Physiol
125:406-422
Laurie S, Feeney KA, Maathuis FJM, Heard PJ, Brown SJ, Leigh RA (2002) A role for
HKT1 in sodium uptake by wheat roots. Plant J 32:139-149
Leung J, Giraudat J (1998) Abscisic acid signal transduction. Annu Rev Plant Physiol Plant
Mol Biol 49:199-222
Li J, Lee Y-R, Assmann SM (1998) Guard cells possess a calcium-dependent protein kinase
that phosphorylates the KAT1 potassium channel. Plant Physiol 116: 785-795
Lino B, Baizabal-Aguirre VM, de la Vara LEG (1998) The plasma-membrane H+-ATPase
from beet root is inhibited by a calcium-dependent phosphorylation. Planta 204:352-
359
Liu J, Ishitani M, Halfter U, Kim C-S, Zhu J-K (2000) The Arabidopsis thaliana SOS2
gene encodes a protein kinase that is required for salt tolerance. Proc Natl Acad Sci
USA 97:3730-3734
Liu J, Zhu J-K (1998) A calcium sensor homolog required for plant salt tolerance. Science
280:1943-1945
Liu W, Fairbairn DJ, Reid RJ, Schachtman DP (2001) Characterization of two HKT1
homologues from Eucalyptus camaldulensis that display intrinsic osmosensing capa-
bility. Plant Physiol 127:283-294
Lynch J, Polito VS, Läuchli A (1989) Salinity stress increases cytoplasmic Ca activity in
maize root protoplasts. Plant Physiol 90:1271¯1274
Mano Y, Takeda K (1997) Mapping quantitative trait loci for salt tolerance at germination
and the seedling stage in barley (Hordeum vulgare L.). Euphytica 94:263-272
Marschner H (1995) Mineral nutrition of higher plants, 2nd edition, Academic Press, Lon-
don
Mikolajczyk M, Awotunde OS, Muszyska G, Klessig DF, Dobrowolska G (2000) Osmotic
stress induces rapid activation of a salicylic acid–induced protein kinase and a ho-
molog of protein kinase ASK1 in tobacco cells. Plant Cell 12:165–178
Miyata S, Urao T, Yamaguchi-Shinozaki K, Shinozaki K (1998). Characterization of genes
for two-component phosphorelay mediators with a single HPt domain in Arabidopsis
thaliana. FEBS Lett 437:11-14.
is induced simultaneously with genes for a mitogen-activaed protein kinase and an S6
Moon H, Lee B, Choi G, Shin D, Prasad DT, Lee O, Kwak S-S, Kim DH, Nam J, Bahk J,
Hong JC, Lee SY, Cho MJ, Lim CO, Yun D-J (2003) NDP kinase 2 interacts with two
ple stress tolerance in transgenic plants Proc Natl Acad Sci USA 100:358-363
Mou Z, Wang X, Fu Z, Dai Y, Han C, Ouyang J, Bao F, Hu Y, Li J (2002) Silencing of
phosphoethanolamine N- Methyltransferase results in temperature-sensitive male ste-
rility and salt hypersensitivity in Arabidopsis. Plant Cell 14:2031–2043
Munnik T, Ligterink W, Meskiene I, Calderini O, Beyerly J, Musgrave A, Hirt H (1999)
Distinct osmosensing protein kinase pathways are involved in signaling moderate and
severe hyper-osmotic stress. Plant J 20:381-388
Nanjo T, Kobayashi TM, Yoshida Y, Kakubari Y, Yamaguchi-Shinozaki K, Shinozaki K
(1999) Antisense suppression of proline degradation improves tolerance to freezing
and salinity in Arabidopsis thaliana. FEBS Lett 461:205¯210
Navazio L, Bewell MA, Siddiqua A, Dickinson GD, Galione A, Sanders D (2000) Calcium
release from the endosplasmic reticulum of higher plants elicited by the NADP me-
tabolite nicotinic acid adenine dinucleotide phosphate. Proc Natl Acad Sci USA
97:8693-8698
Ober ES, Sharp RE (1994) Proline accumulation in maize (Zea mays L.) primary roots at
low water potentials. I. Requirement for increased levels of abscisic acid. Plant Physiol
105:981-987
Ohnishi J, Flugge U-I, Heldt HW, Kanai R (1990) Involvement of Na+ in active uptake of
pyruvate in mesophyll chloroplasts of some C4 plants: Na+/Pyruvate cotransport. Plant
Physiol 94: 950-959
Park JM, Park CJ, Lee SB, Ham BK, Shin R, Paek KH (2001) Overexpression of the to-
bacco Tsi1 gene encoding an EREBP/AP2–type transcription factor enhances resis-
tance against pathogen attack and osmotic stress in tobacco. Plant Cell 13:1035-1046
Patharkar OR, Cushman JC (2000) A stress-induced calcium-dependent protein kinase from
Mesembryanthemum crystallinum phosphorylates a two-component pseudo-response
regulator. Plant J 24:679-691
Pei ZM, Murata Y, Benning G, Thomine S, Klusener B, Allen GJ, Grill E, Schroeder JI
Pei ZM, Ward JM, Harper JF, Schroeder JI (1996) A novel chloride channel in Vicia faba
guard cell vacuoles activated by the serine/threonine kinase, CDPK. EMBO J
15:6564–6574
Piao HL, Pih KT, Lim JH, Kang SG, Jin JB, Kim SH, IH (1999) An Arabidopsis
GSK3/shaggy-like gene that complements yeast salt stress-sensitive mutants is induced
by NaCl and abscisic acid. Plant Physiol 119:1527-1534
Pical C, Westergren T, Dove SK, Larsson C, Sommarin M (1999) Salinity and hyperosmo-
tic stress induce rapid increases in phosphatidylinositol 4,5-bisphosphate, diacylglyc-
erol pyrophosphate, and phosphatidylcholine in Arabidopsis thaliana cells. J Biol
Chem 274:38232-38240
Plieth C, Hansen UP, Knight H, Knight MR (1999) Temperature sensing by plants: the
primary characteristics of signal perception and calcium response. Plant J 18:491–497
Prasad KVSK, Sharmila P, Kumar PA, Saradhi PP (2000) Transformation of Brassica
juncea (L.) Czern with bacterial codA gene enhances its tolerance to salt stress. Mo-
lecular Breed 6:489-499
Qiu QS, Guo Y, Dietrich MA, Schumaker KS, Zhu J-K (2002) Regulation of SOS1, a
plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3.
Quesada V, Garcia-Martinez S, Piqueras P, Ponce MR, Micol JL (2002) Genetic architec-
ture of NaCl tolerance in Arabidopsis. Plant Physiol 130: 951-963
Quesada V, Ponce MR, Micol JL (2000) Genetic analysis of salt-tolerant mutants in Arabi-
dopsis thaliana. Genetics 154:421-436
Quintero FJ, Garciadeblas B, Rodriguez-Navarro A (1996) The SAL1 gene of Arabidopsis,
encoding an enzyme with 3’(2’),5’-bisphosphate nucleotide and inositol polyphosphate
1-phosphatase activities, increases salt tolerance in yeast. Plant Cell 8:529-537
Quintero FJ, Ohta M, Shi H, Zhu, J-K, Pardo JM (2002) Reconstitution in yeast of the
Arabidopsis SOS signaling pathway for Na+ homeostasis. Proc Nat1 Acad Sci USA
99:9061-9066
Raven JA (1985) Regulation of pH and generation of osmolarity in vascular plants: a cost-
benefit analysis in relation to efficiency of use of energy, nitrogen and water. New
Phytol 101:25-77
Roxas VP, Lodhi SA, Garrett DK, Mahan JR, Allen RD (2000) Stress tolerance in trans-
genic tobacco seedlings that overexpress glutathione S-transferase/glutathione peroxi-
dase. Plant Cell Physiol 41:1229-1234
Roxas VP, Smith Jr RK, Allen ER, Allen RD (1997) Overexpression of glutathione S-
transferase/glutathione peroxidase enhances the growth of transgenic tobacco seedlings
during stress. Nature Biotech 15:988-991
Rubio F, Gassmann W, Schroeder JI (1995) Sodium driven potassium uptake by the plant
potassium transporter HKT1 and mutations conferring salt tolerance. Science
270:1660-1663.
Rus A, Yokoi S, Sharkhuu A, Reddy M, Lee B-H, Matsumoto TK, Koiwa H, Zhu J-K,
Bressan RA, Hasegawa PM (2001a) AtHKT1 is a salt tolerance determinant that con-
trols Na(+) entry into plant roots. Proc Natl Acad Sci USA 98:14150-14155
Rus AM, Estañ MT, Gisbert C, Garcia-Sogo B, Serrano R, Caro M, Moreno V, Bolarín MC
(2001b) Expressing the yeast HAL1 gene in tomato increases fruit yield and enhances
K+ /Na+ selectivity under salt stress. Plant Cell Environ 24:875-880
Saijo Y, Hata S, Kyozuka J, Shimamoto K, Izui K (2000) Over-expression of a single Ca2+
dependent protein kinase confers both cold and salt/drought tolerance on rice plants.
Plant J 23:319-327
Sakamoto A, Alia H, Murata N (1998) Metabolic engineering of rice leading to biosynthe-
sis of glycinebetaine and tolerance to salt and cold. Plant Mol Biol 38:1011-1019
Sanchez J-P, Chua N-H (2001) Arabidopsis PLC1 is required for secondary responses to
abscisic acid signals. Plant Cell 13:1143-1154
Sanders D, Brownlee C, Harper JF (1999) Communicating with calcium. Plant Cell 11:691-
706
Sheen J (1996) Ca2+-dependent protein kinases and stress signal transduction in plants. Sci-
ence 274:1900-1902
Shen B, Jensen RG, Bohnert HJ (1997) Increased resistance to oxidative stress in transgenic
plants by targeting mannitol biosynthesis to chloroplasts. Plant Physiol 113:1177-1183
Shen QX, Zhang PH, Ho T-HD (1996) Modular nature of abscisic acid (ABA) response
complexes: composite promoter units that are necessary and sufficient for ABA induc-
tion of gene expression in barley. Plant Cell 8:1107-1119
Sheveleva E, Chmara W, Bohnert HJ, Jensen RG (1997) Increased salt and drought toler-
ance by D-ononitol production in transgenic Nicotiana tabacum L. Plant Physiol
115:1211-1219
Shi H, Ishitani M, Kim C-S, Zhu J-K (2000) The Arabidopsis thaliana salt tolerance gene
Shi H, Lee B-H, Wu S-J, Zhu J-K (2003) Overexpression of a plasma membrane Na+/H+
antiporter improves salt tolerance in Arabidopsis. Nature Biotech 21:81-85
Shi H, Quintero, FJ, Pardo JM, Zhu J-K (2002a) The putative plasma membrane Na+/H+
antiporter SOS1 controls long-distance Na+ transport in plants. Plant Cell 14:465-477
Shi H, Xiong L, Stevenson B, Lu T, Zhu J-K (2002b) The Arabidopsis salt overly sensitive
4 mutants uncover a critical role for vitamin B6 in plant salt tolerance. Plant Cell
14:575-588
Shi H, Zhu J-K (2002) Regulation of expression of the vacuolar Na+/H+ antiporter gene
AtNHX1 by salt stress and ABA. Plant Mol Biol 50:543-550
Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular response to dehydration and low

temperature: Differences and cross-talk between two stress signaling pathways. Curr
Skriver K, Olsen FL, Rogers JC, Mundy J (1991) Cis-acting elements responsive to gibber-
ellin and its antagonist abscisic acid. Proc Natl Acad Sci USA 88:7266-7270
Smirnoff N (1993) The role of active oxygen in the response of plants to water deficit and
desiccation. New Phytol 125:27-58
Spollen WG, LeNoble ME, Samuels TD, Bernstein N, Sharp RE (2000) Abscisic acid ac-
cumulation maintains maize primary root elongation at low water potentials by re-
stricting ethylene production. Plant Physiol 122:967-976
Su H, Golldack D, Zhao C, Bohnert HJ (2002) The expression of HAK-type K+ transporters
is regulated in response to salinity stress in common ice plant. Plant Physiol 129:1482-
1493
Suzuki T, Imamura A, Ueguchi C, Mizuno T (1998) Histidine-containing phosphotransfer
(HPt) signal transducers implicated in His-to-Asp phosphorelay in Arabidopsis. Plant
Cell Physiol 39:1258-1268
Suzuki T, Sakurai K, Ueguchi C, Mizuno T (2001) Two types of putative nuclear factors
that physically interact with Histidine-containing phosphotransfer (Hpt) domains, sig-
naling mediators in His-to-Asp phosphorelay, in Arabidopsis thaliana. Plant Cell
Physiol 42:37-45
Tarczynski MC, Jensen RG, Bohnert HJ (1993) Stress protection of transgenic tobacco by
production of the osmolyte mannitol. Science 259: 508-510
Tsugane K, Kobayashi K, Niwa Y, Ohba Y, Wada K, Kobayashi H (1999) A recessive
Arabidopsis mutant that grows photoautotrophically under salt stress shows enhanced
active oxygen detoxification. Plant Cell 11:1195-1206
Tyerman SD, Skerrett IM (1999) Root ion channels and salinity. Sci Hort 78:175-235
Ulm R, Ichimura K, Mizoguchi T, Peck SC, Zhu T, Wang X, Shinozaki K, Paszkowski J
(2002) Distinct regulation of salinity and genotoxic stress responses by Arabidopsis
MAP kinase phosphatase 1. EMBO J 21:6483-6493
Ullah H, Chen JG, Young J, Im K-H, Sussman M, Jones A (2001) Modulation of cell pro-
liferation by heterotrimeric G protein in Arabidopsis. Science 292 2066-2069
Uozumi N, Kim EJ, Rubio F, Yamaguchi T, Muto S, Tsuboi A, Bakker EP, Nakamura T,
Schroeder JI (2000) The Arabidopsis HKT1 gene homolog mediates inward Na+ cur-
rents in Xenopus laevis oocytes and Na+ uptake in Saccharomyces cerevisiae. Plant
Physiol 122:1249-1259
(1994) Two genes that encode Ca2+ dependent protein kinases are induced by drought
and high-salt stress in Arabidopsis thaliana. Mol Gen Genet 244:331-340
Viswanathan C, Zhu J-K (2002) Molecular genetic analysis of cold-regulated gene tran-
scription. Phil Trans Royal Soc London. Biol Sci 357: 877-886
Wang QY, Nick P (2001) Cold acclimation can induce microtubular cold stability in a
manner distinct from abscisic acid. Plant Cell Physiol 42:999-1005
Wang H, Qi Q, Schorr P, Cutler AJ, Crosby W, Fowke LC (1998) ICK1, a cyclin depend-
ent protein kinase inhibitor from Arabidopsis thaliana interacts with both Cdc2a and
CycD3, and its expression is induced by abscisic acid. Plant J 15:501-510
Wang X-Q, Ullah H, Jones A, Assmann S (2001) G protein regulation of ion channels and
abscisic acid signaling in Arabidopsis guard cells. Science 292:2070-2072
Winicov I (2000) Alfin1 transcription factor overexpression enhances plant root growth un-
der normal and saline conditions and improves salt tolerance in alfalfa. Planta 210:416-
422
Winicov I, Bastola DR (1999) Transgenic overexpression of the transcription factor Alfin1
enhances expression of the endogenous, MSPRP2 gene in alfalfa and improves salinity
tolerance of the plant. Plant Physiol 120:473-480
Wu Y, Spollen WG, Sharp RE, Hetherington PR, Fry SC (1994) Root growth maintenance
at low water potentials. Increased activity of xyloglucan endotransglycosylase and its
possible regulation by abscisic acid. Plant Physiol 106: 607-615
Wu Y, Kuzma J, Marechal E, Graeff R, Lee HC, Foster R, Chua N-H (1997) Abscisic acid
signaling through cyclic ADP-ribose in plants. Science 278:2126–2130
Wurgler-Murphy SM, Saito H (1997) Two-component signal transducers and MAPK cas-
cades. Trends Biochem Sci 22:172-176
Xiong L, Ishitani M, Lee H, Zhu J-K (2001a) The Arabidopsis LOS5/ABA3 locus encodes a
molybdenum cofactor sulfurase and modulates cold stress- and osmotic stress- respon-
sive gene expression. Plant Cell 13:2063-2083
Xiong L, Lee B-H, Ishitani M, Lee H, Zhang C, Zhu J-K (2001b) FIERY1 encoding an
inositol polyphosphate 1-phosphatase is a negative regulator of abscisic acid and stress
signaling in Arabidopsis. Genes Dev 15:1971-1984
Xiong L, Lee H, Ishitani M, Zhu J-K (2002a) Regulation of osmotic stress responsive gene
expression by LOS6/ABA1 locus in Arabidopsis. J Biol Chem 277:8588-8596
Xiong L, Schumaker KS, Zhu J-K (2002b) Cell signaling for cold, drought, and salt
stresses. Plant Cell 14:S165-183
Xu D, Duan X, Wang B, Hong B, Ho TD, Wu R (1996) Expression of a late embryogenesis
abundant protein gene, HVA1, from barley confers tolerance to water deficit and salt
stress in transgenic rice. Plant Physiol 110:249-257
Xu Q, Fu H-H, Gupta R, Luan S (1998) Molecular characterization of a tyrosine-specific
protein phosphatase encoded by a stress-responsive gene in Arabidopsis. Plant Cell
10:849–857
Yadav R, Flowers TJ, Yeo AR (1996) The involvement of the transpirational bypass flow
in sodium uptake by high- and low-sodium-transporting lines of rice developed
through intravarietal selection. Plant Cell Environ 22:329-336
Yancey PH, Clark ME, Hand SC, Bowles RD, Somero GN (1982) Living with water stress:
evolution of osmolyte system. Science 217:1214-1222
Yeo AR, Flowers SA, Rao G, Welfare K, Senanayake N, Flowers TJ (1999) Silicon reduces
sodium uptake in rice (Oryza sativa L.) in saline conditions and this is accounted for
by a reduction in the transpirational bypass flow. Plant Cell Environ 22:559-565
Yuasa T, Ichimura K, Mizoguchi T, Shinozaki K (2001) Oxidative stress activates
ATMPK6, an Arabidopsis homologue of MAP Kinase. Plant Cell Physiol 42:1012-
1016
Zhang HX, Blumwald E (2001) Transgenic salt-tolerant tomato plants accumulate salt in
foliage but not in fruit Nature Biotech 19:765-768
Zhang HX, Hodson JN, Williams JP, Blumwald E (2001) Engineering salt-tolerant Brassica
plants: Characterization of yield and seed oil quality in transgenic plants with in-
creased vacuolar sodium accumulation. Proc Natl Acad Sci USA 98:12832-12836
Zhang J-S, Xie C, Li ZY, Chen SY (1999) Expression of the plasma membrane H+ATPase
gene in response to salt stress in a rice salt-tolerant mutant and its original variety.
Theor Appl Genet 99:1006-1011
Zhu B, Su J, Chang MC, Verma DPS, Fan YL, Wu R (1998) Overexpression of a pyr-
roline-5-carboxylate synthetase gene and analysis of tolerance to water and salt stress
in transgenic rice. Plant Sci 139:41-48
Zhu J, Gong Z, Zhang C, Song C-P, Damsz B, Inan G, Koiwa H, Zhu J-K, Hasegawa PM,
Bressan RA (2002) OSM1/SYP61: a syntaxin protein in Arabidopsis controls abscisic
acid–mediated and non-abscisic acid–mediated responses to abiotic stress. Plant Cell
14:3009-3028
Zhu J-K (2001) Plant salt tolerance. Trends Plant Sci 6:66-71
53:247-273
Zhu J-K, Liu J, Xiong L (1998) Genetic analysis of salt tolerance in Arabidopsis thaliana:
evidence of a critical role for potassium nutrition. Plant Cell 10:1181-1192
10 Transcriptome analysis in abiotic stress
conditions in higher plants
Motoaki Seki, Ayako Kamei, Masakazu Satou, Tetsuya Sakurai, Miki Fujita,
Youko Oono, Kazuko Yamaguchi-Shinozaki and Kazuo Shinozaki
Abstract
Drought, high salinity, and low temperature are major environmental factors that
limit plant productivity. Plants respond and adapt to these stresses in order to sur-
vive. Recent molecular and genetic studies have revealed the presence of many
signaling components are involved in the signaling pathways of these stresses.
Furthermore, gene expression profiling using cDNA microarrays or gene chips has
identified many genes that are regulated by drought-, cold-, or high-salinity
stresses. In this review, we highlight recent progress on the transcriptome analysis
in drought-, cold-, or high-salinity stress conditions.
10.1 Introduction
Plant growth is greatly affected by environmental abiotic stresses, such as drought,

high salinity and low temperature. Plants respond and adapt to these stresses in or-
der to survive. These stresses induce various biochemical and physiological re-
sponses in plants. Several genes that respond to drought, high-salinity, or cold
stress at the transcriptional level have been studied (Hasegawa et al. 2000; Shino-
zaki and Yamaguchi-Shinozaki 2000; Thomashow 1999; Zhu 2002). The products
of the stress-inducible genes have been classified into two groups: those that di-
rectly protect against environmental stresses and those that regulate gene expres-
sion and signal transduction in the stress response. The first group includes pro-
teins that likely function by protecting cells from dehydration, such as the
enzymes required for biosynthesis of various osmoprotectants, late-
embryogenesis-abundant (LEA) proteins, antifreeze proteins, chaperones, and de-
toxification enzymes. The second group of gene products includes transcription
factors, protein kinases, and enzymes involved in phosphoinositide metabolism.
Stress-inducible genes have been used to improve the stress tolerance of plants by
gene transfer (Hasegawa et al. 2000; Shinozaki and Yamaguchi-Shinozaki 2000;
Thomashow 1999). It is important to analyze the functions of stress-inducible
genes not only to understand the molecular mechanisms of stress tolerance and the
responses of higher plants but also to improve the stress tolerance of crops by gene
manipulation. Hundreds of genes are thought to be involved in abiotic stress re-
sponses (Shinozaki and Yamaguchi-Shinozaki 1999, 2000; Xiong and Zhu 2001,
Topics
Topics in in Current
Current Genetics,
Genetics, Vol.
Vol. 44
H.H. Hirt,
Hirt, K.K. Shinozaki
Shinozaki (Eds.)
(Eds.) Plant
Plant responsesTo
Responses toAbiotic
abiotic stress
Stress
©© Springer-Verlag
Springer-Verlag Berlin
Berlin Heidelberg
Heidelberg 2003
2003
272 Motoaki Seki et al.
2002; Xiong et al. 2002; Zhu 2002). In this review, we highlight recent progress
on the gene expression in these stress responses.
10.2 Cis- and trans-acting factors involved in regulation of

gene expression by drought, high-salinity and cold stress
A number of genes that are induced by osmotic stress have been identified (Shino-
zaki and Yamaguchi-Shinozaki 1999, 2000; Thomashow 1999; Xiong and Zhu
2001, 2002; Xiong et al. 2002; Zhu 2002). Although the signaling pathways re-
sponsible for the activation of these genes are largely unknown, transcriptional ac-
tivation of some of the stress-responsive genes is understood to a great extent, ow-
ing to studies on RD29A/COR78/LTI78 gene. The promoter of this gene contains
both ABA-responsive element (ABRE) and DRE/CRT (Yamaguchi-Shinozaki and
Shinozaki 1994). ABRE and DRE/CRT are cis-acting elements that function in
ABA-dependent and ABA-independent gene expression in response to stress, re-
spectively. Transcription factors belonging to the ERF/AP2 family that bind to
DRE/CRT were isolated and termed DREB1A/CBF3, DREB1B/CBF1 and
DREB1C/CBF2 (Liu et al. 1998; Stockinger et al. 1997). These transcription fac-
tor genes are induced early and transiently by cold stress, and they, in turn, acti-
vate the expression of target genes. Similar transcription factors DREB2A and
DREB2B are induced by dehydration stress to express various genes involved in
drought stress tolerance (Liu et al. 1998). Sakuma et al. (2002) precisely analyzed
the DNA-binding specificity of DREB1A/CBF3 and DREB2 and demonstrated
that the core sequence of DRE is the 6-bp A/GCCGAC sequence. The ability of
DREB1/CBF to activate the DRE/CRT class of stress-responsive genes was fur-
ther demonstrated by the observation that overexpression or enhanced inducible
expression of DREB1/CBF could activate the target genes. Overexpression of
DREB1/CBF also increased the tolerance of the transgenic plants to freezing,
drought and high-salinity stresses (Jaglo-Ottosen et al. 1998; Kasuga et al. 1999;
Liu et al. 1998; Shinozaki and Yamaguchi-Shinozaki 2000), suggesting that the
DREB1/CBF system is important for the development of stress tolerance in plants.
The DREB1/CBF pathway is a major transcription system regulating ABA-
independent gene expression in response to drought and cold stresses (Shinozaki
and Yamaguchi-Shinozaki 2000). Taji et al (2002) showed that galactinol synthase
(AtGolS) gene is a target gene of DREB1A/CBF3. Transgenic Arabidopsis plants
overexpressing the AtGolS2 gene accumulated galactinol and raffinose, showed a
reduced transpiration rate, and were more tolerant to drought-stress than were con-
trol plants. Kim et al. (2002) reported that cold-induced gene expression through
DRE/CRT is greatly enhanced by a signal generated by light and that the primary
photoreceptor involved in light signaling is phytochrome B.
Several basic leucine zipper (bZIP) transcription factors that can bind to ABRE
and activate the expression of ABRE-driven reporter genes also have been iso-
lated: AREB1/ABF2, AREB2/ABF4, AREB3, ABF1, and ABF3 (Choi et al. 2000;
Uno et al. 2000). AREB1/ABF2 and AREB2/ABF4 genes need ABA for full activa-
10 Transcriptome analysis in abiotic stress conditions in higher plants 273
tion, since the activities of these transcription factors were reduced in the ABA-
deficient mutant aba2 and ABA-insensitive mutant abi1-1, but were enhanced in
the ABA-hypersensitive era1 mutant, probably due to ABA-dependent phos-
phorylation of the proteins (Uno et al. 2000). Recently, Kang et al. (2002) reported
that constitutive overexpression of ABF3 or AREB2/ABF4 in Arabidopsis resulted
in ABA hypersensitivity, reduced transpiration rate and enhanced drought toler-
ance. Changes in phenotypes for loss-of-function mutants have not yet been re-
ported for any DREB/CBF or AREB/ABF genes. This may be due to functional re-
dundancy between the family members, and hence it may be necessary to combine
loss-of-function mutants for two or more members to see the phenotype.
The induction of the drought-inducible genes such as RD22 is mediated by
ABA and requires protein biosynthesis for its ABA-dependent expression (Abe et
al. 1997; Shinozaki and Yamaguchi-Shinozaki 2000). A MYC transcription factor,
RD22BP1 (AtMYC2), and a MYB transcription factor, ATMYB2, were shown to
bind cis-elements in the RD22 promoter and cooperatively activate RD22 (Abe et
al. 1997, 2003).
A number of drought- and/or ABA-inducible genes encoding various transcrip-
tion factors have been reported (Zhu 2002). Among them, ATHB6 containing the
homeodomain functions as a negative regulator downstream of ABI1 in the ABA
signal transduction pathway (Himmelbach et al. 2002).
10.2.1 Application of cDNA microarray analysis to expression

profiling under abiotic stress conditions
Recently, microarray technology has become a powerful tool for the systematic
analysis of expression profiles of large numbers of genes (Eisen and Brown 1999;
Richmond and Somerville 2000; Seki et al. 2001b). This DNA chip-based tech-
nology arrays cDNA sequences or oligonucleotides on a glass slide at a density
>1000 genes/cm2. These arrayed sequences are hybridized simultaneously to a
two-color fluorescently labeled cDNA probe pair prepared from RNA samples of
different cell or tissue types, allowing direct and large-scale comparative analysis
of gene expression. Several groups reported the application of the microarray
technology to the analysis of expression profiles in response to drought, cold and
high-salinity stresses (Chen et al. 2002; Fowler and Thomashow 2002; Kawasaki
et al. 2001; Seki et al. 2001a, 2002b, 2002c). In this review article, first, we sum-
marize the recent progress on the transcriptome analysis under abiotic stress con-
ditions using our RIKEN Arabidopsis full-length (RAFL) cDNA microarray.
10.3 Collection and functional annotation of RIKEN

