American Association of Avian Pathologists Avian Diseases

Future Applications of Biotechnology in Poultry
Author(s): H. Graham Purchase

Source: Avian Diseases, Vol. 30, No. 1 (Jan. - Mar., 1986), pp. 47-59
Published by: American Association of Avian Pathologists
Stable URL: https://www.jstor.org/stable/1590612
Accessed: 21-10-2018 16:38 UTC
REFERENCES
Linked references are available on JSTOR for this article:
https://www.jstor.org/stable/1590612?seq=1&cid=pdf-reference#references_tab_contents
You may need to log in to JSTOR to access the linked references.
JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide
range of content in a trusted digital archive. We use information technology and tools to increase productivity and
facilitate new forms of scholarship. For more information about JSTOR, please contact support@jstor.org.
Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at
https://about.jstor.org/terms
American Association of Avian Pathologists is collaborating with JSTOR to digitize,

preserve and extend access to Avian Diseases
This content downloaded from 181.53.249.80 on Sun, 21 Oct 2018 16:38:38 UTC
All use subject to https://about.jstor.org/terms
Biotechnology Symposium-
Future Applications of Biotechnology in Poultry
H. Graham Purchase
USDA, Agricultural Research Service, Beltsville Area, BARC-West

Beltsville, Maryland 20705
23 July 1985
SUMMARY. The major biotechnological advances that can be applied in the poultry in-
dustry will include molecular genetics, molecular immunology, and solid-state reactions. The
elucidation of the genetic code and the development of techniques to manipulate genes offer
new opportunities for changing pathogenic agents and changing chickens to reduce the effect
of disease and improve productivity. The monoclonal antibody technique and the discovery
that cells of the immune response communicate with one another through peptide factors will
permit improved diagnostic techniques and enhanced immune responses to vaccines. Immu-
nologic and biochemical reactions that occur on a solid substrate can be used to simplify and
accelerate diagnostic tests and to purify antigens and antibodies. These advances will lead to
improvements in diagnosis, disease resistance, and productivity of poultry.
RESUMEN. Simposio sobre Biotecnologia-Aplicaciones futuras de la biotecnologia en las

aves domesticas.
Los mayores avances de la biotecnologia que pueden ser aplicados en la industria avicola
incluiran genetica molecular, inmunologia molecular y reacciones de fase s6lida. La elucidaci6n
del c6digo gen6tico y el desarrollo de tecnicas para la manipulaci6n de genes ofrecen nuevas
oportunidades para modificar agentes pat6genos. Asi mismo, las aves seran sujetas a cambios
que les ayudaran a reducir su susceptibilidad a enfermedades y mejorar la productividad. La
tecnica de anticuerpos monoclonales y el descubrimiento de que las celulas del sistema inmune
se comunican entre si por medio de factores peptidicos, permitira el mejoramiento de las t6cnicas
de diagn6stico y una mayor respuesta del sistema inmune a las vacunas. Las reacciones in-
munol6gicas y bioquimicas que ocurren sobre un substrato en una fase s6lida pueden ser usadas
para simplificar y acelerar las pruebas de diagn6stico, asi como para purificar antigenos y
anticuerpos. Estos avances conduciran a una serie de mejoras en el diagn6stico, la resistencia
a enfermedades y la productividad de las aves dom6sticas.
Biotechnology may be defined as the appli- old students will be able to take genes out of a
cation of knowledge and techniques of advancedcommon salivary bacterium and insert them into
biological science and bioengineering to theanother
re- (12).
search, development, or production of commer- It is my ambitious objective to outline some
cial products or processes. It is one of the of
fourthe biotechnological techniques and to ex-
major scientific revolutions of our generation, on possible future applications of those tech-
amine
a par with unlocking the atom, escaping the earth's
niques. I will attempt to bridge the gap between
gravity, and the computer revolution. Biotech-
the scientist in the white lab coat who uses a
nology is permeating our society. Our schools jargon that only he and his peers understand and
are beginning to teach and practice biotechnol-the scientist who was trained a generation ago
ogy. Students are learning a new meaning toand "seehas spent his life on the important practical
Spot run." With "Dr. Cloner's Genetic Engi- aspects of poultry husbandry.
neering Home Cloning Kit," the 10-to- 14-year- In this paper, I will discuss only selected tech-
niques in molecular genetics and immunology. I
will focus on those techniques that I think have
Based on a paper presented at the Annual Meeting
of the American Veterinary Medical Association,future
Las applications in poultry. Of necessity, my
Vegas, Nevada, July 23, 1985. discussion of the techniques will be brief.
47 AVIAN DISEASES Vol. 30, No. 1
48 H. Graham Purchase
THE GENETIC CODE RESTARITION ENDONUCLEASE MAPPING
INTRON EXON INTRON EXON Ha IllI Eco RI Has III
GT4:Oi.GTCCCG O CCAC
CA
T T G GG C A ATACTAGTATACTT A CTT GTA GT AiC':CAGGCGTC
G S: C GGTT
DNA ACACCGTTA:t'l:'^T. GTATGAT TACATCT:A''': , A.'t:
TRANSCRIPTION
HaN III Eco RI Hae III
RNA A
GT.iS" =iG TCCCGO CCACAACTGGAGCT GGGTGA'G'.t i;GGA
C;A !:CAC GGGCAiG -"iGGTGTTGACCTCGACCCACCT/C!( QGGCCT
UG G CAA AUC:'AN::<., -GU ACUACUAUGU
IELECTROPHOR ESIS
32 15
NUCLEUS
Eco il / /
CYTOPLASM 1 I.. / / / / /
Eco Ra H.. / / / / /
N NA A A Ct 30 26 12 6 4
TRANSLATION Fig. 2. Restriction enzym

