Baker. The Social Skills Picture Book

INTERNATIONAL
REVIEW OF
NEUROBIOLOGY
VOLUME 113
SERIES EDITORS
R. ADRON HARRIS
Waggoner Center for Alcohol and Drug Addiction Research
The University of Texas at Austin
Austin, Texas, USA
PETER JENNER
Division of Pharmacology and Therapeutics
GKT School of Biomedical Sciences
King's College, London, UK
EDITORIAL BOARD
ERIC AAMODT HUDA AKIL
PHILIPPE ASCHER MATTHEW J. DURING
DONARD S. DWYER DAVID FINK
MARTIN GIURFA BARRY HALLIWELL
PAUL GREENGARD JON KAAS
NOBU HATTORI LEAH KRUBITZER
DARCY KELLEY KEVIN MCNAUGHT
BEAU LOTTO JOSÉ A. OBESO
MICAELA MORELLI CATHY J. PRICE
JUDITH PRATT SOLOMON H. SNYDER
EVAN SNYDER STEPHEN G. WAXMAN
JOHN WADDINGTON
Academic Press is an imprint of Elsevier
32 Jamestown Road, London NW1 7BY, UK
Radarweg 29, PO Box 211, 1000 AE Amsterdam, The Netherlands
The Boulevard, Langford Lane, Kidlington, Oxford, OX5 1GB, UK
225 Wyman Street, Waltham, MA 02451, USA
525 B Street, Suite 1800, San Diego, CA 92101-4495, USA
First edition 2013
Copyright © 2013, Elsevier Inc. All Rights Reserved
No part of this publication may be reproduced, stored in a retrieval system

or transmitted in any form or by any means electronic, mechanical, photocopying,
recording or otherwise without the prior written permission of the publisher
Permissions may be sought directly from Elsevier’s Science & Technology Rights
Department in Oxford, UK: phone (þ44) (0) 1865 843830; fax (þ44) (0) 1865 853333;
email: permissions@elsevier.com. Alternatively you can submit your request online
by visiting the Elsevier web site at http://elsevier.com/locate/permissions, and selecting
Obtaining permission to use Elsevier material
Notice
No responsibility is assumed by the publisher for any injury and/or damage to persons
or property as a matter of products liability, negligence or otherwise, or from any use
or operation of any methods, products, instructions or ideas contained in the material
herein. Because of rapid advances in the medical sciences, in particular, independent
verification of diagnoses and drug dosages should be made
ISBN: 978-0-12-418700-9
ISSN: 0074-7742
For information on all Academic Press publications

visit our website at store.elsevier.com
Printed and bound in USA

13 14 15 16 11 10 9 8 7 6 5 4 3 2 1
CONTRIBUTORS
Ashley Anderson
Department of Neuroscience, UT Southwestern Medical Center, Dallas, Texas, USA
Esther B.E. Becker
MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics,
University of Oxford, Oxford, United Kingdom
Brent R. Bill
Department of Psychiatry, David Geffen School of Medicine, Center for Autism Research
and Treatment and Center for Neurobehavioral Genetics, Semel Institute for Neuroscience
and Human Behavior, University of California, Los Angeles, California, USA
Daniel B. Campbell
Zilkha Neurogenetic Institute, and Department of Psychiatry and the Behavioral Sciences,
University of Southern California, Los Angeles, California, USA
Leanne Chukoskie
Institute for Neural Computation, University of California, San Diego, California, USA
Joseph D. Dougherty
Department of Genetics, and Department of Psychiatry, Washington University School of
Medicine, St. Louis, Missouri, USA
Christina T. DyBuncio
and Human Behavior, and Program in Neurogenetics, Department of Neurology, David
Geffen School of Medicine, University of California, Los Angeles, California, USA
Brent L. Fogel
Program in Neurogenetics, Department of Neurology, David Geffen School of Medicine,
University of California, Los Angeles, California, USA
Elaine Y. Hsiao
Division of Biology and Biological Engineering, Division of Chemistry and Chemical
Engineering, California Institute of Technology, Pasadena, California, USA
Matthew Huentelman
Neurogenomics Division, Translational Genomics Research Institute, Phoenix, Arizona,
USA
Genevieve Konopka
Kenneth Y. Kwan
Department of Human Genetics, Molecular & Behavioral Neuroscience Institute (MBNI),
University of Michigan, Ann Arbor, Michigan, USA
ix
x Contributors
Stephanie Lepp
Jennifer K. Lowe
and Human Behavior, and Program in Neurogenetics, Department of Neurology, David
Geffen School of Medicine, University of California, Los Angeles, California, USA
Susan E. Maloney
Shingo Miyauchi
School of Biotechnology and Biomolecular Sciences, University of New South Wales,
Sydney, Australia
Yun Peng
Department of Basic Medical Sciences, University of Arizona College of Medicine, Phoenix,
Arizona, USA
Shenfeng Qiu
Department of Basic Medical Sciences, University of Arizona College of Medicine, Phoenix,
Arizona, USA
Michael A. Rieger
Christopher Smith
Southwest Autism Research Center, Phoenix, Arizona, USA
Catherine J. Stoodley
Department of Psychology, American University, Washington, District of Columbia, USA
Jeanne Townsend
Department of Neurosciences, University of California, San Diego, California, USA
Irina Voineagu
School of Biotechnology and Biomolecular Sciences, University of New South Wales,
Sydney, Australia
Marissa Westerfield
Institute for Neural Computation, University of California, San Diego, California, USA
Brent Wilkinson
Program in Biological and Biomedical Sciences, and Zilkha Neurogenetic Institute,
University of Southern California, Los Angeles, California, USA
PREFACE
The Neurobiology of Autism: Integrating
Genetics, Brain Development, Behavior,
and the Environment
The definition and diagnosis of autism spectrum disorder (ASD) has remained
somewhat constant: impairment in social and communicative behavior and
the manifestation of repetitive and restrictive behaviors. However, our
understanding of the mechanisms underlying ASD is continuously evolving
as both more researchers across broad disciplines enter the field and as
techniques improve for greater resolution into genetics, genomics, brain
connectivity, and behavior. Together, these advances have determined that
ASD is not caused by a single source, but rather these collective studies have
demonstrated that there are a multitude of genetic and environmental mech-
anisms at play that all ultimately manifest (in a variety of combinations)
in ASD.
The genetic component of ASD has been well documented as a central
contributor to etiology. However, this genetic component rarely takes the
form of a monogenetic disorder, and it is unlikely that genetics can
completely explain all incidences of ASD. Thus, the genetics of ASD are
complex and how this genetic component interacts with environmental
components, for example, at the epigenetic level, remains a topic of great
interest. In this volume, Campbell and colleagues discuss the role of noncod-
ing RNAs in ASD. This is yet another level of genetic regulation that is just
beginning to be explored but certainly plays an important function in ASD.
Specific genes are also discussed in this volume as windows into understand-
ing basic brain mechanisms at risk in ASD: the chapter by Qiu and colleagues
focuses on MET and its role in brain connectivity, the chapter by Lepp and
colleagues highlights the role of the FOXP genes in language and commu-
nication, and the chapter by Fogel and colleagues outlines how a splicing
factor, RBFOX1, may have a pivotal role in ASD gene networks.
How such an altered genetic architecture may lead to a manifestation in
changes in gene expression in the brain is a relatively underexplored topic in
ASD research due to the paucity of tissue for such studies. However, the
chapter by Miyauchi and Voineagu summarizes this field and presents
new insights into these data including the expression pattern of ASD genes
xi
xii Preface
throughout brain development. One striking finding from the genomics

data is the enrichment of immune function genes in certain analysis. The
chapter by Hsiao explores the role of the immune system in ASD pathophys-
iology in detail and connects these findings to ASD behaviors.
At a cellular and circuit level, there is still much to be learned regarding
ASD; however, there seems to be some convergence on the hypotheses of
disrupted synaptic signaling as well as altered regional connectivity. The
chapter by Dougherty and colleagues highlights key neuronal subtypes,
including serotonergic and GABAergic interneurons, as examples of cells
whose dysfunction is tightly linked to ASD. This and several other chapters
also emphasize key brain regions implicit in ASD pathology. Kwan delin-
eates neocortical development and how genes essential to this crucial devel-
opmental process, in particular a number of transcription factors, are
intimately linked to ASD and associated circuit disruptions. The chapter
by Becker and Stoodley comprehensively details the role of the cerebellum
in ASD, and the chapter by Chukoskie and colleagues expands to the basal
ganglia and rigorously documents motor skill dysfunction in ASD and con-
nections to different brain regions.
As many of the chapters in this volume detail, there are numerous studies
using animal models to study basic brain mechanisms that are vulnerable in
ASD. These studies are challenging due to the intrinsically human nature of
ASD; however, coupling these data to ongoing studies of patient
populations has yielded mechanistic insights into potential therapeutic ave-
nues. Future studies that integrate the insights made across all of the topics
highlighted in this volume of the International Review of Neurobiology will
likely prove to be extremely valuable in terms of therapeutic potential.
GENEVIEVE KONOPKA
Department of Neuroscience, UT Southwestern Medical Center,
Dallas, Texas, USA
CHAPTER ONE
Autism Spectrum Disorder

and the Cerebellum
Esther B.E. Becker*,1, Catherine J. Stoodley†,1
*MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford,
Oxford, United Kingdom
†
Department of Psychology, American University, Washington, District of Columbia, USA
1
Corresponding authors: e-mail address: esther.becker@dpag.ox.ac.uk; stoodley@american.edu
Contents
1. Introduction 2
2. Cerebellar Organization 3
3. ASD Symptoms in Patients with Cerebellar Disorders 5
4. Motor Impairment in Autistic Individuals 6
5. Cerebellar Pathology in Autism 8
6. Cerebellar Differences in Autism: Structural Neuroimaging 9
7. Abnormal Cerebellar Activation in Autism 11
8. Autoimmune Studies in ASD Implicating the Cerebellum 13
9. Autism Genes in Mouse Cerebellar Development 14
10. Cerebellar Phenotypes in Rodent Models of Autism 17
11. Functional Evidence from Mouse Genetics 20
12. Conclusions 21
Acknowledgment 21
References 22
Abstract
The cerebellum has been long known for its importance in motor learning and coor-
dination. Recently, anatomical, clinical, and neuroimaging studies strongly suggest that
the cerebellum supports cognitive functions, including language and executive func-
tions, as well as affective regulation. Furthermore, the cerebellum has emerged as
one of the key brain regions affected in autism. Here, we discuss our current understand-
ing of the role of the cerebellum in autism, including evidence from genetic, molecular,
clinical, behavioral, and neuroimaging studies. Cerebellar findings in autism suggest
developmental differences at multiple levels of neural structure and function, indicating
that the cerebellum is an important player in the complex neural underpinnings of
autism spectrum disorder, with behavioral implications beyond the motor domain.
International Review of Neurobiology, Volume 113 # 2013 Elsevier Inc. 1

ISSN 0074-7742 All rights reserved.
http://dx.doi.org/10.1016/B978-0-12-418700-9.00001-0
2 Esther B.E. Becker and Catherine J. Stoodley
1. INTRODUCTION
Autism spectrum disorder (ASD) comprises a collection of neu-
rodevelopmental diseases defined by deficits in communication and social
interaction, and repetitive and restrictive behaviors (American Psychiatric
Association, 2013). The etiology of autism is complex. The past decade
has seen revolutionary advances in our understanding of the genetics of
ASD and several hundreds of genetic variants have been identified
(Berg & Geschwind, 2012; Betancur, 2011; Devlin & Scherer, 2012). In
addition to its intricate genetic landscape, various environmental factors
and specific gene–environment interactions are thought to contribute to
the pathogenesis of ASD (Hallmayer et al., 2011; Herbert, 2010).
Despite the recent advances in autism research, the molecular underpin-
nings and neural and circuit substrates of autism remain incompletely under-
stood. ASD is widely regarded as a disorder of connectivity between
different parts of the brain. A number of different brain areas have been
implicated in autism (Amaral, Schumann, & Nordahl, 2008; Courchesne,
Campbell, & Solso, 2011; Di Martino et al., 2013), including the cerebellum
(Fatemi et al., 2012; Rogers, McKimm, et al., 2013).
Termed the “little brain,” the cerebellum comprises 10% of total brain
volume but contains more neurons than the rest of the brain and has the
highest cell density of any brain area, approximately four times that of the
neocortex (Herculano-Houzel, 2010). Its unique geometric arrangement,
relatively simple structure, and sophisticated circuitry have been the subject
of intense scrutiny for over two centuries. The cerebellum is at the cross-
roads between the sensory and motor systems and is essential for coordinat-
ing communications between these two systems. Importantly, the
cerebellum is not necessary for basic elements of perception or movement,
but rather controls the spatial accuracy and temporal coordination of move-
ment. In addition, the cerebellum has long been implicated in motor skill
learning. More recently, driven by increasingly sophisticated imaging tech-
niques and advances in genetic studies, mounting evidence points to a role
for the cerebellum in cognition and emotion.
In this chapter, we will give a brief introduction to the cerebellum and
discuss the different lines of evidence that link the cerebellum to autism.
Autism Spectrum Disorder and the Cerebellum 3
2. CEREBELLAR ORGANIZATION
The cerebellum lies behind the pons and is connected to the brain stem
by three pairs of peduncles. Structurally, the cerebellum is composed of an
outer mantle of gray matter (GM) (cerebellar cortex), which surrounds the
internal white matter (WM), with three pairs of embedded deep nuclei (from
medial to lateral, the fastigial, interposed, and dentate nuclei). Morphologi-
cally, the cerebellum is subdivided into a central vermis flanked by two hemi-
spheres. The hemispheres are evolutionarily more recent and their volume
increases progressively from lower vertebrates to higher mammals; this dra-
matic increase parallels the expansion of the neocortex in higher mammalian
orders (Balsters et al., 2010). Notably, this region (cerebrocerebellum)
receives input exclusively from the cerebral cortex. The cerebellum of higher
vertebrates is highly folded into a series of parallel folia and subdivided into 3
lobes and 10 lobules (I–X). In humans, lobule VII is subdivided into Crus I,
Crus II, and VIIB, and lobule VIII is divided into VIIIA and VIIIB (Fig. 1.1A).
Figure 1.1 Cerebellar anatomy. (A) Illustration of the lobes and lobules of the cerebel-
lum, with the lobules color-coded (Spatially Unbiased Infratentorial (SUIT) Atlas;
Diedrichsen et al., 2006, 2009). (B) Schematic representation of the basic cerebellar cell
types and circuitry. The cerebellar neurons receive input from the climbing fibers (CF)
originating in the inferior olive (IO) and the mossy fibers (MF) coming from the
precerebellar nuclei (PCN). Purkinje cells (PC) form the sole output of the cerebellar cor-
tex. Excitatory (þ) and inhibitory () inputs are indicated. BC, basket cell; DCN, deep
cerebellar nuclei; GC, granule cell; GL, granular layer; GoC, Golgi cell; ML, molecular layer;
PCL, Purkinje cell layer; PF, parallel fiber, SC, stellate cell; WM, white matter.
Unlike the cerebral cortex, the cytoarchitecture of the cerebellar cortex

is remarkably uniform. The cerebellar cortex has three layers and consists of
five major cell types: the inhibitory stellate and basket cells, Golgi and
Purkinje neurons, and the excitatory granule cells (GCs) (Fig. 1.1B). Each
of the neuronal subtypes has a stereotypic and distinct morphology and dis-
crete localization within the cerebellar cortex. Precise connections between
the principal neurons are arranged in repeating circuit modules throughout
the cerebellum. The cerebellum receives two types of excitatory inputs,
mossy fibers originating from the precerebellar nuclei and climbing fibers
coming from the inferior olive. The Purkinje cells (PCs) serve as the sole
output of the cerebellar cortex. Their axons terminate on neurons in the cer-
ebellar nuclei, which then project to other regions of the brain.
The cerebellum is richly connected with the majority of the cerebral cor-
tex, forming closed-loop cerebello-thalamo-cortico-pontine-cerebellar cir-
cuits. Different cerebellar functional regions can be broadly defined based on
their patterns of connectivity with the cerebral cortex and the spinal cord,
giving rise to a functional topography in the cerebellum (see Stoodley &
Schmahmann, 2010 for review). The anterior lobe (lobules I–V) and lobule
VIII are predominantly sensorimotor, with an upside-down representation
of the body in the anterior lobe and secondary representations in lobule VIII.
Lobules VI and VII (including Crus I, Crus II, and lobule VIIB) contribute
to higher-level processes via connections with prefrontal and parietal corti-
ces. The role of lobule IX is not yet clear, though it is important for the visual
guidance of movement and may also be involved in the default network (see
Buckner, Krienen, Castellanos, Diaz, & Yeo, 2011). Lobule X, the
vestibulocerebellum, is connected with the vestibular nuclei. The posterior
cerebellar vermis is thought to be involved in emotional modulation (Heath,
1977). In task-based imaging studies, activation patterns reflect the topo-
graphic arrangement of these different networks (Fig. 1.2) (Stoodley,
Figure 1.2 Cerebellar functional topography. Task-based functional MRI activation pat-
terns reflect contralateral connections with cerebral cortex and ipsilateral connections
with the spinal cord. Language tasks engage right-lateralized cerebellar lobule VII, spa-
tial task activation is left-lateralized, and right-handed finger-tapping activates the right
cerebellar anterior lobe and lobule VIII. Adapted and reproduced with permission from
Stoodley and Schmahmann (2009).
2012; Stoodley & Schmahmann, 2009). This provides a framework for

interpreting cerebellar findings in ASD based on the localization of structural
and functional differences to specific regions within the cerebellum.
3. ASD SYMPTOMS IN PATIENTS WITH CEREBELLAR

DISORDERS
Cerebellar disorders offer insight into the link between the cerebellum
and ASD. While cerebellar damage can result in motor dysfunction, cere-
bellar lesions also cause the Cerebellar Cognitive Affective Syndrome
(CCAS; Schmahmann & Sherman, 1998), a constellation of symptoms
including impairments in language, spatial, and executive functions as well
as affective dysregulation—symptoms that are relevant to ASD.
Although the cerebellum is one of the first structures of the human brain
to differentiate, it is not fully mature until the first postnatal years. This
lengthy developmental phase makes the cerebellum particularly vulnerable
to a broad spectrum of developmental disorders. Cerebellar malformations
have been associated with a range of developmental impairments, including
ASD symptomology (see review by Bolduc & Limperopoulos, 2009). Jou-
bert syndrome (JS) is associated with hypoplasia of the cerebellar vermis, and
13–27% of JS children have clinically significant ASD symptoms (Ozonoff,
Williams, Gale, & Miller, 1999). Smaller posterior vermal volume is also
reported in Fragile X syndrome (FXS) and is associated with cognitive
impairment (Mostofsky et al., 1998) and poorer social cognition (Cornish
et al., 2005). Some patients with autism-associated 22q13.3 deletion
(Phelan–McDermid) syndrome have severe hypoplasia of the vermis
(Aldinger et al., 2013). Larger studies of cerebellar malformations also sup-
port a relationship between vermal malformations and positive ASD screens,
whereas cerebellar hemisphere malformations are more often associated
with selective deficits in executive function, language, or spatial cognition
(Bolduc et al., 2011, 2012; Tavano et al., 2007). These findings reflect
the connectivity patterns of these cerebellar regions, with the posterior ver-
mis thought to connect to limbic structures and the posterolateral hemi-
spheres forming cerebro-cerebellar loops with frontal and parietal
association cortices (see Stoodley & Schmahmann, 2010 for review).
In humans, rapid cerebellar growth takes place in the third trimester,
which is impeded by preterm delivery. Preterm delivery leads to disruptions
in the developmental program of the cerebellum, resulting in reduced thick-
ness but increased packing density of GC layers and reduction in the density
of Bergmann glia. Cerebellar injury associated with premature birth is
followed by reduced prefrontal volume and an approximately 40-fold

increase in ASD by age 2 (Limperopoulos, Chilingaryan, Guizard,
Robertson, & Du Plessis, 2010). A significant relationship was found
between vermal damage in preterm infants and a positive autism screen
(Limperopoulos et al., 2007, 2008).
Around 25% of patients with tuberous sclerosis complex (TSC) have cer-
ebellar lesions (Eluvathingal et al., 2006; Vaughn et al., 2013), and reduction
in cerebellar volume has been specifically associated with the TSC2 gene
mutation (Weisenfeld et al., 2013). In TSC patients, autism severity is asso-
ciated with a greater number of cerebellar tubers, and patients with cerebellar
tubers have lower adaptive behavior, communication, and socialization
scores (Eluvathingal et al., 2006; Weber, Egelhoff, McKellop, & Franz, 2000).
In acquired cerebellar lesions due to tumor or stroke, affective distur-
bances were most often associated with vermal and paravermal lesions
(see Schmahmann, Weilburg, & Sherman, 2007), whereas language difficulties
are associated with right posterolateral hemisphere lesions (e.g., Riva & Giorgi,
2000; Stoodley, MacMore, Makris, Sherman, & Schmahmann, 2012).
4. MOTOR IMPAIRMENT IN AUTISTIC INDIVIDUALS

Motor impairment and clumsiness has been noted since the earliest
descriptions of ASD (Kanner and Asperger in Frith, 1991). Although only
repetitive behaviors are included in the diagnostic criteria, motor impair-
ment is a cardinal feature in ASD (Fournier, Hass, Naik, Lodha, &
Cauraugh, 2010). Up to 80% of children with autism show motor coordi-
nation deficits and these are highly correlated with autistic severity and IQ
(Green et al., 2009; Hilton, Zhang, Whilte, Klohr, & Constantino, 2012).
Similarly, it has been suggested that dyspraxia is a core feature of ASD, rather
than a comorbid or associated disorder (Dziuk et al., 2007; MacNeil &
Mostofsky, 2012).
Motor signs indicative of cerebellar dysfunction in ASD include eye-
movement abnormalities, fine and gross motor deficits, impaired gait, bal-
ance and coordination, postural instability, and motor learning deficits
(Table 1.1) (Freitag et al., 2007; Gowen & Hamilton, 2013; Jeste, 2011).
ASD patients can be more variable in their motor performance, indicating
difficulties maintaining performance consistency (e.g., Moran et al., 2013).
Slower and more variable saccadic adaptation (Mosconi et al., 2013) could
be related to structural differences in the posterior vermis in ASD. It has been
Table 1.1 Cerebellar motor impairments in ASD

Task Description Reference
Gross motor Scores on Movement- Freitag, Kleser, Schneider, and von
skill ABC and PANESS, Gontard (2007), Green et al. (2002), Landa
ball catching, hopping and Garrett-Mayer (2006), MacNeil and
Mostofsky (2012), Moran, Foley, Parker,
and Weiss (2013), Noterdaeme,
Mildenberger, Minow, and Amorosa
(2002), Whyatt and Craig (2012)
Balance and Static balance, balance Chang, Wade, Stoffregen, Hsu, and Pan
posture with sensory challenge, (2010), Esposito, Venuti, Apicella, and
postural asymmetry Muratori (2011), Fournier, Kimberg, et al.
(2010), Gepner and Mestre (2002), Greffou
et al. (2012), MacNeil and Mostofsky
(2012), Minshew, Sung, Jones, and Furman
(2004), Molloy, Dietrich, and Bhattacharya
(2003), Noterdaeme et al. (2002),
Radonovich, Fournier, and Hass (2013),
Travers et al. (2012)
Gait Variability in gait Hallett et al. (1993), Rinehart, Bellgrove,
parameters et al. (2006), Rinehart, Tonge, et al. (2006)
Praxis Planning and Dziuk et al. (2007), MacNeil and
performing skilled, Mostofsky (2012)
coordinated
movements
Motor Serial response time Mostofsky, Goldberg, Landa, and Denckla
learning task, sequence learning (2000), Mostofsky et al. (2009), Muller,
Kleinhans, Kemmotsu, Pierce, and
Courchesne (2003)
Eyeblink Timing of conditioned Sears, Finn, and Steinmetz (1994),
conditioning response Steinmetz, Tracy, and Green (2001)
Saccadic eye Saccadic and smooth Mosconi et al. (2010, 2013), Takarae,
movements, pursuit, rate and Minshew, Luna, Krisky, and Sweeney
adaptation variability of adaptation (2004), Takarae, Minshew, Luna, and
Sweeney (2004), Takarae, Minshew, Luna,
and Sweeney (2007)
Gesture and Motor imitation tasks Jones and Prior (1985), Rogers, Hepburn,
imitation (facial expressions, Stackhouse, and Wehner (2003), Stieglitz
gesture, using objects), Ham et al. (2011)
lack of social gestures
suggested that adults and adolescents with ASD are impaired in calibrating
the relationship between their body and environment, and this is strongly
correlated with their social and communication impairments
(Linkenauger, Lerner, Ramenzoni, & Proffitt, 2012).
Motor impairments are among the earliest signs of an autistic phenotype
(Esposito et al., 2011; Teitelbaum, Teitelbaum, Nye, Fryman, & Maurer,
1998; Zwaigenbaum, Bryson, & Garon, 2013). Prospective studies of
at-risk infants have shown that children who are later diagnosed with
ASD show poorer fine and gross motor skills than typically developing
(TD) and language-impaired children (Landa & Garrett-Mayer, 2006),
and motor impairments are predictive of ASD outcome (Zwaigenbaum
et al., 2013). Greater head lag during pull-to-sit was more frequently
observed in infants at high-risk for ASD and was associated with ASD status
upon follow-up (Flanagan, Landa, Bhat, & Bauman, 2012). Similarly, oral
and manual motor skills in infancy and toddlerhood differentiated ASD indi-
viduals and predicted later speech fluency (Gernsbacher, Sauer, Geye,
Schweigert, & Hill Goldsmith, 2008), and early motor delays are more com-
mon in infants at risk for ASD and are related to later communication delays
(Bhat, Galloway, & Landa, 2012).
Performance on motor tasks also correlates with ASD symptoms,
including emotional/behavioral disturbance and communication disorder
(Papadopoulos et al., 2012). ASD children that were significantly impaired dur-
ing quiet stance had a higher number of restricted and repetitive behaviors
(Radonovich et al., 2013). It has been suggested that the lack of gesture and imi-
tation in ASD might be related to motor dysfunction, providing a mechanism
by which cerebellar dysfunction could impact the core social communication
symptoms of ASD (Gidley Larson & Mostofsky, 2006; Jones & Prior, 1985).
Consistent with this, ASD children are impaired on both the recognition
and imitation of gestures (Stieglitz Ham et al., 2011), and imitation impairment
was associated with increased ASD symptoms and poorer joint attention
(Rogers et al., 2003).
5. CEREBELLAR PATHOLOGY IN AUTISM

Histopathological changes in the cerebellum have been observed in
almost all postmortem brains of autistic individuals. The most consistent
neuropathological finding in ASD is the loss of PCs (Allen, 2005; Bailey
et al., 1998; Palmen, 2004). PC loss is widely distributed throughout the
folia and observed in the vermis and particularly the cerebellar hemispheres
(Allen, 2005; Bauman & Kemper, 2005; Whitney, Kemper, Bauman,

Rosene, & Blatt, 2008). Because of the absence of glial hyperplasia in the
cerebellum, it has been argued that loss of PCs likely occurs early on during
cerebellar development (Allen, 2005; Bauman & Kemper, 2005). Also,
widespread cellular dysplasia that has been observed in 62% of studied autis-
tic brains suggests very early cerebellar developmental defects in ASD
(Wegiel et al., 2010). In contrast, the preservation of basket and stellate cells
in the presence of reduced PC numbers in some autistic brains suggests that
PCs die after proper migration (Whitney, Kemper, Rosene, Bauman, &
Blatt, 2009). In addition to cell loss, reduced packing density of PCs
(Palmen, 2004) and reduced PC size (Fatemi et al., 2002) have been reported
in autistic brains. Further observed cerebellar pathology in ASD includes a
reduction of GCs and hypertrophy and atrophy of cerebellar nuclei (Allen,
2005; Bauman & Kemper, 2005; Kemper & Bauman, 1998).
While these studies point to abnormal cerebellar pathology in ASD,
some inconsistencies in the observations can be noted. These might be
due to the heterogeneity in the ASD phenotype of the tested individuals.
In the future, it will be important to carry out quantitative stereological stud-
ies in different regions of the cerebellum and at different ages in stratified
patient populations. Some clues come from the genetically well-defined
syndromic forms of ASD. Both postmortem and imaging studies from
human patients with Rett syndrome (RTT) show cerebellar pathology,
including progressive vermal hypoplasia, loss of PCs, and decreases in PC
size (Bauman, Kemper, & Arin, 1995; Murakami, Courchesne, Haas,
Press, & Yeung-Courchesne, 1992; Oldfors et al., 1990). PC loss and cer-
ebellar glial abnormalities have also been reported in FXS (Greco et al.,
2011; Sabaratnam, 2000). Similarly, TSC is associated with cerebellar atro-
phy and loss of PCs (Boer et al., 2008; Reith, Way, McKenna, Haines, &
Gambello, 2011).
6. CEREBELLAR DIFFERENCES IN AUTISM: STRUCTURAL

NEUROIMAGING
Abnormalities in the cerebellum are among the most consistently
reported brain differences in autism, and decreased bilateral cerebellar cortex
was one of the most important markers for classifying adult ASD brains
(Ecker et al., 2010). Cerebellar enlargement has been reported in autistic
toddlers and young children (Courchesne et al., 2001). This early over-
growth is generally proportional to total brain volume (Stanfield et al.,
2008) and likely related to cerebellar WM (Allen, 2005; Amaral et al., 2008;
Courchesne, Webb, & Schumann, 2012). By adulthood, smaller cerebellar
volume has been reported (Hallahan et al., 2009).
Numerous imaging studies have reported cerebellar hypoplasia in autism,
specifically smaller cerebellar vermal lobules VI and VII (e.g., Allen, 2005;
Courchesne et al., 2011, 2012; Courchesne, Yeung-Courchesne,
Hesselink, & Jernigan, 1988). Reduced vermal VI–VII is associated with
ASD symptoms (Kaufmann et al., 2003), including reduced exploration
and increased stereotyped and repetitive movements (Pierce &
Courchesne, 2001). The imaging findings in other vermal lobules are incon-
sistent (e.g., Courchesne et al., 2012; Stanfield et al., 2008; Webb et al.,
2009). Reduced size of the cerebellar hemispheres has also been observed
and is correlated with vermal hypoplasia (Murakami, Courchesne, Press,
Yeung-Courchesne, & Hesselink, 1989). Differences in the volume of
the vermis and anterior lobe and abnormal left-lateralization in lobule
VIIIA have been associated with language impairment in ASD (Hodge
et al., 2010).
Differences in cerebellar WM tracts have also been reported. Increased
diffusivity of the superior cerebellar peduncles suggests abnormal connectiv-
ity between the cerebellum and its rostral connections (Sivaswamy et al.,
2010), and Catani et al. (2008) found a correlation between the degree of
social impairment and the integrity of the superior cerebellar peduncle. In
ASD children, cerebellar WM abnormalities were associated with repetitive
behaviors (Cheung et al., 2009).
Voxel-based morphometry studies have reported both increases and
decreases in cerebellar GM and WM (Fig. 1.3). Decreased GM is consis-
tently found in midline IX, right Crus I, and lobule VIII in ASD, and in
some studies lobule IX was the most significant cluster in the entire brain;
increased GM was reported in lobule VI (Cauda et al., 2011; Duerden,
Mak-Fan, Taylor, & Roberts, 2012; Nickl-Jockschat et al., 2012; Yu,
Cheung, Chua, & McAlonan, 2011). Resting-state activity in lobule IX
and right Crus I most strongly correlates with the default mode network
(Buckner et al., 2011), and healthy males engage Crus I bilaterally during
both theory of mind and empathy tasks (Vollm et al., 2006). In ASD chil-
dren, GM reductions bilaterally in Crus II and in vermal lobules VIII–IX
correlated with communication scores (Riva et al., 2013), and lower GM
in Crus I was associated with increased repetitive and stereotyped behaviors
(Rojas et al., 2006). Although increases in right Crus I have been reported,
these were in a different region of right Crus I that is thought to be part of
Figure 1.3 Activation likelihood estimate (ALE) meta-analysis revealing GM differences

in ASD. Structural GM increases in VI/Crus I are shown in red-orange and decreases in
Crus I and IX are shown in blue-green. Adapted and reproduced with permission from
Cauda et al. (2011).
fronto-parietal cognitive control networks (Buckner et al., 2011). GM

increases in lobule VI correlated with poorer social and communication
scores (Rojas et al., 2006). These findings suggest that the structural differ-
ences within the cerebellum are related to different aspects of the core ASD
deficits.
7. ABNORMAL CEREBELLAR ACTIVATION IN AUTISM

Functional imaging has revealed task-dependent differences in cere-
bellar activation in ASD in a wide range of tasks. Allen and Courchesne
(2003) found greater and more widespread cerebellar activation during a
simple motor task, but less attention-related activation in the cerebellum
in ASD individuals. Reduction in cerebellar activity in ASD is often accom-
panied by an increase in activation in cortical regions, particularly prefrontal
regions (e.g., Mostofsky et al., 2009; Takarae et al., 2007). This may reflect
compensatory activity and suggests that cerebellar dysfunction taxes top-
down systems. In the resting state, ASD children showed decreased regional
homogeneity in bilateral Crus I, and greater regional homogeneity
bilaterally in lobule VIII (Paakki et al., 2010). Based on resting-state studies

of cerebro-cerebellar networks (e.g., Buckner et al., 2011), differences in
Crus I could reflect alterations in default or prefrontal–parietal control net-
work activity, whereas changes in lobule VIII could be related to repetitive
or stereotyped behaviors.
During more complex motor tasks, ASD participants showed reduced
anterior cerebellar activation during sequential finger-movement tasks
(e.g., Gilbert, Bird, Brindley, Frith, & Burgess, 2008; Muller et al., 2003;
Villalobos, Mizuno, Dahl, Kemmotsu, & Muller, 2005), and less activation
bilaterally in Crus I during visually guided saccades and in VI/Crus I during
visual pursuit (Takarae et al., 2007). During visual–spatial attention, both
ASD and unaffected siblings showed atypical engagement of frontal–
cerebellar circuits, which correlated with ASD traits in autistic participants
and their siblings (Belmonte, Gomot, & Baron-Cohen, 2010). ASD partic-
ipants did not engage the posterior vermis during spatial attention, where
structural differences in ASD are widely reported (Haist, Adamo,
Westerfield, Courchesne, & Townsend, 2005). During eye movements,
the typically-developing (TD) group activated the oculomotor vermis,
whereas the ASD group activated Crus I (Haist et al., 2005), suggesting that
the ASD group was not using typical eye-movement regions of the cerebel-
lum but instead utilized association cerebro-cerebellar loops.
While not all studies find cerebellar differences during face processing
(e.g., Corbett et al., 2009; Schulte-Ruther et al., 2011), others report differ-
ences particularly during direct gaze processing (Pitskel et al., 2011). During
explicit and implicit processing of facial expressions, ASD adults showed
greater activation in the anterior vermis during implicit processing, whereas
TD adults showed greater activation in this region during explicit processing
(Critchley et al., 2000). These data suggest that the groups engage different
cerebro-cerebellar circuits when processing facial expressions.
As in structural imaging, functional imaging also supports lobule VII dys-
function in ASD. During emotional processing, ASD groups showed
reduced activity in lobule VII (Crus I, Crus II) during processing of music
(Caria, Venuti, & de Falco, 2011), facial and vocal stimuli (Wang, Lee,
Sigman, & Dapretto, 2007), and emotional images (Silani et al., 2008).
Reduced activation in right VII has also been reported during language
tasks, including semantic processing (Harris et al., 2006; Knaus, Silver,
Lindgren, Hadjikhani, & Tager-Flusberg, 2008; Tesink et al., 2011) and
anomalous sentence processing (Groen et al., 2010). Significant correlations
were found in the ASD group between the N-acetyl-aspartate concentration
in the right cerebellar hemisphere and verbal fluency scores (Kleinhans,

Schweinsburg, Cohen, Muller, & Courchesne, 2007), though no significant
differences in cerebellar activation were reported during prosodic speech
(Hesling et al., 2010) or word categorization (Gaffrey et al., 2007). Reduced
activation in right Crus I and II (together with frontal and parietal cortices)
has also been reported during executive function paradigms (Solomon et al.,
2009), though differences are not always found in ASD participants during
executive function tasks. For attention tasks, change detection and attention
shifting tasks have shown both greater (right I–IV; Gomot et al., 2006) and
reduced (lobule V; Shafritz, Dichter, Baranek, & Belger, 2008) activation in
the anterior cerebellum.
In summary, cerebellar functional activation differences have been found
in both resting-state and task-based neuroimaging studies. The tasks in
which cerebellar differences are reported go beyond motor tasks and include
language and executive function measures, and in many cases correspond
with regions in which cerebellar structural differences have been identified
in ASD.
8. AUTOIMMUNE STUDIES IN ASD IMPLICATING

THE CEREBELLUM
Autoimmune mechanisms are considered to be one of the environ-
mental factors contributing to autism (Braunschweig & Van de Water,
2012). Maternal brain-reactive antibodies are thought to access the fetal
brain during pregnancy as the fetal blood–brain barrier is not yet fully
formed. Indeed, studies have identified the presence of antibodies that bind
to human fetal brain tissue in a subset of women who have children with
autism (Braunschweig et al., 2008; Croen et al., 2008; Singer et al., 2008;
Zimmerman et al., 2007). Several studies have described antibodies that
are reactive to cerebellar proteins in ASD (Dalton et al., 2003; Goines
et al., 2011; Wills et al., 2009). Dalton et al. (2003) described maternal anti-
bodies from a mother of children with autism and language disorder binding
to cerebellar PCs. When the maternal serum was injected into pregnant mice
during gestation, the offspring exhibited altered exploration and motor
coordination and changes in cerebellar magnetic resonance spectroscopy.
Moreover, in humans the presence of antibodies against cerebellar proteins
is associated with a worsening of cognitive function and aberrant behaviors
including deficits in communication (Braunschweig et al., 2012; Goines
et al., 2011). Together, these studies suggest that maternal antibodies to
cerebellar proteins might be a cause of ASD. However, it is unclear which

cerebellar proteins are targeted by these auto-antibodies and what the under-
lying molecular mechanisms might be. It is important to identify the cere-
bellar target antigens as this might give important insights into the
pathogenesis of ASD in general and might also lead to the identification
of important biomarkers to ascertain autism risk. Furthermore, these studies
might also give important insight into the molecular basis of gene–
environment interactions in autism. For example, the presence of a single
nucleotide polymorphism in the promoter of the human MET gene,
encoding Met proto-oncogene receptor tyrosine kinase, is highly correlated
with the presence of maternal antibodies, potentially by dysregulating
maternal cytokine production and hence immune function (Heuer,
Braunschweig, Ashwood, Van de Water, & Campbell, 2011).
9. AUTISM GENES IN MOUSE CEREBELLAR

DEVELOPMENT
Much of our current understanding of the cellular and molecular
mechanisms governing the formation of the cerebellum has come from
the analysis of mutant mice with cerebellar phenotypes. A number of autism
candidate genes are known to have important functions in cerebellar devel-
opment. However, most of the cerebellar mouse mutants were generated
before the respective genes were associated with autism. Consequently, in
most of these mutants, autism-related behaviors have not yet been rigorously
assessed.
Several studies have found a genetic association between the gene encoding
the transcription factor engrailed homeobox 2 (EN2) and autism (see curated
databases SFARI Gene and Autism KB; Basu, Kollu, & Banerjee-Basu, 2009;
Xu et al., 2012). In mice, En2 contributes to the early specification of all
cerebellar neurons and is required for late embryonic morphogenesis through
its inhibition of migration, growth, and differentiation. Mice deficient for En2
display abnormal cerebellar foliation, hypoplasia, and a reduction in cerebellar
neuron numbers (Kuemerle, Zanjani, Joyner, & Herrup, 1997; Millen, Wurst,
Herrup, & Joyner, 1994). Consistent with aberrant cerebellar development,
these mice display a motor phenotype including abnormal motor coordination
and grip strength (Cheh et al., 2006). En2 knockout mice also exhibit other
behavioral impairments that are relevant to autism, including social deficits
and increased grooming (Brielmaier et al., 2012; Cheh et al., 2006). However,
it is unclear whether the latter result specifically from loss of En2 in the
cerebellum, as En2 is also expressed, albeit at lower levels, in other parts of
the brain, including the cortex and the thalamus (Brielmaier et al., 2012).
RAR-related orphan receptor alpha (ROR-alpha) is another transcrip-
tion factor crucial for cerebellar development that recently has been associ-
ated with autism (SFARI Gene). It has long been known that ROR-alpha is
vital for early PC development (Boukhtouche et al., 2006; Gold, Gent, &
Hamilton, 2007). Both the staggerer mouse, harboring a spontaneous intra-
genic Rora deletion, and targeted Rora knockout mice display abnormal PC
development, followed by progressive loss of PCs and secondary loss of GCs
(Sidman, Lane, & Dickie, 1962) (see also Mouse Genome Database (MGD);
Eppig et al., 2012). Behaviorally, Rora-deficient mice are ataxic and exhibit
impaired motor coordination and learning phenotypes (MGD).
PC development is also known to be under control of the transcription
factor forkhead box 2 (Foxp2). Human mutations in FOXP2 cause devel-
opmental speech and language deficits and are associated with autism
(SFARI Gene, Autism KB). Mice deficient for the Foxp2 gene show impair-
ments in PC development, cerebellar radial glia morphology, and GC
migration (Shu, 2005). Furthermore, mice with a language disorder-
implicated missense mutation (R522H) in Foxp2 also show cerebellar hypo-
plasia, abnormal PC development, cerebellar synaptic deficits, and impaired
motor learning (Fujita et al., 2008; Groszer et al., 2008).
The extracellular matrix protein reelin is important for neuronal migra-
tion in both the cortex and the cerebellum (Rice & Curran, 2001). Several
studies have found a genetic association between the RELN gene and
autism, and rare mutations in RELN have been identified in individuals with
ASD (SFARI Gene). Furthermore, reelin signaling was impaired in the
frontal cortex and cerebellum of autistic postmortem brains (Fatemi et al.,
2005). In the cerebellum, reelin is highly expressed in GCs. Reln mouse
mutants, including the classic spontaneous reeler mouse, display cerebellar
hypoplasia with severely reduced GC numbers and secondary PC migration
deficits (Mariani, Crepel, Mikoshiba, Changeux, & Sotelo, 1977) (MGD).
Behaviorally, Reln mouse mutants display ataxia, motor coordination, and
balance deficits (MGD). Consistent with the findings in mice, human RELN
mutations have also been associated with profound cerebellar hypoplasia
(Hong et al., 2000). The adaptor proteins Dab1 and CrkL are downstream
effectors in the reelin-signaling pathway (Ballif et al., 2004; Park & Curran,
2008). Similar to the reeler mice, mice deficient for Dab1 (scrambler mouse
mutant) or Crkl knockout mice display cerebellar hypofoliation and failure
of PC migration and dendritic differentiation (Park & Curran, 2008; Sweet,

Bronson, Johnson, Cook, & Davisson, 1996). Both human genes DAB1 and
CRKL are associated with ASD (Autism KB). Interestingly, Crkl is impli-
cated in Met signaling (Furge, Zhang, & Van de Woude, 2000), and the
human MET gene is strongly associated with autism (SFARI Gene, Autism
KB) (for more information, see Chapter 5). In the cerebellum, Met is
expressed postnatally in proliferating GC precursors and adult GCs and
required for normal cerebellar development (Honda et al., 1995; Ieraci,
Forni, & Ponzetto, 2002). Mice harboring a hypomorphic Met receptor dis-
play cerebellar hypoplasia with foliation defects and reduced GC prolifera-
tion (Ieraci et al., 2002). Consistently, these mice display impaired motor
coordination.
Another autism-implicated signaling molecule involved in cerebellar
development is phosphatase and tensin homolog (PTEN). Rare single gene
variants in human PTEN have been associated with ASD including Cowden
syndrome (SFARI Gene). Mice deficient in Pten are ataxic and display aber-
rant neuronal proliferation and migration deficits in the cerebellum
(Backman et al., 2001; Kwon et al., 2001; Marino et al., 2002).
Ca2þ-dependent activator protein for secretion 2 (CADPS2) is a vesic-
ular protein highly expressed in the parallel fiber terminals of cerebellar GCs
and involved in the secretion of the neurotrophic factors NT-3 and BDNF
(Sadakata, 2004; Speidel et al., 2003), both of which are essential for cere-
bellar development. Rare variants in human CADPS2 are associated with
autism (Cisternas, Vincent, Scherer, & Ray, 2003) and there is also expres-
sion, linkage, and copy number variant (CNV) evidence for CADPS2 in
autism (Autism KB). Mice deficient in Cadps2 exhibit cerebellar foliation
defects, impaired PC differentiation, and GC migration abnormalities
(Sadakata, Kakegawa, et al., 2007). Cadps2-deficient mice also show behav-
ioral deficits related to aberrant cerebellar function including impaired
motor coordination and eye movements (Sadakata, Kakegawa, et al.,
2007). Moreover, these mice display cognitive deficits including impaired
spatial memory, social behavior, and circadian rhythm (Sadakata,
Washida, et al., 2007). However, it remains unclear whether the latter
are due to cerebellar deficits or altered circuit activity elsewhere in the brain.
Lastly, mouse mutants deficient in the Gabrb3 gene encoding the
gamma-aminobutyric acid (GABA) A receptor, subunit beta 3, have rev-
ealed a role for this receptor in cerebellar development. GABRB3 maps
to chromosomal region 15q11–q13, the most common known cytogenetic
abnormality in individuals with ASD (Devlin & Scherer, 2012).
Furthermore, rare variants in the human GABRB3 have been associated

with autism (SFARI Gene, Autism KB). Gabrb3 protein expression was
found to be reduced in autism postmortem cerebellum (Fatemi,
Reutiman, Folsom, & Thuras, 2008). Gabrb3-deficient mice have a variety
of neurological phenotypes including impaired motor coordination
(DeLorey et al., 1998). Neuropathologically, Gabrb3-deficient mice display
cerebellar hypoplasia, particularly of lobules II–VII (DeLorey, Sahbaie,
Hashemi, Homanics, & Clark, 2008). These mice also show impairments
in social and exploratory behavior (DeLorey et al., 2008). However, it
should be noted that Gabrb3 is expressed widely in the developing nervous
system including the cortex, hippocampus, and thalamus (Laurie, Wisden, &
Seeburg, 1992).
10. CEREBELLAR PHENOTYPES IN RODENT MODELS

OF AUTISM
Over the past several years, an increasing number of rodent models of
autism have been developed and characterized in terms of their molecular,
cellular, and behavioral phenotypes and responses to drug treatment. The
models that have been assessed for cerebellar phenotypes will be
discussed here.
One of the earliest autism rodent models is the valproic acid (VPA) rat
model (Rodier, 1996). Injection of pregnant dams with VPA causes
autism-related behavior in their offspring including impaired social
behavior, exploratory activity, and repetitive/stereotypic-like hyperactivity
(Roullet, Wollaston, deCatanzaro, & Foster, 2010; Schneider &
Przewłocki, 2004; Yochum, Dowling, Reuhl, Wagner, & Ming, 2008).
Motor performance has not been well assessed in these models, although
delayed motor maturation and impairments in fine motor skills have been
reported (Reynolds, Millette, & Devine, 2012; Wagner, Reuhl, Cheh,
McRae, & Halladay, 2006). VPA-exposed offspring show a number of
prominent cerebellar anomalies including cerebellar hypoplasia, a reduction
of PCs, reduced PC spine density, and increased apoptosis of cerebellar GCs
(Ingram, Peckham, Tisdale, & Rodier, 2000; Mychasiuk, Richards,
Nakahashi, Kolb, & Gibb, 2012; Yochum et al., 2008).
Cerebellar phenotypes including aberrant neuropathology, electrophys-
iology, and behavior have also been demonstrated in several well-established
genetic mouse models of autism. The transcriptional regulator methyl-
CpG-binding protein 2 (MeCP2), which is mutated in RTT, shows
dramatic developmental increases in expression in the cerebellum during the

period of extensive synapse formation (Mullaney, Johnston, & Blue, 2004).
Mecp2-deficient mice exhibit RTT-like phenotypes including motor
impairments (Chen, Akbarian, Tudor, & Jaenisch, 2001; Guy, Hendrich,
Holmes, Martin, & Bird, 2001). Motor coordination and learning are also
impaired in MeCP2 knockin mice that harbor the RTT-associated mutation
T158A (Goffin et al., 2011). Consistent with the observed motor deficits,
cerebellar pathology is observed in the mutant mice. Cerebellar volume is
significantly reduced in Mecp2-deficient mice (Belichenko, Belichenko,
Li, Mobley, & Francke, 2008), and the cell bodies of cerebellar GCs are
smaller and more densely packed (Chen et al., 2001). Given these pheno-
types, a number of expression studies have been carried out in the RTT mice
to identify the underlying molecular deficits in the cerebellum. Hundreds of
genes were found to be significantly changed in the cerebella of both MecP2-
deficient and -overexpression mice (Ben-Shachar, Chahrour, Thaller,
Shaw, & Zoghbi, 2009). Interestingly, MeCP2 was shown to directly reg-
ulate the expression of reelin in mouse cerebellum (Jordan, Li, Kwan, &
Francke, 2007), hinting at a potential common molecular pathway under-
lying cerebellar deficits in ASD.
Similarly, FXS model mice deficient in Fmr1 display cerebellar pathology
and aberrant cerebellar function. A mouse MRI study on Fmr1-deficient
mice revealed anatomical changes only in the cerebellum including
decreased volume and neuronal loss in the deep cerebellar nuclei
(Ellegood, Pacey, Hampson, Lerch, & Henkelman, 2010). Moreover,
Fmr1-deficient mice exhibit abnormal PC morphology with longer den-
dritic spines (Koekkoek et al., 2005). Behaviorally, these mice are impaired
in eyeblink conditioning, a cerebellum-dependent form of associative learn-
ing, similar to FXS and ASD patients (Koekkoek et al., 2005; Tobia &
Woodruff-Pak, 2009). Standard motor function is only mildly impaired in
the Fmr1-deficient mice, but they show significant cerebellum-dependent
oromotor defects that might be related to articulation deficits in humans with
FXS (Roy et al., 2011). Recently, abnormalities in the cerebellar–prefrontal
circuitry were reported in Fmr1 knockout mice, resulting in abnormal dopa-
mine transmission in the prefrontal cortex (Rogers, Dickson, et al., 2013).
Mice with maternal deficiency (m/pþ) for the Ube3a gene have been
generated as a model system for Angelman syndrome ( Jiang et al., 1998;
Miura et al., 2002). When maternally inherited, Ube3a is strongly expressed
in PCs and cerebellar neurons in the molecular and granular layers and in
some cortical and hippocampal neurons (Albrecht et al., 1997; Dindot,

Antalffy, Bhattacharjee, & Beaudet, 2008). Ube3am/pþ mice display several
cerebellar phenotypes including abnormal gait and impaired motor coordi-
nation and balance (Heck, Zhao, Roy, LeDoux, & Reiter, 2008; Jiang et al.,
1998; Miura et al., 2002). Similar to the Fmr1 knockout mice, Ube3am/pþ
mice also display cerebellar-dependent deficits in oromotor function (Heck
et al., 2008). Furthermore, Ube3am/pþ mice exhibit fast oscillations
sustained by abnormally increased PC firing rate and rhythmicity and also
abnormal PC spine morphology (Cheron, Servais, Wagstaff, & Dan,
2005; Dindot et al., 2008). Recently, it was found that motor dysfunction
in Ube3am/pþ mice is caused by decreased tonic inhibition in cerebellar
GCs due to reduced degradation of the GABA transporter 1 (Egawa
et al., 2012). Interestingly, the motor deficits in the Ube3am/pþ mice could
be alleviated by administration of the selective extrasynaptic GABAA recep-
tor agonist THIP (Egawa et al., 2012). It will be important to establish
whether the Ube3am/pþ mice also exhibit autism-like phenotypes including
social and communication deficits and restricted behaviors and whether
these phenotypes can be rescued with THIP.
Nonsyndromic forms of autism are often associated with mutations in
cell adhesion molecules including SHANKS and neuroligins (Betancur,
Sakurai, & Buxbaum, 2009; Peça & Feng, 2012). SHANK3 is highly
expressed in the molecular and granular layer of the cerebellum (Böckers
et al., 2001; Peça et al., 2011). Recently, several mutant Shank3 mouse
models have been generated and shown to recapitulate autistic behaviors rel-
evant to individuals with SHANK3 mutations (Jiang & Ehlers, 2013). While
a possible cerebellar pathology has not been analyzed yet in these mouse
mutants, motor coordination defects have been described in two Shank3-
knockout lines (Bozdagi et al., 2010; Yang et al., 2011).
Mutant Neuroligin-3 (Nlgn3) mice, either harboring an ASD-associated
point mutation (R451C) or deficient in Nlgn3, display autism-related
behaviors such as impaired social interaction and communication
(Radyushkin et al., 2009; Tabuchi et al., 2007). Nlgn3-deficient mice also
exhibit cerebellar-dependent motor incoordination (Baudouin et al.,
2012). Furthermore, these mice show disrupted cerebellar heterosynaptic
competition and deficits in cerebellar metabotropic glutamate receptor-
dependent synaptic plasticity, similar to those observed in Fmr1-deficicient
mice, suggestive of a shared cerebellar pathophysiology in these mouse
models (Baudouin et al., 2012; Koekkoek et al., 2005).
11. FUNCTIONAL EVIDENCE FROM MOUSE GENETICS