Arabidopsis full-length (RAFL) cDNAs
We have constructed Arabidopsis full-length cDNA libraries from plants grown

under different conditions as reported previously (Seki et al. 1998, 2001b, 2002a)
by the biotinylated CAP trapper method using trehalose-thermoactivated reverse

transcriptase (Carninci et al. 1996, 1997, 1998). Until now, we have constructed
19 full-length cDNA libraries from Arabidopsis plants grown under various stress,
hormone and light conditions, from plants at various developmental stages, and
from various plant tissues (Seki et al. 2002a). We performed single-pass sequenc-
ing of the cDNA clones from the 3’-end. We have obtained 155,144 3’-end ex-
pressed sequence tags (ESTs) as of February, 2002 (Seki et al. 2002a). The
155,144 3’-ESTs were clustered and then mapped onto the Arabidopsis genome.
Finally, 14,668 non-redundant RAFL cDNA clones were identified and mapped
on the Arabidopsis genome (Seki et al. 2002a). The information of the 14,668
RAFL cDNA clones (the “RAFL cDNA” genes) is available at
http://www.gsc.riken.go.jp/Plant/index.html (Seki et al. 2002a). Assuming that the
total number of Arabidopsis genes is about 26,000, the RAFL clones isolated
should account for about 60% of all Arabidopsis genes.
From the 5’-end sequences of mRNAs, the promoter sequences can be obtained
by comparison with the Arabidopsis genomic sequences. We also obtained 5’-
ESTs of 14,034 RAFL cDNA clones and constructed a promoter database (Seki et
al., 2002a) using the Plant cis-acting regulatory DNA elements (PLACE) database
(Higo et al., 1999). The Arabidopsis promoter database constructed contains the
information on the genomic sequences 1000-bp upstream from the 5’-termini of
each RAFL cDNA clone, and about 300 cis-acting elements known from plants
(Seki et al., 2002a). The Arabidopsis promoter database constructed is available at
http://www.gsc.riken.go.jp/Plant/index.html (Seki et al. 2002a, 2002d). One of the
interesting types of the microarray analysis is the identification of novel cis-
elements that regulate the expression of genes in response to various experimental
treatments. By identifying subsets of the genes that have a common expression
profile, it might be possible to identify conserved motifs in the promoter regions.
We think that our promoter database becomes useful for systematic analysis of
cis-acting elements in Arabidopsis (Seki et al. 2002a, 2002d).
10.3.1 Application of RIKEN Arabidopsis full-length (RAFL) cDNA

microarray to identify drought-, cold-, or high-salinity-stress-
regulated genes
A number of genes have been described that respond to drought, cold, and high-
salinity stresses at the transcriptional level as described above. However, many
unidentified genes are thought to be involved in drought, cold, and high-salinity
stress responses. Therefore, we applied the full-length cDNA microarray contain-
ing ca. 1300 Arabidopsis full-length cDNAs to identify new drought- or cold-
inducible genes (Seki et al. 2001a). Forty-four and nineteen cDNAs for drought-
and cold-inducible genes, respectively, were isolated, 30 and 10 of which were
novel stress-inducible genes that have not been reported as drought- or cold-
inducible genes previously. As described above, we reported that overexpression
of the DREB1A/CBF3 cDNA under the control of the cauliflower mosaic virus
(CaMV) 35S promoter or the stress-inducible rd29A promoter in transgenic plants
gave rise to strong constitutive expression of the stress-inducible DREB1A target

genes and increased tolerance to freezing, drought, and salt stresses (Kasuga et al.
1999; Liu et al. 1998). Kasuga et al. (1999) identified 6 DREB1A target genes.
However, it is not well understood how overexpression of the DREB1A cDNA in
transgenic plants increases stress tolerance to freezing, drought, and high-salinity
stresses. To study the molecular mechanisms of drought and freezing tolerance, it
is important to identify and analyze more genes that are controlled by DREB1A.
Therefore, we applied the full-length cDNA microarray containing ca. 1300
Arabidopsis full-length cDNAs to identify new target genes of DREB1A (Seki et
al. 2001a). Twelve stress-inducible genes were identified as target stress-inducible
genes of DREB1A, and six of them were novel. All DREB1A target genes identi-
fied contained DRE- or DRE-related CCGAC core motif sequences in their pro-
moter regions (Seki et al. 2001a). These results show that our full-length cDNA
microarray is a useful material with which to analyze the expression pattern of
Arabidopsis genes under drought and cold stresses, to identify target genes of
stress-related transcription factors, and to identify potential cis-acting DNA ele-
ments by combining the expression data with the genomic sequence data.
Recently, we prepared a new full-length cDNA microarray containing ca. 7000
independent Arabidopsis full-length cDNA groups, including drought-inducible
genes, responsive to dehydration (rd) and early responsive to dehydration (erd)
(Taji et al. 1999), as positive controls, the PCR-amplified fragment from lambda
control template DNA fragment (Takara) as an external control, and the mouse
nicotinic acetylcholine receptor epsilon-subunit (nAChRE) gene and the mouse
glucocorticoid receptor homolog gene, which have no substantial homology to any
sequences in the Arabidopsis database, to assess for nonspecific hybridization as
negative controls.(Seki et al. 2002b). We applied the cDNA microarray containing
ca. 7000 Arabidopsis full-length cDNA groups to identify new drought-, cold-,
high-salinity-, or ABA-inducible genes. In this study, we used the PCR-amplified
fragment from lambda control template DNA fragment (Takara) as an external
control gene to equalize hybridization signals generated from different samples
and regarded the genes with expression ratios (dehydration/unstressed,
cold/unstressed, or high-salinity/unstressed) greater than five times that of the
lambda control template DNA fragment in at least 1 time-course point as dehydra-
tion-, cold-, or high-salinity-stress-inducible genes. We identified 299 drought-
inducible genes, 54 cold-inducible genes, 213 high-salinity-stress-inducible genes
and 245 ABA-inducible genes (Fig. 1)(Seki et al. 2002b, 2002c). Information on
each stress-inducible gene is available at http://www.gsc.riken.go.jp
/Plant/index.html. Venn diagram analysis indicated the existence of significant
crosstalk between drought and high-salinity stress signaling processes (Fig. 1)
(Seki et al. 2002b). Many ABA-inducible genes are induced after drought - and
Fig. 1. Classification of the drought-, cold-, high-salinity-stress- or ABA- inducible genes

on the basis of their expression pattern: A The ABA-, drought-, or high-salinity-stress-
inducible genes identified were grouped into the following 7 groups: (1) ABA-highly-
inducible genes, (2) drought-stress-highly-inducible genes, (3) high-salinity-stress-highly-
inducible genes, (4) ABA- and drought-stress-highly-inducible genes, (5) ABA- and high-
salinity-stress-highly-inducible genes, (6) drought- and high-salinity-stress-highly-inducible
genes, and (7) ABA-, drought- and high-salinity-stress-inducible genes. B The ABA-,
drought-, or cold-stress-inducible genes identified were grouped into the following 7
groups: (1) ABA-highly-inducible genes, (2) drought-highly-inducible genes, (3) cold-
stress-highly-inducible genes, (4) ABA- and drought-stress-highly-inducible genes, (5)
ABA- and cold-stress-highly-inducible genes, (6) drought- and cold-stress-highly-inducible
genes, and (7) ABA-, drought- and cold-stress-inducible genes. The number of genes whose
expression ratio is more than 5-fold for each treatment and less than 5-fold for the other
treatments is indicated. Numbers in parentheses represent the number of genes whose ex-
pression ratio is more than 5-fold for each treatment and less than 3-fold for the other
treatments. The list of the genes is available at http://pfgweb.gsc.riken.go.jp/index.html
(Seki et al. 2002c).
high-salinity-stress treatments, which indicates the existence of significant

crosstalk between drought and ABA responses (Fig. 1) (Seki et al. 2002c). These
results supported our previous model on strong overlap of gene expression in re-
sponse to drought, high-salinity, and ABA (Shinozaki and Yamaguchi-Shinozaki
2000), and partial overlap of gene expression in response to cold and osmotic
stress.
10.4 Stress-inducible genes and functions of their gene

products identified by RAFL cDNA microarray
The products of the drought-, high-salinity-, or cold-stress-inducible gene products

can be classified into 2 groups (Figs. 2, 3 and 4; Supplemental tables 1, 2, and 3)
(Seki et al. 2002b; Shinozaki and Yamaguchi-Shinozaki 1999, 2000). The first
group includes functional proteins, or proteins that probably function in stress tol-
erance. They are late-embryogenesis-abundant (LEA) proteins, heat shock pro-
teins, KIN (cold-inducible) proteins, osmoprotectant-biosynthesis-related proteins,
carbohydrate-metabolism-related proteins, water channel proteins, sugar trans-
porters, potassium transporters, detoxification enzymes, proteases, senescence-
related genes, protease inhibitors, ferritin, and lipid transfer proteins (Figs. 2, 3,
and 4; Supplemental tables 1, 2, and 3) (Seki et al. 2002b). LEA proteins and heat
shock proteins have been shown to be involved in protecting macromolecules like
enzymes and lipids (Shinozaki and Yamaguchi-Shinozaki 1999). Proline, sugars
and raffinose family oligosaccharides (RFO) probably function as osmolytes in
protecting cells from dehydration (Cushman and Bohnert 2000; Taji et al. 2002).
KIN proteins may have a unique ability to neutralize ice nucleators and inhibit ice
recrystallization (Holmberg and Bülow 1998). Water channel proteins and sugar
transporters are thought to function in transport of water and sugars through
plasma membranes and tonoplast to adjust the osmotic pressure under stress con-
ditions. Potassium transporters may function in transport of K+, which is an essen-
tial cofactor for many enzymes (Hasegawa et al. 2000) or control K+ uptake and
regulate Na+ uptake, which can be an important determinant of salinity tolerance
(Bray 1997). Detoxification enzymes, such as glutathione S-transferase are
thought to be involved in protection of cells from active oxygens. Proteases in-
cluding cysteine proteases, Clp protease, and ubiquitin-conjugating enzyme are
thought to be required for protein turnover and recycling of amino acids. Drought
stress has been shown to accelerate leaf senescence, which is characterized by
many subcellular changes, including an increase in protease activities (Thomas
and Stoddart 1980). The protease inhibitors may perform a defensive role against
the proteases. Ferritin may have a function in protecting the cells from oxidative
damage caused by various stresses by sequestering intracellular iron involved in
the generation of various reactive hydroxyl radicals through a Fenton reaction
(Bajaj et al. 1999). Lipid transfer proteins and fatty acid-metabolism-related genes
may have a function in repair of stress-induced damage in membranes or changes
in the lipid composition of membranes, perhaps to regulate the permeability to
toxic ions and the fluidity of the membrane (Holmberg and Bülow 1998; Torres-
Schumann et al. 1992).
The second group contains regulatory proteins, that is, protein factors involved
in further regulation of signal transduction and gene expression that probably
function in stress response (Figs. 2, 3, and 4; Supplemental tables 1, 2 and 3) (Seki
et al. 2002b; Shinozaki and Yamaguchi-Shinozaki 1999, 2000). They are various
transcription factors, protein kinases, protein phosphatases, enzymes involved in
Fig. 2. Drought stress-inducible genes and their possible functions in stress tolerance and
response. Gene products are classified into two groups. The first group (Functional pro-
teins) includes proteins that probably function in stress tolerance. They are protection fac-
tors such as chaperones, LEA proteins, and lipid transfer proteins, proteins involved in re-
pair and protection from damages, such as proteinases, detoxification enzymes, protease
inhibitors, ferritin and plant defense-related proteins, membrane proteins such as water
channel protein and transporters, protein synthesis-related proteins, proteins involved in
synthesis of osmoprotectant (proline, glycine betaine, sugars and RFO), proteins involved
in cellular metabolic processes, such as carbohydrate metabolism, secondary metabolism,
fatty acid metabolism, biosynthesis of plant hormones (ABA, ethylene, IAA and JA), pro-
teins regulated by plant hormones (ABA, auxin and JA), RNA-binding proteins, cellular
structure and organization-related proteins such as arabinogalactan protein, senescence-
related proteins, cytochrome P450, alcohol dehydrogenase, aldehyde dehydrogenase, re-
production development-related proteins such as pollen coat-like protein and respiration-
related proteins such as flavin-containing monooxygenase. The second group (Regulatory
proteins) contains protein factors involved in further regulation of signal transduction and
gene expression that probably function in stress response. They are transcription factors
such as DREB family, ERF family, zinc finger family, WRKY family, MYB family, MYC
family, HD-ZIP family, bZIP family and NAC family, protein kinases such as MAPK
(Mizoguchi et al. 1996), MAPKKK (Mizoguchi et al. 1996), CDPK (Urao et al. 1994), S6K
(Mizoguchi et al. 1996) and RPK (Hong et al. 1997), protein phosphatases such as PP2C,
PI turnover-related proteins, such as PLC (Hirayama et al. 1995), PLD (Katagiri et al.
2001), PIP5K (Mikami et al. 1998), DGK (Shinozaki and Yamaguchi-Shinozaki 1999), and
PAP (Shinozaki and Yamaguchi-Shinozaki 1999), and calmodulin-binding protein and
Ca2+-binding protein. The list of the drought stress-inducible genes identified by the cDNA
microarray analysis (Seki et al. 2002b) is available at http://pfgweb.gsc.riken.go.jp
/index.html (as supplemental table 1).
phospholipid metabolism, and other signaling molecules, such as calmodulin-

binding protein (Figs. 2, 3 and 4; Supplemental tables 1, 2, and 3) (Seki et al.
2002b). Among the drought-, cold-, or high-salinity-stress-inducible genes identi-
fied, we found ca. 40 (corresponding to ca. 11% of all stress-inducible genes iden-
tified) transcription factor genes, suggesting that various transcriptional regulatory
mechanisms function in the drought-, cold-, or high-salinity-stress signal transduc-
tion pathways (Seki et al. 2002b, 2002c). Among these stress-inducible transcrip-
tion factors, there are 6 DREB family cDNAs, 2 ethylene-responsive element
binding factor (ERF) family cDNAs, 10 zinc finger family cDNAs, 4 WRKY fam-
ily cDNAs, 3 MYB family cDNAs, 2 basic helix-loop-helix (bHLH) family
cDNAs, 4 bZIP family cDNAs, 5 NAC family cDNAs, and 3 homeodomain-
leucine zipper (HD-ZIP) transcription factor family cDNAs. These transcription
factors probably regulate various stress-inducible genes cooperatively or sepa-
rately. Among 6 protein kinase genes, we found 2 receptor-like protein kinase
genes. These regulatory proteins are thought to function in further regulating vari-
ous functional genes under stress conditions. Functional analysis of these stress-
inducible transcription factors or protein kinase genes should provide more infor-
mation on signal transduction in responses to drought, cold and high-salinity
stresses.
Fig. 3. High salinity stress-inducible genes and their possible functions in stress tolerance
and response. Gene products are classified into two groups. The first group (Functional pro-
teins) includes proteins that probably function in stress tolerance. They are protection fac-
tors such as chaperones and LEA proteins, proteins involved in repair and protection from
damages, such as proteinases, and plant defense-related proteins, membrane proteins such
as SOS1 (Shi et al. 2000), protein synthesis-related proteins, proteins involved in synthesis
of osmoprotectant (proline, sugars and RFO), senescence-related proteins, proteins in-
volved in cellular metabolic processes, such as carbohydrate metabolism, secondary me-
tabolism, biosynthesis of plant hormones (ABA, ethylene and IAA), proteins regulated by
plant hormones (ABA and JA), RNA-binding proteins, cytochrome P450, alcohol dehydro-
genase and aldehyde dehydrogenase. The second group (Regulatory proteins) contains pro-
tein factors involved in further regulation of signal transduction and gene expression that
probably function in stress response. They are transcription factors such as DREB family,
ERF family, zinc finger family, WRKY family, MYB family, MYC family, HD-ZIP fam-
ily, bZIP family and NAC family, protein kinases such as MAPK (Mizoguchi et al. 1996),
MAPKKK (Mizoguchi et al. 1996), CDPK (Urao et al. 1994), S6K (Mizoguchi et al. 1996),
HK (Urao et al. 1999) and RPK (Hong et al. 1997), protein phosphatases such as PP2C, PI
turnover-related proteins, such as PLC (Hirayama et al. 1995), PLD (Katagiri et al. 2001),
and PIP5K (Mikami et al. 1998), calmodulin-binding proteins and Ca2+-binding proteins.
The list of the high-salinity-stress-inducible genes identified by the cDNA microarray
analysis (Seki et al. 2002b) is available at http://pfgweb.gsc.riken.go.jp/index.html (as sup-
plemental table 2).
Various genes involved in the metabolism of ABA, ethylene, jasmonic acid

(JA), and auxin, and JA- or auxin-regulated genes were identified as drought-
inducible genes (Fig. 2; Supplemental table 1) (Seki et al. 2002b), suggesting the
link between ethylene, JA, and auxin, and drought-stress-signaling pathways.
Also, aldehyde dehydrogenase genes, genes related to secondary metabolism,
genes involved in various cellular metabolic processes, genes encoding membrane
proteins and cytochrome P450 were identified as drought- or high-salinity-stress-
inducible genes (Figs. 2 and 3; Supplemental tables 1 and 2) (Seki et al. 2002b).
At present, the functions of most of these genes are not fully understood. Further-
more, we found many drought-, cold-, or high-salinity-stress-inducible genes
whose functions are unknown.
10.4.1 Cold-inducible genes and stress-downregulated genes

identified using RAFL cDNA microarray
Among the cold-inducible genes identified, 9 genes did not contain DRE or DRE-
related CCGAC core motif in their promoters. These results suggest the existence
of novel cis-acting elements involved in cold-inducible gene expression (Seki et
al. 2002b).
Analysis of the expression profiles of cold-inducible genes during cold treat-
ment showed the existence of at least 2 groups that show different expression pro-
files (Seki et al. 2002b). In one group containing the DREB1A gene, gene expres-
sion was rapid and transient in response to cold treatment, reached a maximum at
Fig. 4. Cold stress-inducible genes and their possible functions in stress tolerance and re-
sponse. Gene products are classified into two groups. The first group (Functional proteins)
includes proteins that probably function in stress tolerance. They are protection factors such
as LEA proteins, proteins involved in repair and protection from damages, such as plant de-
fense-related proteins, membrane proteins, proteins involved in synthesis of osmoprotectant
(proline, sugars and RFO), proteins involved in cellular metabolic processes, such as β-
amylase, cellular structure and organization-related proteins such as pectine esterase, senes-
cence-related proteins, and respiration-related proteins such as flavin-containing monooxy-
genase. The second group (Regulatory proteins) contains protein factors involved in further
regulation of signal transduction and gene expression that probably function in stress re-
sponse. They are transcription factors such as DREB family, zinc finger family, MYB fam-
ily, protein kinases such as MAPK (Mizoguchi et al. 1996), MAPKKK (Mizoguchi et al.
1996), S6K (Mizoguchi et al. 1996), HK (Urao et al. 1999) and RPK (Hong et al. 1997), PI
turnover-related proteins, such as PLC (Hirayama et al. 1995). The list of the cold stress-
inducible genes identified by the cDNA microarray analysis (Seki et al. 2002b) is available
at http://pfgweb.gsc.riken.go.jp/index.html (as supplemental table 3).
2 hours, and then decreased (Seki et al. 2002b). In the other group containing
DREB1A target genes, such as rd29A, erd10, cor15A, rd17, kin2, and RAFL06-
16-B22 genes, their expression increased slowly and gradually after cold treatment
within 10 hours (Seki et al. 2002b). The expression of the DREB1A gene during
cold stress preceded that of the DREB1A target genes. These results support our
previous results that DREB1A regulates the expression of the DREB1A target
genes, such as rd29A, erd10, cor15A, rd17, kin2, and RAFL06-16-B22 genes (Ka-
suga et al. 1999; Seki et al. 2001a).
Analysis of stress-downregulated as well as stress-upregulated genes is impor-
tant in understanding of molecular responses to abiotic stresses. We identified
many drought-, high-salinity-, cold-stress-, or ABA-downregulated genes by mi-
croarray analysis (Seki et al. 2002b, 2002c). The list and the expression data on
these drought-, cold-, high-salinity-stress-, or ABA-downregulated genes is avail-
able at http://www.gsc.riken.go.jp/Plant/index.html. Among the drought-, cold-,
high-salinity-stress-, or ABA-downregulated genes, we found many photosynthe-
sis-related genes, such as ribulose 1,5-bisphosphate carboxylase small subunit
(rbcS), chlorophyll a/b-binding protein (cab), and the components of photosystem
I and II. These results are consistent with the previous report that water stress in-
hibits photosynthesis (Tezara et al. 1999).
10.4.2 Application of RAFL cDNA microarray to study the expression

profiles under abiotic stress conditions
Simpson et al. (2003) showed that a 14-bp region (CACTAAATTGTCAC; site-1-

like sequence) from –599 to –586, and a myc recognition element (CATGTG)
from –466 to –461 in the promoter region of the erd1 gene encoding a regulatory
subunit of Clp protease (Kiyosue et al., 1993, 1994; Nakashima et al., 1998) are
responsible for gene expression during dehydration. To assess the frequency with
which the sequence with homology to the core sequence of the site-1 motif, and
the myc recognition element (CATGTG), occur together in the promoter regions
of dehydration-inducible genes, a homology search for these two sequences within
the promoter regions of dehydration-inducible genes was performed. Of the 100
drought-, cold-, high-salinity-stress-, or ABA-inducible genes (Seki et al. 2002b,
2002c) that show the greatest degree of induction by dehydration, 22 contained
both the putative core motif of the site-1-like sequence (in either forward or com-
plementary orientation) and the putative myc recognition sequence in their pro-
moter regions (Simpson et al. 2003). Examination of the data revealed that just
under 50% of the 22 genes show similar pattern of expression in response to de-
hydration, high salinity, ABA and cold treatment as that of the erd1 gene; such
that induction by dehydration > high salinity > ABA > cold, and that 21 have low
levels of induction in response to cold stress. These results suggest that these se-
quences may also function as novel cis-acting elements in stress-responsive gene
expression (Simpson et al. 2003).
The transgenic plants overexpressing AtMYC2 and/or AtMYB2 cDNAs have
higher sensitivity to ABA (Abe et al. 2003). Abe et al. (2003) studied the expres-
sion profiles in the transgenic plants overexpressing AtMYC2 and/or AtMYB2
cDNAs using the RAFL cDNA microarray. mRNAs prepared from
35S:AtMYC2/AtMYB2 and wild type plants were used for the generation of Cy3-
labeled and Cy5-labeled cDNA probes, respectively. Microarray analysis of the
transgenic plants revealed that several ABA-inducible genes were upregulated in
the 35S:AtMYC2/AtMYB2 transgenic plants. Abe et al. (2003) searched for the
MYC recognition sequence (CANNTG) and the MYB recognition sequences
(A/TAACCA and C/TAACG/TG) located within the 10- to 600-bp upstream re-
gion from each putative TATA box in the promoter regions of the 32 upregulated
genes identified. Abe et al. (2003) found that 29 genes have the MYC recognition
sequence, 29 genes have the MYB recognition sequence, and 26 genes have both
MYC and MYB recognition sequences in their promoter regions. Ds insertion mu-
tant of the AtMYC2 gene was less sensitive to ABA and showed significantly de-
creased ABA-induced gene expression of rd22 and AtADH1. These results indi-
cated that both AtMYC2 and AtMYB2 function as transcriptional activators in
ABA-inducible gene expression under drought stress conditions in plants.
In rice, Dubouzet et al. (2003) isolated five cDNAs for DREB homologs: Os-
DREB1A, OsDREB1B, OsDREB1C, OsDREB1D, and OsDREB2A. Expression of
OsDREB1A and OsDREB1B was induced by cold stress, whereas expression of
OsDREB2A was induced by dehydration and high-salinity stresses. The Os-
DREB1A and OsDREB2A proteins specifically bound to DRE and activated the
transcription of the GUS reporter gene driven by DRE in rice protoplasts. Overex-
pression of OsDREB1A in transgenic Arabidopsis plants resulted in improved tol-
erance to drought, high-salinity, and freezing stresses, indicating that OsDREB1A
has functional similarity to DREB1A (Dubouzet et al. 2003). Several OsDREB1A
target genes were identified by the cDNA microarray and RNA gel blot analyses.
Computer analysis showed that the seven OsDREB1A target genes have at least
one core GCCGAC sequence as the DRE core motif in their promoter regions.
Some of the DREB1A target genes such as kin1, kin2, and erd10, containing
ACCGAC but not GCCGAC as the DRE core motifs in their promoter regions,
were not overexpressed in the 35S:OsDREB1A plants. These results indicated that
the OsDREB1A protein binds more preferentially to GCCGAC than to ACCGAC
in the promoter regions, whereas the DREB1A protein binds to both GCCGAC
and ACCGAC efficiently (Dubouzet et al. 2003).
Proline (Pro) is one of the most widely distributed osmolytes in water-stressed
plants. L-Pro is metabolized to L-Glu via ∆1-pyrroline-5-carboxylate (P5C) by two
enzymes, Pro dehydrogenase (ProDH) and P5C dehydrogenase (Strizhov et al.
1997; Yoshiba et al. 1997). The ProDH gene in Arabidopsis is upregulated not
only by rehydration after dehydration, but also by L-Pro and hypoosmolarity (Ki-
yosue et al. 1996; Nakashima et al. 1998). Satoh et al. (2002) analyzed the pro-
moter regions of ProDH to identify cis-acting elements involved in L-Pro-induced
and hypoosmolarity-induced expression in transgenic tobacco and Arabidopsis
plants. Satoh et al. (2002) found that a 9-bp sequence, ACTCATCCT, in the
ProDH promoter is necessary for the efficient expression of ProDH in response to
L-Pro and hypoosmolarity and that the ACTCAT sequence is a core cis-acting
element. To elucidate whether the promoter region of the other L-Pro-inducible
genes have the ACTCAT sequence, Satoh et al. (2002) used the RAFL cDNA mi-
croarray and found that 27 L-Pro-inducible genes identified have the ACTCAT
sequence in their promoter regions. 21 genes among the 27 genes showed L-Pro-
inducible expression based on RNA gel blot analysis. These results suggest that
the ACTCAT sequence is conserved in many L-Pro-inducible promoters and plays
a key role in L-Pro-inducible gene expression. The microarray analysis also
showed that some L-Pro-inducible genes do not have the ACTCAT sequences in
their promoter regions, suggesting the existence of other cis-acting elements for L-
Pro-inducible gene expression.
10.5 Application of Arabidopsis GeneChip to study the

expression profiles under abiotic stress conditions
Recently, several studies on the expression profiling under abiotic stress condi-
tions using Arabidopsis GeneChip provided by Affymetrix Co. (Zhu et al. 2001)
have been published. The GeneChip used includes probes for 8,300 Arabidopsis
genes and forty probes for spiking and negative controls (Zhu et al. 2001). For
each gene, there are sixteen probe pairs (probe sets) including perfect match
probes and mismatch probes to control for non-specific binding (Zhu et al. 2001).
In this session, we also summarize the studies on the expression profiling under
abiotic stress conditions using Arabidopsis GeneChip.
Recently, Kreps et al. (2002) studied the expression profiles in leaves and roots
from Arabidopsis subjected to salt (100mM NaCl), hyperosmotic (200 mM man-
nitol), and cold (4°C) stress treatments. RNA samples were collected separately
from leaves and roots after 3- and 27-hour stress treatments. Kreps et al. (2002)
identified a total of 2,409 unique stress-regulated genes that displayed a greater
than 2-fold change in expression compared with control. The results suggested the
majority of changes were each stress-specific. At the 3-hour time point, less than
5% (118 genes) of the changes were observed as shared by all three stress re-
sponses, and by 27 hours, the number of shared responses was reduced more than
10-fold (< 0.5%). Roots and leaves displayed very different changes. For example,
less than 14% of the cold-specific changes were shared between roots and leaves
at both 3 and 27 hours. The gene with the largest induction under all three stress
treatments was rd29A/lti78/cor78, with induction levels in roots greater than 250-
fold for cold, 40-fold for mannitol, and 57-fold for NaCl. Kreps et al. (2002) iden-
tified 306 stress-regulated genes among the 453 known circadian controlled genes
(Harmer et al. 2000). These results suggested that ca. 68% of the circadian con-
trolled genes are linked to a stress response pathway and supported the hypothesis
that an important function of the circadian clock is to “anticipate” predictable
stresses such as cold nights.
Chen et al. (2002) used the expression profiles generated from the GeneChip
experiments to deduce the functions of genes encoding known and putative Arabi-
dopsis transcription factors. The expression levels of the 402 transcription factor
genes were monitored in various organs, at different developmental stages, and
under various biotic and abiotic stresses. A two-dimensional matrix (genes versus
treatments or developmental stages/tissues) describing the changes in the mRNA
levels of the 402 transcription factor genes was constructed for these experiments.
The data represent 19 independent experiments, with samples derived from differ-
ent organs such as roots, leaves, inflorescence stems, flowers, and siliques and at
different developmental stages (Zhu et al. 2001) and >80 experiments representing
57 independent treatments with cold, salt, osmoticum, wounding, jasmonic acid,
and different types of pathogens at different time points. The results showed that
the transcription factors potentially controlling downstream gene expression in
stress signal transduction pathways were identified by observed activation and re-
pression of the genes after certain stress treatments and that the mRNA levels of a
number of previously characterized transcription factor genes were changed sig-
nificantly in connection with other regulatory pathways, suggesting their multi-
functional nature (Chen et al. 2002). Among the 43 transcription factor genes that
are induced during senescence, 28 of them also are induced by stress treatment,
suggesting that the signaling pathway activated by senescence may overlap sub-
stantially with the stress signaling pathways (Chen et al. 2002). The statistical
analysis of the promoter regions of the genes responsive to cold stress indicated
that two elements, the ABRE-like element and the DRE-like element (Shinozaki
and Yamaguchi-Shinozaki 2000) occur at significantly higher frequencies in the
promoters from the late cold response cluster than their average frequency in all of
the promoters of the genes on the Arabidopsis Genechip (Chen et al. 2002). These
results suggest that ABRE-like element and DRE-like element are two major ele-
ments that are important for the transcriptional regulation of genes in the late cold
response cluster.
Hugouvieux et al. (2001) isolated a recessive ABA hypersensitive Arabidopsis
mutant, abh1. ABH1 encodes a functional mRNA cap binding protein. DNA chip
experiments showed that 18 genes including RD20, KIN2, and COR15b had sig-
nificant and 3-fold reduced transcript levels in the abh1 mutant, and 7 of these
genes are ABA-regulated in the wild type. Consistent with these results, abh1
plants showed ABA-hypersensitive stomatal closing and reduced wilting during