contains the genetic messa
PROTEIN YR Y HISTOP ments) at very specific site
AMINO ACIDS
tion enzymes. Each enzym
logical scissors, cuts the D
Fig. 1. The genetic code. The instructions (code) are
and nowhere else. The fra
made up of three-letter words employingarea four-letter
separated by electroph
alphabet (A, T, G, C). The code is transcribed in shorter on the basis of
tinguished
pieces of RNA that are transported to the cytoplasm.
There the ribosomal "factory" translates the instruc-
tions and assembles the building blocks working
(amino acids)instructions s
into product (proteins). ported from the library
(cytoplasm).
MOLECULAR GENETICS The working instructions are translated to the
final product (the protein). Each three-letter word
Molecular genetics is the branch of genetics
encodes one of twenty different building blocks
(the study of heredity) concerned with (amino acids) that make up the product (a pro-
molecular
structure and activities of the genetictein material,
which is a linear chain of amino acids), which
including the replication of DNA, itsis transcrip-
a functionally active part of the organism.
tion into RNA, and the translation of RNA
This to
understanding of the genetic code forms
form proteins. the basis of the technological revolution. Once
The genetic code. A gene is like a paragraph
the instructions are known, pieces can be snipped
out of
giving instructions in a foreign language foronemak-
organism and inserted into another.
This is thecon-
ing one part of an organism. The language basis for recombinant DNA technol-
sists of three-letter words (codons) employing
ogy. a
four-letter alphabet (the bases adenineRestriction
abbrevi- enzyme mapping. The discovery
ated as A, thymine as T, guanine as of G, and cy-enzymes was one of the keys to the
restriction
tosine as C) (Fig. 1). The words (exons), paren-process. Restriction enzymes occur
engineering
thetical comments (introns), and punctuation
in many microorganisms and recognize and de-
(stop codes) are strung together in long sentences
grade DNA from foreign organisms, thereby pre-
(double-stranded chains of DNA) to formserving the genetic integrity of the organism.
a para-
graph (gene). Many paragraphs are in These enzymes cut highly specific sites in the
one chapter
(chromosome) and many chapters form DNA,ansites
entire
that can be read the same way back-
instruction book which is stored in the wardslibrary
as forwards (palindromic) (Fig. 2). These
(nucleus). A common language is used for all enzymes are the tiny biological scis-
restriction
organisms, including plants, animals, sorsand
thathu-
cut up foreign DNA. Each enzyme cuts
mans. Recently some dialects have been discov-place (site).
at a different
ered. The fragments that result from cutting DNA
Portions of the instructions are transcribed into with a restriction enzyme can be separated ac-
a machine (ribosome)-readable form (single- cording to size by electrophoresis. Being nega-
stranded RNA). In this form, all the instructions tively charged, the fragments move towards the
to make one product can be combined, the par- positive pole. The largest fragments move slow-
enthetical comments can be eliminated, and the est. The sizes of the fragments are characteristic
Future of biotechnology in poultry 49
SOUTHERN BLOT
NUCLEIC ACID HYBRIDIZATION
RADIOLABELLED
DNA FRAGMENTS
DNA
DNA ATGTGGCAAATGCA C
DNA TACACCGTTTACGT T C
DNA ATGTGGCAAATGCACG'CC
RNA UACACCGUUUACGUUGC4AUC
?B LV"'l Q'RADIOGRAPH
Fig. 3. Nucleic acid hybridization. Strands of DNA
or RNA match up where the messages are identicalFig. 4. A blotting test (Southern b
and stick together (hybridize). Stretches in which the
be tested is digested with enzymes, an
messages are even slightly different remain separate.
are separated by size by electropho
onto a special piece of paper onto w
firmly. Radioactively labelled fragm
of both the starting DNA and the enzyme used the paper hybridize to complementary
to cut it up. Changes in the DNA base sequence to the paper. The excess fragments
by as little as one letter can prevent the enzyme Radiation from the radioactive fragm
from attacking the DNA at that site. The result- film. Where the x-ray film is exposed
of the radioactive and test fragments
ing fragments are different. When DNAs from
different strains of viruses (such as strains of in-
fectious laryngotracheitis virus) or individual
chickens of the same line are treated with re- taining a complementary messa
striction enzymes, they yield fragments oftwo dif- strands stick together wher
ferent sizes (restriction fragment length poly- are complementary and separate
morphisms), which can be used to distinguish sages are dissimilar. The pairing
between the strains. Like fingerprints, theygether can is known as hybridization
be used to trace the origin of the organism. In
complementary nucleic acid stran
comparing organisms, those with the most been sim-heated to stretch them out and separate
ilar patterns of fragments are considered to thembe out into individual strands, are gradually
evolutionarily most closely related. cooled. The degree of specificity of hybridization
As more is known about the genetics ofcan or-be controlled by changing the constituents
ganisms, rapid tests can be developed which ofcan
the medium in which the hybridization occurs.
be used epidemiologically to determine where Under optimum conditions, it is very highly spe-
agents came from (introduced viruses willcific be and hybridization will occur only between
traced to the premises where the original intro- nucleic acids which have significant portions that
duction occurred), etiologically to determine arethe
complementary.
cause of disease, prophylactically to identify Hybridization is used to detect genes or por-
avirulent strains that can be used as vaccines, tions of genes in the DNA of organisms. The
and immunologically to identify chickens thatpresence of a portion of a gene may be used as
produce a high immune response. an indication that the whole gene is present or
Nucleic acid hybridization. Nucleic acids are even that the whole organism is present. The
either DNA that carries the original or RNA that "Southern blot" (Fig. 4) allows one to determine
carries the transcribed instructions or messages. the size of the gene fragment on which the por-
Because A and T always pair and G and C always tion of the gene occurs. In the procedure, DNA
pair, a strand of nucleic acid with a particular is cut into fragments using a restriction enzyme
message will match up or pair with a strand con- (Fig. 2), and the fragments are separated by size
AMPLIFICATION OR 'SANDWICH'
DNA
TO BE
TESTED
INDICATOR
MOLECULES
Fig. 5. The dot blot technique. When used as a test