While there is mounting evidence for cerebellar phenotypes in mouse
mutants for autism genes as discussed above, it remains controversial
whether these are a bystander effect or are key to the disease pathogenesis.
Using conditional mouse knockouts for TSC proteins, recent studies have
provided functional evidence that abnormal PC function is an important
contributor to autism-related behavior in the mouse. TSC is an
autosomal-dominant disorder with high rates of comorbid ASD caused
by mutations in either TSC1 or TSC2. As discussed above, the cerebellum
has been implicated in TSC, and cerebellar pathology is correlated with the
severity of ASD symptoms in TSC patients (Eluvathingal et al., 2006; Weber
et al., 2000). Tsc1 and Tsc2 are strongly expressed in the mouse cerebellum
(Gutmann et al., 2000). To investigate the contribution of cerebellar TSC1
to autistic-like behavior in a mouse model, Tsai et al. (2012) created con-
ditional mouse mutants with Tsc1 deleted only in PCs (Tsc1PC).
PC-specific loss of Tsc1 results not only in progressive ataxia but also causes
autistic-like behaviors including impaired social interaction, repetitive
behavior, and abnormal ultrasonic vocalizations. Interestingly, the Tsc1PC
heterozygote mice, which more accurately mimic the human genetic con-
dition, display no motor impairments but similar social deficits compared to
the homozygous Tsc1PC knockout mice, suggesting that motor deficits are
not responsible for the abnormal social behavior. On a cellular level, Tsc1-
deficient PCs exhibit abnormal spine density and reduced excitability. Fur-
thermore, progressive loss of PCs occurs in the homozygous mice, likely
causing the observed motor impairments. It will be important to determine
whether cerebellar output from the cerebellar nuclei is reduced and also
which connections to other brain structures are affected in the Tsc1PC-
deficient mice. This will give important insights into the cerebello-cortical
circuitry underlying the observed autism-related behaviors.
Similar findings were observed upon deletion of Tsc2, specifically in PCs.
Homo- and heterozygous Tsc2PC mutant mice display PC degeneration and
motor impairment (Reith et al., 2011). Furthermore, heterozygous Tsc2PC-
deficent mice show autistic-like behavior including increased repetitive
behavior and social deficits (Reith et al., 2013).
TSC1 and TSC2 are known to negatively regulate the mammalian target
of rapamycin (mTOR) signaling. Importantly, the pathological and behav-
ioral deficits in the Tsc1PC- and Tsc2PC-deficient mice are prevented upon
treatment of the mice with the mTOR inhibitor rapamycin (Reith et al.,
2011, 2013; Tsai et al., 2012), identifying the mTOR signaling pathway
as a key molecular mechanism in the cerebellum contributing to autistic-like
behavior.
12. CONCLUSIONS
There is ample evidence at multiple levels of inquiry that link differ-
ences in cerebellar structure and function to autism. From mouse models of
autism-related genes to human studies of cerebellar malformations, cerebel-
lar dysfunction is related to the core behaviors that comprise the autism spec-
trum. Vice versa, differences in cerebellar structure and function, and
behavioral evidence of cerebellar-type motor impairments, have been
clearly documented in autistic populations. Given the evidence presented
here, it seems unlikely that changes in cerebellar structure and function in
autism are a mere anatomical beacon of dysfunction elsewhere (Ziats &
Rennert, 2013). Instead, the cerebellum appears to be part of extensive neu-
ral networks that together govern the social, communication, and repeti-
tive/restrictive behaviors impaired in autism. Future research will
undoubtedly extend our current understanding of the link between the cer-
ebellum and autism. It will be important to further characterize the lobular
localization of cellular, molecular, and structural differences in the cerebel-
lum, their relevance to specific motor and nonmotor autistic symptoms, and
the effects of these differences on downstream cortical targets. As extensive
exome and whole genome sequencing studies of autistic patients are now
underway, these discoveries should be linked to specific human gene muta-
tions. This will give important insight into the specific molecular and neural
pathways that underlie distinct autistic traits. The generation of temporally
and spatially conditional mouse models will help to clarify which cell types
and autism symptoms are affected by specific human genetic mutations.
Ultimately, our increasing knowledge of the specific role of the cerebellum
in ASD should lead to better diagnosis and promising targets for more effec-
tive clinical interventions.
ACKNOWLEDGMENT
E. B. is a Royal Society Research Fellow. We thank Friederike Winter for critical reading of
the chapter.
REFERENCES
Albrecht, U., Sutcliffe, J. S., Cattanach, B. M., Beechey, C. V., Armstrong, D., Eichele, G.,
et al. (1997). Imprinted expression of the murine Angelman syndrome gene, Ube3a, in
hippocampal and Purkinje neurons. Nature Genetics, 17(1), 75–78.
Aldinger, K. A., Kogan, J., Kimonis, V., Fernandez, B., Horn, D., Klopocki, E., et al. (2013).
Cerebellar and posterior fossa malformations in patients with autism-associated chromo-
some 22q13 terminal deletion. American Journal of Medical Genetics A, 161A(1), 131–136.
Allen, G. (2005). The cerebellum in autism. Clinical Neuropsychiatry, 2(6), 321–337.
Allen, G., & Courchesne, E. (2003). Differential effects of developmental cerebellar abnor-
mality on cognitive and motor functions in the cerebellum: An fMRI study of autism.
American Journal of Psychiatry, 160(2), 262–273.
Amaral, D. G., Schumann, C. M., & Nordahl, C. W. (2008). Neuroanatomy of autism.
Trends in Neurosciences, 31(3), 137–145.
American Psychiatric Association (2013). Diagnostic and statistical manual of mental disorders
(DSM-5) (5th ed.). Washington, DC: American Psychiatric Association.
Backman, S. A., Stambolic, V., Suzuki, A., Haight, J., Elia, A., Pretorius, J., et al. (2001).
Deletion of Pten in mouse brain causes seizures, ataxia and defects in soma size resem-
bling Lhermitte-Duclos disease. Nature Genetics, 29(4), 396–403.
Bailey, A., Luthert, P., Dean, A., Harding, B., Janota, I., Montgomery, M., et al. (1998).
A clinicopathological study of autism. Brain, 121(5), 889–905.
Ballif, B. A., Arnaud, L., Arthur, W. T., Guris, D., Imamoto, A., & Cooper, J. A. (2004).
Activation of a Dab1/CrkL/C3G/Rap1 pathway in Reelin-stimulated neurons. Current
Biology, 14(7), 606–610.
Balsters, J. H., Cussans, E., Diedrichsen, J., Phillips, K. A., Preuss, T. M., Rilling, J. K., et al.
(2010). Evolution of the cerebellar cortex: The selective expansion of prefrontal-
projecting cerebellar lobules. NeuroImage, 49(3), 2045–2052.
Basu, S. N., Kollu, R., & Banerjee-Basu, S. (2009). AutDB: A gene reference resource for
autism research. Nucleic Acids Research, 37, D832–D836.
Baudouin, S. J., Gaudias, J., Gerharz, S., Hatstatt, L., Zhou, K., Punnakkal, P., et al. (2012).
Shared synaptic pathophysiology in syndromic and nonsyndromic rodent models of
autism. Science, 338(6103), 128–132.
Bauman, M. L., & Kemper, T. L. (2005). Neuroanatomic observations of the brain in autism:
A review and future directions. International Journal of Developmental Neuroscience, 23(2–3),
183–187.
Bauman, M. L., Kemper, T. L., & Arin, D. M. (1995). Pervasive neuroanatomic abnormal-
ities of the brain in three cases of Rett’s syndrome. Neurology, 45(8), 1581–1586.
Belichenko, N. P., Belichenko, P. V., Li, H. H., Mobley, W. C., & Francke, U. (2008).
Comparative study of brain morphology in Mecp2mutant mouse models of Rett syn-
drome. The Journal of Comparative Neurology, 508(1), 184–195.
Belmonte, M. K., Gomot, M., & Baron-Cohen, S. (2010). Visual attention in autism fam-
ilies: ‘Unaffected’ sibs share atypical frontal activation. Journal of Child Psychology and Psy-
chiatry, 51(3), 259–276.
Ben-Shachar, S., Chahrour, M., Thaller, C., Shaw, C. A., & Zoghbi, H. Y. (2009). Mouse
models of MeCP2 disorders share gene expression changes in the cerebellum and hypo-
thalamus. Human Molecular Genetics, 18(13), 2431–2442.
Berg, J. M., & Geschwind, D. H. (2012). Autism genetics: Searching for specificity and con-
vergence. Genome Biology, 13(7), 247.
Betancur, C. (2011). Etiological heterogeneity in autism spectrum disorders: More than 100
genetic and genomic disorders and still counting. Brain Research, 1380, 42–77.
Betancur, C., Sakurai, T., & Buxbaum, J. D. (2009). The emerging role of synaptic
cell-adhesion pathways in the pathogenesis of autism spectrum disorders. Trends in
Neurosciences, 32(7), 402–412.
Bhat, A. N., Galloway, J. C., & Landa, R. J. (2012). Relation between early motor delay and
later communication delay in infants at risk for autism. Infant Behavior and Development,
35(4), 838–846.
Böckers, T. M., Mameza, M. G., Kreutz, M. R., Bockmann, J., Weise, C., Buck, F., et al.
(2001). Synaptic scaffolding proteins in rat brain. The Journal of Biological Chemistry,
276(43), 40104–40112.
Boer, K., Troost, D., Jansen, F., Nellist, M., van den Ouweland, A. M. W., Geurts, J. J. G.,
et al. (2008). Clinicopathological and immunohistochemical findings in an autopsy case
of tuberous sclerosis complex. Neuropathology, 28(6), 577–590.
Bolduc, M. E., du Plessis, A. J., Sullivan, N., Guizard, N., Zhang, X., Robertson, R. L., et al.
(2012). Regional cerebellar volumes predict functional outcome in children with cere-
bellar malformations. Cerebellum, 11(2), 531–542.
Bolduc, M. E., Du Plessis, A. J., Sullivan, N., Khwaja, O. S., Zhang, X., Barnes, K., et al.
(2011). Spectrum of neurodevelopmental disabilities in children with cerebellar mal-
formations. Developmental Medicine and Child Neurology, 53(5), 409–416.
Bolduc, M. E., & Limperopoulos, C. (2009). Neurodevelopmental outcomes in children
with cerebellar malformations: A systematic review. Developmental Medicine and Child
Neurology, 51(4), 256–267.
Boukhtouche, F., Janmaat, S., Vodjdani, G., Gautheron, V., Mallet, J., Dusart, I., et al.
(2006). Retinoid-related orphan receptor alpha controls the early steps of Purkinje cell
dendritic differentiation. The Journal of Neuroscience, 26(5), 1531–1538.
Bozdagi, O., Sakurai, T., Papapetrou, D., Wang, X., Dickstein, D. L., Takahashi, N., et al.
(2010). Haploinsufficiency of the autism-associated Shank3 gene leads to deficits
in synaptic function, social interaction, and social communication. Molecular Autism,
1(1), 15.
Braunschweig, D., Ashwood, P., Krakowiak, P., Hertz-Picciotto, I., Hansen, R.,
Croen, L. A., et al. (2008). Autism: Maternally derived antibodies specific for fetal brain
proteins. Neurotoxicology, 29(2), 226–231.
Braunschweig, D., Duncanson, P., Boyce, R., Hansen, R., Ashwood, P., Pessah, I. N., et al.
(2012). Behavioral correlates of maternal antibody status among children with autism.
Journal of Autism and Developmental Disorders, 42(7), 1435–1445.
Braunschweig, D., & Van de Water, J. (2012). Maternal autoantibodies in autism. Archives of
Neurology, 69(6), 693–699.
Brielmaier, J., Matteson, P. G., Silverman, J. L., Senerth, J. M., Kelly, S., Genestine, M., et al.
(2012). Autism-relevant social abnormalities and cognitive deficits in engrailed-2 knock-
out mice. PLoS One, 7(7), e40914.
Buckner, R. L., Krienen, F. M., Castellanos, A., Diaz, J. C., & Yeo, B. T. (2011). The orga-
nization of the human cerebellum estimated by intrinsic functional connectivity. Journal
of Neurophysiology, 106(5), 2322–2345.
Caria, A., Venuti, P., & de Falco, S. (2011). Functional and dysfunctional brain circuits
underlying emotional processing of music in autism spectrum disorders. Cerebral Cortex,
21(12), 2838–2849.
Catani, M., Jones, D. K., Daly, E., Embiricos, N., Deeley, Q., Pugliese, L., et al. (2008).
Altered cerebellar feedback projections in Asperger syndrome. NeuroImage, 41,
1184–1191.
Cauda, F., Geda, E., Sacco, K., D’Agata, F., Duca, S., Geminiani, G., et al. (2011).
Grey matter abnormality in autism spectrum disorder: An activation likelihood estima-
tion meta-analysis study. Journal of Neurology, Neurosurgery, and Psychiatry, 82(12),
1304–1313.
Chang, C. H., Wade, M. G., Stoffregen, T. A., Hsu, C. Y., & Pan, C. Y. (2010). Visual tasks
and postural sway in children with and without autism spectrum disorders. Research in
Developmental Disabilities, 31(6), 1536–1542.
Cheh, M. A., Millonig, J. H., Roselli, L. M., Ming, X., Jacobsen, E., Kamdar, S., et al.
(2006). En2 knockout mice display neurobehavioral and neurochemical alterations rel-
evant to autism spectrum disorder. Brain Research, 1116(1), 166–176.
Chen, R. Z., Akbarian, S., Tudor, M., & Jaenisch, R. (2001). Deficiency of methyl-CpG
binding protein-2 in CNS neurons results in a Rett-like phenotype in mice. Nature
Genetics, 27(3), 327–331.
Cheron, G., Servais, L., Wagstaff, J., & Dan, B. (2005). Fast cerebellar oscillation asso-
ciated with ataxia in a mouse model of Angelman syndrome. Neuroscience, 130(3),
631–637.
Cheung, C., Chua, S. E., Cheung, V., Khong, P. L., Tai, K. S., Wong, T. K., et al. (2009).
White matter fractional anisotrophy differences and correlates of diagnostic symptoms in
autism. Journal of Child Psychology and Psychiatry, 50(9), 1102–1112.
Cisternas, F. A., Vincent, J. B., Scherer, S. W., & Ray, P. N. (2003). Cloning and charac-
terization of human CADPS and CADPS2, new members of the Ca2þ-dependent acti-
vator for secretion protein family. Genomics, 81(3), 279–291.
Corbett, B. A., Carmean, V., Ravizza, S., Wendelken, C., Henry, M. L., Carter, C., et al.
(2009). A functional and structural study of emotion and face processing in children with
autism. Psychiatry Research, 173(3), 196–205.
Cornish, K., Kogan, C., Turk, J., Manly, T., James, N., Mills, A., et al. (2005). The emerging
fragile X premutation phenotype: Evidence from the domain of social cognition. Brain
and Cognition, 57(1), 53–60.
Courchesne, E., Campbell, K., & Solso, S. (2011). Brain growth across the life span in autism:
Age-specific changes in anatomical pathology. Brain Research, 1380, 138–145.
Courchesne, E., Karns, C. M., Davis, H. R., Ziccardi, R., Carper, R. A., Tigue, Z. D., et al.
(2001). Unusual brain growth patterns in early life in patients with autistic disorder.
Neurology, 57(2), 245–254.
Courchesne, E., Webb, S. J., & Schumann, C. M. (2012). From toddlers to adults: The
changing landscape of the brain in autism. In D. Amaral, D. Geschwind, &
G. Dawson (Eds.), Autism spectrum disorders. Oxford: Oxford University Press.
Courchesne, E., Yeung-Courchesne, R., Hesselink, J. R., & Jernigan, T. L. (1988). Hypo-
plasia of cerebellar vermal lobules VI and VII in autism. The New England Journal of Med-
icine, 318(21), 1349–1354.
Critchley, H., Daly, E., Phillips, M., Brammer, M., Bullmore, E., Williams, S., et al. (2000).
Explicit and implicit neural mechanisms for processing of social information from facial
expressions: A functional magnetic resonance imaging study. Human Brain Mapping, 9(2),
93–105.
Croen, L. A., Braunschweig, D., Haapanen, L., Yoshida, C. K., Fireman, B., Grether, J. K.,
et al. (2008). Maternal mid-pregnancy autoantibodies to fetal brain protein: The early
markers for autism study. Biological Psychiatry, 64(7), 583–588.
Dalton, P., Deacon, R., Blamire, A., Pike, M., McKinlay, I., Stein, J., et al. (2003). Maternal
neuronal antibodies associated with autism and a language disorder. Annals of Neurology,
53(4), 533–537.
DeLorey, T. M., Handforth, A., Anagnostaras, S. G., Homanics, G. E., Minassian, B. A.,
Asatourian, A., et al. (1998). Mice lacking the beta3 subunit of the GABAA receptor
have the epilepsy phenotype and many of the behavioral characteristics of Angelman syn-
drome. The Journal of Neuroscience, 18(20), 8505–8514.
DeLorey, T. M., Sahbaie, P., Hashemi, E., Homanics, G. E., & Clark, J. D. (2008). Gabrb3
gene deficient mice exhibit impaired social and exploratory behaviors, deficits in non-
selective attention and hypoplasia of cerebellar vermal lobules: A potential model of
autism spectrum disorder. Behavioural Brain Research, 187(2), 207–220.
Devlin, B., & Scherer, S. W. (2012). Genetic architecture in autism spectrum disorder.
Current Opinion in Genetics and Development, 22(3), 229–237.
Diedrichsen, J., Balsters, J. H., Flavell, J., Cussans, E., & Ramnani, N. (2009). A probabilistic
MR atlas of the human cerebellum. Neuroimage, 46, 39–46.
Diedrichsen, J. (2006). A spatially unbiased atlas template of the human cerebellum.
Neuroimage, 33, 127–138.
Di Martino, A., Yan, C.-G., Li, Q., Denio, E., Castellanos, F. X., Alaerts, K., et al. (2013).
The autism brain imaging data exchange: Towards a large-scale evaluation of the intrinsic
brain architecture in autism. Molecular Psychiatry, http://dx.doi.org/10.1038/
mp.2013.78. (Epub ahead of Print).
Dindot, S. V., Antalffy, B. A., Bhattacharjee, M. B., & Beaudet, A. L. (2008). The Angelman
syndrome ubiquitin ligase localizes to the synapse and nucleus, and maternal deficiency
results in abnormal dendritic spine morphology. Human Molecular Genetics, 17(1),
111–118.
Duerden, E. G., Mak-Fan, K. M., Taylor, M. J., & Roberts, S. W. (2012). Regional differ-
ences in grey and white matter in children and adults with autism spectrum disorders: An
activation likelihood estimate (ALE) meta-analysis. Autism Research, 5(1), 49–66.
Dziuk, M. A., Gidley Larson, J. C., Apostu, A., Mahone, E. M., Denckla, M. B., &
Mostofsky, S. H. (2007). Dyspraxia in autism: Association with motor, social, and com-
municative deficits. Developmental Medicine and Child Neurology, 49(10), 734–739.
Ecker, C., Rocha-Rego, V., Johnston, P., Mourao-Miranda, J., Marquand, A., Daly, E. M.,
et al. (2010). Investigating the predictive value of whole-brain structural MR scans in
autism: A pattern classification approach. NeuroImage, 49(1), 44–56.
Egawa, K., Kitagawa, K., Inoue, K., Takayama, M., Takayama, C., Saitoh, S., et al. (2012).
Decreased tonic inhibition in cerebellar granule cells causes motor dysfunction in a
mouse model of Angelman Syndrome. Science Translational medicine, 4(163), 163ra157.
Ellegood, J., Pacey, L. K., Hampson, D. R., Lerch, J. P., & Henkelman, R. M. (2010). Ana-
tomical phenotyping in a mouse model of fragile X syndrome with magnetic resonance
imaging. NeuroImage, 53(3), 1023–1029.
Eluvathingal, T. J., Behen, M. E., Chugani, H. T., Janisse, J., Bernardi, B., Chakraborty, P.,
et al. (2006). Cerebellar lesions in tuberous sclerosis complex. Journal of Child Neurology,
21(10), 846–851.
Eppig, J. T., Blake, J. A., Bult, C. J., Kadin, J. A., Richardson, J. E., & Mouse Genome
Database Group (2012). The Mouse Genome Database (MGD): Comprehensive
resource for genetics and genomics of the laboratory mouse. Nucleic Acids Research,
40, D881–D886.
Esposito, G., Venuti, P., Apicella, F., & Muratori, F. (2011). Analysis of unsupported gait in
toddlers with autism. Brain and Development, 33(5), 367–373.
Fatemi, S. H., Aldinger, K. A., Ashwood, P., Bauman, M. L., Blaha, C. D., Blatt, G. J., et al.
(2012). Consensus paper: Pathological role of the cerebellum in autism. Cerebellum,
11(3), 777–807.
Fatemi, S. H., Halt, A. R., Realmuto, G., Earle, J., Kist, D. A., Thuras, P., et al. (2002).
Purkinje cell size is reduced in cerebellum of patients with autism. Cellular and Molecular
Neurobiology, 22(2), 171–175.
Fatemi, S. H., Reutiman, T. J., Folsom, T. D., & Thuras, P. D. (2008). GABAA receptor
downregulation in brains of subjects with autism. Journal of Autism and Developmental
Disorders, 39(2), 223–230.
Fatemi, S. H., Snow, A. V., Stary, J. M., Araghi-Niknam, M., Reutiman, T. J., Lee, S., et al.
(2005). Reelin signaling is impaired in autism. Biological Psychiatry, 57(7), 777–787.
Flanagan, J. E., Landa, R., Bhat, A., & Bauman, M. (2012). Head lag in infants at risk for
autism: A preliminary study. American Journal of Occupational Therapy, 66(5), 577–585.
Fournier, K. A., Hass, C. J., Naik, S. K., Lodha, N., & Cauraugh, J. H. (2010). Motor coor-
dination in autism spectrum disorders: A synthesis and meta-analysis. Journal of Autism and
Developmental Disorders, 40(10), 1227–1240.
Fournier, K. A., Kimberg, C. I., Radonovich, K. J., Tillman, M. D., Chow, J. W.,
Lewis, M. H., et al. (2010). Decreased static and dynamic postural control in children
with autism spectrum disorders. Gait and Posture, 32(1), 6–9.
Freitag, C. M., Kleser, C., Schneider, M., & von Gontard, A. (2007). Quantitative assessment
of neuromotor function in adolescents with high functioning autism and Asperger syn-
drome. Journal of Autism and Developmental Disorders, 37(5), 948–959.
Frith, U. (1991). Autism and Asperger syndrome. Cambridge: Cambridge University Press.
Fujita, E., Tanabe, Y., Shiota, A., Ueda, M., Suwa, K., Momoi, M. Y., et al. (2008). Ultra-
sonic vocalization impairment of Foxp2 (R552H) knockin mice related to speech-
language disorder and abnormality of Purkinje cells. Proceedings of the National Academy
of Sciences of the United States of America, 105(8), 3117–3122.
Furge, K. A., Zhang, Y. W., & Van de Woude, G. F. (2000). Met receptor tyrosine kinase:
Enhanced signaling through adapter proteins. Oncogene, 19(49), 5582–5589.
Gaffrey, M. S., Kleinhans, N. M., Haist, F., Akshoomoff, N., Campbell, A., Courchesne, E.,
et al. (2007). Atypical participation of visual cortex during word processing in autism: An
fMRI study of semantic decision. Neuropsychologia, 45(8), 1672–1684.
Gepner, B., & Mestre, D. (2002). Rapid visual-motion integration deficit in autism. Trends in
Cognitive Sciences, 6(11), 455.
Gernsbacher, M. A., Sauer, E. A., Geye, H. M., Schweigert, E. K., & Hill Goldsmith, H.
(2008). Infant and toddler oral- and manual-motor skills predict later speech fluency
in autism. Journal of Child Psychology and Psychiatry, 49(1), 43–50.
Gidley Larson, J. C., & Mostofsky, S. H. (2006). Motor deficits in autism. In R. Tuchman &
I. Rapin (Eds.), Autism: A neurological disorder of early brain development (pp. 231–247).
London: MacKeith Press.
Gilbert, S. J., Bird, G., Brindley, R., Frith, C. D., & Burgess, P. W. (2008). Atypical recruit-
ment of medial prefrontal cortex in autism spectrum disorders: An fMRI study of two
executive function tasks. Neuropsychologia, 46(9), 2281–2291.
Goffin, D., Allen, M., Zhang, L., Amorim, M., Wang, I.-T. J., Reyes, A.-R. S., et al. (2011).
Rett syndrome mutation MeCP2 T158A disrupts DNA binding, protein stability and
ERP responses. Nature Neuroscience, 15(2), 274–283.
Goines, P., Haapanen, L., Boyce, R., Duncanson, P., Braunschweig, D., Delwiche, L., et al.
(2011). Autoantibodies to cerebellum in children with autism associate with behavior.
Brain, Behavior, and Immunity, 25(3), 514–523.
Gold, D. A., Gent, P. M., & Hamilton, B. A. (2007). ROR alpha in genetic control of cer-
ebellum development: 50 staggering years. Brain Research, 1140, 19–25.
Gomot, M., Bernard, F. A., Davis, M. H., Belmonte, M. K., Ashwin, C., Bullmore, E. T.,
et al. (2006). Change detection in children with autism: An auditory event-related fMRI
study. NeuroImage, 29(2), 475–484.
Gowen, E., & Hamilton, A. (2013). Motor abilities in autism: a review using a computational
context. Journal of Autism and Developmental Disorders, 43, 323–344.
Greco, C. M., Navarro, C. S., Hunsaker, M. R., Maezawa, I., Shuler, J. F., Tassone, F., et al.
(2011). Neuropathologic features in the hippocampus and cerebellum of three older men
with fragile X syndrome. Molecular Autism, 2(1), 2.
Green, D., Baird, G., Barnett, A. L., Henderson, L., Huber, J., & Henderson, S. E. (2002).
The severity and nature of motor impairment in Asperger’s syndrome: A comparison
with specific developmental disorder of motor function. Journal of Child Psychology and
Psychiatry, 43(5), 655–668.
Green, D., Charman, T., Pickles, A., Chandler, S., Loucas, T., Simonoff, E., et al. (2009).
Impairment in movement skills of children with autistic spectrum disorders. Developmen-
tal Medicine and Child Neurology, 51(4), 311–316.
Greffou, S., Bertone, A., Hahler, E. M., Hanssens, J. M., Mottron, L., & Faubert, J. (2012).
Postural hypo-reactivity in autism is contingent on development and visual
environment: A fully immersive virtual reality study. Journal of Autism and Developmental
Disorders, 42(6), 961–970.
Groen, W. B., Tesink, C., Petersson, K. M., van Berkum, J., van der Gaag, R. J.,
Hagoort, P., et al. (2010). Semantic, factual, and social language comprehension in ado-
lescents with autism: An fMRI study. Cerebral Cortex, 20(8), 1937–1945.
Groszer, M., Keays, D. A., Deacon, R. M. J., de Bono, J. P., Prasad-Mulcare, S., Gaub, S.,
et al. (2008). Impaired synaptic plasticity and motor learning in mice with a point muta-
tion implicated in human speech deficits. Current Biology, 18(5), 354–362.
Gutmann, D. H., Zhang, Y., Hasbani, M. J., Goldberg, M. P., Plank, T. L., & Petri
Henske, E. (2000). Expression of the tuberous sclerosis complex gene products, hamartin
and tuberin, in central nervous system tissues. Acta Neuropathologica, 99(3), 223–230.
Guy, J., Hendrich, B., Holmes, M., Martin, J. E., & Bird, A. (2001). A mouse Mecp2-null
mutation causes neurological symptoms that mimic Rett syndrome. Nature Genetics,
27(3), 322–326.
Haist, F., Adamo, M., Westerfield, M., Courchesne, E., & Townsend, J. (2005). The func-
tional neuroanatomy of spatial attention in autism spectrum disorder. Developmental
Neuropsychology, 27(3), 425–458.
Hallahan, B., Daly, E. M., McAlonan, G., Loth, E., Toal, F., O’Brien, F., et al. (2009). Brain
morphometry volume in autistic spectrum disorder: A magnetic resonance imaging study
of adults. Psychological Medicine, 39(2), 337–346.
Hallett, M., Lebiedowska, M. K., Thomas, S. L., Stanhope, S. J., Denckla, M. B., &
Rumsey, J. (1993). Locomotion of autistic adults. Archives of Neurology, 50(12),
1304–1308.
Hallmayer, J., Cleveland, S., Torres, A., Phillips, J., Cohen, B., Torigoe, T., et al. (2011).
Genetic heritability and shared environmental factors among twin pairs with autism.
Archives of General Psychiatry, 68(11), 1095–1102.
Harris, G. J., Chabris, C. F., Clark, J., Urban, T., Aharon, I., Steele, S., et al. (2006). Brain
activation during semantic processing in autism spectrum disorders via functional mag-
netic resonance imaging. Brain and Cognition, 61(1), 54–68.
Heath, R. G. (1977). Modulation of emotion with a brain pacemamer. Treatment for intrac-
table psychiatric illness. Journal of Nervous and Mental Disease, 165(5), 300–317.
Heck, D. H., Zhao, Y., Roy, S., LeDoux, M. S., & Reiter, L. T. (2008). Analysis of cere-
bellar function in Ube3a-deficient mice reveals novel genotype-specific behaviors.
Human Molecular Genetics, 17(14), 2181–2189.
Herbert, M. R. (2010). Contributions of the environment and environmentally vulnerable
physiology to autism spectrum disorders. Current Opinion in Neurology, 23(2), 103–110.
Herculano-Houzel, S. (2010). Coordinated scaling of cortical and cerebellar numbers of neu-
rons. Frontiers in Neuroanatomy, 4, 12.
Hesling, I., Dilharreguy, B., Peppe, S., Amirault, M., Bouvard, M., & Allard, M. (2010). The
integration of prosodic speech in high functioning autism: A preliminary fMRI study.
PLoS One, 5(7), e11571.
Heuer, L., Braunschweig, D., Ashwood, P., Van de Water, J., & Campbell, D. B. (2011).
Association of a MET genetic variant with autism-associated maternal autoantibodies
to fetal brain proteins and cytokine expression. Translational Psychiatry, 1(10), e48.
Hilton, C. L., Zhang, Y., Whilte, M. R., Klohr, C. L., & Constantino, J. (2012). Motor
impairment in sibling pairs concordant and discordant for autism spectrum disorders.
Autism, 16(4), 430–441.
Hodge, S. M., Makris, N., Kennedy, D. N., Caviness, V. S., Jr., Howard, J., McGrath, L.,
et al. (2010). Cerebellum, language, and cognition in autism and specific language
impairment. Journal of Autism and Developmental Disorders, 40(3), 300–316.
Honda, S., Kagoshima, M., Wanaka, A., Tohyama, M., Matsumoto, K., & Nakamura, T.
(1995). Localization and functional coupling of HGF and c-Met/HGF receptor in rat
brain: Implication as neurotrophic factor. Brain Research Molecular Brain Research, 32(2),
197–210.
Hong, S. E., Shugart, Y. Y., Huang, D. T., Shahwan, S. A., Grant, P. E., Hourihane, J. O.,
et al. (2000). Autosomal recessive lissencephaly with cerebellar hypoplasia is associated
with human RELN mutations. Nature Genetics, 26(1), 93–96.
Ieraci, A., Forni, P. E., & Ponzetto, C. (2002). Viable hypomorphic signaling mutant of the
Met receptor reveals a role for hepatocyte growth factor in postnatal cerebellar develop-
ment. Proceedings of the National Academy of Sciences, 99(23), 15200–15205.
Ingram, J. L., Peckham, S. M., Tisdale, B., & Rodier, P. M. (2000). Prenatal exposure of rats
to valproic acid reproduces the cerebellar anomalies associated with autism. Neu-
rotoxicology and Teratology, 22(3), 319–324.
Jeste, S. S. (2011). The neurology of autism spectrum disorders. Current Opinion Neurology,
24(2), 132–139.
Jiang, Y., Armstrong, D., Albrecht, U., Atkins, C., Noebels, J., Eichele, G., et al. (1998).
Mutation of the angelman ubiquitin ligase in mice causes increased cytoplasmic p53
and deficits of contextual learning and long-term potentiation. Neuron, 21(4), 799–811.
Jiang, Y.-H., & Ehlers, M. D. (2013). Modeling autism by SHANK gene mutations in mice.
Neuron, 78(1), 8–27.
Jones, V., & Prior, M. (1985). Motor imitation abilities and neurological signs in autistic chil-
dren. Journal of Autism and Developmental Disorders, 15(1), 37–46.
Jordan, C., Li, H. H., Kwan, H. C., & Francke, U. (2007). Cerebellar gene expression pro-
files of mouse models for Rett syndrome reveal novel MeCP2 targets. BMC Medical
Genetics, 8(1), 36.
Kaufmann, W. E., Cooper, K. L., Mostofsky, S. H., Capone, G. T., Kates, W. R.,
Newschaffer, C. J., et al. (2003). Specificity of cerebellar vermian abnormalities in
autism: A quantitative magnetic resonance imaging study. Journal of Child Neurology,
18(7), 463–470.
Kemper, T. L., & Bauman, M. (1998). Neuropathology of infantile autism. Journal of
Neuropathology and Experimental Neurology, 57(7), 645–652.
Kleinhans, N. M., Schweinsburg, B. C., Cohen, D. N., Muller, R. A., & Courchesne, E.
(2007). N-acetyl aspartate in autism spectrum disorders: Regional effects and relationship
to fMRI activation. Brain Research, 1162, 85–97.
Knaus, T. A., Silver, A. M., Lindgren, K. A., Hadjikhani, N., & Tager-Flusberg, H. (2008).
FMRI activation during a language task in adolescents with ASD. Journal of the Interna-
tional Neuropsychological Society, 14(6), 967–979.
Koekkoek, S. K. E., Yamaguchi, K., Milojkovic, B. A., Dortland, B. R., Ruigrok, T. J. H.,
Maex, R., et al. (2005). Deletion of FMR1 in Purkinje cells enhances parallel fiber LTD,
enlarges spines, and attenuates cerebellar eyelid conditioning in fragile X syndrome. Neu-
ron, 47(3), 339–352.
Kuemerle, B., Zanjani, H., Joyner, A., & Herrup, K. (1997). Pattern deformities and cell loss
in Engrailed-2 mutant mice suggest two separate patterning events during cerebellar
development. The Journal of Neuroscience, 17(20), 7881–7889.
Kwon, C.-H., Zhu, X., Zhang, J., Knoop, L. L., Tharp, R., Smeyne, R. J., et al. (2001).
Pten regulates neuronal soma size: A mouse model of Lhermitte-Duclos disease. Nature
Genetics, 29(4), 404–411.
Landa, R., & Garrett-Mayer, E. (2006). Development in infants with autism spectrum dis-
orders: A prospective study. Journal of Child Psychology and Psychiatry, 47(6), 629–638.
Laurie, D. J., Wisden, W., & Seeburg, P. H. (1992). The distribution of thirteen GABAA
receptor subunit mRNAs in the rat brain. III. Embryonic and postnatal development.
The Journal of Neuroscience, 12(11), 4151–4172.
Limperopoulos, C., Bassan, H., Gauvreau, K., Jr., Robertson, R. L., Sullivan, N. R.,
Benson, C. B., et al. (2007). Does cerebellar injury in premature infants contribute to
the high prevalence of long-term cognitive, learning, and behavioral disability in survi-
vors? Pediatrics, 120, 584–593.
Limperopoulos, C., Bassan, H., Sullivan, N. R., Soul, J. S., Robertson, R. L., Jr., Moore, M.,
et al. (2008). Positive screening for autism in ex-preterm infants: Prevalence and risk fac-
tors. Pediatrics, 121(4), 758–765.
Limperopoulos, C., Chilingaryan, G., Guizard, N., Robertson, R. L., & Du Plessis, A. J.
(2010). Cerebellar injury in the premature infant is associated with impaired growth
of specific cerebral regions. Pediatric Research, 68(2), 145–150.
Linkenauger, S. A., Lerner, M. D., Ramenzoni, V. C., & Proffitt, D. R. (2012). A perceptual-
motor deficit predicts social and communicative impairments in individuals with autism
spectrum disorders. Autism Research, 5(5), 352–362.
MacNeil, L. K., & Mostofsky, S. H. (2012). Specificity of dyspraxia in children with autism.
Neuropsychology, 26(2), 165–171.
Mariani, J., Crepel, F., Mikoshiba, K., Changeux, J. P., & Sotelo, C. (1977). Anatomical,
physiological and biochemical studies of the cerebellum from Reeler mutant mouse.
Philosophical Transactions of the Royal Society B: Biological Sciences, 281(978), 1–28.
Marino, S., Krimpenfort, P., Leung, C., van der Korput, H. A. G. M., Trapman, J.,
Camenisch, I., et al. (2002). PTEN is essential for cell migration but not for fate
determination and tumourigenesis in the cerebellum. Development, 129(14), 3513–3522.
Millen, K. J., Wurst, W., Herrup, K., & Joyner, A. L. (1994). Abnormal embryonic cerebellar
development and patterning of postnatal foliation in two mouse Engrailed-2 mutants.
Development, 120, 695–706.
Minshew, N. J., Sung, K., Jones, B. L., & Furman, J. M. (2004). Underdevelopment of the
postural control system in autism. Neurology, 63(11), 2056–2061.
Miura, K., Kishino, T., Li, E., Webber, H., Dikkes, P., Holmes, G. L., et al. (2002). Neu-
robehavioral and electroencephalographic abnormalities in Ube3a maternal-deficient
mice. Neurobiology of Disease, 9(2), 149–159.
Molloy, C. A., Dietrich, K. N., & Bhattacharya, A. (2003). Postural stability in children
with autism spectrum disorder. Journal of Autism and Developmental Disorders, 33(6),
643–652.
Moran, M. F., Foley, J. T., Parker, M. E., & Weiss, M. J. (2013). Two-legged hopping in
autism spectrum disorders. Frontiers in Integrative Neuroscience, 7, 14.
Mosconi, M. W., Kay, M., D’Cruz, A. M., Guter, S., Kapur, K., Macmillan, C., et al. (2010).
Neurobehavioral abnormalities in first-degree relatives of individuals with autism.
Mosconi, M. W., Luna, B., Kay-Stacey, M., Nowinski, C. V., Rubin, L. H., Scudder, C.,
et al. (2013). Saccade adaptation abnormalities implicate dysfunction of cerebellar-
dependent learning mechanisms in autism spectrum disorders (ASD). PLoS One, 8(5),
e63709.
Mostofsky, S. H., Goldberg, M. C., Landa, R. J., & Denckla, M. B. (2000). Evidence for a
deficit in procedural learning in children and adolescents with autism: Implications for
cerebellar contribution. Journal of the International Neuropsychological Society, 6(7),
752–759.
Mostofsky, S. H., Mazzocco, M. M., Aakalu, G., Warsofsky, I. S., Denckla, M. B., &
Reiss, A. L. (1998). Decreased cerebellar posterior vermis size in fragile X syndrome:
Correlation with neurocognitive performance. Neurology, 50(1), 121–130.
Mostofsky, S. H., Powell, S. K., Simmonds, D. J., Goldberg, M. C., Caffo, B., & Pekar, J. J.
(2009). Decreased connectivity and cerebellar activity in autism during motor task per-
formance. Brain, 132(Pt. 9), 2413–2425.
Mullaney, B. C., Johnston, M. V., & Blue, M. E. (2004). Developmental expression of
methyl-CpG binding protein 2 is dynamically regulated in the rodent brain. Neuroscience,
123(4), 939–949.
Muller, R. A., Kleinhans, N., Kemmotsu, N., Pierce, K., & Courchesne, E. (2003). Abnor-
mal variability and distribution of functional maps in autism: An fMRI study of
visuomotor learning. American Journal of Psychiatry, 160(10), 1847–1862.
Murakami, J. W., Courchesne, E., Haas, R. H., Press, G. A., & Yeung-Courchesne, R.
(1992). Cerebellar and cerebral abnormalities in Rett syndrome: A quantitative MR
analysis. American Journal of Roentgenology, 159(1), 177–183.
Murakami, J. W., Courchesne, E., Press, G. A., Yeung-Courchesne, R., & Hesselink, J. R.
(1989). Reduced cerebellar hemisphere size and its relationship to vermal hypoplasia in
autism. Archives of Neurology, 46(6), 689–694.
Mychasiuk, R., Richards, S., Nakahashi, A., Kolb, B., & Gibb, R. (2012). Effects of rat pre-
natal exposure to valproic acid on behaviour and neuro-anatomy. Developmental Neuro-
science, 34(2–3), 268–276.
Nickl-Jockschat, T., Habel, U., Michel, T. M., Manning, J., Laird, A. R., Fox, P. T., et al.
(2012). Brain structure anomalies in autism spectrum disorder—A meta-analysis of VBM
studies using anatomic likelihood estimation. Human Brain Mapping, 33(6), 1470–1489.
Noterdaeme, M., Mildenberger, K., Minow, F., & Amorosa, H. (2002). Evaluation of
neuromotor deficits in children with autism and children with a specific speech and lan-
guage disorder. European Child and Adolescent Psychiatry, 11(5), 219–225.
Oldfors, A., Sourander, P., Armstrong, D. L., Percy, A. K., Witt-Engerström, I., &
Hagberg, B. A. (1990). Rett syndrome: Cerebellar pathology. Pediatric Neurology,
6(5), 310–314.
Ozonoff, S., Williams, B. J., Gale, S., & Miller, J. N. (1999). Autism and autistic behavior in
Joubert syndrome. Journal of Child Neurology, 14(10), 636–641.
Paakki, J. J., Rahko, J., Long, X., Moilanen, I., Tervonen, O., Nikkinen, J., et al. (2010).
Alterations in regional homogeneity of resting-state brain activity in autism spectrum dis-
orders. Brain Research, 1321, 169–179.
Palmen, S. J. M. C. (2004). Neuropathological findings in autism. Brain, 127(12),
2572–2583.
Papadopoulos, N., McGinley, J., Tonge, B., Bradshaw, J., Saunders, K., Murphy, A., et al.
(2012). Motor proficiency and emotional/behavioural disturbance in autism and
Asperger’s disorder: Another piece of the neurological puzzle? Autism, 16(6), 627–640.
Park, T. J., & Curran, T. (2008). Crk and Crk-like play essential overlapping roles down-
stream of disabled-1 in the reelin pathway. Journal of Neuroscience, 28(50), 13551–13562.
Peça, J., Feliciano, C., Ting, J. T., Wang, W., Wells, M. F., Venkatraman, T. N., et al.
(2011). Shank3 mutant mice display autistic-like behaviours and striatal dysfunction.
Nature, 472(7344), 437–442.
Peça, J., & Feng, G. (2012). Cellular and synaptic network defects in autism. Current Opinion
in Neurobiology, 22(5), 866–872.
Pierce, K., & Courchesne, E. (2001). Evidence for a cerebellar role in reduced exploration
and stereotyped behavior in autism. Biological Psychiatry, 49(8), 655–664.
Pitskel, N. B., Bolling, D. Z., Hudac, C. M., Lantz, S. D., Minshew, N. J., Vander
Wyk, B. C., et al. (2011). Brain mechanisms for processing direct and averted gaze in
individuals with autism. Journal of Autism and Developmental Disorders, 41(12), 1686–1693.
Radonovich, K. J., Fournier, K. A., & Hass, C. J. (2013). Relationship between postural
control and restricted, repetitive behaviors in autism spectrum disorders. Frontiers in
Integrative Neuroscience, 7, 28.
Radyushkin, K., Hammerschmidt, K., Boretius, S., Varoqueaux, F., El-Kordi, A.,
Ronnenberg, A., et al. (2009). Neuroligin-3-deficient mice: Model of a monogenic
heritable form of autism with an olfactory deficit. Genes, Brain, and Behavior, 8(4),
416–425.
Reith, R. M., McKenna, J., Wu, H., Hashmi, S. S., Cho, S.-H., Dash, P. K., et al. (2013).
Loss of Tsc2 in Purkinje cells is associated with autistic-like behavior in a mouse model of
tuberous sclerosis complex. Neurobiology of Disease, 51, 93–103.
Reith, R. M., Way, S., McKenna, J., III., Haines, K., & Gambello, M. J. (2011). Loss
of the tuberous sclerosis complex protein tuberin causes Purkinje cell degeneration.
Neurobiology of Disease, 43(1), 113–122.
Reynolds, S., Millette, A., & Devine, P. D. (2012). Sensory and motor characterization in the
postnatal valproate rat model of autism. Developmental Neuroscience, 34(2–3), 258–267.
Rice, D. S., & Curran, T. (2001). Role of the reelin signaling pathway in central nervous
system development. Annual Review of Neuroscience, 24, 1005–1039.
Rinehart, N. J., Bellgrove, M. A., Tonge, B. J., Brereton, A. V., Howells-Rankin, D., &
Bradshaw, J. L. (2006). An examination of movement kinematics in young people with
high-functioning autism and Asperger’s disorder: Further evidence for a motor planning
deficit. Journal of Autism and Developmental Disorders, 36(6), 757–767.
Rinehart, N. J., Tonge, B. J., Iansek, R., McGinley, J., Brereton, A. V., Enticott, P. G., et al.
(2006). Gait function in newly diagnosed children with autism: Cerebellar and basal
ganglia related motor disorder. Developmental Medicine and Child Neurology, 48(10),
819–824.
Riva, D., Annunziata, S., Contarino, V., Erbetta, A., Aquino, D., & Bulgheroni, S. (2013).
Gray matter reduction in the VERMIS and CRUS-II is associated with social and inter-
action deficits in low-functioning children with autistic spectrum disorders: A VBM-
DARTEL study. Cerebellum, 12(5), 676–685.
Riva, D., & Giorgi, C. (2000). The cerebellum contributes to higher functions during devel-
opment: Evidence from a series of children surgically treated for posterior fossa tumours.
Brain, 123(Pt. 5), 1051–1061.
Rodier, P. M. (1996). Animal model of autism based on developmental data. Mental Retar-
dation and Developmental Disabilities Research Reviews, 2(4), 249–256.
Rogers, T. D., Dickson, P. E., McKimm, E., Heck, D. H., Goldowitz, D., Blaha, C. D.,
et al. (2013). Reorganization of circuits underlying cerebellar modulation of prefrontal
cortical dopamine in mouse models of autism spectrum disorder. Cerebellum, 12(4),
547–556.
Rogers, S. J., Hepburn, S. L., Stackhouse, T., & Wehner, E. (2003). Imitation performance
in toddlers with autism and those with other developmental disorders. Journal of Child
Psychology and Psychiatry, 44(5), 763–781.
Rogers, T. D., McKimm, E., Dickson, P. E., Goldowitz, D., Blaha, C. D., & Mittleman, G.
(2013). Is autism a disease of the cerebellum? An integration of clinical and pre-clinical
research. Frontiers in Systems Neuroscience, 7, 15.
Rojas, D. C., Peterson, E., Winterrowd, E., Reite, M. L., Rogers, S. J., & Tregellas, J. R.
(2006). Regional gray matter volumetric changes in autism associated with social and
repetitive behavior symptoms. BMC Psychiatry, 6, 56.
Roullet, F. I., Wollaston, L., deCatanzaro, D., & Foster, J. A. (2010). Behavioral and molec-
ular changes in the mouse in response to prenatal exposure to the anti-epileptic drug
valproic acid. Neuroscience, 170(2), 514–522.
Roy, S., Zhao, Y., Allensworth, M., Farook, M. F., LeDoux, M. S., Reiter, L. T., et al.
(2011). Comprehensive motor testing in Fmr1-KO mice exposes temporal defects in
oromotor coordination. Behavioral Neuroscience, 125(6), 962–969.
Sabaratnam, M. (2000). Pathological and neuropathological findings in two males with
fragile-X syndrome. Journal of Intellectual Disability Research, 44, 81–85.
Sadakata, T. (2004). The secretory granule-associated protein CAPS2 regulates neurotrophin
release and cell survival. Journal of Neuroscience, 24(1), 43–52.
Sadakata, T., Kakegawa, W., Mizoguchi, A., Washida, M., Katoh-Semba, R.,
Shutoh, F., et al. (2007). Impaired cerebellar development and function in mice
lacking CAPS2, a protein involved in neurotrophin release. Journal of Neuroscience,

27(10), 2472–2482.
Sadakata, T., Washida, M., Iwayama, Y., Shoji, S., Sato, Y., Ohkura, T., et al. (2007).
Autistic-like phenotypes in Cadps2-knockout mice and aberrant CADPS2 splicing in
autistic patients. The Journal of Clinical Investigation, 117(4), 931–943.
Schmahmann, J. D., & Sherman, J. C. (1998). The cerebellar cognitive affective syndrome.
Brain, 121(Pt. 4), 561–579.
Schmahmann, J. D., Weilburg, J. B., & Sherman, J. C. (2007). The neuropsychiatry of the
cerebellum—Insights from the clinic. Cerebellum, 6(3), 254–267.
Schneider, T., & Przewłocki, R. (2004). Behavioral alterations in rats prenatally exposed to
valproic acid: Animal model of autism. Neuropsychopharmacology, 30(1), 80–89.
Schulte-Ruther, M., Greimel, E., Markowitsch, H. J., Kamp-Becker, I., Remschmidt, H.,
Fink, G. R., et al. (2011). Dysfunctions in brain networks supporting empathy: An fMRI
study in adults with autism spectrum disorders. Social Neuroscience, 6(1), 1–21.
Sears, L. L., Finn, P. R., & Steinmetz, J. E. (1994). Abnormal classical eye-blink conditioning
in autism. Journal of Autism and Developmental Disorders, 24(6), 737–751.
Shafritz, K. M., Dichter, G. S., Baranek, G. T., & Belger, A. (2008). The neural circuitry
mediating shifts in behavioral response and cognitive set in autism. Biological Psychiatry,
63(10), 974–980.
Shu, W. (2005). Altered ultrasonic vocalization in mice with a disruption in the Foxp2 gene.
Proceedings of the National Academy of Sciences of the United States of America, 102(27),
9643–9648.
Sidman, R. L., Lane, P. W., & Dickie, M. M. (1962). Staggerer, a new mutation in the mouse
affecting the cerebellum. Science, 137, 610–612.
Silani, G., Bird, G., Brindley, R., Singer, T., Frith, C., & Frith, U. (2008). Levels of emo-
tional awareness and autism: An fMRI study. Social Neuroscience, 3(2), 97–112.
Singer, H. S., Morris, C. M., Gause, C. D., Gillin, P. K., Crawford, S., &
Zimmerman, A. W. (2008). Antibodies against fetal brain in sera of mothers with autistic
children. Journal of Neuroimmunology, 194(1–2), 165–172.
Sivaswamy, L., Kumar, A., Rajan, D., Behen, M., Muzik, O., Chugani, D., et al. (2010).
A diffusion tensor imaging study of the cerebellar pathways in children with autism spec-
trum disorder. Journal of Child Neurology, 25(10), 1223–1231.
Solomon, M., Ozonoff, S. J., Ursu, S., Ravizza, S., Cummings, N., Ly, S., et al. (2009). The
neural substrates of cognitive control deficits in autism spectrum disorders.
Neuropsychologia, 47(12), 2515–2526.
Speidel, D., Varoqueaux, F., Enk, C., Nojiri, M., Grishanin, R. N., Martin, T. F. J., et al.
(2003). A family of Ca2þ-dependent activator proteins for secretion. The Journal of
Biological Chemistry, 278, 52802–52809.
Stanfield, A. C., McIntosh, A. M., Spencer, M. D., Philip, R., Gaur, S., & Lawrie, S. M.
(2008). Towards a neuroanatomy of autism: A systematic review and meta-analysis of
structural magnetic resonance imaging studies. European Psychiatry, 23(4), 289–299.
Steinmetz, J. E., Tracy, J. A., & Green, J. T. (2001). Classical eyeblink conditioning: Clinical
models and applications. Integrative Physiological and Behavioral Science, 36(3), 220–238.
Stieglitz Ham, H., Bartolo, A., Corley, M., Rajendran, G., Szabo, A., & Swanson, S. (2011).
Exploring the relationship between gestural recognition and imitation: Evidence of
dyspraxia in autism spectrum disorders. Journal of Autism and Developmental Disorders,
41(1), 1–12.
Stoodley, C. J. (2012). The cerebellum and cognition: Evidence from functional imaging
studies. Cerebellum, 11(2), 352–365.
Stoodley, C. J., MacMore, J., Makris, N., Sherman, J. C., & Schmahmann, J. D. (2012). Pre-
liminary voxel-based lesion-symptom mapping in cerebellar stroke patients: Motor vs.
cognitive outcomes. In: Paper presented at the Society for Neuroscience Annual Meeting,
New Orleans, LA.
Stoodley, C. J., & Schmahmann, J. D. (2009). Functional topography in the human cerebel-
lum: A meta-analysis of neuroimaging studies. NeuroImage, 44(2), 489–501.
Stoodley, C. J., & Schmahmann, J. D. (2010). Evidence for topographic organization in the cer-
ebellum of motor control versus cognitive and affective processing. Cortex, 46(7), 831–844.
Sweet, H. O., Bronson, R. T., Johnson, K. R., Cook, S. A., & Davisson, M. T. (1996).
Scrambler, a new neurological mutation of the mouse with abnormalities of neuronal
migration. Mammalian Genome, 7(11), 798–802.
Tabuchi, K., Blundell, J., Etherton, M. R., Hammer, R. E., Liu, X., Powell, C. M., et al.
(2007). A neuroligin-3 mutation implicated in autism increases inhibitory synaptic trans-
mission in mice. Science, 318(5847), 71–76.
Takarae, Y., Minshew, N. J., Luna, B., Krisky, C. M., & Sweeney, J. A. (2004). Pursuit eye
movement deficits in autism. Brain, 127(Pt. 12), 2584–2594.
Takarae, Y., Minshew, N. J., Luna, B., & Sweeney, J. A. (2004). Oculomotor abnormal-
ities parallel cerebellar histopathology in autism. Journal of Neurology, Neurosurgery, and
Psychiatry, 75(9), 1359–1361.
Takarae, Y., Minshew, N. J., Luna, B., & Sweeney, J. A. (2007). Atypical involvement of
frontostriatal systems during sensorimotor control in autism. Psychiatry Research,
156(2), 117–127.
Tavano, A., Grasso, R., Gagliardi, C., Triulzi, F., Bresolin, N., Fabbro, F., et al. (2007). Dis-
orders of cognitive and affective development in cerebellar malformations. Brain, 130,
2646–2660.
Teitelbaum, P., Teitelbaum, O., Nye, J., Fryman, J., & Maurer, R. G. (1998). Movement
analysis in infancy may be useful for early diagnosis of autism. Proceedings of the National
Academy of Sciences of the United States of America, 95(23), 13982–13987.
Tesink, C. M., Buitelaar, J. K., Petersson, K. M., van der Gaag, R. J., Teunisse, J. P., &
Hagoort, P. (2011). Neural correlates of language comprehension in autism spectrum
disorders: When language conflicts with world knowledge. Neuropsychologia, 49(5),
1095–1104.
Tobia, M. J., & Woodruff-Pak, D. S. (2009). Delay eyeblink classical conditioning is
impaired in Fragile X syndrome. Behavioral Neuroscience, 123(3), 665–676.
Travers, B. G., Adluru, N., Ennis, C., Tromp do, P. M., Destiche, D., Doran, S., et al.
(2012). Diffusion tensor imaging in autism spectrum disorder: A review. Autism Research,
5(5), 289–313.
Tsai, P. T., Hull, C., Chu, Y., Greene-Colozzi, E., Sadowski, A. R., Leech, J. M., et al.
(2012). Autistic-like behaviour and cerebellar dysfunction in Purkinje cell Tsc1 mutant
mice. Nature, 488(7413), 647–651.
Vaughn, J., Hagiwara, M., Katz, J., Roth, J., Devinsky, O., Weiner, H., et al. (2013). MRI
characterization and longitudinal study of focal cerebellar lesions in a young tuberous
sclerosis cohort. American Journal of Neuroradiology, 34(3), 655–659.
Villalobos, M. E., Mizuno, A., Dahl, B. C., Kemmotsu, N., & Muller, R. A. (2005).
Reduced functional connectivity between V1 and inferior frontal cortex associated with
visuomotor performance in autism. NeuroImage, 25(3), 916–925.
Vollm, B. A., Taylor, A. N., Richardson, P., Corcoran, R., Stirling, J., McKie, S., et al.
(2006). Neuronal correlates of theory of mind and empathy: A functional magnetic res-
onance imaging study in a nonverbal task. NeuroImage, 29(1), 90–98.
Wagner, G. C., Reuhl, K. R., Cheh, M., McRae, P., & Halladay, A. K. (2006). A new neu-
robehavioral model of autism in mice: Pre- and postnatal exposure to sodium valproate.
Wang, A. T., Lee, S. S., Sigman, M., & Dapretto, M. (2007). Reading affect in the face and
voice: Neural correlates of interpreting communicative intent in children and adoles-
cents with autism spectrum disorders. Archives of General Psychiatry, 64(6), 698–708.
Webb, S. J., Sparks, B. F., Friedman, S. D., Shaw, D. W., Giedd, J., Dawson, G., et al. (2009).
Cerebellar vermal volumes and behavioral correlates in children with autism spectrum
disorder. Psychiatry Research, 172(1), 61–67.
Weber, A. M., Egelhoff, J. C., McKellop, J. M., & Franz, D. N. (2000). Autism and the cer-
ebellum: Evidence from tuberous sclerosis. Journal of Autism and Developmental Disorders,
30(6), 511–517.
Wegiel, J., Kuchna, I., Nowicki, K., Imaki, H., Wegiel, J., Marchi, E., et al. (2010). The
neuropathology of autism: Defects of neurogenesis and neuronal migration, and dysplas-
tic changes. Neuropsychology Review, 119(6), 755–770.
Weisenfeld, N. I., Peters, J. M., Tsai, P. T., Prabhu, S. P., Dies, K. A., Sahin, M., et al. (2013).
A magnetic resonance imaging study of cerebellar volume in tuberous sclerosis complex.
Pediatric Neurology, 48(2), 105–110.
Whitney, E. R., Kemper, T. L., Bauman, M. L., Rosene, D. L., & Blatt, G. J. (2008). Cer-
ebellar Purkinje cells are reduced in a subpopulation of autistic brains: A stereological
experiment using calbindin-D28k. Cerebellum, 7(3), 406–416.
Whitney, E. R., Kemper, T. L., Rosene, D. L., Bauman, M. L., & Blatt, G. J. (2009). Density
of cerebellar basket and stellate cells in autism: Evidence for a late developmental loss of
Purkinje cells. Journal of Neuroscience Research, 87(10), 2245–2254.
Whyatt, C. P., & Craig, C. M. (2012). Motor skills in children aged 7-10 years, diagnosed
1799–1809.
Wills, S., Cabanlit, M., Bennett, J., Ashwood, P., Amaral, D. G., & Van de Water, J. (2009).
Detection of autoantibodies to neural cells of the cerebellum in the plasma of subjects
with autism spectrum disorders. Brain, Behavior, and Immunity, 23(1), 64–74.
Xu, L.-M., Li, J.-R., Huang, Y., Zhao, M., Tang, X., & Wei, L. (2012). AutismKB: An
evidence-based knowledgebase of autism genetics. Nucleic Acids Research, 40,
D1016–D1022.
Yang, M., Bozdagi, O., Scattoni, M. L., Wöhr, M., Roullet, F. I., Katz, A. M., et al. (2011).
Reduced excitatory neurotransmission and mild autism-relevant phenotypes in adoles-
cent Shank3 null mutant mice. The Journal of Neuroscience, 32(19), 6525–6541.
Yochum, C. L., Dowling, P., Reuhl, K. R., Wagner, G. C., & Ming, X. (2008). VPA-
induced apoptosis and behavioral deficits in neonatal mice. Brain Research, 1203,
126–132.
Yu, K. K., Cheung, C., Chua, S. E., & McAlonan, G. M. (2011). Can Asperger syndrome be
distinguished from autism? An anatomic likelihood meta-analysis of MRI studies. Journal
of Psychiatry and Neuroscience, 36(6), 412–421.
Ziats, M. N., & Rennert, O. M. (2013). The cerebellum in autism: Pathogenic or an ana-
tomical beacon? Cerebellum, 12(5), 776–777.
Zimmerman, A. W., Connors, S. L., Matteson, K. J., Lee, L.-C., Singer, H. S.,
Castaneda, J. A., et al. (2007). Maternal antibrain antibodies in autism. Brain, Behavior,
and Immunity, 21(3), 351–357.
Zwaigenbaum, L., Bryson, S., & Garon, N. (2013). Early identification of autism spectrum
disorders. Behavioural Brain Research, 251, 133–146.
CHAPTER TWO
Contribution of Long Noncoding

RNAs to Autism Spectrum
Disorder Risk
Brent Wilkinson*,†, Daniel B. Campbell†,{,1
*Program in Biological and Biomedical Sciences, University of Southern California, Los Angeles,
California, USA
†
Zilkha Neurogenetic Institute, University of Southern California, Los Angeles, California, USA
{
Department of Psychiatry and the Behavioral Sciences, University of Southern California, Los Angeles,
California, USA
1
Corresponding author: e-mail address: dbcampbe@med.usc.edu
Contents
1. Small ncRNA 36
2. Long ncRNA 38
3. LncRNA in Fundamental Genetic Mechanisms 38
4. LncRNAs in Cancer 40
5. LncRNAs in the Brain 41
5.1 Brain development and function 41
5.2 Neurodegenerative diseases 44
5.3 Neurodevelopmental disorders 45
6. LncRNAs Contribute to ASD 47
7. Conclusions 48
References 49
Abstract
Accumulating evidence indicates that long noncoding RNAs (lncRNAs) contribute to
autism spectrum disorder (ASD) risk. Although a few lncRNAs have long been recog-
nized to have important functions, the vast majority of this class of molecules remains
uncharacterized. Because lncRNAs are more abundant in human brain than protein-
coding RNAs, it is likely that they contribute to brain disorders, including ASD. We review
here the known functions of lncRNAs and the potential contributions of lncRNAs to ASD.
Projects aiming to characterize all of the functional elements in the mamma-

lian genome such as ENCODE (Djebali et al., 2012) and FANTOM3
(Carninci et al., 2005) have made significant strides in our understanding
of the complexity of transcriptional regulation. It is now clear that while less

http://dx.doi.org/10.1016/B978-0-12-418700-9.00002-2
36 Brent Wilkinson and Daniel B. Campbell
than 2% of the mammalian genome codes for proteins, a majority of what

used to be thought of as “junk DNA” actually undergoes transcription and
produces noncoding RNAs (ncRNAs) (Bertone et al., 2004; Birney et al.,
2007; Carninci et al., 2005, 2006; Cheng et al., 2005; Core, Waterfall, & Lis,
2008; Djebali et al., 2012; Kapranov et al., 2007; Lander et al., 2001; Seila
et al., 2008). Emergence of the functional characteristics of ncRNA has
shown that these regulatory RNAs play several critical roles in modulating
gene expression and influence the developmental complexity of higher spe-
cies. Considering the proportion of ncRNA relative to total genome size,
there is a significant correlation between increased ncRNA in a species with
developmental complexity (Taft, Pheasant, & Mattick, 2007). Because of
this role, it can be inferred that ncRNA will take part in many critical func-
tions in the most complex organ of the body, the brain.
NcRNA can be broadly categorized into two classes based on their size:
short ncRNAs (<200 nucleotides in length) and long ncRNA (>200 nucle-
otides in length) (Kapranov et al., 2007), both of which contain a number of
diverse subclasses with their own distinct properties. Currently, relatively
few ncRNAs have been functionally characterized compared to the large
amount shown to undergo transcription. But for those that have, it is clear
that many are integral to the processes of development and maintenance of
an organism. Being essential components of regulatory networks within our
cells also means that when they become aberrant, they can influence disease.
Indeed, ncRNAs have been implicated in a number of conditions including
cancer, HIV, heart disease, and neurological disorders. This highlights the
critical importance of characterizing ncRNAs which may provide a pathway
to discover routes of pathogenesis that are currently unknown and improve
on those that are.
Here, we outline the current progress of characterizing ncRNAs and
their relationship to several neurological disorders. Specifically, we show
that a number of ncRNAs have been identified in autism spectrum disorder
(ASD) and associated neurodevelopmental disorders, may play critical roles
in these, and may serve as potential therapeutic targets.
1. SMALL ncRNA
The classification, small ncRNA, encompasses a wide variety of sub-
classes including microRNAs (miRNAs), short interfering RNAs
(siRNAs), small nucleolar RNAs (snoRNAs), and PIWI-interacting RNAs
(piRNAs). These can be derived from a variety of sources within the
LncRNAs in Autism 37
genome (review in Mattick & Makunin, 2005) and it has been suggested that
one potential source is also from the processing of long noncoding RNAs
(lncRNAs) (Jalali, Jayaraj, & Scaria, 2012; Keniry et al., 2012). In general,
one of the most prominent forms of genetic regulation carried out by small
ncRNAs is by binding to their specific target transcripts via complementary
nucleotide sequences and subsequently influencing the translation of the tar-
get through a diverse set of downstream events. For an in-depth explanation
of small ncRNA, including subclasses, biogenesis, and forms of genetic reg-
ulation, we refer the reader to these reviews: Carthew and Sontheimer
(2009), Kim, Han, and Siomi (2009), Luteijn and Ketting (2013), Matera,
Terns, and Terns (2007), Mattick and Makunin (2005), and Winter,
Jung, Keller, Gregory, and Diederichs (2009).
One of the most thoroughly studied classes of small ncRNAs, miRNAs,
was first discovered in Caenorhabditis elegans in 1993 (Lee, Feinbaum, &
Ambros, 1993) and since then has been postulated to be relatively conserved
among vertebrate species (Altuvia et al., 2005; Berezikov et al., 2005;
Ibáñez-Ventoso, Vora, & Driscoll, 2008). MiRNAs can participate in post-
transcriptional gene regulation by binding to either the 30 -UTR (Lai, 2002)
or the 50 -UTR (Lytle, Yario, & Steitz, 2007) of a target transcript which
subsequently inhibits its translation. A single miRNA has the potential to
target multiple transcripts and similarly, a given transcript may be regulated
by more than one miRNA (Krek et al., 2005). Both the importance and
prevalence of miRNAs in the human genome is underscored by the fact that
greater than 60% of human protein-coding genes are predicted targets of
miRNAs (Friedman, Farh, Burge, & Bartel, 2009). The regulation per-
formed by miRNAs is a critical process in the development of mammals
and like many other ncRNAs, their expression can be specific in both
particular tissue types and developmental stages as reviewed in Alvarez-
Garcia and Miska (2005), Sayed and Abdellatif (2011), and Wienholds
and Plasterk (2005).
Like miRNA, siRNA also regulates gene expression by binding to com-
plementary sequences on target transcripts, but with more stringent require-
ments as they have to have close to perfect sequence complementation
(Elbashir, Martinez, Patkaniowska, Lendeckel, & Tuschl, 2001). In general,
this difference results in two separate mechanisms where targets with close to
perfect complementation undergo direct cleavage (as with siRNA) and
those with relatively loose complementation are destabilized or transcrip-
tionally repressed (as with miRNA) (Guo, Ingolia, Weissman, & Bartel,
2010; Hutvágner & Zamore, 2002; Martinez, Patkaniowska, Urlaub,
Lührmann, & Tuschl, 2002). Endogenous siRNAs (endo-siRNAs) in

Drosophila have been proposed to protect against dsDNA viruses and trans-
posable elements in somatic tissues (Chung, Okamura, Martin, & Lai, 2008;
Li, Li, & Ding, 2002; Wang et al., 2006). Endo-siRNAs have also been iden-
tified in human cells (Chan et al., 2013; Xia, Joyce, Bowcock, & Zhang,
2013; Yang & Kazazian, 2006) and in mice (Babiarz, Ruby, Wang,
Bartel, & Blelloch, 2008; Song et al., 2011; Tam et al., 2008; Watanabe
et al., 2008), showing another layer of genetic regulation in mammals.
siRNA has been explored in numerous settings as a therapeutic agent used
for gene therapy and has potential for correcting the dysregulation of
ncRNA in several different diseases (Burnett & Rossi, 2012).
2. LONG ncRNA
LncRNA is a broad category which encompasses transcripts of diverse
structural features and mechanisms of action. They can be derived from
sense or antisense strands overlapping with protein-coding genes, within
intergenic regions (lincRNAs), or within pseudogenes. Once transcribed
they may undergo splicing and be processed to include a 50 -
methyl-guanosine cap and 30 -poly (A) tail. Within the cell, lncRNAs can
be localized to the nucleus or the cytoplasm (Ponting, Oliver, & Reik,
2009). They have been found to perform a wide variety of functions includ-
ing participating in the recruitment of chromatin-modifying complexes,
acting as competing endogenous RNAs (ceRNAs), providing a scaffold
for the assembly of protein complexes, modulating alternative splicing,
and employing enhancer-like functions (Nagano & Fraser, 2011; Rinn &
Chang, 2012; Wang & Chang, 2011). This diverse set of functions further
emphasizes the notion that lncRNAs are key components of numerous cel-
lular processes (Table 2.1).
3. LncRNA IN FUNDAMENTAL GENETIC MECHANISMS

X-chromosome inactivation (XCI) is essential to the identity of
female mammals and is a highly intricate process involving multiple
lncRNAs that work together in order to ultimately downregulate mass
quantities of genes for dosage compensation. X-inactive specific transcript
(Xist) is a conserved lncRNA specifically expressed in the inactive
X-chromosome and required for XCI (Brown et al., 1992; Brown,
1991). This was confirmed in XX murine embryonic stem cells (mESCs)
Table 2.1 LncRNAs implicated in neurodevelopmental and neurodegenerative

disorders
lncRNA Function Reference
ASFMR1 Unknown, co-expressed with FMR1 Ladd et al. (2007)
ATXN8OS Unknown Moseley et al. (2006)
BACE1-AS Regulation of BACE1 and roles in Faghihi et al. (2008)
amyloid plaque formation
BC200 Initiation of protein translation in Muddashetty et al. (2002),
dendritic processes Mus, Hof, and Tiedge (2007)
BDNFOS Regulation of BDNF Lipovich et al. (2012)
DISC2 Unknown, antisense to DISC1 Millar et al. (2000)
EVF2 Involvement in GABAergic Bond et al. (2009), Feng et al.
interneuron function (2006)
FMR4 Antiapoptic functions, co-expressed Khalil, Faghihi, Modarresi,
with FMR1 Brothers, and Wahlestedt
(2008)
Gomafu Alternative splicing of DISC1 and Barry et al. (2013)
ERBB4
HAR1F Unknown, expressed in Cajal-Retzius Pollard et al. (2006)
neurons of developing human
neocortex
MALAT1 Regulation of alternative splicing and Bernard et al. (2010)
synaptogenesis
MSNP1AS Regulation of Moesin Kerin et al. (2012)
SOX2OT Neurogenesis Amaral et al. (2009)
UBE3A- Genomic imprinting of UBE3A Meng, Person, and Beaudet
ATS (2012)
by introducing a targeted deletion of Xist into a single allele. Following dif-

ferentiation, the targeted X chromosome would always fail to inactivate and
only the X chromosome expressing Xist would undergo XCI (Penny, Kay,
Sheardown, Rastan, & Brockdorff, 1996). Xist acts by coating the chromo-
some to be inactivated and then recruiting polycomb-group proteins for
inactivation via epigenetic mechanisms (Plath et al., 2003). By manipulating
the expression of Xist, selective silencing of one copy of chromosome 21 was
achieved in induced pluripotent stem cells (iPSCs) derived from patients
with Down’s syndrome. In the iPSC model, this corrected for the trisomy of
chromosome 21 involved in the pathogenesis of Down’s syndrome and
improved deficiencies in proliferation and neural rosette formation (Jiang
et al., 2013). In addition, it was recently discovered that there is also a human
specific lncRNA, XACT, that coats the active X chromosome in pluripo-
tent cells (Vallot et al., 2013). Xist displays a common trait among lncRNAs
as they can associate with chromatin and recruit proteins with epigenetic
functions in order to regulate the transcription of multiple genes.
LncRNAs have also been shown to be involved in genomic imprinting,
the process by which genes are expressed in a parent-specific manner. The
paternally expressed lncRNA, Antisense Igf 2r (Air), silences three protein-
coding genes (Igf2r, Slc22a2, and Slc22a3) located within the Igf2r cluster on
the same allele (Sleutels, Zwart, & Barlow, 2002). Like Xist, Air is conserved
between mice and humans (Yotova et al., 2008) and is involved in epige-
netic regulation as it inactivates the Slc22a3 gene by recruiting G9a (a histone
methyltransferase) (Nagano et al., 2008). Factors influencing genomic
imprinting are of extreme importance as dysregulation of this process is hall-
mark of a number of conditions, including the neurodevelopmental disor-
ders, Angelman Syndrome (AS), and Prader-Willi Syndrome (PWS)
(Horsthemke & Wagstaff, 2008).
4. LncRNAs IN CANCER
Downregulation of the tumor suppressor, PTEN, has been associated
with numerous types of cancers (Cairns et al., 1997; Li et al., 1997; Vlietstra,
van Alewijk, Hermans, van Steenbrugge, & Trapman, 1998). The lncRNA,
PTENpg1 (also known as PTENP1), is selectively lost in cancer, has similar
expression levels to that of PTEN, and functions as an miRNA decoy by
intercepting miRNA species targeting PTEN (Poliseno et al., 2010).
Two PTENpg1 antisense (as) isoforms, a and b, regulate the expression
levels of PTEN by diverse mechanisms, illustrating the complex networks
of regulation lncRNAs can take part in. PTENpg1 asRNA a is able to
decrease PTEN expression levels through epigenetic mechanisms involving
DNMT3A and EZH2, while PTENpg1 asRNA b interacts with PTENpg1
in order to positively influence its stability and decoy function ( Johnsson
et al., 2013). Interestingly, abnormalities in PTEN have also been implicated
in ASD (Butler et al., 2005; O’Roak et al., 2012).
The HOX genes are essential for specifying patterning during the devel-
opment of bilateral animals (Pearson, Lemons, & McGinnis, 2005).
HOTAIR is an lncRNA transcribed from the HOXC locus that acts in trans
to regulate transcription at the HOXD locus. Here, HOTAIR associates
with Polycomb Repressive Complex 2 (PRC2) in order to influence His-
tone H3 Lysine-27 trimethylation which results in transcriptional silencing
(Rinn et al., 2007). Increased expression of HOTAIR has been associated
with a variety of cancer types including breast (Gupta et al., 2010), colon
(Kogo et al., 2011), and liver (Ishibashi et al., 2013) cancers. This may be
due to massive epigenetic changes in which increased HOTAIR reverts
the epigenetic profile of cancerous cells to something resembling that of
embryonic fibroblasts through retargeting of PRC2 (Gupta et al., 2010).
Maternally expressed gene 3 (MEG3) is a conserved, imprinted gene
encoding an lncRNA. In meningiomas, there is a strong association between
loss of MEG3 expression and increase in tumor grade (Zhang et al., 2010).
This can be attributed to the activation of the p53 pathway (Zhao, Dahle,
Zhou, Zhang, & Klibanski, 2005) and increased methylation of MEG3 reg-
ulatory region. The effect of decreased expression of MEG3 has also been
implicated in pituitary adenomas (Zhang et al., 2003), gliomas (Wang,
Ren, & Sun, 2012), cervical cancer (Qin et al., 2013), and bladder cancer
(Ying et al., 2013).
5. LncRNAs IN THE BRAIN

LncRNAs have been shown to be highly expressed within the central
nervous system and in particular, the brain, where they can exhibit spatio-
temporal expression patterns (Lipovich et al., 2013; Ponjavic, Oliver,
Lunter, & Ponting, 2009). This highly diverse class of ncRNAs has been
shown to be involved in several key roles of brain development and func-
tion. Therefore, dysregulation of lncRNAs can be contributing factors to
neurological disorders, which we will show examples with respect to neu-
rodevelopmental and neurodegenerative disorders. For many complex neu-
rological disorders such as autism, the pathogenesis is quite unclear. The
functional characterization of lncRNAs could unveil another layer of tran-
scriptional regulation involved in their pathogenesis and potentially provide
routes of therapeutic intervention.
5.1. Brain development and function

LncRNAs are essential to the development, maintenance, and function of
the brain. They have been shown to take part in fundamental processes such
as synaptogenesis, neurogenesis, and GABAergic interneuron function.
Abnormalities in these processes have been implicated in several neu-

rodevelopmental disorders including ASD and schizophrenia (SZ). Dys-
regulation of lncRNAs involved in these processes may ultimately impact
the molecular mechanisms that underlie the observed phenotypes in these
disorders.
Neurogenesis, the differentiation of neurons from neural stem cells or
neural progenitor cells, is a critical process that occurs throughout the life
of an individual (Ming & Song, 2005). Studies analyzing the differential
expression of lncRNAs upon differentiating human ESCs or iPSCs to
neurons have identified several lncRNAs as integral components of neuro-
genesis (Lin et al., 2011; Ng, Johnson, & Stanton, 2012). The protein-
coding gene, SOX2, has been shown to play key roles in both embryonic
and adult neurogenesis (Ellis et al., 2004; Favaro et al., 2009; Ferri et al.,
2004) and is located within an intron of the lncRNA Sox2 overlapping tran-
script (SOX2OT) (Fantes et al., 2003). Sox2ot and an alternatively spliced
isoform, Sox2dot, are both expressed in the mouse brain and enriched in
areas associated with neurogenesis (Amaral et al., 2009; Mercer, Dinger,
Sunkin, Mehler, & Mattick, 2008). Defects in neurogenesis during develop-
ment and adulthood have been linked to a number of neurodevelopmental
and neurodegenerative diseases (Amiri et al., 2012; Guidi et al., 2008;
Hsieh & Eisch, 2010; Reif et al., 2006; Wegiel et al., 2010).
In the human brain, synaptogenesis is characterized by increased prolif-
eration of neuronal cells and an overproduction of synaptic connections
from gestation to about 3 years of age, followed by subsequent “trimming”
of these into adulthood (Bourgeron, 2009; Huttenlocher & Dabholkar,
1997; Petanjek et al., 2011). This timeline has many important implications
in neurodevelopmental disorders, as ASD typically presents itself prior to the
age of 3 (Bourgeron, 2009; Investigators & Prevention, 2012). Metastasis-
associated lung-adenocarcinoma transcript 1 (MALAT1) was originally
identified as being overexpressed in non-small cell lung cancer ( Ji et al.,
2003) and is also highly expressed in neurons where it plays key roles in syn-
aptogenesis. This lncRNA was shown to regulate synaptic density and the
expression levels of neuroligin1 (NLGN1) and synaptic cell-adhesion mol-
ecule (SynCAM1), which are involved in controlling synapse formation
(Bernard et al., 2010). As with neurogenesis, aberrant regulation of syn-
aptogenesis is a common theme among many neurological disorders includ-
ing ASD and SZ (Bourgeron, 2009; Grant, 2012; Zoghbi, 2003). In
addition, MALAT1 takes part in the recruitment of SR-type pre-mRNA
splicing factors to nuclear speckle domains where they participate in
regulating alternative splicing (Tripathi et al., 2010). This is particularly rel-

evant to the human brain, which contains one of the highest proportions of
alternatively spliced transcripts (de la Grange, Gratadou, Delord, Dutertre, &
Auboeuf, 2010; Grosso et al., 2008). Dysregulation of alternative splicing
can impact the expression levels of large quantities of transcripts and has been
implicated in SZ and ASD (Morikawa & Manabe, 2010; Voineagu
et al., 2011).
GABA is one of the most abundant neurotransmitters in the brain and has
key roles in development (Wonders & Anderson, 2006). Because of this,
irregular GABAergic interneuron function has been linked to ASD
(Fatemi, Folsom, Kneeland, & Liesch, 2011; Hogart, Nagarajan, Patzel,
Yasui, & Lasalle, 2007; Horder et al., 2013) and SZ (Lewis,
Hashimoto, & Volk, 2005). Dlx homeobox genes are critical for the differ-
entiation and migration of GABAergic interneurons in the developing brain
(Anderson, Eisenstat, Shi, & Rubenstein, 1997; Kuwajima, Nishimura, &
Yoshikawa, 2006). Evf2 is an lncRNA transcribed from the Dlx-5/6 ultra-
conserved region that recruits DLX and MECP2 transcription factors to this
same region in order to influence the expression of Dlx5, Dlx6, and Gad1.
This occurs through a combination of both cis and trans mechanisms (Bond
et al., 2009) and illustrates how lncRNAs are able to regulate specific targets
through diverse mechanisms. Evf2 knockout mice show reduced numbers of
GABAergic interneurons in the hippocampus and dentate gyrus during
infancy. Although the quantity of interneurons returns to normal in adults,
defects in synaptic connectivity remain (Bond et al., 2009). The early dys-
regulation in Evf2 having a long-lasting influence highlights the importance
of lncRNA in neurodevelopmental disorders.
BDNF, the most abundant neurotrophin in the brain, takes part in sev-
eral fundamental functions including the regulation of neuron morphology,
neuronal cell survival, and neuronal plasticity and memory (Egan et al.,
2003; Horch & Katz, 2002; Tanaka et al., 2008). Due to its diverse roles
in fundamental processes, BDNF has been linked to a wide range of
neurodevelopmental and neurodegenerative disorders including SZ
(Krebs et al., 2000; Neves-Pereira et al., 2005; Nieto, Kukuljan, & Silva,
2013), Alzheimer’s disease (AD) (Hock, Heese, Hulette, Rosenberg, &
Otten, 2000), Parkinson’s disease (Howells et al., 2000), and ASD
(Gadow, Roohi, DeVincent, Kirsch, & Hatchwell, 2009; Katoh-Semba
et al., 2007; Ricci et al., 2013). BDNFOS or anti-BDNF is a conserved nat-
ural antisense transcript that forms dsRNA duplexes in the brain in order to
downregulate BDNF transcript levels (Liu et al., 2006; Pruunsild,
Kazantseva, Aid, Palm, & Timmusk, 2007). In neocortical regions of brain

tissue removed from patients to treat intractable seizures, an increase in
BDNF expression along with a reciprocal decrease in BDNFOS expression
has been observed (Lipovich et al., 2012). This same trend was seen in
human neuronal cells after repeated depolarization that mimicked the effects
of epileptic seizures. In addition, the lncRNAs RPPH1, NEAT1, and
MALAT1 were also upregulated in both experimental settings, showing that
lncRNAs can have activity-dependent expression (Lipovich et al., 2012).
5.2. Neurodegenerative diseases

In addition to contributing to the fundamental processes of development,
lncRNAs can also be causative factors in diseases characterized by rapid
decline of the brain. BACE1 is involved in cleaving APP in order to generate
the toxic Ab peptides that contribute to the pathogenesis of AD (Cai et al.,
2001) and decreased expression of BACE1 leads to reduced levels of Ab
(Atwal et al., 2011; Singer et al., 2005). BACE1-antisense transcript
(BACE1-AS) is upregulated in both a transgenic mouse model and human
patients with AD. With increased BACE1-AS, there is a concurrent
upregulation of BACE1 which is proposed to be due to stabilization of
BACE1 by BACE1-AS (Faghihi et al., 2008). This is in contrast to the
mechanisms proposed for other protein-coding genes and their
corresponding antisense transcripts such as BDNF/BDNFOS and
UBE3A/UBE3-ATS where the antisense transcript imposes down-
regulation of the protein-coding gene (Lipovich et al., 2012; Meng et al.,
2012). Upon exposure to Ab 1–42, expression of both BACE1 and
BACE1-AS increases which subsequently acts to further increase the levels
of Ab 1–42. This can lead to the formation of amyloid plaques and progres-
sion of AD (Faghihi et al., 2008).
BC200 RNA is a brain-specific ncRNA that is homologous to the
rodent BC1 RNA (Martignetti & Brosius, 1993; Tiedge, Chen, &
Brosius, 1993). In the dendritic processes of neurons, BC200 RNA associ-
ates with poly(A)-binding protein (PABP1) and plays a role in regulating the
initiation of protein translation (Muddashetty et al., 2002). Expression of
BC200 RNA is upregulated in selectively vulnerable areas of the brain in
AD. This upregulation increases with severity of AD and skews the distri-
bution of BC200 RNA, causing it to be clustered in the cell soma (Mus
et al., 2007).
5.3. Neurodevelopmental disorders

Silencing of the Fragile X Mental Retardation Gene (FMR1) resulting from
extensive 50 -UTR CGG trinucleotide repeats is a causative factor in the
most common form of inherited mental retardation, fragile X syndrome
(FXS). Normal FMR1 genes contain 5–54 repeats, 55–200 repeats is cate-
gorized as the premutation allele, and above 200 repeats is termed the full
mutation allele and has a direct link with FXS. The premutation allele con-
fers increased expression of FMR1 mRNA and is associated with fragile
X-associated tremor and ataxia syndrome (FXTAS) while the full mutation
allele silences the transcription of FMR1 (Garber, Visootsak, & Warren,
2008). Two lncRNAs, ASFMR1 and FMR4, are transcribed from the
FMR1 locus and have been shown to have similar patterns of expression
with respect to FMR1 in both the premutation and full mutation alleles.
Although the function of ASFMR1 is currently unknown, FMR4 has been
shown to have antiapoptotic properties in vitro (Khalil et al., 2008; Ladd
et al., 2007). In addition, carriers of the premutation allele have been asso-
ciated with mitochondrial dysfunction (Ross-Inta et al., 2010), which may
predispose individuals to neurodegenerative disorders such as Parkinson’s
disease (Loesch et al., 2011). Based on the similar expression patterns of both
ASFMR1 and FMR4, there is a significant possibility of their contribution to
the pathogenesis of the FXS and FXTAS.
Like ASD, SZ is a complex disorder thought to be the result of a variety
of genetic and environmental influences (Sullivan, Kendler, & Neale, 2003).
The DISC locus was originally identified in a large Scottish family as a can-
didate gene for SZ and contains DISC1 along with a human-specific
lncRNA antisense to DISC1 and DISC2 (Millar et al., 2000; Taylor,
Devon, Millar, & Porteous, 2003). Recently, it was shown that the
lncRNA, Gomafu, is involved in the alternative splicing of DISC1 and
another SZ-associated gene, ERBB4. Gomafu is downregulated in an
activity-dependent manner in response to depolarization in both mouse
and human neuronal cell lines. Knockdown of Gomafu results in increased
expression of alternatively spliced isoforms of DISC1 and ERBB4 but not
the unspliced genes; this is the same expression pattern previously observed
in postmortem brain tissue of schizophrenic patients (Barry et al., 2013; Law,
Kleinman, Weinberger, & Weickert, 2007; Nakata et al., 2009). Impor-
tantly, decreased expression of Gomafu was also observed in postmortem
brain tissue of individuals with SZ, implicating this lncRNA in the patho-
genesis of SZ and as a potential therapeutic target (Barry et al., 2013).
UBE3A-ATS is an lncRNA antisense to UBE3A within the 15q11–13

chromosomal region (Rougeulle, Cardoso, Fontés, Colleaux, & Lalande,
1998), which is termed the PWS/AS region due to chromosomal abnormal-
ities arising here being causative factors to these disorders (Nicholls &
Knepper, 2001). The failure to inherit/express a maternal copy of UBE3A
is known to cause AS in a majority of the cases (Kishino, Lalande, &
Wagstaff, 1997). UBE3A is imprinted in a neuron-specific manner, where
it is only expressed from the maternal allele due to silencing of UBE3A on
the paternal allele by the lncRNA, UBE3A-ATS (Meng et al., 2012;
Yamasaki et al., 2003). This suggests UBE3-ATS may also be a useful ther-
apeutic target as dysregulation of UBE3A-ATS can cause abnormal expres-
sion of paternal UBE3A and contribute to the pathogenesis of AS.
Due to the tissue- and cell type-specific expression of many lncRNAs,
they have the potential to be utilized as biomarkers in order to monitor
developmental changes within the brain. Rhabdomyosarcoma 2-associated
transcript (RMST ) was originally identified as differentially expressed in var-
ious tumor types (Chan, Thorner, Squire, & Zielenska, 2002). It has subse-
quently been shown that the expression of this conserved lncRNA is mainly
restricted to the CNS (Chodroff et al., 2010) and is a marker for midbrain
dopaminergic neurons in mice (Uhde, Vives, Jaeger, & Li, 2010). Although
a function in human neurons is yet to be elucidated, a recent genome-wide
association study identified RMST as a risk gene for severe obesity in which
the other loci having significant association were involved in neuronal reg-
ulation of energy homeostasis (Wheeler et al., 2013).
While some lncRNAs are conserved among species, a majority of these
are not in comparison to the prevalence of conserved protein-coding genes
(Mercer, Dinger, & Mattick, 2009; Pang, Frith, & Mattick, 2006). Those
that are human specific may be linked to human complexity and elucidate
pathways involved in complex disorders. By comparing the human genome
against that of the chimpanzee and looking for regions that display acceler-
ated evolutionary change, Pollard et al. identified “human accelerated
region” (HAR1). HAR1 is part of a pair of overlapping transcripts termed
HAR1F and HAR1R. HAR1F displays both time- and cell type-specific
expression in Cajal–Retzius neurons of the developing human neocortex
that is not detectable past 24 gestational weeks (Pollard et al., 2006). This
developmental specificity, or lncRNAs with expression patterns like this,
could be important in neurodevelopmental disorders that have defects pre-
sent from early on such as ASD or SZ. In fact, within the Cajal–Retzius neu-
rons, HAR1F is coexpressed with reelin (Pollard et al., 2006), which has
been implicated in SZ (Eastwood & Harrison, 2006; Impagnatiello et al.,

1998) and ASD (Ashley-Koch et al., 2007; Persico et al., 2001).
The involvement of lncRNA in contributing to the pathogenesis of neu-
rodevelopmental disorders is limited to a handful of examples. But, these
examples do show that lncRNAs play critical roles in human development
and emphasize the need for further characterization of others. The fact that
several of these disorders can have comorbid diagnoses with one another
points to the possibility of some common molecular pathways that could
involve lncRNA. For example, some patients diagnosed with AS also have
mutations in the MECP2 gene responsible for a majority of Rett Syndrome
cases (Samaco, Hogart, & LaSalle, 2005; Watson et al., 2001).
6. LncRNAs CONTRIBUTE TO ASD

Direct evidence for a contribution of lncRNAs to ASD continues to
accumulate. Differential expression of lncRNAs has been observed in both
postmortem brain tissue and lymphoblastoid cell lines. Recently, we
reported that a genome-wide significant association signal implicated an
lncRNA, not the neighboring protein-coding genes.
To date there has only been one study characterizing lncRNA expres-
sion profiles in postmortem tissues of individuals with ASD. Ziat and col-
leges detected over 222 differentially expressed lncRNAs between
individuals with ASD compared to controls. Within these 222 lncRNAs,
82 were unique to the prefrontal cortex (PFC), while 143 were unique
to the cerebellum (Ziats & Rennert, 2013). This observation again underlies
the fact that lncRNA expression can be highly tissue specific. They also
reported increased transcriptional homogeneity between the PFC and cer-
ebellum of ASD brain tissue when compared to controls in both mRNA and
annotated lncRNA (1375 differentially expressed lncRNAs in control sam-
ples versus 236 in the ASD samples) (Ziats & Rennert, 2013). Although the
conclusions drawn from these results are exciting, the sample size of brain
tissue in this study is relatively small (n ¼ 2 ASD patients and n ¼ 2 age,
sex-matched controls). More studies of this nature will have to be repeated
with a larger sample size in order to assess variability and determine the sig-
nificance of these conclusions.
A scan for differential expression of transcripts in LCLs derived from
three subgroups of individuals diagnosed with ASD identified 20 common
lncRNAs that were dysregulated in all of the subgroups compared to con-
trols. A majority of the lncRNAs identified were also shown to be
androgen-responsive, suggesting a gender-specific component (Hu, 2013;