drought. Hugouvieux et al. (2001) showed ABA-hypersensitive cytosolic calcium
increases in abh1 guard cells. These results indicate a functional link between
mRNA processing and modulation of early ABA signal transduction.
Recently, Fowler and Thomashow (2002) identified 306 cold-regulated genes
and 41 DREB/CBF-regulated genes using Affymetrix Gene Chip (Fowler and
Thomashow 2002). This report expanded on the findings of Seki et al. (2001a) by
describing the expression of ca. 8,000 genes after transfer of plants to cold tem-
perature. Several differences between our results (Seki et al. 2001a, 2002b) and
those of Fowler and Thomashow exist. This difference may be due to differences
in gene annotation, expression profiling methods, ecotypes used and plant growth
conditions. As the original Affymetrix annotation table was outdated, the Affy-
metrix annotation table should be updated with the improved Arabidopsis genome
annotation data (Ghassemian et al. 2001; Garcia-Hernandez et al. 2002), and then
the expression profiling data should be rechecked.
10.6 Abiotic stress-inducible genes identified using

microarrays in monocots
Several other similar studies reported gene expression profile analysis under
abiotic stress in other plant species, such as rice (Bohnert et al. 2001; Kawasaki et
al. 2001) and barley (Ozturk et al. 2002). Kawasaki et al. (2001) analyzed the ex-
pression profiles using cDNA microarray including ca. 1700 cDNAs under salt
stress conditions in rice and reported similar results that transcripts of protease in-
hibitor, beta-glucosidase, detoxification enzyme, water channel protein, and pro-
tein synthesis-related genes are upregulated after salt stress. Ozturk et al. (2002)
analyzed the expression profiles using cDNA microarray including ca. 1500
cDNAs under drought and salt stressed conditions in barley and also reported
similar results that transcripts of ∆1-pyrroline-5-carboxylate synthetase (P5CS)
and ERD1 homologs in barley are upregulated after drought and salt stress treat-
ments.
10.7 Conclusions and perspectives
The cDNA microarray analysis includes useful material with which to analyze the
expression pattern of Arabidopsis genes under drought-, cold-, or high-salinity-
stresses, to identify target genes of stress-related transcription factors, and to iden-
tify potential cis-acting DNA elements by combining the expression data with the
genomic sequence data. By the expression profiling approach, more than 300
drought-, cold-, or high-salinity-stress-inducible genes and 40 drought-, cold-, or
high-salinity-stress-inducible transcription factor genes have been identified, sug-
gesting that various transcriptional regulatory mechanisms function in these stress
signal transduction pathways. Functional analysis of these drought-, cold-, or

high-salinity-stress-inducible genes should provide more information on the signal
transduction in these stress responses.
By genetic approaches and biochemical analyses of signal transduction and
stress tolerance of drought, cold, and high-salinity stress, several mutants on the
signal transduction and stress tolerance of these stresses have been identified
(Browse and Xin 2001; Finkelstein et al. 2002; Knight and Knight 2001; Xiong et
al. 2002; Zhu 2002). In a genetic screen using a firefly luciferase reporter gene
(LUC) under the control of the RD29A promoter, Zhu’s group isolated several
Arabidopsis mutants with altered induction of stress-responsive genes under
drought, high-salinity, cold and ABA treatments (Ishitani et al. 1997). Compared
with wild type RD29A-LUC plants, mutants exhibited either a constitutive (cos),
high (hos), or low (los) level of RD29A-LUC expression in response to various
stress or ABA treatments (Ishitani et al. 1997; Xiong and Zhu 2001, 2002; Xiong
et al. 2002; Zhu 2002). These mutants might be involved in the activation of the
DRE/CRT class genes. The Arabidopsis salt overly sensitive (sos) mutants (sos1,
sos2, sos3 and sos4) were also identified by genetic screening for seedlings that
were hypersensitive to growth inhibition by NaCl stress (Liu and Zhu 1998; Liu et
al. 2000; Shi et al. 2000, 2002). The sos1, sos2 and sos3 mutants are hypersensi-
tive to salt stress, but activation of the DRE/CRT class of genes seems to be un-
changed in them. Reverse genetic approaches, such as transgenic analyses, have
also become useful for studying the function of the signaling components (Apse
and Blumwald 2002; Finkelstein et al. 2002; Gong et al. 2002; Guo et al. 2002;
Hasegawa et al. 2000; Iuchi et al. 2001; Xiong et al. 2002).
The availability of the Arabidopsis genome sequence will not only greatly fa-
cilitate the isolation of mutations identified by the above genetic screen, but also
offer many other useful opportunities to study stress signal transduction. Genome-
wide expression profiling of the stress-resistant or stress-sensitive mutants, and
mutants on the stress signal transduction should help identify more genes that are
regulated at the transcriptional level by the signaling components. Moreover, full-
length cDNAs (Seki et al. 2002a) are useful resources for transgenic analyses,
such as overexpression, antisense suppression, and double-stranded RNA interfer-
ence (dsRNAi) and biochemical analyses to study the function of the encoded pro-
teins. T-DNA- or transposon-knockout mutants also offer the opportunity to study
the function of the genes. Genome-wide protein interaction studies will help to
identify the interactions among signaling components and to construct the signal
networks ‘dissected’ with the above genetic analysis. The information generated
by focused studies of gene function in Arabidopsis will be the springboard for a
new wave of strategies to improve the dehydration, high-salinity, and cold toler-
ance in agriculturally important crops.
Acknowledgements
This work was supported in part by a grant for Genome Research from RIKEN,
the Program for Promotion of Basic Research Activities for Innovative Biosci-
ences, the Special Coordination Fund of the Science and Technology Agency, and
a Grant-in-Aid from the Ministry of Education, Culture, Sports, Science and
Technology of Japan (MECSST) to K.S. It was also supported in part by a Grant-
in-Aid for Scientific Research on Priority Areas (C) ‘Genome Science’ from
MECSST to M.S.
References

AtMYC2 (bHLH) and AtMYB2 (MYB) Function as Transcriptional Activators in Ab-
scisic Acid Signaling. Plant Cell 15:63-78
Apse MP and Blumwald E (2002) Engineering salt tolerance in plants. Curr Opin Biotech-
nol 13:146-150
Bajaj S, Targolli J, Liu LF, Ho THD, Wu R (1999) Transgenic approaches to increase de-
hydration-stress tolerance in plants. Mol Breed 5:493-503
Bohnert HJ, Ayoubi P, Borchert C et al. (2001) A genomics approach towards salt stress
tolerance. Plant Physiol Biochem 39:295-311
Bray EA (1997) Plant responses to water deficit. Trends Plant Sci 2:48-54
Browse J, Xin Z (2001) Temperature sensing and cold acclimation. Curr Opin Plant Biol
4:241-246
Carninci P, Kvam C, Kitamura A, Ohsumi T, Okazaki Y, Itoh M, Kamiya M, Shibata K,
Sasaki N, Izawa M et al. (1996) High-efficiency full-length cDNA cloning by bioti-
nylated CAP trapper. Genomics 37:327-336
Carninci P, Westover A, Nishiyama Y, Ohsumi T, Itoh M, Nagaoka S, Sasaki N, Okazaki
Y, Muramatsu M, Schneider C et al. (1997) High efficiency selection of full-length
cDNA by improved biotinylated cap trapper. DNA Research 4:61-66
Carninci P, Nishiyama Y, Westover A, Itoh M, Nagaoka S, Sasaki N, Okazaki Y, Mu-
ramatsu M, Hayashizaki Y (1998) Thermostabilization and thermoactivation of ther-
molabile enzymes by trehalose and its application for the synthesis of full length
cDNA. Proc Natl Acad Sci USA 95:520-524
Chen W, Provart NJ, Glazebrook J, Katagiri F, Chang HS, Eulgem T, Mauch F, Luan S,
Zou G, Whitham SA, Budworth PR, Tao Y, Xie Z, Chen X, Lam S, Kreps JA, Harper
JF, Si-Ammour A, Mauch-Mani B, Heinlein M, Kobayashi K, Hohn T, Dangl JL,
Wang X, Zhu T (2002) Expression profile matrix of Arabidopsis transcription factor
genes suggests their putative functions in response to environmental stresses. Plant
Cell 14:559-574
Choi H, Hong JH, Ha J, Kang JY, Kim SY (2000) ABFs, a family of ABA-responsive ele-
ment binding factors. J Biol Chem 275:1723-1730
Cushman JC and Bohnert HJ (2000) Genomic approaches to plant stress tolerance. Curr
Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura S, Seki M, Shinozaki K,
Yamaguchi-Shinozaki K (2003) OsDREB genes in rice, Oryza sativa L., encode tran-
scription activators that function in drought-, high-salt- and cold-responsive gene
expression. Plant J 33:751-763
Eisen MB and Brown PO (1999) DNA arrays for analysis of gene expression. Methods En-
zymol 303:179-205
Finkelstein RR, Gampala SSL, Rock CD (2002) Abscisic acid signaling in seeds. Plant Cell
14:S15-S45
Fowler S and Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that
multiple regulatory pathways are activated during cold acclimation in addition to the
CBF cold response pathway. Plant Cell 14:1675-1690
Garcia-Hernandez M, Berardini TZ, Chen G, Crist D, Doyle A, Huala E, Knee E, Lam-
brecht M, Miller N, Mueller LA, Mundodi S, Reiser L, Rhee SY, Scholl R, Tacklind J,
Weems DC, Wu Y, Xu I, Yoo D, Yoon J, Zhang P (2002) TAIR: a resource for inte-
grated Arabidopsis data. Funct Integr Genomics 2: 239-253
Ghassemian M, Waner D, Tchieu J, Gribskov M, Schroeder JI (2001) An integrated Arabi-
dopsis annotation database for Affymetrix Genechip data analysis, and tools for regu-
latory motif searches. Trends Plant Sci 6:448-449
Gong D, Zhang C, Chen X, Gong Z, Zhu, JK (2002) Constitutive activation and transgenic
evaluation of the function of an Arabidopsis PKS protein kinase. J Biol Chem
277:42088-42096
Guo Y, Xiong L, Song CP, Gong D, Halfter U, Zhu JK (2002) A calcium sensor and its in-
teracting protein kinase are global regulators of abscisic acid signaling in Arabidopsis.
Dev Cell 3: 233-244
Harmer SL, Hogenesch JB, Straume M, Chang HS, Han B, Zhu T, Wang X, Kreps JA, Kay
SA (2000) Orchestrated transcription of key pathways in Arabidopsis by the circadian
clock. Science 290:2110-2113
Hasegawa PM, Bressan RA, Zhu JK, Bohnert HJ (2000) Plant cellular and molecular re-
sponses to high salinity. Annu Rev Plant Physiol Plant Mol Biol 51:463-499
Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA ele-
ments (PLACE) database. Nucleic Acids Res 27:297-300
Himmelbach A, Hoffmann T, Leube M, Hohener B, Grill E (2002) Homeodomain protein
in Arabidopsis. EMBO J 21: 3029-3038
dopsis thaliana. Proc Natl Acad Sci USA 92: 3903-3907
Holmberg N and Bülow L (1998) Improving stress tolerance in plants by gene transfer.
Hong SW, Jon JH, Kwak JM, Nam HG (1997) Identification of a receptor-like protein
kinase gene rapidly induced by abscisic acid, dehydration, high salt, and cold treat-
ments in Arabidopsis thaliana. Plant Physiol 113:1203-1212
Hugouvieux V, Kwak JM, Schroeder JI (2001) An mRNA cap binding protein, ABH1,
modulates early abscisic acid signal transduction in Arabidopsis. Cell 106:477-487
Ishitani M, Xiong L, Stevenson B, Zhu JK (1997) Genetic analysis of osmotic and cold
stress signal transduction in Arabidopsis: interactions and convergence of abscisic
acid-dependent and abscisic acid-independent pathways. Plant Cell 9:1935-1949
Iuchi S, Kobayashi M, Taji T, Naramoto M, Seki M, Kato T, Tabata S, Kakubari Y, Yama-
guchi-Shinozaki K, Shinozaki K (2001) Regulation of drought tolerance by gene ma-
nipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid bio-
synthesis, in Arabidopsis. Plant J 27:325-333
Jaglo-Ottosen KR, Gilmour SJ, Zarka DG, Schabenberger O, Thomashow MF (1998)
Arabidopsis CBF1 overexpression induces cor genes and enhances freezing tolerance.
Science 280:104-106
Kang JY, Choi HI, Im MY, Kim SY (2002) Arabidopsis basic leucine zipper proteins that
mediate stress-responsive abscisic acid signaling. Plant Cell 14:343-357
scription factor. Nature Biotechnol 17:287-291
Katagiri T, Takahashi S, Shinozaki K (2001) Involvement of a novel Arabidopsis phosphol-
ipase D, AtPLDdelta, in dehydration-inducible accumulation of phosphatidic acid in
stress signaling. Plant J 26:595-605
Kawasaki S, Borchert C, Deyholos M, Wang H, Brazille S, Kawai K, Galbraith D, Bohnert
H (2001) Gene expression profiles during the initial phase of salt stress in rice. Plant
Cell 13:889-905
Kim HJ, Kim YK, Park JY, Kim J (2002) Light signaling mediated by phytochrome plays
an important role in cold-induced gene expression through the C-repeat/dehydration
responsive element (C/DRE) in Arabidopsis thaliana. Plant J 29:693-704
Kiyosue T, Yamaguch-Shinozaki K, Shinozaki K (1993) Characterization of a cDNA for
for a dehydration-inducible gene that encodes a Clp A, B-like protein in Arabidopsis
thaliana L. Biochem Biophys Res Commun 196:1214-1220
Kiyosue T, Yamaguchi-Shinozaki K, Shinozaki K (1994) Cloning of cDNA for genes that
are early responsive to dehydration-stress (ERDs) in Arabidopsis thaliana L. identifi-
cation of three ERDs as HSP cognate genes. Plant Mol. Biol 25:791-798
Kiyosue T, Yoshiba Y, Yamaguchi-Shinozaki K, Shinozaki K (1996) A nuclear gene en-
coding mitochondrial proline dehydrogenase, an enzyme involved in proline metabo-
lism, is upregulated by proline but downregulated by dehydration in Arabidopsis. Plant
Cell 8:1323-1335
Knight H and Knight MR (2001) Abiotic stress signalling pathways: specificity and cross-
talk. Trends Plant Sci 6: 262-267
Kreps JA, Wu Y, Chang HS, Zhu T, Wang X, Harper JF (2002) Transcriptome changes for
Arabidopsis in response to salt, osmotic, and cold stress. Plant Physiol 130:2129-2141
Liu J, Ishitani M, Halfter U, Kim CS, Zhu JK (2000) The Arabidopsis thaliana SOS2 gene
encodes a protein kinase that is required for salt tolerance. Proc Natl Acad Sci USA
97:3730-3734
Liu J and Zhu JK (1998) A calcium sensor homolog required for plant salt tolerance. Sci-
ence 280:1943-1945
Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K
(1998) The transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA
10:1391-1406
Mikami K, Katagiri T, Iuchi S, Yamaguchi-Shinozaki K, Shinozaki (1998) A gene encod-

ing phosphatidylinositol-4-phosphate 5-kinase is induced by water stress and abscisic
acid in Arabidopsis thaliana. Plant J 15:563-568
is induced simultaneously with genes for a mitogen-activated protein kinase and an S6
Nakashima K, Satoh R, Kiyosue T, Yamaguchi-Shinozaki K, Shinozaki K (1998) A gene
encoding proline dehydrogenase is not only induced by proline and hypoosmolarity,
but is also developmentally regulated in the reproductive organs of Arabidopsis. Plant
Physiol 118:1233-1241
Ozturk ZN, Talame V, Deyholos M, Michalowski CB, Galbraith DW, Gozukirmizi N, Tu-
berosa R, Bohnert HJ (2002) Monitoring large-scale changes in transcript abundance
in drought- and salt-stressed barley. Plant Mol Biol 48:551-573
Richmond T and Somerville S (2000) Chasing the dream: plant EST microarrays. Curr
Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki K (2002)
DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription
factors involved in dehydration- and cold-inducible gene expression. Biochem Biophys
Res Com 290:998-1009
Satoh R, Nakashima K, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2002) ACTCAT, a
novel cis-acting element for proline- and hypoosmolarity-responsive expression of the
ProDH gene encoding proline dehydrogenase in Arabidopsis. Plant Physiol 130:709-
719
Seki M, Carninci P, Nishiyama Y, Hayashizaki Y, Shinozaki K (1998) High-efficiency
cloning of Arabidopsis full-length cDNA by biotinylated CAP trapper. Plant J 15:707-
720
Seki M, Narusaka M, Abe H, Kasuga M, Yamaguchi-Shinozaki K, Carninci P, Hayashizaki
Y, Shinozaki K (2001a) Monitoring the expression pattern of 1300 Arabidopsis genes
under drought and cold stresses using a full-length cDNA microarray. Plant Cell
13:61-72
Seki M, Narusaka M, Yamaguchi-Shinozaki K, Carninci P, Kawai J, Hayashizaki Y, Shi-
nozaki K (2001b) Arabidopsis encyclopedia using full-length cDNAs and its applica-
tion. Plant Physiol Biochem 39:211-220
Seki M, Narusaka M, Kamiya A, Ishida J, Satou M, Sakurai T, Nakajima M, Enju A, Aki-
yama K, Oono Y, Muramatsu M, Hayashizaki Y, Kawai J, Carninci P, Itoh M, Ishii Y,
Arakawa T, Shibata K, Shinagawa A, Shinozaki K (2002a) Functional annotation of a
full-length Arabidopsis cDNA collection. Science 296:141-145
Seki M, Narusaka M, Ishida, J, Nanjo T, Fujita M, Oono Y, Kamiya A, Nakajima M, Enju
A, Sakurai T, Satou M, Akiyama K, Taji T, Yamaguchi-Shinozaki K, Carninci P,
Kawai J, Hayashizaki Y, Shinozaki K (2002b) Monitoring the expression profiles of
7000 Arabidopsis genes under drought, cold, and high-salinity stresses using a full-
length cDNA microarray. Plant J 31:279-292
Seki M, Ishida J, Narusaka M, Fujita M, Nanjo T, Umezawa T, Kamiya A, Nakajima M,
Enju A, Sakurai T, Satou M, Akiyama K, Yamaguchi-Shinozaki K, Carninci P, Kawai
J, Hayashizaki Y, Shinozaki K (2002c) Monitoring the expression pattern of ca. 7000
Arabidopsis genes under ABA treatments using a full-length cDNA microarray. Funct
Integr Genom 2:282-291
Seki M, Satou M, Sakurai T, Shinozaki K (2002d) RIKEN Arabidopsis full-length (RAFL)
cDNA database. Trends Plant Sci 7:562-563
Shi H, Ishitani M, Kim C, Zhu JK (2000) The Arabidopsis thaliana salt tolerance gene
Shi H, Xiong L, Stevenson B, Lu T, Zhu JK (2002) The Arabidopsis salt ovary sensitive 4
mutants uncover a critical role for vitamin B6 in plant salt tolerance. Plant Cell
14:575-588
Shinozaki K and Yamaguchi-Shinozaki K (1999) Molecular responses to drought stress. In
Molecular Responses to Cold, Drought, Heat and Salt Stress in Higher Plants. Edited
by Shinozaki, K. and Yamaguchi-Shinozaki, K. Austin, TX: RG Landes; pp. 11-28
Shinozaki K and Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and
low temperature: Differences and cross-talk between two stress signaling pathways.
Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K
(2003) Two different novel cis-acting elements of erd1, a clpA homologous Arabidop-
sis gene function in induction by dehydration stress and dark-induced senescence.
Plant J 33:259-270
Stockinger EJ, Gilmour SJ, Thomashow MF (1997) Arabidopsis thaliana CBF1 encodes an
AP2 domain-containing transcription activator that binds to the C-repeat/DRE, a cis-
acting DNA regulatory element that stimulates transcription in response to low tem-
perature and water deficit. Proc Natl Acad Sci USA 94:1035-1040
Strizhov N, Abraham E, Okresz L, Blickling S, Zilberstein A, Schell J, Koncz C, Szabados
L (1997) Differential expression of two P5CS genes controlling proline accumulation
during salt-stress requires ABA and is regulated by ABA1, ABI1 and AXR2 in Arabi-
dopsis. Plant J 12:557-569
Taji T, Seki M, Yamaguchi-Shinozaki K, Kamada H, Giraudat J, Shinozaki K (1999) Map-
ping of 25 drought-inducible genes, RD and ERD, in Arabidopsis thaliana. Plant Cell
Physiol 40:119-123
Taji T, Ohsumi C, Iuchi S, Seki M, Kasuga M, Kobayashi M, Yamaguchi-Shinozaki K,
Shinozaki K (2002) Important roles of drought- and cold-inducible genes for galactinol
synthase in stress tolerance in Arabidopsis thaliana. Plant J 29:417-426
Tezara W, Mitchell VJ, Driscoll SD, Lawlor DW (1999) Water stress inhibits plant photo-
synthesis by decreasing coupling factor and ATP. Nature 401:914-917
Thomas H and Stoddart JL (1980) Leaf senescence. Annu Rev Plant Physiol 31:83-111
Thomashow MF (1999) Plant cold acclimation: freezing tolerance genes and regulatory
mechanisms. Annu Rev Plant Physiol Plant Mol Biol 50: 571-599
Torres-Schumann S, Godoy JA, Pintor-Toro JA (1992) A probable lipid transfer protein
gene is induced by NaCl in stems of tomato plants. Plant Mol Biol 18:749-757
Proc Natl Acad Sci USA 97: 11632-11637
(1994) Two genes that encode Ca2+-dependent protein kinases are induced by drought
and high-salt stresses in Arabidopsis thaliana. Mol Gen Genet 244:331-340

Xiong L, Schumaker KS, Zhu JK (2002) Cell signaling during cold, drought, and salt
stress. Plant Cell Suppl:S165-183
Xiong L and Zhu JK (2001) Abiotic stress signal transduction in plants: Molecular and ge-
netic perspectives. Physiol Plant 112: 152-166
Xiong L and Zhu JK (2002) Molecular and genetic aspects of plant responses to osmotic
stress. Plant Cell Environment 25: 131-139
Yamaguchi-Shinozaki K and Shinozaki K (1994) A novel cis-acting element in an Arabi-
dopsis gene is involved in responsiveness to drought, low temperature, or high-salt
Yoshiba Y, Kiyosue T, Nakashima K, Yamaguchi-Shinozaki K, Shinozaki K (1997) Regu-
lation of levels of proline as an osmolyte in plants under water stress. Plant Cell
Physiol 38:1095-1102
Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol
53: 247-273
Zhu T, Budworth P, Han B, Brown D, Chang HS, Zou G, Wang X (2001) Toward elucidat-
ing the global gene expression patterns of developing Arabidopsis: Parallel analysis of
8300 genes by a high-density oligonucleotide probe array. Plant Physiol Biochem
39:221-242
Abbreviations
ABA: abscisic acid

aba: ABA-deficient
ABF: ABRE-binding factor
abh: ABA-hypersensitive
abi: ABA-insensitive
ABRE: ABA-responsive element
AREB: ABRE-binding protein
AtGolS: Arabidopsis galactinol synthase
bHLH: basic helix-loop-helix
bp: base pairs
bZIP: basic-domain leucine zipper
CAB: chlorophyll a/b-binding protein
CaMV: cauliflower mosaic virus
CBF: C-repeat-binding factor
CDPK: calcium-dependent protein kinase
COR: cold-regulated
cos: constitutive expression of osmotically responsive genes
CRT: C-repeat
DGK: diacylglycerol kinase
DRE: dehydration-responsive element
DREB: DRE-binding protein
dsRNAi: double-stranded RNA interference