Fig. 6. Amplification or "sandwich" technique. A
for the RNA of the potato spindle tumor viroid, drops
piece of DNA that hybridizes with the DNA to be
of potato sap from different plants containing the RNA
tested is recombined with several pieces of DNA that
are placed on special paper and treated so the RNA
hybridize to a probe DNA that is radioactively labelled.
sticks to the paper. Radioactively labelled comple-
The initial hybridization reaction is amplified sever-
mentary DNA is spread over the paper. After a while,
alfold.
all the excess is washed off. The presence of the viroid
is indicated by a black spot on the x-ray film which
has been exposed to the paper and then developed.
of the infectious agent. The test can be performed
in 45 minutes instead of the usual cultural meth-
by electrophoresis and blotted onto ods that require
special pa-48 hours.
per. In the "dot blot" (Fig. 5) technique, Because ofsmall
its great specificity, the sensitivity
drops of liquid containing the DNA or RNA of the hybridization technique can be increased
fragments are placed on the paper. In both tech- by amplification (Fig. 6). The tests for Legion-
niques, the paper is treated to make the test DNA naires' disease and for mycoplasma described
fragments stick. Radioactively labelled DNA above are claimed to be able to detect 400 or-
fragments (probes) are spread on the paper in ganisms in 0.4 mg of liver tissue. Future de-
such a way that the probe will not stick (hybrid- velopments are likely to increase the sensitivity
ize) unless the sequence in the probe is identical so that as few as 10 organisms, such as 10 virus
to the sequence in the DNA to be tested. The particles, can be detected in a very short period
rest of the probe that does not stick is washed using simple equipment that can be carried to
off. The paper is then placed on an x-ray film for the farm. The ability to detect such small quan-
a period of time, and the radiation from the probe tities of infectious agents with the degree of speci-
exposes the x-ray film. When the film is devel- ficity that would allow differentiation between
oped, the location of the probe that has hybrid- vaccine and virulent strains would revolutionize
ized can be determined. poultry diagnostics. If the pathogen can be iden-
In the plant field, these blotting techniques tified
are in a rapid, simple test on the farm, treat-
used to detect potato spindle tuber viroid inment po- or control procedures can be initiated im-
tato germ lines. They are beginning to be used mediately without waiting for antibody to
in the animal field. For example, they are the develop.
basis for a rapid test for the organism that causesInsertion of genes into cells or exchange of
Legionnaires' disease and for the presence ofmy- genes between cells. Once genes have been iden-
coplasma in cell culture (14). The technique usestified, there are many ways to insert them into
DNA probes complementary to ribosomal RNA cells. Simply mixing the strands of DNA with
bacteria in a solution that is high in calcium will DIDEOXY DNA SEQUENCING
result in the bacteria taking up some of the DNA. + A+T+G+C

Animal cells in culture or early embryos can be + Tdd
injected with DNA. 4-
3' CAGCATCCCC 5'
A similar procedure for exchanging genes be-
IPrimer 'I , ;,m J&4
tween cells is somatic cell hybridization. Cells of
two types are fused together using electric cur- T Tdd
rents or agents that act on the cytoplasmic mem-

branes of cells, causing the membranes to fuse.
In subsequent replication of the cells, some of
IPrime rI- ir ~
the genes persist and others are thrown out. By +
determining which genes remain in the cell and A TP r i m e r
what properties or functions the cell continues

to have, the functions can be linked to the genes.
A T G C
These techniques can be used for mapping
genes, i.e., determining where in the library, book,
chapter, or paragraph the instruction resides. This
is an important first step in being able to ma-
nipulate the genes. The technique can also be
used to determine the function of genes and the
mechanism of action. Thus genes for virulence
can be identified and subsequent biochemical Fig. 7. Dideoxy
procedures can elucidate how the genes result in sized by an enzy
increased virulence. Once the functions are hybridization to
understood they can be changed. Characteristics of the nucleotide
such as virulence, persistence, antigenicity, thatand it terminat
spread of the agent can all be changed. Thenucleotides tech- in t
procedure is repe
niques are also applicable to animals where dis-
The DNA fragme
ease resistance and productivity traits can be im-
size by electroph
proved.
difference in len
Sequencing and synthesis of genes. Reading sualized (there ar
the sequence of the letters in the instructions is in lane A in this
called sequencing. Two sequencing procedures of the bands, the
are commonly used. One determines the se- T, C, C, C, and C
quence as the DNA is fragmented, and the other
determines the sequence as a complementary
strand is constructed beside the DNA (Figs. 7, rise to a piece
8). In the latter technique, known as the dideoxy continues with
DNA sequencing technique, a primer, which is later, the piece
the starting point for the process, is first synthe- the 2nd and 5t
sized chemically or biologically or cut out of a then the pieces
piece of DNA. The primer hybridizes to a spe- (Fig. 7). The pr
cific site on a single strand of the DNA to be reaction for eac
sequenced. An enzyme assembles a new strand C. When these
of DNA on the primer beside the DNA. Nu- toradiograph is
cleotides (letters in the code) are provided to the so that the seq
enzyme for this purpose. In one reaction mixture, (Fig. 8).
a portion of one nucleotide, such as a portion of With the knowledge of the genetic code, the
the T, is altered so that it terminates the synthesis sequence of amino acids in a protein may be
of the DNA at that point and is radioactive. Be- inferred from the sequence of the nucleotides of
cause T pairs with A, this means that every time its gene. Techniques of DNA sequencing have
there is an A in the test sequence, synthesis of a advanced so far that it is easier to sequence the
portion of the molecules will be stopped, giving DNA than the protein (2,7). Large numbers of
Fig. 8. Reading a DNA sequence. This is a photograph of an autoradiograph analogous to what is