Hu et al., 2009).
A genome-wide association study (GWAS) of ASD indicated genome-
wide significant association (P ¼ 1010) of rs4307059 on chromosome
5p14.1 (Wang et al., 2009). The same rs4307059 allele was also associated
with social communication phenotypes in a general population sample
(St Pourcain et al., 2010). However, rs4307059 genotype was not corre-
lated with expression of either of the flanking protein-coding genes,
CDH9 and CDH10 (Wang et al., 2009). We identified a 3.9 kb noncoding
RNA that is transcribed directly at the site of the chromosome 5p14.1 ASD
GWAS peak (Kerin et al., 2012). The noncoding RNA is encoded by the
opposite (antisense) strand of moesin pseudogene 1 (MSNP1) and is thus
designated MSNP1AS (moesin pseudogene 1, antisense). MSNP1AS is
94% identical and antisense to the X chromosome transcript MSN, which
encodes a protein (moesin) that regulates neuronal architecture and
immune response. Expression of MSNP1AS in postmortem temporal cor-
tex is increased 12.7-fold in individuals with ASD and increased 22-fold in
individuals with the rs4307059 risk allele (Kerin et al., 2012). The
MSNP1AS noncoding RNA binds MSN and its overexpression in cul-
tured neurons causes significant decreases in MSN transcript, moesin pro-
tein, neurite number, and neurite length. Thus, our discovery reveals a
functional lncRNA which, based on the GWAS findings, contributes to
ASD risk (Fig. 2.1).
7. CONCLUSIONS
The Central Dogma of Molecular Biology posits that DNA is tran-
scribed into RNA, which is translated into protein. Genetic information
is stored in protein-coding genes, while RNA is merely an intermediary
between genes and functional proteins. Prior to the completion of the
Human Genome Project, the prevailing hypothesis was that the human
genome would produce approximately 100,000 protein-coding genes. This
seemed like a reasonable estimate based on the size of the human genome
and the complexity of human anatomy. However, the human genome con-
tains only approximately 21,000 protein-coding genes, slightly more than a
mouse and slightly less than a grape. Over the last decade, RNA has become
increasingly recognized as a functional entity. The whole genome and trans-
criptome sequencing suggests that the complexity of an organism may be
regulated by noncoding portions of the genome rather than by proteins.
B rs7704909 rs4307059
C MSNP1: Chr 5p14.1 pseudogene with 94% sequence identity to Chr X gene MSN
+ Strand
– Strand
MSNP1AS: Chr 5p14.1 transcribed 3.9 kb non-coding anti-sense RNA
Figure 2.1 MSNP1AS maps within the chromosome 5p14.1 GWAS-significant ASD-
association peak and is the only significantly expressed transcript within 500 kb of
the GWAS peak. (A) The GWAS results from Wang et al. (2009), indicating ASD-
associated markers on chromosome 5p14.1. (B) Genome-wide RNA-Seq data from a
variety of tissue sources indicate that a single major transcript of 4 kb is expressed
within 500 kb of the GWAS peak. (C) The þ strand of this 4 kb chromosome 5p14.1
region is the pseudogene moesin-like 1 (MSNP1), which has 94% sequence identity
to the X chromosome gene-encoding moesin (MSN) but does not appear to be tran-
scribed. Instead, our data indicate that a 3.9 kb RNA is transcribed from the strand,
producing a non-protein-coding RNA that is antisense to the X chromosome gene-
encoding moesin (MSN). Because the chromosome 5p14.1 transcript represents the
antisense of the pseudogene, we designate it MSNP1AS (moesin pseudogene 1, anti-
sense). Data from the UCSC Genome Browser.
Among long RNAs produced in the human brain, the majority do not code
for proteins but are instead lncRNAs. Increasing evidence suggests that these
lncRNAs may contribute to brain disorders.
REFERENCES
Altuvia, Y., Landgraf, P., Lithwick, G., Elefant, N., Pfeffer, S., Aravin, A., et al. (2005). Clus-
tering and conservation patterns of human microRNAs. Nucleic Acids Research, 33,
2697–2706.
Alvarez-Garcia, I., & Miska, E. A. (2005). MicroRNA functions in animal development and
human disease. Development, 132, 4653–4662.
Amaral, P. P., Neyt, C., Wilkins, S. J., Askarian-Amiri, M. E., Sunkin, S. M., Perkins, A. C.,
et al. (2009). Complex architecture and regulated expression of the Sox2ot locus during
vertebrate development. RNA, 15, 2013–2027.
Amiri, A., Cho, W., Zhou, J., Birnbaum, S. G., Sinton, C. M., McKay, R. M., et al. (2012).
Pten deletion in adult hippocampal neural stem/progenitor cells causes cellular abnor-
malities and alters neurogenesis. Journal of Neuroscience, 32, 5880–5890.
Anderson, S. A., Eisenstat, D. D., Shi, L., & Rubenstein, J. L. (1997). Interneuron migration
from basal forebrain to neocortex: Dependence on Dlx genes. Science, 278, 474–476.
Ashley-Koch, A. E., Jaworski, J., Ma, de, Q., Mei, H., Ritchie, M. D., Skaar, D. A., et al.
(2007). Investigation of potential gene-gene interactions between APOE and RELN
contributing to autism risk. Psychiatric Genetics, 17, 221–226.
Atwal, J. K., Chen, Y., Chiu, C., Mortensen, D. L., Meilandt, W. J., Liu, Y., et al. (2011).
A therapeutic antibody targeting BACE1 inhibits amyloid-b production in vivo. Science
Translational Medicine, 3, 84ra43.
Babiarz, J. E., Ruby, J. G., Wang, Y., Bartel, D. P., & Blelloch, R. (2008). Mouse ES cells
express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-
dependent small RNAs. Genes and Development, 22, 2773–2785.
Barry, G., Briggs, J. A., Vanichkina, D. P., Poth, E. M., Beveridge, N. J., Ratnu, V. S., et al.
(2013). The long non-coding RNA Gomafu is acutely regulated in response to neuronal
activation and involved in schizophrenia-associated alternative splicing. Molecular Psychiatry,
http://dx.doi.org/10.1038/mp.2013.45.
Berezikov, E., Guryev, V., van de Belt, J., Wienholds, E., Plasterk, R. H., & Cuppen, E.
(2005). Phylogenetic shadowing and computational identification of human microRNA
genes. Cell, 120, 21–24.
Bernard, D., Prasanth, K. V., Tripathi, V., Colasse, S., Nakamura, T., Xuan, Z., et al. (2010).
A long nuclear-retained non-coding RNA regulates synaptogenesis by modulating gene
expression. The EMBO Journal, 29, 3082–3093.
Bertone, P., Stolc, V., Royce, T. E., Rozowsky, J. S., Urban, A. E., Zhu, X., et al. (2004).
Global identification of human transcribed sequences with genome tiling arrays. Science,
306, 2242–2246.
Birney, E., Stamatoyannopoulos, J. A., Dutta, A., Guigó, R., Gingeras, T. R.,
Margulies, E. H., et al. (2007). Identification and analysis of functional elements in
1% of the human genome by the ENCODE pilot project. Nature, 447, 799–816.
Bond, A. M., Vangompel, M. J., Sametsky, E. A., Clark, M. F., Savage, J. C., Disterhoft, J. F.,
et al. (2009). Balanced gene regulation by an embryonic brain ncRNA is critical for adult
hippocampal GABA circuitry. Nature Neuroscience, 12, 1020–1027.
Bourgeron, T. (2009). A synaptic trek to autism. Current Opinion in Neurobiology, 19,
231–234.
Brown, S. D. (1991). XIST and the mapping of the X chromosome inactivation centre. Bio-
essays, 13, 607–612.
Brown, C. J., Hendrich, B. D., Rupert, J. L., Lafrenière, R. G., Xing, Y., Lawrence, J., et al.
(1992). The human XIST gene: Analysis of a 17 kb inactive X-specific RNA that con-
tains conserved repeats and is highly localized within the nucleus. Cell, 71, 527–542.
Burnett, J. C., & Rossi, J. J. (2012). RNA-based therapeutics: Current progress and future
prospects. Chemistry and Biology, 19, 60–71.
Butler, M. G., Dasouki, M. J., Zhou, X. P., Talebizadeh, Z., Brown, M., Takahashi, T. N.,
et al. (2005). Subset of individuals with autism spectrum disorders and extreme
macrocephaly associated with germline PTEN tumour suppressor gene mutations. Jour-
nal of Medical Genetics, 42, 318–321.
Cai, H., Wang, Y., McCarthy, D., Wen, H., Borchelt, D. R., Price, D. L., et al. (2001).
BACE1 is the major beta-secretase for generation of Abeta peptides by neurons. Nature
Neuroscience, 4, 233–234.
Cairns, P., Okami, K., Halachmi, S., Halachmi, N., Esteller, M., Herman, J. G., et al. (1997).
Frequent inactivation of PTEN/MMAC1 in primary prostate cancer. Cancer Research,
57, 4997–5000.
Carninci, P., Kasukawa, T., Katayama, S., Gough, J., Frith, M. C., Maeda, N., et al. (2005).
The transcriptional landscape of the mammalian genome. Science, 309, 1559–1563.
Carninci, P., Sandelin, A., Lenhard, B., Katayama, S., Shimokawa, K., Ponjavic, J., et al.
(2006). Genome-wide analysis of mammalian promoter architecture and evolution.
Nature Genetics, 38, 626–635.
Carthew, R. W., & Sontheimer, E. J. (2009). Origins and mechanisms of miRNAs and
siRNAs. Cell, 136, 642–655.
Chan, A. S., Thorner, P. S., Squire, J. A., & Zielenska, M. (2002). Identification of a novel
gene NCRMS on chromosome 12q21 with differential expression between rhabdo-
myosarcoma subtypes. Oncogene, 21, 3029–3037.
Chan, W. L., Yuo, C. Y., Yang, W. K., Hung, S. Y., Chang, Y. S., Chiu, C. C., et al. (2013).
Transcribed pseudogene cPPM1K generates endogenous siRNA to suppress oncogenic
cell growth in hepatocellular carcinoma. Nucleic Acids Research, 41, 3734–3747.
Cheng, J., Kapranov, P., Drenkow, J., Dike, S., Brubaker, S., Patel, S., et al. (2005). Transcrip-
tional maps of 10 human chromosomes at 5-nucleotide resolution. Science, 308, 1149–1154.
Chodroff, R. A., Goodstadt, L., Sirey, T. M., Oliver, P. L., Davies, K. E., Green, E. D., et al.
(2010). Long noncoding RNA genes: Conservation of sequence and brain expression
among diverse amniotes. Genome Biology, 11, R72.
Chung, W. J., Okamura, K., Martin, R., & Lai, E. C. (2008). Endogenous RNA interference
provides a somatic defense against Drosophila transposons. Current Biology, 18, 795–802.
Core, L. J., Waterfall, J. J., & Lis, J. T. (2008). Nascent RNA sequencing reveals widespread
pausing and divergent initiation at human promoters. Science, 322, 1845–1848.
de la Grange, P., Gratadou, L., Delord, M., Dutertre, M., & Auboeuf, D. (2010). Splicing
factor and exon profiling across human tissues. Nucleic Acids Research, 38, 2825–2838.
Djebali, S., Davis, C. A., Merkel, A., Dobin, A., Lassmann, T., Mortazavi, A., et al. (2012).
Landscape of transcription in human cells. Nature, 489, 101–108.
Eastwood, S. L., & Harrison, P. J. (2006). Cellular basis of reduced cortical reelin expression
in schizophrenia. The American Journal of Psychiatry, 163, 540–542.
Egan, M. F., Kojima, M., Callicott, J. H., Goldberg, T. E., Kolachana, B. S., Bertolino, A.,
et al. (2003). The BDNF val66met polymorphism affects activity-dependent secretion of
BDNF and human memory and hippocampal function. Cell, 112, 257–269.
Elbashir, S. M., Martinez, J., Patkaniowska, A., Lendeckel, W., & Tuschl, T. (2001). Func-
tional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster
embryo lysate. The EMBO Journal, 20, 6877–6888.
Ellis, P., Fagan, B. M., Magness, S. T., Hutton, S., Taranova, O., Hayashi, S., et al. (2004).
SOX2, a persistent marker for multipotential neural stem cells derived from embryonic
stem cells, the embryo or the adult. Developmental Neuroscience, 26, 148–165.
Faghihi, M. A., Modarresi, F., Khalil, A. M., Wood, D. E., Sahagan, B. G., Morgan, T. E.,
et al. (2008). Expression of a noncoding RNA is elevated in Alzheimer’s disease and
drives rapid feed-forward regulation of beta-secretase. Nature Medicine, 14, 723–730.
Fantes, J., Ragge, N. K., Lynch, S. A., McGill, N. I., Collin, J. R., Howard-Peebles, P. N.,
et al. (2003). Mutations in SOX2 cause anophthalmia. Nature Genetics, 33, 461–463.
Fatemi, S. H., Folsom, T. D., Kneeland, R. E., & Liesch, S. B. (2011). Metabotropic glu-
tamate receptor 5 upregulation in children with autism is associated with under-
expression of both Fragile X mental retardation protein and GABAA receptor beta 3
in adults with autism. Anatomical Record, 294, 1635–1645.
Favaro, R., Valotta, M., Ferri, A. L., Latorre, E., Mariani, J., Giachino, C., et al. (2009). Hip-
pocampal development and neural stem cell maintenance require Sox2-dependent reg-
ulation of Shh. Nature Neuroscience, 12, 1248–1256.
Feng, J., Bi, C., Clark, B. S., Mady, R., Shah, P., & Kohtz, J. D. (2006). The Evf-2 non-
coding RNA is transcribed from the Dlx-5/6 ultraconserved region and functions as
a Dlx-2 transcriptional coactivator. Genes and Development, 20, 1470–1484.
Ferri, A. L., Cavallaro, M., Braida, D., Di Cristofano, A., Canta, A., Vezzani, A., et al. (2004).
Sox2 deficiency causes neurodegeneration and impaired neurogenesis in the adult mouse
brain. Development, 131, 3805–3819.
Friedman, R. C., Farh, K. K., Burge, C. B., & Bartel, D. P. (2009). Most mammalian
mRNAs are conserved targets of microRNAs. Genome Research, 19, 92–105.
Gadow, K. D., Roohi, J., DeVincent, C. J., Kirsch, S., & Hatchwell, E. (2009). Association
of COMT (Val158Met) and BDNF (Val66Met) gene polymorphisms with anxiety,
ADHD and tics in children with autism spectrum disorder. Journal of Autism and Devel-
opmental Disorders, 39, 1542–1551.
Garber, K. B., Visootsak, J., & Warren, S. T. (2008). Fragile X syndrome. European Journal of
Human Genetics, 16, 666–672.
Grant, S. G. (2012). Synaptopathies: Diseases of the synaptome. Current Opinion in Neuro-
biology, 22, 522–529.
Grosso, A. R., Gomes, A. Q., Barbosa-Morais, N. L., Caldeira, S., Thorne, N. P., Grech, G.,
et al. (2008). Tissue-specific splicing factor gene expression signatures. Nucleic Acids
Research, 36, 4823–4832.
Guidi, S., Bonasoni, P., Ceccarelli, C., Santini, D., Gualtieri, F., Ciani, E., et al. (2008). Neu-
rogenesis impairment and increased cell death reduce total neuron number in the hip-
pocampal region of fetuses with Down syndrome. Brain Pathology, 18, 180–197.
Guo, H., Ingolia, N. T., Weissman, J. S., & Bartel, D. P. (2010). Mammalian microRNAs
predominantly act to decrease target mRNA levels. Nature, 466, 835–840.
Gupta, R. A., Shah, N., Wang, K. C., Kim, J., Horlings, H. M., Wong, D. J., et al. (2010).
Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer
metastasis. Nature, 464, 1071–1076.
Hock, C., Heese, K., Hulette, C., Rosenberg, C., & Otten, U. (2000). Region-specific neu-
rotrophin imbalances in Alzheimer disease: Decreased levels of brain-derived neuro-
trophic factor and increased levels of nerve growth factor in hippocampus and cortical
areas. Archives of Neurology, 57, 846–851.
Hogart, A., Nagarajan, R. P., Patzel, K. A., Yasui, D. H., & Lasalle, J. M. (2007). 15q11-13
GABAA receptor genes are normally biallelically expressed in brain yet are subject to
epigenetic dysregulation in autism-spectrum disorders. Human Molecular Genetics, 16,
691–703.
Horch, H. W., & Katz, L. C. (2002). BDNF release from single cells elicits local dendritic
growth in nearby neurons. Nature Neuroscience, 5, 1177–1184.
Horder, J., Lavender, T., Mendez, M. A., O’Gorman, R., Daly, E., Craig, M. C., et al.
(2013). Reduced subcortical glutamate/glutamine in adults with autism spectrum disor-
ders: A [(1)H]MRS study. Translational Psychiatry, 3, e279.
Horsthemke, B., & Wagstaff, J. (2008). Mechanisms of imprinting of the Prader-Willi/
Angelman region. American Journal of Medical Genetics Part A, 146A, 2041–2052.
Howells, D. W., Porritt, M. J., Wong, J. Y., Batchelor, P. E., Kalnins, R., Hughes, A. J., et al.
(2000). Reduced BDNF mRNA expression in the Parkinson’s disease substantia nigra.
Experimental Neurology, 166, 127–135.
Hsieh, J., & Eisch, A. J. (2010). Epigenetics, hippocampal neurogenesis, and neuropsychiatric
disorders: Unraveling the genome to understand the mind. Neurobiology of Disease, 39,
73–84.
Hu, V. W. (2013). The expanding genomic landscape of autism: Discovering the ‘forest’
beyond the ‘trees’. Future Neurology, 8, 29–42.
Hu, V. W., Sarachana, T., Kim, K. S., Nguyen, A., Kulkarni, S., Steinberg, M. E., et al.
(2009). Gene expression profiling differentiates autism case-controls and phenotypic
variants of autism spectrum disorders: Evidence for circadian rhythm dysfunction in

severe autism. Autism Research, 2, 78–97.
Huttenlocher, P. R., & Dabholkar, A. S. (1997). Regional differences in synaptogenesis in
human cerebral cortex. Journal of Comparative Neurology, 387, 167–178.
Hutvágner, G., & Zamore, P. D. (2002). A microRNA in a multiple-turnover RNAi
enzyme complex. Science, 297, 2056–2060.
Ibáñez-Ventoso, C., Vora, M., & Driscoll, M. (2008). Sequence relationships among
C. elegans, D. melanogaster and human microRNAs highlight the extensive conserva-
tion of microRNAs in biology. PLoS One, 3, e2818.
Impagnatiello, F., Guidotti, A. R., Pesold, C., Dwivedi, Y., Caruncho, H., Pisu, M. G., et al.
(1998). A decrease of reelin expression as a putative vulnerability factor in schizophrenia.
Proceedings of the National Academy of Sciences of the United States of America, 95,
15718–15723.
Investigators, Autism and Developmental Disabilities Monitoring Network Surveillance
Year 2008 Principal, & Prevention, Centers for Disease Control (2012). Prevalence
of autism spectrum disorders—Autism and Developmental Disabilities Monitoring Net-
work, 14 sites, United States, 2008. MMWR Surveillance Summaries, 61, 1–19.
Ishibashi, M., Kogo, R., Shibata, K., Sawada, G., Takahashi, Y., Kurashige, J., et al. (2013).
Clinical significance of the expression of long non-coding RNA HOTAIR in primary
hepatocellular carcinoma. Oncology Reports, 29, 946–950.
Jalali, S., Jayaraj, G. G., & Scaria, V. (2012). Integrative transcriptome analysis suggest
processing of a subset of long non-coding RNAs to small RNAs. Biology Direct, 7, 25.
Ji, P., Diederichs, S., Wang, W., Böing, S., Metzger, R., Schneider, P. M., et al. (2003).
MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival
in early-stage non-small cell lung cancer. Oncogene, 22, 8031–8041.
Jiang, J., Jing, Y., Cost, G., Chiang, J., Kolpa, H., Cotton, A., et al. (2013). Translating dos-
age compensation to trisomy 21. Nature, 500, 296–300.
Johnsson, P., Ackley, A., Vidarsdottir, L., Lui, W. O., Corcoran, M., Grandér, D., et al.
(2013). A pseudogene long-noncoding-RNA network regulates PTEN transcription
and translation in human cells. Nature Structural and Molecular Biology, 20, 440–446.
Kapranov, P., Cheng, J., Dike, S., Nix, D. A., Duttagupta, R., Willingham, A. T., et al.
(2007). RNA maps reveal new RNA classes and a possible function for pervasive tran-
scription. Science, 316, 1484–1488.
Katoh-Semba, R., Wakako, R., Komori, T., Shigemi, H., Miyazaki, N., Ito, H., et al.
(2007). Age-related changes in BDNF protein levels in human serum: Differences
between autism cases and normal controls. International Journal of Developmental Neuro-
science, 25, 367–372.
Keniry, A., Oxley, D., Monnier, P., Kyba, M., Dandolo, L., Smits, G., et al. (2012). The H19
lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1r.
Nature Cell Biology, 14, 659–665.
Kerin, T., Ramanathan, A., Rivas, K., Grepo, N., Coetzee, G. A., & Campbell, D. B.
(2012). A noncoding RNA antisense to moesin at 5p14.1 in autism. Science Translational
Medicine, 4, 128ra140.
Khalil, A. M., Faghihi, M. A., Modarresi, F., Brothers, S. P., & Wahlestedt, C. (2008).
A novel RNA transcript with antiapoptotic function is silenced in fragile
X syndrome. PLoS One, 3, e1486.
Kim, V. N., Han, J., & Siomi, M. C. (2009). Biogenesis of small RNAs in animals. Nature
Reviews Molecular Cell Biology, 10, 126–139.
Kishino, T., Lalande, M., & Wagstaff, J. (1997). UBE3A/E6-AP mutations cause Angelman
syndrome. Nature Genetics, 15, 70–73.
Kogo, R., Shimamura, T., Mimori, K., Kawahara, K., Imoto, S., Sudo, T., et al. (2011).
Long noncoding RNA HOTAIR regulates polycomb-dependent chromatin
modification and is associated with poor prognosis in colorectal cancers. Cancer Research,
71, 6320–6326.
Krebs, M. O., Guillin, O., Bourdell, M. C., Schwartz, J. C., Olie, J. P., Poirier, M. F., et al.
(2000). Brain derived neurotrophic factor (BDNF) gene variants association with age at
onset and therapeutic response in schizophrenia. Molecular Psychiatry, 5, 558–562.
Krek, A., Grün, D., Poy, M. N., Wolf, R., Rosenberg, L., Epstein, E. J., et al. (2005). Com-
binatorial microRNA target predictions. Nature Genetics, 37, 495–500.
Kuwajima, T., Nishimura, I., & Yoshikawa, K. (2006). Necdin promotes GABAergic neu-
ron differentiation in cooperation with Dlx homeodomain proteins. Journal of Neuro-
science, 26, 5383–5392.
Ladd, P. D., Smith, L. E., Rabaia, N. A., Moore, J. M., Georges, S. A., Hansen, R. S., et al.
(2007). An antisense transcript spanning the CGG repeat region of FMR1 is upregulated in
premutation carriers but silenced in full mutation individuals. Human Molecular Genetics, 16,
3174–3187.
Lai, E. C. (2002). Micro RNAs are complementary to 3’ UTR sequence motifs that mediate
negative post-transcriptional regulation. Nature Genetics, 30, 363–364.
Lander, E. S., Linton, L. M., Birren, B., Nusbaum, C., Zody, M. C., Baldwin, J., et al.
(2001). Initial sequencing and analysis of the human genome. Nature, 409, 860–921.
Law, A. J., Kleinman, J. E., Weinberger, D. R., & Weickert, C. S. (2007). Disease-associated
intronic variants in the ErbB4 gene are related to altered ErbB4 splice-variant expression
in the brain in schizophrenia. Human Molecular Genetics, 16, 129–141.
Lee, R. C., Feinbaum, R. L., & Ambros, V. (1993). The C. elegans heterochronic gene lin-4
encodes small RNAs with antisense complementarity to lin-14. Cell, 75, 843–854.
Lewis, D. A., Hashimoto, T., & Volk, D. W. (2005). Cortical inhibitory neurons and schizo-
phrenia. Nature Reviews Neuroscience, 6, 312–324.
Li, H., Li, W. X., & Ding, S. W. (2002). Induction and suppression of RNA silencing by an
animal virus. Science, 296, 1319–1321.
Li, J., Yen, C., Liaw, D., Podsypanina, K., Bose, S., Wang, S. I., et al. (1997). PTEN, a puta-
tive protein tyrosine phosphatase gene mutated in human brain, breast, and prostate can-
cer. Science, 275, 1943–1947.
Lin, M., Pedrosa, E., Shah, A., Hrabovsky, A., Maqbool, S., Zheng, D., et al. (2011).
RNA-Seq of human neurons derived from iPS cells reveals candidate long non-
coding RNAs involved in neurogenesis and neuropsychiatric disorders. PLoS One,
6, e23356.
Lipovich, L., Dachet, F., Cai, J., Bagla, S., Balan, K., Jia, H., et al. (2012). Activity-
dependent human brain coding/noncoding gene regulatory networks. Genetics, 192,
1133–1148.
Lipovich, L., Tarca, A. L., Cai, J., Jia, H., Chugani, H. T., Sterner, K. N., et al. (2013).
Developmental changes in the transcriptome of human cerebral cortex tissue: Long non-
coding RNA transcripts. Cerebral Cortex, http://dx.doi.org/10.1093/cercor/bhs414.
Liu, Q. R., Lu, L., Zhu, X. G., Gong, J. P., Shaham, Y., & Uhl, G. R. (2006). Rodent
BDNF genes, novel promoters, novel splice variants, and regulation by cocaine. Brain
Research, 1067, 1–12.
Loesch, D. Z., Godler, D. E., Evans, A., Bui, Q. M., Gehling, F., Kotschet, K. E., et al.
(2011). Evidence for the toxicity of bidirectional transcripts and mitochondrial dysfunc-
tion in blood associated with small CGG expansions in the FMR1 gene in patients with
parkinsonism. Genetics in Medicine, 13, 392–399.
Luteijn, M. J., & Ketting, R. F. (2013). PIWI-interacting RNAs: From generation to trans-
generational epigenetics. Nature Reviews Genetics, 14, 523–534.
Lytle, J. R., Yario, T. A., & Steitz, J. A. (2007). Target mRNAs are repressed as efficiently by
microRNA-binding sites in the 5’ UTR as in the 3’ UTR. Proceedings of the National
Academy of Sciences of the United States of America, 104, 9667–9672.
Martignetti, J. A., & Brosius, J. (1993). BC200 RNA: A neural RNA polymerase III product
encoded by a monomeric Alu element. Proceedings of the National Academy of Sciences of the
United States of America, 90, 11563–11567.
Martinez, J., Patkaniowska, A., Urlaub, H., Lührmann, R., & Tuschl, T. (2002).
Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell, 110,
563–574.
Matera, A. G., Terns, R. M., & Terns, M. P. (2007). Non-coding RNAs: Lessons from the
small nuclear and small nucleolar RNAs. Nature Reviews Molecular Cell Biology, 8, 209–220.
Mattick, J. S., & Makunin, I. V. (2005). Small regulatory RNAs in mammals. Human Molec-
ular Genetics, 14(Spec. No. 1), R121–R132.
Meng, L., Person, R. E., & Beaudet, A. L. (2012). Ube3a-ATS is an atypical RNA polymer-
ase II transcript that represses the paternal expression of Ube3a. Human Molecular Genetics,
21, 3001–3012.
Mercer, T. R., Dinger, M. E., & Mattick, J. S. (2009). Long non-coding RNAs: Insights into
functions. Nature Reviews Genetics, 10, 155–159.
Mercer, T. R., Dinger, M. E., Sunkin, S. M., Mehler, M. F., & Mattick, J. S. (2008). Specific
expression of long noncoding RNAs in the mouse brain. Proceedings of the National Acad-
emy of Sciences of the United States of America, 105, 716–721.
Millar, J. K., Wilson-Annan, J. C., Anderson, S., Christie, S., Taylor, M. S., Semple, C. A.,
et al. (2000). Disruption of two novel genes by a translocation co-segregating with
schizophrenia. Human Molecular Genetics, 9, 1415–1423.
Ming, G. L., & Song, H. (2005). Adult neurogenesis in the mammalian central nervous sys-
tem. Annual Review of Neuroscience, 28, 223–250.
Morikawa, T., & Manabe, T. (2010). Aberrant regulation of alternative pre-mRNA splicing
in schizophrenia. Neurochemistry International, 57, 691–704.
Moseley, M. L., Zu, T., Ikeda, Y., Gao, W., Mosemiller, A. K., Daughters, R. S., et al. (2006).
Bidirectional expression of CUG and CAG expansion transcripts and intranuclear poly-
glutamine inclusions in spinocerebellar ataxia type 8. Nature Genetics, 38, 758–769.
Muddashetty, R., Khanam, T., Kondrashov, A., Bundman, M., Iacoangeli, A.,
Kremerskothen, J., et al. (2002). Poly(A)-binding protein is associated with neuronal
BC1 and BC200 ribonucleoprotein particles. Journal of Molecular Biology, 321, 433–445.
Mus, E., Hof, P. R., & Tiedge, H. (2007). Dendritic BC200 RNA in aging and in
Alzheimer’s disease. Proceedings of the National Academy of Sciences of the United States of
America, 104, 10679–10684.
Nagano, T., & Fraser, P. (2011). No-nonsense functions for long noncoding RNAs. Cell,
145, 178–181.
Nagano, T., Mitchell, J. A., Sanz, L. A., Pauler, F. M., Ferguson-Smith, A. C., Feil, R., et al.
(2008). The Air noncoding RNA epigenetically silences transcription by targeting G9a
to chromatin. Science, 322, 1717–1720.
Nakata, K., Lipska, B. K., Hyde, T. M., Ye, T., Newburn, E. N., Morita, Y., et al. (2009).
DISC1 splice variants are upregulated in schizophrenia and associated with risk polymor-
phisms. Proceedings of the National Academy of Sciences of the United States of America, 106,
15873–15878.
Neves-Pereira, M., Cheung, J. K., Pasdar, A., Zhang, F., Breen, G., Yates, P., et al. (2005).
BDNF gene is a risk factor for schizophrenia in a Scottish population. Molecular Psychiatry,
10, 208–212.
Ng, S. Y., Johnson, R., & Stanton, L. W. (2012). Human long non-coding RNAs promote
pluripotency and neuronal differentiation by association with chromatin modifiers and
transcription factors. The EMBO Journal, 31, 522–533.
Nicholls, R. D., & Knepper, J. L. (2001). Genome organization, function, and imprinting in
Prader-Willi and Angelman syndromes. Annual Review of Genomics and Human Genetics,
2, 153–175.
Nieto, R., Kukuljan, M., & Silva, H. (2013). BDNF and schizophrenia: From
neurodevelopment to neuronal plasticity, learning, and memory. Frontiers in Psychiatry,
4, 45.
O’Roak, B. J., Vives, L., Fu, W., Egertson, J. D., Stanaway, I. B., Phelps, I. G., et al. (2012).
Multiplex targeted sequencing identifies recurrently mutated genes in autism spectrum
disorders. Science, 338, 1619–1622.
Pang, K. C., Frith, M. C., & Mattick, J. S. (2006). Rapid evolution of noncoding RNAs:
Lack of conservation does not mean lack of function. Trends in Genetics, 22, 1–5.
Pearson, J. C., Lemons, D., & McGinnis, W. (2005). Modulating Hox gene functions during
animal body patterning. Nature Reviews Genetics, 6, 893–904.
Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S., & Brockdorff, N. (1996). Require-
ment for Xist in X chromosome inactivation. Nature, 379, 131–137.
Persico, A. M., D’Agruma, L., Maiorano, N., Totaro, A., Militerni, R., Bravaccio, C., et al.
(2001). Reelin gene alleles and haplotypes as a factor predisposing to autistic disorder.
Molecular Psychiatry, 6, 150–159.
Petanjek, Z., Judaš, M., Šimic, G., Rasin, M. R., Uylings, H. B., Rakic, P., et al. (2011).
Extraordinary neoteny of synaptic spines in the human prefrontal cortex. Proceedings of
the National Academy of Sciences of the United States of America, 108, 13281–13286.
Plath, K., Fang, J., Mlynarczyk-Evans, S. K., Cao, R., Worringer, K. A., Wang, H., et al.
(2003). Role of histone H3 lysine 27 methylation in X inactivation. Science, 300,
131–135.
Poliseno, L., Salmena, L., Zhang, J., Carver, B., Haveman, W. J., & Pandolfi, P. P. (2010).
A coding-independent function of gene and pseudogene mRNAs regulates tumour biol-
ogy. Nature, 465, 1033–1038.
Pollard, K. S., Salama, S. R., Lambert, N., Lambot, M. A., Coppens, S., Pedersen, J. S., et al.
(2006). An RNA gene expressed during cortical development evolved rapidly in
humans. Nature, 443, 167–172.
Ponjavic, J., Oliver, P. L., Lunter, G., & Ponting, C. P. (2009). Genomic and transcriptional
co-localization of protein-coding and long non-coding RNA pairs in the developing
brain. PLoS Genetics, 5, e1000617.
Ponting, C. P., Oliver, P. L., & Reik, W. (2009). Evolution and functions of long noncoding
RNAs. Cell, 136, 629–641.
Pruunsild, P., Kazantseva, A., Aid, T., Palm, K., & Timmusk, T. (2007). Dissecting the
human BDNF locus: Bidirectional transcription, complex splicing, and multiple pro-
moters. Genomics, 90, 397–406.
Qin, R., Chen, Z., Ding, Y., Hao, J., Hu, J., & Guo, F. (2013). Long non-coding RNA
MEG3 inhibits the proliferation of cervical carcinoma cells through the induction of cell
cycle arrest and apoptosis. Neoplasma, 60, 486–492.
Reif, A., Fritzen, S., Finger, M., Strobel, A., Lauer, M., Schmitt, A., et al. (2006). Neural
stem cell proliferation is decreased in schizophrenia, but not in depression. Molecular Psy-
chiatry, 11, 514–522.
Ricci, S., Businaro, R., Ippoliti, F., Lo Vasco, V. R., Massoni, F., Onofri, E., et al. (2013).
Altered cytokine and BDNF levels in autism spectrum disorder. Neurotoxicity Research,
24, 491–501.
Rinn, J. L., & Chang, H. Y. (2012). Genome regulation by long noncoding RNAs. Annual
Review of Biochemistry, 81, 145–166.
Rinn, J. L., Kertesz, M., Wang, J. K., Squazzo, S. L., Xu, X., Brugmann, S. A., et al. (2007).
Functional demarcation of active and silent chromatin domains in human HOX loci by
noncoding RNAs. Cell, 129, 1311–1323.
Ross-Inta, C., Omanska-Klusek, A., Wong, S., Barrow, C., Garcia-Arocena, D.,
Iwahashi, C., et al. (2010). Evidence of mitochondrial dysfunction in fragile
X-associated tremor/ataxia syndrome. The Biochemical Journal, 429, 545–552.
Rougeulle, C., Cardoso, C., Fontés, M., Colleaux, L., & Lalande, M. (1998). An imprinted
antisense RNA overlaps UBE3A and a second maternally expressed transcript. Nature
Genetics, 19, 15–16.
Samaco, R. C., Hogart, A., & LaSalle, J. M. (2005). Epigenetic overlap in autism-spectrum
neurodevelopmental disorders: MECP2 deficiency causes reduced expression of UBE3A
and GABRB3. Human Molecular Genetics, 14, 483–492.
Sayed, D., & Abdellatif, M. (2011). MicroRNAs in development and disease. Physiological
Reviews, 91, 827–887.
Seila, A. C., Calabrese, J. M., Levine, S. S., Yeo, G. W., Rahl, P. B., Flynn, R. A., et al.
(2008). Divergent transcription from active promoters. Science, 322, 1849–1851.
Singer, O., Marr, R. A., Rockenstein, E., Crews, L., Coufal, N. G., Gage, F. H., et al.
(2005). Targeting BACE1 with siRNAs ameliorates Alzheimer disease neuropathology
in a transgenic model. Nature Neuroscience, 8, 1343–1349.
Sleutels, F., Zwart, R., & Barlow, D. P. (2002). The non-coding Air RNA is required for
silencing autosomal imprinted genes. Nature, 415, 810–813.
Song, R., Hennig, G. W., Wu, Q., Jose, C., Zheng, H., & Yan, W. (2011). Male germ cells
express abundant endogenous siRNAs. Proceedings of the National Academy of Sciences of the
St Pourcain, B., Wang, K., Glessner, J. T., Golding, J., Steer, C., Ring, S. M., et al. (2010).
Association between a high-risk autism locus on 5p14 and social communication spec-
trum phenotypes in the general population. The American Journal of Psychiatry, 167,
1364–1372.
Sullivan, P. F., Kendler, K. S., & Neale, M. C. (2003). Schizophrenia as a complex trait:
Evidence from a meta-analysis of twin studies. Archives of General Psychiatry, 60,
1187–1192.
Taft, R. J., Pheasant, M., & Mattick, J. S. (2007). The relationship between non-protein-
coding DNA and eukaryotic complexity. Bioessays, 29, 288–299.
Tam, O. H., Aravin, A. A., Stein, P., Girard, A., Murchison, E. P., Cheloufi, S., et al. (2008).
Pseudogene-derived small interfering RNAs regulate gene expression in mouse oocytes.
Nature, 453, 534–538.
Tanaka, J., Horiike, Y., Matsuzaki, M., Miyazaki, T., Ellis-Davies, G. C., & Kasai, H. (2008).
Protein synthesis and neurotrophin-dependent structural plasticity of single dendritic
spines. Science, 319, 1683–1687.
Taylor, M. S., Devon, R. S., Millar, J. K., & Porteous, D. J. (2003). Evolutionary constraints
on the disrupted in schizophrenia locus. Genomics, 81, 67–77.
Tiedge, H., Chen, W., & Brosius, J. (1993). Primary structure, neural-specific expression,
and dendritic location of human BC200 RNA. Journal of Neuroscience, 13, 2382–2390.
Tripathi, V., Ellis, J. D., Shen, Z., Song, D. Y., Pan, Q., Watt, A. T., et al. (2010). The
nuclear-retained noncoding RNA MALAT1 regulates alternative splicing by modulat-
ing SR splicing factor phosphorylation. Molecular Cell, 39, 925–938.
Uhde, C. W., Vives, J., Jaeger, I., & Li, M. (2010). Rmst is a novel marker for the mouse
ventral mesencephalic floor plate and the anterior dorsal midline cells. PLoS One, 5,
e8641.
Vallot, C., Huret, C., Lesecque, Y., Resch, A., Oudrhiri, N., Bennaceur-Griscelli, A., et al.
(2013). XACT, a long noncoding transcript coating the active X chromosome in human
pluripotent cells. Nature Genetics, 45, 239–241.
Vlietstra, R. J., van Alewijk, D. C., Hermans, K. G., van Steenbrugge, G. J., & Trapman, J.
(1998). Frequent inactivation of PTEN in prostate cancer cell lines and xenografts. Cancer
Research, 58, 2720–2723.
Voineagu, I., Wang, X., Johnston, P., Lowe, J. K., Tian, Y., Horvath, S., et al. (2011). Trans-
criptomic analysis of autistic brain reveals convergent molecular pathology. Nature, 474,
380–384.
Wang, X. H., Aliyari, R., Li, W. X., Li, H. W., Kim, K., Carthew, R., et al. (2006). RNA
interference directs innate immunity against viruses in adult Drosophila. Science, 312,
452–454.
Wang, K. C., & Chang, H. Y. (2011). Molecular mechanisms of long noncoding RNAs.
Molecular Cell, 43, 904–914.
Wang, P., Ren, Z., & Sun, P. (2012). Overexpression of the long non-coding RNA
MEG3 impairs in vitro glioma cell proliferation. Journal of Cellular Biochemistry, 113,
1868–1874.
Wang, K., Zhang, H., Ma, D., Bucan, M., Glessner, J. T., Abrahams, B. S., et al. (2009).
Common genetic variants on 5p14.1 associate with autism spectrum disorders. Nature,
459, 528–533.
Watanabe, T., Totoki, Y., Toyoda, A., Kaneda, M., Kuramochi-Miyagawa, S., Obata, Y.,
et al. (2008). Endogenous siRNAs from naturally formed dsRNAs regulate transcripts in
mouse oocytes. Nature, 453, 539–543.
Watson, P., Black, G., Ramsden, S., Barrow, M., Super, M., Kerr, B., et al. (2001). Angel-
man syndrome phenotype associated with mutations in MECP2, a gene encoding a
methyl CpG binding protein. Journal of Medical Genetics, 38, 224–228.
Wegiel, J., Kuchna, I., Nowicki, K., Imaki, H., Marchi, E., Ma, S. Y., et al. (2010). The
tic changes. Acta Neuropathologica, 119, 755–770.
Wheeler, E., Huang, N., Bochukova, E. G., Keogh, J. M., Lindsay, S., Garg, S., et al. (2013).
Genome-wide SNP and CNV analysis identifies common and low-frequency variants
associated with severe early-onset obesity. Nature Genetics, 45, 513–517.
Wienholds, E., & Plasterk, R. H. (2005). MicroRNA function in animal development.
FEBS Letters, 579, 5911–5922.
Winter, J., Jung, S., Keller, S., Gregory, R. I., & Diederichs, S. (2009). Many roads to matu-
rity: MicroRNA biogenesis pathways and their regulation. Nature Cell Biology, 11,
228–234.
Wonders, C. P., & Anderson, S. A. (2006). The origin and specification of cortical interneu-
rons. Nature Reviews Neuroscience, 7, 687–696.
Xia, J., Joyce, C. E., Bowcock, A. M., & Zhang, W. (2013). Noncanonical microRNAs and
endogenous siRNAs in normal and psoriatic human skin. Human Molecular Genetics, 22,
737–748.
Yamasaki, K., Joh, K., Ohta, T., Masuzaki, H., Ishimaru, T., Mukai, T., et al. (2003). Neu-
rons but not glial cells show reciprocal imprinting of sense and antisense transcripts of
Ube3a. Human Molecular Genetics, 12, 837–847.
Yang, N., & Kazazian, H. H. (2006). L1 retrotransposition is suppressed by endogenously
encoded small interfering RNAs in human cultured cells. Nature Structural & Molecular
Biology, 13, 763–771.
Ying, L., Huang, Y., Chen, H., Wang, Y., Xia, L., Chen, Y., et al. (2013). Downregulated
MEG3 activates autophagy and increases cell proliferation in bladder cancer. Molecular
BioSystems, 9, 407–411.
Yotova, I. Y., Vlatkovic, I. M., Pauler, F. M., Warczok, K. E., Ambros, P. F., Oshimura, M.,
et al. (2008). Identification of the human homolog of the imprinted mouse Air non-
coding RNA. Genomics, 92, 464–473.
Zhang, X., Gejman, R., Mahta, A., Zhong, Y., Rice, K. A., Zhou, Y., et al. (2010). Mater-
nally expressed gene 3, an imprinted noncoding RNA gene, is associated with menin-
gioma pathogenesis and progression. Cancer Research, 70, 2350–2358.
Zhang, X., Zhou, Y., Mehta, K. R., Danila, D. C., Scolavino, S., Johnson, S. R., et al.
(2003). A pituitary-derived MEG3 isoform functions as a growth suppressor in tumor
cells. Journal of Clinical Endocrinology and Metabolism, 88, 5119–5126.
Zhao, J., Dahle, D., Zhou, Y., Zhang, X., & Klibanski, A. (2005). Hypermethylation of the
promoter region is associated with the loss of MEG3 gene expression in human pituitary
tumors. Journal of Clinical Endocrinology and Metabolism, 90, 2179–2186.
Ziats, M. N., & Rennert, O. M. (2013). Aberrant expression of long noncoding RNAs in
autistic brain. Journal of Molecular Neuroscience, 49, 589–593.
Zoghbi, H. Y. (2003). Postnatal neurodevelopmental disorders: Meeting at the synapse?
Science, 302, 826–830.
CHAPTER THREE
Identifying Essential Cell Types

and Circuits in Autism Spectrum
Disorders
Susan E. Maloney*,†, Michael A. Rieger*,†, Joseph D. Dougherty*,†,1
*Department of Genetics, Washington University School of Medicine, St. Louis, Missouri, USA
†
Department of Psychiatry, Washington University School of Medicine, St. Louis, Missouri, USA
1
Corresponding author: e-mail address: jdougherty@genetics.wustl.edu
Contents
1. Introduction to Cell Types and Autism Spectrum Disorder 62
2. Genetics of ASD 63
3. Brief Review of Rodent Behavioral Assays Relevant to ASD Symptoms 66
4. ASD Models Involving Serotonergic Neurons 69
5. ASD Models Involving GABAergic Interneurons 74
6. ASD Models Involving the Cerebellum 78
7. ASD Models Involving the Striatum 81
8. Other Regions and Cell Types 83
9. Conclusions 84
Acknowledgments 85
References 85
Abstract
Autism spectrum disorder (ASD) is highly genetic in its etiology, with potentially hun-
dreds of genes contributing to risk. Despite this heterogeneity, these disparate genetic
lesions may result in the disruption of a limited number of key cell types or circuits—
information which could be leveraged for the design of therapeutic interventions. While
hypotheses for cellular disruptions can be identified by postmortem anatomical analysis
and expression studies of ASD risk genes, testing these hypotheses requires the use of
animal models. In this review, we explore the existing evidence supporting the contri-
bution of different cell types to ASD, specifically focusing on rodent studies disrupting
serotonergic, GABAergic, cerebellar, and striatal cell types, with particular attention to
studies of the sufficiency of specific cellular disruptions to generate ASD-related behav-
ioral abnormalities. This evidence suggests multiple cellular routes can create features of
the disorder, though it is currently unclear if these cell types converge on a final com-
mon circuit. We hope that in the future, systematic studies of cellular sufficiency and
genetic interaction will help to classify patients into groups by type of cellular disrup-
tions which suggest tractable therapeutic targets.

http://dx.doi.org/10.1016/B978-0-12-418700-9.00003-4
62 Susan E. Maloney et al.
1. INTRODUCTION TO CELL TYPES AND AUTISM

SPECTRUM DISORDER
Autism spectrum disorder (ASD) is a pervasive developmental disor-
der, with prevalence rates now estimated at more than 1 in 100 (Kirov et al.,
2012). While often comorbid with a variety of other medical problems and
behavioral difficulties, including epilepsy, ADHD, and intellectual disability,
a diagnosis of ASD is defined by key deficits in social interaction and com-
munication, as well as restricted interests, stereotyped behaviors, and resis-
tance to change. Twin and family studies suggest that a substantial
proportion of the risk for developing ASD is heritable (Bailey et al.,
1995; Hallmayer et al., 2011), with monozygotic twins displaying
60–90% concordance in ASD diagnoses. However, genetic studies indicate
a remarkable heterogeneity, with recent estimates suggesting hundreds of
different genes may contribute to this disorder (Klei et al., 2012). Yet, indi-
viduals with these different genetic etiologies share a common symptom-
atology. This suggests that these distinct genetic lesions must be
converging on a discrete set of cell types or circuits in the brain that mediate
these behavioral disruptions.
The brain contains hundreds of distinct cell types, each a wide range of
morphological, anatomical, and molecular features. However, pathological
conditions can be caused by disruption of just a single cell type. For example,
destruction of dopaminergic neurons of the substantia nigra is sufficient to
generate most of the characteristic symptoms of Parkinson’s disease. Like-
wise, removal of hypocretin neurons is sufficient to generate the behavioral
features of narcolepsy with cataplexy (Peyron et al., 2000; Zhang et al.,
2007). This suggests that individual neurological symptoms can be mapped
to deficiencies in particular cell types or circuits. A key question for the neu-
robiology of ASD is which cellular disruptions are sufficient to create the
symptoms. Importantly, an understanding of cellular and circuit level dis-
ruptions may permit the identification of novel avenues for treatment—if
individuals with distinct genetic lesions share a common circuit level pathol-
ogy, then the circuit becomes the target of treatment, rather than the gene.
For example, although the genetics of risk for idiopathic Parkinson’s are not
understood for most cases, most cases are responsive to dopamine replace-
ment therapies. It is our hope that identification of cellular disruptions that
are sufficient to generate ASD symptomatology will lead to similar insights
for treatment that will be broadly applicable.
Essential Cell Types and Circuits in ASD 63
How can one identify these cellular disruptions? There are several com-
plimentary approaches. Most directly, human brain imaging of patient
populations and postmortem anatomical experiments allow for identifica-
tion of regional and/or cellular abnormalities from human patients, respec-
tively. More indirectly, one can examine the expression patterns of known
ASD risk genes to identify the cells and regions most likely to be impacted by
their disruption. For example, if an ASD risk gene is only expressed in one
population of cells in the brain, then these cells must almost certainly medi-
ate the effect of the gene’s mutation. These approaches allow for the gen-
eration of hypotheses regarding cellular deficits, but testing these
hypotheses requires the use of animal models. Therefore, an essential com-
plement to patient-oriented approaches is the use of animal models to test
the sufficiency of disruptions in particular cell types to recreate key symp-
toms of the disorder. This can be done genetically in the mouse either by
the deletion of a gene only employed by a single cell type in the brain, or
by creating conditional knockouts using the Cre–Lox system (Nagy, 2000).
Here, we are going to focus on reviewing the existing data, particularly
from conditional mouse models, regarding the sufficiency of certain cell
types for the generation of ASD-like behavioral features. We will briefly
overview the genetics of the disorder with a focus on using the expression
of ASD-associated genes to guide us toward circuits that may be most
disrupted by their loss. We will then briefly discuss behavioral methods of
assessment of the ASD-like symptoms in rodents, as a preview to presenting
the current knowledge regarding the cell types that may mediate ASD-like
behaviors. We will focus on the four regions or cell types that have received
substantial attention in ASD thus far: serotonin-producing neurons,
GABAergic interneurons, the cerebellum, and the striatum.
2. GENETICS OF ASD
The genetics of ASD are thoroughly reviewed in recent publications
(Berg & Geschwind, 2012; Geschwind, 2011; Persico & Napolioni, 2013).
Briefly, the genetic variation contributing to risk in ASD has been investi-
gated in one of several ways. These have included identification of genes for
classic ASD-associated syndromes, common variant association studies, and
rare variant analyses. ASD-associated syndromes, such as Fragile
X syndrome, Rett syndrome, and tuberous sclerosis are typically caused
by highly penetrant, loss-of-function mutations in single genes (FMR1,
MECP2, and TSC1 or 2, respectively). Some of these genes have been

shown to have regionalized patterns of expression in the brain, such as
SHANK3, which is involved in Phelan–McDermid syndrome and the
expression of which is enriched in the striatum. However, ASD-associated
syndromes account for less than 10% of ASD cases. Genetic variation con-
tributing to risk in idiopathic cases was initially explored through genome-
wide association studies (GWAS) of common variants using case–control
and family studies (Anney et al., 2012; Berg & Geschwind, 2012; Wang
et al., 2009; Weiss, Arking, Daly, & Chakravarti, 2009). Common variation
has been shown to contribute significantly to risk in a multiple hit, or
oligogenic, model (Klei et al., 2012) though the contribution of each gene
is quite small. Currently, no loci have been reproducibly associated, yet esti-
mates are that several hundred genes will be implicated once enough subjects
have been collected for sufficient statistical power. Variants currently
approaching significance are near genes previously suggested to be ASD
associated (Anney et al., 2012). There has also been considerable effort in
the last several years in understanding the contribution of rare or de novo
single-nucleotide and copy number variants in contributing to ASD risk. In
a landmark set of publications in 2012, whole-exome sequencing (WES)
was performed to identify the burden of nonsynonymous variants in ASD cases
compared to controls (Chahrour et al., 2012; Iossifov et al., 2012; Neale et al.,
2012; O’Roak et al., 2012; Sanders et al., 2012). These reports make use of
families, which include trios (two parents and ASD proband) as well as quartets
(trios with unaffected sibling). Some of these reports have benefited greatly
from the latter (Iossifov et al., 2012; O’Roak et al., 2012; Sanders et al.,
2012) as the burden in probands can be compared directly to their siblings
at the same loci. These reports identify about 120 novel risk genes, only
8 of which were previously suggested by GWAS (SETBP1, SHANK2,
DYRK1A, SLC7A7, RPS6KA3, RELN, NRXN1, and GRIN2B).
Many reports, of both common and rare variation, attempt to make sense
of these genes by analysis of protein–protein interaction networks, or ana-
lyses for enrichment in particular biological processes or molecular func-
tions, as defined by gene ontologies (GO). However, it has long been
recognized that the data used to generate protein interaction networks suffer
from a high false discovery rate (Deane, Salwinski, Xenarios, & Eisenberg,
2002), and GO term assignments also exhibit biases (du Plessis, Skunca, &
Dessimoz, 2011). It may be helpful to augment these networks with infor-
mation regarding overlapping spatial and temporal patterns of expression.
A few of the genes recently identified by WES are known to have region-
alized patterns of expression, and these are summarized in Table 3.1. The
Table 3.1 Genes identified by recent whole-exome sequencing (WES) studies with
regionalized patterns of expression
Gene
symbol Region, cell type References
FOXP1 Striatum, medium spiny neurons Ferland, Cherry, Preware,
Morrisey, and Walsh (2003),
Tamura, Morikawa, Iwanishi,
Hisaoka, and Senba (2004)
GRIN2B Striatum, all cell types Kuppenbender, Standaert,
Feuerstein, Penney, and Young
(2000)
NRXN1 Cortex, Ntsr1 þ and Cck þ cells; Dougherty, Schmidt, Nakajima,
cerebellum, granule cells and Heintz (2010)
PLXNB1 Cerebellum, purkinje cells Fazzari, Penachioni, Gianola,
Rossi, and Eickholt (2007)
RELN Cortex, GABA interneurons; Pesold, Impagnatiello, Pisu,
hippocampus, GABA Uzunov, and Costa (1998)
interneurons; cerebellum, granule
cells
TBR1 Cortex Bulfone, Smiga, Shimamura,
Peterson, and Puelles (1995),
Englund et al. (2005)
A minority of genes recently identified by WES studies have patterns of expression which have been
previously studied in the brain. Relevant references are listed alongside the regions and cell types
implicated.
more we learn about the spatial and temporal dynamics of ASD risk genes,
the better poised we are to make testable hypotheses about underlying cel-
lular and molecular mechanisms in the disorder. Currently, lacking is a
method akin to GO, which provides statistical analysis for the enrichment
of candidate genes in particular regions or cell types. We have recently
developed such a method, cell-type-specific expression analysis, and appli-
cation of this method to lists of previously implicated genes in ASD (Basu,
Kollu, & Banerjee-Basu, 2009) suggests a modest enrichment in genes found
in cortical interneurons and the striatum (not shown). These analyses will
likely be more informative as the number of candidate genes increases.
Furthermore, with advances in genome editing technologies ( Joung &
Sander, 2013; Wang et al., 2013), it will become easier to model the effects
of targeted mutations, in single and multiple genes, and study the effects of
these on behavior. While the relevance to ASD risk has been explored in
mouse knockout models for many genes, targeted knockout studies in
specific cell populations have not been performed for the overwhelming
majority of candidate genes, with the exception of genes for some ASD-
related syndromes such as Tsc1 (Reith et al., 2013) and Mecp2 (Adachi,
Autry, Covington, & Monteggia, 2009; Alvarez-Saavedra, Saez, Kang,
Zoghbi, & Young, 2007; Chao et al., 2010; Fyffe et al., 2008;
Michaelson et al., 2012; Samaco et al., 2009).
Mouse models of ASD risk genes provide powerful tools for both explor-
ing the cellular phenotype that results when these genes are disrupted, as well
as the larger phenotype of the behaving animal, often mirroring the symp-
toms observed in humans. In the subsequent sections, we will first review
how ASD-like behaviors are identified and interpreted in mice. Then we
will proceed to discuss the existing evidence in several mouse models, with
a focus on conditional deletions and ASD genes that implicate certain cir-
cuits by their spatially or temporally restricted patterns of expression.
3. BRIEF REVIEW OF RODENT BEHAVIORAL ASSAYS

RELEVANT TO ASD SYMPTOMS
Mouse models provide an important complement to environmental
and genetic studies of ASD risk in humans. Mouse models serve three essential
functions. First, models mimicking human genetic polymorphisms—
particularly rare deleterious variants—provide valuable experimental
support for the causality of the genetic mutation. If a rare variant in humans
implicates a particular gene, even when there are not sufficient cases available
for statistical association, recapitulation of ASD-like features in the mouse pro-
vides strong causal inference for the role of the gene in ASD-like behaviors
(Abrahams & Geschwind, 2008). Disruptions of genes responsible for human
syndromes with some association to ASD, such as Rett or Fragile X, result in
similar syndromes in mice (Shahbazian et al., 2002; The Dutch-Belgian
Fragile X Consortium, 1994). Second, mice provide experimental opportu-
nities to dissect the neurobiological mechanisms mediating both normal social
behaviors, as well as cellular disruptions resulting from particular genetic
manipulations. Given the large degree of heterogeneity in human causes of
ASD, identification of common neurobiological features across models will
be essential to development of broadly applicable treatments.
ASD in humans is defined by deficits in social behavior and communi-
cation, as well as stereotypies and resistance to change. While any human
disease cannot be perfectly modeled in a mouse, both social and
communicative behavior, as well as resistance to change, can be operation-

ally assayed in the mouse by a variety of behavioral paradigms. In this first
section, the most common assays used to evaluate ASD-relevant behaviors
will be briefly discussed as they are reviewed elsewhere in greater detail
(Crawley, 2012; Moy, Nadler, Magnuson, & Crawley, 2006; Silverman,
Yang, Lord, & Crawley, 2010; Wohr & Scattoni, 2013). Then we will
discuss what cell- or region-specific genetic alterations reveal about the neu-
robiology of ASD symptoms.
As mice are social creatures, several assays have been developed to assess
disruptions to social behaviors. Key social behavior paradigms include social
interaction, juvenile play, and resident intruder, which evaluate reciprocal
social behaviors during full contact between the mice (Pellis & Pasztor,
1999; Scattoni, Martire, Cartocci, Ferrante, & Ricceri, 2013; Scattoni
et al., 2008) and the social approach assay, which is designed to measure
sociability initiated by the test mouse only (Moy et al., 2004). Abnormal
social behaviors can include decreased or increased sociability measured
by proximity to or contact with another mouse, agonistic behaviors indicat-
ing increased aggression, or increased sociopositive behaviors like following
or allogrooming. Evaluation of a genetic model in multiple social assays will
allow for a more complete understanding of the nature of the social deficit.
While mice do not use language, mice do employ vocal systems of com-
munication which are socially conditioned, allowing for analysis of commu-
nication deficits. Mice emit ultrasonic vocalizations (USVs) in response to
certain social stimuli such as maternal separation, a possible sexual partner,
or a territorial intruder. In the maternal separation paradigm, frequently used
in the ASD literature, mouse pups emit USVs in response to separation from
the dam. While this is used as a measure of communication (Hofer, Shair, &
Brunelli, 2002), factors like anxiety levels can greatly impact this behavior as
well. Additionally, mice produce vocalizations during juvenile social
encounters, though this assay has rarely been employed in mouse models
of ASD (Cheh et al., 2006; McFarlane et al., 2008; Panksepp et al., 2007;
Scattoni, Ricceri, & Crawley, 2011). Deficits in USVs during juvenile social
encounters in mice may have more face validity for communication deficits
seen in children with ASD during peer interactions.
Aside from vocalization, urinary scent marking behaviors, such as time
near another animal’s urinary mark or frequency of urinary marks in
response to another animal, can serve as a measure of social communication
(Kane et al., 2012). This may be a more ethologically representative assay of
communicative behaviors as mice rely heavily on olfaction as a mode of
communication (Arakawa, Blanchard, Arakawa, Dunlap, & Blanchard,

2008), but does not have a clear human analog.
A variety of assays exist to evaluate the different aspects of restricted
behaviors or resistance to change. Interpretation of stereotyped or even
repetitive behaviors can be more straightforward than that of assays assessing
resistance to change. Assays include quantification of spontaneous stereo-
typed behaviors such as self-grooming, digging in bedding, or locomotor
activities such as circling or flipping (Silverman et al., 2010), and repetitive
behaviors such as increased marble burying or nestlet shredding in the
homecage (Kane et al., 2012; Thomas et al., 2009). Resistance to change
is also measured by failure to exhibit a wild type-like change in behavior
during reversal tasks such as rewarded alternation T-maze or reversal trials
in the Morris water maze. These require the mouse to extinguish a previ-
ously learned response in favor of a new one (Kirsten et al., 2012; Moy et al.,
2006). Performance in exploratory tasks can be used to evaluate resistance to
change such as the spontaneous alternation T-maze or holeboard explora-
tion/olfactory preference test which measure the tendency of the mouse
to repeatedly explore the same arm sequentially (Silverman et al., 2010)
or change hole-poking behavior following familiarization with a food
reward (Dougherty et al., 2013; Moy et al., 2008), respectively. It is valuable
to evaluate mice in multiple assays to understand the full range of the model’s
behavioral disinhibition phenotype.
The multiple comorbidities associated with ASD can also be tested in
rodents. Hyperactivity can be assessed in open field assays, learning, and
memory with the classic Morris water maze or Barnes maze, and epilepsy
is readily apparent by EEG studies of the rodent cortex. In addition, though
it is not part of the classical diagnostic criteria for ASD, children with ASD
often show profound deficits in motor behavior (reviewed in Chapter 7),
which can also be assessed readily in the mouse using sensorimotor batteries
as well as rotarod assays.
As with all analyses of complex behaviors, performance in tests relevant
to ASD requires some baseline motor capacity. Therefore, it is important to
evaluate the locomotor activity levels and sensorimotor abilities of the mice
in the proper control tasks to permit appropriate interpretation of more
complex behavioral results (Dougherty et al., 2013; Moy et al., 2008).
The behavioral assays listed above do not exhaust those applicable to
ASD-related behaviors. Comprehensive and informative reviews on the
subject are available and should be consulted when designing a study of
an ASD model (Crawley, 2012; Moy et al., 2006; Silverman et al., 2010;
Wohr & Scattoni, 2013). Nonetheless, the assays discussed are the most
widely used in the studies highlighted below characterizing the cellular
mediators of ASD behaviors.
4. ASD MODELS INVOLVING SEROTONERGIC NEURONS

Serotonin (5-HT) neurons were one of the earliest suspected cell types
to be disrupted in individuals with ASD. Although their cell bodies are
restricted to the raphe nuclei of the midbrain and hindbrain, 5-HT neurons
project widely throughout the neuraxis and play a profound neu-
romodulatory role in the behavior of many other circuits and cell types.
5-HT has long been implicated in regulation of normal behaviors such as
sleep and arousal, in addition to potentially being involved in a range of psy-
chiatric disorders. Disruption of the serotonergic system is clearly sufficient
to induce abnormal social behaviors, with increased aggression being the
most frequently reported throughout the animal literature (see Miczek
et al., 2004 for a review). A number of lines of evidence from clinical
populations, pharmacotherapy studies, and genetic mouse models suggest
that abnormalities in the serotonergic system may also contribute to the eti-
ology of ASD. Primarily, it is widely replicated that at least 25% of ASD
patients have elevated levels of 5-HT in whole blood platelets, not due to
possible artifacts such as diet (Anderson et al., 1987; Betancur et al., 2002;
Cook & Leventhal, 1996; Schain & Freedman, 1961). While 5-HT in
the blood does not derive from the central nervous system (CNS), the
5-HT transporter protein (SLC6A4) is responsible for the uptake of
5-HT into the blood platelets as well as terminals in the brain (Lesch,
Wolozin, Murphy, & Reiderer, 1993). Blood platelet hyperserotonemia
could result from increased SLC6A4 activity in ASD individuals, which
would also deplete synapses of 5-HT more quickly, ultimately reducing
5-HT activity in the brain. Examination of human postmortem tissue rev-
ealed increased SLC6A4 immunoreactivity in the brains of autistic subjects
(Azmitia, Singh, & Whitaker-Azmitia, 2011). This is further supported by
studies showing that decreasing 5-HT activity through tryptophan deple-
tion, the 5-HT precursor acquired through diet, can exacerbate repetitive
thoughts and behaviors, aggression, anxiety, and irritability in ASD adults
(Cook & Leventhal, 1996; McDougle et al., 1993). These findings suggest
a role for low synaptic levels of 5-HT in a subset of ASD cases.
Drugs that act to increase 5-HT activity in the brain have been investi-
gated as pharmacotherapies for ASD symptoms. Clinical trials investigating
the use of selective serotonin reuptake inhibitors (SSRIs) in the treatment of

ASD symptoms have yielded mixed results. A small but significant effect in
the treatment of repetitive behaviors with SSRIs is suggested in the publi-
shed literature (Carrasco, Volkmar, & Bloch, 2012). However, the effect
may be due to publication bias if studies that find a lack of support for SSRI
therapy in ASD remain unpublished (Carrasco et al., 2012). This indicates
that inhibition of SLC6A4 and the resulting increase in synaptic 5-HT is not
sufficient as a treatment for ASD symptoms. However, if serotonergic dys-
function only results in a subset of ASD cases, as the hyperserotonemia
results suggest, then complete efficacy of SSRIs in the treatment of all
ASD individuals is not expected. Current FDA-approved drugs for the treat-
ment of ASD include the atypical antipsychotics aripiprazole (Abilify) and
risperidone (Risperdal). These drugs act as antagonists or inverse agonists
at many 5-HT receptors and SLC6A4, as well as other neuromodulatory
receptors such as dopaminergic, adrenergic, histaminergic, and muscarinic
receptors. These drugs reduce irritability, hyperactivity, and stereotypies/
repetitive behaviors in children and adolescents with ASD. This is a similar
reduction as seen with SSRI treatment, but with a more rapid onset
(Canitano & Scandurra, 2011; Ching & Pringsheim, 2012; Cook &
Leventhal, 1996). These findings implicate the serotonin system in the
symptoms of resistance to change or repetitive behaviors, at least in regard
to acute response to pharmacological treatments. Genetic models which
globally disrupt genes whose expression is specific to the serotonin system,
or which conditionally disrupt ASD-associated genes in serotonergic neu-
rons, serve as tools to dissect the role played by the serotonin system in
ASD-related behaviors.
Thus far, there are very few 5-HT-specific disruptions of broadly
expressed ASD-associated genes in animal models. One method for doing
so uses the promoter for the Fev gene (also known as Pet1) to drive expres-
sion of Cre recombinase. Fev is an Ets-family transcription factor shown to
be necessary for early specification of the 5-HT neurons (Hendricks et al.,
2003). From among genes associated with ASD risk, to date, this has only
been employed to disrupt the Rett syndrome gene Mecp2 (behavioral fea-
tures of Rett syndrome will be discussed in greater detail below).
Serotonergic-specific disruption of this gene results in a decrease of the sero-
tonin synthesis enzyme tryptophan hydroxylase 2 (Tph2) and a concomitant
decrease in 5-HT levels. These mice demonstrate increased aggressive
behaviors, but no evidence of repetitive behaviors. Mecp2 deletion in
5-HT neurons was clearly not sufficient to recreate the entire Rett
syndrome phenotype as these mice also did not show motor deficits, breath-
ing irregularities, or heightened anxiety (Samaco et al., 2009). In contrast to
this conditional deletion, there are a fair number of deletions of genes spe-
cific to serotonin cells, such as Tph2 and Slc6a4 (the serotonin transporter),
which can also serve to more broadly elucidate the sufficiency of serotoner-
gic disruption in generating ASD-like behaviors.
Many mutations of 5-HT-cell-specific genes result in ASD-like behav-
iors (see Table 3.2). Complete depletion of brain 5-HT by deletion of the
gene encoding Tph2, the rate-limiting enzyme in the synthesis of CNS
5-HT, results in abnormal social behaviors, communication deficits, and
repetitive behaviors (Alenina et al., 2009; Angoa-Perez et al., 2012; Kane
et al., 2012; Mosienko et al., 2012). A knock-in mouse model expressing
a mutant, low-activity form of Tph2, equivalent to a rare human variant,
also exhibits abnormal social behavior and an approximate 80% reduction
in brain 5-HT (Beaulieu et al., 2008). Likewise, mice null for Slc6a4, exhibit
abnormal social behaviors and repetitive behaviors as well as a loss of about
half of the serotonin-expressing neurons and reduced overall brain 5-HT
levels (Kalueff, Fox, Gallagher, & Murphy, 2007; Moy et al., 2009). While
an increase in 5-HT concentration has been reported in specific brain areas
like the striatum of Slc6a4/ mice (Mossner, Simantov, Marx, Lesch, &
Seif, 2006), it is likely due to compensatory 5-HT uptake by the dopamine
transporter in these areas (Zhou, Lesch, & Murphy, 2002) and not reflective
of an overall increase in brain 5-HT. Heterozygous Slc6a4 mutants display
ASD-like behaviors to a lesser degree than Slc6a4/ mice; however, 5-HT
levels were not reported in these mice (Kyzar et al., 2012; Moy et al., 2009).
Mice expressing a high activity Slc6a4 variant, Ala56, have unchanged over-
all 5-HT levels but do exhibit increased 5-HT clearance rates (Veenstra-
VanderWeele et al., 2012). Disrupted social and communicative behaviors
as well as increased stereotyped behaviors are demonstrated by these mice.
Interestingly, both mice lacking Slc6a4 and those expressing a high activity
Slc6a4 variant exhibit ASD-like phenotypes. Both models would be
predicted to have a decrease of synaptic serotonin overall—the Ala56 variant
due to more rapid clearance and the knockout due to long-term depletion of
serotonin from the presynapse in the absence of the ability to efficiently
recycle the transmitter. Finally, mice mutant for the Itgb3 gene, which
encodes a protein that interacts with Slc6a4, show slight social behavior def-
icits and repetitive behaviors as well as a reduced volume of the serotonergic-
expressing neurons of the dorsal raphe nucleus (Carter et al., 2011; Ellegood,
Henkelman, & Lerch, 2012).
Table 3.2 ASD-related phenotypes of genetic mouse models of the serotonin system
Stereotyped/repetitive
5-HT Abnormal social Communication behaviors, resistance to
Mutation 5-HT levels neurons behaviors deficits change References
/
Celf6 Reduced – Normal sociability Decreased pup Trend toward failed Dougherty et al. (2013)
(30%) USVs reversal performance;
failure to change hole-
poking behavior
Itgb3/ – Reduced Normal sociability; lack – Increased self-grooming Carter et al. (2011),
of preference for social in novel environment Ellegood et al. (2012)
novelty
Itgb3þ/ – – Normal sociability and – Slightly increased self- Carter et al. (2011)
preference for social grooming in novel
novelty environment
Slc6a4/ Reduced Reduced Decreased sociability; – Increased self-grooming Kalueff et al. (2007),
(50%) increased sensitivity to in homecage; normal Moy et al. (2009)
social stress; reduced self-grooming in novel
aggression; increased environment; normal
sociopositive behaviors nest building
Slc6a4þ/ – – Normal sociability in – Increased self-grooming Page et al. (2009), Kyzar
males; decreased in homecage; normal et al. (2012), Moy et al.
sociability in females; self-grooming in novel (2009)
normal preference for environment
social novelty; slightly
reduced aggression
Slc6a4 Unchanged – Decreased sociability; Decreased pup Repetitive homecage Veenstra-VanderWeele
Ala56 with increased submission to USVs wire hanging; normal et al. (2012)
(high- increased social dominance marble burying and
activity 5-HT self-grooming in
variant) clearance homecage
Tph2/ Absent Intact Postnatal lack of Decreased Increased nestlet Angoa-Perez et al.
preference for maternal urinary scent shredding, marbling, (2012), Kane et al.
scent; social memory marking burying, and digging in (2012), Mosienko et al.
deficits; social odorant episodes and mixed C57BL/6J-129Sv (2012), Alenina et al.
disinterest; decreased investigation background; decreased (2009)
social interaction time; marble burying with
lack of preference for increased activity in
social novelty; increased C57BL/6J background;
aggression increased motor
impulsivity; normal
reversal performance
Tph2 Reduced – Increased aggression – – Beaulieu et al. (2008)
R441H (80%)
(low-
activity
variant)
The impact of serotonin-related genetic mutation on 5-HT levels, 5-HT-expressing neurons, and behavioral phenotypes relevant to the core ASD symptoms.
Dash (–) indicates behavior was not assessed.
Building on these findings we employed Translating Ribosome Affinity