era: enhanced response to ABA
ERD: early responsive to dehydration
ERF: ethylene-responsive element binding factor
ESTs: expressed sequence tags
GST: glutathione-S-transferase
HD-ZIP: homeodomain-leucine zipper
HK: histidine kinase
hos: high expression of osmotically responsive genes
IAA: indole-3-acetic acid
JA: jasmonic acid
KIN: cold-inducible
LEA: late embryogenesis abundant
los: low expression of osmotically responsive genes
LTI: low-temperature-induced
LUC: firefly luciferase
MAPK: mitogen-activated protein kinase
MAPKKK: mitogen-activated protein kinase kinase kinase
PAP: phosphatidic acid phosphatase
P5CS: ∆1-pyrroline-5-carboxylate synthetase
P5C: ∆ 1-pyrroline-5-carboxylate
PIP5K: phosphatidylinositol-4-phosphate-5-kinase
PLC: phospholipase C
PLD: phospholipase D
PP2C: protein phosphatase 2C
ProDH: proline dehydrogenase
RAFL: RIKEN Arabidopsis full-length
rbcs: ribulose 1,5-bisphosphate carboxylase small subunit
RFO: raffinose family oligosaccharides
RD: responsive to dehydration
RPK: receptor-like protein kinase
sEH: soluble epoxide hydrolase
S6K: ribosomal protein S6 kinase
sos: salt overly sensitive
1)
Seki et al. Supplemental Table 2. High-Salinity-stress-Inducible Genes Identified by Full-length cDNA Microarray Analysis
Functional Gene Ratio(High-Salinity/Unstressed)2) Encoded protein/Other features3) E-value MIPS4)
Category 1 hr 2 hr 5 hr 10 hr 24 hr
Av. S.D. Av. S.D. Av. S.D. Av. S.D. Av. S.D. Genbank
Transcription Factor
DREB family
DREB2A 19.25 10.51 20.55 5.51 19.46 2.76 16.12 7.55 12.12 2.01
RAFL05-11-M11 3.48 0.74 4.26 1.67 5.54 2.20 2.31 1.45 2.64 2.24 AAD55283.1 Similar to gb|X94698 TINY from Arabidopsis thaliana andcontains a PF|00847 AP2 domain. EST gb|F15362 comesfro 1.00E-87 At1g74930
RAFL06-11-K21 4.17 1.03 7.14 2.53 5.91 3.13 5.64 1.84 2.21 1.20 AAD20907.1 AP2 domain transcription factor [Arabidopsis thaliana] 6.00E-37 At2g20880
RAFL05-16-H23 4.48 0.39 10.36 5.62 4.69 1.96 5.47 5.22 5.03 5.84 T09030 hypothetical protein F26K10.20 - Arabidopsis thaliana 1.00E-88 At4g28140
ERF family
RAFL08-16-G17 5.11 2.99 2.73 0.36 3.26 0.90 2.76 0.40 5.18 2.45 O80337 ERFI_ARATH ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 1 (ATERF1) 1.00E-25 At4g17500
RAFL09-10-M16(=RAFL08-16-G17) 3.17 1.12 2.58 1.08 3.25 0.23 1.85 1.26 6.44 4.71 O80337 ERFI_ARATH ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 1 (ATERF1) 9.00E-62 At4g17500
RAFL06-08-H20 7.19 1.04 14.88 4.71 9.55 9.01 13.96 8.92 28.17 24.13 AAC36019.1 RAP2.6 [Arabidopsis thaliana] e-110 At1g43160
Zinc finger family
RAFL08-11-M13 2.70 1.01 4.35 2.61 4.30 1.53 2.54 1.60 8.03 4.29 CAA67232.1 zinc finger protein [Arabidopsis thaliana] 8.00E-35 At5g59820
RAFL05-19-G24 4.29 1.78 3.92 0.96 3.80 0.54 2.78 0.17 8.74 4.49 T51414 CONSTANS-like 1 - Arabidopsis thaliana 2.00E-93 At5g15850
WRKY family
RAFL05-18-H12 6.34 3.54 5.93 2.10 2.70 0.18 2.04 0.24 2.47 1.35 AAF14671.1 Similar to gb|Z48431 DNA-binding protein from Avenafatua. [Arabidopsis thaliana] 1.00E-79 At1g80840
RAFL05-19-E19 3.50 2.35 3.27 1.18 3.97 0.34 4.50 0.96 9.99 5.31 T00575 probable DNA-binding protein T27E13.1 - Arabidopsis thaliana At2g30250
RAFL08-18-E03(=RAFL05-19-E19) 3.95 1.80 3.77 1.45 5.82 0.66 4.28 1.77 13.17 5.36 T00575 probable DNA-binding protein T27E13.1 - Arabidopsis thaliana At2g30250
RAFL06-10-D22 2.94 1.29 3.50 0.75 2.81 1.14 2.13 0.60 5.37 3.54 CAC05436.1 WRKY-like protein [Arabidopsis thaliana] 1.00E-80 At5g13080
RAFL06-12-M01 2.53 0.50 3.09 1.27 2.18 0.52 2.07 0.89 6.09 5.18 T04919 DNA-binding protein homolog T9A21.10 - Arabidopsis thaliana 4.00E-77 At4g18170
MYB family
RAFL05-14-D24 2.48 0.55 3.92 1.38 4.49 0.96 3.37 1.86 6.83 5.74 CAB81052.1 MYB-like protein [Arabidopsis thaliana] e-114 At4g05100
bHLH family
RD22BP1 4.58 2.36 5.42 1.84 4.40 0.83 2.77 0.48 2.65 0.67
RAFL02-08-M10(=RD22BP1) 5.70 3.53 5.57 1.34 4.18 0.47 3.02 0.59 3.08 1.72 AAF25980.1 F6N18.4 [Arabidopsis thaliana] 7.00E-77 At1g32640
NAC family
RAFL07-07-G15 7.01 3.80 10.44 4.21 9.47 1.38 9.11 0.88 11.82 5.78 AAF78403.1 Strong similarity to OsNAC6 protein from Oryza sativagb|AB028185. ESTs gb|AI996805, gb|T22869 andgb|AI100172 5.00E-12
RAFL05-19-I05(=RAFL07-07-G15) 7.82 3.77 13.80 3.29 10.34 1.37 13.76 1.46 12.15 6.47 AAF78403.1 Strong similarity to OsNAC6 protein from Oryza sativagb|AB028185. ESTs gb|AI996805, gb|T22869 andgb|AI100172 4.00E-69 At1g01720
RAFL05-21-I22 6.12 2.22 8.58 1.13 9.97 0.56 8.19 1.17 11.76 9.70 BAB10472.1 contains similarity to NAC-domainprotein~gene_id:MBK5.27 [Arabidopsis thaliana] 1.00E-73 At5g63790
RAFL08-11-H20 3.77 1.63 3.82 1.81 5.39 0.64 2.41 1.20 6.84 4.02 BAB08893.1 contains similarity to NAM (no apical meristem)protein~gene_id:MIJ24.11 [Arabidopsis thaliana] 2.00E-43 At5g39610
RD26 14.33 7.63 23.02 8.77 27.28 9.55 15.46 5.83 15.97 7.94
RAFL05-21-C17(=RD26) 12.12 5.02 10.68 2.71 12.33 5.76 8.59 7.85 8.50 6.77 T08933 hypothetical protein F27G19.10 - Arabidopsis thaliana e-123 At4g27410
RAFL09-15-E01(=RD26) 11.15 3.09 9.49 3.69 17.85 2.62 5.94 6.33 9.60 6.35 T08933 hypothetical protein F27G19.10 - Arabidopsis thaliana At4g27410
RAFL08-14-A19(=RD26) 10.13 5.14 14.74 9.34 18.18 12.47 13.36 10.82 22.52 7.41 BAB10109.1 root cap protein 2-like protein [Arabidopsis thaliana] 3.00E-14 At4g27410
RAFL05-08-D06 1.31 0.26 2.16 1.38 2.33 0.62 3.15 2.23 6.40 3.35 AAF31294.1 CDS [Arabidopsis thaliana] 5.00E-79 At1g32870
Homeodomain family
RAFL05-20-M16 3.58 0.79 4.90 1.59 5.61 3.29 4.94 0.24 3.31 2.48 AAC69925.1 homeodomain transcription factor (ATHB-7) [Arabidopsisthaliana] 1.00E-66 At2g46680
RAFL11-01-J18 4.96 1.96 4.90 2.52 6.60 1.74 3.69 1.73 4.72 2.26 T47981 homeobox-leucine zipper protein ATHB-12 - Arabidopsis thaliana 1.00E-44 At3g61890
RAFL11-09-C20 2.64 1.01 2.96 0.71 5.63 1.00 3.20 0.53 4.10 1.90 AAD21463.1 putative homeodomain transcription factor [Arabidopsisthaliana] 2.00E-15 At2g35940
bZIP family
RAFL05-18-N16 2.06 0.72 2.52 1.03 2.89 0.52 2.90 0.85 5.99 5.00 AAG26018.1 bZIP transcription factor, putative [Arabidopsisthaliana] 4.00E-85 At1g42990
RAFL11-10-D10 3.95 2.08 3.99 1.86 4.54 0.55 8.50 2.26 15.58 12.32 BAB09915.1 contains similarity to bZIP transcriptionfactor~gene_id:K7J8.13 [Arabidopsis thaliana] 6.00E-57 At5g49450
RAFL04-17-N22 4.20 2.50 10.10 3.02 11.52 0.74 7.49 0.93 4.41 1.18 AAF27181.1 abscisic acid responsive elements-binding factor[Arabidopsis thaliana] 8.00E-76 At4g34010
RAFL05-09-G15 4.64 1.38 6.57 1.40 5.22 1.42 3.70 1.51 3.56 1.68 P42776 GBF3_ARATH G-BOX BINDING FACTOR 3 6.00E-63 At2g46270
Other family
RAFL05-21-L12 9.48 0.47 16.60 14.04 10.46 7.67 13.95 11.37 9.72 8.26 BAB01258.1 heat shock transcription factor-like protein[Arabidopsis thaliana] 4.00E-99 At3g22830
Protein kinase
RAFL06-07-B08 3.96 1.58 5.49 1.75 3.41 0.77 2.84 0.71 4.52 3.58 AAC16938.1 putative protein kinase [Arabidopsis thaliana] 7.00E-21 At2g30360
RAFL06-09-C11 5.21 2.85 1.93 0.62 1.76 0.57 0.99 0.05 1.62 0.83 CAA09731.1 receptor-like protein kinase, RLK3 [Arabidopsisthaliana] 6.00E-92 At4g23190
RAFL07-07-B15 5.57 2.73 6.59 2.82 4.72 2.93 3.27 2.02 13.12 11.68 T51783 AtPP-like protein - Arabidopsis thaliana At3g44860
RAFL08-08-H23 2.82 0.89 4.68 2.92 6.77 2.27 5.50 4.51 11.13 5.21 T00857 hypothetical protein T20F6.15 - Arabidopsis thaliana At2g02710
RAFL05-14-A21 1.84 1.57 3.42 2.35 2.76 1.01 5.23 0.57 5.77 0.79 T49003 protein kinase-like protein - Arabidopsis thaliana 8.00E-81 At3g59350
Protein phosphatase
RAFL09-14-O03(=ABI1) 6.51 1.58 7.28 0.42 8.71 1.24 4.71 2.43 5.75 2.59 P49597 P2C1_ARATH PROTEIN PHOSPHATASE 2C ABI1 (PP2C) 2.00E-14
RAFL05-15-E19 3.67 1.63 5.34 0.61 6.03 2.00 6.37 4.00 3.93 2.49 AAF26133.1 putative protein phosphatase-2C [Arabidopsis thaliana] 1.00E-83 At3g05640
Signaling
RAFL05-07-D07 3.07 3.53 5.53 4.40 3.58 0.91 5.74 2.93 5.52 1.69 AAC37475.1 calmodulin-binding protein [Arabidopsis thaliana] 4.00E-82 At5g65930
RD20 9.38 7.32 15.96 4.96 24.26 6.37 21.37 6.55 18.42 2.49
RAFL08-16-M12(=RD20) 9.12 3.82 13.84 6.45 31.43 5.40 10.72 8.44 24.05 18.56 AAB80656.1 putative Ca2+-binding EF-hand protein [Arabidopsisthaliana] At2g33380
RAFL05-12-B21 5.61 3.55 2.54 1.37 1.82 0.33 1.26 0.47 3.21 2.05 T02109 calmodulin-related protein T3K9.13 - Arabidopsis thaliana 2.00E-99 At2g41100
Osmoprotectant-synthesis-related genes
AtGolS2 6.97 4.03 8.95 4.17 10.28 2.65 5.86 3.76 5.29 1.79
RAFL08-08-L20(=AtGolS2) 5.45 2.51 6.18 1.98 11.09 3.23 6.45 0.76 5.46 2.36 AAG09103.1 Putative galactinol synthase [Arabidopsis thaliana] 9.00E-23
Atp5CS 2.74 0.20 4.46 1.10 9.69 0.67 3.54 0.74 5.09 3.13
RAFL05-20-O23(=AtP5CS) 2.47 0.40 4.07 1.04 8.77 1.92 3.71 1.37 5.82 4.39 O04226 P5CS_ORYSA DELTA 1-PYRROLINE-5-CARBOXYLATE SYNTHETASE (P5CS) [INCLUDES:GLUTAMATE 5-KINAS 5.00E-29 At2g39800
RAFL05-18-M07 1.72 0.47 2.25 0.59 5.19 1.11 3.29 0.24 5.84 2.00 CAB80721.1 putative sucrose synthetase [Arabidopsis thaliana] 5.00E-83 At4g02280
RAFL11-13-K15 1.97 0.54 1.94 0.62 6.35 0.37 2.08 1.65 2.83 2.25 AAB71970.1 nearly identical to rice water stress induced proteingp|D26537|537404 [Arabidopsis thaliana] 2.00E-34 At1g60470
RAFL05-13-B06 5.73 2.80 4.07 0.47 6.03 1.03 3.15 1.19 6.24 2.31 AAD08939.1 putative trehalose-6-phosphate synthase [Arabidopsisthaliana] 3.00E-87 At2g18700
RAFL05-19-C02 1.14 0.29 1.92 0.59 3.37 0.54 3.22 1.06 5.66 3.19 T46188 imbibition protein homolog - Arabidopsis thaliana 3.00E-79 At3g57520
Protein degradation
ERD1 2.62 1.80 3.60 0.68 4.35 0.58 4.36 1.56 5.92 1.02
RAFL09-15-D15(=ERD1) 1.96 1.32 2.52 1.51 3.60 1.44 3.92 0.41 7.85 2.06 P42762 ERD1_ARATH ERD1 PROTEIN PRECURSOR 3.00E-36 At5g51070
RD21 1.29 0.43 1.88 0.54 4.76 1.03 3.94 0.58 5.09 1.34
RAFL05-13-E04 1.98 0.59 2.99 0.55 5.92 1.24 4.15 0.68 5.38 1.37 BAA94978.1 contains similarity to similar to ubiquitin conjugatingenzyme~gene_id:K14A17.7 [Arabidopsis thaliana] 1.00E-84 At3g17000
LEA protein
RAFL09-17-M11(=ERD10) 12.79 5.63 9.61 3.34 8.06 0.92 4.01 1.70 3.03 1.89 P42759 DH10_ARATH DEHYDRIN ERD10 (LOW-TEMPERATURE-INDUCED PROTEIN LTI45) 3.00E-54 At1g20450
RAFL05-08-P17(=ERD10) 7.85 3.07 7.32 2.17 5.88 0.50 2.06 0.05 1.85 0.68 P42759 DH10_ARATH DEHYDRIN ERD10 (LOW-TEMPERATURE-INDUCED PROTEIN LTI45) 1.00E-88 At1g20450
RAFL05-12-E14 2.01 0.69 2.27 0.49 2.06 0.14 1.75 0.87 5.76 6.29 AAC17827.1 putative LEA (late embryogenesis abundant) protein[Arabidopsis thaliana] 3.00E-40 At2g23110
RAFL05-17-B13 5.72 1.70 6.65 1.26 5.69 0.85 4.37 1.95 4.13 3.16 CAA71174.1 putative desication related protein LEA14 [Arabidopsisthaliana] 2.00E-81 At1g01470
RAFL08-11-C23 2.42 0.96 2.03 0.25 5.47 4.61 1.09 0.26 1.68 1.13 BAB09810.1 late embryogenesis abundant protein LEA like[Arabidopsis thaliana] 1.00E-34 At5g06760
RAFL06-13-J20(=FL6-55) 2.34 1.31 5.88 2.68 24.28 5.17 12.02 6.76 38.90 21.82 CAA63012.1 LEA76 homologue type1 [Arabidopsis thaliana] 3.00E-89 At1g52690
RAFL05-04-I14(=RAFL06-13-J20) 1.31 0.31 1.65 0.55 5.18 1.75 4.80 3.47 11.05 9.05 E71604 hypothetical protein PFB0870w - malaria parasite (Plasmodiumfalciparum)
RD17 5.69 1.95 6.43 1.95 6.85 1.05 3.25 0.37 2.87 1.07
RAFL04-20-N09(=RD17) 5.92 1.55 6.17 1.51 6.18 1.62 3.20 0.59 3.37 1.85 P31168 DH47_ARATH DEHYDRIN COR47 (COLD-INDUCED COR47 PROTEIN) 3.00E-90 At1g20440
RAFL05-03-I09(=Rab18) 2.02 0.45 2.69 0.41 4.69 1.64 6.32 4.18 9.49 5.53 P30185 DH18_ARATH DEHYDRIN RAB18 At5g66400
Hydrophilic protein (unknown function)

RD29A 10.39 8.39 16.25 13.81 15.09 14.64 4.15 4.27 3.83 3.31
RAFL04-17-F01(=RD29A) 10.17 3.83 14.59 2.92 9.77 2.32 3.68 0.69 3.70 2.49 AAA32776.1 cor78 [Arabidopsis thaliana] 5.00E-82 At5g52310
RAFL07-11-M21(=RD29A) 11.12 3.36 11.40 3.78 10.22 3.98 3.95 1.79 4.04 2.93 AAB25481.1 AAB25481.1| RD29A=responsive-to-dessication protein [Arabidopsis thaliana,Columbia ecotype, Peptide, 710 aa] 6.00E-40 At5g52310
RD29-B3'-DNA 2.08 0.75 2.41 0.84 13.58 4.37 3.10 2.24 7.66 4.16
RAFL05-11-I09(=RD29B) 4.79 2.77 6.01 4.86 31.30 23.92 6.02 2.93 23.06 28.55 BAB10527.1 low-temperature-induced 65 kD protein [Arabidopsisthaliana] At5g52300
KIN protein
kin1 6.21 1.14 9.93 0.50 11.87 1.44 4.21 0.70 2.75 1.45
RAFL06-08-N16(=kin1) 4.61 0.67 6.87 0.87 8.77 1.08 3.99 1.44 4.19 4.04 P18612 KIN1_ARATH STRESS-INDUCED KIN1 PROTEIN 4.00E-29 At5g15960
kin2 5.18 1.40 7.71 3.03 9.40 3.26 4.77 1.27 2.91 1.19
RAFL04-17-B12(=kin2) 5.67 0.97 7.86 0.77 9.64 0.86 4.85 0.76 3.12 1.54 P31169 KIN2_ARATH STRESS-INDUCED KIN2 PROTEIN (COLD-INDUCED COR6.6 PROTEIN) At5g15970
Detoxification enzyme
RAFL04-17-K13 3.68 1.59 7.43 3.80 4.29 0.35 3.61 0.50 5.47 3.81 AAC95192.1 putative glutathione S-transferase [Arabidopsisthaliana] 6.00E-68 At2g29460
RAFL05-14-J01 5.80 0.94 3.82 0.88 3.80 0.04 3.83 0.58 4.16 2.28 P46421 GTXA_ARATH GLUTATHIONE S-TRANSFERASE 103-1A e-107 At2g29450
RAFL08-17-O07(=RAFL05-14-J01) 9.36 3.71 6.10 1.03 5.92 2.13 4.05 0.62 3.69 1.77 P46421 GTXA_ARATH GLUTATHIONE S-TRANSFERASE 103-1A 2.00E-47 At2g29450
RAFL08-09-P11 5.02 1.61 1.68 0.38 1.39 0.16 0.84 0.14 0.93 0.38 AAD29446.1 phytochelatin synthase 1 [Arabidopsis thaliana] At5g44070
Heat shock protein

RAFL09-06-L09 5.83 2.53 3.20 2.29 3.86 1.07 6.03 4.07 6.85 5.22 CAB72130.1 heat shock protein 70 [Cucumis sativus] 8.00E-26 At3g12580
RAFL06-15-N16 3.01 0.29 6.43 1.20 6.67 3.80 9.92 0.94 17.45 15.77 T49264 heat shock protein 17 - Arabidopsis thaliana 8.00E-85 At3g46230
RAFL08-19-P05 6.78 2.27 4.30 2.00 10.54 7.08 8.17 9.43 8.97 4.10 AAF26423.1 heat shock protein 101 [Arabidopsis thaliana] 6.00E-74
RAFL05-14-C07 1.98 0.96 5.32 1.41 4.05 0.51 6.17 2.57 9.22 7.55 AAF18501.1 Identical to gb|AJ002551 heat shock protein 70 fromArabidopsis thaliana and contains a PF|00012 HSP 70domain. ES 4.00E-90 At1g16030
Lipid transfer protein

RAFL05-12-N10 1.39 0.30 3.09 1.76 7.71 4.46 4.75 2.97 6.06 4.08 AAD32784.1 hypothetical protein [Arabidopsis thaliana] At2g37870
Transport protein, Ion channel, Carrier

RAFL07-17-D16 1.55 0.43 2.06 0.43 5.04 2.90 1.86 1.08 6.19 2.41 AAG27790.1 oligopeptide transporter, putative [Arabidopsis thaliana]
RAFL05-17-O23 1.26 0.39 1.53 0.41 4.05 0.64 3.37 1.17 5.42 4.22 BAA87831.1 Similar to Arabidopsis thaliana chromosome II BAC T27A16sequence; hypothetical protein. (AC005496) [Oryzasativa] 6.00E-24 At5g20380
RAFL09-12-D09 1.19 0.48 1.54 0.49 2.02 0.40 2.88 0.36 8.31 3.91 AAD14460.1 putative chloroplast protein import component[Arabidopsis thaliana] 2.00E-34 At4g03320
Membrane protein
RAFL05-21-K17 4.00 1.29 5.40 0.80 6.39 1.14 5.95 0.96 10.39 5.79 BAB11579.1 membrane related protein-like [Arabidopsis thaliana] 6.00E-87 At5g54170
RAFL06-16-B22(=FL3-5A3) 2.98 0.38 4.94 1.29 6.30 1.75 2.98 1.50 2.87 2.80 AAD41971.1 putative low temperature-regulated protein [Arabidopsisthaliana] e-106 At2g15970
RAFL09-16-O21 2.96 1.69 3.25 1.50 4.63 3.46 2.43 1.72 8.94 4.64 AAF24840.1 putative integral membrane protein; 47574-45498[Arabidopsis thaliana] 4.00E-44 At1g66760
Fatty acid metabolism, Lipids

RAFL07-08-E05 2.09 0.48 4.33 0.65 4.76 0.46 2.75 0.83 5.06 3.16 AAF36744.1 putative lipase; 80914-78480 [Arabidopsis thaliana] 1.00E-43 At1g73920
RAFL05-10-D11 6.94 2.19 7.85 2.88 8.66 1.46 5.63 1.72 6.28 3.76 AAG30967.1 lysophospholipase homolog, putative [Arabidopsisthaliana] 9.00E-55 At1g73480
RAFL05-14-M10 1.34 0.20 1.69 0.25 2.76 0.84 2.78 1.80 13.96 13.58 BAB08297.1 contains similarity to lipase~gene_id:MUA22.18[Arabidopsis thaliana] At5g14180
RAFL05-18-O21 2.51 1.24 3.72 1.18 4.92 0.54 4.59 0.65 6.60 1.71 AAB63082.1 putative lipase [Arabidopsis thaliana] e-104 At2g30550
Cytochrome P450
RAFL04-16-P21 6.81 2.91 8.43 2.77 9.44 6.90 8.78 5.08 21.96 19.38 T04731 cytochrome P450 homolog F6G17.20 - Arabidopsis thaliana e-111 At4g37370
RAFL05-15-C04 7.18 2.44 7.82 3.68 4.19 1.39 2.54 1.25 4.63 4.04 T46196 cytochrome P450-like protein - Arabidopsis thaliana e-120 At3g48520
RAFL08-11-J17 3.44 2.32 6.16 2.49 5.25 0.57 2.93 1.78 3.38 0.90 T04730 cytochrome P450 homolog F6G17.10 - Arabidopsis thaliana At3g28740
RAFL08-17-C04 2.70 1.83 2.62 1.49 2.58 0.84 3.23 0.62 7.88 5.09 BAB00165.1 cytochrome P450 [Arabidopsis thaliana] 2.00E-64 At3g26220
RAFL08-19-C07 1.62 0.36 2.33 0.90 8.68 3.18 6.62 6.13 28.86 28.08 O64637 C7C2_ARATH CYTOCHROME P450 76C2 3.00E-56 At2g45570
RAFL11-07-N15 2.21 0.93 2.48 0.70 2.54 0.49 2.22 1.21 11.50 9.14 T02337 cytochrome P450 homolog F13P17.33 - Arabidopsis thaliana 2.00E-31 At2g34500
Aldehyde dehydrogenase
RAFL05-21-E06 2.76 2.46 6.15 4.30 6.89 0.31 10.74 3.67 10.21 3.03 AAD25783.1 Strong similarity to gb|S77096 aldehyde dehydrogenasehomolog from Brassica napus and is a member of PF|00171A 9.00E-84 At1g54100
RAFL04-09-D07(=RAFL05-21-E06) 2.71 2.47 5.53 3.90 6.52 0.29 8.42 5.09 7.89 3.50 AAD25783.1 Strong similarity to gb|S77096 aldehyde dehydrogenasehomolog from Brassica napus and is a member of PF|00171A 1.00E-44 At1g54100
Plant defense
RAFL05-20-B01 5.61 3.56 4.44 2.52 4.83 0.58 3.44 1.13 6.59 1.80 AAB95285.1 putative nematode-resistance protein [Arabidopsisthaliana] 6.00E-86 At2g40000
Alcohol dehydrogenase
RAFL05-19-B10 1.38 0.67 3.66 2.24 4.49 0.33 6.13 2.10 13.60 10.58 AAF05859.1 putative short-chain type dehydrogenase/reductase[Arabidopsis thaliana] At3g04000
ABA biosynthesis
AtNCED3 4.94 1.08 6.80 1.61 6.73 3.38 1.73 0.33 2.33 1.19
RAFL08-11-H16(=AtNCED3) 6.44 3.06 6.95 0.97 5.93 0.58 1.71 0.28 1.68 0.75 T07123 nine-cis-epoxycarotenoid dioxygenase - tomato At3g14440
Ethylene biosynthesis
RAFL04-17-M08 1.51 0.46 1.62 0.68 3.46 0.97 4.30 2.68 10.07 7.71 BAA97424.1 1-aminocyclopropane-1-carboxylate oxidase [Arabidopsisthaliana] 7.00E-90 At5g43450
JA-regulated genes
RAFL06-09-N04 1.55 0.45 2.60 0.47 5.69 0.77 7.74 1.92 14.28 9.65 BAA96998.1 contains similarity to jasmonate inducibleprotein~gene_id:MIF21.7 [Arabidopsis thaliana] At5g48180
IAA metabolism
RAFL05-11-H09 2.18 0.59 2.36 0.51 4.08 1.53 4.82 4.06 12.50 11.98 AAD30627.1 Similar to indole-3-acetate beta-glucosyltransferase[Arabidopsis thaliana] e-103 At1g05680
RAFL05-16-G04 2.73 1.26 5.06 1.83 4.74 1.55 4.43 2.03 5.34 3.37 T00584 indole-3-acetate beta-glucosyltransferase homolog T27E13.12 -Arabidopsis thaliana e-109 At2g30140
RAFL06-13-E03 1.59 0.85 1.65 0.25 2.67 0.37 4.24 0.91 8.33 3.79 AAB05220.1 nitrilase 2 [Arabidopsis thaliana] 4.00E-97 At3g44300
Senescence-related genes
ERD7 13.13 6.93 9.84 1.13 5.82 3.21 3.57 1.78 2.28 0.80
RAFL08-19-H17(=ERD7) 20.45 11.77 15.05 6.13 8.41 1.22 3.94 0.74 1.75 0.21 T00840 hypothetical protein T13L16.14 - Arabidopsis thaliana 7.00E-30 At2g17840
RAFL02-09-H01 1.81 1.57 3.54 3.36 1.80 0.46 7.06 2.44 3.31 0.70 S66345 senescence-associated protein sen1 - Arabidopsis thaliana 5.00E-99 At4g35770
Cellular metabolism
RAFL05-14-F20 2.72 2.00 5.18 4.34 6.22 0.62 6.64 2.50 9.46 4.93 AAF24813.1 F12K11.9 [Arabidopsis thaliana] e-106 At1g06570
RAFL11-09-O05(=RAFL05-14-F20) 3.44 1.61 3.49 0.29 7.58 1.08 4.73 2.93 5.60 2.94 AAF24813.1 F12K11.9 [Arabidopsis thaliana] 6.00E-41 At1g06570
RAFL05-10-A09 2.93 1.54 3.57 1.65 4.23 1.90 5.03 0.62 6.82 2.75 AAD49980.1 Similar to gb|AF110333 PrMC3 protein from Pinus radiataand is a member of PF|00135 Carboxylesterases family.EST 9.00E-72 At1g68620
RAFL05-01-L22(=RAFL05-10-A09) 1.43 0.73 3.15 1.59 3.44 0.98 4.73 2.29 7.15 6.76 AAD49980.1 Similar to gb|AF110333 PrMC3 protein from Pinus radiataand is a member of PF|00135 Carboxylesterases family.ESTe-102 At1g68620
RAFL05-01-D08 1.20 0.49 4.12 2.46 7.57 2.65 13.06 6.52 21.45 15.70 AAD20078.1 putative steroid sulfotransferase [Arabidopsis thaliana] 5.00E-59 At2g03760
RAFL05-04-G20 1.48 0.71 2.23 0.95 3.25 0.78 4.81 1.45 5.47 1.62 AAD25800.1 Identical to gb|U12536 3-methylcrotonyl-CoA carboxylaseprecursor protein from Arabidopsis thaliana. ESTsgb|H3583 2.00E-95 At1g03090
RAFL05-02-O17 1.17 0.95 1.46 0.56 4.07 0.87 5.17 1.96 7.55 3.17 T05195 saccharopine dehydrogenase (NADP+, L-lysine-forming) (EC 1.5.1.8) -Arabidopsis thaliana 9.00E-71 At4g33150
RAFL05-08-B14 1.66 0.75 1.50 0.56 1.84 0.24 3.25 0.46 7.21 5.17 T02505 hypothetical protein T19C21.11 - Arabidopsis thaliana At2g38400
RAFL05-19-H07 1.43 0.76 2.40 0.83 2.84 0.64 3.20 0.83 5.14 3.16 P46644 AAT3_ARATH ASPARTATE AMINOTRANSFERASE, CHLOROPLAST PRECURSOR (TRANSAMINASE A) At5g11520
RAFL06-09-F14 3.32 0.91 5.96 1.64 4.45 0.38 4.04 0.73 4.36 3.32 T46164 nodulin / glutamate-ammonia ligase-like protein - Arabidopsisthaliana 4.00E-79 At3g53180
RAFL06-14-F12 3.30 1.24 3.40 0.71 3.78 0.93 3.36 2.07 5.08 3.20 T50818 alpha-hydroxynitrile lyase-like protein - Arabidopsis thaliana e-111
RAFL06-16-J10 5.78 2.35 3.01 0.48 2.10 0.31 1.58 0.47 1.35 0.65 AAD19764.1 12-oxophytodienoate-10,11-reductase [Arabidopsisthaliana] e-102 At2g06050
RAFL07-10-M07 1.26 0.55 2.07 0.43 4.36 1.53 7.43 2.85 7.98 4.13 BAB10727.1 tyrosine aminotransferase [Arabidopsis thaliana] 7.00E-36 At5g53970
RAFL08-17-C05 2.58 1.09 3.08 1.08 3.11 0.45 2.45 1.40 9.20 3.86 AAC98454.1 nodulin-like protein [Arabidopsis thaliana] 1.00E-56 At2g28120
RAFL09-06-G09 2.52 2.12 4.12 2.56 4.71 0.98 6.82 2.79 5.73 2.40 AAD45605.1 isovaleryl-CoA-dehydrogenase precursor [Arabidopsisthaliana] 7.00E-32 At3g45300
RAFL09-07-L16 5.78 1.63 1.99 0.23 1.57 0.17 0.93 0.23 1.60 0.62 T02581 hypothetical protein T16B24.15 - Arabidopsis thaliana 3.00E-40 At2g39210
RAFL09-10-H19 2.10 1.17 2.63 0.68 5.93 1.66 4.58 1.63 6.39 0.71 AAC04908.1 3-ketoacyl-CoA thiolase [Arabidopsis thaliana] 1.00E-29 At2g33140
RAFL09-10-N03 2.33 1.06 2.74 1.21 4.51 0.84 3.66 1.49 5.73 3.97 AAG21484.1 glyoxalase II, putative; 78941-80643 [Arabidopsisthaliana] At1g53580
RAFL11-07-F02 1.71 1.24 2.76 0.90 4.04 0.59 6.23 1.95 11.50 6.85 AAF35258.1 3-methylcrotonyl-CoA carboxylase non-biotinylatedsubunit [Arabidopsis thaliana] 4.00E-65 At4g34030
RAFL09-09-K15 3.92 1.76 4.61 1.51 5.54 0.48 4.45 0.85 6.99 2.46 AY058849 acyl-CoA oxidase- Arabidopsis thaliana 1.00E-90 At4g16760
RAFL09-07-G09 3.75 4.25 4.96 3.93 4.15 0.78 9.74 5.72 10.23 1.52 P49078 ASNS_ARATH ASPARAGINE SYNTHETASE [GLUTAMINE-HYDROLYZING] (GLUTAMINE-DEPENDENTASPARAGINE SYNTHETASE) At3g47340
RAFL09-16-K24 2.14 1.84 2.79 1.21 3.26 0.12 8.54 3.82 8.40 1.02 T00626 branched-chain amino acid aminotransferase homolog T27I1.9 -Arabidopsis thaliana At1g10070
Carbohydrate metabolism
RAFL04-10-F19 1.85 0.97 3.04 0.57 5.97 0.61 3.81 0.85 3.95 1.89 CAB64737.1 putative beta-galactosidase [Arabidopsis thaliana] 2.00E-28 At3g13750
RAFL05-11-O20 4.31 1.47 5.53 1.84 7.34 0.87 8.09 2.86 15.38 9.68 AAF63643.1 neutral invertase, putative; 73674-70896 [Arabidopsisthaliana] 9.00E-82 At3g06500
RAFL05-12-L24 1.42 0.27 1.60 0.25 2.12 0.12 1.82 0.90 5.37 3.40 AAF36747.1 putative glucosyltransferase; 88035-86003 [Arabidopsisthaliana] 6.00E-91 At1g73880
RAFL05-18-H16 2.39 0.91 4.42 1.08 9.25 3.94 8.15 5.33 24.19 12.42 AAD20154.1 putative glucosyl transferase [Arabidopsis thaliana] At2g36780
RAFL05-18-I15 1.37 0.71 1.87 0.61 2.67 0.19 3.00 0.90 5.67 4.28 T47837 beta-glucosidase-like protein - Arabidopsis thaliana 2.00E-92 At3g60130
RAFL07-12-I23 1.60 0.68 2.69 0.72 5.06 0.99 4.77 3.10 13.03 5.79 AAB64024.1 putative glucosyltransferase [Arabidopsis thaliana] 2.00E-36 At2g43820
RAFL08-10-K08 2.04 0.98 4.78 0.72 6.07 3.03 7.25 0.49 10.67 6.47 T45603 glucosyltransferase-like protein - Arabidopsis thaliana 4.00E-62 At3g46660
RAFL08-19-G15 1.00 0.12 2.33 2.58 2.79 2.76 2.45 2.98 11.38 9.57 AAD20156.1 putative glucosyl transferase [Arabidopsis thaliana] 7.00E-60 At2g36800
RAFL09-10-C12 4.07 1.88 3.64 1.35 2.50 0.43 2.29 0.47 5.07 3.09 CAA07229.2 putative beta-amilase [Cicer arietinum] 1.00E-15 At5g18670
RAFL09-11-P10 1.91 1.32 5.50 1.33 16.14 0.10 23.11 5.97 24.59 3.99 AAF79730.1 T25N20.21 [Arabidopsis thaliana] 2.00E-56 At1g05560
RAFL09-12-B03 2.46 0.97 2.50 0.71 8.04 1.95 6.15 4.39 20.56 3.97 AAG23719.1 beta-glucosidase [Arabidopsis thaliana] 2.00E-52 At3g60140
RAFL09-13-P15 3.99 1.24 4.06 1.05 6.40 0.73 4.66 1.50 6.44 3.64 BAB03009.1 beta-amylase [Arabidopsis thaliana] 1.00E-31 At3g23920
RAFL05-11-O04 1.97 1.56 2.64 1.63 2.67 0.21 6.42 1.87 7.20 2.13 AAF78483.1 Strong similarity to UDPglucose 4-epimerase fromArabidopsis thaliana gi|2129759 and is a member of theNAD depen e-103 At1g12780
Secondary-metabolism-related genes
RAFL07-15-M03 3.07 0.90 4.00 2.29 2.71 0.63 2.55 1.37 7.79 4.41 T01256 SRG1 protein homolog F16M14.17 - Arabidopsis thaliana At2g38240
RAFL09-07-M01 7.11 3.83 4.39 1.18 3.48 0.29 2.56 0.81 2.75 0.91 T10625 reticuline oxidase homolog F21C20.180 - Arabidopsis thaliana 3.00E-33 At4g20830
RAFL09-15-D03 5.48 1.83 2.78 0.68 3.56 0.71 1.50 0.55 3.95 1.50 AAF98578.1 Contains weak similarity to berberine bridge enzyme(bbe1) from Berberis stolonifera gb|AF049347 andcontains a FAD 2.00E-51 At1g26380
RAFL02-05-I05 2.23 0.97 3.99 0.95 7.93 0.30 5.06 4.06 14.04 6.43 Q02972 MTD2_ARATH PROBABLE MANNITOL DEHYDROGENASE 2 (NAD-DEPENDENT MANNITOLDEHYDROGENASE 3.00E-76 At4g37990
RAFL09-16-M04 2.12 0.82 2.16 0.60 6.61 0.22 6.24 3.29 14.30 7.41 T05625 cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) ELI3-1 - Arabidopsisthaliana 5.00E-38 At4g37980
RAFL11-07-D13 1.70 0.64 3.24 1.47 6.61 0.15 5.57 3.46 12.15 8.87 AAF21160.1 putative cinnamyl-alcohol dehydrogenase; 49641-51171[Arabidopsis thaliana] 2.00E-37 At1g72680
RAFL05-18-A06 1.28 0.27 1.80 0.47 7.11 2.20 7.95 2.20 13.97 10.14 AAC33210.1 Highly similar to cinnamyl alcohol dehydrogenase,gi|1143445 [Arabidopsis thaliana] e-105 At1g09500
RAFL06-15-H16(=RAFL05-18-A06) 1.13 0.28 2.26 0.31 7.05 2.19 8.87 2.22 14.15 15.09 AAC33210.1 Highly similar to cinnamyl alcohol dehydrogenase,gi|1143445 [Arabidopsis thaliana] At1g09500
RAFL05-12-N20 3.04 0.69 2.62 0.40 5.42 2.11 2.34 1.53 4.14 2.23 CAB79765.1 cinnamoyl-CoA reductase-like protein [Arabidopsisthaliana] 1.00E-80 At4g30470
RAFL05-14-E15 1.64 0.49 2.04 0.49 3.60 0.36 2.69 1.14 5.02 3.89 AAB80681.1 putative cinnamoyl-CoA reductase [Arabidopsis thaliana] 7.00E-84 At2g33590
RAFL05-03-O21 2.50 0.76 4.74 2.50 2.44 0.80 4.22 2.09 5.68 4.40 BAB11549.1 leucoanthocyanidin dioxygenase-like protein [Arabidopsisthaliana] 6.00E-75 At5g05600
RAFL09-14-C12 6.97 4.11 6.99 3.30 2.70 0.15 1.78 0.52 4.01 2.50 AAB95283.1 putative anthocyanin 5-aromatic acyltransferase[Arabidopsis thaliana] 9.00E-48 At2g39980
Respiration
RAFL05-07-L13 2.19 0.59 3.13 0.57 5.36 0.73 4.88 2.89 12.36 11.53 Q39219 AX1A_ARATH ALTERNATIVE OXIDASE 1A PRECURSOR 1.00E-67 At3g22370
RAFL05-12-L13 1.86 1.19 3.06 1.16 3.40 0.42 4.48 0.77 9.59 3.01 T51603 monooxygenase 1 [imported] - Arabidopsis thaliana e-108
RAFL05-14-E16 4.46 1.33 8.93 1.09 8.62 1.93 5.80 2.20 8.00 7.08 AAD43614.1 T3P18.13 [Arabidopsis thaliana] 4.00E-71 At1g62570
Reproductive development
RAFL05-05-G20 1.97 0.57 2.38 0.79 5.96 2.27 4.21 1.58 9.28 9.94 AAF32455.1 unknown protein [Arabidopsis thaliana] 3.00E-31 At3g02480
RAFL07-17-B18 1.13 0.57 1.29 0.34 2.43 0.27 2.67 1.03 5.96 2.41 BAB09893.1 pollen specific protein SF21 [Arabidopsis thaliana] 1.00E-15 At5g56750
Cellular structure, organization and biogenesis