the bottom of Fig. 7. The x-ray film has a band wherever the radioactively labelled DNA exposed it.
of different sizes have been electrophoresed so that the sequence can be read and input into a comp
are in groups of four representing the four nucleotides (letters of the alphabet in the genetic code). Long
of sequences of genes can be read in this manner.
genes are being sequenced. For example, a recentpieces of genetic information that code for small
search of the National Institutes of Health da- sections of the protein may be all that is necessary
tabank (L. B. Crittenden, personal communica-to produce a function. The peptide analog of So-
tion) revealed that 142 chicken somatic genes ormatostatin produced by Merck, Inc., is half the
parts of genes have been sequenced. The list in-size of the original protein yet 50-100 times as
cludes parts of 3 duck, 2 quail, and 1 pigeon potent (20). There is a bright future for producing
genes, 50 avian leukosis/sarcoma genes, 6 reticu-peptide neurohormones, growth factors, lym-
loendotheliosis genes, 2 avian adenovirus genes, phokines, and antigens by these techiques.
and 200 genes of influenza viruses of chickens, Recombining and cloning of genes. The abil-
ducks, and turkeys. ity to recombine DNA from two different or-
Chemical synthesis of DNA has been highly ganisms is fundamental to genetic engineering.
automated by using solid-state chemistry in "geneSome restriction enzymes that cut DNA at spe-
machines." There is similar automation of pro- cific sites leave single-stranded protrusions called
tein synthesis (18). "sticky ends" (Fig. 9). Ends stick to one another
Sequencing and synthesis are powerful tools because the bases are complementary. Two DNAs
in determining the function of genes. They can from different organisms cut by the same enzyme
be used to identify the portions of a virus that become "annealed" by base pairing. These
are antigenic and to which antibody binds. Once strands can be permanently joined by a ligating
the sequence of an antigen is known, it can be enzyme.
synthesized from the amino acid building blocks, Genes from one organism, such as the anti-
as has been done with foot-and-mouth disease genic protein of foot-and-mouth disease virus,
can be spliced into a plasmid from a bacterium,
virus (3). It is important to note that very short
fQCOMAINANT DB&
such as Escherichia coli (Fig. 10). (Plasmids are
circular, self-replicating DNA containing hered- DNAI DNA 2
itary material that is not part of the chromosome ' i:'''::'? ' :-." ::'::::::t':": . .GGATCC
":e::ric:ion nsy*'r:&'"c::'?t:on E....m.
of a bacterium.) The plasmid is referred to as a
"vector." The plasmid DNA containing the
I ANNEAL
spliced-in DNA of foot-and-mouth disease virus
can be inserted into the bacterium. The bacte-
rium uses its internal machinery to produce cop-
DNA LIGASE4 ' c
ies of the plasmid containing the virus DNA, and
i:!'::% GAT
in turn the plasmid causes production of quan- RECOMBINED DNA
tities of the foot-and-mouth disease virus protein

Fig. 9. Recombinant DNA. DNA from two
(1).
organisms that are to be recombined are c
Hosts for the protein production can be pro-
same restriction enzyme. The enzyme leav
karyotes such as bacteria (E. coli in the above ends," which readily come together and s
example) or yeasts. However, eukaryotes such as the sequence of the DNA in the ends is comp
cells in culture can also be used. For prokaryotes, The DNAs are permanently joined with a
phages (bacterial viruses) and plasmids are com- zyme called a ligase.
monly used as vectors for foreign DNA. For eu-
karyotes, oncogenic retroviruses, SV4o, and vac-
cinia have been used. The use of vaccinia virus date, there is no method for includin
as a vector for other viral antigens is showing bohydrate moiety on a synthesized gly
great promise. Parts of a virus, such as herpes though this impediment will surely be
simplex, can be recombined in the DNA of vac- Vaccines produced by cloning and e
cinia virus. On infection of the host, the vaccinia may immunize against more than on
virus replicates and produces not only its of own agent if genes for the antigenic portio
proteins but also those of herpes simplex. serotype Re- are included in the genes tra
sistance to challenge by herpes simplex andThese res- vaccines contain no live virus, s
olution of latent infections have been demon- ger of reversion of the vaccine virus
strated in animals infected with the recombinant genicity is eliminated. Human pathoge
vaccinia virus (4). otic organisms can be handled with i
The most widely publicized and most easily These vaccines may be less expensive
understood application of this technology is in ufacture. Smaller quantities of the an
the production of proteins. The first viral proteinnecessary for diagnostic tests than fo
produced was a portion of foot-and-mouth dis- so it is likely that the same techni
ease VPi (1). However, antigenic proteins from improve diagnostic tests. Laboratorie
other viruses, bacteria, protozoa (21), helminths gland and the United States are using
(5), and arthropods will be produced. Every path-niques on infectious bronchitis, infect
ogen has an "Achilles heel," i.e., a place in its disease, Marek's disease, Newcastle di
genetic code that is essential to its replication influenza. The techniques can be used
and therefore vulnerable. Each also has a point proteins in the chicken. Chicken gro
in its life cycle or ecology at which it is vulner-mone has already been cloned (17). Pep
able. For example, among the thousands of an- rohormones and lymphokines are a
tigens of malaria parasites there is one, the cir-dates.
cumsporozoite protein, that covers the surface Using these recombinant DNA techn
of one stage of the parasite that is necessary forwill also be possible to improve live v
the parasite to penetrate a host cell. Antibodies cines by modifying virulence, antigenici
(monoclonal or polyclonal) prepared against this persistence, and other characteristics.
protein neutralize the infectivity of the parasite. viruses containing antigens from differ
The protein consists of repeated sequences of 12of virus, such as different strains of
amino acids which are amenable to biological or bronchitis virus, or even different fam
chemical synthesis (21). Similar relatively simple rus, such as Newcastle and bronchitis
antigens that have been synthesized can immu- are possible. Because infectious laryng
nize against complex helminth parasites (5). To virus is a herpesvirus like herpes sim
Recombinant DNA Strategy For Making