Purification (TRAP) to identify additional gene transcripts enriched in the
serotonergic system and screened for polymorphisms in patients that may be
related to ASD symptoms (Dougherty et al., 2013). Of the transcripts iden-
tified, we found that polymorphisms in CELF6, which is thought to code
for an RNA-binding protein, may contribute to ASD risk in patients. Global
disruption of the murine orthologue of CELF6 resulted in a 30% decrease in
levels of 5-HT extracted from brain tissue, early communicative deficits, and
evidence for resistance to change. Overall, this suggests polymorphisms in
the Celf6 gene may contribute to ASD-related behaviors in mice and
humans.
Though it is difficult to measure directly, ostensibly all of these mutations
appear to reduce the levels of synaptic 5-HT activity. Thus, taken together,
the above studies suggest disruptions of 5-HT neurons that result in reduced
synaptic 5-HT are sufficient to generate some ASD-related behaviors. This
is supported by a study that restored 5-HT levels in Tph2/ mice through
administration of the immediate 5-HT precursor, 5-hydroxytryptophan,
and reported rescue of social behaviors and partial rescue of repetitive behav-
iors (Angoa-Perez et al., 2012). Yet, questions remain as to the exact neu-
robiological mechanism by which these disruptions lead to ASD-like
behaviors, and whether a 5-HT-related mechanism accounts for as substan-
tial a proportion of human cases that the blood findings would suggest.
Since rescue of 5-HT levels in mice only partially alleviates disrupted behav-
iors (Angoa-Perez et al., 2012), this suggests reduced 5-HT levels may also
have durable developmental consequences that may also contribute to ASD
symptoms. Likewise, as a largely neuromodulatory system, 5-HT-mediated
behavior disruptions must be transmitted through other circuits that are
more directly wired as executors of behavior.
5. ASD MODELS INVOLVING GABAergic INTERNEURONS

g-Aminobutyric acid (GABA) is the dominant fast-acting inhibitory
neurotransmitter in the brain, and GABAergic interneurons have funda-
mental roles in multiple circuits, including in the cortex, in fine-tuning
the transmission of information, and in suppressing excess excitation.
GABAergic interneurons make up only about 20% of cortical neurons,
yet these neurons are integral to maintaining proper function and balance
in cortical circuits (Markram et al., 2004; Taniguchi et al., 2011).
A disturbance in the CNS excitation/inhibition balance between the glut-

amatergic and GABAergic systems has been suggested in the etiology of
ASD (Rubenstein & Merzenich, 2003) and is consistent with the observed
high comorbidity with epilepsy. The animal model research suggests the pri-
mary factor in the excitation/inhibition imbalance is loss of GABAergic
inhibitory control over excitatory neurons. This loss of inhibition appears
to occur one of two ways: either disruption in GABAergic neurotransmis-
sion at the synaptic level or aberrant organization or loss of GABAergic neu-
rons during development. Mutations in several synaptic genes, such as those
encoding neuroligins, members of the SHANK family of proteins at the syn-
aptic density, and neurexins, give rise to ASD-relevant phenotypes in mouse
models (see Persico & Napolioni, 2013 for review), supporting the hypoth-
esis of altered synaptic communication in ASD etiology. And, there is some
support for a deficit in cortical interneurons from one human postmortem
transcriptomic study (Voineagu et al., 2011). Below, genetic models of
GABAergic perturbation in relation to ASD-relevant behaviors are
discussed.
At the synapse, the GABAA receptor is highly involved in the inhibition
of excitatory neural pathways and is expressed early in development (Muhle,
Trentacoste, & Rapin, 2004). Cytogenetic abnormalities within the human
chromosome 15q11–q13 region, which houses the GABAA receptor sub-
unit genes GABRB3, GABRA5, and GABRG3, have been associated with
ASD susceptibility, as well as the neurodevelopmental disorders (Prader–
Willi syndrome and Angelman syndrome), which are frequently comorbid
with ASD (Buxbaum et al., 2002; Cook et al., 1998; Michaelson et al., 2012;
Persico & Napolioni, 2013; Wagstaff et al., 1991).
Mice mutant for the GABAA receptor shed light on the potential for
disrupted GABAergic neurotransmission to generate ASD symptoms.
Homozygous Gabrb3 knockouts, and to a lesser extent heterozygous knock-
outs, display EEG abnormalities and epilepsy along with sensory distur-
bances (DeLorey et al., 1998; Liljelund, Handforth, Homanics, & Olsen,
2005; Ugarte, Homanics, Firestone, & Hammond, 2000). Behavioral
phenotyping relevant to ASD symptoms revealed repetitive behaviors,
behavioral disinhibition, and abnormal social behaviors in Gabrb3-deficient
mice (DeLorey et al., 1998; DeLorey, Sahbaie, Hashemi, Homanics, &
Clark, 2008). These results indicate that either disruption of inhibitory con-
trol directly results in ASD behaviors or the ensuing hyperexcitability dis-
rupts the homeostasis of other systems in the brain controlling these
behaviors.
Other mouse models provide support for perturbations of the

GABAergic system in ASD etiology, by conditional deletion of broadly
expressed genes. For example, mice completely deficient for Mecp2, a mouse
model of Rett syndrome, develop normally until about 5 weeks of age and
then exhibit physical and behavioral declines (Chen, Akbarian, Tudor, &
Jaenisch, 2001). These mice demonstrate hyperactivity, abnormal social
behaviors, motor deficits, irregular breathing, stereotypic and repetitive
behaviors, decreased weight, anxiety, and premature lethality (Chao
et al., 2010; Guy, Hendrich, Holmes, Martin, & Bird, 2001; Schaevitz,
Moriuchi, Nag, Mellot, & Berger-Sweeney, 2010). In the CNS, they show
decreased brain weight and brain cell size with a decrease in cortical activity
resulting from a shift in the excitation/inhibition balance (Dani et al., 2005).
The diminished inhibitory rhythmic activity renders circuits like the hippo-
campal CA3 circuit prone to hyperexcitability (Zhang, He, Jugloff, &
Eubanks, 2008). Abnormal sensorimotor behaviors are reversed in Mecp2
null mice with ketamine treatment (Kron et al., 2012), suggesting the con-
sequent hyperexcitability from Mecp2 deletion is primary in the behavior
etiology.
Overall, only partial recapitulation of the Rett syndrome phenotype is
observed with conditional deletions of Mecp2 using the Cre–Lox system
to target the glutamatergic pyramidal cell layer of the forebrain (Alvarez-
Saavedra et al., 2007), dopaminergic cells (Samaco et al., 2009), serotonergic
cells (Samaco et al., 2009), hypothalamic cells (Fyffe et al., 2008), and
amygdalar cells (Adachi et al., 2009). Of these, only the glutamatergic con-
ditional knockout demonstrates abnormal social interaction and the seroto-
nergic and hypothalamic conditional knockouts display increased
aggression, although no other behaviors relevant to the core ASD symptoms
were observed. The dopaminergic and amygdalar conditional knockouts did
not exhibit any of the phenotypes relevant to the core ASD symptoms.
In contrast, disruption of the GABAergic system is sufficient to generate
the Rett syndrome phenotype in Mecp2/ mice. The use of the GABA
vesicular transporter (Viaat) as the promoter region driving the expression
of Cre recombinase results in specific depletion of Mecp2 from greater than
90% of GABA-expressing neurons and a complete recapitulation of the Rett
syndrome phenotype (Chao et al., 2010). When Mecp2 is deleted specifically
from the GABA-expressing neurons only in the forebrain using a Dlx5/6
Cre, the core ASD-relevant behaviors are still observed including repetitive
behaviors, abnormal social behaviors, and impaired sensorimotor gating
(Chao et al., 2010). For Rett syndrome at least, these disruptions seem to
be due to acute loss of Mecp2, and not to abnormal circuit formation during
development; inducible deletion of Mecp2 in the adult mouse was sufficient
to recapitulate some of the behavioral features of the germline mutation
(although social behaviors were not assessed) (McGraw, Samaco, &
Zoghbi, 2011). This suggests the imbalance of inhibitory control over exci-
tation induced by the absence of Mecp2 in the brain may be reversible.
In Mecp2, more than in any other model, multiple groups have
attempted postnatal “rescue” experiments by variously expressing Mecp2
under the control of various cell-specific and ubiquitous promoters. These
are an important complement to the cell-specific deletion experiments.
Deletions indicate which cell types are sufficient to disrupt the behavior.
Cell-specific rescue experiments indicate which cell types are sufficient
for normal behavior, and also provide some indication if the deficits are
due to acute loss of the protein, or permanent abnormalities that are a con-
sequence of the absence of Mecp2 during development. They also serve as a
model for potential treatment strategies. However, the interpretation of
these studies is complicated by the potentially nonphysiological levels of
expression of Mecp2 from exogenous promoters, and may account for
the differences seen across studies (Giacometti, Luikenhuis, Beard, &
Jaenisch, 2007; Guy, Gan, Selfridge, Cobb, & Bird, 2007; Jugloff et al.,
2008; Luikenhuis, Giacometti, Beard, & Jaenisch, 2004). Thus far, an
interneuron-specific Mecp2 rescue has not been demonstrated.
Other mutant models have provided evidence that disruption of
GABAergic inhibitory neurotransmission can result in an ASD-like pheno-
type. The mouse model of the ASD-related syndrome, Dravet’s syndrome,
which is caused in humans by heterozygous loss-of-function mutations in
the SCN1A gene, exhibits a 20–50% reduction in the a-subunit of the brain
voltage-gated Naþ channels. This is the primary Naþ channel in GABAergic
interneurons and thus is critical for action potentials in these neurons (Han
et al., 2012). GABAergic-specific deletion of Scn1a using the Dlx1/2 Cre
revealed that ASD-relevant behaviors in Dlx1/2–Scn1aþ/ mice, particu-
larly abnormal social behaviors, are due to decreased GABAergic neuro-
transmission specifically in the forebrain. These behaviors were reversed
with benzodiazepine administration. This study not only strongly implicates
the sufficiency of the loss of inhibitory control in the forebrain for abnormal
social behaviors but also further suggests abnormal social behaviors in some
ASD patients may not be irreversible consequences of neural development
and may, in fact, be treated in some manner with anticonvulsants or anxi-
olytics. Benzodiazepines are often prescribed to individuals with ASD
(Oswald & Sonenklar, 2007), although typically for management of epilepsy

and comorbid anxiety disorder, and not explicitly for social behaviors.
However, it is clear that aberrant developmental organization of the
GABAergic neurons may also result in disrupted GABA inhibition of excit-
atory neurons. Reeler mice, which lack the Reln gene that encodes a large
glycoprotein secreted by GABAergic interneurons and glutamatergic cere-
bellar neurons, show extreme cell positioning abnormalities in the lamina of
the neocortex and cerebellar cortex (Goffinet, 1984). Reeler mice also
exhibit abnormal social behaviors and sensorimotor gating, and repetitive
behaviors (Persico et al., 2001; Salinger, Ladrow, & Wheeler, 2003). The
dysfunction resulting from the aberrant cell organization may be amelio-
rated, however. Reintroduction of Reelin into an adult Reeler mouse brain
has been shown to alter dendritic spine morphology and alleviate associative
learning deficits (Rogers et al., 2013). Whether this can rescue abnormal
social behaviors has yet to be investigated. These studies suggest that brain
plasticity may be the key to therapies for ASD symptoms, particularly social
deficits, stemming from excitation/inhibition imbalance.
Finally, altered inhibition through GABAergic dysfunction may be a
mechanism by which ASD-related behaviors develop in other, non-GABA-
specific models of ASD. For example, many interneurons express 5-HT
receptors (Willins, Deutch, & Roth, 1997), and Tph2/ mice exhibit alter-
ations in GABA levels in areas of the forebrain (Waider et al., 2013). This
suggests 5-HT levels, either acutely or during development, may influence
the overall inhibitory control of excitatory neurons. Given that genetic
ASD models specific to the serotonergic and GABAergic systems indepen-
dently express similar behavioral phenotypes, a similar etiological mecha-
nism is possible. It may be that the ASD-like behaviors in 5-HT models
are ultimately due to GABA-dependent deficits in inhibitory control.
Genetic interaction studies, such as are common in Drosophila, may prove
fruitful in addressing this question. If crossing 5-HT-related ASD models
with GABA-related ASD models provides no further exacerbation of the
phenotype, the suggestion would be that they are in the same genetic
pathway.
6. ASD MODELS INVOLVING THE CEREBELLUM

A variety of clinical studies have reported cerebellar abnormalities in
autistic brains. For example, reduced cerebellar gray matter in autistic sub-
jects was correlated with Autism Diagnostic Interview—Revised (ADI-R)
and Autism Diagnostic Observation Schedule (ADOS)—Generic Scores in

a voxel-based morphometry study (Riva et al., 2013). Imaging studies
have reported increased cerebellar activation during a motor task (Allen,
Muller, & Courchesne, 2004) and cerebellar hypoplasia in autistic subjects
relative to controls (Courchesne, Yeung-Courchesne, Press, Hesselink, &
Jernigan, 1988). The most often reported cerebellar abnormality is a reduc-
tion in Purkinje cells, as demonstrated by postmortem studies (Bailey et al.,
1998; Ritvo et al., 1986; Wegiel et al., 2013), though few cerebellar alter-
ations were detected at the transcriptional level (Voineagu et al., 2011).
However, the clinical observations have led to a hypothesis that cerebellar
pathology may play a role in the etiology of some cases of ASD. Because
the involvement of the cerebellum in the ASD discussed in depth in
Chapter 1, it is only briefly covered here.
Classically, the behaviors involving cerebellar function are often thought
of as limited to those involving motor coordination and motor learning
(Trouillas et al., 1997). However, behaviors outside of the motor domain
have been shown to depend on an intact cerebellum such as those involved
in behavioral modification (Peterson et al., 2012). Furthermore, individuals
with cerebellar lesions exhibit what has been termed cerebellar cognitive
affective syndrome which is characterized by impaired executive functions,
disrupted spatial cognition, blunted affect, inappropriate behavior, and lan-
guage deficits (Schmahmann & Sherman, 1998). This indicates the cerebel-
lum likely influences nonmotor behaviors through its connections with
other brain regions.
Further supporting a role for cerebellar dysfunction is the many genetic
animal models of ASD that exhibit cerebellar abnormalities. Rare mutations
in the RELN gene has been identified in individuals with ASD (Neale et al.,
2012), and mice mutant for this gene demonstrate extreme cell positioning
abnormalities in the cerebellar cortex (Goffinet, 1984) and ASD-relevant
abnormal social, communicative, and repetitive behaviors (Mullen,
Khialeeva, Hoffman, Ghiani, & Carpenter, 2013). Mice lacking
Engrailed-2, a transcription factor associated with ASD in human genetics
studies, exhibit impaired social behaviors with disrupted cerebellar foliation
and gene expression (Brielmaier et al., 2012; Gharani, Benayed, Mancuso,
Brzustowicz, & Millonig, 2004; Joyner, Herrup, Auerbach, Davis, &
Rossant, 1991; Millen, Wurst, Herrup, & Joyner, 1994; Sen et al., 2010;
Sillitoe, Stephen, Lao, & Joyner, 2008). Despite these cerebellar phenotypes,
few studies have attempted to clarify the cerebellar contribution to ASD
pathogenesis by studying genetic models in a cerebellum-specific manner.
These studies have mostly employed the Purkinje cell protein 2 (Pcp2)
sequence as a promoter driving Cre recombinase for cerebellar-specific dele-
tion of ASD-relevant genes. Pcp2–Fmr1/ mice exhibit altered dendritic
morphology in Purkinje cells and recapitulate the attenuated eyeblink con-
ditioning observed in global Fmr1/ mice and Fragile X patients, who have
a mutation in the FMR1 gene (Koekkoek et al., 2005). The Pcp2–Fmr1/
mice also show impaired sensorimotor gating, but other ASD-relevant
behavior testing was not reported. Cerebellar-specific deletion of either
Tsc1 or Tsc2, genes inactivated in the ASD-related syndrome tuberous scle-
rosis, results in a progressive loss of Purkinje cells due to apoptosis possibly
induced by neuronal stress (Reith et al., 2013; Tsai et al., 2012). Surprisingly,
these mice also display decreased social behaviors and increased repetitive
behaviors and USVs. The loss of Purkinje cells and the abnormal behaviors
were prevented with postnatal-onset of rapamycin treatment, which rec-
tifies the dysregulation of mTOR signaling downstream of Tsc1 or Tsc2.
These cerebellar-specific genetic deletions suggest a role for Purkinje cells
in ASD-relevant behaviors, likely resulting from the influence of these cells
on the excitation/inhibition balance in other brain areas.
The loss of Purkinje cells may alter the functioning of the frontal cortex.
An association was reported between early signs of ASD and dorsolateral
prefrontal cortex volume in premature infants with cerebellar injury
(Limperopoulos et al., 2012). The Purkinje cells receive excitatory input
from glutamatergic granule cells and provide GABAergic inhibition to
other areas of the cerebellum, particularly deep cerebellar nuclei. These
nuclei then send projections to the thalamus and cerebral cortex
(Gonzalo-Ruiz & Leichnetz, 1990; Middleton & Strick, 2001; Saab &
Willis, 2003; Sarna & Hawkes, 2003; Yamamoto, Yoshida, Yoshikawa,
Kishimoto, & Oka, 1992). Therefore, disruption of GABAergic inhibition
in the Purkinje cells can influence functioning in thalamocortical circuits.
Reduced Purkinje cell function has been suggested to ultimately produce
reduced cerebellar modulation of dopamine release in the medial prefrontal
cortex (Rogers et al., 2013). It is possible that loss of Purkinje cells ultimately
leads to an imbalance of the excitation/inhibition ratio in the cortex, which,
as discussed above, is hypothesized as an underlying mechanism of ASD.
However, there is also evidence suggesting that the Purkinje cells are a
particularly vulnerable population. For example, neonatal exposure to toxins
like alcohol or nicotine can reduce Purkinje cell numbers (Chen, Parnell, &
West, 1998). Thus, it is possible that the cerebellar abnormalities seen in
individuals with ASD are simply indicators of a broader developmental def-
icit influencing many systems.
7. ASD MODELS INVOLVING THE STRIATUM

The striatum forms the largest nucleus of the basal ganglia, receiving
input from both cortical and thalamic structures (Middleton & Strick, 2000).
The dorsal striatum is composed of the caudate and putamen in humans,
which is a single structure in mice. Made up of mainly GABAergic projec-
tion neurons (medium spiny neurons (MSNs)), which synapse onto neurons
of the substantia nigra pars reticulata (SNPr)/globus pallidus interna (GPi) in
addition to the globus pallidus externa (GPe), the output of the circuit leads
to inhibition or disinhibition of regions of the thalamus and descending
pathways (Gerfen, 1992; Kemp & Powell, 1970; Middleton & Strick,
2000; Stocco, Lebiere, & Anderson, 2010). The ventral striatum is com-
posed of the nucleus accumbens and the olfactory tubercle. The nucleus
accumbens has been considered a reward-processing center, receiving inputs
from the amygdala and the dopaminergic neurons of the ventral tegmental
area (Gregorios-Pippas, Tobler, & Schultz, 2009; Ubeda-Banon et al.,
2007). A number of functional imaging studies have linked underactivation
or overactivation in the dorsal striatum (specifically, the head of the caudate)
to symptomology of certain psychiatric disorders, such as obsessive–
compulsive disorder (OCD), by looking at fMRI BOLD signal at rest
between affected individuals and controls (Whiteside, Port, &
Abramowitz, 2004), as well as during tasks of motor inhibition (Nakao
et al., 2005; Page et al., 2009), implicit learning (Rauch et al., 1997), and
planning tasks (van den Heuvel et al., 2005). Because of the association
to striatal dysfunction in OCD, it has been attractive to propose that such
dysfunction could be causal to ritualistic, OCD-like behaviors observed
in patients with ASD (Sears et al., 1999). Resting state activity in autistic
children appears elevated in both the dorsal and ventral striatum compared
to controls in at least one report (Di Martino et al., 2011). A few reports
show increased volume of the caudate in autistic patients compared to con-
trols and correlate this change (Hollander et al., 2005; Langen et al., 2009;
Rojas et al., 2006; Sears et al., 1999), to scores of repetitive or other autistic-
like behavior such as the ADI-R (Lord, Rutter, & Le Couteur, 1994) or
ADOS (Lord et al., 2000) scores. However, the data are conflicting with
the correlation being either positive (Hollander et al., 2005; Rojas et al.,
2006) or negative (Sears et al., 1999), and not all reports control for total
brain size nor for the administration of neuroleptic medications.
Several ASD risk genes have enriched expression in the striatum and are
important for striatal function. These include the forkhead box transcription
factors FOXP1 (Ferland et al., 2003; Tamura et al., 2004) and FOXP2
(Takahashi, Liu, Hirokawa, & Takahashi, 2003), the dopamine receptor
DRD3 (Staal, de Krom, & de Jonge, 2012), and the postsynaptic density
scaffolding protein SHANK3 (Peca et al., 2011). While several disruptions
in FOXP1 are linked to ASD (Hamdan et al., 2010; O’Roak et al., 2011;
Talkowski et al., 2012), Foxp1 null mice have not yet been assessed for
behaviors relevant to ASD-like symptoms. FOXP2 is considered a potential
risk gene for ASD primarily due to its apparent role in speech and language
(Newbury & Monaco, 2010), as well as its regulation of downstream genes
MET and CNTNAP2 which have been associated previously with ASD risk
(Arking et al., 2008; Bakkaloglu et al., 2008; Mukamel et al., 2011; Vernes
et al., 2011). Reports on FOXP2 have focused on motor function and pro-
duction of USV (Fisher & Scharff, 2009), the latter of which has had some
conflicting evidence—either reporting a deficit in amount of vocalization
(Shu et al., 2005) or lack thereof, with a subtler phenotype in amplitude
of vocalization (Gaub, Groszer, Fisher, & Ehret, 2010). Mice deficient in
Foxp2 protein have not yet been assessed on other ASD-like measures, such
as the three-chambered test of sociability.
Among genes important to striatal function modeled in mice, perhaps
one of the most well documented in relation to ASD risk is SHANK3.
SH3 and multiple ankyrin repeat domains 3 (Shank3) is a scaffolding protein
associated with the postsynaptic density, which links receptors and ion chan-
nels at the postsynaptic terminus to the cytoskeleton and downstream
molecular signaling pathways (Sheng & Kim, 2000). Mice null for Shank3
protein show ASD-like behaviors in a number of behavioral assays as well as
disrupted corticostriatal neuronal transmission (Bozdagi et al., 2010;
Folstein, Dowd, Mankoski, & Tadevosyan, 2003; Verpelli et al., 2011;
Wang et al., 2011; Yang et al., 2012). Shank3 mutant mice display stereo-
typed motor behaviors, which has been proposed as correlated to deficits in
striatal function (Peca et al., 2011). Specifically, they show excessive
grooming (but not allogrooming) which leads to facial lesions (Peca et al.,
2011). In the same report, Shank3/ mice were found to have striatal
hypertrophy—both in the surface area and dendritic length of MSNs—a
finding which the authors suggest may mirror human reports of increased
volume in the caudate nucleus in autistic patients. Whole-cell patch-clamp
recording of Shank3/ mice showed reduced frequency and amplitude to
MSN AMPAR-mediated mEPSCs. Peca and colleagues in that report argue
that this dysfunction is restricted to the striatum, based upon lack of such
deficits in transmission in the hippocampus, as well as normal reversal
learning in the Morris water maze task (Peca et al., 2011). However, because
Shank3 is also expressed in the cerebellum (Welch, Wang, & Feng, 2004),
and because the cerebellum may also have a role in the expression of autistic-
like phenotypes, it is not clear that there is not also cerebellar dysfunction in
the Shank3 null mouse. Furthermore, more recently, Yang et al. (2012) have
shown reduced glutamatergic synaptic transmission in the hippocampus and
a deficit in long-term potentiation in Shank3/ mice.
Overall, in the models described, it is difficult to assess the contribution
of striatal dysfunction to the observed phenotype, as genes such as SHANK3
are not exclusive to the striatum. Furthermore, many other ASD risk genes,
which have more global expression, may have a particularly crucial role to
play in the striatum that has yet been undiscovered. To address these prob-
lems, it will be useful to look at specific striatal disruption of these genes.
There are a number of transgenic mice, expressing Cre recombinase under
the control of different gene promoters, which can be used to mediate dis-
ruption in the striatum. The promoters driving Cre expression are as
described in Gong et al. (2007) (and on gensat.org) and their genes are sum-
marized in Table 3.3. Novel methodologies, such as translational profiling of
cell populations (Doyle et al., 2008; Heiman et al., 2008), have the potential
to uncover highly specific markers of different cell types, which can be used
to benefit future genetic manipulations.
8. OTHER REGIONS AND CELL TYPES

We focused our review on four systems and cell types that had previ-
ously received wide attention particularly using conditional deletion strate-
gies in model organisms, yet these are certainly not the only systems
hypothesized to have a role in ASD. Indeed, it is difficult to identify a cell
type or region that has not previously been suggested to be involved in ASD.
For some of these, such as the hippocampus, the experimental tractability
of the system may in part be responsible for the amount of work that has
been focused there. For other potential cellular mechanisms, such as
immune-mediated neurodevelopmental abnormalities, there is accumulat-
ing evidence that these may play a role in some cases (reviewed in
Chapter 9), but less work has been done thus far into an understanding of
the consequences on particular neuronal cell types in the brain. And beyond
neurons, there are certainly emerging hypotheses regarding the role of glia
(Ballas, Lioy, Grunseich, & Mandel, 2009; Maezawa, Swanberg, Harvey,
Table 3.3 Promoters used to drive Cre recombination in the striatum (from GENSAT)
Gene
symbol Gene Pattern of Cre expression
Adora2a Adenosine A2A receptor Drd2 þ (striatopallidal) projection neurons
Dlx5 Distal-less homeobox 5 Projection neurons (also expressed in GABA
interneurons of the cortex and in the reticular
nucleus of the thalamus)
Drd1a Dopamine receptor D1A Drd1a þ (striatonigral) projection neurons
(some limited expression in cortex and
hypothalamus)
Drd2 Dopamine receptor D2 Drd2 þ (striatopallidal) projection neurons
(some limited expression in limbic cortex and
hypothalamus)
Drd3 Dopamine receptor D3 Drd3 þ (ventral striatum) neurons
(expression in layers 2 and 3 of cortex and in
the EC of the hippocampus)
Gng7 Guanine nucleotide Both Drd1a þ and Drd2 þ projection
binding protein, gamma 7 neurons (scattered expression in cortex and
hippocampus as well)
Vipr2 Vasoactive intestinal Both Drd1a þ and Drd2 þ (also cortex,
peptide receptor 2 layer 5)
A list of available Cre recombinase-expressing transgenic mouse lines available with expression in the
striatum, varying in specificity of expression.
LaSalle, & Jin, 2009) and neural stem cells (Amiri et al., 2012). In-depth ana-
lyses of the sufficiency of these cell types to create ASD-like behavior dis-
ruptions are certainly needed. Determination of sufficiency in conditional
deletion experiments must take into account that drivers of recombination
have varying levels of specificity (Gofflot et al., 2011). Ultimately, converg-
ing lines of evidence, from multiple mouse models and human neuroanat-
omy, will help to define the cell types and circuits that form the basis of ASD
symptoms.
9. CONCLUSIONS
From the current review of the consequences of conditional deletions
and deletions of genes enriched in certain cell types, it is clear there are mul-
tiple cellular disruptions that are sufficient to recreate some ASD-like
symptoms in the mouse. What does this suggest to us about the likely cellular
mechanisms of human ASD? Some things are becoming clearer.
First, there are mutations that lead to broad deficits in the early organi-
zation of the brain such as in the gene RELN (Goffinet, 1984; Neale et al.,
2012) or CNTNAP2 (Penagarikano et al., 2011). These mutations disrupt
many different circuits and lead to multiple deficits including intellectual dis-
ability, epilepsy, motor coordination difficulties, and finally ASD. These
deficits may be more difficult to treat with a single strategy, and may repre-
sent a class of developmental disorders that need to be considered differently
than other diagnoses of ASD (Gillberg, 2010).
Second, even among those individuals without broad cellular disorgani-
zation of CNS development, it seems likely that, much like the heteroge-
neity of ASD genetics, there is likely to be some heterogeneity of cellular
mechanisms as well. Thus, compared to Parkinson’s disease, it seems
unlikely that all ASD patients will share a single common cellular pathology.
Yet, it may still be the case that there are a limited number of distinct cellular
pathologies leading to the disorder. For example, it is possible that a subset of
patients develop ASD as a consequence of serotonergic abnormalities, while
another subset as a consequence of disrupted social reward processing in the
striatum. If the ASD cases can be clustered by cellular deficits, then at
least within these clusters, patients with distinct genetic causes may still
respond to a single treatment strategy. Genetic interaction experiments as
well as conditional deletion of a variety of ASD risk genes across different
cell types, in conjunction with careful and consistent phenotyping, are going
to be key to understanding whether such a clustering of cellular mechanisms
indeed exists.
ACKNOWLEDGMENTS
This work was supported by NINDS (4R00NS067239-03) to J. D. D., and an NIMH ACE
Network Grant (9R01MH100027-06). M. A. R. was supported by Kirschtein-NRSA
(5T32GM007067-38).
REFERENCES
Abrahams, B. S., & Geschwind, D. H. (2008). Advances in autism genetics: On the threshold
of a new neurobiology. Nature Reviews Genetics, 9(5), 341–355.
Adachi, M., Autry, A. E., Covington, H. E., 3rd., & Monteggia, L. M. (2009). MeCP2-
mediated transcription repression in the basolateral amygdala may underlie heightened
anxiety in a mouse model of Rett syndrome. Journal of Neuroscience, 29(13), 4218–4227.
Alenina, N., Kikic, D., Todiras, M., Mosienko, V., Qadri, F., Plehm, R., et al. (2009).
Growth retardation and altered autonomic control in mice lacking brain serotonin.
10332–10337.
Allen, G., Muller, R. A., & Courchesne, E. (2004). Cerebellar function in autism: Functional
magnetic resonance image activation during a simple motor task. Biological Psychiatry,
56(4), 269–278.
Alvarez-Saavedra, M., Saez, M. A., Kang, D., Zoghbi, H. Y., & Young, J. I. (2007). Cell-
specific expression of wild-type MeCP2 in mouse models of Rett syndrome yields
insight about pathogenesis. Human Molecular Genetics, 16(19), 2315–2325.
Amiri, A., Cho, W., Zhou, J., Birnbaum, S. G., Sinton, C. M., McKay, R. M., et al. (2012).
Pten deletion in adult hippocampal neural stem/progenitor cells causes cellular abnor-
malities and alters neurogenesis. The Journal of Neuroscience: The official journal of the Society
for Neuroscience, 32(17), 5880–5890.
Anderson, G. M., Freedman, D. X., Cohen, D. J., Volkmar, F. R., Hoder, E. L.,
McPhedran, P., et al. (1987). Whole blood serotonin in autistic and normal subjects. Jour-
nal of Child Psychology and Psychiatry, 28(6), 885–900.
Angoa-Perez, M., Kane, M. J., Briggs, D. I., Sykes, C. E., Shah, M. M., Francescutti, D. M.,
et al. (2012). Genetic depletion of brain 5HT reveals a common molecular pathway
mediating compulsivity and impulsivity. Journal of Neurochemistry, 121(6), 974–984.
Anney, R., Klei, L., Pinto, D., Almeida, J., Bacchelli, E., Baird, G., et al. (2012). Individual
common variants exert weak effects on the risk for autism spectrum disorders. Human
Molecular Genetics, 21(21), 4781–4792.
Arakawa, H., Blanchard, D. C., Arakawa, K., Dunlap, C., & Blanchard, R. J. (2008). Scent
marking behavior as an odorant communication in mice. Neuroscience and Biobehavioral
Reviews, 32(7), 1236–1248.
Arking, D. E., Cutler, D. J., Brune, C. W., Teslovich, T. M., West, K., Ikeda, M., et al.
(2008). A common genetic variant in the neurexin superfamily member CNTNAP2
increases familial risk of autism. American Journal of Human Genetics, 82(1), 160–164.
Azmitia, E. C., Singh, J. S., & Whitaker-Azmitia, P. M. (2011). Increased serotonin axons
(immunoreactive to 5-HT transporter) in postmortem brains from young autism donors.
Neuropharmacology, 60(7–8), 1347–1354.
Bailey, A., Le Couteur, A., Gottesman, I., Bolton, P., Simonoff, E., Yuzda, E., et al. (1995).
Autism as a strongly genetic disorder: Evidence from a British twin study. Psychological
Medicine, 25(1), 63–77.
A clinicopathological study of autism. Brain, 121(Pt. 5), 889–905.
Bakkaloglu, B., O’Roak, B. J., Louvi, A., Gupta, A. R., Abelson, J. F., Morgan, T. M., et al.
(2008). Molecular cytogenetic analysis and resequencing of contactin associated protein-
like 2 in autism spectrum disorders. American Journal of Human Genetics, 82(1), 165–173.
Ballas, N., Lioy, D. T., Grunseich, C., & Mandel, G. (2009). Non-cell autonomous influence
of MeCP2-deficient glia on neuronal dendritic morphology. Nature Neuroscience, 12(3),
311–317.
autism research. Nucleic Acids Research, 37, D832–D836.
Beaulieu, J. M., Zhang, X., Rodriguiz, R. M., Sotnikova, T. D., Cools, M. J.,
Wetsel, W. C., et al. (2008). Role of GSK3 beta in behavioral abnormalities induced
by serotonin deficiency. Proceedings of the National Academy of Sciences of the United States
of America, 105(4), 1333–1338.
Betancur, C., Corbex, M., Spielewoy, C., Philippe, A., Laplanche, J. L., Launay, J. M., et al.
(2002). Serotonin transporter gene polymorphisms and hyperserotonemia in autistic dis-
order. Molecular Psychiatry, 7(1), 67–71.
Bozdagi, O., Sakurai, T., Papapetrou, D., Wang, X., Dickstein, D. L., Takahashi, N., et al.
(2010). Haploinsufficiency of the autism-associated Shank3 gene leads to deficits in
synaptic function, social interaction, and social communication. Molecular Autism,
1(1), 15.
Brielmaier, J., Matteson, P. G., Silverman, J. L., Senerth, J. M., Kelly, S., Genestine, M., et al.
(2012). Autism-relevant social abnormalities and cognitive deficits in engrailed-2 knock-
out mice. PLoS One, 7(7), e40914.
Bulfone, A., Smiga, S. M., Shimamura, K., Peterson, A., Puelles, L., et al. (1995). T-brain-1:
a homolog of Brachyury whose expression defines molecularly distinct domains within
the cerebral cortex. Neuron, 15, 63–78.
Buxbaum, J. D., Silverman, J. M., Smith, C. J., Greenberg, D. A., Kilifarski, M., Reichert, J.,
et al. (2002). Association between a GABRB3 polymorphism and autism. Molecular Psy-
chiatry, 7(3), 311–316.
Canitano, R., & Scandurra, V. (2011). Psychopharmacology in autism: An update. Progress in
Neuro-Psychopharmacology & Biological Psychiatry, 35(1), 18–28.
Carrasco, M., Volkmar, F. R., & Bloch, M. H. (2012). Pharmacologic treatment of repetitive
behaviors in autism spectrum disorders: Evidence of publication bias. Pediatrics, 129(5),
e1301–e1310.
Carter, M. D., Shah, C. R., Muller, C. L., Crawley, J. N., Carneiro, A. M., & Veenstra-
VanderWeele, J. (2011). Absence of preference for social novelty and increased
grooming in integrin beta3 knockout mice: Initial studies and future directions. Autism
Research, 4(1), 57–67.
Chahrour, M. H., Yu, T. W., Lim, E. T., Ataman, B., Coulter, M. E., Hill, R. S., et al.
(2012). Whole-exome sequencing and homozygosity analysis implicate
depolarization-regulated neuronal genes in autism. PLoS Genetics, 8(4), e1002635.
Chao, H. T., Chen, H., Samaco, R. C., Xue, M., Chahrour, M., Yoo, J., et al. (2010). Dys-
function in GABA signalling mediates autism-like stereotypies and Rett syndrome phe-
notypes. Nature, 468(7321), 263–269.
Cheh, M. A., Millonig, J. H., Roselli, L. M., Ming, X., Jacobsen, E., Kamdar, S., et al.
(2006). En2 knockout mice display neurobehavioral and neurochemical alterations rel-
evant to autism spectrum disorder. Brain Research, 1116(1), 166–176.
Chen, R. Z., Akbarian, S., Tudor, M., & Jaenisch, R. (2001). Deficiency of methyl-CpG
binding protein-2 in CNS neurons results in a Rett-like phenotype in mice. Nature
Genetics, 27(3), 327–331.
Chen, W. J., Parnell, S. E., & West, J. R. (1998). Neonatal alcohol and nicotine exposure
limits brain growth and depletes cerebellar Purkinje cells. Alcohol, 15(1), 33–41.
Ching, H., & Pringsheim, T. (2012). Aripiprazole for autism spectrum disorders (ASD).
Cochrane Database of Systematic Reviews, 5, CD009043.
Cook, E. H., Jr., Courchesne, R. Y., Cox, N. J., Lord, C., Gonen, D., Guter, S. J., et al.
(1998). Linkage-disequilibrium mapping of autistic disorder, with 15q11-13 markers.
American Journal of Human Genetics, 62(5), 1077–1083.
Cook, E. H., & Leventhal, B. L. (1996). The serotonin system in autism. Current Opinion in
Pediatrics, 8(4), 348–354.
Courchesne, E., Yeung-Courchesne, R., Press, G. A., Hesselink, J. R., & Jernigan, T. L.
(1988). Hypoplasia of cerebellar vermal lobules VI and VII in autism. New England Journal
of Medicine, 318(21), 1349–1354.
Crawley, J. N. (2012). Translational animal models of autism and neurodevelopmental dis-
orders. Dialogues in Clinical Neuroscience, 14(3), 293–305.
Dani, V. S., Chang, Q., Maffei, A., Turrigiano, G. G., Jaenisch, R., & Nelson, S. B. (2005).
Reduced cortical activity due to a shift in the balance between excitation and inhibition
in a mouse model of Rett syndrome. Proceedings of the National Academy of Sciences of the
United States of America, 102(35), 12560–12565.
Deane, C. M., Salwinski, L., Xenarios, I., & Eisenberg, D. (2002). Protein interactions: Two
methods for assessment of the reliability of high throughput observations. Molecular &
Cellular Proteomics, 1(5), 349–356.
DeLorey, T. M., Handforth, A., Anagnostaras, S. G., Homanics, G. E., Minassian, B. A.,
Asatourian, A., et al. (1998). Mice lacking the beta3 subunit of the GABAA receptor
have the epilepsy phenotype and many of the behavioral characteristics of Angelman syn-
drome. Journal of Neuroscience, 18(20), 8505–8514.
autism spectrum disorder. Behavioural Brain Research, 187(2), 207–220.
Di Martino, A., Kelly, C., Grzadzinski, R., Zuo, X. N., Mennes, M., Mairena, M. A., et al.
(2011). Aberrant striatal functional connectivity in children with autism. Biological Psy-
chiatry, 69(9), 847–856.
Dougherty, J. D., Schmidt, E. F., Nakajima, M., & Heintz, N. (2010). Analytical approaches
to RNA profiling data for the identification of genes enriched in specific cells. Nucleic
Acids Res, 38, 4218–4230.
Dougherty, J. D., Maloney, S. E., Wozniak, D. F., Rieger, M. A., Sonnenblick, L.,
Coppola, G., et al. (2013). The disruption of Celf6, a gene identified by translational
profiling of serotonergic neurons, results in autism-related behaviors. Journal of Neurosci-
ence, 33(7), 2732–2753.
Doyle, J. P., Dougherty, J. D., Heiman, M., Schmidt, E. F., Stevens, T. R., Ma, G., et al.
(2008). Application of a translational profiling approach for the comparative analysis of
CNS cell types. Cell, 135(4), 749–762.
du Plessis, L., Skunca, N., & Dessimoz, C. (2011). The what, where, how and why of
gene ontology—A primer for bioinformaticians. Briefings in Bioinformatics, 12(6), 723–735.
Ellegood, J., Henkelman, R. M., & Lerch, J. P. (2012). Neuroanatomical assessment of the
integrin beta3 mouse model related to autism and the serotonin system using high res-
olution MRI. Front Psychiatry, 3, 37.
Englund, C., et al. (2005). Pax6, Tbr2, and Tbr1 are expressed sequentially by radial glia,
intermediate progenitor cells, and postmitotic neurons in developing neocortex. J Neu-
rosci, 25, 247–251.
Fazzari, P., Penachioni, J., Gianola, S., Rossi, F., Eickholt, B. J., et al. (2007). Plexin-B1 plays
a redundant role during mouse development and in tumour angiogenesis. BMC Dev Biol,
7, 55.
Ferland, R. J., Cherry, T. J., Preware, P. O., Morrisey, E. E., & Walsh, C. A. (2003).
Characterization of Foxp2 and Foxp1 mRNA and protein in the developing and mature
brain. J Comp Neurol, 460(2), 266–279.
Fisher, S. E., & Scharff, C. (2009). FOXP2 as a molecular window into speech and language.
Trends in Genetics, 25(4), 166–177.
Folstein, S. E., Dowd, M., Mankoski, R., & Tadevosyan, O. (2003). How might genetic
mechanisms operate in autism? Novartis Foundation Symposium, 251, 70–80, discussion
80–73, 109–111, 281–297.
Fyffe, S. L., Neul, J. L., Samaco, R. C., Chao, H. T., Ben-Shachar, S., Moretti, P., et al.
(2008). Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2
in feeding behavior, aggression, and the response to stress. Neuron, 59(6), 947–958.
Gaub, S., Groszer, M., Fisher, S. E., & Ehret, G. (2010). The structure of innate vocalizations
in Foxp2-deficient mouse pups. Genes, Brain, and Behavior, 9(4), 390–401.
Gerfen, C. R. (1992). The neostriatal mosaic: Multiple levels of compartmental organization.
Trends in Neurosciences, 15(4), 133–139.
Geschwind, D. H. (2011). Genetics of autism spectrum disorders. Trends in Cognitive Sciences,
15(9), 409–416.
Gharani, N., Benayed, R., Mancuso, V., Brzustowicz, L. M., & Millonig, J. H. (2004). Asso-
ciation of the homeobox transcription factor, ENGRAILED 2, 3, with autism spectrum
disorder. Molecular Psychiatry, 9(5), 474–484.
Giacometti, E., Luikenhuis, S., Beard, C., & Jaenisch, R. (2007). Partial rescue of MeCP2
deficiency by postnatal activation of MeCP2. Proceedings of the National Academy of Sciences
of the United States of America, 104(6), 1931–1936.
Gillberg, C. (2010). The ESSENCE in child psychiatry: Early symptomatic syndromes
eliciting neurodevelopmental clinical examinations. Research in Developmental Disabilities,
31(6), 1543–1551.
Goffinet, A. M. (1984). Events governing organization of postmigratory neurons: Studies on
brain development in normal and reeler mice. Brain Research, 319(3), 261–296.
Gofflot, F., Wendling, O., Chartoire, N., Birling, M.-C., Warot, X., & Auwerx, J. (2011).
Characterization and validation of Cre-driver mouse lines. Current Protocols in Mouse
Biology, 1, 1–15.
Gong, S., Doughty, M., Harbaugh, C. R., Cummins, A., Hatten, M. E., Heintz, N., et al.
(2007). Targeting Cre recombinase to specific neuron populations with bacterial artificial
chromosome constructs. Journal of Neuroscience, 27(37), 9817–9823.
Gonzalo-Ruiz, A., & Leichnetz, G. R. (1990). Connections of the caudal cerebellar inter-
positus complex in a new world monkey (Cebus apella). Brain Research Bulletin, 25(6),
919–927.
Gregorios-Pippas, L., Tobler, P. N., & Schultz, W. (2009). Short-term temporal discounting
of reward value in human ventral striatum. Journal of Neurophysiology, 101(3), 1507–1523.
Guy, J., Gan, J., Selfridge, J., Cobb, S., & Bird, A. (2007). Reversal of neurological defects in
a mouse model of Rett syndrome. Science, 315(5815), 1143–1147.
Guy, J., Hendrich, B., Holmes, M., Martin, J. E., & Bird, A. (2001). A mouse Mecp2-null
mutation causes neurological symptoms that mimic Rett syndrome. Nature Genetics,
27(3), 322–326.
Hamdan, F. F., Daoud, H., Rochefort, D., Piton, A., Gauthier, J., Langlois, M., et al. (2010).
De novo mutations in FOXP1 in cases with intellectual disability, autism, and language
impairment. American Journal of Human Genetics, 87(5), 671–678.
Han, S., Tai, C., Westenbroek, R. E., Yu, F. H., Cheah, C. S., Potter, G. B., et al. (2012).
Autistic-like behaviour in Scn1a þ/- mice and rescue by enhanced GABA-mediated
neurotransmission. Nature, 489(7416), 385–390.
Heiman, M., Schaefer, A., Gong, S., Peterson, J. D., Day, M., Ramsey, K. E., et al. (2008).
A translational profiling approach for the molecular characterization of CNS cell types.
Cell, 135(4), 738–748.
Hendricks, T. J., Fyodorov, D. V., Wegman, L. J., Lelutiu, N. B., Pehek, E. A.,
Yamamoto, B., et al. (2003). Pet-1 ETS gene plays a critical role in 5-HT neuron devel-
opment and is required for normal anxiety-like and aggressive behavior. Neuron, 37(2),
233–247.
Hofer, M. A., Shair, H. N., & Brunelli, S. A. (2002). Ultrasonic vocalizations in rat and
mouse pups. Current Protocols in Neuroscience, (Chapter 8), Unit 8.14.
Hollander, E., Anagnostou, E., Chaplin, W., Esposito, K., Haznedar, M. M., Licalzi, E., et al.
(2005). Striatal volume on magnetic resonance imaging and repetitive behaviors in
autism. Biological Psychiatry, 58(3), 226–232.
Iossifov, I., Ronemus, M., Levy, D., Wang, Z., Hakker, I., Rosenbaum, J., et al. (2012). De
novo gene disruptions in children on the autistic spectrum. Neuron, 74(2), 285–299.
Joung, J. K., & Sander, J. D. (2013). TALENs: A widely applicable technology for targeted
genome editing. Nature Reviews Molecular Cell Biology, 14(1), 49–55.
Joyner, A. L., Herrup, K., Auerbach, B. A., Davis, C. A., & Rossant, J. (1991). Subtle cer-
ebellar phenotype in mice homozygous for a targeted deletion of the En-2 homeobox.
Science, 251(4998), 1239–1243.
Jugloff, D. G., Vandamme, K., Logan, R., Visanji, N. P., Brotchie, J. M., & Eubanks, J. H.
(2008). Targeted delivery of an Mecp2 transgene to forebrain neurons improves the
behavior of female Mecp2-deficient mice. Human Molecular Genetics, 17(10), 1386–1396.
Kalueff, A. V., Fox, M. A., Gallagher, P. S., & Murphy, D. L. (2007). Hypolocomotion,
anxiety and serotonin syndrome-like behavior contribute to the complex phenotype
of serotonin transporter knockout mice. Genes, Brain, and Behavior, 6(4), 389–400.
Kane, M. J., Angoa-Perez, M., Briggs, D. I., Sykes, C. E., Francescutti, D. M.,
Rosenberg, D. R., et al. (2012). Mice genetically depleted of brain serotonin display
social impairments, communication deficits and repetitive behaviors: Possible relevance
to autism. PLoS One, 7(11), e48975.
Kemp, J. M., & Powell, T. P. (1970). The cortico-striate projection in the monkey. Brain,
93(3), 525–546.
Kirov, G., Pocklington, A. J., Holmans, P., Ivanov, D., Ikeda, M., Ruderfer, D., et al.
(2012). De novo CNV analysis implicates specific abnormalities of postsynaptic signalling
complexes in the pathogenesis of schizophrenia. Molecular Psychiatry, 17(2), 142–153.
Kirsten, T. B., Chaves-Kirsten, G. P., Chaible, L. M., Silva, A. C., Martins, D. O.,
Britto, L. R., et al. (2012). Hypoactivity of the central dopaminergic system and
autistic-like behavior induced by a single early prenatal exposure to lipopolysaccharide.
Journal of Neuroscience Research, 90(10), 1903–1912.
Klei, L., Sanders, S. J., Murtha, M. T., Hus, V., Lowe, J. K., Willsey, A. J., et al. (2012).
Common genetic variants, acting additively, are a major source of risk for autism. Molec-
ular Autism, 3(1), 9.
Koekkoek, S. K., Yamaguchi, K., Milojkovic, B. A., Dortland, B. R., Ruigrok, T. J.,
Maex, R., et al. (2005). Deletion of FMR1 in Purkinje cells enhances parallel fiber
LTD, enlarges spines, and attenuates cerebellar eyelid conditioning in Fragile
X syndrome. Neuron, 47(3), 339–352.
Kron, M., Howell, C. J., Adams, I. T., Ransbottom, M., Christian, D., Ogier, M., et al.
(2012). Brain activity mapping in Mecp2 mutant mice reveals functional deficits in fore-
brain circuits, including key nodes in the default mode network, that are reversed with
ketamine treatment. Journal of Neuroscience, 32(40), 13860–13872.
Kuppenbender, K. D., Standaert, D. G., Feuerstein, T. J., Penney, J. B., Jr., Young, A. B.,
et al. (2000). Expression of NMDA receptor subunit mRNAs in neurochemically iden-
tified projection and interneurons in the human striatum. J Comp Neurol, 419, 407–421.
Kyzar, E. J., Pham, M., Roth, A., Cachat, J., Green, J., Gaikwad, S., et al. (2012). Alterations
in grooming activity and syntax in heterozygous SERT and BDNF knockout mice: The
utility of behavior-recognition tools to characterize mutant mouse phenotypes. Brain
Research Bulletin, 89(5–6), 168–176.
Langen, M., Schnack, H. G., Nederveen, H., Bos, D., Lahuis, B. E., de Jonge, M. V., et al.
(2009). Changes in the developmental trajectories of striatum in autism. Biological Psychi-
atry, 66(4), 327–333.
Lesch, K. P., Wolozin, B. L., Murphy, D. L., & Reiderer, P. (1993). Primary structure of the
human platelet serotonin uptake site: Identity with the brain serotonin transporter. Jour-
nal of Neurochemistry, 60(6), 2319–2322.
Liljelund, P., Handforth, A., Homanics, G. E., & Olsen, R. W. (2005). GABAA receptor
beta3 subunit gene-deficient heterozygous mice show parent-of-origin and gender-
related differences in beta3 subunit levels, EEG, and behavior. Brain Research Developmen-
tal Brain Research, 157(2), 150–161.
Limperopoulos, C., Chilingaryan, G., Sullivan, N., Guizard, N., Robertson, R. L., & du
Plessis, A. J. (2012). Injury to the premature cerebellum: Outcome is related to remote
cortical development. Cerebral Cortex. [E-pub ahead of print].
Lord, C., Risi, S., Lambrecht, L., Cook, E. H., Jr., Leventhal, B. L., DiLavore, P. C., et al.
(2000). The autism diagnostic observation schedule-generic: A standard measure of social
and communication deficits associated with the spectrum of autism. Journal of Autism and
Developmental Disorders, 30(3), 205–223.
Lord, C., Rutter, M., & Le Couteur, A. (1994). Autism Diagnostic Interview-Revised:
A revised version of a diagnostic interview for caregivers of individuals with possible
pervasive developmental disorders. Journal of Autism and Developmental Disorders, 24(5),
659–685.
Luikenhuis, S., Giacometti, E., Beard, C. F., & Jaenisch, R. (2004). Expression of MeCP2 in
postmitotic neurons rescues Rett syndrome in mice. Proceedings of the National Academy of
Sciences of the United States of America, 101(16), 6033–6038.
Maezawa, I., Swanberg, S., Harvey, D., LaSalle, J. M., & Jin, L. W. (2009). Rett syndrome
astrocytes are abnormal and spread MeCP2 deficiency through gap junctions. The Journal
of Neuroscience: The official journal of the Society for Neuroscience, 29(16), 5051–5061.
Markram, H., Toledo-Rodriguez, M., Wang, Y., Gupta, A., Silberberg, G., & Wu, C.
(2004). Interneurons of the neocortical inhibitory system. Nature Reviews Neuroscience,
5(10), 793–807.
McDougle, C. J., Naylor, S. T., Goodman, W. K., Volkmar, F. R., Cohen, D. J., &
Price, L. H. (1993). Acute tryptophan depletion in autistic disorder: A controlled case
study. Biological Psychiatry, 33(7), 547–550.
McFarlane, H. G., Kusek, G. K., Yang, M., Phoenix, J. L., Bolivar, V. J., & Crawley, J. N.
(2008). Autism-like behavioral phenotypes in BTBR T þ tf/J mice. Genes, Brain, and
Behavior, 7(2), 152–163.
McGraw, C. M., Samaco, R. C., & Zoghbi, H. Y. (2011). Adult neural function requires
MeCP2. Science, 333(6039), 186.
Michaelson, J. J., Shi, Y., Gujral, M., Zheng, H., Malhotra, D., Jin, X., et al. (2012). Whole-
genome sequencing in autism identifies hot spots for de novo germline mutation. Cell,
151(7), 1431–1442.
Miczek, K. A., Faccidomo, S., De Almeida, R. M., Bannai, M., Fish, E. W., & Debold, J. F.
(2004). Escalated aggressive behavior: New pharmacotherapeutic approaches and oppor-
tunities. Annals of the New York Academy of Sciences, 1036, 336–355.
Middleton, F. A., & Strick, P. L. (2000). Basal ganglia output and cognition: Evidence from
anatomical, behavioral, and clinical studies. Brain and Cognition, 42(2), 183–200.
Middleton, F. A., & Strick, P. L. (2001). Cerebellar projections to the prefrontal cortex of the
primate. Journal of Neuroscience, 21(2), 700–712.
Millen, K. J., Wurst, W., Herrup, K., & Joyner, A. L. (1994). Abnormal embryonic cerebellar
development and patterning of postnatal foliation in two mouse Engrailed-2 mutants.
Development, 120(3), 695–706.
Mosienko, V., Bert, B., Beis, D., Matthes, S., Fink, H., Bader, M., et al. (2012). Exaggerated
aggression and decreased anxiety in mice deficient in brain serotonin. Translational Psychiatry,
2, e122.
Mossner, R., Simantov, R., Marx, A., Lesch, K. P., & Seif, I. (2006). Aberrant accumulation
of serotonin in dopaminergic neurons. Neuroscience Letters, 401(1–2), 49–54.
Moy, S. S., Nadler, J. J., Magnuson, T. R., & Crawley, J. N. (2006). Mouse models of autism
spectrum disorders: The challenge for behavioral genetics. American Journal of Medical
Genetics Part C, Seminars in Medical Genetics, 142C(1), 40–51.
Moy, S. S., Nadler, J. J., Perez, A., Barbaro, R. P., Johns, J. M., Magnuson, T. R., et al.
(2004). Sociability and preference for social novelty in five inbred strains: An
approach to assess autistic-like behavior in mice. Genes, Brain, and Behavior, 3(5),
287–302.
Moy, S. S., Nadler, J. J., Poe, M. D., Nonneman, R. J., Young, N. B., Koller, B. H., et al.
(2008). Development of a mouse test for repetitive, restricted behaviors: Relevance to
autism. Behavioural Brain Research, 188(1), 178–194.
Moy, S. S., Nadler, J. J., Young, N. B., Nonneman, R. J., Grossman, A. W., Murphy, D. L.,
et al. (2009). Social approach in genetically engineered mouse lines relevant to autism.
Genes, Brain, and Behavior, 8(2), 129–142.
Moy, S. S., Nadler, J. J., Young, N. B., Nonneman, R. J., Segall, S. K., Andrade, G. M., et al.
(2008). Social approach and repetitive behavior in eleven inbred mouse strains. Behav-
ioural Brain Research, 191(1), 118–129.
Muhle, R., Trentacoste, S. V., & Rapin, I. (2004). The genetics of autism. Pediatrics, 113(5),
e472–e486.
Mukamel, Z., Konopka, G., Wexler, E., Osborn, G. E., Dong, H., Bergman, M. Y., et al.
(2011). Regulation of MET by FOXP2, genes implicated in higher cognitive dysfunc-
tion and autism risk. Journal of Neuroscience, 31(32), 11437–11442.
Mullen, B. R., Khialeeva, E., Hoffman, D. B., Ghiani, C. A., & Carpenter, E. M. (2013).
Decreased reelin expression and organophosphate pesticide exposure alters mouse
behaviour and brain morphology. ASN Neuro, 5(1), e00106.
Nagy, A. (2000). Cre recombinase: The universal reagent for genome tailoring. Genesis,
26(2), 99–109.
Nakao, T., Nakagawa, A., Yoshiura, T., Nakatani, E., Nabeyama, M., Yoshizato, C., et al.
(2005). A functional MRI comparison of patients with obsessive-compulsive disorder
and normal controls during a Chinese character Stroop task. Psychiatry Research,
139(2), 101–114.
Neale, B. M., Kou, Y., Liu, L., Ma’ayan, A., Samocha, K. E., Sabo, A., et al. (2012). Patterns
and rates of exonic de novo mutations in autism spectrum disorders. Nature, 485(7397),
242–245.
Newbury, D. F., & Monaco, A. P. (2010). Genetic advances in the study of speech and lan-
guage disorders. Neuron, 68(2), 309–320.
O’Roak, B. J., Deriziotis, P., Lee, C., Vives, L., Schwartz, J. J., Girirajan, S., et al. (2011).
Exome sequencing in sporadic autism spectrum disorders identifies severe de novo muta-
tions. Nature Genetics, 43(6), 585–589.
O’Roak, B. J., Vives, L., Girirajan, S., Karakoc, E., Krumm, N., Coe, B. P., et al. (2012).
Sporadic autism exomes reveal a highly interconnected protein network of de novo
mutations. Nature, 485(7397), 246–250.
Oswald, D. P., & Sonenklar, N. A. (2007). Medication use among children with autism spec-
trum disorders. Journal of Child and Adolescent Psychopharmacology, 17(3), 348–355.
Page, L. A., Rubia, K., Deeley, Q., Daly, E., Toal, F., Mataix-Cols, D., et al. (2009).
A functional magnetic resonance imaging study of inhibitory control in obsessive-
compulsive disorder. Psychiatry Research, 174(3), 202–209.
Panksepp, J. B., Jochman, K. A., Kim, J. U., Koy, J. J., Wilson, E. D., Chen, Q., et al. (2007).
Affiliative behavior, ultrasonic communication and social reward are influenced by
genetic variation in adolescent mice. PLoS One, 2(4), e351.
Peca, J., Feliciano, C., Ting, J. T., Wang, W., Wells, M. F., Venkatraman, T. N., et al.
(2011). Shank3 mutant mice display autistic-like behaviours and striatal dysfunction.
Nature, 472(7344), 437–442.
Pellis, S. M., & Pasztor, T. J. (1999). The developmental onset of a rudimentary form of play
fighting in C57 mice. Developmental Psychobiology, 34, 175–182.
Penagarikano, O., Abrahams, B. S., Herman, E. I., Winden, K. D., Gdalyahu, A., Dong, H.,
et al. (2011). Absence of CNTNAP2 leads to epilepsy, neuronal migration abnormalities,
and core autism-related deficits. Cell, 147(1), 235–246.
Molecular Psychiatry, 6(2), 150–159.
Persico, A. M., & Napolioni, V. (2013). Autism genetics. Behavioural Brain Research, 251,
95–112.
Pesold, C., Impagnatiello, F., Pisu, M. G., Uzunov, D. P., Costa, E., et al. (1998). Reelin is
preferentially expressed in neurons synthesizing gamma-aminobutyric acid in cortex and
hippocampus of adult rats. Proc Natl Acad Sci U S A, 95, 3221–3226.
Peterson, T. C., Villatoro, L., Arneson, T., Ahuja, B., Voss, S., & Swain, R. A. (2012).
Behavior modification after inactivation of cerebellar dentate nuclei. Behavioral Neurosci-
ence, 126(4), 551–562.
Peyron, C., Faraco, J., Rogers, W., Ripley, B., Overeem, S., Charnay, Y., et al. (2000).
A mutation in a case of early onset narcolepsy and a generalized absence of hypocretin
peptides in human narcoleptic brains. Nature Medicine, 6(9), 991–997.
Rauch, S. L., Savage, C. R., Alpert, N. M., Dougherty, D., Kendrick, A., Curran, T., et al.
(1997). Probing striatal function in obsessive-compulsive disorder: A PET study of implicit
sequence learning. Journal of Neuropsychiatry and Clinical Neurosciences, 9(4), 568–573.
Reith, R. M., McKenna, J., Wu, H., Hashmi, S. S., Cho, S. H., Dash, P. K., et al. (2013).
Loss of Tsc2 in Purkinje cells is associated with autistic-like behavior in a mouse model of
tuberous sclerosis complex. Neurobiology of Disease, 51, 93–103.
Ritvo, E. R., Freeman, B. J., Scheibel, A. B., Duong, T., Robinson, H., Guthrie, D., et al.
(1986). Lower Purkinje cell counts in the cerebella of four autistic subjects: Initial find-
ings of the UCLA-NSAC autopsy research report. The American Journal of Psychiatry,
143(7), 862–866.
Riva, D., Annunziata, S., Contarino, V., Erbetta, A., Aquino, D., & Bulgheroni, S. (2013).
Gray matter reduction in the Vermis and CRUS-II is associated with social and inter-
action deficits in low-functioning children with autistic spectrum disorders: A VBM-
DARTEL study. Cerebellum, 12(5), 676–685.
Rogers, T. D., Dickson, P. E., McKimm, E., Heck, D. H., Goldowitz, D., Blaha, C. D., et al.
(2013). Reorganization of circuits underlying cerebellar modulation of prefrontal cortical
dopamine in mouse models of autism spectrum disorder. Cerebellum, 12(4), 547–556.
Rogers, J. T., Zhao, L., Trotter, J. H., Rusiana, I., Peters, M. M., Li, Q., et al. (2013).
Reelin supplementation recovers sensorimotor gating, synaptic plasticity and associa-
tive learning deficits in the heterozygous reeler mouse. Journal of Psychopharmacology,
27(4), 386–395.
Rojas, D. C., Peterson, E., Winterrowd, E., Reite, M. L., Rogers, S. J., & Tregellas, J. R.
(2006). Regional gray matter volumetric changes in autism associated with social and
repetitive behavior symptoms. BMC Psychiatry, 6, 56.
Rubenstein, J. L., & Merzenich, M. M. (2003). Model of autism: Increased ratio of excita-
tion/inhibition in key neural systems. Genes, Brain, and Behavior, 2(5), 255–267.
Saab, C. Y., & Willis, W. D. (2003). The cerebellum: Organization, functions and its role in
nociception. Brain Research Brain Research Reviews, 42(1), 85–95.
Salinger, W. L., Ladrow, P., & Wheeler, C. (2003). Behavioral phenotype of the reeler
mutant mouse: Effects of RELN gene dosage and social isolation. Behavioral Neuroscience,
117(6), 1257–1275.
Samaco, R. C., Mandel-Brehm, C., Chao, H. T., Ward, C. S., Fyffe-Maricich, S. L., Ren, J.,
et al. (2009). Loss of MeCP2 in aminergic neurons causes cell-autonomous defects in
neurotransmitter synthesis and specific behavioral abnormalities. Proceedings of the
National Academy of Sciences of the United States of America, 106(51), 21966–21971.
Sanders, S. J., Murtha, M. T., Gupta, A. R., Murdoch, J. D., Raubeson, M. J., Willsey, A. J.,
et al. (2012). De novo mutations revealed by whole-exome sequencing are strongly asso-
ciated with autism. Nature, 485(7397), 237–241.
Sarna, J. R., & Hawkes, R. (2003). Patterned Purkinje cell death in the cerebellum. Progress in
Scattoni, M. L., Martire, A., Cartocci, G., Ferrante, A., & Ricceri, L. (2013). Reduced social
interaction, behavioural flexibility and BDNF signalling in the BTBR T þ tf/J strain, a
mouse model of autism. Behavioural Brain Research, 251, 35–40.
Scattoni, M. L., McFarlane, H. G., Zhodzishsky, V., Caldwell, H. K., Young, W. S.,
Ricceri, L., et al. (2008). Reduced ultrasonic vocalizations in vasopressin 1b knockout
mice. Behavioural Brain Research, 187(2), 371–378.
Scattoni, M. L., Ricceri, L., & Crawley, J. N. (2011). Unusual repertoire of vocalizations in
adult BTBR T þ tf/J mice during three types of social encounters. Genes, Brain, and
Behavior, 10(1), 44–56.
Schaevitz, L. R., Moriuchi, J. M., Nag, N., Mellot, T. J., & Berger-Sweeney, J. (2010). Cog-
nitive and social functions and growth factors in a mouse model of Rett syndrome. Phys-
iology & Behavior, 100(3), 255–263.
Schain, R. J., & Freedman, D. X. (1961). Studies on 5-hydroxyindole metabolism in autistic
and other mentally retarded children. The Journal of Pediatrics, 58, 315–320.
Schmahmann, J. D., & Sherman, J. C. (1998). The cerebellar cognitive affective syndrome.
Brain, 121(Pt. 4), 561–579.
Sears, L. L., Vest, C., Mohamed, S., Bailey, J., Ranson, B. J., & Piven, J. (1999). An MRI
study of the basal ganglia in autism. Progress in Neuro-Psychopharmacology and Biological Psy-
chiatry, 23(4), 613–624.
Sen, B., Singh, A. S., Sinha, S., Chatterjee, A., Ahmed, S., Ghosh, S., et al. (2010). Family-
based studies indicate association of Engrailed 2 gene with autism in an Indian popula-
tion. Genes, Brain, and Behavior, 9(2), 248–255.
Shahbazian, M., Young, J., Yuva-Paylor, L., Spencer, C., Antalffy, B., Noebels, J., et al.
(2002). Mice with truncated MeCP2 recapitulate many Rett syndrome features and dis-
play hyperacetylation of histone H3. Neuron, 35(2), 243–254.
Sheng, M., & Kim, E. (2000). The Shank family of scaffold proteins. Journal of Cell Science,
113(Pt. 11), 1851–1856.
Shu, W., Cho, J. Y., Jiang, Y., Zhang, M., Weisz, D., Elder, G. A., et al. (2005). Altered
ultrasonic vocalization in mice with a disruption in the Foxp2 gene. Proceedings of the
Sillitoe, R. V., Stephen, D., Lao, Z., & Joyner, A. L. (2008). Engrailed homeobox genes
determine the organization of Purkinje cell sagittal stripe gene expression in the adult
cerebellum. Journal of Neuroscience, 28(47), 12150–12162.
Silverman, J. L., Yang, M., Lord, C., & Crawley, J. N. (2010). Behavioural phenotyping
assays for mouse models of autism. Nature Reviews Neuroscience, 11(7), 490–502.
Staal, W. G., de Krom, M., & de Jonge, M. V. (2012). Brief report: The dopamine-3-
receptor gene (DRD3) is associated with specific repetitive behavior in autism spectrum
disorder (ASD). Journal of Autism and Developmental Disorders, 42(5), 885–888.
Stocco, A., Lebiere, C., & Anderson, J. R. (2010). Conditional routing of information to the
cortex: A model of the basal ganglia’s role in cognitive coordination. Psychological Review,
117(2), 541–574.
Takahashi, K., Liu, F. C., Hirokawa, K., & Takahashi, H. (2003). Expression of Foxp2, a
gene involved in speech and language, in the developing and adult striatum. Journal of
Neuroscience Research, 73(1), 61–72.
Talkowski, M. E., Rosenfeld, J. A., Blumenthal, I., Pillalamarri, V., Chiang, C., Heilbut, A.,
et al. (2012). Sequencing chromosomal abnormalities reveals neurodevelopmental loci
that confer risk across diagnostic boundaries. Cell, 149(3), 525–537.
Tamura, S., Morikawa, Y., Iwanishi, H., Hisaoka, T., & Senba, E. (2004). Foxp1 gene
expression in projection neurons of the mouse striatum. Neuroscience, 124(2), 261–267.
Taniguchi, H., He, M., Wu, P., Kim, S., Paik, R., Sugino, K., et al. (2011). A resource of Cre
driver lines for genetic targeting of GABAergic neurons in cerebral cortex. Neuron, 71(6),
995–1013.
The Dutch-Belgian Fragile X Consortium (1994). Fmr1 knockout mice: A model to study
fragile X mental retardation. Cell, 78(1), 23–33.
Thomas, A., Burant, A., Bui, N., Graham, D., Yuva-Paylor, L. A., & Paylor, R. (2009). Mar-
ble burying reflects a repetitive and perseverative behavior more than novelty-induced
anxiety. Psychopharmacology, 204(2), 361–373.
Trouillas, P., Takayanagi, T., Hallett, M., Currier, R. D., Subramony, S. H., Wessel, K.,
et al. (1997). International Cooperative Ataxia Rating Scale for pharmacological assess-
ment of the cerebellar syndrome. The Ataxia Neuropharmacology Committee of the
World Federation of Neurology. Journal of the Neurological Sciences, 145(2), 205–211.
mice. Nature, 488(7413), 647–651.
Ubeda-Banon, I., Novejarque, A., Mohedano-Moriano, A., Pro-Sistiaga, P., de la Rosa-
Prieto, C., Insausti, R., et al. (2007). Projections from the posterolateral olfactory amyg-
dala to the ventral striatum: Neural basis for reinforcing properties of chemical stimuli.
BMC Neuroscience, 8, 103.
Ugarte, S. D., Homanics, G. E., Firestone, L. L., & Hammond, D. L. (2000). Sensory thresh-
olds and the antinociceptive effects of GABA receptor agonists in mice lacking the beta3
subunit of the GABA(A) receptor. Neuroscience, 95(3), 795–806.
van den Heuvel, O. A., Veltman, D. J., Groenewegen, H. J., Cath, D. C., van Balkom, A. J.,
van Hartskamp, J., et al. (2005). Frontal-striatal dysfunction during planning in obsessive-
compulsive disorder. Archives of General Psychiatry, 62(3), 301–309.
Veenstra-VanderWeele, J., Muller, C. L., Iwamoto, H., Sauer, J. E., Owens, W. A.,
Shah, C. R., et al. (2012). Autism gene variant causes hyperserotonemia, serotonin
receptor hypersensitivity, social impairment and repetitive behavior. Proceedings of the
Vernes, S. C., Oliver, P. L., Spiteri, E., Lockstone, H. E., Puliyadi, R., Taylor, J. M., et al.
(2011). Foxp2 regulates gene networks implicated in neurite outgrowth in the develop-
ing brain. PLoS Genetics, 7(7), e1002145.
Verpelli, C., Dvoretskova, E., Vicidomini, C., Rossi, F., Chiappalone, M., Schoen, M., et al.
(2011). Importance of Shank3 protein in regulating metabotropic glutamate receptor 5
(mGluR5) expression and signaling at synapses. Journal of Biological Chemistry, 286(40),
34839–34850.
criptomic analysis of autistic brain reveals convergent molecular pathology. Nature,
474(7351), 380–384.
Wagstaff, J., Knoll, J. H., Fleming, J., Kirkness, E. F., Martin-Gallardo, A., Greenberg, F.,
et al. (1991). Localization of the gene encoding the GABAA receptor beta 3 subunit to
the Angelman/Prader-Willi region of human chromosome 15. American Journal of Human
Genetics, 49(2), 330–337.
Waider, J., Proft, F., Langlhofer, G., Asan, E., Lesch, K. P., & Gutknecht, L. (2013). GABA
concentration and GABAergic neuron populations in limbic areas are differentially
altered by brain serotonin deficiency in Tph2 knockout mice. Histochemistry and Cell Biol-
ogy, 139(2), 267–281.
Wang, X., McCoy, P. A., Rodriguiz, R. M., Pan, Y., Je, H. S., Roberts, A. C., et al. (2011).
Synaptic dysfunction and abnormal behaviors in mice lacking major isoforms of Shank3.
Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F., et al.
(2013). One-step generation of mice carrying mutations in multiple genes by
CRISPR/Cas-mediated genome engineering. Cell, 153(4), 910–918.
459(7246), 528–533.
Wegiel, J., Kuchna, I., Nowicki, K., Imaki, H., Yong Ma, S., Azmitia, E. C., et al. (2013).
Contribution of olivofloccular circuitry developmental defects to atypical gaze in autism.
Brain Research, 1512, 106–122.
Weiss, L. A., Arking, D. E., Daly, M. J., & Chakravarti, A. (2009). A genome-wide linkage
and association scan reveals novel loci for autism. Nature, 461(7265), 802–808.
Welch, J. M., Wang, D., & Feng, G. (2004). Differential mRNA expression and protein
localization of the SAP90/PSD-95-associated proteins (SAPAPs) in the nervous system
of the mouse. Journal of Comparative Neurology, 472(1), 24–39.
Whiteside, S. P., Port, J. D., & Abramowitz, J. S. (2004). A meta-analysis of functional neu-
roimaging in obsessive-compulsive disorder. Psychiatry Research, 132(1), 69–79.
Willins, D. L., Deutch, A. Y., & Roth, B. L. (1997). Serotonin 5-HT2A receptors are
expressed on pyramidal cells and interneurons in the rat cortex. Synapse, 27(1), 79–82.
Wohr, M., & Scattoni, M. L. (2013). Behavioural methods used in rodent models of autism
spectrum disorders: Current standards and new developments. Behavioural Brain Research,
251, 5–17.
Yamamoto, T., Yoshida, K., Yoshikawa, H., Kishimoto, Y., & Oka, H. (1992). The medial
dorsal nucleus is one of the thalamic relays of the cerebellocerebral responses to the fron-
tal association cortex in the monkey: Horseradish peroxidase and fluorescent dye double
staining study. Brain Research, 579(2), 315–320.
Yang, M., Bozdagi, O., Scattoni, M. L., Wohr, M., Roullet, F. I., Katz, A. M., et al. (2012).
Reduced excitatory neurotransmission and mild autism-relevant phenotypes in adoles-
cent Shank3 null mutant mice. Journal of Neuroscience, 32(19), 6525–6541.
Zhang, L., He, J., Jugloff, D. G., & Eubanks, J. H. (2008). The MeCP2-null mouse hippo-
campus displays altered basal inhibitory rhythms and is prone to hyperexcitability. Hip-
pocampus, 18(3), 294–309.
Zhang, S., Lin, L., Kaur, S., Thankachan, S., Blanco-Centurion, C., Yanagisawa, M., et al.
(2007). The development of hypocretin (orexin) deficiency in hypocretin/ataxin-3
transgenic rats. Neuroscience, 148(1), 34–43.
Zhou, F. C., Lesch, K. P., & Murphy, D. L. (2002). Serotonin uptake into dopamine neurons
via dopamine transporters: A compensatory alternative. Brain Research, 942(1–2),
109–119.
CHAPTER FOUR
Connecting Signaling Pathways