RAFL05-14-I08 2.41 0.99 2.89 0.91 3.35 0.22 4.03 2.09 5.39 3.75 AAC77823.1 arabinogalactan-protein [Arabidopsis thaliana] 5.00E-65 At5g64310
RAFL09-11-I12 1.27 0.34 1.08 0.39 1.35 0.08 1.54 0.88 12.42 9.15 AAD45127.1 endoxyloglucan transferase [Arabidopsis thaliana] 2.00E-48 At5g57550
RAFL05-15-K08 1.80 1.70 2.47 1.61 3.15 0.15 5.90 1.80 6.14 0.93 BAB08802.1 xylose isomerase [Arabidopsis thaliana] 6.00E-81 At5g57655
RAFL09-07-E15 1.82 1.32 1.70 0.77 3.88 0.05 4.68 0.85 7.77 2.57 BAB09906.1 xylosidase [Arabidopsis thaliana] 8.00E-40 At5g49360
RAFL07-12-D17 1.17 0.35 1.23 0.36 1.60 0.47 2.11 1.12 7.45 2.97 S71225 xyloglucan endo-1,4-beta-D-glucanase (EC 3.2.1.-) XTR-6 -Arabidopsis thaliana 9.00E-51 At4g25810
RAFL04-13-E17 6.33 4.22 6.44 2.23 4.69 1.24 5.99 2.00 9.98 4.02 T51838 blue copper binding protein homolog [imported] - Arabidopsisthaliana At5g20230
DNA, nucleus
RAFL05-16-J08 2.20 1.43 3.62 1.64 3.31 0.23 2.85 1.60 6.54 4.58 T06703 hypothetical protein T29H11.90 - Arabidopsis thaliana e-106 At3g48390
Photosynthesis
RAFL05-19-E17 1.60 0.86 1.96 0.35 3.56 0.40 3.64 1.40 8.85 5.33 A71420 pyruvate,orthophosphate dikinase (EC 2.7.9.1) - Arabidopsis thaliana 3.00E-65 At4g15530
RNA-binding protein
RAFL08-13-G20 2.76 0.98 3.92 1.20 10.38 2.41 3.13 1.67 6.19 4.76 T48173 hypothetical protein F7A7.40 - Arabidopsis thaliana 9.00E-52 At5g01520
RAFL09-17-E14(=RAFL08-13-G20) 3.32 0.78 3.19 0.49 11.34 2.65 3.36 1.22 4.34 0.45 T48173 hypothetical protein F7A7.40 - Arabidopsis thaliana 8.00E-31 At5g01520
Epoxide hydrolase
RAFL09-14-G09 1.96 0.93 2.36 1.17 3.93 0.75 4.10 0.33 5.92 1.56 T45731 epoxide hydrolase-like protein - Arabidopsis thaliana 6.00E-47 At3g51000
Mei2
RAFL09-12-D07 1.55 1.34 1.96 1.17 3.02 0.08 3.64 0.59 5.01 1.41 AAF21885.1 MEI2 [Arabidopsis thaliana] 2.00E-32 At2g42890
Uncharacterized proteins
cor15A 2.79 0.35 4.52 0.37 6.39 1.96 1.56 0.33 1.17 0.18
RAFL05-21-N22 1.25 0.81 3.03 1.83 3.45 0.39 9.45 3.82 9.59 2.28 AAF21149.1 hypothetical protein; 13251-12244 [Arabidopsis thaliana] 2.00E-81 At1g72800
RAFL04-09-B07 3.39 1.00 3.58 0.83 3.26 0.96 2.56 0.68 6.03 3.70 BAB10517.1 gene_id:MKP11.15~unknown protein [Arabidopsis thaliana] At5g17300
RAFL04-10-D13 5.10 1.15 3.32 0.38 2.18 0.25 1.35 0.68 0.96 0.40 AAB87096.2 unknown protein [Arabidopsis thaliana] 2.00E-40 At2g23120
RAFL04-10-M11 7.61 5.03 3.30 1.31 1.69 0.32 1.48 0.22 2.22 0.92 AAF50667.1 CG10163 gene product [Drosophila melanogaster]
RAFL04-12-F24 5.73 1.58 5.15 2.90 2.59 1.15 1.18 0.36 1.17 0.40 AAG31216.1 proline-rich protein, putative [Arabidopsis thaliana] 1.00E-96 At1g51090
RAFL04-17-I03 2.12 1.74 4.69 1.44 6.89 0.71 15.11 4.31 12.32 2.82 AAF82216.1 ESTs gb|AI993254, gb|T76141 and gb|AA404864 come fromthis gene. [Arabidopsis thaliana] e-102 At1g07040
RAFL08-19-M03(=RAFL04-17-I03) 1.94 1.50 2.46 0.68 5.32 0.48 8.82 1.72 6.95 2.63 AAF82216.1 ESTs gb|AI993254, gb|T76141 and gb|AA404864 come fromthis gene. [Arabidopsis thaliana] At1g07040
RAFL04-17-M22 2.51 0.63 4.44 1.37 6.75 0.92 2.52 0.63 2.10 1.14 AAG30970.1 hypothetical protein [Arabidopsis thaliana] 3.00E-79 At1g73390
RAFL04-20-N21 1.08 0.47 2.66 0.29 5.30 0.95 6.29 1.60 9.08 0.93 AAF13083.1 unknown protein [Arabidopsis thaliana] At3g07650
RAFL05-01-D05 1.33 0.59 2.54 1.32 2.39 0.77 3.17 1.08 7.06 6.32 T05004 hypothetical protein T19P19.60 - Arabidopsis thaliana At4g39670
RAFL05-02-G08 0.94 0.32 1.67 0.74 4.41 1.16 9.37 3.09 14.51 11.05 T47817 hypothetical protein F24G16.200 - Arabidopsis thaliana 3.00E-37 At3g59930
RAFL05-05-A17 2.46 1.05 4.53 2.32 5.88 2.04 6.13 1.55 4.21 0.48 BAB01982.1 contains similarity to unknownprotein~gb|AAF27062.1~gene_id:MWE13.5 [Arabidopsisthaliana] 9.00E-93 At3g29575
RAFL05-05-E24 1.75 0.62 2.58 0.28 5.04 1.05 4.65 0.28 5.26 2.22 AAF79404.1 F16A14.21 [Arabidopsis thaliana] e-105 At1g13990
RAFL05-05-K10 3.58 1.28 3.21 1.16 3.71 0.49 3.45 0.88 5.97 1.92 T02134 hypothetical protein F8K4.9 - Arabidopsis thaliana At1g61890
RAFL05-07-D22 3.61 4.15 7.15 4.23 3.72 0.62 8.88 3.92 6.48 2.17 G81737 hypothetical protein TC0130 [imported] - Chlamydia muridarum(strain Nigg) 1.00E-73 At2g01030
RAFL05-09-L11 1.94 1.03 2.51 0.64 2.82 0.07 5.61 1.29 5.73 0.71 ******No Hit Found******
RAFL05-10-J09 12.92 3.34 16.39 2.98 9.60 5.55 8.66 4.69 9.57 9.01 AAF17690.1 F28K19.28 [Arabidopsis thaliana] At1g78070
RAFL09-14-A12(=RAFL05-10-J09) 13.52 7.02 13.43 1.78 7.26 1.15 7.56 3.01 8.64 6.60 AAF17690.1 F28K19.28 [Arabidopsis thaliana] 6.00E-42 At1g78070
RAFL05-10-M08 2.44 0.61 5.63 2.17 4.52 1.78 5.93 4.51 16.59 16.33 AAF20257.1 unknown protein; 83277-83927 [Arabidopsis thaliana] At1g76600
RAFL05-10-N02 1.67 0.74 3.64 1.05 10.25 3.17 13.73 5.42 25.08 13.30 BAB11216.1 gb|AAC02775.1~gene_id:K18P6.18~similar to unknownprotein [Arabidopsis thaliana] 4.00E-66 At5g24640
RAFL05-11-P23 2.38 0.49 2.60 1.25 2.74 1.02 1.97 1.11 5.03 3.14 AAD03372.1 unknown protein [Arabidopsis thaliana] At2g24110
RAFL05-12-H13 7.07 2.70 9.86 2.43 11.36 1.70 16.02 3.92 12.00 7.36 T10542 hypothetical protein F3I3.40 - Arabidopsis thaliana 2.00E-58 At4g01020
RAFL05-14-G18 3.12 2.08 7.05 1.90 8.70 0.08 7.21 2.61 10.01 3.57 BAB10082.1 MtN19-like protein [Arabidopsis thaliana] 2.00E-86 At5g61820
RAFL05-15-L21 1.49 0.46 2.15 0.33 2.85 0.59 2.39 0.60 6.45 6.17 BAB02810.1 emb|CAA16777.1~gene_id:MQC12.4~similar to unknownprotein [Arabidopsis thaliana] e-100 At3g20300
RAFL05-16-F03 3.80 0.49 5.54 2.27 7.26 4.60 4.33 2.79 8.07 9.80 AAD43155.1 Hypothetical Protein [Arabidopsis thaliana] 1.00E-73 At1g49450
RAFL05-17-L09 1.52 0.57 2.57 0.61 4.73 0.64 4.95 0.81 7.76 3.72 AAD24653.1 putative glycine-rich protein [Arabidopsis thaliana] 2.00E-79 At2g05540
RAFL05-18-E01 4.26 1.41 3.35 0.47 2.70 1.00 4.63 2.32 6.43 7.74 AAF09073.1 hypothetical protein; 49277-47786 [Arabidopsis thaliana] 5.00E-34
RAFL05-18-I12 3.52 0.85 11.21 6.85 33.83 23.54 14.69 11.41 38.69 32.01 AAC63632.1 unknown protein [Arabidopsis thaliana] 4.00E-99 At2g47770
RAFL05-18-J24 1.36 0.10 1.12 0.07 1.45 0.13 2.19 0.56 9.05 4.09 AAD32929.1 T17H7.4 [Arabidopsis thaliana]
RAFL05-19-K24 2.66 0.13 3.79 0.64 5.25 0.72 4.98 3.47 5.10 4.61 CAB95742.1 putative ABC transporter [Staphylococcus xylosus]
RAFL05-19-O22 4.83 1.60 12.52 5.48 16.06 3.21 13.73 7.61 13.04 12.71 T51472 hypothetical protein K3M16_30 - Arabidopsis thaliana 9.00E-29
RAFL05-21-F13 4.63 1.27 3.59 0.40 6.89 2.15 2.83 1.52 2.83 0.90 AAF99848.1 Unknown protein [Arabidopsis thaliana] 8.00E-81 At1g16850
RAFL06-07-I05 2.53 1.58 3.94 1.90 3.91 0.70 5.03 1.93 4.27 2.85 CAC05470.1 putative protein [Arabidopsis thaliana] 5.00E-88 At5g09440
RAFL06-09-E13 2.03 1.15 7.42 3.32 15.15 2.80 22.83 18.12 14.59 4.60 B72581 hypothetical protein APES063 - Aeropyrum pernix (strain K1) At2g01010
RAFL06-10-C16 3.10 0.69 5.86 5.00 6.92 4.02 16.84 13.94 23.28 19.83 AAB71443.1 EST gb|ATTS0295 comes from this gene. [Arabidopsisthaliana] 7.00E-31 At1g05340
RAFL09-15-I16(=RAFL06-10-C16) 1.89 0.71 2.02 0.08 3.54 1.22 4.98 1.54 6.36 3.61 AAB71443.1 EST gb|ATTS0295 comes from this gene. [Arabidopsisthaliana] At1g05340
RAFL06-12-H12 9.73 7.60 17.02 10.28 15.81 2.85 20.45 2.16 16.68 4.48 T48223 hypothetical protein T7H20.70 - Arabidopsis thaliana 7.00E-68 At5g02020
RAFL06-15-P15 2.97 2.32 7.82 6.73 18.89 8.87 31.45 3.17 52.77 34.65 AAD55473.1 Hypothetical protein [Arabidopsis thaliana] 6.00E-81 At1g80160
RAFL07-15-O03 3.16 2.01 2.86 1.61 2.78 0.22 1.96 0.45 10.54 5.06 T00989 patatin homolog T9J22.23 - Arabidopsis thaliana 5.00E-46 At2g26560
RAFL08-10-N24 2.62 0.94 2.77 0.57 4.52 2.47 3.92 1.08 6.92 1.89 AAC49773.1 AP2 domain containing protein RAP2.7 [Arabidopsisthaliana] At4g38060
RAFL08-11-P07 4.98 1.57 4.15 1.55 5.34 2.57 2.28 0.75 1.94 1.15 ******No Hit Found****** At5g17460
RAFL08-13-F10 6.12 2.54 9.89 9.47 14.41 9.17 6.28 4.83 7.80 1.35 BAB08381.1 gene_id:MOK16.12~unknown protein [Arabidopsis thaliana] 7.00E-19 At5g03210
RAFL08-15-M21 6.17 2.61 10.35 2.66 7.70 2.46 2.48 1.05 3.00 1.33 AAD41434.1 F8K7.23 [Arabidopsis thaliana] 4.00E-41 At1g21790
RAFL08-16-D18 2.12 0.91 4.16 3.20 5.24 1.79 2.13 1.02 4.43 1.93 ******No Hit Found****** At4g23050
RAFL08-17-D17 4.70 2.46 6.88 2.29 6.04 0.53 4.53 0.33 6.31 3.59 A82448 tatA protein VCA0533 [imported] - Vibrio cholerae (group O1 strainN16961)
RAFL09-09-P16 5.24 2.46 2.53 1.03 2.02 0.45 1.41 0.25 1.40 0.50 AAC69932.2 putative myosin heavy chain [Arabidopsis thaliana] 5.00E-25 At2g32240
RAFL09-10-A12 2.12 0.70 1.75 0.35 3.56 0.07 2.45 0.45 8.23 3.62 AAF16609.1 unknown protein, 5' partial; 67-381 [Arabidopsisthaliana] 4.00E-32 At1g68440
RAFL09-10-B06 1.36 0.49 1.63 0.26 3.05 0.59 3.71 0.30 8.09 1.72 S57908 hypothetical 527K polyprotein - rice
RAFL09-10-J18 5.88 3.11 13.70 3.51 25.48 8.59 14.37 9.30 23.49 5.75 T04733 hypothetical protein F6G17.40 - Arabidopsis thaliana 2.00E-25 At4g37390
RAFL09-11-P17 2.12 0.88 3.41 1.33 4.21 1.89 5.01 0.60 5.46 1.60 T09561 hypothetical protein L73G19.70 - Arabidopsis thaliana At4g25690
RAFL09-16-I11 7.36 3.66 6.65 2.34 8.37 0.59 3.44 0.99 6.93 3.43 CAA10955.1 unnamed protein product [Arabidopsis thaliana] 5.00E-42 At1g69490
RAFL11-10-F22 3.53 2.19 3.85 2.47 3.78 0.29 3.13 0.45 6.13 1.56 BAB10558.1 contains similarity to unknownprotein~gene_id:MDC12.13~pir||T06706 [Arabidopsisthaliana] 2.00E-29 At5g63160
RAFL11-13-H10 2.43 1.78 5.58 2.78 7.06 0.27 6.14 2.22 4.95 1.93 AAD41421.1 ESTs gb|N96028, gb|F14286, gb|T20680, gb|F14443,gb|AA657300 and gb|N65244 come from this gene.[Arabidopsis 2.00E-21
RAFL05-18-C17(=RD2) 1.56 0.50 2.49 0.48 3.26 0.28 3.03 1.54 6.55 7.17 AAD23643.1 unknown protein [Arabidopsis thaliana] 5.00E-50 At2g21620
RD22 2.87 0.52 4.49 1.45 5.87 0.15 2.89 0.69 2.15 0.88
RAFL05-20-J01(=RAFL05-09-P10) 1.54 0.30 2.21 0.25 5.79 1.95 1.76 0.35 3.24 2.41 T02100 hypothetical protein T3K9.4 - Arabidopsis thaliana 2.00E-67 At2g41190
RAFL06-10-F03(=RAFL05-02-L02) 7.24 4.76 3.78 0.19 3.02 0.96 2.32 0.24 2.60 1.15 AAF82229.1 Contains similarity to an unknown protein T10D10.8gi|6730756 from Arabidopsis thaliana BAC T10D10gb|AC016529. ESTs gb|T14209, gb|BE03At1g19180
RAFL09-09-P15(=RAFL05-02-L02) 6.59 2.07 2.87 0.60 3.47 0.93 2.08 1.10 3.49 2.10 AAF82229.1 Contains similarity to an unknown protein T10D10.8gi|6730756 from Arabidopsis thaliana BAC T10D10gb|AC016529. 4.00E-58 At1g19180
RAFL11-02-N11 2.69 1.60 4.39 4.83 3.78 0.94 4.10 3.19 5.30 4.19 CAB56631.1 SBP-domain protein 5 [Zea mays]
RAFL07-09-N11 1.59 0.91 2.11 0.56 2.91 0.26 4.39 2.81 6.78 3.79 T06706 hypothetical protein T29H11.120 - Arabidopsis thaliana 1.00E-15 At3g48360
RAFL07-16-B09(=RAFL07-09-N11) 2.29 1.55 2.44 0.54 3.60 1.10 6.92 3.76 9.44 1.50 T06706 hypothetical protein T29H11.120 - Arabidopsis thaliana 3.00E-31 At3g48360
RAFL05-01-M12 1.35 1.21 3.14 3.01 2.69 1.84 4.42 1.80 5.19 3.27 AAC26202.1 dormancy-associated protein [Arabidopsis thaliana] 1.00E-60 At1g28330
RAFL05-18-H15 4.77 4.72 6.47 4.46 5.16 0.57 10.49 4.47 7.61 0.88 AAF19680.1 F1N19.23 [Arabidopsis thaliana] e-100 At1g64660
1)
In this study, we regarded the genes with expression ratios (high-salinity stress/unstressed) greater than five times that of lambda control template DNA fragment in at least 1 time-course point as high-salinity-stress-inducible genes (Seki et al. (2002) Plant J. 31:279-292).
2)
｛[Fluorescence Intensity(FI) of each cDNA for high-salinity-stress condition]÷[FI of each cDNA for unstressed condition]｝÷｛[FI of lambda DNA fragment for high-salinity-stress condition]÷[FI of lambda DNA fragment for unstressed condition]｝
Each value is the mean (Av.) of three experiments ± standard deviation (S.D.).
3)
Encoded protein /Other features indicates the putative functions of the gene products that are expected from sequence similarity. The gene products with the high similarity score (indicated in next column) are indicated. Database accession numbers are listed in parentheses.
4)
The MIPS protein entry code in the MIPS Arabidopsis thaliana database corresponding to the gene is indicated.
Seki et al. Supplemental Table 3. Cold-stress-Inducible Genes1) Identified by Full-length cDNA Microarray Analysis
Functional Gene Ratio(Cold/Unstressed)2) Encoded protein/Other features
3)
E-value MIPS
4)
DREB family
DREB1A 3.12 0.64 18.69 3.81 14.04 3.93 7.85 1.77 1.14 0.33
DREB2A 3.29 0.51 2.69 0.21 6.17 0.48 9.84 2.75 5.16 1.99
Zinc finger family
RAFL04-15-K19 1.02 0.10 7.23 0.39 3.84 0.60 3.64 1.00 0.70 0.29 CAA64820.1 salt-tolerance zinc finger protein [Arabidopsis thaliana] e-118 At1g27730
MYB family
RAFL05-20-N17 1.66 0.32 2.06 0.25 2.97 1.71 6.18 1.43 2.09 0.65 T02684 DNA-binding protein CCA1 - Arabidopsis thaliana 1.00E-89 At2g46830
Protein kinase
AtGolS1 1.41 0.21 1.59 0.11 2.51 0.51 6.83 1.92 4.93 1.73
AtGolS2 1.02 0.11 2.65 0.52 6.77 1.72 12.99 12.75 6.74 2.32
AtGolS3 2.41 0.44 5.34 1.44 22.88 14.87 70.81 18.32 29.62 6.89
RAFL04-16-K22(=AtGolS3) 2.83 0.69 4.47 0.50 23.16 15.09 49.52 14.96 20.18 8.91 AAC33195.1 Similar to rice water stress induced protein gi|537404[Arabidopsis thaliana] 1.00E-94 At1g09350
Atp5CS 1.35 0.11 2.81 0.23 2.72 0.82 4.87 1.14 5.57 1.09
RAFL06-10-P15(=AtRafS1) 2.00 0.04 4.71 0.55 5.38 1.72 7.93 2.63 2.01 0.42 BAB11595.1 raffinose synthase protein [Arabidopsis thaliana] 7.00E-79 At5g40390
LEA protein
RD17 1.91 0.23 2.75 0.22 7.02 1.36 13.33 2.84 9.34 6.59