Foot-and-Mouth Disease Vaccine
from E. Coli 9
Bacterium
VP3 Protein*
RNA Core
RNA is Splice
VP3Codons template for VP3-specific
DNA cDNA fragment
synthesis into plasmids
0
a
0
FMD Virus Isolated FMDV RNA cDNA
Insert
VP3 '"
Growing E. Coli bacteria may produce VP3 for
use as vaccine for foot-and-mouth disease. No
virus or infectious RNA is produced by the
harmless bacteria strain.
*VP3 is the protein from the shell of the virus which can act as a vaccine for immunizing
livestock against foot-and-mouth disease. The idea outlined above is to make this VP3
protein without making any virus or infectious RNA.
Fig. 10. Cloning of foot-and-mouth antigen in E. coli. The sequence for VP, (which used to be nam
the protective antigen of the virus, was known. The virus contains only RNA, so a complementary D
was made using the viral RNA as template. The DNA was spliced into a plasmid (circular piece of
the bacterium, which was inserted back into the bacterium. The bacterium transcribed and translated th
for VP, and made the VP, protein.
incorporation into vaccinia virus should follow tibodies. In a manner similar to the hybridization
similar lines. Incorporation of complementary technique (Fig. 6), the sensitivity of a reaction of
DNA of RNA viruses such as Newcastle and monoclonal antibody with an antigen can be in-
infectious bronchitis should be possible, and creased
thegreatly by use of the "sandwich" tech-
use of fowl or pigeon pox as a vector maynique have or by amplification using enzymes or ra-
advantages over vaccinia. Work on recombining dioassay. The antibodies should always be
pox viruses with Marek's disease, avian leukosis, available, because they can be stored away fro-
and infectious bronchitis viruses is underway. zen, whereas obtaining more of a polyclonal an-
Live recombinant virus vaccines likely will tibodyin- is prevented by the death of the animal.
duce a better cellular immunity, and theHowever, im- monoclonal antibodies have many
munity will persist longer than with killed disadvantages.
or Sometimes the hybridomas are
subunit vaccines. not stable, produce antibodies of low affinity, or
produce antibodies with a short shelf life. Mono-
The use of eukaryotic cells in culture as a host
for the production of biologically active proteinsclonal antibodies may be too specific and give
poor epitope coverage. To date, monoclonal an-
is also a possibility. It offers the advantage that
the product would not have to be purified iftibodiesit can be produced only by using mouse
was used on the same species, because it did not tumor cells and either mouse or bovine lympho-
contain any foreign proteins. Because the phys- cytes. The mouse or bovine immune response
may not always be optimal. Problems in com-
iology of eukaryotic cells is so different from that
of prokaryotic cells, it may not be possible mercial
to production include high cost and diffi-
biosynthesize many compounds in prokaryotic culty in ensuring purity.
cells. In these instances, eukaryotic cells offer the In both diagnosis and prophylaxis, monoclo-
best opportunity. nal antibodies have an advantage where the added
specificity over polyclonal antibodies is needed.
MOLECULAR IMMUNOLOGY Polyclonal antibodies may have an advantage
where group reactions are sought or where the
Monoclonal antibodies. When an animal is antigens being sought are very variable and are
exposed to antigen (a foreign substance), notcells of to pathogenicity.
related
the immune system (lymphocytes) recognize an-
Monoclonal antibodies can be used in a variety
tigenic sites (epitopes) on the antigen and startincluding agglutination, precipitation,
of tests,
producing antibodies that bind with those sites.
neutralization, lysis, antibody-dependent cyto-
Each lymphocyte that responds divides toxicity, into a radioimmunoassay (RIA), enzyme-
clone of cells, and each member of the clone linked immunosorbent assay (ELISA), fluores-
produces identical antibody molecules. Antigens cence, and luminescence. Monoclonal antibodies
usually have many epitopes; therefore, at any one can also be used for affinity chromatography to
time, many clones of cells are responding to the isolate and purify antigens. The antibodies are
antigens by producing antibodies of different particularly useful in the identification of the
types. Thus the antibody produced in normal products of immune-response genes.
animals is polyclonal antibody, i.e., many clones In the future, it is likely that chicken/mouse
of cells producing antibody of many different hybridomas and even chicken/chicken hybrid-
types. Using the hybridoma technique described omas will be developed that produce avian im-
elsewhere in this symposium, a single clone of munoglobulins. Although it is unlikely that the
cells which produces just one type of antibody transfer of passive immunity to chicks using
to one epitope (monoclonal antibody) is isolated monoclonal antibodies will be profitable in the
from a recently immunized animal. Hybridomas poultry industry, chicken antibodies would be
that are the fusion products of cancer and normal useful in research.
antibody-producing cells grow indefinitely, a trait Antibody-drug conjugates are being explored
acquired from the tumor, and they produce an- extensively for the treatment of human cancer.
tibody of only one type, a trait acquired from the The antibody takes the drug to the target cell so
clonal progeny of the responding lymphocytes. that the effect of the drug is focused and much
Monoclonal antibodies, because they recog- less drug is needed. It seems unlikely that this
nize only one epitope, are always much more technique would offer therapeutic prophylactic
highly specific and uniform than polyclonal an- possibilities for poultry.
INDUCTION EXPANSION DIFFERENTIATION Study and exploitation of these has just begun.
O ANT tGEN
Interferon (13), interleukins- 1 (11) and -2 (16),
LYMPHOBLAST HELPER and several growth factors (9) have been cloned
* and expressed. Undoubtedly many other peptide
T-CELL
factors will be produced commercially. Some of
T'^l^ -CELL ^^U \^^^^/SUPPRESSOR them will be species-specific, and others will cross
species boundaries. In either instance, commer-
SECRETING KILLER
IL2 cial production of these substances may be ex-
"CSECRETING
IL I : ,
ploited in the poultry industry. For example, the
peptides that stimulate the immune response or
l. ")I?GE Let --@i @AMPLIFIER
MACROPHA
substances that stimulate the production of pep-
T-CELL
tides can be incorporated into vaccines as ad-