Underlying Communication to
ASD Vulnerability
Stephanie Lepp, Ashley Anderson, Genevieve Konopka1
1
Corresponding author: e-mail address: genevieve.konopka@utsouthwestern.edu
Contents
1. Introduction 98
2. Neuroanatomy of Communication Deficits in ASD 99
3. Genes Linking Language to ASD 102
3.1 FOXP2 102
3.2 CNTNAP2 107
3.3 FOXP1 109
4. Modeling Communication Phenotypes Using Animal Models 116
4.1 Ultrasonic vocalizations in rodents 116
4.2 Songbird models 119
5. Evolutionary Comparisons 119
6. Conclusions and Future Directions 122
Acknowledgments 124
References 124
Abstract
Language is a human-specific trait that likely facilitated the rapid increase in higher cog-
nitive function in our species. A consequence of the selective pressures that have per-
mitted language and cognition to flourish in humans is the unique vulnerability of
humans to developing cognitive disorders such as autism. Therefore, progress in under-
standing the genetic and molecular mechanisms of language evolution should provide
insight into such disorders. Here, we discuss the few genes that have been identified in
both autism-related pathways and language. We also detail the use of animal models to
uncover the function of these genes at a mechanistic and circuit level. Finally, we pre-
sent the use of comparative genomics to identify novel genes and gene networks
involved in autism. Together, all of these approaches will allow for a broader and deeper
view of the molecular brain mechanisms involved in the evolution of language and the
gene disruptions associated with autism.

http://dx.doi.org/10.1016/B978-0-12-418700-9.00004-6
98 Stephanie Lepp et al.
1. INTRODUCTION
Deficits in language or communication are key features of autism
spectrum disorder (ASD). Such deficits can span a wide range of phenotypes
from complete lack of verbal communication to inappropriate use of lan-
guage in social situations. The fact that language plays such an integral role
in ASD lends credence to the idea that the evolution of higher cognitive
functions, such as language, has led to humans having increased susceptibil-
ities to disorders of cognition such as ASD or schizophrenia (Crespi,
Summers, & Dorus, 2007; Crow, 1997). This also ties into the prevailing,
albeit controversial, notion that language is a human-specific trait as some
of the cognitive processes underlying language are not human-specific
(Hauser, Chomsky, & Fitch, 2002; Penn, Holyoak, & Povinelli, 2008;
Pinker & Jackendoff, 2005; Premack, 2007). Furthermore, most cognitive
disorders are also thought to be human-specific. Thus, understanding such
human-specific traits (and language is debatably the only human-specific
trait) can provide a unique perspective into both human brain evolution
and the pathophysiology of human diseases such as ASD.
One of the challenging aspects of studying language phenotypes as they
relate to ASD is that language deficits are prevalent across many neu-
rodevelopmental disorders such as schizophrenia and reactive attachment
disorder (Gillberg, 2010; King & Lord, 2011; Li, Branch, & DeLisi,
2009). In addition, children with early language impairments are often diag-
nosed with specific language impairment, or SLI, and longitudinal studies
have demonstrated that these children often develop other disorders such
as ASD (Gillberg, 2010). Consequently, phenotypes observed early in devel-
opment can be red flags that there are other broader pathological processes at
play that should be investigated and potentially treated through early behav-
ioral interventional processes. Due to this high comorbidity of phenotypic
features across neurodevelopmental disorders, it is very difficult to predict
how early language disturbances will correlate with later behavioral out-
comes and diagnoses. Therefore, in the absence of any other phenotypic
or genetic biomarkers, language dysfunction is not a strong predictor of
ASD. However, in the context of other ASD phenotypes such as social
impairments and repetitive or restricted behaviors, the presence of language
or communication deficits can strengthen and verify the diagnosis of ASD.
Another complicating factor in deciphering the genetic and molec-
ular mechanisms of language as they relate to ASD is that other
Language and Autism 99
neurodevelopmental disorders with language disruptions, such as schizophre-

nia, share many other properties with ASD. One striking example of the
shared etiologies of these disorders is their shared genetic underpinnings
(Cook & Scherer, 2008; Crespi, 2008; Walsh & Engle, 2010). Overlapping
phenotypes between the disorders include alterations in brain structure and
function and dysfunction in social behaviors (Crespi & Badcock, 2008;
Dumontheil, Burgess, & Blakemore, 2008; King & Lord, 2011; Penzes,
Buonanno, Passafaro, Sala, & Sweet, 2013; Sugranyes, Kyriakopoulos,
Corrigall, Taylor, & Frangou, 2011). Interestingly, one of the most promi-
nent genes associated with language, FOXP2 (discussed in detail in the
succeeding text), has been associated with both autism (Bowers &
Konopka, 2012b) and schizophrenia (Sanjuan et al., 2005, 2006; Tolosa
et al., 2010). Thus, the results of studies of genes and molecular phenotypes
related to language may need to be couched within the framework of mul-
tiple neurodevelopmental disorders and not just ASD.
2. NEUROANATOMY OF COMMUNICATION DEFICITS

IN ASD
It is always challenging to state that a particular brain region is not
involved in a particular neurological process given the multitude of intricate
connections among brain regions. However, lesion and imaging studies can
implicate a specific brain region in contributing to a particular phenotype.
For example, famous early brain lesion studies of language dysfunction in
patients by Broca and Wernicke focused attention on the cerebral cortex,
in particular, the left inferior frontal cortex (Broca’s area) (Keller, Crow,
Foundas, Amunts, & Roberts, 2009) and the posterior superior temporal
cortex (Wernicke’s area) (Spocter et al., 2010). We now know that much
of the cortex, in particular, the left frontal and temporal cortices (in most
right-handed people), is likely involved in processing language
(Ojemann, 1991). In addition, many studies have implicated deficits in cor-
tical function with ASD. In particular, there seem to be decreased functional
long-range cortical–cortical connections with a converse strengthening in
functional short-range connections (Barttfeld et al., 2011; Monk et al.,
2009; Shi, Wang, Peng, Wee, & Shen, 2013; Villalobos, Mizuno, Dahl,
Kemmotsu, & Muller, 2005). These stronger short-range cortical–cortical
connections have also been positively correlated with repetitive behavior
in some ASD cohorts (Monk et al., 2009). The role of the cerebral cortex
in ASD will be discussed in detail in Chapter 6.
While the cerebral cortex has been a primary focus of research related to
both ASD and language, there are several other key players: the cerebellum,
striatum, and thalamus. The cerebellum plays a role in ASD (Rogers et al.,
2013) and will be discussed in detail in Chapter 1. The cortex, thalamus, and
striatum all form a complex circuit that is likely important for many cogni-
tive functions (Fig. 4.1A). The striatum has been a brain region of intense
focus in the study of ASD and language (Di Martino et al., 2011;
Lieberman, 2002) since spoken language involves complex regulation of
motor output and frontal cortical–striatal circuitry is frequently disrupted
in numerous cognitive disorders (Shepherd, 2013). In addition, the thala-
mus, often referred to as the “gateway to the neocortex,” plays an important
role in parsing complex input sensory data and incoming data from the neo-
cortex that may be important in sensory feedback loops and dysfunctional in
ASD. For example, imaging studies have demonstrated ASD patients
exhibiting excessive cortical–striatal connectivity (Di Martino et al.,
A B
Cortical layer 4 Prefrontal

cortex
Cortical layer 5
Centromedian
Cortical layer 6 Striatum nucleus
Medial Anterior Broca’s area
MD
A
(BA44, BA45)
LD
VA
LP
VL
MG VPL
P VPM
Striatum Posterior LG Lateral
Motor
cortices
Visual Somatosensory
cortex cortex
Thalamus
Figure 4.1 (A) Simplified diagram of cortical–striatal–thalamic circuitry involved in sen-

sory and motor integration. FOXP2 and FOXP1 are both expressed in the striatum and
thalamus, whereas cortical expression of FOXP2 is limited to layer 6 and FOXP1 is not
expressed in layer 6, setting up a potentially interesting circuit driven by these two tran-
scription factors. (B) Representation of the various thalamic nuclei known to express
both FOXP1 and FOXP2 and their respective projections to the cortical areas and basal
ganglia. BA, Brodmann's area. Labeled nuclei: MD, mediodorsal; A, anterior; LD, lateral
dorsal; LP, lateral posterior; VL, ventral lateral; VA, ventral anterior; VPM, ventral posterior
medial; VPL, ventral posterior lateral; P, pulvinar; LG, lateral geniculate; MG, medial
geniculate.
2011) and weaker thalamocortical connections (Nair, Treiber, Shukla,

Shih, & Muller, 2013), along with structural abnormalities in specific
thalamocortical white matter tracts (Nair et al., 2013). These imaging studies
suggest that multiple brain regions converge upon shared signaling pathways
that are important for language processing in humans.
The study of patients with lesions has also shown that subcortical regions,
such as the thalamus and basal ganglia, are associated with language function
in humans (Crosson, 2013; Jonas, 1982). Individuals with thalamic lesions
develop various forms of expressive aphasia, usually involving difficulties
with articulation, word emission, phonation control, and language produc-
tion and comprehension ( Jonas, 1982). Yet, syntax and repetitive speech
remain unaffected in these patients (Jonas, 1982). In contrast, lesions of
the basal ganglia result in syntactic and grammatical speech disturbances
(Kotz, Schwartze, & Schmidt-Kassow, 2009). Importantly, a recent study
using diffusion-weighted imaging fiber tracking showed direct connections
from the ventral anterior thalamic nucleus to Broca’s area, which in turn
connects to the anterior putamen (Ford et al., 2013). These studies offer
compelling evidence that both cortical and subcortical structures coordinate
along a common pathway to affect human language processing. Together,
these studies provide insight into which brain regions and circuits to exam-
ine at the molecular level.
Due to the central role of the thalamus connecting many regions asso-
ciated with ASD, we highlight the outgoing information from different tha-
lamic nuclei in Fig. 4.1B. Understanding these connections are important as
both FOXP2 and FOXP1, two genes involved in ASD and language dis-
cussed in the succeeding text, are coexpressed in many thalamic nuclei across
several species (ventral anterior/lateral, ventral posterior lateral, ventral pos-
terior medial, and lateral dorsal), whereas a few nuclei have increased
FOXP2 expression compared to FOXP1 (mediodorsal, centromedian,
and lateral posterior) (Hawrylycz et al., 2012; Takahashi, Liu,
Hirokawa, & Takahashi, 2003; Takahashi, Liu, Oishi, et al., 2008;
Teramitsu, Kudo, London, Geschwind, & White, 2004). Such differences
in expression and potential differences in FOXP2-/FOXP1-mediated
inputs (as they have distinct expression in the cortex as well, with FOXP2
primarily expressed in layer 6 and FOXP1 expressed in layers 2–5) may be
critical for feedback loops that go through both the thalamus and striatum
(Bowers & Konopka, 2012b). A better understanding of how transcription-
ally mediated networks affect brain development and synaptic connections
among these different brain regions is needed. In addition, understanding
direct ties between brain circuit abnormalities and specific behavioral abnor-
malities is still needed to more fully appreciate how mutations in specific
genes in ASD patients result in atypical behaviors. In summary, given the
robust circuitry linking the cortex, striatum, and thalamus, directed
approaches to finding pathways underlying language can be uncovered by
studying how these regions form connections and overlaying imaging data
of these connections with genetic studies of patients. Together, this overlap
will inform our understanding of how disorders affecting language, like
ASD, disrupt these connections.
3. GENES LINKING LANGUAGE TO ASD

While hundreds of genes have been implicated in ASD, there are few
genes with direct relationships to language. Here, we focus on three genes
with robust connections to both language and ASD: FOXP2, contactin-
associated protein-like 2 (CNTNAP2), and FOXP1. One reason to focus
on these three genes is that they are all interconnected through their rela-
tionship to FOXP2 as discussed in the succeeding text. Thus, it is likely that
these genes represent a larger network of genes that is important in the
language-based phenotypes of ASD.
3.1. FOXP2
The gene encoding FOXP2 ( forkhead box P2) was the first gene directly
implicated in a language disorder (Lai, Fisher, Hurst, Vargha-Khadem, &
Monaco, 2001). The affected individuals of a large, intergenerational family
(termed the KE family) had a dominantly inherited verbal dyspraxia with
additional cognitive impairments (Vargha-Khadem, Gadian, Copp, &
Mishkin, 2005; Vargha-Khadem, Watkins, Alcock, Fletcher, &
Passingham, 1995; Watkins, Dronkers, & Vargha-Khadem, 2002). FOXP2
is a member of the family of forkhead transcription factors expressed in areas
of the brain including the neocortex, striatum, thalamus, and cerebellum,
which are thought to be important for language and the coordination of
sequential motor output required for speech (Ferland, Cherry, Preware,
Morrisey, & Walsh, 2003; Teramitsu et al., 2004; Vargha-Khadem et al.,
2005). Moreover, the molecular evolution of FOXP2 on the human lineage
supports the idea that FOXP2 modification (at both the coding and noncod-
ing levels) may have been important for the emergence of language in
humans (Enard et al., 2002, 2009; Konopka et al., 2009; Maricic et al.,
2013; Zhang, Webb, & Podlaha, 2002). Thus, a deeper understanding of
the function of FOXP2 during normal brain development is likely to pro-

vide insight into language development and evolution and language dys-
function in diseases such as ASD.
The use of animal models of Foxp2 has shown that Foxp2 is an important
mediator of vocalizations and therefore has played a conserved role in medi-
ating vocal output throughout evolution (Bowers & Konopka, 2012a).
Foxp2 knockout mice have significantly fewer ultrasonic vocalizations, or
USVs (discussed in detail in the succeeding text) (Shu et al., 2005), “human-
ized” Foxp2 knock-in mice have alterations to USV complexity (Enard
et al., 2009), and knockdown of FoxP2 in songbird leads to deficits in vocal
learning (Haesler et al., 2007). A recent study has found that male and female
rats with knockdown of Foxp2 have differences in USVs, which translates
into a differential response by the mother rat to these pup distress calls
(Bowers, Perez-Pouchoulen, Edwards, & McCarthy, 2013). This is
extremely interesting given the dichotomous ratio (typically cited as 4:1)
of male to female individuals identified with ASD (Werling &
Geschwind, 2013).
Many studies have investigated whether there is genetic variation in
FOXP2 that is associated with ASD (Casey et al., 2012; Chien et al.,
2011; Feuk et al., 2006; Gauthier et al., 2003; Gong et al., 2004; Laroche
et al., 2008; Li, Yamagata, Mori, & Momoi, 2005; Lin et al., 2012;
Marui et al., 2005; Newbury et al., 2002; O’Roak, Vives, Girirajan,
et al., 2012; Richler, Reichert, Buxbaum, & McInnes, 2006; Toma
et al., 2013; Wassink et al., 2002). The overall consensus of these studies
is that there is scant evidence to support association between FOXP2 muta-
tions and autism. Such a conclusion fits with the phenotypic analyses of most
individuals with FOXP2 mutations (e.g., the affected KE family members),
who may have some cognitive impairment but have not been diagnosed
with ASD.
As genetic variation in FOXP2 has shown conflicting or weak correla-
tion with ASD status, a focus on the transcriptional targets as windows into
how this transcription factor might be linked to ASD has emerged. The first
evidence for this connection arose when the first genome-wide attempt to
identify FOXP2 target genes was conducted. Using chromatin immunopre-
cipitation coupled to promoter microarrays (ChIP-chip), Spiteri et al. were
able to identify hundreds of genes as potential direct FOXP2 targets in the
human fetal brain (Spiteri et al., 2007). Interestingly, a number of these tar-
get genes had been previously identified in studies of either ASD or schizo-
phrenia (Bowers & Konopka, 2012b; Spiteri et al., 2007). Subsequent
studies using both human cells and mouse tissue have identified additional
FoxP2 target genes that are associated with ASD (Enard et al., 2009;
Konopka et al., 2009; Mukamel et al., 2011; Vernes et al., 2007, 2008,
2011). In Table 4.1, we summarize the current knowledge of FOXP2 target
genes involved in ASD. However, such a table is a moving target. The list of
ASD genes is constantly evolving, and a recent estimate based on ASD
patient exome sequencing studies puts the projected number of genes likely
to have a genetic link to ASD at over 800 genes (O’Roak, Vives, Girirajan,
et al., 2012). For the analysis presented in Table 4.1, we used two curated
databases, the SFARI (Simons Foundation Autism Research Initiative)
Gene database (https://gene.sfari.org/autdb/; Basu, Kollu, & Banerjee-
Basu, 2009) containing over 500 genes and the AutismKB database from
Peking University, which has over 3000 ASD-associated genes including
a list of over 400 “core” ASD genes (Xu et al., 2011).
The second list that is not completely solidified is the list of direct
FOXP2 target genes. Although, we and others previously identified pro-
moters bound by FOXP2 in human fetal brain tissue and cells using
ChIP-chip (Spiteri et al., 2007; Vernes et al., 2007), these studies had tech-
nical limitations due to the fact that only the proximal promoter regions of
6000 genes were included on the promoter arrays. FOXP2 was one of the
transcription factors recently assessed using ChIP-seq (chromatin immuno-
precipitation followed by DNA sequencing) as part of the ENCODE
(Encyclopedia of DNA Elements) project to determine the function and
regulation of all “nongenic” regions of the genome (Dunham et al.,
2012). These FOXP2 ChIP-seq data have recently been analyzed for deter-
mining the optimal FOXP2 DNA binding motif (Nelson et al., 2013).
However, two recent studies have shown that the antibody used for the
ChIP portion of the experiment in the ENCODE dataset (Abcam antibody
ab16046) also recognizes FOXP1 (Campbell et al., 2010; Tsui, Vessey,
Tomita, Kaplan, & Miller, 2013). Therefore, the ENCODE FOXP2
ChIP-seq data likely contain numerous false-positives. Moreover, the
ENCODE experiments were conducted in transformed human cell lines
(PFSK-1 and SK-N-MC), which are not as optimal as using primary human
neuronal cells or tissue. In summary, we are still lacking a true genome-wide
assessment (using ChIP-seq) of FOXP2 binding in human neurons due to
technical limitations.
Even if ChIP-seq studies for FOXP2 could be reliably carried out in
human neurons, it is estimated that less than 50% of the identified genes will
actually be transcriptionally regulated by FOXP2 (Marson et al., 2007; Wei
Table 4.1 Targets of FOXP2 implicated in ASD

Gene Reference
A2BP1 Spiteri et al. (2007), Vernes et al. (2011)
ALDH1A3 Spiteri et al. (2007)
AMT Konopka et al. (2009)
BLMH Vernes et al. (2011)
CADPS2 Enard et al. (2009)
CDH8 Vernes et al. (2011)
CNTNAP2 Vernes et al. (2008)
DISC1 Spiteri et al. (2007)
DPP6 Spiteri et al. (2007)
DPYD Konopka et al. (2009)
DYNLT3 Konopka et al. (2009)
EIF4EBP2 Spiteri et al. (2007)
FRMPD4 Vernes et al. (2011)
GNAS Vernes et al. (2011)
GRM8 Konopka et al. (2009)
IGFBP3 Konopka et al. (2009)
ITGB3 Spiteri et al. (2007)
KCND1 Spiteri et al. (2007)
KCNT1 Konopka et al. (2009)
KIT Spiteri et al. (2007)
KLC2 Vernes et al. (2011)
MAOB Konopka et al. (2009)
MCF2 Spiteri et al. (2007)
MCPH1 Vernes et al. (2011)
MEF2C Spiteri et al. (2007)
MET Mukamel et al. (2011)
MTF1 Spiteri et al. (2007)
NOS1 Spiteri et al. (2007)
Continued
Table 4.1 Targets of FOXP2 implicated in ASD—cont'd

Gene Reference
NPTX2 Konopka et al. (2009)
NTRK3 Vernes et al. (2011)
PCDHA2 Vernes et al. (2011)
PPP1R1B Vernes et al. (2011)
RPL10 Spiteri et al. (2007)
RPS6KA2 Spiteri et al. (2007)
SNAP25 Spiteri et al. (2007)
SYN1 Vernes et al. (2011)
TAF1C Spiteri et al. (2007)
TBL1X Vernes et al. (2011)
TBR1 Enard et al. (2009)
TDO2 Spiteri et al. (2007)
TIMP1 Konopka et al. (2009)
UBE3A Vernes et al. (2011)
UBL7 Vernes et al. (2011)
VIP Enard et al. (2009), Konopka et al. (2009)
ASD genes are from the SFARI Gene database (https://gene.sfari.org/) and AutismKB (http://autismkb.
cbi.pku.edu.cn/).
et al., 2006), due to spatial and temporal factors necessary for activation or
repression. Thus, it is important to confirm that genes physically bound by
FOXP2 exhibit a change in expression upon manipulation of FOXP2 levels.
To this end, we have identified gene expression changes downstream of
human FOXP2 in human cell lines and primary human neuronal progeni-
tors using whole genome microarrays (Konopka et al., 2009; Konopka,
Friedrich, et al., 2012). Gene expression microarrays using Foxp2 knockout
mice and expression microarray studies in “humanized” Foxp2 mice have
also been conducted (Enard et al., 2009; Vernes et al., 2011). Expression
microarrays have also been utilized to identify networks of gene
coexpression in the songbird striatum and uncovered one network in which
FoxP2 had high connectivity (Hilliard, Miller, Fraley, Horvath, & White,
2012). Thus, once ChIP-seq for FOXP2 is successfully carried out in one or
more species, several published gene expression studies can be combined
across species to identify conserved and species-specific transcriptional tar-
gets of FoxP2.
A handful of direct FOXP2 target genes associated with ASD have been
identified and studied in detail. These include CNTNAP2 (Vernes et al.,
2008), DISC1 (disrupted in schizophrenia 1) (Walker et al., 2012), the receptor
tyrosine kinase MET (Mukamel et al., 2011), and the genes for SRPX2/
uPAR (sushi-repeat-containing protein, X-linked 2; urokinase plasminogen activator
receptor/urokinase receptor) (Roll et al., 2010). One of the interesting defining
features of even just these few genes is the strong interrelatedness of the genes
with phenotypes and the connection not only to disease but also to language.
As discussed in detail in the succeeding text, CNTNAP2 is associated with
language and epilepsy. DISC1 has been studied extensively within the con-
text of schizophrenia (Crespi et al., 2007), another developmental disorder
that is characterized by disruptions to language and communication (Li et al.,
2009; Morice & Igram, 1983; Rapoport, Addington, Frangou, & Psych,
2005; van Os & Kapur, 2009). Using data from the Allen Brain Atlas
(Hawrylycz et al., 2012), MET is the most enriched gene in the human tem-
poral lobe, an important cortical area involved in language. A number of
studies have suggested that MET may have genetic or protein interactions
with uPAR (also known as PLAUR) to mediate signaling through MET
or coordinate oppositional excitatory versus inhibitory signaling in the cor-
tex (Campbell, Li, Sutcliffe, Persico, & Levitt, 2008; Eagleson, Campbell,
Thompson, Bergman, & Levitt, 2011), an important component of normal
brain functioning that is often disrupted in ASD (LeBlanc & Fagiolini, 2011;
Penzes et al., 2013; Yizhar et al., 2011). (For a more detailed discussion of
the role of MET in ASD, see Chapter 5.) Together, these data suggest an
integral role for FOXP2-mediated signaling pathways in both language
and ASD.
3.2. CNTNAP2
The gene encoding CNTNAP2 was first identified as a candidate ASD gene
in several studies conducting fine mapping of a genetic locus significantly
associated with a particular endophenotype of autism, age at first word
(Alarcon, Cantor, Liu, Gilliam, & Geschwind, 2002; Alarcon et al., 2008;
Arking et al., 2008; Bakkaloglu et al., 2008). Additional studies have found
genetic variation or association in CNTNAP2 in individuals with ASD,
epilepsy, and/or intellectual disability (Jackman, Horn, Molleston, & Sokol,

2009; Li et al., 2010; Mefford et al., 2010; Poot et al., 2010; Strauss et al.,
2006; Zweier et al., 2009), SLI (Vernes et al., 2008) or speech delay/speech
comprehension issues (Al-Murrani, Ashton, Aftimos, George, & Love,
2012). Notably, most of the affected individuals for whom detailed pheno-
typic information was provided had prominent speech and language deficits.
A more recent study was unable to replicate significant association of two
polymorphisms in CNTNAP2 with autism or language (Toma et al.,
2013). However, as is always the case with genetic association studies, the
number of subjects queried and the specific cohort of patients queried
can have a profound effect on the outcome of the study, especially for a
genetically complex disorder such as ASD where many genes of small effect
size are likely contributing to the phenotypes (Berg & Geschwind, 2012).
Interestingly, common variation in CNTNAP2 has been shown to be asso-
ciated with risk susceptibility to connectivity deficits in the frontal cortex
(Scott-Van Zeeland et al., 2010) and to normal language functioning
(Kos et al., 2012). Together, these findings paint a complex picture for
the role of genetic variation in CNTNAP2 and language and autism: com-
binations of common and complex variation in CNTNAP2 may lead to
pleiotropic effects in abnormal brain function.
CNTNAP2 exhibits an enrichment of expression in the human frontal
cortex that was not observed in rodent (Abrahams et al., 2007), suggesting an
important role for CNTNAP2 in higher cognitive functions mediated by
the frontal cortex. Since CNTNAP2 is a member of the superfamily of
neurexins (Poliak et al., 1999), there has been much speculation about its
potential role in synapse formation and conduction of action potentials.
CNTNAP2 has been shown to play a role in clustering potassium channels
at the juxtaparanodal region of nodes of Ranvier (Poliak et al., 1999, 2003),
suggesting that CNTNAP2 may be important for normal nerve conduction.
Some patients with CNTNAP2 mutations (as well as Cntnap2 knockout
mice) have ectopic expression of neurons in white matter tracts and disor-
ganized cortical structure (Penagarikano et al., 2011; Strauss et al., 2006),
suggesting a role for CNTNAP2 in neuronal migration. These functional
studies are just in their infancy and additional studies linking the molecular
function of CNTNAP2 to language or vocalization circuitry are warranted.
Mouse models of Cntnap2 have proven to be an extremely valuable tool
for deciphering the distinct molecular mechanisms at play in ASD including
its role in vocal behavior and social interactions. Cntnap2 knockout mice
display a range of “autistic-like” behaviors including a decrease in the
number of USVs (Penagarikano et al., 2011). Interestingly, a number of

the behavioral traits exhibited by these knockout mice are alleviated by ris-
peridone, one of the only two FDA-approved drugs for ASD symptoms in
patients. Unfortunately, the effects of such drug treatment on vocalizations
could not be ascertained since pup vocalizations are measured in the first
week after birth. However, any differences in adult vocalizations in Cntnap2
knockout mice and the effect of risperidone or other drugs on this behavior
could be an interesting future study. Expression of Cntnap2 in songbird
changes during vocal learning in important song-related nuclei and these
expression changes exhibit sexual dimorphism (Panaitof, Abrahams,
Dong, Geschwind, & White, 2010). These results may provide important
mechanistic insights into the imbalanced ratio of male to female patients
diagnosed with ASD. Future genetic manipulations of Cntnap2 in specific
brain regions of rodents or birds should begin to further address the down-
stream functions of CNTNAP2 in brain development and language
circuitry. Recent work in primary rodent cortical cultures showed that
knockdown of CNTNAP2 leads to a decrease in dendritic arbors and
spines, resulting in an overall change in synaptic network activity due to
an imbalance in excitatory/inhibitory connections (Anderson et al.,
2012). Such changes are reminiscent of dendritic changes due to FOXP2
alterations and synaptic changes through modulation of MET/uPAR sig-
naling discussed earlier. Furthermore, these data suggest a critical role for
CNTNAP2 function in mediating proper synapse formation that ultimately
leads to proper circuitry necessary for ASD-related behaviors such as
vocalizations.
3.3. FOXP1
FOXP1 is also a member of the forkhead family of transcription factors, is
highly homologous to FOXP2, and can physically interact with FOXP2
(heterodimerize) to regulate transcription (Li, Weidenfeld, & Morrisey,
2004; Shu, Yang, Zhang, Lu, & Morrisey, 2001). FOXP1 is also expressed
in areas of the brain associated with language such as the neocortex and stri-
atum; however, unlike FOXP2, it has high expression in the hippocampus
and low expression in the cerebellum (Ferland et al., 2003; Teramitsu et al.,
2004). The ability to heterodimerize and the somewhat overlapping expres-
sion patterns, especially in the striatum, support the idea that FOXP1 and
FOXP2 function in a coordinated manner to regulate signaling pathways
in the brain.
In contrast to FOXP2, there is strong evidence supporting the link

between genetic variation in FOXP1 and ASD and/or intellectual disability
(Carr et al., 2010; Hamdan et al., 2010; Horn et al., 2010; O’Roak et al.,
2011; Pariani, Spencer, Graham, & Rimoin, 2009). Mutations range from
point mutations to deletions (Bacon & Rappold, 2012). Interestingly, one
exome sequencing study found a patient with copy number variation in
FOXP1 and a missense mutation in CNTNAP2 (O’Roak et al., 2011). Fur-
ther, molecular experimentation demonstrated that FOXP1 is able to reg-
ulate CNTNAP2 expression, supporting the idea that genes involved in
ASD cluster within certain molecular signaling pathways. These findings
also suggest a convergence in signaling pathways related to language since
FOXP1 can interact with FOXP2 and FOXP2 has also been shown to reg-
ulate CNTNAP2.
Despite a strong link between FOXP1 and ASD, very little progress has
been made into the molecular function of FOXP1 in the brain. Several stud-
ies have examined the importance of FOXP1 in spinal cord function, detail-
ing the role of Foxp1 in motor neuron specification in the mouse (Dasen, De
Camilli, Wang, Tucker, & Jessell, 2008; Rousso, Gaber, Wellik,
Morrisey, & Novitch, 2008; Surmeli, Akay, Ippolito, Tucker, & Jessell,
2011). Complete knockout Foxp1 mice are embryonic lethal due to a heart
defect (Hu et al., 2006; Wang et al., 2004), making behavioral analyses in the
knockout animals impossible. However, a conditional allele of Foxp1 has
been generated (Feng et al., 2010; Surmeli et al., 2011), and these animals
could be used to make a brain-specific knockout of Foxp1. Such studies
would indicate the distinct role of Foxp1 in specific brain regions and even
help to elucidate which brain regions might have compensatory Foxp2
expression with the loss of Foxp1.
Similar to the paucity of cognitive behavioral studies associated with
Foxp1, there is only one study in which putative Foxp1 target genes were
identified (Tang et al., 2012). In this study, the authors forced expression of
Foxp1 in rodent striatal cell lines and conducted both expression microarrays
and ChIP-seq. In addition, gene expression microarrays were used to assess
changes in gene expression upon forced expression of human FOXP1 in the
striatum of a mouse model of Huntington’s disease. In Table 4.2, we sum-
marize the overlap of this study with currently known ASD genes. The
results from these genome-wide studies suggest that FOXP1 regulates genes
important in immune function in the striatum and may be involved in
Huntington’s disease pathology. These results may converge with recent
accumulating evidence for an immune response in the brains of patients with
Table 4.2 Targets of FOXP1 implicated in ASD

Gene Reference
ABAT Tang et al. (2012)
ABCC1 Tang et al. (2012)
AGAP1 Konopka Lab unpublished RNA-seq data
ALDH1A3 Tang et al. (2012)
APC Tang et al. (2012)
ARHGAP24 Konopka Lab unpublished RNA-seq data
ATRX Tang et al. (2012)
AUTS2 Konopka Lab unpublished RNA-seq data
BBS4 Tang et al. (2012)
BDNF Tang et al. (2012)
BIN1 Konopka Lab unpublished RNA-seq data
BZRAP1 Tang et al. (2012)
CBS Tang et al. (2012)
CD38 Tang et al. (2012)
CD44 Tang et al. (2012)
CNR1 Konopka Lab unpublished RNA-seq data
CNTN4 Tang et al. (2012)
CNTNAP2 O’Roak et al. (2011)
CTNNA3 Konopka Lab unpublished RNA-seq data
DHRS9 Tang et al. (2012)
DLGAP2 Tang et al. (2012)
DMPK Konopka Lab unpublished RNA-seq data
DPP10 Konopka Lab unpublished RNA-seq data
DSC2 Tang et al. (2012)
EHMT1 Tang et al. (2012)
EML1 Tang et al. (2012)
EPHA6 Tang et al. (2012)
EPHB6 Tang et al. (2012)
Continued

Gene Reference
ERBB4 Konopka Lab unpublished RNA-seq data
ESR1 Tang et al. (2012)
EXOC4 Konopka Lab unpublished RNA-seq data
FABP5 Konopka Lab unpublished RNA-seq data
FHIT Konopka Lab unpublished RNA-seq data
FLT1 Tang et al. (2012)
FOXP1 Tang et al. (2012), Konopka Lab unpublished RNA-seq data
GAMT Tang et al. (2012)
GAP43 Konopka Lab unpublished RNA-seq data
GPC6 Konopka Lab unpublished RNA-seq data
GPM6B Konopka Lab unpublished RNA-seq data
GPR173 Tang et al. (2012)
GPX1 Konopka Lab unpublished RNA-seq data
GRIN2B Tang et al. (2012)
GSTM1 Tang et al. (2012)
HCFC1 Konopka Lab unpublished RNA-seq data
HMGA2 Konopka Lab unpublished RNA-seq data
HOXA1 Tang et al. (2012)
HYDIN Konopka Lab unpublished RNA-seq data
IGF2 Konopka Lab unpublished RNA-seq data
IL23A Tang et al. (2012)
KCND2 Konopka Lab unpublished RNA-seq data
KCNMA1 Konopka Lab unpublished RNA-seq data
KIF5C Konopka Lab unpublished RNA-seq data
MAPK3 Tang et al. (2012)
MEF2C Tang et al. (2012), Konopka Lab unpublished RNA-seq data
MKKS Tang et al. (2012)

Gene Reference
MSN Konopka Lab unpublished RNA-seq data
MYO1D Konopka Lab unpublished RNA-seq data
MYO3B Konopka Lab unpublished RNA-seq data
NF1 Konopka Lab unpublished RNA-seq data
NFIX Tang et al. (2012)
NIPA1 Tang et al. (2012)
NOS1AP Konopka Lab unpublished RNA-seq data
NRCAM Konopka Lab unpublished RNA-seq data
NRP2 Konopka Lab unpublished RNA-seq data
NRXN3 Konopka Lab unpublished RNA-seq data
OPRM1 Konopka Lab unpublished RNA-seq data
PAFAH1B1 Tang et al. (2012)
PARD3B Konopka Lab unpublished RNA-seq data
PCDH10 Konopka Lab unpublished RNA-seq data
PCDH11X Konopka Lab unpublished RNA-seq data
PCYT1B Tang et al. (2012)
PDE1C Tang et al. (2012), Konopka Lab unpublished RNA-seq data
PLD5 Konopka Lab unpublished RNA-seq data
PLXNA4 Konopka Lab unpublished RNA-seq data
PPP1R1B Tang et al. (2012)
PTPRC Tang et al. (2012)
PTPRD Tang et al. (2012)
PTPRT Konopka Lab unpublished RNA-seq data
RORA Tang et al. (2012)
RPE65 Konopka Lab unpublished RNA-seq data
RYR2 Tang et al. (2012)
SCN1A Konopka Lab unpublished RNA-seq data
SCN7A Tang et al. (2012)
Continued

Gene Reference
SERPINE1 Konopka Lab unpublished RNA-seq data
SLC16A3 Konopka Lab unpublished RNA-seq data
SLC38A10 Konopka Lab unpublished RNA-seq data
SOX5 Tang et al. (2012)
SPON2 Tang et al. (2012)
STX1A Tang et al. (2012)
SUV420H1 Tang et al. (2012)
SYN1 Tang et al. (2012)
SYNE1 Tang et al. (2012)
TBL1XR1 Tang et al. (2012)
TLK2 Tang et al. (2012)
TYR Tang et al. (2012)
UBE2L3 Tang et al. (2012)
UPB1 Tang et al. (2012)
ZNF517 Konopka Lab unpublished RNA-seq data
ASD genes are from the SFARI Gene database (https://gene.sfari.org/) and AutismKB (http://autismkb.
cbi.pku.edu.cn/).
ASD (Gibney & Drexhage, 2013; Michel, Schmidt, & Mirnics, 2012). One
of the largest gene expression studies to date using brain tissue from ASD and
control brains found an enrichment of immune-related genes that did not
appear to have a genetic basis (i.e., no enrichment in genome-wide associ-
ation studies) (Voineagu et al., 2011). Thus, the coexpression and regulation
of these immune-related genes may possibly be coordinated through a tran-
scriptional network regulated by a factor such as FOXP1. In fact, the
immune-related genes in this dataset are coexpressed with the RNA binding
and splicing factor A2BP1 (also known as RBFOX1) and there are data for
dysregulation of A2BP1-mediated splicing in the ASD brains (Voineagu
et al., 2011). In addition, previous work has shown that A2BP1 is a target
of FOXP2 in both humans (Spiteri et al., 2007) and mice (Vernes et al.,
2011). More interestingly, A2BP1 was identified as a target of Foxp1 in
mouse striatum with forced expression (Tang et al., 2012). (For a more
detailed discussion of the role of A2BP1 in ASD, see Chapter 8.) Thus, it
is possible that while FOXP1 was not identified as differentially expressed
or coexpressed in the ASD brain dataset, it could be playing an upstream role
in the dysregulated transcriptional networks identified in ASD brain. Overall
though, there is a need for further study of both the transcriptional targets of
FOXP1 and its role in normal brain development. In Table 4.2, we include
our unpublished RNA-seq data from primary human neural progenitors
(Konopka, Wexler, et al., 2012) with forced expression of human FOXP1
with known ASD genes. What is interesting from Tables 4.1 and 4.2 is that
there are twice as many FOXP1 target genes that are associated with ASD
than FOXP2 target genes, again suggesting a more direct role for FOXP1 in
ASD pathophysiology. These and other future studies will begin to elucidate
the role of FOXP1 in ASD and how FOXP1 heterodimerization with
FOXP2 may be mediating signaling pathways important in language. What
has become quite clear though is that both FOXP1 and FOXP2 regulate
convergent and divergent signaling pathways that are likely important for
a myriad of neurodevelopmentally regulated processes that are frequently
disrupted in disorders like ASD (Fig. 4.2).
FOXP1 FOXP2
Target Shared Target

genes target genes: genes
e.g., CNTNAP2
Cognitive Gross motor Expressive Receptive Fine motor

development function language language function
Figure 4.2 Shared molecular pathways downstream of FOXP2 and FOXP1. Individuals
with mutations in FOXP1 or FOXP2 develop unique and overlapping phenotypes affect-
ing aspects of language, motor control, and cognition. This flowchart shows FOXP1- and
FOXP2-regulating molecular pathways underlying these phenotypes through activation
of shared and distinct direct and indirect gene targets, of which many have been linked
to neurological disorders, such as ASD.
4. MODELING COMMUNICATION PHENOTYPES USING

ANIMAL MODELS
4.1. Ultrasonic vocalizations in rodents
As discussed in the preceding text, because language is thought to be a
human-specific trait, modeling the communication deficits seen in ASD
has proven challenging; however, many rodents, including mice and rats,
communicate using ultrasonic vocalizations. For example, rodent pups pro-
duce ultrasonic isolation calls when separated from the dam, and adult mice
vocalize during mating and other social interactions. While it is thought that
these vocalizations are innate, unlike human language (Arriaga & Jarvis,
2013; Arriaga, Zhou, & Jarvis, 2012), the ultrasonic calls emitted by mice
have been used in several experimental paradigms to determine the genetic
basis of vocal communication.
USVs are innate calls emitted by postnatal mice upon separation from the
dam which can be analyzed when assessing communication deficits in genet-
ically modified mice (Ehret, 2005). USVs include whistle-like sounds with
frequencies between approximately 30 and 90 kHz and clicking sounds
(Hahn et al., 1998) (Fig. 4.3). Both the number and structure of USVs follow
a distinct developmental trajectory with the number of calls peaking
between postnatal days 4 and 7 (PN4–7) depending on strain and with calls
typically being absent by PN14–15 (Hahn et al., 1998). Thus, USVs can be
used to assess not only general levels of postnatal mouse communication but
also the proper development of communication over time. Moreover, USVs
are easy to collect with little manipulation of the pup (Fig. 4.4). Importantly,
the calls have been shown to be functionally useful in eliciting maternal
approach and retrieval (Hahn & Lavooy, 2005). As stated in the previous
sections, USVs have been analyzed in Foxp2 mutant mice and mice lacking
Cntnap2, a downstream target of Foxp2 (Enard et al., 2009; Gaub, Groszer,
Fisher, & Ehret, 2010; Penagarikano et al., 2011; Shu et al., 2005). (For a
review of USVs in Foxp2 mutant mice, see Bowers and Konopka
(2012a).) Thus, USVs have proven to be useful tools in determining the
potential genetic contributors to the language deficits seen in ASD.
The ultrasonic vocalizations of adult mice can also be used to assess
autistic-like communication phenotypes in mouse models. For example,
male mice produce ultrasonic calls reminiscent of bird song when exposed
to female mice or their urine (Holy & Guo, 2005). Although it is also believe
that these calls are innate, they contain multiple syllable types repeated in a
Figure 4.3 Experimental set up for collecting USVs using Avisoft Bioacoustics recording
equipment and software. (A) A mouse pup is placed in a plastic container (a) inside a
polystyrene recording chamber (b). An Avisoft ultrasound microphone is mounted
on the lid of the recording chamber (c) and connected to the Avisoft-UltraSoundGate.
The UltraSoundGate is connected via USB to a PC with Avisoft-RECORDER USGH soft-
ware installed (e). (B) A photograph of the equipment setup.
nonrandom order, leading the authors to classify them as mating “songs”

(Holy & Guo, 2005). Moreover, the songs have functional value during
mating. Indeed, female mice have been shown to prefer vocalizing males
to devocalized males and to lose preference for male songs after ovariectomy
(Pomerantz, Nunez, & Bean, 1983). Additionally, during playback experi-
ments, female mice exhibited approach behavior when exposed to male
songs, but not to artificial control whistles or playbacks of pup isolation
calls (Hammerschmidt, Radyushkin, Ehrenreich, & Fischer, 2009). Muta-
tions in synaptic cell adhesion proteins NLGN4 and SHANK2 have both
been associated with autism (Berkel et al., 2010; Jamain et al., 2003). Inter-
estingly, studies of the behavior of NLGN4 knockout mice have shown
an increased latency to call and a significantly diminished number of calls
Figure 4.4 Examples of mouse isolation calls: (A) Simple calls made by PN4 animals.
(B) More complex calls made by PN7 animals. (C) Calls are often preceded by clicks (den-
oted here with a yellow arrow). Clicks can also appear independently of calls (data not
shown).
compared to wild-type controls when mutant mice are exposed to females

(Jamain et al., 2008). Male SHANK2 knockout mice have a similarly
increased latency to call when exposed to a female, and the emitted calls
are shorter and less structured than those of wild-type males (Schmeisser
et al., 2012).
Mutant SHANK2 females also show autistic-like behavior in the resi-
dent–intruder paradigm (Schmeisser et al., 2012). In this experiment, the
USVs of a resident mouse are recorded when an intruder mouse of the same
sex is presented. A resident female typically emits 50–70 kHz calls for the
first few minutes of exposure to the intruder female. These calls are thought
to be a marker of motivation for social investigation. For example, female
resident mice vocalize more when introduced to a novel intruder than when
exposed to a familiar intruder (Moles, Costantini, Garbugino, Zanettini, &
D’Amato, 2007). Resident SHANK2 knockout females have shown a lon-
ger latency to call and fewer total calls compared to wild-type residents in the
resident–intruder paradigm. Moreover, similar to male mating songs, the
calls were short and unstructured (Schmeisser et al., 2012).
Both postnatal and adult mouse USVs are important tools for determin-
ing the genetic contributions to speech and language disorders and the com-
munication deficits present in autistic spectrum disorders. USVs are clearly
affected by mutations in Foxp2, but due to the early lethality of homozygous
Foxp2 mutants by PN21, adult USVs have yet to be studied in these mice
(Gaub et al., 2010; Shu et al., 2005). Analyzing adult USVs in conditional
mutants with Foxp2 knocked down in specific brain regions or at later time
points would be of interest assuming that they survive until adulthood
(French et al., 2007).
4.2. Songbird models

As there is little evidence that rodents (in particular mice) are vocal learners
(Arriaga & Jarvis, 2013; Arriaga et al., 2012), the use of other animal models
to study learned vocalizations is extremely important, as such models would
likely be more akin to human speech with regard to the learning aspect of
language. Recent studies have demonstrated the similarities between human
speech and songbird vocalizations (Lipkind et al., 2013; Moorman et al.,
2012; Petkov & Jarvis, 2012). Therefore, the study of how genes (in partic-
ular ASD-related genes) affect songbird vocalizations should be informative
with respect to the conserved molecular and anatomical pathways underly-
ing human language. The zebra finch has been widely used for studies of
vocalizations and can be manipulated via viruses to have altered gene expres-
sion profiles. The most prominent zebra finch study to show how alteration
in a gene affects song learning and production involved knockdown of
FoxP2 in Area X, the songbird equivalent of the striatum (Haesler et al.,
2007). Knockdown of FoxP2 in juvenile zebra finches disrupts song learning
(imitation of the song that a young bird is tutored with) and increased trail to
trail variability in their adult song. As discussed earlier, FOXP2 is one of a
handful of genes with a strong link to speech and language in humans, and
FoxP2 expression in the brains of songbirds is similar to that of FOXP2
expression in the human brain (Teramitsu et al., 2004). Thus, the study
of FoxP2 knockdown in songbird brain affecting vocal learning and produc-
tion was the first of its kind to demonstrate a strong conserved molecular link
between genes and behavior related to language across species. Future stud-
ies that assess the role of other genes in vocal learning or more fully delineate
the role of FoxP2 and its target genes in vocal learning are warranted.
5. EVOLUTIONARY COMPARISONS
A different approach to identify the genes and molecular pathways
involved in ASD is to use evolutionary comparisons to identify human-
specific gene expression patterns. As the susceptibility to cognitive disorders,
such as ASD, may have coevolved with our increased capacity for social
communication, uncovering the molecular mechanisms driving human
brain evolution will likely provide insights into the pathophysiology of cog-
nitive disorders.
The advent of high-throughput genomics technologies such as micro-

arrays and RNA-seq has allowed for unbiased genome-wide analyses of gene
expression profiles in the brains of humans and nonhuman primates. Such
comparative genomics studies have provided detailed glimpses into what
makes a human brain unique and thus might be relevant to human-unique
phenotypes such as language or diseases such as ASD (Wang & Konopka,
2013). A number of these comparative studies have provided insight into
not only how basic neuronal processes such as synapse formation may have
evolved (Liu et al., 2012) but also how genes already linked to diseases such
as ASD are differentially expressed in the human brain (Konopka, Friedrich,
et al., 2012).
Attempts to correlate human-specific gene expression signatures with
cognitive disorders such as ASD are limited by current knowledge of
ASD genes and disrupted biological processes. However, by taking an unbi-
ased gene network approach, one can begin to extend that knowledge base
through a “guilt by association” type of methodology. While many types of
gene and regulatory network methods have been used to build such associ-
ations, we and others have employed weighted gene coexpression network
analysis or WGCNA (Langfelder & Horvath, 2008; Zhang & Horvath,
2005). Using WGCNA, we have identified human-specific coexpression
networks or modules (Konopka, Friedrich, et al., 2012). In this particular
study, the modules of the most interest were those specific to the human
frontal pole, as this region of the brain has undergone recent modifications
during human brain evolution and has also been implicated in many cogni-
tive disorders such as ASD and schizophrenia (Dumontheil et al., 2008).
One module of particular interest was a human frontal pole-specific module,
the olivedrab2 module, which was built using exon-specific data from the
RNA-seq dataset. The olivedrab2 module is notable because of the follow-
ing: (1) it is enriched for genes involved in neuronal process formation such
as axons, spines, and dendrites, and numerous studies have identified
human-specific spine properties (Benavides-Piccione, Ballesteros-Yanez,
DeFelipe, & Yuste, 2002; Elston, Benavides-Piccione, & DeFelipe,
2001); (2) both FOXP2 and FOXP1 are among the most coexpressed genes
in the module (Fig. 4.5); (3) there is an enrichment of FOXP2 target genes in
the module; and (4) there is a significant enrichment of ASD genes in this
module (e.g., CNTNAP2, MECP2, and NRXN1; see Konopka,
Friedrich et al., 2012, for more details). Together, these data demonstrate
the possibility of the evolution of a coexpression network in human frontal
pole that has FOXP2 gene regulation as a key component. In addition, the
Figure 4.5 Visualization of a human frontal pole-specific coexpression module, the

olivedrab2 module. Both FOXP2 and FOXP1 are among the top 500 connected genes
and are highlighted in large bold text. This module is also enriched for FOXP2 target
genes as indicated by the green, yellow, and red circles. Modified from Konopka,
Friedrich et al. (2012).
relationship with known genes important for neuronal process formation

and previous data suggesting FOXP2 has a role in neurite outgrowth and
synaptic plasticity (Enard et al., 2009; Vernes et al., 2011) suggest that
FOXP2 may be an important regulator of the signaling pathways that have
evolved for these human-specific morphological and resultant plasticity
changes. The enrichment of ASD genes within the module also suggests
a strong relationship between these potential evolutionary processes and
pathways disrupted in ASD. Thus, there is likely to be coevolution of
molecular signaling networks for language evolution and those at risk in
ASD. Future comparative genomics studies that use additional areas of
the brain with a known association to both ASD and language such as
Broca’s or Wernicke’s areas or other temporal cortical regions will provide

additional evidence for these convergent signaling networks.
6. CONCLUSIONS AND FUTURE DIRECTIONS

The explosion in genetic data related to human diseases has revolu-
tionized our understanding not only of these diseases but also of the basic
neurological processes that underlie disease pathology. A molecular under-
standing of language has benefitted from studies of cases with rare speech
disorders (e.g., the KE family) or patients with language endophenotypes
in ASD and also from genome-wide studies of genetic association, copy
number variation, and exome sequencing in large cohorts of ASD patients.
Candidate genes from these approaches have been further studied in animal
and cellular models and screened for evidence of common genetic variation
in either ASD or normal language function. All of these approaches have led
to a convergence of molecular pathways that focus on FOXP2-mediated
transcriptional activity, as many other salient genes (e.g., CNTNAP2,
FOXP1, and MET) can be directly linked to FOXP2 in some fashion.
However, there is still much to be learned about the role of FOXP2 in
language and ASD. For example, what are the regulators of FOXP2 expres-
sion itself? A tantalizing candidate is POU3F2, a transcription factor
expressed in the brain recently identified as possibly having unique regula-
tion of human FOXP2 compared to ancestral forms of the FOXP2 gene
(e.g., in Neanderthals) (Maricic et al., 2013). Another important facet of
FOXP2 function is the role of protein interaction partners for potential tran-
scriptional regulation. As discussed previously, FOXP1 can heterodimerize
with FOXP2 to regulate transcription. However, another FOXP family
member expressed in the brain, FOXP4, can also heterodimerize with either
FOXP2 or FOXP1 (Li et al., 2004; Takahashi, Liu, Hirokawa, & Takahashi,
2008). Furthermore, the transcription factor TBR1 was shown to physically
interact with FOXP2 in a yeast two-hybrid assay (Sakai et al., 2011), and a
recent study found a significant enrichment of deleterious mutations in
TBR1 in ASD patients (O’Roak, Vives, Fu, et al., 2012). Of course, FOXP2
is certainly not the only important mediator of pathways that have been crit-
ical for the evolution of language. There are likely to be many more genes
that are important orchestrators of pathways that work in concert or in par-
allel with FOXP2-mediated pathways. There are many large studies of
exome and whole genome sequencing that are being undertaken in the
realm of both ASD and language abnormalities. Many of these studies are
being coupled to brain imaging studies so that we can begin to have better
connections between genotypes and phenotypes. These studies will likely
push the ongoing molecular and cellular studies into new frontiers.
Such genetic studies in humans are, however, limited to observational
and correlative reports due to obvious ethical issues with altering gene
expression in humans. While these correlative studies of genotype and func-
tion can obviously be extremely valuable, they are also limited by the avail-
ability of large cohorts of patients with known genetic alterations (although
this is rapidly changing as exome and whole genome sequencing costs fall
and analytic methods improve). Therefore, the study of specific genetic
alterations in vivo in animal models can provide groundbreaking insights into
normal brain development and function relevant to diseases such as ASD.
We have discussed using standard transgenic techniques or viral approaches
for candidate genes in the preceding text. However, new techniques have
revolutionized the field of transgenic animals. These techniques include
nucleases such as zinc finger nucleases or transcription activator-like effector
nucleases and the even newer clustered regularly interspaced short palin-
dromic repeats system (Cong et al., 2013; Gaj, Gersbach, & Barbas, 2013;
Li et al., 2011; Mali et al., 2013; Moehle et al., 2007). This burgeoning field
of alternative genome-editing techniques has opened up the possibility of
genetically manipulating model organisms that have been challenging to
study using standard transgenic technology (e.g., rats or birds) (Geurts
et al., 2009; Huang et al., 2011). The use of animal models beyond the stan-
dard laboratory mouse will be critical for the study of the molecular under-
pinnings of language. Having genetically modified vocal learners, such as
songbirds, will uncover conserved neural circuitry that is necessary for vocal-
izations. It will also be intriguing to see how ASD genes alter the social
aspects of these learned vocalizations and whether there are gender-relevant
differences to these social behaviors upon ASD gene manipulations.
The genetic studies have been leading the way in ASD research, and the
pace of these studies has made it challenging for the confirmatory, functional
studies to keep up (State & Levitt, 2011). In addition, the molecular study of
language has primarily focused on FOXP2 and its target genes, whereas
there are likely to be many more equally relevant genes to follow in such
detail. All of these avenues of research have been instrumental for furthering
our understanding of ASD and how language-relevant neurobiology is at
play during brain development and learning. The future of this field will
require delving deeper into the genetic studies and connecting them to func-
tional studies. This will encompass not only imaging studies in humans but
also new animal models that display ASD and language-relevant behaviors
and phenotypes. Moreover, meta-analyses of all of these studies will be
required to fully flesh out the relevant brain circuitry in finer detail. Overall,
though, tremendous advances have already been made and the road to the
development of pharmacotherapeutics based on these studies is becoming
more tangible and achievable.
ACKNOWLEDGMENTS
G. K. is a Jon Heighten Scholar in Autism Research at UT Southwestern. This work was
supported by the NIMH (R00MH090238), a March of Dimes Basil O’Connor Starter
Scholar Research Award, and CREW Dallas to G. K. S. L. is supported by NIDA
(T32DA07290, Basic Science Training Program in Drug Abuse, Amelia J. Eisch, PhD PI).
REFERENCES
Abrahams, B. S., Tentler, D., Perederiy, J. V., Oldham, M. C., Coppola, G., &
Geschwind, D. H. (2007). Genome-wide analyses of human perisylvian cerebral cortical
patterning. Proceedings of the National Academy of Sciences of the United States of America,
104(45), 17849–17854.
Alarcon, M., Abrahams, B. S., Stone, J. L., Duvall, J. A., Perederiy, J. V., Bomar, J. M., et al.
(2008). Linkage, association, and gene-expression analyses identify CNTNAP2 as an
autism-susceptibility gene. American Journal of Human Genetics, 82(1), 150–159.
Alarcon, M., Cantor, R. M., Liu, J., Gilliam, T. C., & Geschwind, D. H. (2002). Evidence
for a language quantitative trait locus on chromosome 7q in multiplex autism families.
Al-Murrani, A., Ashton, F., Aftimos, S., George, A. M., & Love, D. R. (2012). Amino-
terminal microdeletion within the CNTNAP2 gene associated with variable expressivity
of speech delay. Case Reports in Genetics, 2012, 172408.
Anderson, G. R., Galfin, T., Xu, W., Aoto, J., Malenka, R. C., & Sudhof, T. C. (2012).
Candidate autism gene screen identifies critical role for cell-adhesion molecule CASPR2
in dendritic arborization and spine development. Proceedings of the National Academy of
Sciences of the United States of America, 109(44), 18120–18125.
Arking, D. E., Cutler, D. J., Brune, C. W., Teslovich, T. M., West, K., Ikeda, M., et al.
(2008). A common genetic variant in the neurexin superfamily member CNTNAP2
increases familial risk of autism. American Journal of Human Genetics, 82(1), 160–164.
Arriaga, G., & Jarvis, E. D. (2013). Mouse vocal communication system: Are ultrasounds
learned or innate? Brain and Language, 124(1), 96–116.
Arriaga, G., Zhou, E. P., & Jarvis, E. D. (2012). Of mice, birds, and men: The mouse ultra-
sonic song system has some features similar to humans and song-learning birds. PLoS
One, 7(10), e46610.
Bacon, C., & Rappold, G. A. (2012). The distinct and overlapping phenotypic spectra of
FOXP1 and FOXP2 in cognitive disorders. Human Genetics, 131(11), 1687–1698.
Bakkaloglu, B., O’Roak, B. J., Louvi, A., Gupta, A. R., Abelson, J. F., Morgan, T. M., et al.
(2008). Molecular cytogenetic analysis and resequencing of contactin associated protein-
like 2 in autism spectrum disorders. American Journal of Human Genetics, 82(1), 165–173.
Barttfeld, P., Wicker, B., Cukier, S., Navarta, S., Lew, S., & Sigman, M. (2011). A big-world
network in ASD: Dynamical connectivity analysis reflects a deficit in long-range connec-
tions and an excess of short-range connections. Neuropsychologia, 49(2), 254–263.
autism research. Nucleic Acids Research, 37(Database issue), D832–D836.
Benavides-Piccione, R., Ballesteros-Yanez, I., DeFelipe, J., & Yuste, R. (2002). Cortical
area and species differences in dendritic spine morphology. Journal of Neurocytology,
31(3–5), 337–346.
Berkel, S., Marshall, C. R., Weiss, B., Howe, J., Roeth, R., Moog, U., et al. (2010). Muta-
tions in the SHANK2 synaptic scaffolding gene in autism spectrum disorder and mental
retardation. Nature Genetics, 42(6), 489–491.
Bowers, J. M., & Konopka, G. (2012a). ASD-relevant animal models of the Foxp family of
transcription factors. Autism Open Access, S1(10). http://dx.doi.org/10.4172/2165-7890.
S1-010.
Bowers, J. M., & Konopka, G. (2012b). The role of the FOXP family of transcription factors
in ASD. Disease Markers, 33(5), 251–260.
Bowers, J. M., Perez-Pouchoulen, M., Edwards, N. S., & McCarthy, M. M. (2013). Foxp2
mediates sex differences in ultrasonic vocalization by rat pups and directs order of mater-
nal retrieval. Journal of Neuroscience, 33(8), 3276–3283.
Campbell, D. B., Li, C., Sutcliffe, J. S., Persico, A. M., & Levitt, P. (2008). Genetic evidence
implicating multiple genes in the MET receptor tyrosine kinase pathway in autism spec-
trum disorder. Autism Research, 1(3), 159–168.
Campbell, A. J., Lyne, L., Brown, P. J., Launchbury, R. J., Bignone, P., Chi, J., et al. (2010).
Aberrant expression of the neuronal transcription factor FOXP2 in neoplastic plasma
cells. British Journal of Haematology, 149(2), 221–230.
Carr, C. W., Moreno-De-Luca, D., Parker, C., Zimmerman, H. H., Ledbetter, N.,
Martin, C. L., et al. (2010). Chiari I malformation, delayed gross motor skills, severe
speech delay, and epileptiform discharges in a child with FOXP1 haploinsufficiency.
European Journal of Human Genetics, 18(11), 1216–1220.
Casey, J. P., Magalhaes, T., Conroy, J. M., Regan, R., Shah, N., Anney, R., et al. (2012).
A novel approach of homozygous haplotype sharing identifies candidate genes in autism
spectrum disorder. Human Genetics, 131(4), 565–579.
Chien, Y. L., Wu, Y. Y., Chiu, Y. N., Liu, S. K., Tsai, W. C., Lin, P. I., et al. (2011). Asso-
ciation study of the CNS patterning genes and autism in Han Chinese in Taiwan. Progress
in Neuro-Psychopharmacology and Biological Psychiatry, 35(6), 1512–1517.
Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., et al. (2013). Multiplex
genome engineering using CRISPR/Cas systems. Science, 339(6121), 819–823.
Cook, E. H., Jr., & Scherer, S. W. (2008). Copy-number variations associated with neuro-
psychiatric conditions. Nature, 455(7215), 919–923.
Crespi, B. (2008). Genomic imprinting in the development and evolution of psychotic
spectrum conditions. Biological Reviews of the Cambridge Philosophical Society, 83(4),
441–493.
Crespi, B., & Badcock, C. (2008). Psychosis and autism as diametrical disorders of the social
brain. Behavioral and Brain Sciences, 31(3), 241–261, discussion 261–320.
Crespi, B., Summers, K., & Dorus, S. (2007). Adaptive evolution of genes underlying schizo-
phrenia. Proceedings of the Biological Sciences, 274(1627), 2801–2810.
Crosson, B. (2013). Thalamic mechanisms in language: A reconsideration based on recent
findings and concepts. Brain and Language, 126(1), 73–88.
Crow, T. J. (1997). Is schizophrenia the price that Homo sapiens pays for language?
Schizophrenia Research, 28(2–3), 127–141.
Dasen, J. S., De Camilli, A., Wang, B., Tucker, P. W., & Jessell, T. M. (2008). Hox reper-
toires for motor neuron diversity and connectivity gated by a single accessory factor,
FoxP1. Cell, 134(2), 304–316.
(2011). Aberrant striatal functional connectivity in children with autism. Biological
Psychiatry, 69(9), 847–856.
Dumontheil, I., Burgess, P. W., & Blakemore, S. J. (2008). Development of rostral prefron-
tal cortex and cognitive and behavioural disorders. Developmental Medicine and Child
Neurology, 50(3), 168–181.
Dunham, I., Kundaje, A., Aldred, S. F., Collins, P. J., Davis, C. A., Doyle, F., et al. (2012).
An integrated encyclopedia of DNA elements in the human genome. Nature, 489(7414),
57–74.
Eagleson, K. L., Campbell, D. B., Thompson, B. L., Bergman, M. Y., & Levitt, P. (2011).
The autism risk genes MET and PLAUR differentially impact cortical development.
Autism Research, 4(1), 68–83.
Ehret, G. (2005). Infant rodent ultrasounds—A gate to the understanding of sound commu-
nication. Behavior Genetics, 35(1), 19–29.
Elston, G. N., Benavides-Piccione, R., & DeFelipe, J. (2001). The pyramidal cell in cogni-
tion: A comparative study in human and monkey. Journal of Neuroscience, 21(17), RC163.
Enard, W., Gehre, S., Hammerschmidt, K., Holter, S. M., Blass, T., Somel, M., et al. (2009).
A humanized version of Foxp2 affects cortico-basal ganglia circuits in mice. Cell, 137(5),
961–971.
Enard, W., Przeworski, M., Fisher, S. E., Lai, C. S., Wiebe, V., Kitano, T., et al. (2002).
Molecular evolution of FOXP2, a gene involved in speech and language. Nature,
418(6900), 869–872.
Feng, X., Ippolito, G. C., Tian, L., Wiehagen, K., Oh, S., Sambandam, A., et al. (2010).
Foxp1 is an essential transcriptional regulator for the generation of quiescent naive
T cells during thymocyte development. Blood, 115(3), 510–518.
Ferland, R. J., Cherry, T. J., Preware, P. O., Morrisey, E. E., & Walsh, C. A. (2003). Char-
acterization of Foxp2 and Foxp1 mRNA and protein in the developing and mature
brain. Journal of Comparative Neurology, 460(2), 266–279.
Feuk, L., Kalervo, A., Lipsanen-Nyman, M., Skaug, J., Nakabayashi, K., Finucane, B., et al.
(2006). Absence of a paternally inherited FOXP2 gene in developmental verbal
dyspraxia. American Journal of Human Genetics, 79(5), 965–972.
Ford, A. A., Triplett, W., Sudhyadhom, A., Gullett, J., McGregor, K., Fitzgerald, D. B., et al.
(2013). Broca’s area and its striatal and thalamic connections: A diffusion-MRI
tractography study. Frontiers in Neuroanatomy, 7, 8.
French, C. A., Groszer, M., Preece, C., Coupe, A. M., Rajewsky, K., & Fisher, S. E. (2007).
Generation of mice with a conditional Foxp2 null allele. Genesis, 45(7), 440–446.
Gaj, T., Gersbach, C. A., & Barbas, C. F., 3rd. (2013). ZFN, TALEN, and CRISPR/Cas-
based methods for genome engineering. Trends in Biotechnology, 31(7), 397–405.
Gaub, S., Groszer, M., Fisher, S. E., & Ehret, G. (2010). The structure of innate vocalizations
in Foxp2-deficient mouse pups. Genes, Brain and Behavior, 9(4), 390–401.
Gauthier, J., Joober, R., Mottron, L., Laurent, S., Fuchs, M., De Kimpe, V., et al. (2003).
Mutation screening of FOXP2 in individuals diagnosed with autistic disorder. American
Journal of Medical Genetics Part A, 118A(2), 172–175.
Geurts, A. M., Cost, G. J., Freyvert, Y., Zeitler, B., Miller, J. C., Choi, V. M., et al.
(2009). Knockout rats via embryo microinjection of zinc-finger nucleases. Science,
325(5939), 433.
Gibney, S. M., & Drexhage, H. A. (2013). Evidence for a dysregulated immune system
in the etiology of psychiatric disorders. Journal of NeuroImmune Pharmacology, 8(4),
900–920.
Gillberg, C. (2010). The ESSENCE in child psychiatry: Early symptomatic syndromes