RD29A 4.10 2.43 8.37 7.74 23.12 17.83 26.48 14.64 19.59 11.61
RAFL07-11-M21(=RD29A) 4.52 0.52 8.90 1.63 19.63 4.63 26.68 10.32 22.76 7.33 AAB25481.1 AAB25481.1| RD29A=responsive-to-dessication protein [Arabidopsis thaliana,Columbia ecotype, Pe 6.00E-40 At5g52310
KIN protein
kin1 1.61 0.23 3.48 0.59 5.80 1.10 9.71 1.84 15.67 2.70
kin2 1.84 0.41 3.12 0.37 5.20 0.45 8.92 3.92 9.05 2.87

RAFL05-11-G05 1.17 0.25 7.68 1.15 2.19 1.11 2.09 0.32 0.68 0.38 T05577 uncoupling protein homolog F22K18.230 - Arabidopsis thaliana e-103 At4g24570
Membrane protein
ERD4 1.77 0.48 2.06 0.21 2.30 0.71 5.75 2.82 3.35 0.36
RAFL04-12-K17(=ERD4) 1.66 0.26 2.14 0.17 1.98 0.85 5.14 1.98 3.01 0.11 AAG28290.1 unknown protein [Arabidopsis thaliana] 1.00E-96 At1g30360
Plant defense
RAFL04-19-L09 1.64 0.14 1.91 0.12 3.33 0.62 8.77 3.56 2.23 0.73 T06660 hypothetical protein T6G15.130 - Arabidopsis thaliana e-112 At4g13580
RAFL08-09-G22 1.47 0.21 2.62 0.26 1.96 0.55 4.47 1.82 5.91 2.79 AAF69827.1 polygalacturonase inhibiting protein 1; PGIP1[Arabidopsis thaliana] 2.00E-73 At5g06860
ERD7 3.48 0.47 2.48 0.26 5.76 0.84 11.86 4.52 5.15 2.12
Cellular metabolism
RAFL07-07-N10 1.41 0.42 2.30 0.26 3.84 2.91 5.98 0.75 1.41 0.42 AAF79535.1 F21D18.18 [Arabidopsis thaliana] 2.00E-30 At1g48100
RAFL06-15-O23(=RAFL07-07-N10) 1.42 0.10 2.50 0.26 2.87 1.69 7.38 1.60 1.72 0.08 AAF79535.1 F21D18.18 [Arabidopsis thaliana] 6.00E-84 At1g48100
RAFL09-11-N14 1.54 0.81 2.21 1.53 2.16 1.60 5.03 1.23 2.56 0.56 T51421 L-aspartate oxidase-like protein - Arabidopsis thaliana 2.00E-54 At5g14760
2)
Functional Gene Ratio(Cold/Unstressed) Encoded protein/Other features3) E-value MIPS
4)
RAFL06-16-M17(=FL5-90) 2.36 0.18 8.24 0.58 20.60 8.06 20.91 7.13 2.41 0.64 D71439 probable Beta-Amylase - Arabidopsis thaliana 2.00E-79 At4g17090
Respiration
RAFL09-16-L12 1.40 0.20 2.29 0.55 1.82 0.82 5.15 0.51 1.95 0.14 AAD43613.1 T3P18.12 [Arabidopsis thaliana] 1.00E-36 At1g62560

RAFL04-18-B07(=FL5-2I22) 1.85 0.04 2.90 0.17 3.79 0.34 9.92 3.16 2.41 0.47 BAA97199.1 ripening-related protein-like; contains similarity topectinesterase [Arabidopsis thaliana] 5.00E-97 At5g62350
DNA, nucleus
RAFL04-12-N15 1.75 0.43 1.86 0.78 2.46 1.61 10.26 5.22 2.31 0.57 T47697 Regulator of chromosome condensation-like protein - Arabidopsisthaliana e-102 At3g55580
cor15A 1.66 0.28 3.15 0.83 5.21 0.37 11.92 1.73 19.22 6.58
RAFL05-03-A05(=cor15A) 1.31 0.19 2.27 0.12 4.84 0.86 8.41 7.29 6.03 1.45 S43769 cold-regulated protein cor15a precursor - Arabidopsis thaliana 2.00E-70 At2g42540
RAFL05-20-N18 1.56 0.14 3.23 0.12 8.05 4.64 18.23 4.49 18.33 2.30 S43320 cold-regulated protein cor15b precursor - Arabidopsis thaliana 2.00E-71 At2g42530
RAFL04-12-P22 1.81 0.35 2.29 0.82 5.34 3.03 6.67 1.16 1.90 0.38 AAD38263.1 Hypothetical Protein [Arabidopsis thaliana] 4.00E-51
RAFL04-20-N21 1.15 0.14 5.31 1.03 4.20 1.43 2.54 0.75 1.33 0.38 AAF13083.1 unknown protein [Arabidopsis thaliana] At3g07650
RAFL05-17-F02 1.96 0.12 4.68 0.28 3.15 0.35 6.19 2.10 3.61 0.62 T05857 hypothetical protein T29A15.10 - Arabidopsis thaliana 3.00E-97 At4g27520
RAFL05-18-O20 0.98 0.01 1.75 0.06 2.27 0.60 3.59 1.67 5.46 1.26 AAG12637.1 unknown protein; 31966-27882 [Arabidopsis thaliana] e-107
RAFL06-07-E01 1.78 0.09 5.81 0.45 3.86 1.40 7.85 1.99 7.16 2.57 CAB79783.1 low temperature and salt responsive protein homolog[Arabidopsis thaliana] 4.00E-35 At4g30650
RAFL07-12-N12 1.74 0.15 2.72 0.25 3.56 0.61 5.12 1.12 2.66 0.41 BAB09328.1 gene_id:K16E1.4~unknown protein [Arabidopsis thaliana] 9.00E-43 At5g42570
RAFL07-15-O03 1.83 0.32 3.91 0.96 4.37 3.24 5.52 1.92 2.32 0.88 T00989 patatin homolog T9J22.23 - Arabidopsis thaliana 5.00E-46 At2g26560
RAFL07-18-O08 2.02 0.28 3.54 0.45 3.73 3.53 5.17 1.61 1.45 0.50 AAD50003.1 Unknown protein [Arabidopsis thaliana] 3.00E-38 At1g11210
RAFL08-17-G11 2.32 0.25 5.38 0.56 1.75 1.10 1.99 0.45 2.05 1.11 T05313 hypothetical protein F26P21.170 - Arabidopsis thaliana 5.00E-46 At4g33050
RAFL09-17-B09 1.47 0.16 1.78 0.10 2.88 1.11 5.98 1.45 1.48 0.41 AAG12711.1 unknown protein; 48715-49943 [Arabidopsis thaliana] 3.00E-50 At3g12320
RAFL09-17-E07 1.67 0.09 2.99 0.38 2.27 1.40 5.79 1.57 2.81 1.15 AAF79871.1 T7N9.26 [Arabidopsis thaliana] 7.00E-64 At1g27200
RAFL11-12-C17 1.62 0.13 6.32 0.82 3.53 1.74 3.89 1.04 1.46 0.60 ******No Hit Found****** At2g40140
RAFL08-13-N04 2.01 0.56 2.73 0.77 2.64 2.42 5.06 0.94 1.55 0.52 AAC64220.1 putative glucosyltransferase [Arabidopsis thaliana] At2g16890
1)
In this study, we regarded the genes with expression ratios (cold/unstressed) greater than five times that of lambda control template DNA fragment in at least 1 time-course point as cold-stress-inducible genes (Seki et al. (2002) Plant J. 31:279-292).
2)
｛[Fluorescence Intensity(FI) of each cDNA for cold stress condition]÷[FI of each cDNA for unstressed condition]｝÷｛[FI of lambda DNA fragment for cold stress condition]÷[FI of lambda DNA fragment for unstressed condition]｝
3)
4)
Seki et al., Supplemental Table 1. Drought-stress-Inducible Genes1) Identified by Full-length cDNA Microarray Analysis
Functional Gene Ratio(Dry/Unstressed)2) Encoded protein/Other features3) E-value MIPS4)
DREB family
DREB2A 7.95 2.16 13.47 10.28 6.43 3.09 10.65 2.99 9.55 3.62
RAFL06-11-K21 1.67 0.83 24.38 32.88 4.10 2.10 3.61 1.10 2.97 0.26 AAD20907.1 AP2 domain transcription factor [Arabidopsis thaliana] 6.00E-37 At2g20880
RAFL05-16-H23 1.67 1.25 37.77 25.85 8.47 3.30 15.72 10.14 6.75 4.95 T09030 hypothetical protein F26K10.20 - Arabidopsis thaliana 1.00E-88 At4g28140
RAFL08-16-D06 3.72 1.38 5.25 2.01 1.34 0.62 1.81 0.61 2.44 1.33 AAF87854.1 Contains similarity to a cadmium-imduced protein AS30from Arabidopsis thaliana gi|1168862 and contains an AP2PF|00847 domain. EST gb|AI09At1g22190
ERF family
RAFL06-08-H20 1.06 0.47 9.19 7.20 21.72 10.30 39.83 8.27 19.25 10.46 AAC36019.1 RAP2.6 [Arabidopsis thaliana] e-110 At1g43160
Zinc finger family
RAFL07-10-G04 1.93 1.12 5.62 4.77 2.22 1.05 5.33 2.37 4.18 2.98 BAA85107.1 Cys2/His2-type zinc finger protein 2 [Arabidopsisthaliana] 8.00E-45 At3g19580
RAFL04-17-D16 1.03 0.15 1.51 0.20 1.11 0.34 1.89 0.11 5.00 1.87 AAC79588.1 putative C3HC4-type RING zinc finger/ankyrin protein[Arabidopsis thaliana] 8.00E-67 At2g28840
RAFL04-17-P17 0.98 0.29 2.83 0.62 2.72 0.76 4.67 1.66 5.75 2.41 AAD20957.1 zinc finger protein 4 [Homo sapiens]
RAFL05-19-M20 0.86 0.14 1.34 0.33 1.49 0.44 5.44 1.45 1.89 0.32 AAD26481.1 putative CONSTANS-like B-box zinc finger protein[Arabidopsis thaliana] 3.00E-90 At2g31380
RAFL04-15-K19 5.80 0.94 11.69 2.48 5.36 1.64 5.15 2.95 5.65 1.92 CAA64820.1 salt-tolerance zinc finger protein [Arabidopsis thaliana] e-118 At1g27730
RAFL05-14-C11 1.42 0.29 2.81 1.09 2.50 1.19 5.19 0.66 3.68 2.25 T04577 hypothetical protein T12H17.210 - Arabidopsis thaliana e-99 At4g22820
RAFL05-20-N02 0.48 0.06 0.64 0.06 0.72 0.18 6.02 4.92 2.49 1.64 CAA64819.1 salt-tolerance protein [Arabidopsis thaliana] 1.00E-98 At1g06040
WRKY family
RAFL05-18-H12 6.73 2.22 6.62 3.36 3.06 0.94 2.09 1.29 1.60 0.27 AAF14671.1 Similar to gb|Z48431 DNA-binding protein from Avenafatua. [Arabidopsis thaliana] 1.00E-79 At1g80840
RAFL06-12-M01 1.25 0.67 10.45 13.77 3.42 1.39 8.53 0.76 8.78 3.44 T04919 DNA-binding protein homolog T9A21.10 - Arabidopsis thaliana 4.00E-77 At4g18170
MYB family
RAFL05-14-D24 2.56 1.11 14.50 6.06 7.13 2.92 9.66 3.97 4.53 4.10 CAB81052.1 MYB-like protein [Arabidopsis thaliana] e-114 At4g05100
RAFL05-20-N17 0.66 0.27 1.21 0.37 1.38 0.50 6.25 2.58 3.28 0.88 T02684 DNA-binding protein CCA1 - Arabidopsis thaliana 1.00E-89 At2g46830
RAFL04-17-F21 1.02 0.28 2.35 1.14 1.48 0.98 13.32 7.95 1.38 0.15 CAA07004.1 late elongated hypocotyl [Arabidopsis thaliana] 8.00E-78 At1g01060
bHLH family
RD22BP1 3.10 1.21 5.52 3.05 2.47 0.92 1.91 0.39 1.16 0.64
RAFL02-08-M10(=RD22BP1) 4.31 0.38 6.04 1.37 1.32 0.23 0.87 0.06 1.08 0.36 AAF25980.1 F6N18.4 [Arabidopsis thaliana] 7.00E-77 At1g32640
RAFL09-12-N16 3.83 1.10 5.82 2.96 2.19 0.63 1.62 0.18 1.36 0.68 AAD20162.1 putative bHLH transcription factor [Arabidopsisthaliana] At2g46510
NAC family
RAFL07-07-G15 2.20 0.74 7.77 2.00 4.28 1.19 4.52 0.44 4.12 1.94 AAF78403.1 Strong similarity to OsNAC6 protein from Oryza sativagb|AB028185. ESTs gb|AI996805, gb|T22869 andgb|AI100172 c 5.00E-12
RAFL05-19-I05(=RAFL07-07-G15) 2.60 0.56 7.52 2.34 4.40 1.48 5.26 0.27 4.67 1.84 AAF78403.1 Strong similarity to OsNAC6 protein from Oryza sativagb|AB028185. ESTs gb|AI996805, gb|T22869 andgb|AI100172 c 4.00E-69 At1g01720
RAFL08-11-H20 0.74 0.30 2.54 1.78 3.43 2.09 7.02 4.08 6.27 2.32 BAB08893.1 contains similarity to NAM (no apical meristem)protein~gene_id:MIJ24.11 [Arabidopsis thaliana] 2.00E-43 At5g39610
RD26 3.63 1.60 20.83 12.59 12.96 4.11 37.19 17.57 14.41 7.98
RAFL05-21-C17(=RD26) 4.54 2.27 12.73 9.58 8.51 4.45 19.82 3.32 15.67 9.75 T08933 hypothetical protein F27G19.10 - Arabidopsis thaliana e-123 At4g27410
RAFL09-15-E01(=RD26) 2.65 1.19 16.46 21.12 7.01 3.50 24.34 12.88 10.49 5.39 T08933 hypothetical protein F27G19.10 - Arabidopsis thaliana At4g27410
RAFL08-14-A19(=RD26) 4.10 2.56 28.75 16.79 16.32 7.81 32.38 22.73 18.38 13.32 BAB10109.1 root cap protein 2-like protein [Arabidopsis thaliana] 3.00E-14 At4g27410
Homeodomain family
RAFL05-20-M16 1.28 0.06 3.28 1.36 2.96 0.97 9.25 1.26 9.26 4.03 AAC69925.1 homeodomain transcription factor (ATHB-7) [Arabidopsisthaliana] 1.00E-66 At2g46680
RAFL11-01-J18 1.83 0.42 12.56 6.04 8.31 2.60 24.39 8.11 19.36 11.20 T47981 homeobox-leucine zipper protein ATHB-12 - Arabidopsis thaliana 1.00E-44 At3g61890
bZIP family
RAFL11-10-D10 0.91 0.28 1.73 0.78 2.38 1.05 5.71 0.99 5.54 1.47 BAB09915.1 contains similarity to bZIP transcriptionfactor~gene_id:K7J8.13 [Arabidopsis thaliana] 6.00E-57 At5g49450
RAFL04-17-N22 1.20 0.07 7.15 2.20 4.61 2.00 7.25 2.03 3.02 1.22 AAF27181.1 abscisic acid responsive elements-binding factor[Arabidopsis thaliana] 8.00E-76 At4g34010
RAFL05-09-G15 2.30 0.26 5.98 1.80 3.99 1.68 5.56 0.87 5.51 1.94 P42776 GBF3_ARATH G-BOX BINDING FACTOR 3 6.00E-63 At2g46270
Other families
RAFL05-21-L12 1.81 1.40 19.28 27.65 7.29 3.16 6.43 3.26 12.74 7.31 BAB01258.1 heat shock transcription factor-like protein[Arabidopsis thaliana] 4.00E-99 At3g22830
RAFL08-16-H18 0.97 0.46 2.57 1.86 1.79 0.78 3.10 1.04 5.05 2.82 P28348 NIRA_EMENI NITROGEN ASSIMILATION TRANSCRIPTION FACTOR NIRA At5g64430
Protein kinase
RAFL05-16-K11 0.90 0.24 1.86 0.75 2.65 1.04 5.94 1.10 8.24 3.59 T50802 serine/threonine protein kinase-like protein - Arabidopsis thaliana At5g25110
RAFL06-07-B08 3.57 2.47 11.46 9.99 4.91 1.93 6.72 1.28 4.89 2.20 AAC16938.1 putative protein kinase [Arabidopsis thaliana] 7.00E-21 At2g30360
RAFL09-10-A09 5.74 1.06 2.49 1.05 1.41 0.29 0.98 0.51 1.58 0.58 AAD32284.1 putative receptor-like protein kinase [Arabidopsisthaliana] 9.00E-54 At2g31880
RAFL07-07-B15 2.24 1.03 10.35 10.19 2.16 1.31 1.64 0.91 2.07 0.66 T51783 AtPP-like protein - Arabidopsis thaliana At3g44860
RAFL08-08-H23 0.67 0.24 2.47 0.63 4.21 1.29 6.64 5.58 7.17 4.77 T00857 hypothetical protein T20F6.15 - Arabidopsis thaliana At2g02710
Protein phosphatase
RAFL09-14-O03(=ABI1) 1.30 0.39 6.77 2.61 3.70 1.38 5.58 0.54 4.32 1.51 P49597 P2C1_ARATH PROTEIN PHOSPHATASE 2C ABI1 (PP2C) 2.00E-14
RAFL05-15-E19 1.70 0.11 14.11 4.50 7.65 3.46 7.69 1.11 9.61 3.20 AAF26133.1 putative protein phosphatase-2C [Arabidopsis thaliana] 1.00E-83 At3g05640
RAFL06-07-B19 1.48 0.63 3.68 2.53 2.26 0.56 4.46 0.33 5.39 2.93 P49598 P2C4_ARATH PROTEIN PHOSPHATASE 2C (PP2C) 2.00E-86 At3g11410
Signaling
RAFL05-07-D07 1.46 0.34 4.09 1.18 3.16 0.92 3.42 0.33 5.19 0.82 AAC37475.1 calmodulin-binding protein [Arabidopsis thaliana] 4.00E-82 At5g65930
RD20 1.87 0.20 18.91 5.15 17.98 6.82 40.32 18.73 9.13 5.35
RAFL08-16-M12(=RD20) 1.76 0.52 28.51 12.14 24.36 3.35 47.15 17.79 13.93 7.16 AAB80656.1 putative Ca2+-binding EF-hand protein [Arabidopsisthaliana] At2g33380
RAFL06-15-G18 1.38 0.63 3.33 3.30 1.40 0.61 3.72 2.72 5.54 4.92 BAB10479.1 contains similarity to calmodulin~gene_id:MDH9.7[Arabidopsis thaliana] 4.00E-69 At5g42380
RAFL04-13-E14 0.88 0.45 1.30 0.39 1.49 0.58 1.46 0.52 5.51 4.45 T48302 hypothetical protein F9G14.120 - Arabidopsis thaliana e-101 At5g02810
AtGolS2 1.19 0.10 9.96 3.00 6.02 1.75 6.37 3.70 4.66 1.69
Atp5CS 1.64 0.38 3.03 0.68 2.77 0.88 12.00 7.77 4.57 2.64
RAFL05-20-O23(=AtP5CS) 1.42 0.13 3.30 0.62 2.89 0.86 12.64 9.76 4.99 2.59 O04226 P5CS_ORYSA DELTA 1-PYRROLINE-5-CARBOXYLATE SYNTHETASE (P5CS) [INCLUDES:GLUTAMATE 5-KINASE 5.00E-29 At2g39800
RAFL06-10-P15(=AtRafS1) 2.72 0.86 12.66 8.71 4.71 2.28 5.59 0.51 2.26 1.24 BAB11595.1 raffinose synthase protein [Arabidopsis thaliana] 7.00E-79 At5g40390
RAFL05-16-I09 0.71 0.09 1.62 0.59 4.53 1.56 7.12 2.15 6.90 3.59 P49040 SUS1_ARATH SUCROSE SYNTHASE (SUCROSE-UDP GLUCOSYLTRANSFERASE) 8.00E-78 At5g20830
RAFL05-18-M07 0.98 0.29 1.83 0.38 4.13 1.86 12.11 0.76 16.03 12.28 CAB80721.1 putative sucrose synthetase [Arabidopsis thaliana] 5.00E-83 At4g02280
RAFL03-07-A16 1.52 0.32 2.84 0.43 4.35 1.06 4.48 0.77 5.61 4.42 T05291 arginine decarboxylase (EC 4.1.1.19) SPE2 - Arabidopsis thaliana 3.00E-69 At4g34710
RAFL09-13-D07(=RAFL03-07-A16) 1.65 0.65 3.24 1.19 5.22 0.91 4.77 0.63 3.69 1.62 T05291 arginine decarboxylase (EC 4.1.1.19) SPE2 - Arabidopsis thaliana 8.00E-11 At4g34710
RAFL05-13-B06 1.22 0.39 7.53 4.38 3.93 1.44 7.30 0.43 7.11 2.33 AAD08939.1 putative trehalose-6-phosphate synthase [Arabidopsisthaliana] 3.00E-87 At2g18700
RAFL05-19-C02 1.65 0.21 5.05 1.51 5.08 1.59 19.17 3.53 27.35 7.13 T46188 imbibition protein homolog - Arabidopsis thaliana 3.00E-79 At3g57520
Protein degradation
ERD1 1.52 0.14 2.61 1.04 3.28 1.27 6.94 2.37 6.11 1.56
RAFL09-15-D15(=ERD1) 0.73 0.28 2.46 0.55 4.52 1.18 6.66 3.21 10.69 7.65 P42762 ERD1_ARATH ERD1 PROTEIN PRECURSOR 3.00E-36 At5g51070
RAFL05-05-I08(=ERD1) 0.72 0.13 1.73 0.51 3.25 1.08 5.18 2.02 6.26 2.29 T15264 hypothetical protein F59E12.9 - Caenorhabditis elegans
RAFL05-13-E04 1.01 0.14 3.49 1.23 4.76 1.94 12.91 2.19 9.37 3.90 BAA94978.1 contains similarity to similar to ubiquitin conjugatingenzyme~gene_id:K14A17.7 [Arabidopsis thaliana] 1.00E-84 At3g17000
Protease inhibitor
RAFL11-13-F11 0.94 0.33 2.94 0.92 3.76 1.48 6.89 2.07 4.82 1.88 BAB09081.1 gene_id:MNJ7.14~pir||H71431~similar to unknown protein[Arabidopsis thaliana] 2.00E-57 At5g47550
RAFL06-11-B11 0.82 0.19 1.19 0.24 4.02 1.55 8.76 0.76 5.69 1.38 AAF18711.1 putative trypsin inhibitor; 19671-20297 [Arabidopsisthaliana] 3.00E-57 At1g73260
RAFL11-04-I22(=RAFL06-11-B11) 0.73 0.23 1.16 0.39 3.42 1.22 6.73 1.07 8.73 7.94 AAF18711.1 putative trypsin inhibitor; 19671-20297 [Arabidopsisthaliana] 6.00E-53 At1g73260
LEA protein
ERD10 2.42 0.18 8.10 3.31 3.98 1.57 7.82 2.30 5.26 1.96
RAFL05-04-C07(=ERD10) 3.20 1.54 8.82 2.91 5.52 1.43 7.85 2.69 4.96 2.23 P42759 DH10_ARATH DEHYDRIN ERD10 (LOW-TEMPERATURE-INDUCED PROTEIN LTI45) At1g20450
RAFL05-12-E14 1.05 0.60 2.12 0.68 1.22 0.32 6.46 2.55 8.86 3.86 AAC17827.1 putative LEA (late embryogenesis abundant) protein[Arabidopsis thaliana] 3.00E-40 At2g23110
RAFL08-11-C23 1.24 0.52 13.06 17.75 6.38 3.20 15.94 9.21 11.96 6.03 BAB09810.1 late embryogenesis abundant protein LEA like[Arabidopsis thaliana] 1.00E-34 At5g06760
RAFL06-13-J20(=FL6-55) 2.98 2.18 41.79 32.69 51.69 25.54 110.96 9.90 92.00 45.40 CAA63012.1 LEA76 homologue type1 [Arabidopsis thaliana] 3.00E-89 At1g52690
RAFL05-04-I14(=RAFL06-13-J20) 2.16 0.15 24.14 10.66 33.29 14.36 64.14 12.18 90.40 7.08 E71604 hypothetical protein PFB0870w - malaria parasite (Plasmodiumfalciparum)
RD17 3.05 0.08 11.12 1.66 11.23 3.65 15.12 1.94 6.52 2.01
RAFL05-03-I09(=Rab18) 1.17 0.23 4.48 2.99 10.09 4.38 30.36 7.44 31.50 10.93 P30185 DH18_ARATH DEHYDRIN RAB18 At5g66400
RAFL03-07-M07 2.47 0.49 4.96 1.48 5.51 1.79 6.53 4.66 14.20 3.33 T01312 hypothetical protein T14P8.2 - Arabidopsis thaliana 1.00E-48 At4g02380
RAFL08-10-E21 1.02 0.33 1.72 0.88 4.87 1.95 29.31 21.06 31.13 9.22 BAB08620.1 gene_id:MUD21.2~pir||T09249~similar to unknown protein[Arabidopsis thaliana] 2.00E-40 At5g66780

RD29A 2.50 1.71 19.60 10.04 13.90 8.46 29.33 31.22 10.33 8.64
RAFL07-11-M21(=RD29A) 2.43 0.54 21.17 5.26 19.01 4.72 31.93 30.00 14.99 6.66 AAB25481.1 AAB25481.1| RD29A=responsive-to-dessication protein [Arabidopsis thaliana,Columbia ecotype, Peptide, 710 aa] 6.00E-40 At5g52310
RD29-B3'-DNA 1.43 0.58 9.44 7.47 13.39 7.28 51.72 8.09 35.51 20.72
RAFL05-11-I09(=RD29B) 3.05 0.25 27.19 19.31 38.39 20.08 133.99 19.83 110.79 109.60 BAB10527.1 low-temperature-induced 65 kD protein [Arabidopsisthaliana] At5g52300
KIN protein
kin1 0.82 0.05 4.72 1.22 6.83 2.78 19.92 18.48 3.52 1.75
kin2 0.83 0.06 3.60 0.82 2.78 0.75 10.06 13.80 1.02 0.22
Detoxification enzyme
RAFL04-17-K13 0.97 0.39 3.35 1.40 6.36 2.52 13.22 4.64 8.29 2.35 AAC95192.1 putative glutathione S-transferase [Arabidopsisthaliana] 6.00E-68 At2g29460
RAFL04-20-P19 0.71 0.16 1.16 0.31 1.92 0.72 4.79 0.81 11.19 0.52 P24101 PERC_ARATH NEUTRAL PEROXIDASE C PRECURSOR 4.00E-90 At3g49110
RAFL09-07-G15 0.80 0.26 1.18 0.13 1.55 0.43 6.01 1.69 16.94 12.41 T46118 peroxidase - Arabidopsis thaliana 8.00E-58 At3g49120
RAFL09-10-D20 0.70 0.23 1.52 0.44 3.03 1.08 6.43 0.49 3.08 0.84 AAB52725.1 glutathione peroxidase [Arabidopsis thaliana] At2g31570
RAFL05-14-J01 1.39 0.39 5.61 2.46 4.14 1.23 5.70 2.40 2.09 0.97 P46421 GTXA_ARATH GLUTATHIONE S-TRANSFERASE 103-1A e-107 At2g29450
Heat shock protein

RAFL09-06-L09 0.64 0.21 1.21 0.36 4.03 1.79 6.63 0.82 6.09 2.24 CAB72130.1 heat shock protein 70 [Cucumis sativus] 8.00E-26 At3g12580
RAFL06-15-N16 0.89 0.66 1.68 0.74 1.59 0.70 5.49 0.87 3.69 0.27 T49264 heat shock protein 17 - Arabidopsis thaliana 8.00E-85 At3g46230
Lipid transfer protein