Fig. 11. Lymphokines. When macrophages (phag-
juvants.
ocytic cells of the blood and tissues) that have pro-instances, the genes that code for pro-
In many
cessed antigen pass the antigen on to T-cells (cells with
duction of these proteins have already been iden-
a variety of immune functions), the macrophages pro-
tified in some animals, mostly mice and humans.
duce a protein substance (interleukin-1 or IL1) that
stimulates T-cells (those cells that assist in the immune
Because much of the structure of the genes is
response). The T-cells produce another protein conserved
(IL2),in evolution, it should be possible to
which stimulates the T-cells to divide. The interleukins go directly to poultry and identify the genes.
are like messages from one cell to another. (FigureIdentifying the regulatory genes and factors is
courtesy L. Gasbarre.) more difficult but should also be possible. These
technologies should allow the breeding of chick-
ens with improved immunologic responsiveness
Peptide factors and lymphokines. Cells com- and resistance to disease.
municate with one another by a variety of small Anti-idiotype antibodies. Most proteins to
proteins (Fig. 11), which can be considered mes- which the body has not been previously exposed
sages. Some messages, like interferon or inter- can become antigens. Antibody molecules have
leukin-1, are known to be produced by almost new structures on them which correspond to the
every nucleated cell in an animal. Some have structures on the antigen to which the antibody
very broad activity, such as interleukin-1, whichis directed. Thus antibody molecules themselves
augments thymocyte and peripheral T-lympho- can become antigens. The antigenicity is asso-
cyte proliferation, promotes B-lymphocyte pro- ciated with the antibody-combining site. Popu-
liferation and antibody production, promotes the lations of antibody molecules with different com-
growth and functional activity of many nonlym- bining sites may be antigenically different and
phoid cells, is an endogenous pyrogen, and is a are referred to as idiotypes.
chemotactic attractant for both neutrophils and Anti-idiotype antibodies may have in the an-
monocytes. Others, like interleukin-2, are much tibody-combining sites structures that mimic the
more specific, being produced by T-cells and being structures of the antigen against which the orig-
necessary for the growth of T-cells after contact inal antibody was directed (Fig. 12). Anti-idi-
with antigen. otype antibodies can carry the image of the
The peptide hormones produced by the pitu- foreign antigen and act like it. Injection of the
itary (a small gland at the base of the brain) reg- anti-idiotype antibodies into animals can pro-
ulate many aspects of growth, metabolism, and duce antibodies that react to the original antigen.
reproduction. These hormones can also be con- Thus, anti-idiotype antibodies can be used as
sidered to be messages from the brain to the cells vaccines (10). An experimental monoclonal anti-
(for growth), the liver (for metabolism), or the idiotype vaccine has been produced against
reproductive organs. Growth hormones have Streptococcus pneumoniae (15).
been well studied and cloned (17). However, there Interactions between idiotype and anti-idi-
are many other growth factors that regulate the otype play a role in regulation of the immune
growth and maturation of normal cells such as response network. For example, priming with
epidermal growth factor, insulin-like growth fac- anti-idiotype antibodies increased the number of
tor, transforming growth factor, nerve growth animals responding to Hepatitis B antigen and
factor, and platelet-derived growth factor (9). the level of response (8,10). Anti-idiotype anti-
bodies may also modulate T-cell responses (10). ANTI-IDIOTYPE ANTIBODY
As more is known about their functions, it will