eliciting neurodevelopmental clinical examinations. Research in Developmental Disabilities,
31(6), 1543–1551.
Gong, X., Jia, M., Ruan, Y., Shuang, M., Liu, J., Wu, S., et al. (2004). Association between
the FOXP2 gene and autistic disorder in Chinese population. American Journal of Medical
Genetics Part B: Neuropsychiatric Genetics, 127B(1), 113–116.
Haesler, S., Rochefort, C., Georgi, B., Licznerski, P., Osten, P., & Scharff, C. (2007).
Incomplete and inaccurate vocal imitation after knockdown of FoxP2 in songbird basal
ganglia nucleus Area X. PLoS Biology, 5(12), e321.
Hahn, M. E., Karkowski, L., Weinreb, L., Henry, A., Schanz, N., & Hahn, E. M. (1998).
Genetic and developmental influences on infant mouse ultrasonic calling. II. Develop-
mental patterns in the calls of mice 2-12 days of age. Behavior Genetics, 28(4), 315–325.
Hahn, M. E., & Lavooy, M. J. (2005). A review of the methods of studies on infant ultrasound
production and maternal retrieval in small rodents. Behavior Genetics, 35(1), 31–52.
impairment. American Journal of Human Genetics, 87(5), 671–678.
Hammerschmidt, K., Radyushkin, K., Ehrenreich, H., & Fischer, J. (2009). Female mice
respond to male ultrasonic ‘songs’ with approach behaviour. Biology Letters, 5(5),
589–592.
Hauser, M. D., Chomsky, N., & Fitch, W. T. (2002). The faculty of language: What is it,
who has it, and how did it evolve? Science, 298(5598), 1569–1579.
Hawrylycz, M. J., Lein, E. S., Guillozet-Bongaarts, A. L., Shen, E. H., Ng, L., Miller, J. A.,
et al. (2012). An anatomically comprehensive atlas of the adult human brain trans-
criptome. Nature, 489(7416), 391–399.
Hilliard, A. T., Miller, J. E., Fraley, E. R., Horvath, S., & White, S. A. (2012). Molecular
microcircuitry underlies functional specification in a Basal Ganglia circuit dedicated to
vocal learning. Neuron, 73(3), 537–552.
Holy, T. E., & Guo, Z. (2005). Ultrasonic songs of male mice. PLoS Biology, 3(12), e386.
Horn, D., Kapeller, J., Rivera-Brugues, N., Moog, U., Lorenz-Depiereux, B., Eck, S., et al.
(2010). Identification of FOXP1 deletions in three unrelated patients with mental retar-
dation and significant speech and language deficits. Human Mutation, 31(11),
E1851–E1860.
Hu, H., Wang, B., Borde, M., Nardone, J., Maika, S., Allred, L., et al. (2006). Foxp1 is an
essential transcriptional regulator of B cell development. Nature Immunology, 7(8),
819–826.
Huang, G., Tong, C., Kumbhani, D. S., Ashton, C., Yan, H., & Ying, Q. L. (2011). Beyond
knockout rats: New insights into finer genome manipulation in rats. Cell Cycle, 10(7),
1059–1066.
Jackman, C., Horn, N. D., Molleston, J. P., & Sokol, D. K. (2009). Gene associated with
seizures, autism, and hepatomegaly in an Amish girl. Pediatric Neurology, 40(4), 310–313.
Jamain, S., Quach, H., Betancur, C., Rastam, M., Colineaux, C., Gillberg, I. C., et al.
(2003). Mutations of the X-linked genes encoding neuroligins NLGN3 and NLGN4
are associated with autism. Nature Genetics, 34(1), 27–29.
Jamain, S., Radyushkin, K., Hammerschmidt, K., Granon, S., Boretius, S., Varoqueaux, F.,
et al. (2008). Reduced social interaction and ultrasonic communication in a mouse
model of monogenic heritable autism. Proceedings of the National Academy of Sciences of
the United States of America, 105(5), 1710–1715.
Jonas, S. (1982). The thalamus and aphasia, including transcortical aphasia: A review. Journal
of Communication Disorders, 15(1), 31–41.
Keller, S. S., Crow, T., Foundas, A., Amunts, K., & Roberts, N. (2009). Broca’s area:
Nomenclature, anatomy, typology and asymmetry. Brain and Language, 109(1), 29–48.
King, B. H., & Lord, C. (2011). Is schizophrenia on the autism spectrum? Brain Research,
1380, 34–41.
Konopka, G., Bomar, J. M., Winden, K., Coppola, G., Jonsson, Z. O., Gao, F., et al. (2009).
Human-specific transcriptional regulation of CNS development genes by FOXP2.
Nature, 462(7270), 213–217.
Konopka, G., Friedrich, T., Davis-Turak, J., Winden, K., Oldham, M. C., Gao, F., et al.
(2012). Human-specific transcriptional networks in the brain. Neuron, 75(4), 601–617.
Konopka, G., Wexler, E., Rosen, E., Mukamel, Z., Osborn, G. E., Chen, L., et al. (2012).
Modeling the functional genomics of autism using human neurons. Molecular Psychiatry,
17(2), 202–214.
Kos, M., van den Brink, D., Snijders, T. M., Rijpkema, M., Franke, B., Fernandez, G., et al.
(2012). CNTNAP2 and language processing in healthy individuals as measured with
ERPs. PLoS One, 7(10), e46995.
Kotz, S. A., Schwartze, M., & Schmidt-Kassow, M. (2009). Non-motor basal ganglia func-
tions: A review and proposal for a model of sensory predictability in auditory language
perception. Cortex, 45(8), 982–990.
Lai, C. S., Fisher, S. E., Hurst, J. A., Vargha-Khadem, F., & Monaco, A. P. (2001).
A forkhead-domain gene is mutated in a severe speech and language disorder. Nature,
413(6855), 519–523.
Langfelder, P., & Horvath, S. (2008). WGCNA: An R package for weighted correlation net-
work analysis. BMC Bioinformatics, 9, 559.
Laroche, F., Ramoz, N., Leroy, S., Fortin, C., Rousselot-Paillet, B., Philippe, A., et al.
(2008). Polymorphisms of coding trinucleotide repeats of homeogenes in neu-
rodevelopmental psychiatric disorders. Psychiatric Genetics, 18(6), 295–301.
LeBlanc, J. J., & Fagiolini, M. (2011). Autism: A “critical period” disorder? Neural Plasticity,
2011, 921680.
Li, X., Branch, C. A., & DeLisi, L. E. (2009). Language pathway abnormalities in schizophre-
nia: A review of fMRI and other imaging studies. Current Opinion in Psychiatry, 22(2),
131–139.
Li, X., Hu, Z., He, Y., Xiong, Z., Long, Z., Peng, Y., et al. (2010). Association analysis of
CNTNAP2 polymorphisms with autism in the Chinese Han population. Psychiatric
Genetics, 20(3), 113–117.
Li, T., Huang, S., Zhao, X., Wright, D. A., Carpenter, S., Spalding, M. H., et al. (2011).
Modularly assembled designer TAL effector nucleases for targeted gene knockout and
gene replacement in eukaryotes. Nucleic Acids Research, 39(14), 6315–6325.
Li, S., Weidenfeld, J., & Morrisey, E. E. (2004). Transcriptional and DNA binding activity of
the Foxp1/2/4 family is modulated by heterotypic and homotypic protein interactions.
Molecular and Cellular Biology, 24(2), 809–822.
Li, H., Yamagata, T., Mori, M., & Momoi, M. Y. (2005). Absence of causative mutations and
presence of autism-related allele in FOXP2 in Japanese autistic patients. Brain Dev, 27(3),
207–210.
Lieberman, P. (2002). On the nature and evolution of the neural bases of human language.
The American Journal of Physical Anthropology, 35(Suppl.), 36–62.
Lin, P. I., Chien, Y. L., Wu, Y. Y., Chen, C. H., Gau, S. S., Huang, Y. S., et al. (2012). The
WNT2 gene polymorphism associated with speech delay inherent to autism. Research in
Developmental Disabilities, 33(5), 1533–1540.
Lipkind, D., Marcus, G. F., Bemis, D. K., Sasahara, K., Jacoby, N., Takahasi, M., et al.
(2013). Stepwise acquisition of vocal combinatorial capacity in songbirds and human
infants. Nature, 498(7452), 104–108.
Liu, X., Somel, M., Tang, L., Yan, Z., Jiang, X., Guo, S., et al. (2012). Extension of cortical
synaptic development distinguishes humans from chimpanzees and macaques. Genome
Research, 22(4), 611–622.
Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., et al. (2013). RNA-
guided human genome engineering via Cas9. Science, 339(6121), 823–826.
Maricic, T., Gunther, V., Georgiev, O., Gehre, S., Curlin, M., Schreiweis, C., et al. (2013).
A recent evolutionary change affects a regulatory element in the human FOXP2 gene.
Molecular Biology and Evolution, 30(4), 844–852.
Marson, A., Kretschmer, K., Frampton, G. M., Jacobsen, E. S., Polansky, J. K.,
MacIsaac, K. D., et al. (2007). Foxp3 occupancy and regulation of key target genes dur-
ing T-cell stimulation. Nature, 445(7130), 931–935.
Marui, T., Koishi, S., Funatogawa, I., Yamamoto, K., Matsumoto, H., Hashimoto, O., et al.
(2005). No association of FOXP2 and PTPRZ1 on 7q31 with autism from the Japanese
population. Neuroscience Research, 53(1), 91–94.
Mefford, H. C., Muhle, H., Ostertag, P., von Spiczak, S., Buysse, K., Baker, C., et al. (2010).
Genome-wide copy number variation in epilepsy: Novel susceptibility loci in idiopathic
generalized and focal epilepsies. PLoS Genetics, 6(5), e1000962.
Michel, M., Schmidt, M. J., & Mirnics, K. (2012). Immune system gene dysregulation in
autism and schizophrenia. Developmental Neurobiology, 72(10), 1277–1287.
Moehle, E. A., Rock, J. M., Lee, Y. L., Jouvenot, Y., DeKelver, R. C., Gregory, P. D., et al.
(2007). Targeted gene addition into a specified location in the human genome using
designed zinc finger nucleases. Proceedings of the National Academy of Sciences of the United
States of America, 104(9), 3055–3060.
Moles, A., Costantini, F., Garbugino, L., Zanettini, C., & D’Amato, F. R. (2007). Ultrasonic
vocalizations emitted during dyadic interactions in female mice: A possible index of
sociability? Behavioural Brain Research, 182(2), 223–230.
Monk, C. S., Peltier, S. J., Wiggins, J. L., Weng, S. J., Carrasco, M., Risi, S., et al. (2009).
Abnormalities of intrinsic functional connectivity in autism spectrum disorders.
NeuroImage, 47(2), 764–772.
Moorman, S., Gobes, S. M., Kuijpers, M., Kerkhofs, A., Zandbergen, M. A., & Bolhuis, J. J.
(2012). Human-like brain hemispheric dominance in birdsong learning. Proceedings of the
Morice, R. D., & Igram, J. C. (1983). Language complexity and age of onset of schizophre-
nia. Psychiatry Research, 9(3), 233–242.
tion and autism risk. Journal of Neuroscience, 31(32), 11437–11442.
Nair, A., Treiber, J. M., Shukla, D. K., Shih, P., & Muller, R. A. (2013). Impaired
thalamocortical connectivity in autism spectrum disorder: A study of functional and ana-
tomical connectivity. Brain, 136(Pt 6), 1942–1955.
Nelson, C. S., Fuller, C. K., Fordyce, P. M., Greninger, A. L., Li, H., & Derisi, J. L. (2013).
Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding
motif in chimp and human, which enables the detection of evolutionarily novel targets.
Nucleic Acids Research, 41(12), 5991–6004.
Newbury, D. F., Bonora, E., Lamb, J. A., Fisher, S. E., Lai, C. S., Baird, G., et al. (2002).
FOXP2 is not a major susceptibility gene for autism or specific language impairment.
Ojemann, G. A. (1991). Cortical organization of language. Journal of Neuroscience, 11(8),
2281–2287.
tions. Nature Genetics, 43(6), 585–589.
disorders. Science, 338(6114), 1619–1622.
mutations. Nature, 485(7397), 246–250.
Panaitof, S. C., Abrahams, B. S., Dong, H., Geschwind, D. H., & White, S. A. (2010).
Language-related Cntnap2 gene is differentially expressed in sexually dimorphic song
nuclei essential for vocal learning in songbirds. Journal of Comparative Neurology,
518(11), 1995–2018.
Pariani, M. J., Spencer, A., Graham, J. M., Jr., & Rimoin, D. L. (2009). A 785kb deletion of
3p14.1p13, including the FOXP1 gene, associated with speech delay, contractures,
hypertonia and blepharophimosis. European Journal of Medical Genetics, 52(2–3), 123–127.
Penn, D. C., Holyoak, K. J., & Povinelli, D. J. (2008). Darwin’s mistake: Explaining the dis-
continuity between human and nonhuman minds. Behavioral and Brain Sciences, 31(2),
109–130, discussion 130–178.
Penzes, P., Buonanno, A., Passafaro, M., Sala, C., & Sweet, R. A. (2013). Developmental
vulnerability of synapses and circuits associated with neuropsychiatric disorders. Journal
of Neurochemistry, 126(2), 165–182.
Petkov, C. I., & Jarvis, E. D. (2012). Birds, primates, and spoken language origins: Behavioral
phenotypes and neurobiological substrates. Frontiers in Evolutionary Neuroscience, 4, 12.
Pinker, S., & Jackendoff, R. (2005). The faculty of language: What’s special about it?
Cognition, 95(2), 201–236.
Poliak, S., Gollan, L., Martinez, R., Custer, A., Einheber, S., Salzer, J. L., et al. (1999).
Caspr2, a new member of the neurexin superfamily, is localized at the juxtaparanodes
of myelinated axons and associates with K þ channels. Neuron, 24(4), 1037–1047.
Poliak, S., Salomon, D., Elhanany, H., Sabanay, H., Kiernan, B., Pevny, L., et al. (2003).
Juxtaparanodal clustering of Shaker-like K þ channels in myelinated axons depends
on Caspr2 and TAG-1. Journal of Cell Biology, 162(6), 1149–1160.
Pomerantz, S. M., Nunez, A. A., & Bean, N. J. (1983). Female behavior is affected by male
ultrasonic vocalizations in house mice. Physiology and Behavior, 31(1), 91–96.
Poot, M., Beyer, V., Schwaab, I., Damatova, N., Van’t Slot, R., Prothero, J., et al. (2010).
Disruption of CNTNAP2 and additional structural genome changes in a boy with speech
delay and autism spectrum disorder. Neurogenetics, 11(1), 81–89.
Premack, D. (2007). Human and animal cognition: Continuity and discontinuity. Proceedings
of the National Academy of Sciences of the United States of America, 104(35), 13861–13867.
Rapoport, J. L., Addington, A. M., Frangou, S., & Psych, M. R. (2005). The neu-
rodevelopmental model of schizophrenia: Update 2005. Molecular Psychiatry, 10(5),
434–449.
Richler, E., Reichert, J. G., Buxbaum, J. D., & McInnes, L. A. (2006). Autism and ultra-
conserved non-coding sequence on chromosome 7q. Psychiatric Genetics, 16(1), 19–23.
Rogers, T. D., McKimm, E., Dickson, P. E., Goldowitz, D., Blaha, C. D., & Mittleman, G.
(2013). Is autism a disease of the cerebellum? An integration of clinical and pre-clinical
research. Frontiers in Systems Neuroscience, 7, 15.
Roll, P., Vernes, S. C., Bruneau, N., Cillario, J., Ponsole-Lenfant, M., Massacrier, A., et al.
(2010). Molecular networks implicated in speech-related disorders: FOXP2 regulates the
SRPX2/uPAR complex. Human Molecular Genetics, 19(24), 4848–4860.
Rousso, D. L., Gaber, Z. B., Wellik, D., Morrisey, E. E., & Novitch, B. G. (2008). Coor-
dinated actions of the forkhead protein Foxp1 and Hox proteins in the columnar orga-
nization of spinal motor neurons. Neuron, 59(2), 226–240.
Sakai, Y., Shaw, C. A., Dawson, B. C., Dugas, D. V., Al-Mohtaseb, Z., Hill, D. E., et al.
(2011). Protein interactome reveals converging molecular pathways among autism dis-
orders. Science Translational Medicine, 3(86), 86ra49.
Sanjuan, J., Tolosa, A., Gonzalez, J. C., Aguilar, E. J., Molto, M. D., Najera, C., et al. (2005).
FOXP2 polymorphisms in patients with schizophrenia. Schizophrenia Research, 73(2–3),
253–256.
Sanjuan, J., Tolosa, A., Gonzalez, J. C., Aguilar, E. J., Perez-Tur, J., Najera, C., et al. (2006).
Association between FOXP2 polymorphisms and schizophrenia with auditory halluci-
nations. Psychiatric Genetics, 16(2), 67–72.
Schmeisser, M. J., Ey, E., Wegener, S., Bockmann, J., Stempel, A. V., Kuebler, A., et al.
(2012). Autistic-like behaviours and hyperactivity in mice lacking ProSAP1/Shank2.
Nature, 486(7402), 256–260.
Scott-Van Zeeland, A. A., Abrahams, B. S., Alvarez-Retuerto, A. I., Sonnenblick, L. I.,
Rudie, J. D., Ghahremani, D., et al. (2010). Altered functional connectivity in frontal
lobe circuits is associated with variation in the autism risk gene CNTNAP2. Science Trans-
lational Medicine, 2(56), 56ra80.
Shepherd, G. M. (2013). Corticostriatal connectivity and its role in disease. Nature Reviews
Neuroscience, 14(4), 278–291.
Shi, F., Wang, L., Peng, Z., Wee, C. Y., & Shen, D. (2013). Altered modular organization of
structural cortical networks in children with autism. PLoS One, 8(5), e63131.
Shu, W., Cho, J. Y., Jiang, Y., Zhang, M., Weisz, D., Elder, G. A., et al. (2005). Altered
ultrasonic vocalization in mice with a disruption in the Foxp2 gene. Proceedings of the
Shu, W., Yang, H., Zhang, L., Lu, M. M., & Morrisey, E. E. (2001). Characterization of a
new subfamily of winged-helix/forkhead (Fox) genes that are expressed in the lung and
act as transcriptional repressors. Journal of Biological Chemistry, 276(29), 27488–27497.
Spiteri, E., Konopka, G., Coppola, G., Bomar, J., Oldham, M., Ou, J., et al. (2007). Iden-
tification of the transcriptional targets of FOXP2, a gene linked to speech and language,
in developing human brain. American Journal of Human Genetics, 81(6), 1144–1157.
Spocter, M. A., Hopkins, W. D., Garrison, A. R., Bauernfeind, A. L., Stimpson, C. D.,
Hof, P. R., et al. (2010). Wernicke’s area homologue in chimpanzees (Pan troglodytes)
and its relation to the appearance of modern human language. Proceedings of the Biological
Sciences, 277(1691), 2165–2174.
State, M. W., & Levitt, P. (2011). The conundrums of understanding genetic risks for autism
spectrum disorders. Nature Neuroscience, 14(12), 1499–1506.
Strauss, K. A., Puffenberger, E. G., Huentelman, M. J., Gottlieb, S., Dobrin, S. E.,
Parod, J. M., et al. (2006). Recessive symptomatic focal epilepsy and mutant
contactin-associated protein-like 2. The New England Journal of Medicine, 354(13),
1370–1377.
Sugranyes, G., Kyriakopoulos, M., Corrigall, R., Taylor, E., & Frangou, S. (2011). Autism
spectrum disorders and schizophrenia: Meta-analysis of the neural correlates of social
cognition. PLoS One, 6(10), e25322.
Surmeli, G., Akay, T., Ippolito, G. C., Tucker, P. W., & Jessell, T. M. (2011). Patterns of
spinal sensory-motor connectivity prescribed by a dorsoventral positional template. Cell,
147(3), 653–665.
Takahashi, K., Liu, F. C., Hirokawa, K., & Takahashi, H. (2003). Expression of Foxp2, a
gene involved in speech and language, in the developing and adult striatum. Journal of
Neuroscience Research, 73(1), 61–72.
Takahashi, K., Liu, F. C., Hirokawa, K., & Takahashi, H. (2008). Expression of Foxp4 in the
developing and adult rat forebrain. Journal of Neuroscience Research, 86(14), 3106–3116.
Takahashi, K., Liu, F. C., Oishi, T., Mori, T., Higo, N., Hayashi, M., et al. (2008). Expres-
sion of FOXP2 in the developing monkey forebrain: Comparison with the expression of
the genes FOXP1, PBX3, and MEIS2. Journal of Comparative Neurology, 509(2), 180–189.
Tang, B., Becanovic, K., Desplats, P. A., Spencer, B., Hill, A. M., Connolly, C., et al. (2012).
Forkhead box protein p1 is a transcriptional repressor of immune signaling in the CNS:
Implications for transcriptional dysregulation in Huntington disease. Human Molecular
Genetics, 21(14), 3097–3111.
Teramitsu, I., Kudo, L. C., London, S. E., Geschwind, D. H., & White, S. A. (2004). Parallel
FoxP1 and FoxP2 expression in songbird and human brain predicts functional interac-
tion. Journal of Neuroscience, 24(13), 3152–3163.
Tolosa, A., Sanjuan, J., Dagnall, A. M., Molto, M. D., Herrero, N., & de Frutos, R. (2010).
FOXP2 gene and language impairment in schizophrenia: Association and epigenetic
studies. BMC Medical Genetics, 11, 114.
Toma, C., Hervas, A., Torrico, B., Balmana, N., Salgado, M., Maristany, M., et al. (2013).
Analysis of two language-related genes in autism: A case-control association study of
FOXP2 and CNTNAP2. Psychiatric Genetics, 23(2), 82–85.
Tsui, D., Vessey, J. P., Tomita, H., Kaplan, D. R., & Miller, F. D. (2013). FoxP2 regulates
neurogenesis during embryonic cortical development. Journal of Neuroscience, 33(1),
244–258.
van Os, J., & Kapur, S. (2009). Schizophrenia. Lancet, 374(9690), 635–645.
Vargha-Khadem, F., Gadian, D. G., Copp, A., & Mishkin, M. (2005). FOXP2 and the neu-
roanatomy of speech and language. Nature Reviews Neuroscience, 6(2), 131–138.
Vargha-Khadem, F., Watkins, K., Alcock, K., Fletcher, P., & Passingham, R. (1995). Praxic
and nonverbal cognitive deficits in a large family with a genetically transmitted speech
and language disorder. Proceedings of the National Academy of Sciences of the United States
of America, 92(3), 930–933.
Vernes, S. C., Newbury, D. F., Abrahams, B. S., Winchester, L., Nicod, J., Groszer, M., et al.
(2008). A functional genetic link between distinct developmental language disorders. The
New England Journal of Medicine, 359(22), 2337–2345.
Vernes, S. C., Oliver, P. L., Spiteri, E., Lockstone, H. E., Puliyadi, R., Taylor, J. M., et al.
(2011). Foxp2 regulates gene networks implicated in neurite outgrowth in the develop-
ing brain. PLoS Genetics, 7(7), e1002145.
Vernes, S. C., Spiteri, E., Nicod, J., Groszer, M., Taylor, J. M., Davies, K. E., et al. (2007).
High-throughput analysis of promoter occupancy reveals direct neural targets of
FOXP2, a gene mutated in speech and language disorders. American Journal of Human
Genetics, 81(6), 1232–1250.
Villalobos, M. E., Mizuno, A., Dahl, B. C., Kemmotsu, N., & Muller, R. A. (2005).
Reduced functional connectivity between V1 and inferior frontal cortex associated with
visuomotor performance in autism. NeuroImage, 25(3), 916–925.
474(7351), 380–384.
Walker, R. M., Hill, A. E., Newman, A. C., Hamilton, G., Torrance, H. S.,
Anderson, S. M., et al. (2012). The DISC1 promoter: Characterization and regulation
by FOXP2. Human Molecular Genetics, 21(13), 2862–2872.
Walsh, C. A., & Engle, E. C. (2010). Allelic diversity in human developmental neu-
rogenetics: Insights into biology and disease. Neuron, 68(2), 245–253.
Wang, G. Z., & Konopka, G. (2013). Decoding human gene expression signatures in the
brain. Transcription, 4(3), 102–108.
Wang, B., Weidenfeld, J., Lu, M. M., Maika, S., Kuziel, W. A., Morrisey, E. E., et al. (2004).
Foxp1 regulates cardiac outflow tract, endocardial cushion morphogenesis and myocyte
proliferation and maturation. Development, 131(18), 4477–4487.
Wassink, T. H., Piven, J., Vieland, V. J., Pietila, J., Goedken, R. J., Folstein, S. E., et al.
(2002). Evaluation of FOXP2 as an autism susceptibility gene. American Journal of Medical
Genetics, 114(5), 566–569.
Watkins, K. E., Dronkers, N. F., & Vargha-Khadem, F. (2002). Behavioural analysis of an
inherited speech and language disorder: Comparison with acquired aphasia. Brain,
125(Pt. 3), 452–464.
Wei, C. L., Wu, Q., Vega, V. B., Chiu, K. P., Ng, P., Zhang, T., et al. (2006). A global map
of p53 transcription-factor binding sites in the human genome. Cell, 124(1), 207–219.
Werling, D. M., & Geschwind, D. H. (2013). Sex differences in autism spectrum disorders.
Current Opinion in Neurology, 26(2), 146–153.
Xu, L. M., Li, J. R., Huang, Y., Zhao, M., Tang, X., & Wei, L. (2011). AutismKB: An
evidence-based knowledgebase of autism genetics. Nucleic Acids Research, 40(Database
issue), D1016–D1022.
Yizhar, O., Fenno, L. E., Prigge, M., Schneider, F., Davidson, T. J., O’Shea, D. J., et al.
(2011). Neocortical excitation/inhibition balance in information processing and social
dysfunction. Nature, 477(7363), 171–178.
Zhang, B., & Horvath, S. (2005). A general framework for weighted gene co-expression net-
work analysis. Statistical Applications in Genetics and Molecular Biology, 4, Article17, E-pub.
http://dx.doi.org/10.2202/1544-6115.1128.
Zhang, J., Webb, D. M., & Podlaha, O. (2002). Accelerated protein evolution and origins of
human-specific features: Foxp2 as an example. Genetics, 162(4), 1825–1835.
Zweier, C., de Jong, E. K., Zweier, M., Orrico, A., Ousager, L. B., Collins, A. L., et al.
(2009). CNTNAP2 and NRXN1 are mutated in autosomal-recessive Pitt-Hopkins-like
mental retardation and determine the level of a common synaptic protein in Drosophila.
CHAPTER FIVE
MET Receptor Tyrosine Kinase

as an Autism Genetic Risk Factor
Yun Peng*, Matthew Huentelman†, Christopher Smith{,
Shenfeng Qiu*,1
*Department of Basic Medical Sciences, University of Arizona College of Medicine, Phoenix, Arizona, USA
†
Neurogenomics Division, Translational Genomics Research Institute, Phoenix, Arizona, USA
{
Southwest Autism Research Center, Phoenix, Arizona, USA
1
Corresponding author: e-mail address: sqiu@email.arizona.edu
Contents
1. Introduction 135
2. MET Receptor Tyrosine Kinase-Mediated Signaling has a Pleiotropic Role in
Multiple Organ Ontogenesis 138
3. MET Signaling Plays a Role in a Large Number of Neurodevelopment Events 142
4. MET Receptor Tyrosine Kinase Expression in the Developing Brain 145
5. The Human MET Gene Emerges as a Prominent Autism Risk Factor 149
6. Implication of MET Signaling in Neural Development and Functional Connectivity 152
7. Concluding Remarks 156
Acknowledgments 158
References 158
Abstract
In this chapter, we will briefly discuss recent literature on the role of MET receptor tyro-
sine kinase (RTK) in brain development and how perturbation of MET signaling may alter
normal neurodevelopmental outcomes. Recent human genetic studies have
established MET as a risk factor for autism, and the molecular and cellular underpinnings
of this genetic risk are only beginning to emerge from obscurity. Unlike many autism risk
genes that encode synaptic proteins, the spatial and temporal expression pattern of
MET RTK indicates this signaling system is ideally situated to regulate neuronal growth,
functional maturation, and establishment of functional brain circuits, particularly in
those brain structures involved in higher levels of cognition, social skills, and executive
functions.
1. INTRODUCTION
Autism spectrum disorders (ASD), which include autistic disorder,
Asperger’s syndrome, and pervasive developmental disorder (PDD)-not

http://dx.doi.org/10.1016/B978-0-12-418700-9.00005-8
136 Yun Peng et al.
otherwise specified, are a group of neurodevelopmental syndromes that

share a disease onset during early brain development and maturation
(Abrahams & Geschwind, 2008; Geschwind & Levitt, 2007; Walsh,
Morrow, & Rubenstein, 2008). There have been no unifying neuropatho-
logic or neurobiological features that define ASDs. The diagnosis is based on
clinical assessment of some core behavioral features, including impaired
communicative skills, atypical social behavior, and restricted interests and
repetitive behaviors. Two cardinal features of ASD are heritability and het-
erogeneity. Heritability refers to the fact that autism has evidently the stron-
gest genetic components of all the developmental neuropsychiatric
disorders. This is exemplified by the 82–92% concordance rate for autism
among monozygotic twins as compared with 10% concordance rate for
dizygotic twins (Abrahams & Geschwind, 2008; Bailey et al., 1995;
Constantino et al., 2013). Heterogeneity is reflected by the enormous num-
ber (>200) of gene loci (Aldinger, Plummer, Qiu, & Levitt, 2011; Ebert &
Greenberg, 2013; Piggot, Shirinyan, Shemmassian, Vazirian, & Alarcon,
2009) that contribute to the risk of developing ASD, hence imposing a major
challenge for the identification of causative genes. While this genetic hetero-
geneity can manifest as noncoding variations, de novo mutations that produce
syndromic disorders with autistic traits, copy number variations, and chro-
mosome abnormalities (Marshall et al., 2008; Nakatani et al., 2009; Piggot
et al., 2009; Sebat et al., 2007; Walsh et al., 2008), their functional implica-
tion spans even wider, from neuronal growth, projection and motility,
GTPase/Ras-mediated signaling and cytoskeletal organization, proteolysis,
to activity-dependent synaptic remodeling (Levitt & Campbell, 2009; Pinto
et al., 2010). Thus, to gain insights into the underlying mechanisms of ASD
will require a multidisciplinary approach focusing on brain regions, neural
networks, and cellular substrates.
ASD is a complex disorder and, as such, identification of causative genes
has been hampered by many inherent problems, such as multiple gene
effects/interactions, environmental factors, gene–environment interactions,
variable penetrance for each individual gene, and genetic heterogeneity.
Many well-established autism risk genes encode proteins that are involved
in the molecular networks controlling formation and function of the glut-
amatergic synapse, the submicron-scale structure that connects individual
neurons into functional networks capable of computational outputs. These
well-established genes include, but are not limited to, NRXN1, PTEN,
SHANK3, UBE3a, NF1, NLGN3/4, CNTNAP2, SYNGAP1, and
FMR1 (Alarcon et al., 2008; Bourgeron, 2009; Clement et al., 2012;
MET Receptor Tyrosine Kinase as an Autism Genetic Risk Factor 137
Durand et al., 2007; Penagarikano et al., 2011; Piggot et al., 2009; Tabuchi
et al., 2007; Yashiro et al., 2009). These molecules function by mediating
pre- and postsynaptic assembly, scaffolding the synaptic structure, control-
ling neurotransmitter release, and affecting the activity-dependent structural
changes, processes critical to sculpting our experience into neuronal circuits
to guide future behavior. Not surprisingly, pathogenic mutations of the pre-
viously mentioned ASD genes during development have been shown to lead
to synaptic dysfunction, impact the brain circuit, and disrupt the balanced
excitatory/inhibitory brain networks (Ebert & Greenberg, 2013;
Rubenstein & Merzenich, 2003; Tabuchi et al., 2007).
It is important to note, however, that synaptogenesis and neural circuit
dynamics are relatively late events during the neurodevelopmental timeline.
Prior to these events, the production and positioning of neurons in a correct
cellular and network context must take place in order for synaptogenesis and
circuit remodeling to occur. These early histogenic events are determined
by genetic programs encoding neurogenesis, migration, neurite outgrowth
and polarization, and axon guidance at critical developmental stages. At the
cellular level, once a neuron is born, it migrates a long distance before arriv-
ing at its destination and differentiating. Neurons extend two classes of
processes: a single axon to carry its output and several dendrites to collect
information input. Once this neuronal polarity is established, the axon
navigates through a complex environment to find its target, and dendrites
undergo extensive growth and branching. The last step in forming functional
circuitry is the establishment of synaptic connections between different neu-
rons (Bradke & Dotti, 2000; Craig & Banker, 1994; Mueller, 1999; Tessier-
Lavigne & Goodman, 1996). Two major types of synapses, excitatory and
inhibitory, coexist within any functional circuitry, and their balanced action
on the postsynaptic neurons shapes their functional output (Rubenstein &
Merzenich, 2003). Therefore, aberrant genetic programs during this early
extended timeline (as compared to impaired synaptic function at later stages)
may profoundly affect brain function as well. Consistently, autism risk genes
have been shown to control wide aspects of developmental events including
neurogenesis, synaptogenesis, glutamatergic transmission, endosomal traf-
ficking, and protein turnover (Ebert & Greenberg, 2013; Qiu, Aldinger, &
Levitt, 2012; Walsh et al., 2008). As diverse as these risk genes appear, they
may converge on a final common molecular pathway to disrupt developmen-
tal outcomes that perturb circuit formation and maturation.
The development of the central nervous system (CNS) is a complex pro-
cess driven by a myriad of factors including a large family of growth factors
138 Yun Peng et al.
and their receptors. Protein receptor tyrosine kinases (RTKs), which are
cell-surface receptors for many polypeptide growth factors, hormones,
and cytokines (Robinson, Wu, & Lin, 2000), regulate many aspects of neu-
ronal physiology, including neurogenesis and survival, differentiation and
migration, patterned connectivity, and plasticity. The human gene MET,
which encodes MET RTK (Cooper et al., 1984), has emerged as a prom-
inent risk factor for ASD (Campbell et al., 2006, 2009; Jackson et al., 2009;
Sousa et al., 2009; Thanseem et al., 2010). MET plays a pleiotropic role in
cell proliferation, motogenesis, differentiation, and survival in many tissue
types (Birchmeier, Birchmeier, Gherardi, & Vande Woude, 2003; Maina
et al., 1998). The ligand for MET receptor, hepatocyte growth factor
(HGF), is a polypeptide growth factor that activates MET (Naldini,
Weidner, et al., 1991). Both MET and HGF are expressed in the developing
brain, with distinct spatial and temporal profiles (Judson, Amaral, & Levitt,
2011; Judson, Bergman, Campbell, Eagleson, & Levitt, 2009; Jung et al.,
1994). Genetic studies from multiple laboratories have found that functional
MET promoter variants are associated with differential risks for ASD. Con-
sistently, clinical imaging and animal studies have provided evidence that
disrupted MET signaling levels produce both morphological and functional
alterations in neurons in those brain regions implicated in producing the
ASD endophenotypes. In this chapter, we will briefly discuss how MET sig-
naling might be ideally situated to regulate circuits and modify neuronal
function. We review recent literature and hypothesize that MET signaling
plays a critical role in balancing neuronal growth, functional maturation, and
establishing functional circuits.
2. MET RECEPTOR TYROSINE KINASE-MEDIATED

SIGNALING HAS A PLEIOTROPIC ROLE IN MULTIPLE
ORGAN ONTOGENESIS
The MET RTK and its sole polypeptide growth factor ligand, HGF,
exemplify a versatile signaling system that has effects not only on neurons but
also on multiple target tissues during embryogenesis. HGF, also known as
“scatter factor,” was originally identified as a molecule capable of triggering
proliferation, motility, and morphogenesis in many epithelial cell types
and is also involved in organ regeneration, angiogenesis, and tumor invasion
(Naldini, Vigna, et al., 1991). The MET receptor was first identified as a
proto-oncogene and later as a receptor for HGF (Bottaro et al., 1991;
Cooper et al., 1984; Naldini, Vigna, et al., 1991). Soon after, MET/HGF-
mediated signaling was found to be involved in a number of
normal physiological processes. The signaling system appears important in
mesenchymal–epithelial interactions during fetal development: genetic
inactivation of Met or Hgf in mice leads to embryonic lethality, resulting
from impaired liver development, loss of parenchymal cells, and failed devel-
opment of placenta trophoblast cells and muscles (Bladt, Riethmacher,
Isenmann, Aguzzi, & Birchmeier, 1995; Huh et al., 2004; Schmidt et al.,
1995; Uehara et al., 1995). The context in which MET function is best
understood is in cancer biology. HGF signaling through MET is said to
be morphogenic, motogenic, and mitogenic. The function of this signaling
extends to early steps of cell proliferation, survival, branching morphogen-
esis, neuronal induction, organ regeneration, angiogenesis, and tumor
metastasis (Furge, Zhang, & Vande Woude, 2000; Maina et al., 1998).
This pleiotropic role suggests that the molecular basis for MET signaling
is of broad significance. Human MET protein is produced as a 170 kD
single-chain precursor (Cooper et al., 1984; Faletto et al., 1992). The pre-
cursor is proteolytically processed, resulting in a highly glycosylated extra-
cellular a-subunit (50 kD) and a transmembrane b-subunit (145 kD) (Furge
et al., 2000; Tempest, Stratton, & Cooper, 1988) (Fig. 5.1). The two sub-
units are linked together by a disulfide bond. The b-subunit has extracellu-
lar, transmembrane, and intracellular domains. The extracellular domain of
both a- and b-subunits contains homology to semaphorins (Sema domain);
the b chain has cysteine-rich MET-related sequences, glycine-proline-rich
repeats, and four immunoglobulin-like domains (Ig domain). The intracel-
lular b-subunits contain motifs of tyrosine kinase domain and a multi-
substrate docking site. The function of both domains is dependent on
several critical tyrosine residues. Upon HGF activation, MET dimerizes
and transphosphorylation occurs on Tyr1234 and Tyr1235 within the activa-
tion loop of the tyrosine kinase domain, and this activates the intrinsic kinase
activity of the receptor (Naldini, Weidner, et al., 1991). Close to the
C-terminal region, two tyrosine residues (1349 and 1356), residing in the
multisubstrate docking site, are capable of recruiting downstream Src
homology-2 (SH2) domain-containing adaptor proteins (Ponzetto et al.,
1994). Some adaptor proteins, such as Grb2, Src, SHC, and PI3K, interact
with the multisubstrate docking site directly, whereas many other effects are
mediated through the large scaffolding protein Gab1, which is sequentially
tyrosine-phosphorylated and recruits a number of downstream effector pro-
teins such as PI3K, SHP2, and PLC-g (Faletto et al., 1992; Gual et al., 2000).
140 Yun Peng et al.
Figure 5.1 Potential molecular signaling pathways mediated by MET receptor tyrosine
kinase in neurons. The activation of the MET signaling pathway is initiated by hepato-
cyte growth factor (HGF) binding, which induces MET dimerization and trans-
phosphorylation of two critical tyrosine residues (Tyr1234 and Tyr1235) in the tyrosine
kinase domain to activate the intrinsic kinase activity of MET. The ensuing phosphory-
lation of two additional tyrosine residuals (Tyr1349 and Tyr1356) in the multisubstrate
docking sites recruits downstream adaptor proteins including Grb2, Gab1, and SHC
to activate cascades of downstream pathways that involve major signal transducers
such as PLCg, AKT, MAPK/Erk1/2, STAT3, focal adhesion kinase (FAK), and Rho family
of small GTPases (Rho, Rac1, and Cdc42). Note that PI3 kinase can be directly activated
by binding either to the multisubstrate docking site or downstream to Gab1 activation.
Although most of these signaling events are established in nonneuronal cells, it is pos-
sible that these molecular pathways cooperate in developing neurons to mediate the
outcome of neuronal survival, morphogenesis and proliferation, projection and motility,
and activity-dependent gene transcription. Indeed, there has been some experimental
evidence that MET signaling in neurons activates PI3K–AKT pathway and MAP kinase
pathway (indicated by shaded boxes). MET has been shown to directly interact with
other membrane-bound proteins in neurons, such as AXL, CD44, and plexins (which
bind to semaphorins). The extent to which these membrane protein interactions and
the intracellular signaling pathways in mediating the functional developmental out-
comes in neurons has yet to be ascertained.
During peripheral tissue ontogenesis, the majority of the MET signaling

outcomes are mediated by the adaptor proteins Grb2 and Gab1 (Maina et al.,
1996, 2001; Ponzetto et al., 1994, 1996), which activate downstream path-
ways involving Ras, Rho family GTPases (such as Rho, Rac1, and Cdc42),
ERK/MAPKs, guanine nucleotide exchange factors, Src family kinases,
PI3K, and PKB/AKT (Fig. 5.1). The signaling mediates a diversity of
events, including cell polarity, actin cytoskeleton reorganization, prolifera-
tion and cell-cycle progression, cell motility and migration, angiogenesis,
organ regeneration (Arthur, Schwartz, Kuenzler, & Birbe, 2004; Ido,
Numata, Kodama, & Tsubouchi, 2005; Royal, Lamarche-Vane, Lamorte,
Kaibuchi, & Park, 2000; Tahara et al., 2003; Takaishi et al., 1994), immune
and hormone responses (Beilmann, Vande Woude, Dienes, & Schirmacher,
2000; Okunishi et al., 2005; Roccisana et al., 2005), and tumor invasion
(Birchmeier et al., 2003). MET signaling is initiated through HGF binding
and the ensuing dimerization and tyrosine phosphorylation at its intracellular
multisubstrate docking site (Naldini, Weidner, et al., 1991; Ponzetto et al.,
1994). In nonneuronal cells, MET can activate multiple signaling cascades,
including the Ras/MAP kinase and JNK/SAP kinase pathways, phospho-
lipid pathways through binding of PI3K, PLC-g, SHP2 tyrosine phospha-
tase, and Src tyrosine kinase.
MET activation recruits adaptor proteins to engage various molecular
signaling pathways leading to different development outcomes (Maina
et al., 1998, 2001). Generally, these multiple pathways are connected to cell
growth and invasion following MET–HGF signaling. For example, activat-
ing RAS pathways serves as a cellular scatter and proliferation signal
(O’Brien et al., 2004). The sustained RAS activation also leads to a pro-
tracted MAPK activity (Marshall, 1995). Additionally, PI3K can be activated
by RAS or through binding to the multifunctional docking site. Activation
of PI3K activates cell motility through remodeling of cell adhesion and
localized cytoskeletal reorganization, processes which involve recruitment
of transducers such as small GTPase Rac1- and p21-activated kinase. By
activating PKB/AKT, PI3K is conferring a survival signal to the cells
(Fan et al., 2001; Moumen et al., 2007). MET is also capable of activating
the STAT3 transcription factor through binding to its SH2 domain
(Boccaccio et al., 1998), which is necessary for the HGF-induced branching
morphogenesis. In cancer cells, MET can be associated with b-catenin,
which forms a complex with MET intracellular kinase domain. Upon
HGF activation, b-catenin translocates to the nucleus to guide gene expres-
sion, an effect not seen in cells overexpressing a dominant-negative form of
142 Yun Peng et al.
MET (only contains extracellular and transmembrane regions of MET and is

therefore signaling-incompetent) (Monga et al., 2002).
3. MET SIGNALING PLAYS A ROLE IN A LARGE NUMBER

OF NEURODEVELOPMENT EVENTS
The molecular signaling events discussed earlier are mostly ascertained
in human epithelial or cancer cell lines, and, collectively, they mediate cell
growth and invasive programs. The recognition of MET serving as a key
signaling component in specific neurodevelopmental events is relatively
new compared with the well-established roles in cancer biology (Judson,
Eagleson, & Levitt, 2011; Maina et al., 1998). It is currently unclear to what
extent these signaling events are operating in neurons during brain develop-
ment. Nonetheless, accumulating evidence suggests that MET signaling is
also required for multiple neurodevelopmental events. For example,
MET is required for neuronal lineage commitment. Streit et al. (1995)
showed that grafts of Hensen’s node into chick embryos enhanced the
expression of neuronal markers in neighboring epiblast cells. In the presence
of HGF, epiblast explant cultures prepared from chick embryos can differ-
entiate into cells with neuronal morphology and express neuronal markers.
This suggests that HGF plays a role during the early steps of neural induction,
perhaps by inducing or maintaining the competence of the epiblast to
respond to neural-inducing signals.
It has also been shown that postnatal proliferation of cerebellar granule
neurons requires the full level of HGF/MET signaling. Cerebellum devel-
opment occurs mainly postnatally and implies cell proliferation and migra-
tion during this period. HGF and MET are coexpressed in the developing
cerebellum (Ieraci, Forni, & Ponzetto, 2002). MET is localized in granule
cell precursors, and cultures of these cells respond to HGF with prolifera-
tion. HGF and MET are involved in mediating these responses, and a hypo-
morphic MET mutant (Grb2-binding incompetent) results in reduced size
of the cerebellum, foliation defects, and reduced granule cell proliferation
(Ieraci et al., 2002). HGF/MET signaling has been shown to modulate
migration of specialized neuron types (Garzotto, Giacobini, Crepaldi,
Fasolo, & De Marchis, 2008; Giacobini et al., 2007; Krasnoselsky et al.,
1994; Powell, Mars, & Levitt, 2001; Segarra, Balenci, Drenth, Maina, &
Lamballe, 2006). For example, HGF/MET signaling can elicit trans-
telencephalic migration of interneurons during forebrain development
(Powell et al., 2001). The activation of HGF requires urokinase-type

plasminogen activator receptor (uPAR). uPAR-deficient mice showed
impaired scatter activity of forebrain neurons and reduced number of inter-
neurons in the frontal and parietal cortex, likely due to impaired interneuron
migration from the ganglionic eminence (Eagleson, Bonnin, & Levitt,
2005; Powell, Campbell, et al., 2003). HGF has also been shown to act as
a motogen and guidance signal for gonadotropin hormone-releasing
hormone-1 neuronal migration (Giacobini et al., 2007), an effect that is
mediated by molecular cross talk between MET and the AXL receptor tyro-
sine kinase (Salian-Mehta, Xu, & Wierman, 2013). MET also has been
shown to regulate the migration of olfactory interneuron precursors in
the rostral migratory stream (Garzotto et al., 2008), thus potentially contrib-
uting to olfactory sensory processing. MET-triggered cortical neuron
migratory effects seem to depend on combined MET–Grb2 coupling and
signaling through ERK, PI3K/AKT, and RAC1/p38 (Segarra et al., 2006).
MET signaling has a profound effect on neuronal growth and morphol-
ogy. In cortical organotypic slice culture, exogenous HGF increases
dendritic growth and branching of pyramidal neurons, whereas applying
function-blocking HGF antibody or transfection of neurons with a MET
dominant-negative mutant receptor reduced the size and complexity of
the dendritic arbors (Gutierrez, Dolcet, Tolcos, & Davies, 2004), suggesting
that HGF plays a role in regulating dendritic morphology in the developing
cerebral cortex. This is in agreement with studies showing in vivo manipu-
lation of MET in dorsal pallial-specific knockout mice ( Judson et al., 2009).
A recent study has shown that exogenous HGF treatment of cultured
hippocampal neurons enhanced the phosphorylation and activation of
MET, increased the number of dendrites, and increased the total dendritic
length. These effects are mediated by AKT activation, subsequent phos-
phorylation of glycogen synthase kinase-3 beta, and ultimately impinging
upon cytoskeletal proteins (Lim & Walikonis, 2008). This study suggests that
the PI3K pathway is involved in mediating HGF-induced neuronal growth
effect. It would be interesting to examine whether axonal outgrowth
involves other molecular mechanisms such as peripheral tissue development
or tumor cell metastasis. MET signaling also seems to have a role in senso-
rimotor gating. HGF promotes development of sensory neuron target inner-
vations (Maina, Hilton, Ponzetto, Davies, & Klein, 1997), cooperates with
nerve growth factor to enhance sympathetic neuron axonal outgrowth, and
increases the numbers of neurites of sensory neurons (Maina et al., 1998).
144 Yun Peng et al.
HGF is also growth-promoting a chemoattractant for cranial motor axons

during development (Caton et al., 2000), an axonal chemoattractant, and
a neurotrophic factor for spinal motor neurons (Ebens et al., 1996). One
potential mechanism for HGF to promote optimal axonal growth ganglion
neurons is through an intrinsic, local dendritic autocrine mechanism (Yang
et al., 1998).
In addition to mediating neuronal growth and morphological develop-
ment in vivo, HGF/MET could affect neuronal function, likely through
both cell-autonomous and cell nonautonomous mechanisms. In cultured
hippocampal neurons, Tyndall and Walikonis (2006) reported that MET
is clustered at excitatory synapses and colocalizes with NMDA receptor sub-
unit NR2B and PSD-95 protein. This is revealed by immunocytochemistry
and ultrastructural verification through immunoelectron microscopy. Addi-
tionally, MET protein is enriched at the postsynaptic density fraction, and
HGF treatment can induce MET phosphorylation and enhance the expres-
sion and clustering of synaptic proteins including NR2B, calmodulin-
dependent protein kinase II, and the AMPA receptor subunit GluA1. These
findings suggest a direct functional connection with MET signaling and
glutamatergic synapses.
Many studies have established HGF as a neurotrophic/neuroprotective
factor. HGF promotes motor neuron survival and synergizes with ciliary
neurotrophic factor to promote growth of sensory and parasympathetic neu-
rons (Davey, Hilton, & Davies, 2000; Wong et al., 1997). HGF secreted by
muscle fibers serves as a survival factor for certain populations of embryonic
motoneurons (Yamamoto et al., 1997). Additionally, HGF signaling allevi-
ates neuronal injury in a rat model for amyotrophic lateral sclerosis, and
transgenic overexpression of HGF in a mouse model for amyotrophic lateral
sclerosis delays the disease progression and prolongs life span of the mouse
(Ishigaki et al., 2007; Sun, Funakoshi, & Nakamura, 2002). HGF also pro-
motes endogenous repair and functional recovery after spinal cord injury
(Kitamura et al., 2007). HGF is capable of protecting hippocampal neurons
from injury induced by ischemia and preventing cultured rat cerebellar gran-
ule neurons from apoptosis (Miyazawa et al., 1998), an effect probably
involving the activation of the Ras/MAPK and PI3K/AKT pathways.
The fact that HGF has neuroprotective effects implies a therapeutic potential
of MET signaling on the CNS. A recent study (Bai et al., 2012) showed that
conditioned medium from cultured human mesenchymal stem cells reduces
functional deficits in experimental autoimmune encephalomyelitis mouse
model by promoting the development of oligodendrocytes and neurons.
Functional tests from the same study identified HGF and MET as mediators
of the conditioned medium-stimulated recovery. This protective effect is
due to HGF and MET promotion of neural cell development and
remyelination.
4. MET RECEPTOR TYROSINE KINASE EXPRESSION

IN THE DEVELOPING BRAIN
To better understand the developmental capacity of MET/HGF sig-
naling in the brain, it is important to ascertain the normal spatiotemporal
patterns of MET/HGF expression levels. Several early studies have
attempted to resolve this question. Di Renzo et al. (1993) showed that
MET is expressed in the human CNS and MET protein is detectable in
human brain tissues using Western blot. Immunohistochemical staining of
MET revealed a rather extensive labeling of both gray and white matter, par-
ticularly in cells showing morphological and immunochemical markers for
microglia cells, suggesting a potential role of HGF/MET in microglial reac-
tions to CNS injuries. Another earlier study using in situ hybridization dem-
onstrated that both Hg f and Met transcripts are expressed in developing and
adult mouse brain (Jung et al., 1994). Specifically, Hg f mRNA is primarily
localized in the neurons of hippocampus, cortex, and the granule cell layer of
the cerebellum, while Met mRNA is more specifically restricted to the CA1
area of the hippocampus, the septum, and the cortex. Both Hg f and Met
mRNA transcripts are detectable as early as embryonic days 12–13, respec-
tively. Functionally, neurons respond to HGF/MET signaling by increased
immediate early gene c-Fos transcription.
In light of recent human genetic studies implicating MET as an ASD risk
gene (see discussion in the succeeding text), a detailed investigation of
MET/HGF expression across the spatial and temporal domains (preferably
in multiple species) during brain development would be informative to
understanding the biological role of MET signaling at cellular and system
levels. By examining specific brain structures, one can focus on the expres-
sion patterns of MET in defined brain circuits that are behaviorally relevant
to autism. In a recent study, Judson et al. (2009) had systematically investi-
gated the expression pattern of Met transcripts and protein levels using
complementary Western blotting, in situ hybridization, and immunohisto-
chemical approaches. The study was conducted in mice forebrain through-
out late embryonic and postnatal development (embryonic day E17.5–P35).
146 Yun Peng et al.
It was found that the expression of MET protein levels was tightly regulated
across the time domain in the forebrain. MET protein levels are relatively
low around the late embryonic stage in mouse (E16.5) but increase dramat-
ically during perinatal development (postnatal day 0, P0) to reach a peak at
P7. Thereafter, MET levels are relatively stable during the second postnatal
week but decline drastically after P21 to very low levels at adult stage. The
study has revealed that peak levels of MET expression coincide with prin-
cipal periods of neurite outgrowth and synaptogenesis. High-resolution
immunohistochemistry staining from the same study reveals that MET is
expressed by discrete subtypes of long-projecting neurons of the forebrain,
especially those of dorsal pallial origin. Interestingly, MET protein is found
to be enriched in the developing axons of these projection neurons. In P7–
P14 mouse, MET immunoreactivity is strongly distributed to axons and
neuropil throughout the anteroposterior axis in the cortex. The corpus cal-
losum has the highest level of MET expression. There is also a clear laminar
patterning of Met transcript and protein expression in the neocortex in
which the barrel cortex and layer IV of the cortex distinctly lack MET
expression. Because layer IV is the synaptic input layer from subcortical
structures, this is consistent with the observation that the majority of subcor-
tical region shows minimum MET immunoreactivity in mouse. Another
interesting finding from this study is the apparent discrepant patterns of
expression for Met transcripts and proteins in the striatum. For instance,
Western blot analysis showed that striatum tissue contains abundant MET
proteins, whereas in situ hybridization failed to reveal Met transcripts in
the striatum. Therefore, the presence of MET protein in the striatum is
exclusively attributed to cortical projecting axons. Since the medium spiny
neurons in the striatum do not express MET, changes to corticostriatal cir-
cuits following ablation of MET in dorsal pallium structures can be therefore
attributed to a presynaptic mechanism.
The brainstem circuitry is implicated in ASD pathophysiology and auto-
nomic function control, and a recent study (Wu & Levitt, 2013) has exam-
ined Met and Hgf mRNA expression in the developing rodent brainstem
using in situ hybridization and immunohistochemistry to probe protein
levels. This study revealed a highly selective expression pattern of MET
in the brainstem in a subpopulation of neurons in cranial motor nuclei,
the dorsal raphe, Barrington’s nucleus, and the nucleus of solitary tract.
All of these brainstem structures show strong Met transcripts and immuno-
reactivity, which indicates that MET signaling may influence the develop-
ment of brainstem circuits that control autonomic function, such as central
regulation of respiration and circulation, gastrointestinal function, tongue

movement, speech, stress, and mood.
Compared with the rodent brain, there has been limited information of
MET protein expression levels in the brains of higher organisms. It has been
shown that MET protein and mRNAs can be readily detected by quantita-
tive Western blots and RT-PCR from postmortem temporal lobe gray mat-
ter samples (Brodmann areas 41/42, 52, or 22) in both ASD cases and their
matched controls (Campbell et al., 2007). In fetal human brain, MET
mRNA expression during midgestation (weeks 15–20) can be detected
and is restricted almost exclusively to portions of the temporal and occipital
lobes (Mukamel et al., 2011). However, little is known on the physiological
MET protein expression patterns at later developmental stages in postnatal
human or primate brain.
It is of interest to examine whether the orthologs of MET receptor func-
tion similarly in the developing primate forebrain because of the presumed
circuit similarity of primate brain in producing social and communication
phenotypes. Judson, Amaral, et al. (2011) had found that MET expression
levels in the rhesus macaque forebrain are similar to mouse brain in that
strong temporal conservation of expression exists during the time of rapid
axon development and at the onset of robust synapse formation. The expres-
sion patterns of MET in axon fiber tracts (e.g., corpus callosum, anterior
commissure, and cortiothalamic projections) and limbic structures (entorhi-
nal cortical projections of the perforant pathway) were similar in both spe-
cies. Most strikingly, the neocortex MET expression patterns showed highly
divergent pattern: while the mouse neocortex shows a generally uniform
distribution of MET, the macaque brain exhibited more restricted expres-
sion to the cingulate cortex, posterior parietal, inferior temporal, and
visual cortices, including the putative face-processing temporal lobe cortex.
This unique pattern in the primate brain may indicate a more prominent role
for MET-expressing neurons in establishing circuits relevant to species-
appropriate responses, such as vision-guided social behavior. Although
extreme caution should be taken on how to interpret these findings in mice
and make them relevant to understanding ASD, this study nonetheless sug-
gests that, when evaluating expression pattern of ASD risk genes, it is impor-
tant to consider the alterations in the spatial and temporal distributions of
gene products rather than the absolute levels of proteins with regard to their
role in the formation of brain circuits.
There has been some ultrastructural evidence on the subcellular distribu-
tion of MET in neurons. Using immunoelectron microscopy, Tyndall and
148 Yun Peng et al.
Walikonis (2006) had found that MET protein is localized at the postsynap-
tic dendritic site, suggesting MET could be part of the postsynaptic signaling
complex. In a recent study by Kawas, Benoist, Harding, Wayman, and Abu-
Lail (2013), it was found that MET protein levels are especially enriched in
brain regions that undergo extensive synaptic remodeling and plasticity,
such as the hippocampus CA1 region. Additionally, MET activation
increases the dendritic spine density and number of synapses. The authors
then used atomic force microscopy combined with a specific MET antibody
to address the question of subcellular localization of MET and found that the
activated multimeric form of MET is concentrated in the dendritic spine
compartment. In comparison, the inactivated monomeric form of MET
is prominent on the soma of neurons. This ultrastructural study provides
the first direct evidence of functional activation of MET in neurons.
A comprehensive morphology study by Eagleson, Milner, Xie, and Levitt
(2013) attempted to resolve the perisynaptic location of MET, that is,
whether MET is expressed in the presynaptic, postsynaptic, or glial compart-
ments. Combining immunoelectron microscopy and in situ proximity liga-
tion assay (PLA), the authors found that MET localization is rather dynamic,
depending on the postnatal age of mouse examined. In the striatum radiatum
layer of CA1 region of P7 mouse (peak stage of rapid neuronal dendritic
growth and morphogenesis), MET expression is equally located at both
pre- and postsynaptic compartments. At a later stage when extensive syn-
aptogenesis occurs, MET expression is predominantly presynaptic, with a
small proportion of immunoreactivity arising from glial cells at this time.
These morphological observations are consistent with their PLA analysis
in cultured neurons and Western blot analysis of MET levels in the sub-
synaptic compartments in brain tissues. This study provides conclusive evi-
dence that MET is enriched at synapses during development, and its
expression is dynamically regulated. The study also provides structural evi-
dence that signaling of MET can potentially recruit both pre- and postsyn-
aptic mechanisms.
A current important unanswered question is how MET receptor tyrosine
kinase is regulated to allow its spatiotemporal specificity in the developing
brain. Initial study by Campbell et al. (2006) has shown that the transcription
factors SP1 and PC4 (encoded by SUB1) bind to the 50 -transcriptional reg-
ulatory region of the MET gene, but the functional significance of this bind-
ing is not clear. A recent study (Mukamel et al., 2011) has identified
Forkhead box protein P2 (FOXP2) as a novel transcriptional repressor of
the MET gene. FOXP2 has been established as a regulatory repressor protein
and has been implicated in regulating higher cognitive functions, including

language development (Lai, Fisher, Hurst, Vargha-Khadem, & Monaco,
2001). In the cortical plate of the developing human brain, the laminar pat-
tern of MET expression is complementary to that of FOXP2, indicating that
FOXP2 may be capable of repressing MET gene expression. Over-
expression of FOXP2 in normal human neuronal progenitor cells leads to
reduced levels of MET protein expression in vitro. Using an EMSA assay,
these authors identified a direct FOXP2-binding site in the 50 -regulatory
region of MET gene. Considering the role of FOXP2 in language develop-
ment, it is possible downstream regulation by FOXP2 of key gene networks
including MET ultimately impacts wiring of ASD at-risk circuits. Therefore,
despite the fact that relatively little is known on the transcriptional regulation
of MET, FOXP2 seems to be a functional repressor for MET expression. In
the future, it would be interesting to examine whether genetic inactivation
of FOXP2 expression, such as in the brain-specific conditional knockout
mouse, will alter the patterned expression of MET across spatial and tempo-
ral domains. Nonetheless, although the detailed regulatory mechanisms for
MET expression are yet to be determined, the functional significance of this
regulation can be dramatic. We can predict that this intrinsic regulatory
mechanism limiting MET signaling is important in that (1) since MET sig-
naling plays a role in neurite outgrowth and synaptogenesis, once these
major events pass their peak time, MET expression is downregulated so
there is limited redundancy for this signaling system and, (2) alternatively,
the reduced level of MET signaling following the peak of neurite outgrowth
and synaptogenesis may be a prerequisite for functional maturation of the
glutamatergic synapses.
5. THE HUMAN MET GENE EMERGES AS A PROMINENT

AUTISM RISK FACTOR
The human MET gene (OMIM 164860; chromosome 7q31) was first
reported by Campbell et al. as a risk factor for autism based on genome-wide
association studies aimed to identify genetic variants that are overrepresented
in individuals with autism compared to control populations (Campbell et al.,
2006). MET was hypothesized as a candidate gene based on the following
observations prior to this study: First, MET is located on human chromo-
some 7q31, under a linkage peak identified in multiple whole-genome scan
studies of ASD (IMGSAC, 1998, 2001; Yonan et al., 2003). Second, MET
signaling mediates invasive growth and neurite extension and contributes to
150 Yun Peng et al.
the development of the brain (Beilmann et al., 2000; Gutierrez et al., 2004;
Ido et al., 2005; Ieraci et al., 2002; Maina et al., 1997; Okunishi et al., 2005;
Powell et al., 2001). Additionally, MET signaling plays a role in immune
function and gastrointestinal repair (Arthur et al., 2004; Tahara et al.,
2003), and both are impaired modalities seen in some ASD cases. Lastly,
there have been converging developmental biological studies indicating
hypomorphic MET signaling in the cortex results in abnormal interneuron
migration and decreased proliferation of granule cells in the cerebellum
(Eagleson et al., 2005; Ieraci et al., 2002; Powell, Campbell, et al., 2003).
The study by Campbell et al. (2006) analyzed the MET gene in a family-
based study of ASD including >1200 cases. The study revealed strong
genetic association of a common C allele (rs1858830 “C”) in the 50 -
transcriptional regulatory region of the MET gene in >200 autism families.
Additionally, in multiplex families with more than one autistic child, the
rs1858830 “C” allelic association is even stronger. Overall, the relative risk
for autism diagnosis was 2.27 (95% CI 1.41–3.65) for the CC genotype and
1.67 (95% CI 1.11–2.49) for the CG type compared with the GG type. The
autism risk susceptibility is correlated with MET promoter activity and the
promoter sequence’s binding for specific transcription factors SP1 and PC4
(encoded by SUB1) in a functional assay. A subsequent study following this
initial report by the same group examined MET expression levels in the
postmortem tissue from the temporal lobe of autism and control cases.
The study found decreased MET transcript and protein expression in indi-
viduals with ASD compared to matched controls (Campbell et al., 2007),
further supporting the notion that reduction or hypomorphic MET signaling
is a risk factor for autism.
Additional genetic and pathophysiological evidence that dysfunctional
MET signaling contributes to ASD risk has been complimentary to the orig-
inal findings. Campbell, Li, Sutcliffe, Persico, and Levitt (2008) tested
whether genes in the MET pathway (multiple genes encoding proteins that
regulate MET expression and activity), such as HGF, and PLAUR tran-
scripts are significantly altered in the ASD brain. The PLAUR gene encodes
the urokinase plasminogen activator receptor, which is required for the uro-
kinase plasminogen activator to process the HGF precursor into an active
form. In addition, the SERPINE1 gene, which encodes plasminogen acti-
vator inhibitor-1, was also examined. Both PLAUR and SERPINE1
exhibited significant association with autism (Campbell et al., 2008).
PLAUR promoter variant rs344781 T allele was associated with ASD by
both family-based association test and case–control analyses. There is also
significant gene–gene interaction contributing to ASD risk between MET

and PLAUR. This study further supports that multiple components of the
MET signaling pathway contribute to ASD genetic susceptibility.
Additional independent genetic studies in different populations have fur-
ther confirmed the association of MET with ASD risk. A study by Sousa
et al. (2009) found a positive correlation between rs38845 in the MET gene
and autism in an additional two cohorts with ASD diagnoses. However, this
study did not find a correlation between the rs1858830 “C” allele variants
and autism. Shortly after this report, a third independent study screened two
additional cohorts and found the rs1858830 “C” variant to be associated
with the autism cohort but not the PDD cohort (Jackson et al., 2009). At
a similar time, another group (Thanseem et al., 2010) performed a trio asso-
ciation study of MET with ASD in a Japanese population and revealed an
additional SNP in intron 1, rs38841, that is associated with ASD risk. There-
fore, these combined results including five unrelated cohorts all revealed a
strong association between MET and ASD, irrespective of the source of
genetic variation.
How do these functional MET variants confer risk for ASD, and how do
they relate to the disrupted circuit connectivity seen in ASD cases? Impaired
local and long-range cortical connectivity has been posited as a pathophys-
iological hallmark of ASD brain (Anderson et al., 2011; Courchesne &
Pierce, 2005; Geschwind & Levitt, 2007). A recent functional imaging study
by Rudie et al. (2012) has provided evidence on how MET impacts func-
tional and structural networks in the human brain and offered a critical miss-
ing puzzle piece in the context of convergent genetic, clinical, and
neurobiological findings regarding MET as a candidate for mediating
ASD risk. Rudie et al. have examined the functional ASD risk variant
(rs1858830 “CC”) on network functions in ASD and control subjects by
examining the relationship between MET risk genotype and functional acti-
vation patterns to social stimuli (emotional faces). MET risk genotype
(“CC” allele) is capable of predicting atypical fMRI activation and deacti-
vation patterns to social stimuli and is correlated with reduced functional and
structural connectivity in temporoparietal lobes, areas known to have high
levels of MET expression. Additionally, the MET rs1858830 “CC” risk
allele exhibits the largest alterations in structural and functional endo-
phenotypes in individuals with ASD. This study is also important in that
it shows that genetic stratification may reduce heterogeneity and helps clarify
the biological basis of ASD and potentially other neuropsychiatric
conditions.
152 Yun Peng et al.
6. IMPLICATION OF MET SIGNALING IN NEURAL

DEVELOPMENT AND FUNCTIONAL CONNECTIVITY
ASD is considered a developmental disconnection syndrome, and the
core pathophysiological basis can likely be attributed to disrupted ontogeny
of neural connectivity (Courchesne & Pierce, 2005; Geschwind & Levitt,
2007). The specificity and the timing of brain circuits that are involved
and the severity of disruption determine the presentation of clinical pheno-
types. There is strong molecular and cellular basis for this hypothesized mis-
wiring. MET signaling is required for multiple neurodevelopmental events,
including neuronal lineage commitment and survival (Bronner-Fraser,
1995; Streit et al., 1995), proliferation (Ieraci et al., 2002), migration
(Garzotto et al., 2008; Giacobini et al., 2007; Krasnoselsky et al., 1994;
Powell et al., 2001; Segarra et al., 2006), neurite outgrowth (Gutierrez
et al., 2004; Maina et al., 1997; Tyndall, Patel, & Walikonis, 2007), senso-
rimotor axon pathfinding (Caton et al., 2000; Ebens et al., 1996; Powell,
Muhlfriedel, Bolz, & Levitt, 2003), and neuronal repair and survival
(Maina et al., 1997, 1998; Miyazawa et al., 1998; Wong et al., 1997;
Yamamoto et al., 1997). MET signaling in vitro enhances axon outgrowth,
dendritogenesis, and synaptogenesis (Ebens et al., 1996; Gutierrez et al.,
2004; Tyndall et al., 2007). It has been shown that MET is required not only
for excitatory neuron development but also for migration of inhibitory
interneurons. For instance, HGF stimulates migration of GABAergic inter-
neurons from cultured ganglionic eminence explants (Powell et al., 2001).
Hypomorphic MET signaling in uPAR/ mouse leads to disruption of
cortical interneuron development and atypical emotional and social behav-
ior (Eagleson et al., 2005; Powell, Campbell, et al., 2003). All of these evi-
dence suggests MET has an essential role in hardwiring circuits during early
histogenetic events. It is important to note that these distinct physiological
processes may involve differential intracellular pathways mediated by MET
signaling. However, it is unclear which signaling cascades are responsible for
each of these processes involving differentiation, axonal outgrowth, and syn-
aptogenesis. Most likely, common intracellular mechanisms are shared
among different tissue types, and these mechanisms converge on the regu-
lation of adhesion molecules and cytoskeleton proteins that ultimately
impinge upon cell growth and motility.
Studies have shown that MET signaling functions beyond early
histogenic events. In relatively mature synapses, such as long-term in vitro
cultures of hippocampal neurons, MET protein is concentrated at excitatory

synapses and colocalizes with postsynaptic density proteins. Treatment of
cultured neurons with HGF induces MET tyrosine phosphorylation and
enhances clustering of synaptic proteins, such as NR2B, GluR1, and
CaMKII (Tyndall & Walikonis, 2006). MET signaling seems capable of
modifying and responding to activity-dependent neural plasticity as well.
Enhancing neuronal activity in cultured developing hippocampal neurons,
which produces growth effects, also increased HGF immunoreactivity and
clustering (Tyndall et al., 2007), suggesting MET signaling can be a down-
stream player employed by activity-dependent mechanisms. In neuronal cir-
cuits closely resembling in vivo conditions (i.e., the hippocampal slice
preparation), MET signaling by HGF application enhanced phosphorylation
of NMDA receptor subunit GluN1 (Ser 896/897), augmented NMDA
receptor-mediated currents, and increased the amplitude of long-term
potentiation induced by elevated neuronal activity (Akimoto et al.,
2004). The physiological role of this MET signaling in the adult brain is fur-
ther supported by the finding that tissue plasminogen activator, which is
required for HGF activation, is released in a neuronal activity-dependent
manner (Thewke & Seeds, 1999). Therefore, although anatomical studies
(Judson et al., 2009) indicate a dramatically reduced MET expression level
in adult brain, the remaining levels of MET expression, at least in the hip-
pocampus (Akimoto et al., 2004), could likely play a physiological role in
regulating synaptic transmission and plasticity.
There is strong evidence that MET signaling may affect the assembly and
function of neural circuits, and the substrates of neurological dysfunction
have been studied at the synaptic and microcircuit levels in mouse models
with disrupted MET signaling. Because genetic knockout of Hg f or Met
results in embryonic lethality in mouse (Bladt et al., 1995; Huh et al.,
2004; Schmidt et al., 1995; Uehara et al., 1995), Judson et al. have taken
advantage of a conditional knockout mouse model by crossing two genetic
modified mouse lines ( Judson et al., 2009). In one of the mouse lines, the
mouse Met was modified by conditional gene targeting (Met fx/fx) (Huh
et al., 2004). These Met fx/fx floxed mutant mice contain loxP sites flanking
exon 16 and, when crossed to mice that express Cre recombinase, the
resulting offspring will have an exon 16 deletion. Exon 16 encodes a critical
ATP-binding site (Lys1108), and this deletion inactivates the intracellular
tyrosine kinase activity of MET, which is essential for its function. In the
second mouse line, Cre recombinase is expressed from an Emx1 knockin
site (Emx1-IRES-cre) (Gorski et al., 2002). Crossing these two lines will
154 Yun Peng et al.
lead to MET inactivation in the Emx1-expressing dorsal pallial structures.