RAFL05-04-F21 0.66 0.13 1.31 0.22 1.68 0.55 4.33 0.61 5.10 2.02 BAB01177.1 lipid transfer protein [Arabidopsis thaliana] 6.00E-49 At3g18280
RAFL05-04-J20(=FL5-2D23) 0.23 0.05 1.61 0.37 11.12 2.78 26.11 3.29 23.48 8.84 AAF76929.1 lipid transfer protein 3 [Arabidopsis thaliana] 1.00E-55 At5g59320
RAFL05-08-P24 0.56 0.02 1.21 0.12 3.15 1.08 9.87 1.43 10.28 4.14 AAF76930.1 lipid transfer protein 4 [Arabidopsis thaliana] 6.00E-60 At5g59310
RAFL08-08-I08(=RAFL05-08-P24) 0.14 0.06 0.67 0.14 7.83 2.28 50.46 19.69 42.50 19.43 AAF76930.1 lipid transfer protein 4 [Arabidopsis thaliana] 1.00E-31 At5g59310
RAFL05-12-N10 1.22 0.18 3.90 0.74 8.27 3.46 19.43 9.56 22.56 17.91 AAD32784.1 hypothetical protein [Arabidopsis thaliana] At2g37870
RAFL06-07-J20 0.67 0.22 3.18 1.65 4.38 1.34 8.45 1.98 12.21 5.94 Q9S7I3 LTP2_ARATH NONSPECIFIC LIPID-TRANSFER PROTEIN 2 PRECURSOR (LTP 2) 2.00E-63 At2g38530

RAFL09-16-N17 (=ERD6) 5.05 1.09 3.43 1.25 1.12 0.33 0.62 0.45 1.38 1.15 BAA25989.1 ERD6 protein [Arabidopsis thaliana] 4.00E-15 At1g08930
RAFL04-20-O21 0.94 0.17 6.62 2.63 2.72 1.33 2.40 0.69 1.37 0.50 T46101 ABC transporter-like protein - Arabidopsis thaliana 2.00E-19 At5g06530
RAFL05-14-L07 1.49 0.09 5.16 0.97 3.12 1.12 2.12 0.16 2.21 0.89 BAB10100.1 ABC transporter [Arabidopsis thaliana] 9.00E-35 At5g60790
RAFL07-17-D16 0.83 0.31 1.73 1.10 2.52 1.23 7.40 1.08 6.72 2.79 AAG27790.1 oligopeptide transporter, putative [Arabidopsis thaliana]
RAFL08-17-C11 0.83 0.32 1.82 0.95 3.11 1.38 5.47 1.60 6.04 2.55 T01493 probable potassium transport protein F17O7.17 - Arabidopsisthaliana 8.00E-52 At1g70300
RAFL09-09-E01 0.77 0.12 2.10 0.47 3.43 1.50 5.08 1.92 5.47 2.10 BAA96091.1 sodium sulfate or dicarboxylate transporter [Arabidopsisthaliana] 2.00E-27 At5g47560
RAFL09-10-F18 0.99 0.23 2.22 0.50 3.55 0.79 5.29 0.19 7.03 3.05 AAB87674.1 neutral amino acid transport system II [Arabidopsisthaliana] 5.00E-58 At1g58360
RAFL05-09-N09 10.34 5.54 6.88 5.23 10.07 4.74 4.25 2.79 2.85 0.35 AAD22351.1 putative mitochondrial dicarboxylate carrier protein[Arabidopsis thaliana] 7.00E-78 At2g22500
RAFL05-11-G05 8.02 3.48 7.10 4.07 2.67 1.34 2.02 1.69 1.66 0.71 T05577 uncoupling protein homolog F22K18.230 - Arabidopsis thaliana e-103 At4g24570
RAFL09-12-D09 0.99 0.50 1.25 0.40 2.29 1.21 6.26 1.67 5.23 2.30 AAD14460.1 putative chloroplast protein import component[Arabidopsis thaliana] 2.00E-34 At4g03320
RAFL11-01-A10 0.88 0.25 1.71 0.53 1.11 0.26 2.18 0.10 5.30 2.06 T48054 hypothetical protein F26K9.80 - Arabidopsis thaliana 7.00E-36 At3g62650
Water channel protein

RD28 1.04 0.08 10.51 3.01 2.45 0.71 1.26 0.04 0.69 0.19
RAFL11-09-M11(=RD28) 0.77 0.24 9.52 4.00 2.23 0.80 1.09 0.11 0.65 0.17 P30302 WC2C_ARATH PLASMA MEMBRANE INTRINSIC PROTEIN 2C (WATER-STRESS INDUCEDTONOPLAST INTRINS 2.00E-48
Membrane protein
RAFL09-16-O21 2.02 1.48 7.86 5.98 3.61 1.66 5.46 3.48 4.05 2.27 AAF24840.1 putative integral membrane protein; 47574-45498[Arabidopsis thaliana] 4.00E-44 At1g66760
Fatty acid metabolism, Lipids
RAFL07-08-E05 1.51 0.49 6.41 2.42 3.49 1.69 3.60 0.43 2.42 1.18 AAF36744.1 putative lipase; 80914-78480 [Arabidopsis thaliana] 1.00E-43 At1g73920
RAFL08-08-G07(=RAFL07-08-E05) 1.10 0.35 5.14 2.27 2.38 0.61 2.98 0.55 3.64 2.76 AAF36744.1 putative lipase; 80914-78480 [Arabidopsis thaliana] 6.00E-45
RAFL05-10-D11 1.31 0.36 3.96 1.34 3.33 1.64 8.31 2.55 4.36 1.31 AAG30967.1 lysophospholipase homolog, putative [Arabidopsisthaliana] 9.00E-55 At1g73480
RAFL05-14-M10 0.75 0.37 1.44 0.60 1.54 0.67 4.66 1.18 18.46 10.96 BAB08297.1 contains similarity to lipase~gene_id:MUA22.18[Arabidopsis thaliana] At5g14180
RAFL05-18-O21 1.16 0.04 2.63 0.55 3.19 1.13 7.35 1.07 6.32 3.65 AAB63082.1 putative lipase [Arabidopsis thaliana] e-104 At2g30550
RAFL06-16-C13 0.74 0.21 1.79 0.67 2.52 0.80 4.16 1.05 5.61 1.95 T04023 choline kinase 2 homolog F17A8.110 - Arabidopsis thaliana 2.00E-98 At4g09760
RAFL09-06-B11 0.94 0.53 3.18 1.27 5.23 1.65 9.33 1.91 9.28 2.31 AAF75082.1 Contains similarity to fatty acid elongase3-ketoacyl-CoA synthase 1 from Arabidopsis thalianagb|AF053345. It contains 2.00E-21 At1g07720
Cytochrome P450
RAFL04-16-P21 1.39 0.55 2.91 0.99 4.54 2.46 8.18 3.62 12.05 3.52 T04731 cytochrome P450 homolog F6G17.20 - Arabidopsis thaliana e-111 At4g37370
RAFL05-15-C04 7.29 8.34 9.92 9.87 8.00 3.51 11.73 6.21 7.95 3.78 T46196 cytochrome P450-like protein - Arabidopsis thaliana e-120 At3g48520
RAFL08-19-C07 0.78 0.40 1.74 1.04 5.66 2.62 36.82 27.58 18.35 3.74 O64637 C7C2_ARATH CYTOCHROME P450 76C2 3.00E-56 At2g45570
RAFL05-16-H03 1.23 0.29 5.17 2.05 2.29 0.71 1.37 0.14 0.91 0.28 O23066 C862_ARATH CYTOCHROME P450 86A2 e-101 At4g00360
Aldehyde dehydrogenase
RAFL03-05-E06 0.81 0.06 1.41 0.13 1.19 0.26 2.06 0.19 5.64 2.34 T06683 aldehyde dehydrogenase (NAD+) (EC 1.2.1.3) T17F15.130 - Arabidopsisthaliana 8.00E-99 At3g48000
RAFL05-21-E06 0.93 0.17 5.87 1.20 8.74 2.95 14.57 1.70 22.54 6.01 AAD25783.1 Strong similarity to gb|S77096 aldehyde dehydrogenasehomolog from Brassica napus and is a member of PF|00171Ald 9.00E-84 At1g54100
RAFL04-09-D07(=RAFL05-21-E06) 0.74 0.01 4.23 1.44 6.75 2.14 11.98 2.26 20.87 6.99 AAD25783.1 Strong similarity to gb|S77096 aldehyde dehydrogenasehomolog from Brassica napus and is a member of PF|00171Ald 1.00E-44 At1g54100
Plant defense
RAFL04-12-G16 0.59 0.04 1.81 0.78 3.26 1.12 3.75 0.40 5.89 2.79 AAB64049.1 putative endochitinase [Arabidopsis thaliana] 5.00E-98 At2g43570
RAFL05-09-M02 5.68 0.32 3.85 1.11 1.77 0.58 1.98 0.52 3.12 0.74 BAB08954.1 harpin-induced protein-like [Arabidopsis thaliana] At5g06320
RAFL05-20-E01 7.47 2.56 3.42 2.12 4.16 1.55 4.29 2.06 4.15 1.23 T47682 beta-1,3-glucanase-like protein - Arabidopsis thaliana 6.00E-86 At3g55430
RAFL11-01-D24 0.77 0.24 1.93 0.39 2.55 0.87 5.80 0.17 6.59 3.34 AAF24612.1 feebly-like protein [Arabidopsis thaliana] 3.00E-40 At3g01420
Alcohol dehydrogenase
ADH 0.68 0.13 2.08 0.54 6.67 1.38 7.32 3.40 5.07 0.57
RAFL07-16-P10(=ADH) 0.51 0.14 2.24 0.48 7.73 2.25 7.26 3.44 6.61 3.02 AAF23549.1 alcohol dehydrogenase [Arabis pauciflora] 2.00E-42 At1g77120
RAFL05-19-B10 0.87 0.25 1.89 1.10 7.78 3.22 4.62 1.14 3.40 1.14 AAF05859.1 putative short-chain type dehydrogenase/reductase[Arabidopsis thaliana] At3g04000
ABA biosynthesis
AtNCED3 4.32 1.95 16.10 15.18 5.24 0.20 23.96 10.92 6.00 1.58
RAFL08-11-H16(=AtNCED3) 6.03 3.30 13.38 7.43 8.21 4.09 16.07 1.99 6.19 3.72 T07123 nine-cis-epoxycarotenoid dioxygenase - tomato At3g14440
RAFL07-13-A16 0.74 0.21 1.97 0.63 2.73 0.92 5.77 1.75 3.01 1.06 AAG17703.1 zeaxanthin epoxidase [Arabidopsis thaliana] 3.00E-19 At5g67030
Ethylene biosynthesis
RAFL08-10-M13 0.89 0.25 1.51 0.13 2.07 0.92 5.16 1.63 8.18 6.59 S44261 SRG1 protein - Arabidopsis thaliana 8.00E-51 At1g17020
JA biosynthesis
RAFL08-10-O15 5.05 4.77 2.31 1.15 0.94 0.39 0.87 0.21 1.43 0.86 AAF21176.1 putative lipoxygenase, 5' partial; 101105-97928[Arabidopsis thaliana] 2.00E-55 At1g72520
JA-regulated genes
RAFL06-09-N04 0.89 0.23 1.49 0.38 4.91 0.99 11.92 1.04 11.69 4.62 BAA96998.1 contains similarity to jasmonate inducibleprotein~gene_id:MIF21.7 [Arabidopsis thaliana] At5g48180
IAA metabolism
RAFL05-11-H09 1.32 0.34 1.91 0.57 2.74 1.48 4.01 1.70 6.82 3.24 AAD30627.1 Similar to indole-3-acetate beta-glucosyltransferase[Arabidopsis thaliana] e-103 At1g05680
RAFL05-16-G04 1.09 0.30 2.39 0.68 3.41 1.28 4.83 2.20 5.55 2.25 T00584 indole-3-acetate beta-glucosyltransferase homolog T27E13.12 -Arabidopsis thaliana e-109 At2g30140
RAFL06-13-E03 0.49 0.15 0.70 0.14 1.14 0.31 2.98 0.18 5.14 2.22 AAB05220.1 nitrilase 2 [Arabidopsis thaliana] 4.00E-97 At3g44300
Auxin-regulated genes
RAFL07-11-A11 2.33 0.75 7.34 3.09 2.14 0.87 1.51 0.15 0.90 0.32 AAF86349.1 FIN219 [Arabidopsis thaliana] 7.00E-52 At2g46370
Wound-inducible genes
RAFL05-19-P11 2.54 0.33 8.19 1.93 2.14 0.79 1.59 0.19 1.39 0.30 AAF01523.1 unknown protein [Arabidopsis thaliana] 4.00E-56 At3g10980
Ionic homeostasis
RAFL05-03-P08 0.90 0.10 1.21 0.26 1.79 0.57 3.04 1.17 5.86 2.09 P25860 MT2A_ARATH METALLOTHIONEIN-LIKE PROTEIN 2A (MT-2A) (MT-K) (MT-1G) At3g09390
ERD7 6.40 4.91 6.92 6.22 3.16 0.91 3.09 0.97 4.64 2.72
RAFL05-19-F21 1.43 0.40 1.86 0.54 6.59 5.03 55.73 16.25 28.48 13.01 CAC05445.1 senescence-associated protein (SAG29) [Arabidopsisthaliana] 1.00E-78 At5g13170
RAFL02-09-H01 2.24 0.86 2.92 1.44 1.50 0.55 5.19 2.94 16.64 4.71 S66345 senescence-associated protein sen1 - Arabidopsis thaliana 5.00E-99 At4g35770
Cellular metabolism
RAFL05-14-F20 1.07 0.32 3.61 2.36 6.28 2.83 9.36 4.36 12.08 2.84 AAF24813.1 F12K11.9 [Arabidopsis thaliana] e-106 At1g06570
RAFL11-09-O05(=RAFL05-14-F20) 0.90 0.32 3.46 1.88 2.60 0.87 8.05 4.04 6.20 3.60 AAF24813.1 F12K11.9 [Arabidopsis thaliana] 6.00E-41 At1g06570
RAFL07-07-N10 1.02 0.46 4.87 4.89 3.90 2.49 5.89 1.68 1.41 0.68 AAF79535.1 F21D18.18 [Arabidopsis thaliana] 2.00E-30 At1g48100
RAFL06-15-O23(=RAFL07-07-N10) 0.86 0.31 5.24 3.95 4.70 2.14 5.96 1.65 1.73 0.25 AAF79535.1 F21D18.18 [Arabidopsis thaliana] 6.00E-84 At1g48100
RAFL05-10-A09 1.13 0.13 1.77 0.52 2.11 1.25 4.99 1.86 2.20 0.74 AAD49980.1 Similar to gb|AF110333 PrMC3 protein from Pinus radiataand is a member of PF|00135 Carboxylesterases family.EST 9.00E-72 At1g68620
RAFL05-01-L22(=RAFL05-10-A09) 1.21 0.32 2.31 0.75 2.88 1.61 6.64 2.51 2.48 0.35 AAD49980.1 Similar to gb|AF110333 PrMC3 protein from Pinus radiataand is a member of PF|00135 Carboxylesterases family.EST e-102 At1g68620
RAFL05-01-D08 1.55 0.43 2.72 0.74 3.94 1.61 6.73 1.70 11.78 2.73 AAD20078.1 putative steroid sulfotransferase [Arabidopsis thaliana] 5.00E-59 At2g03760
RAFL05-02-O17 0.64 0.08 1.34 0.28 3.82 1.38 13.97 4.72 27.25 18.95 T05195 saccharopine dehydrogenase (NADP+, L-lysine-forming) (EC 1.5.1.8) -Arabidopsis thaliana 9.00E-71 At4g33150
RAFL05-08-B14 0.68 0.13 1.39 0.22 1.65 0.55 8.39 0.30 31.97 13.86 T02505 hypothetical protein T19C21.11 - Arabidopsis thaliana At2g38400
RAFL05-15-D21 1.08 0.09 1.83 0.64 2.65 1.17 6.59 0.38 8.17 3.77 AAD21729.1 putative citrate synthase [Arabidopsis thaliana] 1.00E-79 At2g42790
RAFL05-19-H07 0.98 0.14 1.40 0.20 2.94 1.16 6.45 0.69 4.17 0.75 P46644 AAT3_ARATH ASPARTATE AMINOTRANSFERASE, CHLOROPLAST PRECURSOR (TRANSAMINASE A) At5g11520
RAFL06-14-F12 1.36 0.49 3.88 3.11 5.91 2.01 15.35 2.03 16.24 8.02 T50818 alpha-hydroxynitrile lyase-like protein - Arabidopsis thaliana e-111
RAFL06-16-J10 4.77 1.13 6.39 1.95 1.48 0.46 1.12 0.22 0.83 0.22 AAD19764.1 12-oxophytodienoate-10,11-reductase [Arabidopsisthaliana] e-102 At2g06050
RAFL07-10-M07 0.75 0.23 1.56 0.85 1.91 0.92 5.39 0.58 3.81 2.06 BAB10727.1 tyrosine aminotransferase [Arabidopsis thaliana] 7.00E-36 At5g53970
RAFL08-19-D04 0.81 0.42 1.88 1.19 2.13 0.66 14.66 10.28 19.45 14.66 AAC62126.1 malate oxidoreductase (malic enzyme) [Arabidopsisthaliana] 1.00E-33 At2g19900
RAFL09-06-G09 1.06 0.35 1.25 0.35 1.64 0.56 3.85 1.61 9.43 4.05 AAD45605.1 isovaleryl-CoA-dehydrogenase precursor [Arabidopsisthaliana] 7.00E-32 At3g45300
RAFL09-10-H19 0.84 0.37 1.09 0.30 1.56 0.56 3.43 0.42 5.36 2.47 AAC04908.1 3-ketoacyl-CoA thiolase [Arabidopsis thaliana] 1.00E-29 At2g33140
RAFL09-10-N03 0.81 0.25 1.95 0.55 3.04 0.93 6.80 0.32 8.48 4.04 AAG21484.1 glyoxalase II, putative; 78941-80643 [Arabidopsisthaliana] At1g53580
RAFL09-11-J12 0.66 0.26 1.77 0.67 3.30 0.63 4.31 1.16 5.40 3.97 T51815 succinate dehydrogenase (EC 1.3.99.1) flavoprotein alpha chain[imported] - Arabidopsis thaliana 1.00E-67 At5g66760
RAFL09-09-K15 0.92 0.29 3.76 1.54 4.83 1.48 6.32 1.51 5.62 3.57 AY058849 acyl-CoA oxidase- Arabidopsis thaliana 1.00E-90 At4g16760
RAFL09-07-G09 3.19 2.43 3.09 1.96 3.48 1.91 8.03 5.02 9.44 7.98 P49078 ASNS_ARATH ASPARAGINE SYNTHETASE [GLUTAMINE-HYDROLYZING] (GLUTAMINE-DEPENDENTASPARAGINE SYNTHETASE) At3g47340
RAFL09-16-K24 1.05 0.42 2.07 0.90 1.87 0.63 4.12 1.19 16.86 10.89 T00626 branched-chain amino acid aminotransferase homolog T27I1.9 -Arabidopsis thaliana At1g10070
RAFL04-19-J05 0.99 0.18 1.62 0.60 2.77 1.50 7.53 1.87 6.97 0.97 T02126 glucose-6-phosphate/phosphate translocator precursor - Arabidopsisthaliana 1.00E-72 At1g61800
RAFL05-02-P11 0.90 0.23 1.63 0.19 2.15 0.76 4.09 1.00 9.19 4.72 AAF87255.1 Strong similarity to UDP-glucose glucosyltransferasefrom Arabidopsis thaliana gb|AB016819 and contains aUDP-gluco e-113 At1g22370
RAFL05-11-O20 6.21 0.47 16.04 5.17 10.68 3.29 15.38 1.98 10.80 3.85 AAF63643.1 neutral invertase, putative; 73674-70896 [Arabidopsisthaliana] 9.00E-82 At3g06500
RAFL05-12-L24 0.95 0.69 1.86 1.22 6.38 2.53 7.37 2.89 7.83 4.07 AAF36747.1 putative glucosyltransferase; 88035-86003 [Arabidopsisthaliana] 6.00E-91 At1g73880
RAFL05-15-B03 1.17 0.46 3.17 2.07 2.68 1.29 6.69 2.34 4.65 3.64 T00467 UDPglucose 4-epimerase homolog F19I3.8 - Arabidopsis thaliana At2g34850
RAFL05-18-H16 0.82 0.18 1.44 0.66 4.48 2.52 10.63 4.54 7.73 4.78 AAD20154.1 putative glucosyl transferase [Arabidopsis thaliana] At2g36780
RAFL08-08-F02 0.79 0.33 1.31 0.69 2.05 1.06 2.53 1.13 5.08 1.82 T10232 hypothetical protein T11I11.100 - Arabidopsis thaliana 2.00E-41 At4g34860
RAFL08-10-K08 1.13 0.40 5.41 4.00 4.70 2.77 7.34 2.27 4.12 2.23 T45603 glucosyltransferase-like protein - Arabidopsis thaliana 4.00E-62 At3g46660
RAFL09-09-L03 0.97 0.27 2.74 0.47 2.86 0.53 2.78 0.60 5.43 4.25 AAF26789.1 putative O-linked GlcNAc transferase [Arabidopsisthaliana] At3g04240
RAFL09-12-B03 0.78 0.33 1.29 0.16 1.64 0.47 13.72 7.79 52.68 35.07 AAG23719.1 beta-glucosidase [Arabidopsis thaliana] 2.00E-52 At3g60140
RAFL09-13-P15 1.87 0.84 9.29 4.19 9.37 2.76 17.95 3.90 12.20 6.00 BAB03009.1 beta-amylase [Arabidopsis thaliana] 1.00E-31 At3g23920
RAFL09-14-D11 1.11 0.42 1.33 0.26 1.18 0.43 3.46 0.47 9.37 3.69 AAF19575.1 putative alpha-L-arabinofuranosidase [Arabidopsisthaliana] 5.00E-41 At3g10740
Secondary-metabolism
RAFL05-05-F20 1.39 0.18 3.01 0.25 3.40 1.19 11.47 6.58 4.13 1.45 T47762 hypothetical protein F24I3.100 - Arabidopsis thaliana 1.00E-28 At3g57020
RAFL05-09-N10 1.00 0.47 1.87 0.56 7.11 2.12 16.34 3.97 9.68 3.43 T47761 hypothetical protein F24I3.90 - Arabidopsis thaliana 5.00E-42 At3g57010
RAFL05-09-P03 1.56 0.43 1.95 0.45 2.62 1.09 6.41 1.30 5.29 1.39 AAF36734.1 putative strictosidine synthase; 35901-37889[Arabidopsis thaliana] At1g74020
RAFL07-15-M03 0.90 0.35 7.11 8.16 2.48 1.03 4.97 1.15 3.45 0.72 T01256 SRG1 protein homolog F16M14.17 - Arabidopsis thaliana At2g38240
RAFL09-07-M01 5.31 3.82 4.29 2.77 2.34 1.02 3.85 1.50 4.63 3.33 T10625 reticuline oxidase homolog F21C20.180 - Arabidopsis thaliana 3.00E-33 At4g20830
RAFL02-05-I05 1.01 0.26 1.39 0.43 3.37 1.98 8.40 1.57 5.36 2.65 Q02972 MTD2_ARATH PROBABLE MANNITOL DEHYDROGENASE 2 (NAD-DEPENDENT MANNITOLDEHYDROGENASE 2 3.00E-76 At4g37990
RAFL04-14-P24 1.08 0.08 4.67 1.03 7.04 2.32 13.30 7.15 4.93 1.09 T05413 cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) F28A23.10 -Arabidopsis thaliana 1.00E-93 At4g34230
RAFL09-16-M04 0.80 0.26 1.26 0.51 1.90 0.30 2.99 0.47 6.75 4.65 T05625 cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) ELI3-1 - Arabidopsisthaliana 5.00E-38 At4g37980
RAFL11-07-D13 0.95 0.42 1.76 0.91 2.10 0.63 4.07 1.84 6.79 5.41 AAF21160.1 putative cinnamyl-alcohol dehydrogenase; 49641-51171[Arabidopsis thaliana] 2.00E-37 At1g72680
RAFL05-18-A06 0.74 0.26 1.57 0.39 4.87 0.58 34.27 10.84 30.22 17.59 AAC33210.1 Highly similar to cinnamyl alcohol dehydrogenase,gi|1143445 [Arabidopsis thaliana] e-105 At1g09500
RAFL06-15-H16(=RAFL05-18-A06) 0.71 0.30 1.43 0.48 5.27 2.05 28.25 10.64 23.61 15.78 AAC33210.1 Highly similar to cinnamyl alcohol dehydrogenase,gi|1143445 [Arabidopsis thaliana] At1g09500
RAFL05-12-N20 0.97 0.56 6.21 3.84 5.75 2.03 6.85 2.84 3.31 1.09 CAB79765.1 cinnamoyl-CoA reductase-like protein [Arabidopsisthaliana] 1.00E-80 At4g30470
RAFL05-14-E15 1.26 0.11 2.88 0.64 7.48 2.91 14.53 1.24 18.81 4.84 AAB80681.1 putative cinnamoyl-CoA reductase [Arabidopsis thaliana] 7.00E-84 At2g33590
RAFL05-03-O21 2.57 1.88 7.97 6.78 4.37 1.90 8.22 4.93 3.22 1.72 BAB11549.1 leucoanthocyanidin dioxygenase-like protein [Arabidopsisthaliana] 6.00E-75 At5g05600
Respiration
Protein synthesis
RAFL07-17-P18 0.72 0.22 1.53 0.40 1.83 0.65 2.52 0.60 7.52 6.32 BAB11335.1 eukaryotic release factor 1 homolog [Arabidopsisthaliana] 3.00E-09 At5g47880
Reproductive development
RAFL05-05-G20 0.89 0.17 4.78 2.58 10.59 4.20 20.90 1.81 19.77 10.39 AAF32455.1 unknown protein [Arabidopsis thaliana] 3.00E-31 At3g02480
RAFL04-09-M06 7.75 3.08 5.52 2.61 2.08 1.00 1.82 0.69 2.98 0.47 T47537 hypothetical protein F16L2.180 - Arabidopsis thaliana At3g45970 (AF261277) beta-expansin [Oryza sativa]
RAFL06-12-F13(=RAFL04-09-M06) 8.53 7.06 7.56 8.00 3.38 1.38 2.13 1.43 6.77 1.63 T47537 hypothetical protein F16L2.180 - Arabidopsis thaliana 1.00E-70 At3g45970