be possible to alter them to produce an optimum
immune response. Although this technique ap- ANTIGEN ANTIBODY
pears to be a curiosity or a research tool, there

are remote possibilities for commercial exploi-
tation.
SOLID-STATE REACTIONS
In classical test-tube chemistry, reagents in so-

lution are mixed and react to produce a precip-
itate or color change. Before a second reaction is
possible, it is necessary to go through steps to
purify the reactant and remove excess reagents. V-
Such purification often involves centrifugation

or chromatography, time-consuming and com-
plicated processes. Recently, supports have been
developed to which reagents or substrates can be
attached, either covalently through a chemical _t
reaction or by adsorption. Reactions occur on
the surface of the support, and excess reagents
can be easily rinsed off.
Supports include gels, plastics, cellulose, and
other compounds, which can be arranged as Fig.sticks 12. Anti
for dipping, beads for packing columns, antigen
sheets is u
for blotting, or wells in which reactionsthe can take second s
is used as an
place. More sophisticated configurations include
antibody kn
trapping in a lattice formation by a permeable
tibody has in
polymer such as silica gel or trapping in antigen.
spherical Wh
capsules made of semipermeable membranes. antibody tha
Instead of being packed in a stationaryantigen.
bed, beads
can be assembled in a fluidized bed in which
substrate flows from the bottom up. Such tech-
niques are being used even in cell culture. sis. In Southern blots for DNA, Northern blots
These solid-state reactions form the basis for for RNA, and Western blots for protein, the DNA,
the ELISA. Antigen or antibody is first bound to RNA, or protein molecules are adsorbed to a
a plastic plate with 96 tiny wells, which act as solid support of cellulose paper by blotting. Pu-
miniature test tubes. Reactions take place within rification of both antigens and antibodies can be
the wells, and excess reagents can be rinsed off. performed when antibodies or antigens, respec-
The final reaction usually involves an enzymetively, are adsorbed to beads in columns (affinity
that produces a colored product, and the inten- columns).
sity of the color can be measured. The enzyme Solid-state reactions will be exploited even fur-
amplifies many-fold the speed and sensitivity ther of in the future. Flock profiling will include
the immunologic reaction (19). This techniqueexquisitely sensitive tests for the presence of an-
tigens of the pathogen rather than antibodies. It
is the basis for flock profiling in which large num-
bers of samples can be tested against a wide va- will be possible to catch the pathogen red-handed
riety of antigens at the same time. Flock profiling(detect antigens) rather than determine that it
gives an indication of the disease agents to whichwas there by its footprints (antibodies). "Dip-
the flock has been exposed and the ability of the stick" technology is a reality. Sticks of the ap-
flock to respond to them. Solid-state synthesis propriate material, or coated with the appropri-
of DNA and peptides (18) is much more rapid ate material, can be dipped in body fluids and
and cheaper than conventional test-tube synthe- then in a series of solutions that will result in a
color change. The easily visible color change 2.

will
Bankier, A. T. Advances in dideoxy sequen
Bio Techniques 2:72-77. 1984.
indicate the presence of disease agent, antibody,
or an immune response. 3. Bittle, J. L., R. A. Houghten, H. Alexande
M. Shinnick, I. G. Sutcliffe, R. A. Lerner, D. J.
CONCLUSIONS lands, and F. Brown. Protection against foot and m
disease by immunization with a chemically synthe
The new biotechnologies will improve diag-
peptide predicted from the viral nucleotide sequ
Nature 298:30-33.
nosis, disease resistance, and productivity of 1982.
poultry. 4. Cremer, K. J., M. Mackett, C. Wohlenberg, A. L