The cellular elements with inactivated MET signaling will include radial
glia, Cajal–Retzius cells, glutamatergic pyramidal neurons, astrocytes, and
oligodendrocytes. In comparison, most of the pallial GABAergic neurons
arising outside the Emx1-expressing lineage are not affected.
Anatomical studies from Met forebrain conditional knockout mice
(Met fx/fx/Emx1cre) have provided important clues on MET signaling in
the development of normal neuronal morphology. Judson et al. used lucifer
yellow microinjection technique to reveal the detailed morphology of
defined neuron types and compared that in wild-type and Metfx/fx/Emx1cre
mice ( Judson, Eagleson, Wang, & Levitt, 2010). The study revealed mor-
phological deficits in cortical pyramidal neurons, specifically a reduction in
apical dendritic arborization, and a decreased cortical volume that can be
sampled by Met fx/fx/Emx1cre neurons. Interestingly, although the dendritic
spine density in cortical pyramidal neurons is not altered, the spine head
volume is significantly increased by 20%. In comparison, medium spiny
neurons in the striatum, which do not express MET but receive MET-
containing presynaptic cortical input (see discussion earlier), exhibited
significant increase in total dendritic arbor length and enlarged spine head
volume. Considering that dendritic spine size and geometry is correlated
with glutamate receptor content and synapse maturity (Matsuzaki et al.,
2001), these findings suggest the effect of MET signaling on the dendritic
structure appears to be circuit-selective, and developmental loss of presyn-
aptic MET signaling can affect postsynaptic morphogenesis through cell
nonautonomous mechanisms. Additionally, reduced MET signaling could
impair both local and long-range connectivity within circuits relevant to
ASD by altering the time course of glutamatergic synapse maturation.
Numerous functional and structural imaging studies in patients support
connectivity-based etiology for ASD (Geschwind & Levitt, 2007; Hong
et al., 2011; Just, Cherkassky, Keller, Kana, & Minshew, 2007; Just,
Cherkassky, Keller, & Minshew, 2004; Kana, Keller, Cherkassky,
Minshew, & Just, 2009; Sahyoun, Belliveau, Soulieres, Schwartz, &
Mody, 2010; Shukla, Keehn, Smylie, & Muller, 2011). These imaging stud-
ies consistently indicate alterations in both local brain regions and long-range
connectivity among different functional regions. For example, Just et al.
(2007, 2004) had shown that there is less synchronous activity of
language-processing areas in ASD patients in response to a semantic com-
prehension task, and the impaired synchrony is selectively seen in
frontoparietal areas during the executive function testing. A similar
conclusion on compromised synchrony was obtained during social

processing tasks (Kana et al., 2009). Reduced functional connectivity
with frontal cortical regions in individuals with ASD was also observed dur-
ing face recognition task or visuospatial and linguistic reasoning (Sahyoun
et al., 2010). This phenotype of hypofunctioning in long-range circuits is
supported by the anatomical evidence. For instance, altered white matter
structure, as evidenced by reduced corpus callosum volume, has been
reported in some ASD patients (Hong et al., 2011; Just et al., 2007;
Shukla, Keehn, & Muller, 2011; Shukla, Keehn, et al., 2011; Thomas,
Humphreys, Jung, Minshew, & Behrmann, 2011). Diffusion tensor imaging
of the ASD brain reveals reduced fractional anisotropy in most major
long-range fiber tracts, indicating a possibility for global deficit in functional
connectivity (Shukla, Keehn, et al., 2011) in ASD brains. In addition to
these clinical imaging findings, convergent genetic and developmental
neurobiology studies have supported the role of MET in influencing synapse
development in circuits relevant to core behavioral domains of ASD. Based
on these combined evidence, a basic mechanistic hypothesis accounting
for MET-induced ASD genetic risk can be formulated: developmental
dysregulation of the MET signaling pathway increases the risk of ASD-
relevant brain circuit miswiring.
Complementary to neurogenetic and neuroanatomical approaches,
functional microcircuit analysis is emerging as an important line of investi-
gation due to the fact that this technique is capable of providing a direct read-
out of circuit function (Luo, Callaway, & Svoboda, 2008). It holds promise
for resolving the underlying pathophysiology and also for designing poten-
tial novel therapeutic strategies targeting specific neurological pathways.
A recent study has revealed functional circuit abnormality in Met fx/fx/
Emx1cre mice model (Qiu, Anderson, Levitt, & Shepherd, 2011). We used
laser scanning photostimulation (LSPS) combined with glutamate uncaging
to investigate a major local synaptic pathway in mouse frontal cortical region
and compared this circuit function in Met fx/fx/Emx1cre mice and their litter-
mate controls. The study found that laminar synaptic input from layer 2/3
into layer 5 pyramidal neurons is increased. Specifically, the layer 2/3 to
layer 5 corticostriatal neurons (which project to striatum, as identified by ret-
rograde tracer injection) are selectively increased by twofold. In comparison,
the layer 2/3 to layer 5 corticopontine neurons (which project to the
brainstem) synaptic connectivity did not change. The enhanced connectiv-
ity from layer 2/3 to layer 5 is also seen at synaptically connected neuronal
pairs, suggesting stronger unitary connections in local brain regions resulting
156 Yun Peng et al.
from MET loss of function. Although this study did not reveal whether pre-
or postsynaptic mechanisms contribute to increased synaptic drive, the
enhanced synaptic connectivity seen in a major local synaptic circuit may
be reminiscent of hyperconnectivity of local brain regions seen in ASD
patients. It would be interesting to examine long-range circuit functionality
in future studies. Due to the limitations that LSPS mapping can only be done
in brain slices where intact long-range circuits cannot be preserved, adapta-
tion of new optogenetic tools into this technique provides a feasible
approach to map long-range circuits (Petreanu, Huber, Sobczyk, &
Svoboda, 2007). Lastly, although neuroanatomical and functional mapping
gained valuable insight into the static circuit property, neural circuits are
very dynamic in that they exhibit a remarkable ability to scale their activity
in response to changes of activity or experimental perturbations, a process
known as homeostatic plasticity (Pozo & Goda, 2010; Turrigiano &
Nelson, 2000). It would be interesting for future work to look at the prin-
cipal substrates of synaptic homeostasis, that is, the compensatory adaptations
in synaptic strength or intrinsic excitability, and how these components
respond to disrupted MET signaling.
7. CONCLUDING REMARKS
Translating the genetic contributions to neurodevelopmental disor-
ders, such as ASD, into pathophysiological mechanisms will bridge the cur-
rent knowledge gap and facilitate developing novel interventions and
treatments. Many of the most compelling candidate genes identified for
rare/syndromic and idiopathic forms of ASD so far are involved in brain
wiring and synaptic function by being an integral part of synaptic molecular
machinery, by regulating gene transcriptions, or by contributing to the
excitatory/inhibitory balances (Bourgeron, 2009). MET signaling may
be a unique mechanism capable of regulating a multitude of neuron
behavior, including differentiation, growth, neurite extension, and synapse
maturation, all of which are prerequisite steps in establishing brain circuits.
Therefore, efforts in deciphering the functional significance of MET at
molecular, cellular, and system levels are central to understanding how
MET contributes to ASD pathophysiology. A recent genetic study (Pinto
et al., 2010) focusing on the functional impact of global rare copy number
variations in ASD has reported “an enrichment of CNVs disrupting func-
tional gene sets involved in cellular proliferation, projection and motility,
and GTPase/Ras signaling.” Existing experimental evidence suggests that
MET signaling plays a role in each of these functional domains. MET
expression levels peak in the early postnatal phase of development, which

coincides a period when synaptic microcircuits are undergoing develop-
ment, refinement, and maturation (Fig. 5.2). During these protracted pro-
cesses, the signaling is tightly regulated by developmentally encoded
intrinsic mechanisms yet to be defined and can be influenced by multiple
factors through possible cross talks through the intracellular molecular path-
ways. These pathways are fundamentally involved in neurodevelopmental,
plasticity, and disorder processes and may be engaged by other autism risk
genes. These processes, when disrupted, may lead to impaired final common
molecular pathways and the most replicated ASD-related endophenotype—
the disrupted synaptic connectivity.
Convergent genetic, clinical, and neurobiological findings from recent
research studies have contributed to an accumulating body of evidence that
MET is a critical signaling element in the developing brain. The biological
basis of the genetic risk mediated by hypomorphic MET expression may
occur through alterations in MET-mediated signaling pathways in neurons.
MET activation by HGF induces a signaling cascade that involves many
molecular components, such as TSC1, NF, PTEN, Ras/MAPK, and
Figure 5.2 MET receptor tyrosine kinase as a synaptic player that balances neuronal
growth, synaptic plasticity, and functional maturation. The expression of MET protein
in the developing brain is tightly regulated in both spatial and temporal domains.
MET expression is turned on during the perinatal period in mouse and peaks during
the period of extensive neurite growth and synaptogenesis. This suggests that MET-
mediated signaling plays a role in these early processes of brain development (green
arrows). MET protein is dramatically reduced as the brain circuits undergo functional
maturation and synaptic plasticity (red ticks). Disturbances of MET signaling, such as car-
rying a hypofunctional MET allele, could have detrimental effects in the protracted neu-
ronal developmental timeline and contribute to impaired circuit function in the adult
brain.
158 Yun Peng et al.
PI3K/AKT/mTOR (Fig. 5.1; also reviewed in Levitt & Campbell, 2009).

These molecules either are known ASD risk factors themselves or interact
with signaling pathways involving other ASD risk genes. The recent finding
that MET expression levels are regulated by FOXP2 (Mukamel et al., 2011),
a well-known risk factor for language dysfunction (Lai et al., 2001), further
supports the view that MET is part of a complex molecular network impli-
cated in ASD risk. The clinical relevance of MET signaling has been exem-
plified by 50% lower levels of MET protein in postmortem brain studies
(Campbell et al., 2007). MET is integrated within a cell signaling network
of synaptic proteins that regulates the early organization and function of syn-
apses in MET-expressing circuits. The functional nature of the common risk
allele in regulating levels of gene expression (Campbell et al., 2006, 2007),
the patterns of connectivity and circuit activity in human brain (Rudie et al.,
2012), the dramatic restriction of neocortical expression to regions that are
implicated in ASD dysfunction in primates ( Judson, Amaral, et al., 2011;
Mukamel et al., 2011), and the circuit abnormality resulting from MET loss
of function in animal models (Qiu et al., 2011) all support this conclusion.
The literature discussed here further supports the view that ASD is a devel-
opmental “disconnection syndrome,” and MET signaling is critical for the
normal synaptic connectivity established during development. We reason
that the core pathophysiology of ASD brain lies not only in the impaired
construction of circuit topography but also perhaps, more importantly, in
the refinement and plasticity of these circuits in response to constant, adap-
tive behavior input of the individual processes of which can be all pro-
foundly shaped by MET receptor tyrosine kinase.
ACKNOWLEDGMENTS
The authors thank Dr. Aaron McGee, Zhongming Lu, and Mariel Piechowicz for
proofreading and their critiques of this chapter.
REFERENCES
of a new neurobiology. Nature Reviews Genetics, 9(5), 341–355.
Akimoto, M., Baba, A., Ikeda-Matsuo, Y., Yamada, M. K., Itamura, R., Nishiyama, N.,
et al. (2004). Hepatocyte growth factor as an enhancer of nmda currents and synaptic
plasticity in the hippocampus. Neuroscience, 128(1), 155–162.
Alarcon, M., Abrahams, B. S., Stone, J. L., Duvall, J. A., Perederiy, J. V., Bomar, J. M., et al.
(2008). Linkage, association, and gene-expression analyses identify CNTNAP2 as an
autism-susceptibility gene. American Journal of Human Genetics, 82(1), 150–159.
Aldinger, K. A., Plummer, J. T., Qiu, S., & Levitt, P. (2011). SnapShot: Genetics of autism.
Neuron, 72(2), 418, e411.
Anderson, J. S., Druzgal, T. J., Froehlich, A., DuBray, M. B., Lange, N., Alexander, A. L.,
et al. (2011). Decreased interhemispheric functional connectivity in autism. Cerebral Cor-
tex, 21(5), 1134–1146.
Arthur, L. G., Schwartz, M. Z., Kuenzler, K. A., & Birbe, R. (2004). Hepatocyte growth
factor treatment ameliorates diarrhea and bowel inflammation in a rat model of inflam-
matory bowel disease. Journal of Pediatric Surgery, 39(2), 139–143, discussion 139–143.
Bai, L., Lennon, D. P., Caplan, A. I., DeChant, A., Hecker, J., Kranso, J., et al. (2012). Hepa-
tocyte growth factor mediates mesenchymal stem cell-induced recovery in multiple scle-
rosis models. Nature Neuroscience, 15(6), 862–870.
Medicine, 25(1), 63–77.
Beilmann, M., Vande Woude, G. F., Dienes, H. P., & Schirmacher, P. (2000). Hepatocyte
growth factor-stimulated invasiveness of monocytes. Blood, 95(12), 3964–3969.
Birchmeier, C., Birchmeier, W., Gherardi, E., & Vande Woude, G. F. (2003). Met, metas-
tasis, motility and more. Nature Reviews Molecular Cell Biology, 4(12), 915–925.
Bladt, F., Riethmacher, D., Isenmann, S., Aguzzi, A., & Birchmeier, C. (1995). Essential role
for the c-met receptor in the migration of myogenic precursor cells into the limb bud.
Nature, 376(6543), 768–771.
Boccaccio, C., Ando, M., Tamagnone, L., Bardelli, A., Michieli, P., Battistini, C., et al.
(1998). Induction of epithelial tubules by growth factor HGF depends on the STAT
pathway. Nature, 391(6664), 285–288.
Bottaro, D. P., Rubin, J. S., Faletto, D. L., Chan, A. M., Kmiecik, T. E., Vande
Woude, G. F., et al. (1991). Identification of the hepatocyte growth factor receptor
as the c-met proto-oncogene product. Science, 251(4995), 802–804.
Bourgeron, T. (2009). A synaptic trek to autism. Current Opinion in Neurobiology, 19(2), 231–234.
Bradke, F., & Dotti, C. G. (2000). Establishment of neuronal polarity: Lessons from cultured
hippocampal neurons. Current Opinion in Neurobiology, 10(5), 574–581.
Bronner-Fraser, M. (1995). Hepatocyte growth factor/scatter factor (HGF/SF) in early devel-
opment: Evidence for a role in neural induction. Trends in Genetics, 11(11), 423–425.
Campbell, D. B., Buie, T. M., Winter, H., Bauman, M., Sutcliffe, J. S., Perrin, J. M., et al.
(2009). Distinct genetic risk based on association of MET in families with co-occurring
autism and gastrointestinal conditions. Pediatrics, 123(3), 1018–1024.
Campbell, D. B., D’Oronzio, R., Garbett, K., Ebert, P. J., Mirnics, K., Levitt, P., et al.
(2007). Disruption of cerebral cortex MET signaling in autism spectrum disorder. Annals
of Neurology, 62(3), 243–250.
Campbell, D. B., Li, C., Sutcliffe, J. S., Persico, A. M., & Levitt, P. (2008). Genetic evidence
implicating multiple genes in the MET receptor tyrosine kinase pathway in autism spec-
trum disorder. Autism Research, 1(3), 159–168.
Campbell, D. B., Sutcliffe, J. S., Ebert, P. J., Militerni, R., Bravaccio, C., Trillo, S., et al.
(2006). A genetic variant that disrupts MET transcription is associated with autism. Pro-
ceedings of the National Academy of Sciences of the United States of America, 103(45),
16834–16839.
Caton, A., Hacker, A., Naeem, A., Livet, J., Maina, F., Bladt, F., et al. (2000). The branchial
arches and HGF are growth-promoting and chemoattractant for cranial motor axons.
Development, 127(8), 1751–1766.
Clement, J. P., Aceti, M., Creson, T. K., Ozkan, E. D., Shi, Y., Reish, N. J., et al. (2012).
Pathogenic SYNGAP1 mutations impair cognitive development by disrupting matura-
tion of dendritic spine synapses. Cell, 151(4), 709–723.
Constantino, J. N., Todorov, A., Hilton, C., Law, P., Zhang, Y., Molloy, E., et al. (2013).
Autism recurrence in half siblings: Strong support for genetic mechanisms of transmission
in ASD. Molecular Psychiatry, 18(2), 137–138.
160 Yun Peng et al.
Cooper, C. S., Park, M., Blair, D. G., Tainsky, M. A., Huebner, K., Croce, C. M., et al.
(1984). Molecular cloning of a new transforming gene from a chemically transformed
human cell line. Nature, 311(5981), 29–33.
Courchesne, E., & Pierce, K. (2005). Why the frontal cortex in autism might be talking only
to itself: Local over-connectivity but long-distance disconnection. Current Opinion in
Craig, A. M., & Banker, G. (1994). Neuronal polarity. Annual Review of Neuroscience, 17,
267–310.
Davey, F., Hilton, M., & Davies, A. M. (2000). Cooperation between HGF and CNTF in
promoting the survival and growth of sensory and parasympathetic neurons. Molecular
and Cellular Neurosciences, 15(1), 79–87.
Di Renzo, M. F., Bertolotto, A., Olivero, M., Putzolu, P., Crepaldi, T., Schiffer, D., et al.
(1993). Selective expression of the Met/HGF receptor in human central nervous system
microglia. Oncogene, 8(1), 219–222.
Durand, C. M., Betancur, C., Boeckers, T. M., Bockmann, J., Chaste, P., Fauchereau, F.,
et al. (2007). Mutations in the gene encoding the synaptic scaffolding protein SHANK3
are associated with autism spectrum disorders. Nature Genetics, 39(1), 25–27.
Eagleson, K. L., Bonnin, A., & Levitt, P. (2005). Region- and age-specific deficits in gamma-
aminobutyric acidergic neuron development in the telencephalon of the uPAR(-/-)
mouse. Journal of Comparative Neurology, 489(4), 449–466.
Eagleson, K. L., Milner, T. A., Xie, Z., & Levitt, P. (2013). Synaptic and extrasynaptic
location of the receptor tyrosine kinase Met during postnatal development in the mouse
neocortex and hippocampus. The Journal of Comparative Neurology, 521(14), 3241–3259.
Ebens, A., Brose, K., Leonardo, E. D., Hanson, M. G., Jr., Bladt, F., Birchmeier, C., et al.
(1996). Hepatocyte growth factor/scatter factor is an axonal chemoattractant and a neu-
rotrophic factor for spinal motor neurons. Neuron, 17(6), 1157–1172.
Ebert, D. H., & Greenberg, M. E. (2013). Activity-dependent neuronal signalling and autism
spectrum disorder. Nature, 493(7432), 327–337.
Faletto, D. L., Tsarfaty, I., Kmiecik, T. E., Gonzatti, M., Suzuki, T., & Vande Woude, G. F.
(1992). Evidence for non-covalent clusters of the c-met proto-oncogene product. Onco-
gene, 7(6), 1149–1157.
Fan, S., Ma, Y. X., Gao, M., Yuan, R. Q., Meng, Q., Goldberg, I. D., et al. (2001). The
multisubstrate adapter Gab1 regulates hepatocyte growth factor (scatter factor)-c-Met
signaling for cell survival and DNA repair. Molecular and Cellular Biology, 21(15),
4968–4984.
Furge, K. A., Zhang, Y. W., & Vande Woude, G. F. (2000). Met receptor tyrosine kinase:
Enhanced signaling through adapter proteins. Oncogene, 19(49), 5582–5589.
Garzotto, D., Giacobini, P., Crepaldi, T., Fasolo, A., & De Marchis, S. (2008). Hepatocyte
growth factor regulates migration of olfactory interneuron precursors in the rostral
migratory stream through Met-Grb2 coupling. The Journal of Neuroscience, 28(23),
5901–5909.
Geschwind, D. H., & Levitt, P. (2007). Autism spectrum disorders: Developmental discon-
nection syndromes. Current Opinion in Neurobiology, 17(1), 103–111.
Giacobini, P., Messina, A., Wray, S., Giampietro, C., Crepaldi, T., Carmeliet, P., et al.
(2007). Hepatocyte growth factor acts as a motogen and guidance signal for gonadotropin
hormone-releasing hormone-1 neuronal migration. The Journal of Neuroscience, 27(2),
431–445.
Gorski, J. A., Talley, T., Qiu, M., Puelles, L., Rubenstein, J. L., & Jones, K. R. (2002). Cor-
tical excitatory neurons and glia, but not GABAergic neurons, are produced in the
Emx1-expressing lineage. The Journal of Neuroscience, 22(15), 6309–6314.
Gual, P., Giordano, S., Williams, T. A., Rocchi, S., Van Obberghen, E., & Comoglio, P. M.
(2000). Sustained recruitment of phospholipase C-gamma to Gab1 is required for HGF-
induced branching tubulogenesis. Oncogene, 19(12), 1509–1518.
Gutierrez, H., Dolcet, X., Tolcos, M., & Davies, A. (2004). HGF regulates the development
of cortical pyramidal dendrites. Development, 131(15), 3717–3726.
Hong, S., Ke, X., Tang, T., Hang, Y., Chu, K., Huang, H., et al. (2011). Detecting abnor-
malities of corpus callosum connectivity in autism using magnetic resonance imaging and
diffusion tensor tractography. Psychiatry Research, 194(3), 333–339.
Huh, C. G., Factor, V. M., Sanchez, A., Uchida, K., Conner, E. A., & Thorgeirsson, S. S.
(2004). Hepatocyte growth factor/c-met signaling pathway is required for efficient liver
regeneration and repair. Proceedings of the National Academy of Sciences of the United States of
America, 101(13), 4477–4482.
Ido, A., Numata, M., Kodama, M., & Tsubouchi, H. (2005). Mucosal repair and growth
factors: Recombinant human hepatocyte growth factor as an innovative therapy for
inflammatory bowel disease. Journal of Gastroenterology, 40(10), 925–931.
Ieraci, A., Forni, P. E., & Ponzetto, C. (2002). Viable hypomorphic signaling mutant of the
Met receptor reveals a role for hepatocyte growth factor in postnatal cerebellar develop-
ment. Proceedings of the National Academy of Sciences of the United States of America, 99(23),
15200–15205.
IMGSAC (1998). A full genome screen for autism with evidence for linkage to a region on
chromosome 7q. International Molecular Genetic Study of Autism Consortium. Human
Molecular Genetics, 7(3), 571–578.
IMGSAC (2001). Further characterization of the autism susceptibility locus AUTS1 on chro-
mosome 7q. Human Molecular Genetics, 10(9), 973–982.
Ishigaki, A., Aoki, M., Nagai, M., Warita, H., Kato, S., Kato, M., et al. (2007). Intrathecal
delivery of hepatocyte growth factor from amyotrophic lateral sclerosis onset suppresses
disease progression in rat amyotrophic lateral sclerosis model. Journal of Neuropathology and
Experimental Neurology, 66(11), 1037–1044.
Jackson, P. B., Boccuto, L., Skinner, C., Collins, J. S., Neri, G., Gurrieri, F., et al. (2009).
Further evidence that the rs1858830 C variant in the promoter region of the MET gene
is associated with autistic disorder. Autism Research, 2(4), 232–236.
Judson, M. C., Amaral, D. G., & Levitt, P. (2011). Conserved subcortical and divergent cor-
tical expression of proteins encoded by orthologs of the autism risk gene MET. Cerebral
Cortex, 21(7), 1613–1626.
Judson, M. C., Bergman, M. Y., Campbell, D. B., Eagleson, K. L., & Levitt, P. (2009).
Dynamic gene and protein expression patterns of the autism-associated met receptor
tyrosine kinase in the developing mouse forebrain. Journal of Comparative Neurology,
513(5), 511–531.
Judson, M. C., Eagleson, K. L., & Levitt, P. (2011). A new synaptic player leading to autism
risk: Met receptor tyrosine kinase. Journal of Neurodevelopmental Disorders, 3(3), 282–292.
Judson, M. C., Eagleson, K. L., Wang, L., & Levitt, P. (2010). Evidence of cell-
nonautonomous changes in dendrite and dendritic spine morphology in the met-signaling-
deficient mouse forebrain. Journal of Comparative Neurology, 518(21), 4463–4478.
Jung, W., Castren, E., Odenthal, M., Vande Woude, G. F., Ishii, T., Dienes, H. P., et al.
(1994). Expression and functional interaction of hepatocyte growth factor-scatter factor
and its receptor c-met in mammalian brain. The Journal of Cell Biology, 126(2), 485–494.
Just, M. A., Cherkassky, V. L., Keller, T. A., Kana, R. K., & Minshew, N. J. (2007). Func-
tional and anatomical cortical underconnectivity in autism: Evidence from an FMRI
study of an executive function task and corpus callosum morphometry. Cerebral Cortex,
17(4), 951–961.
Just, M. A., Cherkassky, V. L., Keller, T. A., & Minshew, N. J. (2004). Cortical activation
and synchronization during sentence comprehension in high-functioning autism: Evi-
dence of underconnectivity. Brain, 127(Pt. 8), 1811–1821.
Kana, R. K., Keller, T. A., Cherkassky, V. L., Minshew, N. J., & Just, M. A. (2009). Atypical
frontal-posterior synchronization of Theory of Mind regions in autism during mental
state attribution. Social Neuroscience, 4(2), 135–152.
162 Yun Peng et al.
Kawas, L. H., Benoist, C. C., Harding, J. W., Wayman, G. A., & Abu-Lail, N. I. (2013).
Nanoscale mapping of the Met receptor on hippocampal neurons by AFM and confocal
microscopy. Nanomedicine, 9(3), 428–438.
Kitamura, K., Iwanami, A., Nakamura, M., Yamane, J., Watanabe, K., Suzuki, Y., et al.
(2007). Hepatocyte growth factor promotes endogenous repair and functional recovery
after spinal cord injury. Journal of Neuroscience Research, 85(11), 2332–2342.
Krasnoselsky, A., Massay, M. J., DeFrances, M. C., Michalopoulos, G., Zarnegar, R., &
Ratner, N. (1994). Hepatocyte growth factor is a mitogen for Schwann cells and is pre-
sent in neurofibromas. The Journal of Neuroscience, 14(12), 7284–7290.
413(6855), 519–523.
Levitt, P., & Campbell, D. B. (2009). The genetic and neurobiologic compass points toward
common signaling dysfunctions in autism spectrum disorders. The Journal of Clinical Inves-
tigation, 119(4), 747–754.
Lim, C. S., & Walikonis, R. S. (2008). Hepatocyte growth factor and c-Met promote den-
dritic maturation during hippocampal neuron differentiation via the Akt pathway. Cel-
lular Signalling, 20(5), 825–835.
Luo, L., Callaway, E. M., & Svoboda, K. (2008). Genetic dissection of neural circuits. Neu-
ron, 57(5), 634–660.
Maina, F., Casagranda, F., Audero, E., Simeone, A., Comoglio, P. M., Klein, R., et al.
(1996). Uncoupling of Grb2 from the Met receptor in vivo reveals complex roles in
muscle development. Cell, 87(3), 531–542.
Maina, F., Hilton, M. C., Andres, R., Wyatt, S., Klein, R., & Davies, A. M. (1998). Multiple
roles for hepatocyte growth factor in sympathetic neuron development. Neuron, 20(5),
835–846.
Maina, F., Hilton, M. C., Ponzetto, C., Davies, A. M., & Klein, R. (1997). Met receptor
signaling is required for sensory nerve development and HGF promotes axonal growth
and survival of sensory neurons. Genes and Development, 11(24), 3341–3350.
Maina, F., Pante, G., Helmbacher, F., Andres, R., Porthin, A., Davies, A. M., et al. (2001).
Coupling Met to specific pathways results in distinct developmental outcomes. Molecular
Cell, 7(6), 1293–1306.
Marshall, C. J. (1995). Specificity of receptor tyrosine kinase signaling: Transient versus
sustained extracellular signal-regulated kinase activation. Cell, 80(2), 179–185.
Marshall, C. R., Noor, A., Vincent, J. B., Lionel, A. C., Feuk, L., Skaug, J., et al. (2008).
Structural variation of chromosomes in autism spectrum disorder. American Journal of
Human Genetics, 82(2), 477–488.
Matsuzaki, M., Ellis-Davies, G. C., Nemoto, T., Miyashita, Y., Iino, M., & Kasai, H. (2001).
Dendritic spine geometry is critical for AMPA receptor expression in hippocampal CA1
pyramidal neurons. Nature Neuroscience, 4(11), 1086–1092.
Miyazawa, T., Matsumoto, K., Ohmichi, H., Katoh, H., Yamashima, T., & Nakamura, T.
(1998). Protection of hippocampal neurons from ischemia-induced delayed neuronal
death by hepatocyte growth factor: A novel neurotrophic factor. Journal of Cerebral Blood
Flow and Metabolism, 18(4), 345–348.
Monga, S. P., Mars, W. M., Pediaditakis, P., Bell, A., Mule, K., Bowen, W. C., et al. (2002).
Hepatocyte growth factor induces Wnt-independent nuclear translocation of beta-
catenin after Met-beta-catenin dissociation in hepatocytes. Cancer Research, 62(7),
2064–2071.
Moumen, A., Ieraci, A., Patane, S., Sole, C., Comella, J. X., Dono, R., et al. (2007). Met
signals hepatocyte survival by preventing Fas-triggered FLIP degradation in a PI3k-Akt-
dependent manner. Hepatology, 45(5), 1210–1217.
Mueller, B. K. (1999). Growth cone guidance: First steps towards a deeper understanding.
Annual Review of Neuroscience, 22, 351–388.
tion and autism risk. The Journal of Neuroscience, 31(32), 11437–11442.
Nakatani, J., Tamada, K., Hatanaka, F., Ise, S., Ohta, H., Inoue, K., et al. (2009). Abnormal
behavior in a chromosome-engineered mouse model for human 15q11-13 duplication
seen in autism. Cell, 137(7), 1235–1246.
Naldini, L., Vigna, E., Ferracini, R., Longati, P., Gandino, L., Prat, M., et al. (1991). The
tyrosine kinase encoded by the MET proto-oncogene is activated by
autophosphorylation. Molecular and Cellular Biology, 11(4), 1793–1803.
Naldini, L., Weidner, K. M., Vigna, E., Gaudino, G., Bardelli, A., Ponzetto, C., et al. (1991).
Scatter factor and hepatocyte growth factor are indistinguishable ligands for the MET
receptor. The EMBO Journal, 10(10), 2867–2878.
O’Brien, L. E., Tang, K., Kats, E. S., Schutz-Geschwender, A., Lipschutz, J. H., &
Mostov, K. E. (2004). ERK and MMPs sequentially regulate distinct stages of epithelial
tubule development. Developmental Cell, 7(1), 21–32.
Okunishi, K., Dohi, M., Nakagome, K., Tanaka, R., Mizuno, S., Matsumoto, K., et al.
(2005). A novel role of hepatocyte growth factor as an immune regulator through
suppressing dendritic cell function. Journal of Immunology, 175(7), 4745–4753.
Petreanu, L., Huber, D., Sobczyk, A., & Svoboda, K. (2007). Channelrhodopsin-2-
assisted circuit mapping of long-range callosal projections. Nature Neuroscience,
10(5), 663–668.
Piggot, J., Shirinyan, D., Shemmassian, S., Vazirian, S., & Alarcon, M. (2009). Neural systems
approaches to the neurogenetics of autism spectrum disorders. Neuroscience, 164(1), 247–256.
Pinto, D., Pagnamenta, A. T., Klei, L., Anney, R., Merico, D., Regan, R., et al. (2010).
Functional impact of global rare copy number variation in autism spectrum disorders.
Nature, 466(7304), 368–372.
Ponzetto, C., Bardelli, A., Zhen, Z., Maina, F., dalla Zonca, P., Giordano, S., et al. (1994).
A multifunctional docking site mediates signaling and transformation by the hepatocyte
growth factor/scatter factor receptor family. Cell, 77(2), 261–271.
Ponzetto, C., Zhen, Z., Audero, E., Maina, F., Bardelli, A., Basile, M. L., et al. (1996). Spe-
cific uncoupling of GRB2 from the Met receptor. Differential effects on transformation
and motility. The Journal of Biological Chemistry, 271(24), 14119–14123.
Powell, E. M., Campbell, D. B., Stanwood, G. D., Davis, C., Noebels, J. L., & Levitt, P.
(2003). Genetic disruption of cortical interneuron development causes region- and
GABA cell type-specific deficits, epilepsy, and behavioral dysfunction. The Journal of
Powell, E. M., Mars, W. M., & Levitt, P. (2001). Hepatocyte growth factor/scatter factor is a
motogen for interneurons migrating from the ventral to dorsal telencephalon. Neuron,
30(1), 79–89.
Powell, E. M., Muhlfriedel, S., Bolz, J., & Levitt, P. (2003). Differential regulation of tha-
lamic and cortical axonal growth by hepatocyte growth factor/scatter factor. Develop-
mental Neuroscience, 25(2–4), 197–206.
Pozo, K., & Goda, Y. (2010). Unraveling mechanisms of homeostatic synaptic plasticity.
Neuron, 66(3), 337–351.
Qiu, S., Aldinger, K. A., & Levitt, P. (2012). Modeling of autism genetic variations in mice:
Focusing on synaptic and microcircuit dysfunctions. Developmental Neuroscience, 34(2–3),
88–100.
Qiu, S., Anderson, C. T., Levitt, P., & Shepherd, G. M. (2011). Circuit-specific intracortical
hyperconnectivity in mice with deletion of the autism-associated Met receptor tyrosine
kinase. The Journal of Neuroscience, 31(15), 5855–5864.
164 Yun Peng et al.
Robinson, D. R., Wu, Y. M., & Lin, S. F. (2000). The protein tyrosine kinase family of the
human genome. Oncogene, 19(49), 5548–5557.
Roccisana, J., Reddy, V., Vasavada, R. C., Gonzalez-Pertusa, J. A., Magnuson, M. A., &
Garcia-Ocana, A. (2005). Targeted inactivation of hepatocyte growth factor receptor
c-met in beta-cells leads to defective insulin secretion and GLUT-2 downregulation
without alteration of beta-cell mass. Diabetes, 54(7), 2090–2102.
Royal, I., Lamarche-Vane, N., Lamorte, L., Kaibuchi, K., & Park, M. (2000). Activation of
cdc42, rac, PAK, and rho-kinase in response to hepatocyte growth factor differentially
regulates epithelial cell colony spreading and dissociation. Molecular Biology of the Cell,
11(5), 1709–1725.
Rubenstein, J. L., & Merzenich, M. M. (2003). Model of autism: Increased ratio of
excitation/inhibition in key neural systems. Genes, Brain and Behavior, 2(5), 255–267.
Rudie, J. D., Hernandez, L. M., Brown, J. A., Beck-Pancer, D., Colich, N. L., Gorrindo, P.,
et al. (2012). Autism-associated promoter variant in MET impacts functional and struc-
tural brain networks. Neuron, 75(5), 904–915.
Sahyoun, C. P., Belliveau, J. W., Soulieres, I., Schwartz, S., & Mody, M. (2010). Neuroim-
aging of the functional and structural networks underlying visuospatial vs. linguistic rea-
soning in high-functioning autism. Neuropsychologia, 48(1), 86–95.
Salian-Mehta, S., Xu, M., & Wierman, M. E. (2013). AXL and MET crosstalk to promote
gonadotropin releasing hormone (GnRH) neuronal cell migration and survival. Molecular
and Cellular Endocrinology, 374(1–2), 92–100.
Schmidt, C., Bladt, F., Goedecke, S., Brinkmann, V., Zschiesche, W., Sharpe, M., et al.
(1995). Scatter factor/hepatocyte growth factor is essential for liver development. Nature,
373(6516), 699–702.
Sebat, J., Lakshmi, B., Malhotra, D., Troge, J., Lese-Martin, C., Walsh, T., et al. (2007).
Strong association of de novo copy number mutations with autism. Science,
316(5823), 445–449.
Segarra, J., Balenci, L., Drenth, T., Maina, F., & Lamballe, F. (2006). Combined signaling
through ERK, PI3K/AKT, and RAC1/p38 is required for met-triggered cortical neu-
ron migration. The Journal of Biological Chemistry, 281(8), 4771–4778.
Shukla, D. K., Keehn, B., & Muller, R. A. (2011). Tract-specific analyses of diffusion tensor
imaging show widespread white matter compromise in autism spectrum disorder. Journal
of Child Psychology and Psychiatry, 52(3), 286–295.
Shukla, D. K., Keehn, B., Smylie, D. M., & Muller, R. A. (2011). Microstructural abnor-
malities of short-distance white matter tracts in autism spectrum disorder.
Neuropsychologia, 49(5), 1378–1382.
Sousa, I., Clark, T. G., Toma, C., Kobayashi, K., Choma, M., Holt, R., et al. (2009). MET
and autism susceptibility: Family and case-control studies. European Journal of Human
Genetics, 17(6), 749–758.
Streit, A., Stern, C. D., Thery, C., Ireland, G. W., Aparicio, S., Sharpe, M. J., et al. (1995).
A role for HGF/SF in neural induction and its expression in Hensen’s node during gas-
trulation. Development, 121(3), 813–824.
Sun, W., Funakoshi, H., & Nakamura, T. (2002). Overexpression of HGF retards disease
progression and prolongs life span in a transgenic mouse model of ALS. The Journal of
Neuroscience, 22(15), 6537–6548.
Tabuchi, K., Blundell, J., Etherton, M. R., Hammer, R. E., Liu, X., Powell, C. M., et al.
(2007). A neuroligin-3 mutation implicated in autism increases inhibitory synaptic trans-
mission in mice. Science, 318(5847), 71–76.
Tahara, Y., Ido, A., Yamamoto, S., Miyata, Y., Uto, H., Hori, T., et al. (2003). Hepatocyte
growth factor facilitates colonic mucosal repair in experimental ulcerative colitis in rats.
The Journal of Pharmacology and Experimental Therapeutics, 307(1), 146–151.
Takaishi, K., Sasaki, T., Kato, M., Yamochi, W., Kuroda, S., Nakamura, T., et al. (1994).
Involvement of Rho p21 small GTP-binding protein and its regulator in the HGF-
induced cell motility. Oncogene, 9(1), 273–279.
Tempest, P. R., Stratton, M. R., & Cooper, C. S. (1988). Structure of the met protein and
variation of met protein kinase activity among human tumour cell lines. British Journal of
Cancer, 58(1), 3–7.
Tessier-Lavigne, M., & Goodman, C. S. (1996). The molecular biology of axon guidance.
Science, 274(5290), 1123–1133.
Thanseem, I., Nakamura, K., Miyachi, T., Toyota, T., Yamada, S., Tsujii, M., et al. (2010).
Further evidence for the role of MET in autism susceptibility. Neuroscience Research,
68(2), 137–141.
Thewke, D. P., & Seeds, N. W. (1999). The expression of mRNAs for hepatocyte growth
factor/scatter factor, its receptor c-met, and one of its activators tissue-type plasminogen
activator show a systematic relationship in the developing and adult cerebral cortex and
hippocampus. Brain Research, 821(2), 356–367.
Thomas, C., Humphreys, K., Jung, K. J., Minshew, N., & Behrmann, M. (2011). The anat-
omy of the callosal and visual-association pathways in high-functioning autism: A DTI
tractography study. Cortex, 47(7), 863–873.
Turrigiano, G. G., & Nelson, S. B. (2000). Hebb and homeostasis in neuronal plasticity.
Current Opinion in Neurobiology, 10(3), 358–364.
Tyndall, S. J., Patel, S. J., & Walikonis, R. S. (2007). Hepatocyte growth factor-induced
enhancement of dendritic branching is blocked by inhibitors of N-methyl-D-aspartate
receptors and calcium/calmodulin-dependent kinases. Journal of Neuroscience Research,
85(11), 2343–2351.
Tyndall, S. J., & Walikonis, R. S. (2006). The receptor tyrosine kinase Met and its ligand
hepatocyte growth factor are clustered at excitatory synapses and can enhance clustering
of synaptic proteins. Cell Cycle, 5(14), 1560–1568.
Uehara, Y., Minowa, O., Mori, C., Shiota, K., Kuno, J., Noda, T., et al. (1995). Placental
defect and embryonic lethality in mice lacking hepatocyte growth factor/scatter factor.
Nature, 373(6516), 702–705.
Walsh, C. A., Morrow, E. M., & Rubenstein, J. L. (2008). Autism and brain development.
Cell, 135(3), 396–400.
Wong, V., Glass, D. J., Arriaga, R., Yancopoulos, G. D., Lindsay, R. M., & Conn, G. (1997).
Hepatocyte growth factor promotes motor neuron survival and synergizes with ciliary
neurotrophic factor. The Journal of Biological Chemistry, 272(8), 5187–5191.
Wu, H. H., & Levitt, P. (2013). Prenatal expression of MET receptor tyrosine kinase in the
fetal mouse dorsal raphe nuclei and the visceral motor/sensory brainstem. Developmental
Yamamoto, Y., Livet, J., Pollock, R. A., Garces, A., Arce, V., deLapeyriere, O., et al. (1997).
Hepatocyte growth factor (HGF/SF) is a muscle-derived survival factor for a subpopu-
lation of embryonic motoneurons. Development, 124(15), 2903–2913.
Yang, X. M., Toma, J. G., Bamji, S. X., Belliveau, D. J., Kohn, J., Park, M., et al. (1998).
Autocrine hepatocyte growth factor provides a local mechanism for promoting axonal
growth. The Journal of Neuroscience, 18(20), 8369–8381.
Yashiro, K., Riday, T. T., Condon, K. H., Roberts, A. C., Bernardo, D. R., Prakash, R.,
et al. (2009). Ube3a is required for experience-dependent maturation of the neocortex.
Nature Neuroscience, 12(6), 777–783.
Yonan, A. L., Alarcon, M., Cheng, R., Magnusson, P. K., Spence, S. J., Palmer, A. A., et al.
(2003). A genomewide screen of 345 families for autism-susceptibility loci. American Jour-
nal of Human Genetics, 73(4), 886–897.
CHAPTER SIX
Transcriptional Dysregulation
of Neocortical Circuit Assembly
in ASD
Kenneth Y. Kwan1
Department of Human Genetics, Molecular & Behavioral Neuroscience Institute (MBNI), University of
Michigan, Ann Arbor, Michigan, USA
1
Corresponding author: e-mail address: kykwan@umich.edu
Contents
1. Introduction 168
1.1 The organization of the cerebral cortex 172
1.2 The generation and migration of neocortical projection neurons 174
1.3 Generation and migration of neocortical inhibitory interneurons 177
2. Transcriptional Regulation of ASD-related Layer-Dependent Identity
and Connectivity 177
2.1 T-box brain factor 1 (TBR1) 178
2.2 Sex-determining region Y-box 5 (SOX5) 183
2.3 FEZ family zinc finger 2 (FEZF2) 186
2.4 Special AT-rich sequence-binding protein 2 (SATB2) 189
3. Discussion 193
Acknowledgments 195
References 195
Abstract
Autism spectrum disorders (ASDs) impair social cognition and communication, key
higher-order functions centered in the human neocortex. The assembly of neocortical
circuitry is a precisely regulated developmental process susceptible to genetic alter-
ations that can ultimately affect cognitive abilities. Because ASD is an early onset neu-
rodevelopmental disorder that disrupts functions executed by the neocortex, miswiring
of neocortical circuits has been hypothesized to be an underlying mechanism of ASD.
This possibility is supported by emerging genetic findings and data from imaging stud-
ies. Recent research on neocortical development has identified transcription factors as
key determinants of neocortical circuit assembly, mediating diverse processes including
neuronal specification, migration, and wiring. Many of these TFs (TBR1, SOX5, FEZF2, and
SATB2) have been implicated in ASD. Here, I will discuss the functional roles of these
transcriptional programs in neocortical circuit development and their neurobiological
implications for the emerging etiology of ASD.

http://dx.doi.org/10.1016/B978-0-12-418700-9.00006-X
168 Kenneth Y. Kwan
1. INTRODUCTION
Evolution of the neocortex is thought to underlie our species’ remark-
able cognitive, perceptive, and motor capabilities. It has been hypothesized
that evolutionary advances in neocortical organization and circuitry, while
enabling higher cognition, may have also increased our species’ susceptibility
to disorders that affect cognition. Autism spectrum disorders (ASDs) impair
higher cognitive functions executed by the human neocortex, including
social reciprocity and communication. Although the mechanisms underly-
ing ASD remain largely mysterious, emerging biological insights from
genetic and imaging studies have implicated abnormal neocortical circuit
assembly in ASD. The acquisition of neocortical organization and circuitry
requires the coordinated execution of a series of developmental processes,
including the specification of neuronal identity, neuronal migration,
and wiring of neural circuits. In recent studies, transcription factors
(TFs) have emerged as critical determinants of neocortical development
(Kwan, Sestan, & Anton, 2012; Leone, Srinivasan, Chen, Alcamo, &
McConnell, 2008; MacDonald et al., 2013; Molyneaux, Arlotta,
Menezes, & Macklis, 2007; Rash & Grove, 2006; Rubenstein, 2011). Inter-
estingly, many TFs that are required for the development of neocortical
circuitry have been implicated in ASD. In this chapter, I will review the
function of these ASD-implicated transcriptional mechanisms during
neocortical development and discuss the insights they provide into the neu-
robiology underpinning ASD.
Although ASD is a strongly heritable disorder, phenotypic and genetic
heterogeneity has impeded progress toward identifying loci that carry defin-
itive risk. Reliable genetic findings, however, have begun to emerge from
studies that utilized high-throughput methodologies to analyze
well-characterized populations of patients and families (Iossifov et al., 2012;
Jiang et al., 2013; Neale et al., 2012; O’Roak, Vives, Fu, et al., 2012;
O’Roak, Vives, Girirajan, et al., 2012; Sanders et al., 2011, 2012; Sebat
et al., 2007; Talkowski et al., 2012; Weiss et al., 2003). From these data, it
is now clear that no single locus accounts for more than 1% of ASD cases, with
contributing loci likely numbering in the hundreds. Perhaps somewhat iron-
ically, the genetic heterogeneity that has hindered progress in the previous
decades may now provide an opportunity to illuminate the biological under-
pinnings of ASD, since the increasing number of genes makes possible analyses
of convergent molecular pathways and cellular processes (State & Šestan,
Transcriptional Dysregulation of Neocortical Circuit Assembly in ASD 169
2012). Indeed, this strategy has been used to intersect ASD-implicated genes
with those that interact with FMRP (Iossifov et al., 2012), the RNA-binding
protein that is lost in fragile X syndrome, which is the leading monogenic
cause of intellectual disability (ID) and syndromic autism (Chonchaiya,
Schneider, & Hagerman, 2009). This analysis found that a significant number
of ASD candidate genes are associated with FMRP, which is consistent with
the possibility that common molecular pathways underlie autism and fragile
X syndrome. In addition, weighted gene coexpression network analysis can
reveal previously unrecognized connections between ASD risk genes. One
such example of this unbiased approach was used to analyze gene expression
in differentiating normal human neuronal progenitors, which revealed a sig-
nificant overlap with ASD susceptibility genes annotated by the SFARI data-
base (http://gene.sfari.org) (Konopka, Wexler, et al., 2012). Future studies of
the relationship between loci that confer ASD risks are likely to lead to addi-
tional insights about the neurobiological underpinnings of ASD.
With accumulating genetic data, it may now be possible to better pin-
point the timing and location of the biological events most relevant to
the etiology of ASD. This possibility is facilitated by recent transcriptomic
studies from multiple groups that have focused on spatiotemporal analyses of
gene expression in the human brain (Colantuoni et al., 2011; Johnson et al.,
2009; Kang et al., 2011). Available data from one of these resources (http://
www.humanbraintranscriptome.org) revealed that many of the most reli-
able risk-carrying loci exhibit a sharp upregulation in the neocortex during
the mid-fetal period (red arrowhead in Fig. 6.1) (State & Šestan, 2012), a key
developmental window for the acquisition of neocortical organization and
neural circuits. This distinct mid-gestation developmental pattern, which is
not consistently observed in other brain regions (Fig. 6.1), suggests that
ASD-associated genes may converge on pathways that function during
the structural development and neural circuit wiring of the neocortex.
Additional evidence further implicates the mid-fetal period of neocorti-
cal development in ASD. Neuronal migration, the process by which new-
born neurons are positioned away from the germinal zones and toward their
correct mantle layer destinations (Angevine & Sidman, 1961; Caviness,
1982; Lambert de Rouvroit & Goffinet, 1998; Rakic, 1974), occurs during
early to mid-gestation and has been shown to be disrupted in some ASD
patients (Hutsler, Love, & Zhang, 2007; Peñagarikano et al., 2011;
Wegiel et al., 2010). Furthermore, there is evidence for abnormalities
in the minicolumnar organization of neocortical neurons in cases of
ASD and other neuropsychiatric disorders (Casanova, Buxhoeveden,
170 Kenneth Y. Kwan
Neocortex Other brain regions

Period: 1 2 3 45 6 7 8 9 10 11 12 13 14 15 1 2 3 45 6 7 8 9 10 11 12 13 14 15
13
12
mRNA expression levels (log2)
11
10
9
8
7
6
CHD8 NRXN1 SCN2A
5 FOXP1 NRXN2 SHANK1
GRIN2B NRXN3 SHANK2
4 NLGN4X NTNG1 SHANK3
NR4A2 SCN1A TBR1
3
50 100 200 500 2000 10,000 30,000 50 100 200 500 2000 10,000 30,000
Birth Birth
Age (days post conception) Age (days post conception)
Figure 6.1 Developmental expression of 15 select ASD risk genes in the human neo-
cortex and other human brain regions. A collective upregulation in ASD risk gene
expression (red arrowhead) is present during mid-fetal development in the neocortex
but not other brain regions. Data from Kang et al. (2011).
Switala, & Roy, 2002). Neocortical minicolumns, which are composed of

vertically arranged neurons connected into a local network, are thought to
originate from developmental radial units, and their formation is likely to be
related to neuronal migration during the fetal period (Mountcastle, 1997;
Peters, 2010; Rakic, 1988). Interestingly, even subtle alterations in the
arrangement and spacing of minicolumns, which are basic units of neocor-
tical neural circuitry, can significantly alter the architecture of inhibitory
connectivity in the neocortex (Casanova, Buxhoeveden, & Gomez,
2003). The alteration of mid-fetal processes required for the structural devel-
opment of the neocortex, therefore, may have global consequences on the
functioning of neocortical circuits that can contribute to ASD.
Indeed, functional disruption of neocortical connectivity has been
hypothesized to underlie ASD and other neurodevelopmental disorders.
Evidence supporting the dis- or underconnectivity theory of ASD has been
reviewed elsewhere (Geschwind & Levitt, 2007; Just, Keller, Malave,
Kana, & Varma, 2012). In particular, data from some functional imaging
studies support a reduction in the communication bandwidth between fron-
tal and parietal areas, which leads to a redistribution of executive capability
from the frontal areas to the posterior areas of the neocortex ( Just et al.,
2012). This decrease in frontoposterior functional connectivity, as assessed
by synchronized activity, is thought to lead to diverse consequences in neo-

cortical function consistent with the widespread phenotypes of ASD.
Data from anatomical imaging studies have also implicated alterations in
neocortical connectivity. Studies of axonal fiber tracts by diffusion tension
imaging have consistently reported reductions in callosal projections in
ASD, in both young and adult patients (Alexander et al., 2007; Keller,
Kana, & Just, 2007; Kumar et al., 2010; Shukla, Keehn, Lincoln, &
Müller, 2010; Weinstein et al., 2011). As the corpus callosum is the most
prominent intracortical tract, alterations therein may indicate additional
changes to other intracortical connections. Indeed, decreases in intra-
hemispheric connectivity have also been implicated in ASD (Ingalhalikar,
Parker, Bloy, Roberts, & Verma, 2011; Kumar et al., 2010; Lange et al.,
2010; Lee et al., 2007; Nagae et al., 2012; Shukla et al., 2010; Sundaram
et al., 2008; Weinstein et al., 2011). In addition to intracortical connectivity,
defects in corticofugal tracts have been reported in ASD as well (Ingalhalikar
et al., 2011; Wolff et al., 2012), suggesting more widespread changes to neo-
cortical connections.
Interestingly, these changes do not simply reflect a general decrease in
connectivity but may be the outcome of altered developmental trajectories
during the formation of these axonal projections. In a recent longitudinal
study of high-risk infants (younger siblings of ASD children), axon tract
development was prospectively studied from 6 to 24 months of age
(Wolff et al., 2012). Comparison between infants who developed ASD
and those who did not revealed altered developmental trajectories in
12 out of 15 white matter (WM) pathways examined, with a transient
increase in fractional anisotropy at 6 months of age followed by a sustained
decrease likely lasting beyond 24 months. These data suggest that the alter-
ations to neural connectivity in ASD have emerged by early postnatal devel-
opment, preceding the onset of behavioral abnormalities, and are
widespread in the neocortex, affecting both intracortical and corticofugal
connections.
ASD is, fundamentally, a disorder of development. Consistent with the
early childhood onset of the disorder, the aberrant neocortical circuits in
ASD are likely to be developmental in origin, resulting from defective fetal
and early postnatal mechanisms, a possibility supported by converging
genetic and imaging data. In the succeeding text, I will first provide an over-
view of the cellular processes that underlie the structural development of the
neocortex and the assembly of its neural circuits. This will be followed by a
discussion of the roles of four ASD-implicated transcriptional programs in
172 Kenneth Y. Kwan
multiple aspects of neocortical development and their potential contribution

to the pathophysiology of ASD.
1.1. The organization of the cerebral cortex

The cerebral cortex, a thin sheet of gray matter at the most superficial part of
the cerebral hemispheres, is involved in conscious sensory, cognitive, and
motor processes. The emergence of the six-layered neocortex, phylogenet-
ically the most recent division of the cerebral cortex, is thought to be a key
advance in mammalian evolution and higher-order brain function
(Nieuwenhuys, 1994; Northcutt & Kaas, 1995). The neocortex is orga-
nized, cytoarchitectonically and functionally, into six horizontal laminae,
layers (L) 1–6 (DeFelipe & Farinas, 1992; Jones, 1986; Mountcastle,
1997; O’Leary & Koester, 1993), and numerous tangential areas, broadly
classified as sensory, motor, or association (O’Leary & Sahara, 2008;
Rakic, 1988; Rash & Grove, 2006). Neocortical neuronal identity and con-
nectivity exhibit considerable laminar and areal dependence that is well con-
served among mammalian species, suggesting that the establishment of this
complex neocortical organization is likely to be critical to neocortical func-
tion. Accordingly, the incorrect acquisition of organization and circuitry
during neocortical development may contribute to cognitive impairments
and increased susceptibility to psychiatric and neurological disorders (Liu,
2011; Manzini & Walsh, 2011; Rubenstein, 2011; Valiente & Marı́n, 2010).
Present within each horizontal layer of the neocortex is a unique com-
plement of glutamatergic excitatory projection (pyramidal) neurons and
GABAergic inhibitory interneurons (DeFelipe & Farinas, 1992; Jones,
1986). The projection neurons, which account for approximately 80% of
all neocortical neurons, extend long axonal projections. Intracortical projec-
tions connect proximal and distal regions of the neocortex, whereas
corticofugal projections, which constitute the neocortical output system,
connect the neocortex with subcortical brain structures. Projection neurons,
which develop postsynaptic specializations known as dendritic spines, are
also the largest input system, being the major target of afferents from other
structures of the brain (DeFelipe & Farinas, 1992; O’Leary & Koester, 1993).
Positioned within L2–L6, projection neurons exhibit layer- and subtype-
dependent differences in molecular identity and axonal projections
(Fig. 6.2) (DeFelipe & Farinas, 1992; Kwan, Sestan, & Anton, 2012;
Leone et al., 2008; MacDonald et al., 2013; Molyneaux et al., 2007;
O’Leary & Koester, 1993). Corticofugal axonal projections originate strictly
CR Cajal–Retzius neuron
CP Cortical plate L1
En Embryonic day n (mouse)
IP Intermediate progenitor L2
Order of birth date

IZ Intermediate zone L3
Ln Neocortical layer n
MZ Marginal zone L4
NP Neuroepithelial progenitor
PP Preplate L5
RGC Radial glial cell
SP Subplate
SVZ Subventricular zone L6
VZ Ventricular zone Z
WM White matter M SP
Intracortical
CR CP
(callosal)
SP
IZ
WM
PP Corticospinal
Corticobulbar Subcortical
SVZ Corticotectal axon tracts
IP
MZ Corticothalamic
RGC E11
VZ
NP
SP L6 L5 L4 L2/3
<E10 E11 E12 E13 E14 E15/16 >E17
NP expansion Gliogenesis
Figure 6.2 Neocortical development in the mouse. Prior to neurogenesis (<E10), neur-
oepithelial progenitors (NPs) divide mostly symmetrically in the ventricular zone (VZ).
Starting at E11, NPs assume radial glial morphology to become radial glia cells
(RGCs), which divide asymmetrically to generate neurons and guide their migration
to the mantle layers. The first projection neurons settle in the preplate (PP) to form
the nascent cortical plate (CP), from which L2 to L6 would emerge. Incoming CP neurons
segregate the PP into the marginal zone (MZ) and subplate (SP). Projection neurons are
then generated sequentially through successive divisions of RGCs in the VZ, as well as
neurogenic divisions of intermediate progenitors (IPs) in the SVZ. The generation of pro-
jection neurons and their migration into the CP occurs in an inside-first, outside-last
manner; early-born neurons form the deep layers (SP, L6, and L5), whereas later-born
neurons migrate past older neurons to form more superficial layers (L4, L3, and L2).
At the end of neurogenesis, the radial scaffold is dismantled and gliogenesis occurs
(>E17).
from the deep layers (L5 and L6) and the subplate (SP), a neocortical struc-
ture that contains early-born neurons positioned between L6 and WM
(Allendoerfer & Shatz, 1994; Herrmann, Antonini, & Shatz, 1994;
Kostovic & Rakic, 1980, 1990; Molliver, Kostovic, & van der Loos,
1973; Rakic, 1976). Axons that innervate the thalamus, which form the cor-
ticothalamic tract, originate largely from SP and L6, whereas axons that pro-
ject subcerebrally, including the corticotectal, corticobulbar, and
corticospinal tracts, arise exclusively from L5. Projection neurons positioned
in the upper layers (L2–L4), in contrast, project only within the cortex,
either intrahemispherically or contralaterally. The corpus callosum, which
is formed by contralateral intracortical axons, enables communication
between the two cerebral hemispheres. Neural imaging studies have
174 Kenneth Y. Kwan
implicated alterations to this layer-dependent neocortical connectivity in

ASD. In particular, deficits in intracortical axon tracts, most notably the cor-
pus callosum, have been strongly implicated (Alexander et al., 2007;
Ingalhalikar et al., 2011; Keller et al., 2007; Kumar et al., 2010; Lange
et al., 2010; Lee et al., 2007; Nagae et al., 2012; Shukla et al., 2010;
Sundaram et al., 2008; Weinstein et al., 2011). Changes in corticofugal con-
nectivities, including the internal capsule, have been reported as well
(Ingalhalikar et al., 2011; Wolff et al., 2012).
1.2. The generation and migration of neocortical projection

neurons
Diverse subtypes of neocortical projection neurons are generated from ter-
minal divisions that take place within the germinal zones of the dorsal tel-
encephalon, namely, the ventricular and subventricular zones (VZ and
SVZ), and undergo radial migration to their destination in the mantle layers
of the neocortex (Fig. 6.2) (Angevine & Sidman, 1961; Rakic, 1974). Prior
to the onset of neurogenesis, the dorsal telencephalic VZ is composed of
proliferating neuroepithelial progenitors (NPs), which primarily undergo
symmetric divisions, generating two daughter cells that would reenter the
cell cycle and thus exponentially expand the pool of NPs (Caviness,
Takahashi, & Nowakowski, 1995; Rakic, 1995). At the onset of neuro-
genesis, around embryonic day (E) 10.5 in the mouse, some NPs assume
radial glial morphology to become radial glial cells (RGCs) (Rakic,
1971). RGCs function as progenitors for projection neurons both directly,
by undergoing neurogenic divisions in the VZ (Anthony, Klein, Fishell, &
Heintz, 2004; Malatesta et al., 2003; Miyata et al., 2004; Noctor, Martinez-
Cerdeno, Ivic, & Kriegstein, 2004), and indirectly, by giving rise to inter-
mediate progenitors (IPs), which migrate away from the VZ and undergo
further neurogenic divisions in the SVZ (Englund et al., 2005;
Kowalczyk et al., 2009; Noctor, Martı́nez-Cerdeño, & Kriegstein, 2008;
Sessa et al., 2010). In addition, RGCs provide a scaffold for the radial migra-
tion of their neuronal progeny into the mantle layers (Bentivoglio &
Mazzarello, 1999; Rakic, 1971).
The earliest neocortical neurons form a band of cells, termed the preplate
(PP), at the superficial part of the cerebral wall (Fig. 6.2) (De Carlos & O’Leary,
1992; Marin-Padilla, 1971, 1978; The Boulder Committee, 1970). The first
projection neurons, generated around E11.5 in the mouse, migrate radially
away from the VZ and through the intermediate zone (IZ) before settling
as a layer within the PP to form the nascent cortical plate (CP), from which
L2–L6 of the neocortex would eventually emerge (Marin-Padilla, 1978). With

the incoming CP neurons, the PP is split into two layers: the superficial mar-
ginal zone (MZ), which forms L1 of the postnatal cortex, and the deeper SP,
which is positioned below L6. The early-born neurons of the MZ and SP are
the first to mature morphologically and synaptically, form pioneering connec-
tions, and play a key role in the subsequent migration of CP neurons and
assembly of cortical input and output circuits (Allendoerfer & Shatz, 1994;
Herrmann et al., 1994; Kostovic & Rakic, 1980, 1990; Molliver et al.,
1973; Rakic, 1976). Interestingly, the SP is enriched in its expression of
ASD-implicated genes (Hoerder-Suabedissen et al., 2013), which is consistent
with the possibility that defects in SP pioneering connections may contribute
to wider disruption of neocortical wiring relevant to ASD.
From E11.5 to E16.5 in the mouse, neurogenesis progresses to produce,
in a sequential manner, diverse subtypes of neocortical projection neurons
(Fig. 6.2). Because newly generated neurons migrate past older, post-
migratory neurons to settle within the most superficial portion of the CP,
projection neurons are added to the CP following an inside-first, outside-
last (L6–L2) sequence (Angevine & Sidman, 1961; Caviness, 1982;
Lambert de Rouvroit & Goffinet, 1998; Rakic, 1974). At the end of radial
migration, newly postmigratory neurons undergo molecular and morpho-
logical differentiation into diverse neuronal subtypes and form neural cir-
cuits appropriate of their layer location (Anton, Kreidberg, & Rakic,
1999; D’Arcangelo & Curran, 1998; Lambert de Rouvroit & Goffinet,
1998; Yokota et al., 2007).
The sequential nature of neocortical neurogenesis from related progen-
itor lineages directly links neuronal birth date and location of terminal divi-
sion to neuronal position, identity, and axonal connectivity (Fig. 6.2).
During early cortical neurogenesis (E11.5–E13.5 in the mouse), the
majority of neurons are generated directly via asymmetric neurogenic divi-
sions in the VZ. These early-born neurons are mostly destined for the deep
neocortical layers that comprise the corticofugal output of the neocortex.
Later in neurogenesis (E14.5–E16.5), many neurons are derived indirectly
through divisions of IPs in the SVZ (Noctor et al., 2004; Sessa et al., 2010;
Tabata, Kanatani, & Nakajima, 2009; Tarabykin, Stoykova, Usman, &
Gruss, 2001). These late-born neurons are mostly destined for the upper
layers that form intracortical connections and extensively innervate the cor-
pus callosum. IPs are thought to contribute a significant number of cortical
projection neurons (Haubensak, Attardo, Denk, & Huttner, 2004; Miyata
et al., 2004) and may have played a role in the relatively recent evolutionary
176 Kenneth Y. Kwan
increases in upper-layer intracortical projections in the primates (Marı́n-

Padilla, 1992). Consistent with this possibility, many primates, and a number
of other mammals with large brains, have a specialized zone containing addi-
tional IPs known as the outer SVZ (Lui, Hansen, & Kriegstein, 2011).
Because the SVZ contributes to a significant number of upper-layer neu-
rons, perturbation in subventricular divisions may more severely alter intra-
cortical connectivity, which has been implicated in ASD.
Defects in neurogenesis and neuronal migration can lead to severe brain
malformations in humans (Kerjan & Gleeson, 2007; Liu, 2011; Manzini &
Walsh, 2011; Thornton & Woods, 2009). Mutations affecting the cellular
machinery required for VZ mitoses, most notably mechanisms involving
the assembly of the centrosome, can lead to primary microcephaly, whereas
as mismigration can lead to lissencephaly and gyration disorders.
Perhaps the most widely studied neuronal migration phenotype is that of
the Reeler mutant. In mice with the Reeler mutation, newborn projection
neurons are able to migrate away from the germinal zones and through
the IZ but fail to migrate past older neurons within the CP, prematurely
arresting immediately below (Rice & Curran, 2001; Tissir & Goffinet,
2003). As a result of this failure at the final step of neuronal migration,
the partitioning of the PP is defective and the ordering of L2–SP becomes
inverted. Reeler mice have a loss-of-function mutation in Reelin (Reln),
which encodes an extracellular matrix protein secreted by Cajal–Retzius
(CR) neurons positioned in the MZ. Importantly, multiple studies have
shown RELN to be a genetic risk factor in ASD (Holt et al., 2010;
Kelemenova et al., 2010; Li et al., 2008; Persico et al., 2001; Serajee,
Zhong, & Mahbubul Huq, 2006; Skaar et al., 2005), suggesting that altered
neuronal positioning in the neocortex may underlie some ASD cases.
In addition to gross structural abnormalities, defective neuronal migra-
tion can lead to more subtle alterations, including changes to the columnar
organization of the human neocortex (Kwan, Lam, et al., 2012;
Mountcastle, 1997; Rakic, 1988). In addition to altered arrangement of neo-
cortical minicolumns, which has been reported in the postmortem brains of
ASD and schizophrenic patients (Casanova et al., 2003, 2002), other detailed
studies of neuropathology have also revealed subtle neuronal migration
defects in a proportion of examined autistic brains (Hutsler et al., 2007;
Uppal & Hof, 2013; Wegiel et al., 2010). Furthermore, the absence of
contactin-associated protein-like 2 (CNTNAP2, previously known as
CASPR2), which has been implicated in ASD, leads to migration defects
in both mice and humans (Peñagarikano et al., 2011; Strauss et al., 2006).
Together, these data corroborate the possibility that mismigration of neo-

cortical projection neurons, and potential associated changes in neural cir-
cuitry, can contribute to ASD and other neurodevelopmental disorders.
1.3. Generation and migration of neocortical inhibitory

interneurons
Layer-dependent differences in the neocortex are further augmented by the
remaining approximately 20% of neocortical neurons. The interneurons of
distinct morphological, neurochemical, and electrophysiological subtype also
populate the neocortex with selective layer preferences (Markram et al., 2004;
Miyoshi, Butt, Takebayashi, & Fishell, 2007; Miyoshi & Fishell, 2011). Neo-
cortical interneurons are generated from progenitors in the ventral forebrain,
primarily within the medial and caudal ganglionic eminences (Anderson,
Eisenstat, Shi, & Rubenstein, 1997; Marı́n & Rubenstein, 2003;
Nadarajah & Parnavelas, 2002; Wonders & Anderson, 2006; Xu, Cobos,
De La Cruz, Rubenstein, & Anderson, 2004). In order to reach the neocor-
tex, newborn interneurons undergo tangential migration, primarily via migra-
tory corridors above or below the CP. Upon arrival to their destination
cortical area, interneurons undergo radial migration to enter the CP (Ang,
Haydar, Gluncic, & Rakic, 2003; Nadarajah & Parnavelas, 2002; Yokota
et al., 2007) before settling into cortex lamina based on their subtype, origin,
and birth date (Miyoshi & Fishell, 2011; Miyoshi et al., 2010).
Disruption of the balance between cortical excitation and inhibition has
been hypothesized to be relevant to ASD (Rubenstein & Merzenich, 2003),
as suggested by the high proportion of ASD patients that suffer from epilepsy
and other observations. Alterations to the generation, migration, and wiring
of interneurons, therefore, may contribute to this mechanism. Consistent
with this possibility, genes that are critical to the early specification of inter-
neuronal progenitors (genes of the Dlx family) have been associated with
ASD (Liu et al., 2009; Nakashima et al., 2010). Furthermore, defective
GABAergic signaling has been reported to underlie some ASD-related phe-
notypes in Rett syndrome (Chao et al., 2010).
2. TRANSCRIPTIONAL REGULATION OF ASD-RELATED

LAYER-DEPENDENT IDENTITY AND CONNECTIVITY
The molecular mechanisms regulating the layer-dependent identities and
connectivities of distinct neocortical projection neurons are being unraveled
(Fishell & Hanashima, 2008; Kwan, Sestan, & Anton, 2012; Leone et al.,
178 Kenneth Y. Kwan
2008; MacDonald et al., 2013; Molyneaux et al., 2007; Polleux, Ince-Dunn, &
Ghosh, 2007; Rash & Grove, 2006). Although much remains unknown, genes
expressed in layer-selective or neuronal subtype-specific patterns are likely to be
important. TFs are known to play pivotal roles in processes including the early
patterning, sequential generation, arealization, dendritic morphology, and axo-
nal connectivity of distinct neuronal cell types (Guillemot, 2007; Hébert &
Fishell, 2008; Hevner, Hodge, Daza, & Englund, 2006; Jessell, 2000; Kwan,
Sestan, & Anton, 2012; MacDonald et al., 2013; Mallamaci & Stoykova,
2006; Monuki & Walsh, 2001; O’Leary & Sahara, 2008). In the neocortex, a
number of layer- and neuronal subtype-specific TFs have been identified and
characterized (Gray et al., 2004; Kwan, Sestan, & Anton, 2012; MacDonald
et al., 2013; Molyneaux et al., 2007).
Here, I will discuss four transcriptional mechanisms critical to neocortical
development that have been implicated in ASD. As revealed by recent
genetic findings, there exists considerable overlap of risk-carrying genes
in disorders that are phenotypically distinct (Marshall et al., 2008;
Mefford et al., 2010; Smoller et al., 2013; State & Šestan, 2012). Genes that
have been implicated in ASD have also been consistently implicated in epi-
lepsy, intellectual disability, schizophrenia, and bipolar disorder, suggesting
that shared genetic liabilities can lead to diverse clinical manifestations.
Therefore, in my discussion of genetic findings in the succeeding text, stud-
ies of neuropsychiatric disorders in addition to ASD will also be included.
2.1. T-box brain factor 1 (TBR1)

T-box brain factor 1 (TBR1) encodes a T-box-containing TF that controls
multiple processes during the assembly of neocortical circuits. The spatio-
temporal expression of TBR1 is consistent with its roles in regulating the
laminar and regional identity and axonal pathfinding of early-born projec-
tion neurons (Fig. 6.3) (Bedogni et al., 2010; Han et al., 2011; Hevner et al.,
2001; McKenna et al., 2011).
Genetic evidence implicating TBR1 in ASD has been reported by several
groups (Fig. 6.4). Recently, four 2q24 microdeletion cases in which disrup-
tion of TBR1 is shared were reported (Traylor et al., 2012). These patients
exhibited severe speech and language difficulties, autistic-like behavioral
problems, and moderate to severe intellectual disability. Additionally, larger
interval deletions that included TBR1 have been reported (Krepischi et al.,
2010; Magri et al., 2011; Palumbo et al., 2012; Takatsuki et al., 2010). Del-
ayed or absent speech and language and ID were shared by all of the reported
Tbr1 Sox5 Fezf2 (Zfp312) Satb2

MZ MZ
L2-4 L2-4
L5 L5
L6 L6
SP SP
Loss of function Loss of function

AC
Mid
Th CC
St
St
Pons
Hyp
Misexpression Misexpression
Figure 6.3 Summary of neocortical gene expression and function for Tbr1, Sox5, Fezf2,
and Satb2.
chr2: 162,000,000 162,500,000 163,000,000 163,500,000 164,000,000 164,500,000 165,000,000
TBR1
TANK TBR1 DPP4 FAP KCNH7 FIGN
PSMD14 SLC4A10 IFIH1
CNVs (loss)
Traylor et al. (2012)
Magri et al. (2011)
Krepischi et al. (2010)
Palumbo et al. (2012)
Takatsuki et al. (2010)
T-Box
SNVs
O’Roak, Vives, Ala136Profs X80
Fu, et al. (2012) Lys228Glu
O’Roak, Vives, Ser351 X
Girirajan, et al. (2012)
Figure 6.4 Summary of TBR1 genetic findings.
cases. In addition to copy number variants (CNVs), other de novo mutations

have also been found in ASD cases. A recent trio study using the Simon’s col-
lection of simplex families (Fischbach & Lord, 2010) reported a heterozygous
de novo frameshift mutation (Ala136ProfsX80) that leads to a premature stop
codon (O’Roak, Vives, Girirajan, et al., 2012). As the entire T-box domain
critical for DNA binding is truncated as a result, the mutant allele is not
expected to be able to express functional TBR1 protein. Subsequent analyses
from the same group by targeted resequencing in additional ASD cases further
revealed two novel single-nucleotide variants (SNVs) within the coding
180 Kenneth Y. Kwan
region (O’Roak, Vives, Fu, et al., 2012). The first (Lys228Glu) is a missense
mutation that affects a highly conserved residue within the T-box domain.
The second (Ser351X) is a nonsense mutation that truncates a significant por-
tion of the T-box domain. Both of these variants are predicted to be highly
deleterious to protein function.
Additional evidence of TBR1 involvement in molecular pathways rele-
vant to ASD includes its regulation of autism susceptibility candidate 2
(AUTS2) and Reelin (RELN) (Bedogni et al., 2010; Hevner et al., 2001).
Rare mutations in AUTS2 have been identified in ASD in studies from
numerous groups (Ben-David et al., 2011; Huang, Zou, Maher,
Newton, & Milunsky, 2010; Kalscheuer et al., 2007; Prasad et al., 2012;
Sultana et al., 2002; Talkowski et al., 2012). AUTS2 was further identified
as a hypermutable ASD-associated gene (Michaelson et al., 2012). The
expression of Auts2, which is highly enriched in frontal neocortex, is depen-
dent on Tbr1 (Bedogni et al., 2010). In the Tbr1-null mouse, Auts2 expres-
sion is severely decreased, suggesting that loss of AUTS2 may contribute
mechanistically to TBR1 dysfunction in ASD. TBR1 further controls the
expression of Reln (Hevner et al., 2001). Association studies have repeatedly
implicated RELN in ASD (Holt et al., 2010; Kelemenova et al., 2010; Li
et al., 2008; Persico et al., 2001; Serajee et al., 2006; Skaar et al., 2005).
Furthermore, rare variants in RELN have also been identified (Neale
et al., 2012). In the Tbr1-deficient neocortex, the early expression of Reln
in CR neurons of the MZ is greatly reduced (Hevner et al., 2001),
suggesting an additional candidate mechanism by which TBR1 may contrib-
ute to ASD.
The expression and function of Tbr1 may provide key insights into the
neurobiology of ASD. The expression of TBR1 is highly enriched in the
developing neocortex (Fig. 6.3) (Hevner et al., 2001), which is consistent
with a contribution of neocortical dysfunction to ASD. Within the neocor-
tex, TBR1 expression is restricted to the corticothalamic projection neurons
of L6 and the SP and to the CR neurons of the MZ from an early embryonic
age (E12.5) (Han et al., 2011; Hevner et al., 2001; McKenna et al., 2011).
TBR1, however, is absent from VZ and SVZ progenitor cells and therefore
functions postmitotically in neurons after their terminal division and during
their differentiation. In the neonatal mouse cortex, TBR1 is absent from the
upper-layer neurons that contribute to the majority of callosal axons. During
the first postnatal week, however, a number of upper-layer neurons begin to
upregulate TBR1 expression (Han et al., 2011; Hevner et al., 2001;
McKenna et al., 2011). This upper-layer expression of TBR1 likely serves
functions in addition to its roles in early-born neurons. Accordingly, TBR1

expression in the upper layers is required for upper-layer Auts2 expression
(Bedogni et al., 2010; Srinivasan et al., 2012).
Consistent with its expression in a subset of early-born neocortical neu-
rons, TBR1 controls the formation of early corticofugal circuits. Tbr1 is
required for the normal formation of the corticothalamic tract, which orig-
inates mostly from L6 and SP neurons, the early-born cells in which TBR1 is
highly expressed (Han et al., 2011; Hevner et al., 2001; McKenna et al.,
2011). Furthermore, a recent study showed, in a number of mouse mutants,
that the expression of TBR1 consistently correlates with subcortical axons
innervating the dorsal thalamus (Srinivasan et al., 2012), corroborating Tbr1
as a key regulator of corticothalamic connectivity. TBR1 executes this func-
tion, at least in part, by suppressing the expression of Fez family zinc finger 2
(Fezf2, formerly Fezl, and Zfp312) and B-cell leukemia/lymphoma 11B
(Bcl11b, formerly Ctip2), which are determinants of L5 subcerebral projec-
tion neurons (Arlotta et al., 2005; Chen, Rasin, Kwan, & Sestan, 2005;
Chen, Schaevitz, & McConnell, 2005; Molyneaux, Arlotta, Hirata,
Hibi, & Macklis, 2005), to low levels in L6 and SP corticothalamic neurons
(Han et al., 2011; McKenna et al., 2011). In the Tbr1-null neocortex,
L6 and SP neurons, as a result of ectopic upregulation of high Fezf2 expres-
sion, misroute their corticothalamic axons to aberrantly innervate the
corticospinal tract (Han et al., 2011; McKenna et al., 2011). Conversely,
when Tbr1 is misexpressed in L5 corticospinal neurons, it represses L5
molecular identity and abolishes the formation of the corticospinal tract
(Han et al., 2011; McKenna et al., 2011). Therefore, TBR1 deficiency dis-
rupts two key aspects of corticofugal projections, nearly abolishing neocor-
tical connectivity with the thalamus and leading to an ectopic tract that
incorrectly innervates the spinal cord.
In addition to corticofugal connectivity, TBR1 is also required for nor-
mal intracortical connections. In the Tbr1-deficient cortex, callosal axons fail
to cross the midline and instead form Probst bundles (Hevner et al., 2001).
As discussed earlier, alterations to the integrity of the corpus callosum are
often reported in ASD (Ingalhalikar et al., 2011; Kumar et al., 2010;
Lange et al., 2010; Lee et al., 2007; Nagae et al., 2012; Shukla et al.,
2010; Sundaram et al., 2008; Weinstein et al., 2011; Wolff et al., 2012). This
role of TBR1 in callosal connections, therefore, may be a contributory
mechanism to TBR1 dysfunction in ASD in addition to TBR1 control
of corticofugal connectivity. In the postnatal neocortex, upper-layer
intracortical neurons upregulate TBR1 expression (Han et al., 2011;
182 Kenneth Y. Kwan
Hevner et al., 2001; McKenna et al., 2011). Therefore, TBR1 may function
cell autonomously in callosal neurons. Consistent with this possibility, the
expression of TBR1 in upper-layer neurons is sufficient to rescue the callosal
defects observed in the special AT-rich sequence-binding protein 2 (Satb2)
mutant neocortex (Srinivasan et al., 2012), which is further discussed later.
An additional explanation, however, may be found in TBR1 regulation of
early SP circuits, which are known to orchestrate the development of both
callosal and corticofugal connectivities (Allendoerfer & Shatz, 1994; Del
Rı́o, Martı́nez, Auladell, & Soriano, 2000; Herrmann et al., 1994;
Kostovic & Rakic, 1980, 1990; Molliver et al., 1973; Rakic, 1976).
The SP is a transient zone in the developing neocortex in which some of
the earliest synapses and pioneering circuits develop (Allendoerfer & Shatz,
1994; Del Rı́o et al., 2000; Herrmann et al., 1994; Kostovic & Rakic, 1980,
1990; Molliver et al., 1973; Rakic, 1976). The SP, the thickest zone in the
human mid-fetal cerebral wall, is thought to play critical roles in the migra-
tion and synaptogenesis of CP neurons, as well as in the assembly of proper
neocortical efferent and afferent axonal projections. Examination of Tbr1-
deficient mice revealed a severe disruption of SP formation, which is part
of a complex mismigration phenotype that is distinct compared to the
wholly inverted cortex of the Reeler mutant (Rice & Curran, 2001). In
the Tbr1-null neocortex, early-born SP neurons form an ectopic band in
the center of the CP. This “midplate” exhibits a rostral–caudal gradient,
being more deeply positioned in the rostral cortex (Han et al., 2011;
Hevner et al., 2001). These areal-dependent migration defects are consistent
with a role of Tbr1 in the control of regional identity (Bedogni et al., 2010).
In addition to mismigration of SP neurons, L5 neurons are also disrupted,
being more widely distributed throughout the CP, whereas upper-layer
neurons are distributed bimodally, with a majority positioned below the
ectopic band of SP neurons (Han et al., 2011; Hevner et al., 2001). These
complex migration defects suggest that, other than regulation of Reln
expression, Tbr1 is likely to control migration via additional mechanisms.
Interestingly, consistent with the central role of SP in orchestrating cor-
tical connectivites, recent data have implicated SP in ASD. Comprehensive
profiling of gene expression in the mouse SP through multiple developmen-
tal ages was combined with network analysis, which unbiasedly revealed a
significant enrichment of ASD- and schizophrenia-implicated genes being
expressed in the SP (Hoerder-Suabedissen et al., 2013). These data suggest
the possibility that disruption of early pioneering SP circuits can ultimately
lead to wider alterations of neocortical organization and circuitry in disease
and is further consistent with SP defects as an addition contributory mech-

anism of TBR1 deficiency in ASD.
2.2. Sex-determining region Y-box 5 (SOX5)

Sex-determining region Y-box 5 (Sox5) encodes a member of the large family of
SOX TFs that play key roles in diverse cellular functions, including sex
determination, stem cell maintenance, and cell fate specification
(Lefebvre, Dumitriu, Penzo-Méndez, Han, & Pallavi, 2007). Although
Sox5 phenotypes exhibit key differences compared to Tbr1, Sox5 is also
required for multiple neocortical developmental processes, such as the
molecular specification and positioning of early-born neurons, and develop-
ment of corticofugal projections (Kwan et al., 2008; Lai et al., 2008).
Genetic evidence implicating SOX5 contribution to ASD includes mul-
tiple studies of CNVs (Fig. 6.5). SOX5 is affected by microdeletions in
numerous cases of ASD and ID (Lamb et al., 2012; Rosenfeld et al.,
2010; Schanze et al., 2013; Talkowski et al., 2012). The deletion intervals
in the majority of the reported cases are small and restricted to SOX5. At
least 10 reported intragenic microdeletions affect either the HMG box,
which is required for DNA binding, or the coiled-coil domain, which is
chr12: 23,000,000 23,500,000 24,000,000 24,500,000 25,000,000 25,500,000
SOX5
HMG CC
C2CD5 SOX5 BCAT1 CASC1

ST8SIA1 ETNK1 MIR920 LINC0477 LRMP KRAS
CASC1 LYRM5
CNVs (loss)
Rosenfeld et al. (2010)
Talkowski et al. (2012)
Lamb et al. (2012)
Schanze et al. (2013)
Stumm et al. (2007)
x 4 Gläser et al. (2003)
Lu et al. (2009)
Nagai et al. (1995)
Rearrangement
Talkowski et al. (2012) t(11;12)(p13;p12.1)
Figure 6.5 Summary of SOX5 genetic findings.