RAFL04-14-J04 7.56 0.66 2.71 0.85 0.65 0.20 0.34 0.07 0.62 0.10 AAF19577.1 putative pectinesterase [Arabidopsis thaliana] e-122 At3g10720
RAFL05-09-D10 1.54 0.25 1.38 0.22 1.73 0.62 4.24 0.33 8.18 4.30 AAC72119.1 Strong similarity to gb|D14550 extracellular dermalglycoprotein (EDGP) precursor from Daucus carota. ESTsgb|H3728 e-101 At1g03220
RAFL05-14-I08 7.17 1.19 9.97 2.09 11.22 4.54 11.74 5.28 12.96 3.85 AAC77823.1 arabinogalactan-protein [Arabidopsis thaliana] 5.00E-65 At5g64310
RAFL07-12-F11 1.00 0.33 5.74 1.81 4.66 1.34 2.10 0.53 0.75 0.29 T45827 pectinesterase-like protein - Arabidopsis thaliana At3g49220
RAFL09-11-I12 1.49 0.98 2.07 1.64 1.36 0.54 1.50 0.68 13.66 9.46 AAD45127.1 endoxyloglucan transferase [Arabidopsis thaliana] 2.00E-48 At5g57550
RAFL09-13-M13 2.69 1.28 3.33 1.91 2.46 1.02 5.67 4.61 11.24 5.93 AAA92363.1 TCH4 protein [Arabidopsis thaliana] At5g57560
RAFL05-15-K08 0.86 0.18 1.19 0.27 1.09 0.46 2.77 0.84 6.71 1.90 BAB08802.1 xylose isomerase [Arabidopsis thaliana] 6.00E-81 At5g57655
RAFL09-07-E15 2.03 0.52 1.08 0.04 0.60 0.19 3.26 1.73 6.15 2.00 BAB09906.1 xylosidase [Arabidopsis thaliana] 8.00E-40 At5g49360
RAFL04-13-E17 2.61 0.55 3.02 2.31 1.91 0.83 7.43 3.96 7.65 4.06 T51838 blue copper binding protein homolog [imported] - Arabidopsisthaliana At5g20230
DNA, nucleus
RAFL05-16-J08 1.16 0.60 2.03 0.68 1.85 0.39 4.09 1.12 5.82 1.99 T06703 hypothetical protein T29H11.90 - Arabidopsis thaliana e-106 At3g48390
RAFL05-20-P13 0.69 0.09 1.18 0.21 1.10 0.33 2.31 0.72 6.59 3.00 AAC49789.1 histone H1-3 [Arabidopsis thaliana] 2.00E-78 At2g18050
RAFL06-11-A17 3.16 1.80 3.77 1.94 2.60 1.37 4.08 1.89 5.07 2.87 BAB10671.1 contains similarity to nucleoid DNA-bindingprotein~gene_id:MPA22.8 [Arabidopsis thaliana] 8.00E-71 At5g37540
RNA-binding protein
RAFL08-13-G20 1.20 0.42 4.10 3.21 5.10 3.38 20.97 2.31 20.37 13.34 T48173 hypothetical protein F7A7.40 - Arabidopsis thaliana 9.00E-52 At5g01520
RAFL09-17-E14(=RAFL08-13-G20) 0.85 0.28 3.50 2.50 3.22 1.48 15.11 3.05 11.87 8.46 T48173 hypothetical protein F7A7.40 - Arabidopsis thaliana 8.00E-31 At5g01520
Ferritin
RAFL06-11-F15(=FL5-3A15) 0.32 0.07 1.13 0.20 3.30 0.94 5.55 1.30 6.93 2.09 S71265 ferritin - Arabidopsis thaliana 6.00E-94 At5g01600
Epoxide hydrolase
RAFL09-14-G09 0.81 0.16 2.13 0.62 1.90 0.44 2.68 0.18 5.11 3.60 T45731 epoxide hydrolase-like protein - Arabidopsis thaliana 6.00E-47 At3g51000
Mei2
RAFL09-12-D07 1.09 0.42 1.80 1.34 1.62 0.53 2.79 1.11 6.33 3.31 AAF21885.1 MEI2 [Arabidopsis thaliana] 2.00E-32 At2g42890
cor15A 1.51 0.22 6.54 2.00 7.49 2.33 37.63 46.29 2.42 0.96
RAFL05-03-A05(=cor15A) 0.95 0.15 5.55 1.54 9.34 3.48 31.89 40.79 2.35 1.37 S43769 cold-regulated protein cor15a precursor - Arabidopsis thaliana 2.00E-70 At2g42540
RAFL05-21-N22 1.49 0.77 1.61 0.92 2.43 1.18 3.77 1.35 5.62 3.52 AAF21149.1 hypothetical protein; 13251-12244 [Arabidopsis thaliana] 2.00E-81 At1g72800
RAFL02-03-F05 2.43 0.37 5.64 1.46 3.79 1.04 3.39 1.57 4.03 0.83 AAF07384.1 hypothetical protein; 28820-29921 [Arabidopsis thaliana] 2.00E-79 At1g69890
RAFL02-06-B20 0.85 0.26 1.21 0.25 1.32 0.59 1.37 0.26 6.13 2.89 T49126 hypothetical protein F26G5.50 - Arabidopsis thaliana 5.00E-86
RAFL03-06-H10 0.95 0.20 1.81 0.40 2.13 0.98 3.35 1.18 6.39 3.01 BAB08959.1 gb|AAF32477.1~gene_id:MHF15.11~similar to unknownprotein [Arabidopsis thaliana] 5.00E-50
RAFL03-07-F12 1.27 0.20 2.38 0.59 2.16 0.91 5.59 1.28 10.22 4.99 T05822 hypothetical protein T5K18.170 - Arabidopsis thaliana e-108 At4g19390
RAFL04-10-F13 0.70 0.11 1.71 0.44 2.28 0.88 7.45 1.15 2.16 0.41 S74942 hypothetical protein slr0692 - Synechocystis sp. (strain PCC 6803) 1.00E-10 At3g10420
RAFL04-12-P15 1.08 0.06 1.76 0.52 2.21 0.76 5.39 0.63 4.12 1.62 BAB10589.1 gene_id:MNL12.8~unknown protein [Arabidopsis thaliana] At5g43260
RAFL04-14-C06 0.99 0.17 3.52 2.53 4.55 1.46 10.17 1.95 7.74 2.75 ******No Hit Found******
RAFL04-14-N10 1.05 0.19 1.58 0.60 4.30 1.49 10.23 1.71 4.55 1.51 AAF79724.1 T25N20.10 [Arabidopsis thaliana] e-102 At3g22610
RAFL04-17-I03 0.96 0.28 1.48 0.38 3.13 1.09 7.88 0.65 10.98 3.70 AAF82216.1 ESTs gb|AI993254, gb|T76141 and gb|AA404864 come fromthis gene. [Arabidopsis thaliana] e-102 At1g07040
RAFL08-19-M03(=RAFL04-17-I03) 0.68 0.20 1.39 0.43 2.08 0.55 4.82 1.26 11.88 7.15 AAF82216.1 ESTs gb|AI993254, gb|T76141 and gb|AA404864 come fromthis gene. [Arabidopsis thaliana] At1g07040
RAFL04-17-M22 1.13 0.13 11.45 4.35 4.52 1.99 4.21 1.23 2.43 1.32 AAG30970.1 hypothetical protein [Arabidopsis thaliana] 3.00E-79 At1g73390
Uncharacterized proteins Av. S.D. Av. S.D. Av. S.D. Av. S.D. Av. S.D. Genbank
RAFL04-19-E09 0.89 0.20 1.34 0.53 1.34 0.45 4.15 0.70 6.65 1.14 BAB10048.1 contains similarity to remorin~gene_id:MRO11.21[Arabidopsis thaliana] 1.00E-87 At5g23750
RAFL05-01-D05 1.74 0.29 3.51 1.43 5.24 2.87 18.50 3.86 10.51 1.23 T05004 hypothetical protein T19P19.60 - Arabidopsis thaliana At4g39670
RAFL05-02-E09 1.12 0.14 1.71 0.72 1.17 0.52 4.63 2.07 6.46 1.85 BAB10252.1 gene_id:K9E15.9~unknown protein [Arabidopsis thaliana] e-106 At5g45310
RAFL05-02-G08 1.13 0.40 1.70 0.57 1.23 0.46 8.42 3.39 7.57 2.82 T47817 hypothetical protein F24G16.200 - Arabidopsis thaliana 3.00E-37 At3g59930
RAFL05-03-K03 2.13 0.14 7.53 2.16 4.39 1.52 4.31 0.54 4.09 1.12 T09559 hypothetical protein L73G19.50 - Arabidopsis thaliana 5.00E-93 At4g25670
RAFL05-05-A17 1.47 0.15 4.21 1.89 3.49 1.79 10.63 7.39 4.06 1.47 BAB01982.1 contains similarity to unknownprotein~gb|AAF27062.1~gene_id:MWE13.5 [Arabidopsisthaliana] 9.00E-93 At3g29575
RAFL05-05-D20 1.11 0.02 2.85 0.76 1.85 0.76 2.97 0.36 5.86 2.00 BAB08327.1 NAM (no apical meristem)-like protein [Arabidopsisthaliana] At5g22290
RAFL05-05-E24 0.88 0.08 1.88 0.74 2.39 1.23 6.67 1.97 6.24 2.87 AAF79404.1 F16A14.21 [Arabidopsis thaliana] e-105 At1g13990
RAFL05-05-K10 6.10 2.07 8.06 4.05 4.30 1.86 5.17 0.94 2.01 1.03 T02134 hypothetical protein F8K4.9 - Arabidopsis thaliana At1g61890
RAFL05-05-N18 0.78 0.10 1.77 0.27 2.88 0.96 4.36 0.89 9.18 5.88 BAB09471.1 gb|AAF00631.1~gene_id:MRG7.9~similar to unknown protein[Arabidopsis thaliana] e-105 At5g18130
RAFL05-07-A03 0.86 0.25 1.42 0.46 2.89 1.30 6.20 1.17 5.78 1.87 AAF97267.1 F2H15.10 [Arabidopsis thaliana] e-111 At1g17870
RAFL05-07-D22 1.78 0.71 3.42 0.72 3.78 1.31 3.74 1.04 5.18 1.66 G81737 hypothetical protein TC0130 [imported] - Chlamydia muridarum(strain Nigg) 1.00E-73 At2g01030
RAFL05-08-B11 2.93 0.25 8.69 3.75 5.87 2.61 15.34 8.63 7.94 0.78 T50527 hypothetical protein T27I15_150 - Arabidopsis thaliana At3g61060
RAFL05-09-G07 1.31 0.18 2.65 0.90 3.51 1.37 5.34 1.78 3.74 0.99 BAB14593.1 unnamed protein product [Homo sapiens] At4g17650
RAFL05-09-K04 2.09 0.41 4.14 1.66 6.06 2.74 9.64 3.34 10.39 8.36 BAB09455.1 emb|CAB62340.1~gene_id:MXI22.7~similar to unknownprotein [Arabidopsis thaliana] 2.00E-81 At5g50360
RAFL05-09-L03 5.12 2.11 6.86 4.05 3.74 1.59 3.90 0.98 3.09 1.06 BAB11552.1 gene_id:MNA5.2~unknown protein [Arabidopsis thaliana] 3.00E-81 At5g65300
RAFL05-10-D21 0.83 0.33 1.62 0.52 2.24 0.96 6.80 1.45 6.47 1.07 AAD25786.1 F15I1.22 [Arabidopsis thaliana] 1.00E-57 At1g54120
RAFL05-10-E07 1.01 0.13 2.49 0.40 1.71 0.56 3.37 0.92 5.11 1.88 AAF27061.1 F4N2.21 [Arabidopsis thaliana] 7.00E-21
RAFL05-09-G08 1.17 0.60 6.74 3.73 18.72 11.71 46.61 19.81 33.22 22.80 BAB00753.1 embryonic abundant protein LEA-like [Arabidopsisthaliana] At3g15670
RAFL05-11-A20 2.59 2.29 8.15 7.14 1.77 0.75 1.36 0.47 1.66 0.47 AAF79491.1 F1L3.3 [Arabidopsis thaliana] e-112 At1g17380
RAFL05-12-H13 1.65 0.28 12.38 4.98 5.66 2.14 5.82 1.49 4.83 2.14 T10542 hypothetical protein F3I3.40 - Arabidopsis thaliana 2.00E-58 At4g01020
RAFL05-12-I12 1.24 0.22 1.95 0.82 2.01 0.86 4.82 0.41 6.29 2.32 T49945 periaxin-like protein - Arabidopsis thaliana 3.00E-12 At5g09530
RAFL05-14-A12 1.03 0.30 7.55 2.90 1.81 0.71 1.31 0.62 1.68 0.34 AAC69932.2 putative myosin heavy chain [Arabidopsis thaliana] e-121
RAFL05-14-D05 4.19 1.21 6.43 3.71 4.94 1.95 4.33 0.78 3.98 1.60 T05165 hypothetical protein F18E5.190 - Arabidopsis thaliana 4.00E-99 At4g21570
RAFL05-14-G18 1.18 0.28 5.12 1.38 6.68 2.13 5.93 0.99 5.96 2.41 BAB10082.1 MtN19-like protein [Arabidopsis thaliana] 2.00E-86 At5g61820
RAFL05-14-I17 2.94 2.12 9.76 8.93 3.30 0.94 2.10 1.24 1.45 0.34 BAA97158.1 mutT domain protein-like [Arabidopsis thaliana] e-107 At5g47240
RAFL05-15-L21 0.92 0.52 1.33 0.60 3.40 1.37 5.30 0.68 7.86 3.68 BAB02810.1 emb|CAA16777.1~gene_id:MQC12.4~similar to unknownprotein [Arabidopsis thaliana] e-100 At3g20300
RAFL05-16-F03 2.67 1.80 17.04 20.33 10.03 6.52 30.48 5.06 14.16 8.46 AAD43155.1 Hypothetical Protein [Arabidopsis thaliana] 1.00E-73 At1g49450
RAFL05-17-L09 0.99 0.08 1.20 0.43 1.98 0.74 8.14 1.72 5.87 1.60 AAD24653.1 putative glycine-rich protein [Arabidopsis thaliana] 2.00E-79 At2g05540
RAFL05-18-I12 3.17 2.21 26.67 12.46 39.80 25.75 73.39 36.49 64.88 64.40 AAC63632.1 unknown protein [Arabidopsis thaliana] 4.00E-99 At2g47770
RAFL05-19-O23 0.72 0.07 1.74 0.07 3.46 1.20 7.23 1.88 10.75 4.78 T51785 lethal leaf-spot 1 homolog Lls1 - Arabidopsis thaliana 8.00E-28
RAFL05-21-G18 0.79 0.44 1.66 1.36 1.82 1.00 4.29 1.35 5.89 2.66 AAG21535.1 unknown protein; 53331-55322 [Arabidopsis thaliana] 1.00E-94 At1g55280
RAFL06-07-D06 2.70 0.47 3.44 0.95 3.40 0.91 4.29 1.13 6.25 2.56 BAB08438.1 gene_id:MJC20.15~similar to unknown protein~sp|P37707[Arabidopsis thaliana] 2.00E-65 At5g42050
RAFL06-07-I05 2.31 0.63 7.36 3.16 2.78 1.32 1.72 0.76 1.98 0.57 CAC05470.1 putative protein [Arabidopsis thaliana] 5.00E-88 At5g09440
RAFL06-09-E13 1.22 0.31 3.56 1.39 3.95 1.35 5.26 1.23 5.51 2.15 B72581 hypothetical protein APES063 - Aeropyrum pernix (strain K1) At2g01010
RAFL06-09-G16 1.02 0.29 1.73 0.27 1.47 0.54 2.80 0.29 5.41 3.20 BAB00764.1 gene_id:MSJ11.18~unknown protein [Arabidopsis thaliana] 4.00E-58 At3g15780
RAFL06-10-A08 1.05 0.21 2.81 1.32 2.41 1.06 4.66 0.48 5.07 1.36 AAD25563.1 hypothetical protein [Arabidopsis thaliana] 6.00E-84 At2g38820
RAFL06-10-C16 3.47 1.43 6.37 6.18 20.24 13.55 81.09 32.53 127.93 68.41 AAB71443.1 EST gb|ATTS0295 comes from this gene. [Arabidopsisthaliana] 7.00E-31 At1g05340
RAFL09-15-I16(=RAFL06-10-C16) 1.22 0.36 2.56 0.91 3.08 0.36 8.84 1.85 8.94 1.35 AAB71443.1 EST gb|ATTS0295 comes from this gene. [Arabidopsisthaliana] At1g05340
RAFL06-10-I08 0.75 0.21 3.26 1.35 4.13 1.93 8.74 1.38 3.04 2.37 T04592 glycine-rich cell wall structural protein homolog F23E13.120 -Arabidopsis thaliana 6.00E-12 At5g50100
RAFL06-11-I17 8.18 3.71 6.69 7.05 1.95 0.51 2.21 1.52 2.32 0.60 ******No Hit Found******
RAFL06-12-H12 1.96 0.50 15.03 5.61 7.03 2.97 19.42 10.19 19.49 9.03 T48223 hypothetical protein T7H20.70 - Arabidopsis thaliana 7.00E-68 At5g02020
RAFL06-15-P15 0.91 0.36 2.02 1.42 6.29 4.40 40.13 14.73 30.39 19.74 AAD55473.1 Hypothetical protein [Arabidopsis thaliana] 6.00E-81 At1g80160
RAFL07-07-J02(=FL1-159) 1.67 0.99 15.66 5.08 4.85 2.23 4.74 3.64 2.41 1.86 AAD31882.1 AtHVA22d [Arabidopsis thaliana] 4.00E-21 At4g24960
RAFL07-07-L03 1.65 1.28 2.29 1.58 2.44 1.45 4.09 1.63 6.06 4.19 6323676 actin related protein, subunit of the chromatin remodeling Snf/Swicomplex; Arp9p [Saccharomyces cerevisiae] At4g19230
RAFL07-12-N12 2.99 1.24 6.60 1.49 4.07 1.31 3.41 0.34 2.72 1.04 BAB09328.1 gene_id:K16E1.4~unknown protein [Arabidopsis thaliana] 9.00E-43 At5g42570
RAFL07-13-F20 2.44 0.63 1.99 0.53 1.92 0.44 4.02 0.55 7.72 5.36 AAC83025.1 Strong similarity to glycoprotein EP1 gb|L16983 Daucuscarota and a member of S locus glycoprotein familyPF|00954. 8.00E-55 At1g78850
RAFL07-13-O03 3.41 1.43 3.63 1.40 4.33 1.27 5.18 0.98 3.45 1.07 BAB02703.1 gb|AAF02142.1~gene_id:MEB5.2~similar to unknown protein[Arabidopsis thaliana] 7.00E-56 At3g17800
RAFL08-08-I15 0.84 0.35 2.29 1.52 3.29 1.66 9.02 4.00 10.64 6.13 AAF16649.1 T23J18.3 [Arabidopsis thaliana] At1g11360
RAFL08-08-I18 0.68 0.25 1.08 0.24 2.25 0.98 3.36 1.34 6.51 2.59 AAF78497.1 Contains similarity to transportin-SR from Homo sapiensgb|AF145029. ESTs gb|T46556, gb|AI993189, gb|T45501,gb|A 4.00E-42 At1g12930
RAFL08-08-O14 0.89 0.33 1.34 0.41 1.53 0.39 6.52 1.13 20.24 12.56 AAF24564.1 F22C12.12 [Arabidopsis thaliana] 6.00E-45 At1g64110
RAFL08-19-A04(=RAFL08-08-O14) 1.02 0.38 2.27 1.73 2.72 0.86 8.82 2.16 32.88 17.00 AAF24564.1 F22C12.12 [Arabidopsis thaliana] 4.00E-74 At1g64110
RAFL08-09-J19 1.78 0.76 2.06 1.02 2.06 1.00 5.58 3.49 4.67 2.57 AAG10634.1 Hypothetical protein [Arabidopsis thaliana] 4.00E-30 At1g02660
RAFL08-09-M05 0.88 0.29 1.76 0.46 6.78 2.47 13.91 1.67 11.55 5.45 4755142 inositol polyphosphate phosphatase-like 1 [Homo sapiens] 9.00E-18 At3g22600
RAFL08-11-M15 1.08 0.36 2.23 1.16 1.66 0.49 2.38 1.11 6.13 6.73 AAF67766.1 unknown protein; 21446-24388 [Arabidopsis thaliana] 5.00E-28 At1g69360
RAFL08-13-F10 3.92 3.25 14.94 7.99 27.13 11.50 19.71 14.91 16.71 15.81 BAB08381.1 gene_id:MOK16.12~unknown protein [Arabidopsis thaliana] 7.00E-19 At5g03210
RAFL08-16-M09 0.95 0.29 1.70 0.49 1.43 0.31 2.95 0.62 6.43 2.14 AAD14448.1 predicted protein of unknown function [Arabidopsisthaliana] 3.00E-58 At4g03200
RAFL08-17-D17 1.66 0.32 5.43 2.75 4.12 1.72 5.39 0.52 4.53 1.46 A82448 tatA protein VCA0533 [imported] - Vibrio cholerae (group O1 strainN16961)
RAFL08-18-N19 1.33 0.78 5.10 2.03 13.60 5.70 10.68 9.73 10.32 8.10 AAD22366.1 unknown protein [Arabidopsis thaliana] 3.00E-40 At2g22470
RAFL08-19-G11 0.29 0.16 1.15 0.21 0.85 0.23 5.47 7.44 0.93 0.62 BAA97273.1 At14a protein-like [Arabidopsis thaliana] At3g28270
RAFL09-07-O15 1.93 0.85 2.02 1.37 1.49 0.60 2.48 1.66 5.62 3.42 T00820 hypothetical protein T32G6.16 - Arabidopsis thaliana 3.00E-67 At2g41640
RAFL09-10-A12 0.97 0.30 2.89 0.94 1.99 0.63 7.16 0.76 3.76 1.61 AAF16609.1 unknown protein, 5' partial; 67-381 [Arabidopsisthaliana] 4.00E-32 At1g68440
RAFL09-10-B06 0.81 0.26 1.24 0.18 2.68 0.70 4.72 1.06 7.49 4.96 S57908 hypothetical 527K polyprotein - rice
RAFL09-10-F14(=RAFL04-12-E05) 0.84 0.30 1.78 0.90 2.55 1.05 5.83 0.73 4.09 1.48 AAF75814.1 Contains similarity to a tetracycline resistance effluxprotein from Pasteurella haemolytica gb|Y16103 andcontains an Et 4.00E-21 At1g63010
RAFL09-11-N10 1.05 0.17 4.22 1.87 3.79 1.33 5.17 1.10 3.24 1.11 AAG26074.1 unknown protein, 5' partial [Arabidopsis thaliana] 8.00E-42 At1g27760
RAFL09-11-P17 1.33 0.54 4.45 2.00 4.11 1.71 4.04 1.75 5.37 3.40 T09561 hypothetical protein L73G19.70 - Arabidopsis thaliana At4g25690
RAFL09-16-I11 0.89 0.15 2.86 1.10 2.39 0.76 6.37 0.12 4.12 1.74 CAA10955.1 unnamed protein product [Arabidopsis thaliana] 5.00E-42 At1g69490
RAFL09-16-J23 0.81 0.26 1.07 0.31 2.35 0.72 9.20 1.36 7.74 5.99 S43565 R01H10.4 protein (clone R01H10) - Caenorhabditis elegans At4g36040
RAFL09-17-B09 0.78 0.23 1.84 1.28 1.36 0.55 4.90 1.74 5.53 5.34 AAG12711.1 unknown protein; 48715-49943 [Arabidopsis thaliana] 3.00E-50 At3g12320
RAFL09-17-E07 1.54 0.56 4.02 3.06 3.42 1.98 5.84 0.86 4.45 1.48 AAF79871.1 T7N9.26 [Arabidopsis thaliana] 7.00E-64 At1g27200
RAFL09-18-E14 2.08 0.97 4.03 2.99 2.41 1.04 5.01 1.99 6.04 3.06 AAD39672.1 F9L1.39 [Arabidopsis thaliana] 9.00E-32 At1g15430
RAFL09-18-G13 7.41 2.59 4.26 2.44 1.60 0.52 0.74 0.23 1.02 0.12 AAF79611.1 F5M15.17 [Arabidopsis thaliana] 2.00E-34 At1g20510
RAFL11-11-M07 2.24 0.78 4.31 3.75 6.57 2.87 12.52 4.01 15.59 8.07 ******No Hit Found******
RAFL05-18-C17(=RD2) 0.77 0.13 1.93 0.85 3.09 0.83 5.31 0.80 6.10 1.72 AAD23643.1 unknown protein [Arabidopsis thaliana] 5.00E-50 At2g21620
RD22 0.95 0.31 2.94 0.73 4.61 1.62 10.53 3.05 4.37 2.26
RAFL05-09-P10 1.50 0.30 10.12 7.23 25.03 11.16 46.69 9.01 37.14 16.10 T02100 hypothetical protein T3K9.4 - Arabidopsis thaliana 1.00E-66 At2g41190
RAFL05-20-J01(=RAFL05-09-P10) 1.94 0.27 11.75 3.85 17.39 10.50 42.15 8.15 34.41 8.89 T02100 hypothetical protein T3K9.4 - Arabidopsis thaliana 2.00E-67 At2g41190
RAFL05-02-L02 4.23 1.08 9.53 6.66 3.48 1.86 5.18 1.88 4.43 1.58 AAF82229.1 Contains similarity to an unknown protein T10D10.8gi|6730756 from Arabidopsis thaliana BAC T10D10gb|AC016529. 3.00E-75 At1g19180
RAFL06-10-F03(=RAFL05-02-L02) 4.01 3.11 6.80 6.82 2.80 0.92 5.02 2.66 4.87 3.35 AAF82229.1 Contains similarity to an unknown protein T10D10.8gi|6730756 from Arabidopsis thaliana BAC T10D10gb|AC016529. ESTs gb|T14209, gb|BE038At1g19180
RAFL09-09-P15(=RAFL05-02-L02) 4.58 1.91 9.96 6.96 2.46 0.36 3.63 1.95 2.84 1.03 AAF82229.1 Contains similarity to an unknown protein T10D10.8gi|6730756 from Arabidopsis thaliana BAC T10D10gb|AC016529. 4.00E-58 At1g19180
RAFL11-02-N11 1.02 0.33 3.17 1.92 2.37 0.86 4.63 1.14 9.74 5.55 CAB56631.1 SBP-domain protein 5 [Zea mays]
Uncharacterized proteins Av. S.D. Av. S.D. Av. S.D. Av. S.D. Av. S.D. Genbank
RAFL09-14-A11 0.92 0.49 1.27 0.52 1.32 0.39 1.20 0.46 5.36 2.83 AAG28230.1 dormancy related protein, putative [Arabidopsisthaliana] At1g54870
RAFL09-17-J19 5.29 3.50 2.94 1.68 1.67 0.88 1.25 0.71 2.50 1.89 T06630 hypothetical protein T20K18.70 - Arabidopsis thaliana At4g12720
RAFL02-02-B06 1.54 0.17 0.75 0.10 0.58 0.17 0.92 0.23 8.03 3.57 AAC69134.1 putative auxin-repressed protein [Arabidopsis thaliana] 1.00E-59 At2g33830
RAFL03-02-F02 3.04 0.75 5.25 1.54 2.69 0.90 1.84 0.89 2.66 0.56 BAB09857.1 phi-1-like protein [Arabidopsis thaliana] 1.00E-35 At5g64260
RAFL05-10-L02 1.22 0.29 1.87 0.53 1.19 0.50 2.30 0.38 5.01 2.26 ******No Hit Found******
RAFL05-19-E15 0.94 0.03 3.46 0.79 2.31 0.74 3.58 0.41 7.18 3.80 AAD41972.1 unknown protein [Arabidopsis thaliana] 3.00E-37 At2g15960
RAFL05-18-H15 1.26 0.39 3.28 0.71 2.89 1.22 4.55 0.64 6.93 4.84 AAF19680.1 F1N19.23 [Arabidopsis thaliana] e-100 At1g64660
1)
In this study, we regarded the genes with expression ratios (dehydration/unstressed) greater than five times that of lambda control template DNA fragment in at least 1 time-course point as dehydration-stress-inducible genes (Seki et al. (2002) Plant J. 31:279-292).
2)
｛[Fluorescence Intensity(FI) of each cDNA for dehydration condition]÷[FI of each cDNA for unstressed condition]｝÷｛[FI of lambda DNA fragment for dehydration condition]÷[FI of lambda DNA fragment for unstressed condition]｝
3)
4)

Plant Responses To Abiotic Stress

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Plant Responses To Abiotic Stress

Uploaded by

Copyright:

Available Formats

Introduction

Topics in Current Genetics, Vol. 4

Water is a central molecule in all physiological processes in plants, comprising be-

Low temperature stress

One of the most severe environmental challenges to plants is low temperature.

process is accompanied by altered expression of a number of stress response genes

ABA as abiotic stress signalling hormone

Abscisic acid (ABA) is considered a ‘stress hormone’ integrating environmental

Heat stress response is invoked in organisms as diverse as bacteria, fungi, plants,

ing of denatured proteins, but because protein conformation is important right

Heavy metal stress

All organisms have the capacity to dynamically respond to environmental chal-

activated. Alternatively, particularly in multicellular eucaryotes, cells may respond

Stress transcriptome analysis

Stress sensors in the model organism Synechocystis

Cells perceive a particular stress and react to it by expressing specific sets of

Dorothea Bartels and Erik Souer

A massive amount of data has been accumulating on the molecular responses of

Topics in Current Genetics, Vol. 4

1.2 Plant species and experimental systems used in

1.3 Abscisic acid (ABA)

The importance of ABA in multiple stress responses, including dehydration, is in-

1.4 The perception of water stress

1.4.1 Histidine kinases

1.4.2 The role of kinases and phosphatases in the response to water

Besides receptor-ligand and protein-DNA interactions, protein modification repre-

1.4.2.1 MAP kinase signalling

1.4.2 Calcium signalling

1.4.3 Heterotrimeric G-proteins

Another group of signalling molecules that have an established role in signal

1.4.4 Phospholipid signalling

The activation of phospholipid signalling in response to a variety of stresses, in-

tion occurs within minutes of the dehydration stimulus. In A. thaliana (Katagiri et

1.5 Transcriptional control

Table 1. Transcription factors controlling the dehydration response in C. plantagineum and

Trx Species Gene Binding site Transcription Reference

AtbZIP36 GGACACGTG (Not by) Dehydra- Choi et al.

AtbZIP38 GGACACGTG Dehydration Choi et al.

Trx Species Gene Binding site Transcription Reference

SAP C. plan- CpR18 pr3.75d Dehydration Hilbricht et

1.5.1 The ABA responsive element

A promoter element that is important for dehydration- and ABA-responsive ex-

1.5.2 The dehydration-responsive element

Analysis of the promoter regions of other dehydration-induced genes led to the

tion of CRT/DRE binding factors, CBF and DREB, respectively (Table 1)

1.5.3 The SAP domain

In C. plantagineum, detailed mapping of the promoter of one of the dehydration-

1.5.4 Myb and helix-loop-helix domains

1.5.5 Homeodomain proteins

Various homeodomain-leucine zipper proteins (HD-Zip) are induced by a variety

1.5.6 An RNA as a signalling molecule?

Callus tissue of Craterostigma is normally not resistant to dehydration unless it is

1.5.7 Positioning of signals in the network

1.6 Dehydration-activated proteins

1.6.1 The accumulation of compatible solutes

In many species, dehydration leads to the accumulation of a variety of compatible

ance effect to be attributed to osmotic adjustment; therefore other mechanisms are

1.6.2 Genes that encode proteins with protective functions

Many genes, which are abundantly expressed in response to dehydration, have

1.6.3 Reactive oxygen intermediates

One consequence of many stresses, including dehydration, is an increase in the

1.7 Conclusions and outlook

a broad spectrum of transcripts, whose expression is modified in response to de-