Diagnosis will be improved by better antigens, Notkins, and B. Moss. Vaccinia virus recombinant
more or less specific antibodies, the use of DNA expressing herpes simplex virus type 1 glycoprotein D
prevents latent herpes infections in mice. Science 228:
probes, and development of simple and rapid
737-740. 1985.
tests (6). Rapid tests to detect antigen in minute
5. Friedman, S. Rockerfeller U reports progress on
quantities will be in general use, because the tests recombinant hookworm vaccine. Genet. Eng. News 5:
detect the presence of infection earlier and allow 24-25. 1985.
more time for countermeasures. Tests for anti- 6. Gosser, H. S., and A. R. Pursell. Moder trends
body will continue to indicate the health andin immunodiagnosis which facilitate and expedite spe-
immune status of the flock. cific diagnoses. Proc. 88th Annual Meeting of the U.S.
Disease resistance will be improved throughAnimal Health Association. Fort Worth, Texas, Oct.
development of effective vaccines against the21-26, 1984. pp. 82-87. 1985.
7. Hunkapiller, M. W., and L. E. Hood. Protein
usual viral, bacterial, and mycoplasmal parasites
sequence analysis: automated microsequencing. Sci-
but also against protozoal, helminth, and ar-
ence 219:650-659. 1983.
thropod parasites. This new generation of vac-
8. Kennedy, R. C., J. T. Sparrow, Y. Sanchez, J. L.
cines may include engineered pox virus, engi- Melnick, and G. R. Dreesman. Enhancement of the
neered bacteria such as E. coli excreting antigens
immune response to a cyclic synthetic hepatitis B sur-
of a pathogen, and even chicken cells excreting face antigen peptide by prior injection of anti-idiotype
antigens or stimulating factors. Killed vaccinesantibodies. Abstracts of papers presented at the meet-
will include biosynthesized and chemically syn- ing on Modern Approaches to Vaccines, Cold Spring
thesized antigens attached to suitable carriers.Harbor Laboratory, Cold Spring Harbor, New York.
Aug. 31-Sept. 4. p. 76. 1983.
Also included in formulations will be immune
9. Kris, R. M., T. A. Libermann, A. Avivi, and J.
modulators to enhance the immune response and
Schlessinger. Growth factors, growth-factor receptors
emulsion or microencapsulation techniques that
and oncogenes. Bio/Technology 3:135-140. 1985.
allow slow release of the antigen. Using moder
10. Marx, J. L. Making antibodies without anti-
techniques, chickens will be bred for their ability
gens. Science 228:162-165. 1985.
to respond immunologically to and resist the del-11. Marx, J. L. Interleukin- genes are cloned. Sci-
eterious effects of disease agents. ence 228:1076-1077. 1985.
Productivity will be improved by engineering 12. McGraw-Hill's Biotechnology Newswatch. See
of the genes that control productivity traitsSpot
and run: gel-maker's home cloning kit targets 10-year-
old gene-splicers. Vol. 4. p. 3. 1984.
the optimization of hormones involved in growth
and reproduction. 13. McGraw-Hill's Biotechnology Newswatch.
Amgen's artificial INF-a cleared for cattle trials. Vol.
We are on the brink of a biotechnological rev-
5. p. 3. 1985.
olution in the poultry industry in which the tech-
14. McGraw-Hill's Biotechnology Newswatch.
niques of diagnosis, prophylaxis, and breeding
Rapid DNA probe-screen for Legionella wins hand at
will be greatly increased in efficiency and effec-
Vegas ASM conference. Vol. 5. p. 8. 1985.
tiveness while at the same time being enor- 15. McNamara, M. K., R. E. Ward, and H. Kohler.
mously simplified. Monoclonal idiotype vaccine against Streptococcus
pneumoniae infection. Science 226:1325-1326. 1984.
REFERENCES 16. Pramik, M. J. Cetus receives interleukin-2 pat-
ent. Genetic Engineering News 5:16. 1985.
1. Bachrach, H. L., J. J. Callis, F. Brown, 17.and
Souza,K.L., T. Boone, D. Murdock, M. Tallen, F.
Strohmaier. Achievements in genetic engineering
Martin, H. and
Hockman, B. Altrock, L. DeOgny, P. Lai,
their influence on the control and prevention of animal
J. Wypych, C. Rudman, N. Stebbing, and K. Langley.
diseases. Revue Scientifique et TechniqueCloning
Officeand In-
expression of chicken growth hormones
ternational des Epizooties 2:629-653. 1983. in E. coli. Poult. Sci. 62:1505-1506. 1983.
18. Spatola, A. F. Automated solid phase peptide R. S. Nussenzweig, and V. Nussenzweig. Rationale
synthesis. Am. Biotech. Lab. 2:14-22. 1984. for development of synthetic vaccine against Plas-
19. Stanley, C. J., F. Paris, A. Plumb, W. Webb, and modium falciparum malaria. Science 228:1436-1440.
A. Johannson. Enzyme amplification: a new technique 1985.
for enhancing the speed and sensitivity of enzyme im-
munoassays. Am. Biotech. Lab. 3:48-53. 1985.
ACKNOWLEDGMENTS
20. Veber, D. F., R. Saperstein, R. F. Nutt, F. M.
Freidinger, S. F. Brady, P. Curley, D. S. Perlow, W. J. The author thanks Paul P. Padovano for the art work
Paleveda, and C. D. Colton. A super active cyclic hexa
and L. Knutson, John B. Dame, Lila Vodkin, and Louis
peptide analog ofsomatostatin. Life Sci. 34:1371. 1984.
Gasbarre for critical review of the manuscript.
21. Zavala, F., J. P. Tam, A. H. Cochrane, I. Quakyi,

American Association of Avian Pathologists Avian Diseases

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

American Association of Avian Pathologists Avian Diseases

Uploaded by

Copyright:

Available Formats

Future Applications of Biotechnology in Poultry

Author(s): H. Graham Purchase

American Association of Avian Pathologists is collaborating with JSTOR to digitize,

Future Applications of Biotechnology in Poultry

USDA, Agricultural Research Service, Beltsville Area, BARC-West

RESUMEN. Simposio sobre Biotecnologia-Aplicaciones futuras de la biotecnologia en las

47 AVIAN DISEASES Vol. 30, No. 1

THE GENETIC CODE RESTARITION ENDONUCLEASE MAPPING

INTRON EXON INTRON EXON Ha IllI Eco RI Has III

TRANSLATION Fig. 2. Restriction enzym

Fig. 5. The dot blot technique. When used as a test

bacteria in a solution that is high in calcium will DIDEOXY DNA SEQUENCING

result in the bacteria taking up some of the DNA. + A+T+G+C

rents or agents that act on the cytoplasmic mem-

what properties or functions the cell continues

Fig. 8. Reading a DNA sequence. This is a photograph of an autoradiograph analogous to what is

tities of the foot-and-mouth disease virus protein

Recombinant DNA Strategy For Making

FMD Virus Isolated FMDV RNA cDNA

tides can be incorporated into vaccines as ad-

bodies may also modulate T-cell responses (10). ANTI-IDIOTYPE ANTIBODY

As more is known about their functions, it will

pears to be a curiosity or a research tool, there

In classical test-tube chemistry, reagents in so-

Such purification often involves centrifugation

color change. The easily visible color change 2.

poultry. 4. Cremer, K. J., M. Mackett, C. Wohlenberg, A. L

You might also like