184 Kenneth Y. Kwan
necessary for homo- and heterodimerization (Lefebvre et al., 2007), and are
therefore predicted to be highly deleterious. Many of these patients suffer
from speech and language delays, moderate to severe ID, and behavioral def-
icits that include autistic-like features and stereotypies (Lamb et al., 2012;
Rosenfeld et al., 2010; Schanze et al., 2013; Talkowski et al., 2012). Fur-
thermore, several cases of larger deletions that span beyond the entire
SOX5 gene have also been reported (Gläser et al., 2003; Lu et al., 2009;
Nagai et al., 1995; Stumm et al., 2007). In addition to CNVs, SOX5 inter-
ruption by chromosomal rearrangement has been reported in ASD
(Talkowski et al., 2012). With a breakpoint located between the HMG
box and coiled-coil domain, this t(11;12)(p13;p12.1) translocation is also
predicted to lead to SOX5 loss of function.
The expression pattern of SOX5 suggests that it plays a role in esta-
blishing early neocortical circuits, perturbations of which may contribute
to ASD (Fig. 6.3). In the embryonic neocortex, SOX5 expression is highly
enriched in L6 and SP corticothalamic projection neurons and a subset of L5
subcerebral projection neurons, starting at around E14.5 (Kwan et al., 2008;
Lai et al., 2008). The absence of SOX5 from cortical VZ and SVZ progen-
itor cells throughout embryonic development indicates that it is likely to
function postmitotically (Kwan et al., 2008; Lai et al., 2008).
Consistent with this spatiotemporal expression, Sox5 cell autonomously
controls the migration, differentiation, and axonal projections of these early-
born neurons (Fig. 6.3) (Kwan et al., 2008; Lai et al., 2008). Analysis of
Sox5-deficient mice revealed marked disruption of layer-dependent
corticofugal connectivities. In the absence of Sox5, the vast majority of cor-
ticothalamic axons arising from SP and L6 neurons fail to reach the dorsal
thalamus and are instead misrouted to the hypothalamus (Kwan et al.,
2008). In addition, subcerebral axons originating from L5 neurons are
greatly reduced, with projections to the pons and spinal cord, including
the corticospinal tract (CST), being nearly completely abolished (Kwan
et al., 2008). Interestingly, although Sox5 is required for the normal forma-
tion of the CST, its misexpression in upper-layer neurons was not sufficient
to respecify their projectional fate (Kwan et al., 2008), suggesting that the
role of Sox5 is not instructive. The corpus callosum, which is known to
be altered in some cases of ASD, is grossly normal in the Sox5-null neocor-
tex. The remarkable defects in corticothalamic and corticospinal projections
in the Sox5 mutant mouse, however, are consistent with studies that show
changes to the internal capsule in ASD, which indicate alterations to
corticofugal connectivites (Ingalhalikar et al., 2011; Wolff et al., 2012).
In addition to axonal projections, Sox5, like Tbr1, also regulates the

molecular identities and positioning of early-born projection neurons. Con-
sistent with its high expression in L6 and SP neurons, Sox5 is selectively
required for their migration (Kwan et al., 2008; Lai et al., 2008). In
Sox5-deficient mice, L6 and SP neurons are unable to migrate past
earlier-born neurons to settle more superficially, thus failing at this final step
of neuronal migration. As a result, the deep cortical layers of the Sox5-null
cortex exhibit a laminar inversion with some similarities to the Reeler phe-
notype (Rice & Curran, 2001). Interestingly, unlike Reeler and related
mutants, the late-born neurons destined for the upper layers are unaffected
and migrate normally. Furthermore, in the Sox5-deficient neocortex, many
SP neurons do not separate from the MZ, instead becoming ectopically posi-
tioned at the upper edge of L2 (Kwan et al., 2008; Lai et al., 2008). This
failure in PP splitting disrupts the proper formation of the SP and may affect
its early pioneering circuits (Kwan et al., 2008). Notably, in addition to
wider migration defects in ASD (Wegiel et al., 2010), aberrant cell clustering
and supernumerary cells in LI and SP have been reported (Hutsler et al.,
2007). These findings suggest that defects in PP splitting may be present
in rare ASD cases and that the migration defects that result from the absence
of SOX5 may have potential relevance to ASD.
In addition to positioning, SOX5 also controls the molecular differenti-
ation of L6 and SP neurons. SOX5 is required not only for the expression of
connective tissue growth factor, a reliable marker of SP neurons, but also for the
progressive downregulation of L5 marker genes Fezf2 and Bcl11b from L6
and SP neurons during late embryogenesis (Kwan et al., 2008). In the
absence of Sox5, L6 and SP neurons aberrantly maintain L5 marker expres-
sion and therefore express a combination of L5 and L6/SP molecular iden-
tities (Kwan et al., 2008; Lai et al., 2008). Thus, changes to the
morphological and molecular development of the SP, as well as its circuitry,
may further compound alterations of neocortical connectivities in Sox5 defi-
ciency in ASD. As discussed earlier, the pioneering neurons of the SP play
key roles in the organization and wiring of CP neuronal circuits
(Allendoerfer & Shatz, 1994; Del Rı́o et al., 2000; Herrmann et al.,
1994; Kostovic & Rakic, 1980, 1990; Molliver et al., 1973; Rakic,
1976). The control of SP positioning and differentiation represents a poten-
tial point of convergence between Tbr1 and Sox5 mechanisms and is con-
sistent with a putative role of SP circuits in ASD, as suggested by the
enrichment of ASD-implicated gene expression in SP neurons (Hoerder-
Suabedissen et al., 2013).
186 Kenneth Y. Kwan
2.3. FEZ family zinc finger 2 (FEZF2)

FEZF2 (previously known as FEZL and ZFP312/ZNF312) is one of the
first TFs shown to be a necessary and sufficient determinant of corticofugal
connectivity (Fig. 6.3) (Chen, Rasin, et al., 2005; Chen, Schaevitz, &
McConnell, 2005; Molyneaux et al., 2005). It encodes a zinc finger-
containing nuclear protein (Hashimoto et al., 2000; Hirata et al., 2004) that
is functionally conserved at the protein level between fish and mammals
(Shim, Kwan, Li, Lefebvre, & Sestan, 2012).
Genetic association has been reported between FEZF2 and ASD in two
large cohorts of European ancestry and replicated in two additional cohorts
(Fig. 6.6) (Wang et al., 2009). This SNV occurs within the highly conserved
proximal promoter region of FEZF2 that has been shown to be important to
drive neocortical gene expression (Hirata et al., 2006). Interestingly, the
major allele (T) seems to have a recent evolutionary origin, having emerged
in primates, within which it has become highly conserved, likely after puri-
fying selection (Fig. 6.6). Importantly, the allele associated with ASD (C)
represents a reversion to the ancestral nonprimate allele. Although it is quite
possible for this base pair substitution itself to have a functional consequence
on FEZF2 gene expression, it may also represent a reversion to a more
chr3: 62,352,000 62,354,000 62,356,000 62,358,000 62,360,000 62,362,000
FEZF2
ZFs
FEZF2
Sanders et al. (2012) Arg344Cys
Wang et al. (2009) rs3755827 (T/c)
Placental Mammal Basewise Conservation by PhyloP
Mammal
Cons
Multiz Alignments of Vertebrates
Rhesus
Mouse
Dog
Elephant
Opossum
Chicken
human PHKCNQCGKAFNRSSTLNTHIRIHA GCGCTCCGCGCTTGGTTTGGAGGGG

Primates
chimp PHKCNQCGKAFNRSSTLNTHIRIHA GCGCTCCGCGCTTGGTTTGGAGGGG

gorilla PHKCNQCGKAFNRSSTLNTHIRIHA GCGCTCCGCGCTTGGTTTGGAGGGG
orangutan PHKCNQCGKAFNRSSTLNTHIRIHA GCGCTCCGCGCTTGGTTTGGAGGGG
rhesus PHKCNQCGKAFNRSSTLNTHIRIHA GCGCTCCGCGCTTGGTTTGGAGGGG
horse PHKCNQCGKAFNRSSTLNTHIRIHA GCGCTCCGCGCTcGGTTTGGAGGGG
cow PHKCNQCGKAFNRSSTLNTHIRIHA GCaCTCCGCGCTcGGTTTGGAGGGG
dog PHKCNQCGKAFNRSSTLNTHIRIHA GCGCTCCaCGCTcGGTTTGGAGGGG
cat PHKCNQCGKAFNRSSTLNTHIRIHA GCGCTCCaCGCTcGGTTTGGAGGGG
rat PHKCNQCGKAFNRSSTLNTHIRIHA GCGCTCCGCaCTgGGTTTGGAGGGG
mouse PHKCNQCGKAFNRSSTLNTHIRIHA GCGCTCgGCGCTgGGTTTGGAGGGG
************************* ** *** * ** ************
Figure 6.6 Summary of FEZF2 genetic findings.

ancient haplotype that may have additional functional changes. Further-

more, a rare mutation in FEZF2 has been identified in ASD (Sanders
et al., 2012). This missense mutation alters an arginine residue that is highly
conserved in mammalian and avian species, and the mutated cysteine residue
is predicted to be highly deleterious to the zinc finger domain critical for
protein function.
Further evidence of FEZF2 contribution to molecular pathways of ASD
includes its regulation of the expression TBR1 (Chen, Rasin, et al., 2005),
whose role in neocortical development and ASD was discussed earlier. In
addition, Fezf2 is required for the neocortical expression of forkhead box
P2 (FOXP2) (Chen, Schaevitz, & McConnell, 2005; Molyneaux et al.,
2005), the disease-causing gene of a severe speech and language disorder
(Lai, Fisher, Hurst, Vargha-Khadem, & Monaco, 2001) and thought to
be important to the emergence of human speech (Enard et al., 2002;
Konopka et al., 2009). FOXP2 and related FOXP genes have been impli-
cated in ASD (Bowers & Konopka, 2012; Girirajan et al., 2013; Hamdan
et al., 2010; O’Roak et al., 2011; Palumbo et al., 2013; Schaaf et al.,
2011) and are discussed in depth in Chapter 4.
As a key determinant of corticofugal connections, FEZF2 may be
important to cortical circuits relevant to ASD in several ways. Starting from
an early developmental age (E10.5), Fezf2 is expressed exclusively in the
corticofugal projection neurons of the deep cortical layers and the early
(E10.5–E13.5) embryonic progenitor cells that generate these neurons
(Fig. 6.3) (Chen, Rasin, et al., 2005; Chen, Schaevitz, & McConnell,
2005; Molyneaux et al., 2005). It is absent from the intracortical projection
neurons, in upper or deep layers, and in the late (>14.5) VZ progenitors that
give rise to upper-layer neurons. Within the deep layers, Fezf2 is most highly
expressed in L5 subcerebral neurons and less strongly expressed in L6 cor-
ticothalamic neurons (Chen, Rasin, et al., 2005). The exclusivity of Fezf2
expression in corticofugal projection neurons, and its graded expression
levels in different corticofugal subtypes (i.e., corticospinal vs. cor-
ticothalamic), suggests that Fezf2 expression is under a very precise gene reg-
ulation and that this regulation is likely to have a functional significance
(Chen, Rasin, et al., 2005; Kwan, Sestan, & Anton, 2012).
Consistent with this highly specific expression pattern, Fezf2 regulates
the molecular specification and axonal projections of deep-layer subcortical
projection neurons (Chen, Rasin, et al., 2005; Chen, Schaevitz, &
McConnell, 2005; Molyneaux et al., 2005). Fezf2 is required for the early
specification of L5 molecular identity. In the absence of Fezf2, the
188 Kenneth Y. Kwan
expression of Bcl11b, Etv1, Foxo1, Crym, Diap3, Clim1, Crim1, and other L5
markers are lost or severely reduced (Chen, Rasin, et al., 2005; Chen,
Schaevitz, & McConnell, 2005; Molyneaux et al., 2005). Accordingly,
Fezf2 is necessary for the formation of the corticospinal tract that originates
from these neurons. When Fezf2 is genetically removed (Chen, Schaevitz, &
McConnell, 2005; Molyneaux et al., 2005) or knocked down by RNAi
(Chen, Rasin, et al., 2005), corticospinal axons fail to enter the pons or spinal
cord and some of these axons aberrantly invade the anterior commissure
(Chen, Schaevitz, & McConnell, 2005; Molyneaux et al., 2005). Fezf2,
however, is not only necessary for normal corticospinal tract formation
but also sufficient to induce it ectopically. When Fezf2 is specifically mis-
expressed in upper-layer neurons that normally project only intracortically,
ectopic subcortical projections to the pons and spinal cord originate from
these neurons (Chen, Rasin, et al., 2005). Furthermore, Fezf2 is sufficient
to reprogram intracortical projection neurons to project subcortically in
the early postnatal neocortex (De la Rossa et al., 2013; Rouaux &
Arlotta, 2013). In addition to L5 identity and projections, Fezf2 also controls
the molecular development of L6 neurons and their corticothalamic projec-
tions (Chen, Rasin, et al., 2005; Chen, Schaevitz, & McConnell, 2005;
Molyneaux et al., 2005). Furthermore, Probst bundles containing callosal
axons that are unable to cross the midline have been reported in the
Fezf2-null cortex (Chen, Rasin, et al., 2005; Chen, Schaevitz, &
McConnell, 2005; Molyneaux et al., 2005). Although this Fezf2 phenotype
may not be cell autonomous, changes in callosal connectivity can contribute
to circuit alternations relevant to ASD. Furthermore, the loss of subcerebral
connectivity in the absence of Fezf2 is consistent with reduced internal cap-
sule innervation reported in some ASD patients (Ingalhalikar et al., 2011;
Wolff et al., 2012).
These diverse roles of Fezf2 on axon projections are mediated by its
involvement in complex transcription networks that mediate multiple
aspects of neocortical development (Chen et al., 2008; Han et al., 2011;
Kwan et al., 2008; Leone et al., 2008; McKenna et al., 2011; Shim et al.,
2012; Srinivasan et al., 2012). These networks include direct and indirect
interactions between FEZF2 and SOX5, TBR1, and SATB2, the other
ASD-implicated TFs discussed in this chapter. This central role of FEZF2
in neocortical transcriptional networks is consistent with its high
intramodular connectivity in a gene coexpression network, the cortical
development module, assembled unbiasedly from the developing human
brain transcriptome (Kang et al., 2011).
Interestingly, Fezf2 may further contribute to circuit assembly by regu-

lating the morphological development of dendrites in projection neurons.
When Fezf2 is silenced, the complexity of the basal dendritic arbors and
the number of dendritic spines are both reduced (Chen, Rasin, et al.,
2005). Furthermore, the vertical orientation of the apical dendrites is also
disrupted. These postsynaptic changes may further add to circuits’ alterations
in the absence of Fezf2. Consistent with a potential contribution to ASD,
dendritic and spine morphologies are often disrupted in ASD and animal
models of ASD (Comery et al., 1997; Hutsler & Zhang, 2010; Irwin,
Galvez, & Greenough, 2000).
Unlike Tbr1 and Sox5, Fezf2 is not required for the migration of projec-
tion neurons. The layer-dependent arrangement and positioning of projection
neurons exhibit no alternations in the absence of Fezf2 (Chen, Rasin, et al.,
2005; Chen, Schaevitz, & McConnell, 2005; Molyneaux et al., 2005). Inter-
estingly, Fezf2 can indirectly control the layer distribution of specific subpop-
ulations of cortical interneurons (Lodato et al., 2011). In the Fezf2-null cortex,
the number of interneurons of certain subtypes is specifically reduced in L5,
indicating that loss of Fezf2-dependent L5 identity alters the distribution of
subclasses of interneurons (Lodato et al., 2011). As discussed earlier, interneu-
rons are critical to the balance between excitation and inhibition in the neo-
cortex (Rubenstein & Merzenich, 2003). Therefore, their disruption in the
absence of Fezf2 may further contribute to ASD.
2.4. Special AT-rich sequence-binding protein 2 (SATB2)

SATB2 is a DNA-binding protein that interacts with DNA matrix attach-
ment regions to alter gene expression by inducing local chromatin remo-
deling. In contrast to TBR1, SOX5, and FEZF2, SATB2 controls the
expression profiles, migration, and connectivity of intracortical projection
neurons (Fig. 6.3) (Alcamo et al., 2008; Britanova et al., 2008).
Numerous mutations, including CNVs, SNVs, and chromosomal
rearrangements that disrupt SATB2, have been reported in ASD cases
(Fig. 6.7). In one of the earlier studies of CNVs in ASD, a balanced trans-
location, t(2;6)(q32;p22), that interrupts SATB2 was described (Marshall
et al., 2008). A more recent study found an additional balanced transloca-
tion, t(2;6)(q33;q21), that disrupts SATB2 in a case of ASD (Talkowski
et al., 2012). Further study from the same group identified five intragenic
deletions that affect the CUT domain critical for DNA binding in cases
of ASD and other neurodevelopmental disorders (Talkowski et al., 2012).
190 Kenneth Y. Kwan
chr2:199,500,000 200,000,000 200,500,000
SATB2
CUT
SATB2 FTCDNL1 TYW5
SATB2-AS1 C2orf69
CNVs (loss)
Talkowski et al. (2012)
Rosenfeld et al. (2009)
Van Buggenhout et al. (2005)
Rearrangements
Marshall et al. (2008) t(2;6)(q32;p22)
Talkowski et al. (2012) t(2;6)(q33;q21)
SNVs
Leoyklang et al. (2007) Arg239X
Rauch et al. (2012) Val381Gly
Jiang et al. (2013) Pro655Ser
Figure 6.7 Summary of SATB2 genetic findings.
Three additional intragenic deletions have been found to underlie a 2q32q33

microdeletion syndrome characterized by severe intellectual disability
(Rosenfeld et al., 2009). Furthermore, a nonsense mutation (Arg239X)
positioned upstream of the CUT domain (Leoyklang et al., 2007) and a mis-
sense mutation (Val381Gly) that alters a well-conserved residue within the
CUT domain (Rauch et al., 2012) have been found in cases of intellectual
disability. A recent ASD study using whole-genome sequencing further
identified an inherited rare missense variant (Pro655Ser) ( Jiang et al.,
2013) that affects a residue that is conserved in mammalian and avian species.
Together, these data support the possibility that loss of SATB2 function can
contribute to ASD.
There is additional evidence of Satb2 involvement in ASD-related
molecular pathways. Satb2 controls the layer-dependent expression of the
ASD-associated gene Auts2 and may do so via its control of Tbr1
(Srinivasan et al., 2012), itself an ASD-implicated gene as discussed earlier.
Together with its interactions with several key transcriptional determinants
of neocortical development, including Fezf2, Bcl11b, and basic helix–loop–
helix family, member e22 (Bhlhe22, also Bhlhb5) (Srinivasan et al., 2012),
which are discussed later, Satb2 may occupy a central position in
transcriptional networks relevant to ASD. Consistent with this possibility,

SATB2 is also a highly connected hub gene in a gene coexpression network
that contains FEZF2, SOX5, and TBR1 (Kang et al., 2011).
SATB2 controls multiple processes required for the formation of intra-
cortical circuits that may be relevant to ASD (Fig. 6.3). The expression
SATB2 is greatly enriched in the intracortical projection neurons positioned
in L2–L5 (Alcamo et al., 2008; Britanova et al., 2008). This expression starts
in postmitotic neurons at around E13.5 as they migrate away from VZ and
SVZ en route to their layer destination. Consistent with its expression, Satb2
controls the molecular and axonal development of these projection neurons
(Alcamo et al., 2008; Baranek et al., 2012; Britanova et al., 2008; Srinivasan
et al., 2012). In the absence of Satb2, the molecular profiles of upper-layer
neurons are greatly altered, including the expression of layer-specific
markers of intracortical projection neurons. Cut-like homeobox 2, cadherin
10, and RAR-related orphan receptor-beta are severely reduced in the Satb2-
deficient neocortex (Alcamo et al., 2008). In addition, Satb2 regulates, in
a layer-dependent manner, the expression of Bhlhe22 (Srinivasan et al.,
2012), which encodes a TF that postmitotically controls neocortical areal
identity ( Joshi et al., 2008). Furthermore, Satb2 suppresses the aberrant
expression of other layer markers. In Satb2-null mice, the expression of
L5 subcortical neuronal marker Bcl11b is derepressed and thus ectopically
upregulated in the upper cortical layers (Alcamo et al., 2008; Britanova
et al., 2008).
Accompanying these alterations in molecular identity, intracortical projec-
tion neurons aberrantly project their axons to subcortical brain structures in
the absence of Satb2. This leads to the agenesis of the corpus callosum and
a misrouting of callosal axons to the anterior commissure (Alcamo et al.,
2008; Britanova et al., 2008). Unlike mutants in which callosal defects occur
secondary to structural changes in the brain, such as the absence of a glial sling
or other midline structures, callosal agenesis in the Satb2-null neocortex was
not associated with Probst bundles, which suggests that Satb2 is a cell-
autonomous determinant of intracortical connectivity. Consistent with this
possibility, this role of Satb2 is mediated, likely cell autonomously, by its con-
trol of axonal guidance molecules in upper-layer neurons. In the Satb2 mutant
neocortex, the upper-layer expression of Eph receptor A4 (EphA4), plexin A4,
and unc-5 homolog C (Unc5c, also known as Unc5H3) is reduced (Srinivasan
et al., 2012). Notably, the callosal defects that result from the absence of Satb2
can be rescued by reexpression of EphA4 or Unc5c, or Tbr1, the upper-layer
expression of which may play a cell-autonomous role in specifying callosal
192 Kenneth Y. Kwan
connectivity (Srinivasan et al., 2012). As discussed earlier, defects in intra-

cortical connectivity, including callosal projections, have been consistently
implicated in ASD (Ingalhalikar et al., 2011; Kumar et al., 2010; Lange
et al., 2010; Lee et al., 2007; Nagae et al., 2012; Shukla et al., 2010;
Sundaram et al., 2008; Weinstein et al., 2011; Wolff et al., 2012). These defects
in the Satb2-deficient neocortex, therefore, are consistent with the potential
contribution of SATB2 to ASD-relevant neural circuits. In addition, Satb2
controls the dendritic arborization and soma density of upper-layer neurons
(Zhang et al., 2011), which may further contribute to the overall development
of input and output connections in intracortical circuits. This role of Satb2 is
also consistent with the disruption of dendritic spine morphology in ASD
(Comery et al., 1997; Hutsler & Zhang, 2010; Irwin et al., 2000).
In addition to axonal projections, Satb2 further regulates neuronal migra-
tion (Fig. 6.3). Similar to its control of molecular identity and connectivity,
this role of Satb2 is also layer-dependent. In Satb2-deficient mice, the migra-
tion of early-born neurons to the SP and deep cortical layers is unaffected. In
contrast, a significant proportion of late-born neurons destined for the upper
layers are stalled in the IZ, being unable to enter the CP (Alcamo et al., 2008;
Britanova et al., 2008). This neuronal migration defect, however, was
restricted to the perinatal ages, as these defects are corrected within the first
postnatal week, with the majority of late-born neurons eventually arriving at
their normal upper-layer positions (Britanova et al., 2008; Zhang et al.,
2011). These data suggest that, in the absence of Satb2, neuronal migration
is not altogether defective, but rather delayed. This delay is distinct from the
neuronal migration defects described for Tbr1 and Sox5, as well as those
reported in postmortem ASD brains (Wegiel et al., 2010). Whether delay
of neuronal migration is present in ASD, however, might not be readily
assessed by examination of postmortem adult brains, as this defect is only
transiently present during development. Although the presence of this defect
in ASD remains to be fully examined, incorrect timing of the arrival of pro-
jection neurons to their CP destination can have functional consequences on
neuronal circuits. The wiring of neocortical circuitry involves a highly coor-
dinated series of events. The early postnatal ages in mouse neocortical devel-
opment, which is approximately equivalent to mid-fetal development in the
human neocortex (Clancy et al., 2007), represent a period of significant syn-
aptogenesis and a time when both efferent and afferent tracts are being
assembled. A delay in the arrival of neurons to the upper layers, therefore,
can alter the formation of key neocortical circuits and contribute to neocor-
tical miswiring in ASD.
3. DISCUSSION
As the pace of genetic discoveries accelerates, functional studies are
required to understand how alterations in candidate risk genes can contrib-
ute to ASD. Mechanistic studies of ASD neurobiology, however, are chal-
lenging not only because of the significant degree of phenotypic and genetic
heterogeneity but also because the complex cognitive and social deficits in
ASD cannot be readily modeled in rodents.
Genetic studies in mice, however, do have the potential to illuminate
mechanisms of neural circuitry assembly relevant to ASD. Many fundamen-
tal aspects of neocortical development are well conserved between rodent
and primate species, including the establishment of primary neocortical areas
and major axon tracts and the genetic programs underlying their specifica-
tion. Indeed, the layer-dependent expression patterns of the four transcrip-
tional determinants discussed in this chapter (Tbr1, Sox5, Fezf2, and Satb2)
are conserved between the mouse and human neocortices (Ip, Bayatti,
Howard, Lindsay, & Clowry, 2011; Kwan, Lam, et al., 2012; Kwan
et al., 2008; Saito et al., 2011). This suggests not only that their highly spe-
cific gene expression patterns are controlled by the same upstream transcrip-
tional regulators in the two species but also that their functions during
neocortical development are shared. These common mechanisms should
be amenable to being modeled in the mouse. Furthermore, although the
mouse is an imperfect model, given the technical, logistical, and ethical con-
siderations, no better alternatives exist for experimental interrogation of
intact neural circuits.
Genetic removal of Tbr1, Sox5, Fezf2, or Satb2 from the mouse leads to
profound defects in the neocortex, which are not observed in human ASD
cases. It should be noted, however, that the mouse genetic studies discussed
in this chapter involved the complete, homozygous removal of the genes of
interest from the animal in order to reveal the most severe phenotypes. In
human cases, these genes are likely to be affected less severely. Often, the
reported ASD variants are SNVs or CNVs that do not remove the entire
gene. Furthermore, all of the ASD cases discussed in this chapter are hetero-
zygous at the locus in question, suggesting that one functional copy of the
gene is present. Subtle alterations in gene dosage or functional capacity may
more subtly affect neocortical circuit wiring in a manner consistent with
ASD. In future experiments, recapitulating patient mutations in the mouse
is likely to reveal mechanistic insights most relevant to human ASD.
194 Kenneth Y. Kwan
Studies of mouse genetics have revealed diverse neocortical phenotypes

in the Tbr1, Sox5, Fezf2, and Satb2 mutants. There are, however, points of
convergence that may illuminate the biology of ASD.
First, relationships in gene function can be inferred based on gene
expression patterns if the spatiotemporal expression data are sufficiently
comprehensive. The unbiased assembly of gene coexpression networks
from large datasets represents a powerful tool to uncover previously
unrecognized functional relationships between genes (Konopka,
Friedrich, et al., 2012; Oldham et al., 2008). Network analysis of human
brain transcriptome data revealed that TBR1, FEZF2, and SATB2 are pre-
sent within the same cortical development module and exhibit high
intramodular connectivity, being among the top 10 hub genes within the
module (Kang et al., 2011). These data indicate that during human brain
development, TBR1, FEZF2, and SATB2 exhibit considerable spatiotem-
poral overlap not only with each other, which indicates related function,
but also with many other genes within the module. The latter suggests
the possibility that these TFs regulate, and perhaps coregulate, a large num-
ber of genes within the cortical development module, which is consistent
with their roles as key determinants in numerous aspects of neocortical
development.
Second, recent evidence points to the presence of complex transcrip-
tional networks in the specification of neocortical projection neuron iden-
tities and connectivities (Chen et al., 2008; Han et al., 2011; Kwan et al.,
2008; Leone et al., 2008; McKenna et al., 2011; Shim et al., 2012;
Srinivasan et al., 2012). The direct and indirect interactions between
TBR1, SOX5, FEZF2, and SATB2 are emerging as important cross regu-
latory mechanisms central to the establishment of distinct neuronal subtypes
and projections. Perturbations of key determinants within this transcrip-
tional network may alter or switch certain neuronal fates and disturb the fine
balance between intracortical, corticofugal, and more subtle neuronal and
projectional subtypes. Such changes are likely to have wider functional con-
sequences on neocortical circuitry.
The convergence of TBR1, SOX5, FEZF2, and SATB2 in molecular
pathways underlying cortical development strongly implicates that they
contribute to ASD by regulating the proper assembly of neocortical circuits.
Future experiments aimed at the identification and characterization of effec-
tors downstream of these transcriptional programs are expected to shed fur-
ther light on pathways necessary for neocortical circuit assembly and relevant
to ASD pathophysiology.
ACKNOWLEDGMENTS
I thank Yuka Imamura Kawasawa and Mingfeng Li for the help with the human brain
transcriptome data in Fig. 6.1. This work was supported by the National Institutes of
Health (MH096939).
REFERENCES
Alcamo, E., Chirivella, L., Dautzenberg, M., Dobreva, G., Fariñas, I., Grosschedl, R., et al.
(2008). Satb2 regulates callosal projection neuron identity in the developing cerebral cor-
tex. Neuron, 57, 364–377.
Alexander, A. L., Lee, J. E., Lazar, M., Boudos, R., DuBray, M. B., Oakes, T. R., et al.
(2007). Diffusion tensor imaging of the corpus callosum in Autism. NeuroImage, 34,
61–73.
Allendoerfer, K. L., & Shatz, C. J. (1994). The subplate, a transient neocortical structure: Its
role in the development of connections between thalamus and cortex. Annual Review of
Anderson, S. A., Eisenstat, D. D., Shi, L., & Rubenstein, J. L. (1997). Interneuron migration
from basal forebrain to neocortex: Dependence on Dlx genes. Science, 278, 474–476.
Ang, E. S., Haydar, T. F., Gluncic, V., & Rakic, P. (2003). Four-dimensional migratory
coordinates of GABAergic interneurons in the developing mouse cortex. The Journal
of Neuroscience, 23, 5805–5815.
Angevine, J. B., Jr., & Sidman, R. L. (1961). Autoradiographic study of cell migration during
histogenesis of cerebral cortex in the mouse. Nature, 192, 766–768.
Anthony, T. E., Klein, C., Fishell, G., & Heintz, N. (2004). Radial glia serve as neuronal
progenitors in all regions of the central nervous system. Neuron, 41, 881–890.
Anton, E. S., Kreidberg, J. A., & Rakic, P. (1999). Distinct functions of alpha3 and
alpha(v) integrin receptors in neuronal migration and laminar organization of the cerebral
cortex. Neuron, 22, 277–289.
Arlotta, P., Molyneaux, B. J., Chen, J., Inoue, J., Kominami, R., & Macklis, J. D. (2005).
Neuronal subtype-specific genes that control corticospinal motor neuron development
in vivo. Neuron, 45, 207–221.
Baranek, C., Dittrich, M., Parthasarathy, S., Bonnon, C. G., Britanova, O., Lanshakov, D.,
et al. (2012). Protooncogene Ski cooperates with the chromatin-remodeling factor Satb2
in specifying callosal neurons. Proceedings of the National Academy of Sciences of the United
States of America, 109, 3546–3551.
Bedogni, F., Hodge, R., Elsen, G., Nelson, B., Daza, R., Beyer, R., et al. (2010). Tbr1
regulates regional and laminar identity of postmitotic neurons in developing neocortex.
13129–13134.
Ben-David, E., Granot-Hershkovitz, E., Monderer-Rothkoff, G., Lerer, E., Levi, S.,
Yaari, M., et al. (2011). Identification of a functional rare variant in autism using
genome-wide screen for monoallelic expression. Human Molecular Genetics, 20,
3632–3641.
Bentivoglio, M., & Mazzarello, P. (1999). The history of radial glia. Brain Research Bulletin,
49, 305–315.
Bowers, J. M., & Konopka, G. (2012). The role of the FOXP family of transcription factors in
ASD. Disease Markers, 33, 251–260.
Britanova, O., de Juan Romero, C., Cheung, A., Kwan, K. Y., Schwark, M., Gyorgy, A.,
et al. (2008). Satb2 is a postmitotic determinant for upper-layer neuron specification in
the neocortex. Neuron, 57, 378–392.
196 Kenneth Y. Kwan
Casanova, M. F., Buxhoeveden, D., & Gomez, J. (2003). Disruption in the inhibitory
architecture of the cell minicolumn: Implications for autism. The Neuroscientist, 9,
496–507.
Casanova, M. F., Buxhoeveden, D. P., Switala, A. E., & Roy, E. (2002). Minicolumnar
pathology in autism. Neurology, 58, 428–432.
Caviness, V. S., Jr. (1982). Neocortical histogenesis in normal and Reeler mice:
A developmental study based upon [3H]thymidine autoradiography. Brain Research,
256, 293–302.
Caviness, V. S., Jr., Takahashi, T., & Nowakowski, R. S. (1995). Numbers, time and neo-
cortical neuronogenesis: A general developmental and evolutionary model. Trends in
Neurosciences, 18, 379–383.
Chao, H. T., Chen, H., Samaco, R. C., Xue, M., Chahrour, M., Yoo, J., et al. (2010). Dys-
function in GABA signalling mediates autism-like stereotypies and Rett syndrome phe-
notypes. Nature, 468, 263–269.
Chen, J., Rasin, M., Kwan, K., & Sestan, N. (2005). Zfp312 is required for subcortical axonal
projections and dendritic morphology of deep-layer pyramidal neurons of the cerebral
cortex. Proceedings of the National Academy of Sciences of the United States of America,
102, 17792–17797.
Chen, B., Schaevitz, L., & McConnell, S. (2005). Fezl regulates the differentiation and axon
targeting of layer 5 subcortical projection neurons in cerebral cortex. Proceedings of the
National Academy of Sciences of the United States of America, 102, 17184–17189.
Chen, B., Wang, S., Hattox, A., Rayburn, H., Nelson, S., & McConnell, S. (2008). The
Fezf 2-Ctip2 genetic pathway regulates the fate choice of subcortical projection neurons
in the developing cerebral cortex. Proceedings of the National Academy of Sciences of the
Chonchaiya, W., Schneider, A., & Hagerman, R. J. (2009). Fragile X: A family of disorders.
Advances in Pediatrics, 56, 165–186.
Clancy, B., Kersh, B., Hyde, J., Darlington, R. B., Anand, K. J., & Finlay, B. L. (2007).
Web-based method for translating neurodevelopment from laboratory species to
humans. Neuroinformatics, 5, 79–94.
Colantuoni, C., Lipska, B. K., Ye, T., Hyde, T. M., Tao, R., Leek, J. T., et al. (2011). Tem-
poral dynamics and genetic control of transcription in the human prefrontal cortex.
Nature, 478, 519–523.
Comery, T. A., Harris, J. B., Willems, P. J., Oostra, B. A., Irwin, S. A., Weiler, I. J., et al.
(1997). Abnormal dendritic spines in fragile X knockout mice: Maturation and pruning
deficits. Proceedings of the National Academy of Sciences of the United States of America, 94,
5401–5404.
D’Arcangelo, G., & Curran, T. (1998). Reeler: New tales on an old mutant mouse. Bioessays,
20, 235–244.
De Carlos, J. A., & O’Leary, D. D. (1992). Growth and targeting of subplate axons and estab-
lishment of major cortical pathways. The Journal of Neuroscience, 12, 1194–1211.
DeFelipe, J., & Farinas, I. (1992). The pyramidal neuron of the cerebral cortex: Morpholog-
ical and chemical characteristics of the synaptic inputs. Progress in Neurobiology, 39,
563–607.
De la Rossa, A., Bellone, C., Golding, B., Vitali, I., Moss, J., Toni, N., et al. (2013). In vivo
reprogramming of circuit connectivity in postmitotic neocortical neurons. Nature
Del Rı́o, J., Martı́nez, A., Auladell, C., & Soriano, E. (2000). Developmental history of the
subplate and developing white matter in the murine neocortex. Neuronal organization
and relationship with the main afferent systems at embryonic and perinatal stages. Cerebral
Cortex, 10, 784–801.
Enard, W., Przeworski, M., Fisher, S. E., Lai, C. S., Wiebe, V., Kitano, T., et al. (2002).
Molecular evolution of FOXP2, a gene involved in speech and language. Nature,
418, 869–872.
Englund, C., Fink, A., Lau, C., Pham, D., Daza, R. A., Bulfone, A., et al. (2005). Pax6, Tbr2,
and Tbr1 are expressed sequentially by radial glia, intermediate progenitor cells, and
postmitotic neurons in developing neocortex. The Journal of Neuroscience, 25, 247–251.
Fischbach, G. D., & Lord, C. (2010). The Simons Simplex Collection: A resource for iden-
tification of autism genetic risk factors. Neuron, 68, 192–195.
Fishell, G., & Hanashima, C. (2008). Pyramidal neurons grow up and change their mind.
Neuron, 57, 333–338.
Geschwind, D., & Levitt, P. (2007). Autism spectrum disorders: Developmental disconnec-
tion syndromes. Current Opinion in Neurobiology, 17, 103–111.
Girirajan, S., Dennis, M. Y., Baker, C., Malig, M., Coe, B. P., Campbell, C. D., et al. (2013).
Refinement and discovery of new hotspots of copy-number variation associated with
autism spectrum disorder. American Journal of Human Genetics, 92, 221–237.
Gläser, B., Rossier, E., Barbi, G., Chiaie, L. D., Blank, C., Vogel, W., et al. (2003). Molec-
ular cytogenetic analysis of a constitutional de novo interstitial deletion of chromosome
12p in a boy with developmental delay and congenital anomalies. American Journal of
Medical Genetics Part A, 116A, 66–70.
Gray, P. A., Fu, H., Luo, P., Zhao, Q., Yu, J., Ferrari, A., et al. (2004). Mouse brain orga-
nization revealed through direct genome-scale TF expression analysis. Science, 306,
2255–2257.
Guillemot, F. (2007). Cell fate specification in the mammalian telencephalon. Progress in
Neurobiology, 83, 37–52.
impairment. American Journal of Human Genetics, 87, 671–678.
Han, W., Kwan, K. Y., Shim, S., Lam, M. M., Shin, Y., Xu, X., et al. (2011). TBR1 directly
represses Fezf 2 to control the laminar origin and development of the corticospinal tract.
3041–3046.
Hashimoto, H., Yabe, T., Hirata, T., Shimizu, T., Bae, Y., Yamanaka, Y., et al. (2000).
Expression of the zinc finger gene fez-like in zebrafish forebrain. Mechanisms of Develop-
ment, 97, 191–195.
Haubensak, W., Attardo, A., Denk, W., & Huttner, W. B. (2004). Neurons arise in the basal
neuroepithelium of the early mammalian telencephalon: A major site of neurogenesis.
3196–3201.
Hébert, J. M., & Fishell, G. (2008). The genetics of early telencephalon patterning: Some
assembly required. Nature Reviews Neuroscience, 9, 678–685.
Herrmann, K., Antonini, A., & Shatz, C. J. (1994). Ultrastructural evidence for synaptic
interactions between thalamocortical axons and subplate neurons. The European Journal
of Neuroscience, 6, 1729–1742.
Hevner, R. F., Hodge, R. D., Daza, R. A., & Englund, C. (2006). Transcription factors in
glutamatergic neurogenesis: Conserved programs in neocortex, cerebellum, and adult
hippocampus. Neuroscience Research, 55, 223–233.
Hevner, R., Shi, L., Justice, N., Hsueh, Y., Sheng, M., Smiga, S., et al. (2001). Tbr1 regulates
differentiation of the preplate and layer 6. Neuron, 29, 353–366.
Hirata, T., Nakazawa, M., Muraoka, O., Nakayama, R., Suda, Y., & Hibi, M. (2006). Zinc-
finger genes Fez and Fez-like function in the establishment of diencephalon subdivisions.
Development, 133, 3993–4004.
198 Kenneth Y. Kwan
Hirata, T., Suda, Y., Nakao, K., Narimatsu, M., Hirano, T., & Hibi, M. (2004). Zinc finger
gene fez-like functions in the formation of subplate neurons and thalamocortical axons.
Developmental Dynamics, 230, 546–556.
Hoerder-Suabedissen, A., Oeschger, F. M., Krishnan, M. L., Belgard, T. G., Wang, W. Z.,
Lee, S., et al. (2013). Expression profiling of mouse subplate reveals a dynamic gene net-
work and disease association with autism and schizophrenia. Proceedings of the National
Academy of Sciences of the United States of America, 110, 3555–3560.
Holt, R., Barnby, G., Maestrini, E., Bacchelli, E., Brocklebank, D., Sousa, I., et al. (2010).
Linkage and candidate gene studies of autism spectrum disorders in European
populations. European Journal of Human Genetics, 18, 1013–1019.
Huang, X. L., Zou, Y. S., Maher, T. A., Newton, S., & Milunsky, J. M. (2010). A de novo
balanced translocation breakpoint truncating the autism susceptibility candidate 2
(AUTS2) gene in a patient with autism. American Journal of Medical Genetics Part A,
152A, 2112–2114.
Hutsler, J. J., Love, T., & Zhang, H. (2007). Histological and magnetic resonance imaging
assessment of cortical layering and thickness in autism spectrum disorders. Biological
Psychiatry, 61, 449–457.
Hutsler, J. J., & Zhang, H. (2010). Increased dendritic spine densities on cortical projection
neurons in autism spectrum disorders. Brain Research, 1309, 83–94.
Ingalhalikar, M., Parker, D., Bloy, L., Roberts, T. P., & Verma, R. (2011). Diffusion based
abnormality markers of pathology: Toward learned diagnostic prediction of ASD.
NeuroImage, 57, 918–927.
Iossifov, I., Ronemus, M., Levy, D., Wang, Z., Hakker, I., Rosenbaum, J., et al. (2012). De
novo gene disruptions in children on the autistic spectrum. Neuron, 74, 285–299.
Ip, B. K., Bayatti, N., Howard, N. J., Lindsay, S., & Clowry, G. J. (2011). The corticofugal
neuron-associated genes ROBO1, SRGAP1, and CTIP2 exhibit an anterior to posterior
gradient of expression in early fetal human neocortex development. Cerebral Cortex, 21,
1395–1407.
Irwin, S. A., Galvez, R., & Greenough, W. T. (2000). Dendritic spine structural anomalies in
fragile-X mental retardation syndrome. Cerebral Cortex, 10, 1038–1044.
Jessell, T. (2000). Neuronal specification in the spinal cord: Inductive signals and transcrip-
tional codes. Nature Reviews Genetics, 1, 20–29.
Jiang, Y. H., Yuen, R. K., Jin, X., Wang, M., Chen, N., Wu, X., et al. (2013). Detection of
clinically relevant genetic variants in autism spectrum disorder by whole-genome
sequencing. American Journal of Human Genetics, 93, 249–263.
Johnson, M. B., Kawasawa, Y. I., Mason, C. E., Krsnik, Z., Coppola, G., Bogdanovic, D.,
et al. (2009). Functional and evolutionary insights into human brain development
through global transcriptome analysis. Neuron, 62, 494–509.
Jones, E. G. (1986). Neurotransmitters in the cerebral cortex. Journal of Neurosurgery, 65,
135–153.
Joshi, P. S., Molyneaux, B. J., Feng, L., Xie, X., Macklis, J. D., & Gan, L. (2008). Bhlhb5
regulates the postmitotic acquisition of area identities in layers II-V of the developing
neocortex. Neuron, 60, 258–272.
Just, M. A., Keller, T. A., Malave, V. L., Kana, R. K., & Varma, S. (2012). Autism as a neural
systems disorder: A theory of frontal-posterior underconnectivity. Neuroscience and
Biobehavioral Reviews, 36, 1292–1313.
Kalscheuer, V. M., FitzPatrick, D., Tommerup, N., Bugge, M., Niebuhr, E.,
Neumann, L. M., et al. (2007). Mutations in autism susceptibility candidate 2
(AUTS2) in patients with mental retardation. Human Genetics, 121, 501–509.
Kang, H. J., Kawasawa, Y. I., Cheng, F., Zhu, Y., Xu, X., Li, M., et al. (2011). Spatio-
temporal transcriptome of the human brain. Nature, 478, 483–489.
Kelemenova, S., Schmidtova, E., Ficek, A., Celec, P., Kubranska, A., & Ostatnikova, D.
(2010). Polymorphisms of candidate genes in Slovak autistic patients. Psychiatric Genetics,
20, 137–139.
Keller, T. A., Kana, R. K., & Just, M. A. (2007). A developmental study of the structural
integrity of white matter in autism. Neuroreport, 18, 23–27.
Kerjan, G., & Gleeson, J. G. (2007). Genetic mechanisms underlying abnormal neuronal
migration in classical lissencephaly. Trends in Genetics, 23, 623–630.
Konopka, G., Bomar, J. M., Winden, K., Coppola, G., Jonsson, Z. O., Gao, F., et al. (2009).
Human-specific transcriptional regulation of CNS development genes by FOXP2.
Nature, 462, 213–217.
Konopka, G., Friedrich, T., Davis-Turak, J., Winden, K., Oldham, M. C., Gao, F., et al.
(2012). Human-specific transcriptional networks in the brain. Neuron, 75, 601–617.
Konopka, G., Wexler, E., Rosen, E., Mukamel, Z., Osborn, G. E., Chen, L., et al. (2012).
Modeling the functional genomics of autism using human neurons. Molecular Psychiatry,
17, 202–214.
Kostovic, I., & Rakic, P. (1980). Cytology and time of origin of interstitial neurons in the
white matter in infant and adult human and monkey telencephalon. Journal of
Neurocytology, 9, 219–242.
Kostovic, I., & Rakic, P. (1990). Developmental history of the transient subplate zone in the
visual and somatosensory cortex of the macaque monkey and human brain. The Journal of
Comparative Neurology, 297, 441–470.
Kowalczyk, T., Pontious, A., Englund, C., Daza, R. A., Bedogni, F., Hodge, R., et al.
(2009). Intermediate neuronal progenitors (basal progenitors) produce pyramidal-
projection neurons for all layers of cerebral cortex. Cerebral Cortex, 19, 2439–2450.
Krepischi, A. C., Knijnenburg, J., Bertola, D. R., Kim, C. A., Pearson, P. L., Bijlsma, E.,
et al. (2010). Two distinct regions in 2q24.2-q24.3 associated with idiopathic epilepsy.
Epilepsia, 51, 2457–2460.
Kumar, A., Sundaram, S. K., Sivaswamy, L., Behen, M. E., Makki, M. I., Ager, J., et al.
(2010). Alterations in frontal lobe tracts and corpus callosum in young children with
autism spectrum disorder. Cerebral Cortex, 20, 2103–2113.
Kwan, K. Y., Lam, M. M., Johnson, M. B., Dube, U., Shim, S., Rašin, M. R., et al. (2012).
Species-dependent posttranscriptional regulation of NOS1 by FMRP in the developing
cerebral cortex. Cell, 149, 899–911.
Kwan, K. Y., Lam, M. M., Krsnik, Z., Kawasawa, Y. I., Lefebvre, V., & Sestan, N. (2008).
SOX5 postmitotically regulates migration, postmigratory differentiation, and projections
of subplate and deep-layer neocortical neurons. Proceedings of the National Academy of
Sciences of the United States of America, 105, 16021–16026.
Kwan, K. Y., Sestan, N., & Anton, E. S. (2012). Transcriptional co-regulation of neuronal
migration and laminar identity in the neocortex. Development, 139, 1535–1546.
413, 519–523.
Lai, T., Jabaudon, D., Molyneaux, B., Azim, E., Arlotta, P., Menezes, J., et al. (2008). SOX5
controls the sequential generation of distinct corticofugal neuron subtypes. Neuron, 57,
232–247.
Lamb, A. N., Rosenfeld, J. A., Neill, N. J., Talkowski, M. E., Blumenthal, I., Girirajan, S.,
et al. (2012). Haploinsufficiency of SOX5 at 12p12.1 is associated with developmental
delays with prominent language delay, behavior problems, and mild dysmorphic features.
Human Mutation, 33, 728–740.
Lambert de Rouvroit, C., & Goffinet, A. M. (1998). A new view of early cortical develop-
ment. Biochemical Pharmacology, 56, 1403–1409.
200 Kenneth Y. Kwan
Lange, N., Dubray, M. B., Lee, J. E., Froimowitz, M. P., Froehlich, A., Adluru, N., et al.
(2010). Atypical diffusion tensor hemispheric asymmetry in autism. Autism Research, 3,
350–358.
Lee, J. E., Bigler, E. D., Alexander, A. L., Lazar, M., DuBray, M. B., Chung, M. K., et al.
(2007). Diffusion tensor imaging of white matter in the superior temporal gyrus and tem-
poral stem in autism. Neuroscience Letters, 424, 127–132.
Lefebvre, V., Dumitriu, B., Penzo-Méndez, A., Han, Y., & Pallavi, B. (2007). Control of cell
fate and differentiation by Sry-related high-mobility-group box (Sox) transcription fac-
tors. The International Journal of Biochemistry & Cell Biology, 39, 2195–2214.
Leone, D. P., Srinivasan, K., Chen, B., Alcamo, E., & McConnell, S. K. (2008). The deter-
mination of projection neuron identity in the developing cerebral cortex. Current Opin-
ion in Neurobiology, 18, 28–35.
Leoyklang, P., Suphapeetiporn, K., Siriwan, P., Desudchit, T., Chaowanapanja, P.,
Gahl, W. A., et al. (2007). Heterozygous nonsense mutation SATB2 associated with cleft
palate, osteoporosis, and cognitive defects. Human Mutation, 28, 732–738.
Li, H., Li, Y., Shao, J., Li, R., Qin, Y., Xie, C., et al. (2008). The association analysis of
RELN and GRM8 genes with autistic spectrum disorder in Chinese Han population.
American Journal of Medical Genetics Part B, Neuropsychiatric Genetics, 147B, 194–200.
Liu, J. S. (2011). Molecular genetics of neuronal migration disorders. Current Neurology and
Neuroscience Reports, 11, 171–178.
Liu, X., Novosedlik, N., Wang, A., Hudson, M. L., Cohen, I. L., Chudley, A. E., et al.
(2009). The DLX1and DLX2 genes and susceptibility to autism spectrum disorders.
European Journal of Human Genetics, 17, 228–235.
Lodato, S., Rouaux, C., Quast, K. B., Jantrachotechatchawan, C., Studer, M.,
Hensch, T. K., et al. (2011). Excitatory projection neuron subtypes control the distribu-
tion of local inhibitory interneurons in the cerebral cortex. Neuron, 69, 763–779.
Lu, H. Y., Cui, Y. X., Shi, Y. C., Xia, X. Y., Liang, Q., Yao, B., et al. (2009). A girl with
distinctive features of borderline high blood pressure, short stature, characteristic
brachydactyly, and 11.47 Mb deletion in 12p11.21-12p12.2 by oligonucleotide array
CGH. American Journal of Medical Genetics Part A, 149A, 2321–2323.
Lui, J. H., Hansen, D. V., & Kriegstein, A. R. (2011). Development and evolution of the
human neocortex. Cell, 146, 18–36.
MacDonald, J. L., Fame, R. M., Azim, E., Shnider, S. J., Molyneaux, B. J., Arlotta, P., et al.
(2013). Specification of cortical projection neurons. In J. Rubenstein & P. Rakic (Eds.),
Comprehensive developmental neuroscience: patterning and cell type specification in the developing
CNS and PNS (pp. 475–502). Amsterdam: Elsevier.
Magri, C., Piovani, G., Pilotta, A., Michele, T., Buzi, F., & Barlati, S. (2011). De novo dele-
tion of chromosome 2q24.2 region in a mentally retarded boy with muscular hypotonia.
European Journal of Medical Genetics, 54, 361–364.
Malatesta, P., Hack, M. A., Hartfuss, E., Kettenmann, H., Klinkert, W., Kirchhoff, F., et al.
(2003). Neuronal or glial progeny: Regional differences in radial glia fate. Neuron, 37,
751–764.
Mallamaci, A., & Stoykova, A. (2006). Gene networks controlling early cerebral cortex
arealization. The European Journal of Neuroscience, 23, 847–856.
Manzini, M. C., & Walsh, C. A. (2011). What disorders of cortical development tell us about
the cortex: One plus one does not always make two. Current Opinion in Genetics & Devel-
opment, 21, 333–339.
Marı́n, O., & Rubenstein, J. L. (2003). Cell migration in the forebrain. Annual Review of
Marin-Padilla, M. (1971). Early prenatal ontogenesis of the cerebral cortex (neocortex) of the
cat (Felis domestica). A Golgi study. I. The primordial neocortical organization.
Zeitschrift für Anatomie und Entwicklungsgeschichte, 134, 117–145.
Marin-Padilla, M. (1978). Dual origin of the mammalian neocortex and evolution of the cor-
tical plate. Anatomy and Embryology (Berlin), 152, 109–126.
Marı́n-Padilla, M. (1992). Ontogenesis of the pyramidal cell of the mammalian neocortex
and developmental cytoarchitectonics: A unifying theory. The Journal of Comparative Neu-
rology, 321, 223–240.
Markram, H., Toledo-Rodriguez, M., Wang, Y., Gupta, A., Silberberg, G., & Wu, C.
(2004). Interneurons of the neocortical inhibitory system. Nature Reviews Neuroscience,
5, 793–807.
Marshall, C. R., Noor, A., Vincent, J. B., Lionel, A. C., Feuk, L., Skaug, J., et al. (2008).
Structural variation of chromosomes in autism spectrum disorder. American Journal of
Human Genetics, 82, 477–488.
McKenna, W. L., Betancourt, J., Larkin, K. A., Abrams, B., Guo, C., Rubenstein, J. L., et al.
(2011). Tbr1 and Fezf2 regulate alternate corticofugal neuronal identities during neocor-
tical development. The Journal of Neuroscience, 31, 549–564.
Mefford, H. C., Muhle, H., Ostertag, P., von Spiczak, S., Buysse, K., Baker, C., et al. (2010).
Genome-wide copy number variation in epilepsy: Novel susceptibility loci in idiopathic
generalized and focal epilepsies. PLoS Genetics, 6, e1000962.
Michaelson, J. J., Shi, Y., Gujral, M., Zheng, H., Malhotra, D., Jin, X., et al. (2012). Whole-
genome sequencing in autism identifies hot spots for de novo germline mutation. Cell,
151, 1431–1442.
Miyata, T., Kawaguchi, A., Saito, K., Kawano, M., Muto, T., & Ogawa, M. (2004). Asym-
metric production of surface-dividing and non-surface-dividing cortical progenitor cells.
Development, 131, 3133–3145.
Miyoshi, G., Butt, S. J., Takebayashi, H., & Fishell, G. (2007). Physiologically distinct tem-
poral cohorts of cortical interneurons arise from telencephalic Olig2-expressing precur-
sors. The Journal of Neuroscience, 27, 7786–7798.
Miyoshi, G., & Fishell, G. (2011). GABAergic interneuron lineages selectively sort into spe-
cific cortical layers during early postnatal development. Cerebral Cortex, 21, 845–852.
Miyoshi, G., Hjerling-Leffler, J., Karayannis, T., Sousa, V. H., Butt, S. J., Battiste, J., et al.
(2010). Genetic fate mapping reveals that the caudal ganglionic eminence produces a
large and diverse population of superficial cortical interneurons. The Journal of Neurosci-
ence, 30, 1582–1594.
Molliver, M. E., Kostovic, I., & van der Loos, H. (1973). The development of synapses in
cerebral cortex of the human fetus. Brain Research, 50, 403–407.
Molyneaux, B., Arlotta, P., Hirata, T., Hibi, M., & Macklis, J. (2005). Fezl is required for the
birth and specification of corticospinal motor neurons. Neuron, 47, 817–831.
Molyneaux, B., Arlotta, P., Menezes, J., & Macklis, J. (2007). Neuronal subtype specification
in the cerebral cortex. Nature Reviews Neuroscience, 8, 427–437.
Monuki, E. S., & Walsh, C. A. (2001). Mechanisms of cerebral cortical patterning in mice
and humans. Nature Neuroscience, 4(Suppl.), 1199–1206.
Mountcastle, V. B. (1997). The columnar organization of the neocortex. Brain, 120(Pt. 4),
701–722.
Nadarajah, B., & Parnavelas, J. G. (2002). Modes of neuronal migration in the developing
cerebral cortex. Nature Reviews Neuroscience, 3, 423–432.
Nagae, L. M., Zarnow, D. M., Blaskey, L., Dell, J., Khan, S. Y., Qasmieh, S., et al. (2012).
Elevated mean diffusivity in the left hemisphere superior longitudinal fasciculus in autism
spectrum disorders increases with more profound language impairment. AJNR—
American Journal of Neuroradiology, 33, 1720–1725.
Nagai, T., Nishimura, G., Kato, R., Hasegawa, T., Ohashi, H., & Fukushima, Y. (1995).
Del(12)(p11.21p12.2) associated with an asphyxiating thoracic dystrophy or cho-
ndroectodermal dysplasia-like syndrome. American Journal of Medical Genetics, 55,
16–18.
202 Kenneth Y. Kwan
Nakashima, N., Yamagata, T., Mori, M., Kuwajima, M., Suwa, K., & Momoi, M. Y. (2010).
Expression analysis and mutation detection of DLX5 and DLX6 in autism. Brain & Develop-
ment, 32, 98–104.
Neale, B. M., Kou, Y., Liu, L., Ma’ayan, A., Samocha, K. E., Sabo, A., et al. (2012). Patterns
and rates of exonic de novo mutations in autism spectrum disorders. Nature, 485,
242–245.
Nieuwenhuys, R. (1994). The neocortex. An overview of its evolutionary development,
structural organization and synaptology. Anatomy and Embryology (Berlin), 190, 307–337.
Noctor, S. C., Martinez-Cerdeno, V., Ivic, L., & Kriegstein, A. R. (2004). Cortical neurons
arise in symmetric and asymmetric division zones and migrate through specific phases.
Nature Neuroscience, 7, 136–144.
Noctor, S. C., Martı́nez-Cerdeño, V., & Kriegstein, A. R. (2008). Distinct behaviors of neu-
ral stem and progenitor cells underlie cortical neurogenesis. The Journal of Comparative
Neurology, 508, 28–44.
Northcutt, R. G., & Kaas, J. H. (1995). The emergence and evolution of mammalian neo-
cortex. Trends in Neurosciences, 18, 373–379.
Oldham, M. C., Konopka, G., Iwamoto, K., Langfelder, P., Kato, T., Horvath, S., et al.
(2008). Functional organization of the transcriptome in human brain. Nature Neuroscience,
11, 1271–1282.
O’Leary, D. D., & Koester, S. E. (1993). Development of projection neuron types, axon
pathways, and patterned connections of the mammalian cortex. Neuron, 10, 991–1006.
O’Leary, D. D., & Sahara, S. (2008). Genetic regulation of arealization of the neocortex. Cur-
rent Opinion in Neurobiology, 18, 90–100.
tions. Nature Genetics, 43, 585–589.
mutations. Nature, 485, 246–250.
Palumbo, O., D’Agruma, L., Minenna, A. F., Palumbo, P., Stallone, R., Palladino, T., et al.
(2013). 3p14.1 de novo microdeletion involving the FOXP1 gene in an adult patient
with autism, severe speech delay and deficit of motor coordination. Gene, 516, 107–113.
Palumbo, O., Palumbo, P., Palladino, T., Stallone, R., Zelante, L., & Carella, M. (2012).
A novel deletion in 2q24.1q24.2 in a girl with mental retardation and generalized hypo-
tonia: A case report. Molecular Cytogenetics, 5, 1.
Peñagarikano, O., Abrahams, B. S., Herman, E. I., Winden, K. D., Gdalyahu, A., Dong, H.,
and core autism-related deficits. Cell, 147, 235–246.
Molecular Psychiatry, 6, 150–159.
Peters, A. (2010). The morphology of minicolumns. In G. Blatt (Ed.), The neurochemical basis
of autism (pp. 45–68). Berlin: Springer.
Polleux, F., Ince-Dunn, G., & Ghosh, A. (2007). Transcriptional regulation of vertebrate
axon guidance and synapse formation. Nature Reviews Neuroscience, 8, 331–340.
Prasad, A., Merico, D., Thiruvahindrapuram, B., Wei, J., Lionel, A. C., Sato, D., et al.
(2012). A discovery resource of rare copy number variations in individuals with autism
spectrum disorder. G3 (Bethesda), 2, 1665–1685.
Rakic, P. (1971). Guidance of neurons migrating to the fetal monkey neocortex. Brain
Research, 33, 471–476.
Rakic, P. (1974). Neurons in rhesus monkey visual cortex: Systematic relation between time
of origin and eventual disposition. Science, 183, 425–427.
Rakic, P. (1976). Prenatal genesis of connections subserving ocular dominance in the rhesus
monkey. Nature, 261, 467–471.
Rakic, P. (1988). Specification of cerebral cortical areas. Science, 241, 170–176.
Rakic, P. (1995). A small step for the cell, a giant leap for mankind: A hypothesis of neocor-
tical expansion during evolution. Trends in Neurosciences, 18, 383–388.
Rash, B., & Grove, E. (2006). Area and layer patterning in the developing cerebral cortex.
Current Opinion in Neurobiology, 16, 25–34.
Rauch, A., Wieczorek, D., Graf, E., Wieland, T., Endele, S., Schwarzmayr, T., et al. (2012).
Range of genetic mutations associated with severe non-syndromic sporadic intellectual
disability: An exome sequencing study. Lancet, 380, 1674–1682.
Rice, D., & Curran, T. (2001). Role of the reelin signaling pathway in central nervous system
development. Annual Review of Neuroscience, 24, 1005–1039.
Rosenfeld, J. A., Ballif, B. C., Lucas, A., Spence, E. J., Powell, C., Aylsworth, A. S., et al.
(2009). Small deletions of SATB2 cause some of the clinical features of the 2q33.1 micro-
deletion syndrome. PLoS One, 4, e6568.
Rosenfeld, J. A., Ballif, B. C., Torchia, B. S., Sahoo, T., Ravnan, J. B., Schultz, R., et al.
(2010). Copy number variations associated with autism spectrum disorders contribute to
a spectrum of neurodevelopmental disorders. Genetics in Medicine, 12, 694–702.
Rouaux, C., & Arlotta, P. (2013). Direct lineage reprogramming of post-mitotic callosal
neurons into corticofugal neurons in vivo. Nature Cell Biology, 15, 214–221.
Rubenstein, J. L. (2011). Annual research review: Development of the cerebral cortex:
Implications for neurodevelopmental disorders. Journal of Child Psychology and Psychiatry,
52, 339–355.
Rubenstein, J. L., & Merzenich, M. M. (2003). Model of autism: Increased ratio of
excitation/inhibition in key neural systems. Genes, Brain, and Behavior, 2, 255–267.
Saito, T., Hanai, S., Takashima, S., Nakagawa, E., Okazaki, S., Inoue, T., et al. (2011). Neo-
cortical layer formation of human developing brains and lissencephalies: Consideration
of layer-specific marker expression. Cerebral Cortex, 21, 588–596.
Sanders, S. J., Ercan-Sencicek, A. G., Hus, V., Luo, R., Murtha, M. T., Moreno-De-
Luca, D., et al. (2011). Multiple recurrent de novo CNVs, including duplications of
the 7q11.23 Williams syndrome region, are strongly associated with autism. Neuron,
70, 863–885.
Sanders, S. J., Murtha, M. T., Gupta, A. R., Murdoch, J. D., Raubeson, M. J., Willsey, A. J.,
et al. (2012). De novo mutations revealed by whole-exome sequencing are strongly asso-
ciated with autism. Nature, 485, 237–241.
Schaaf, C. P., Sabo, A., Sakai, Y., Crosby, J., Muzny, D., Hawes, A., et al. (2011). Oligogenic
heterozygosity in individuals with high-functioning autism spectrum disorders. Human
Molecular Genetics, 20, 3366–3375.
Schanze, I., Schanze, D., Bacino, C. A., Douzgou, S., Kerr, B., & Zenker, M. (2013).
Haploinsufficiency of SOX5, a member of the SOX (SRY-related HMG-box) family
of transcription factors is a cause of intellectual disability. European Journal of Medical
Genetics, 56, 108–113.
Strong association of de novo copy number mutations with autism. Science, 316,
445–449.
Serajee, F. J., Zhong, H., & Mahbubul Huq, A. H. (2006). Association of Reelin gene poly-
morphisms with autism. Genomics, 87, 75–83.
204 Kenneth Y. Kwan
Sessa, A., Mao, C. A., Colasante, G., Nini, A., Klein, W. H., & Broccoli, V. (2010). Tbr2-
positive intermediate (basal) neuronal progenitors safeguard cerebral cortex expansion by
controlling amplification of pallial glutamatergic neurons and attraction of subpallial
GABAergic interneurons. Genes & Development, 24, 1816–1826.
Shim, S., Kwan, K. Y., Li, M., Lefebvre, V., & Sestan, N. (2012). Cis-regulatory control of
corticospinal system development and evolution. Nature, 486, 74–79.
Shukla, D. K., Keehn, B., Lincoln, A. J., & Müller, R. A. (2010). White matter compromise
of callosal and subcortical fiber tracts in children with autism spectrum disorder:
A diffusion tensor imaging study. Journal of the American Academy of Child and Adolescent
Psychiatry, 49, 1269–1278, 1278.e1261–1278.e1262.
Skaar, D. A., Shao, Y., Haines, J. L., Stenger, J. E., Jaworski, J., Martin, E. R., et al. (2005).
Analysis of the RELN gene as a genetic risk factor for autism. Molecular Psychiatry, 10,
563–571.
Smoller, J. W., Craddock, N., Kendler, K., Lee, P. H., Neale, B. M., Nurnberger, J. I., et al.
(2013). Identification of risk loci with shared effects on five major psychiatric disorders:
A genome-wide analysis. Lancet, 381, 1371–1379.
Srinivasan, K., Leone, D. P., Bateson, R. K., Dobreva, G., Kohwi, Y., Kohwi-
Shigematsu, T., et al. (2012). A network of genetic repression and derepression specifies
projection fates in the developing neocortex. Proceedings of the National Academy of Sciences
of the United States of America, 109, 19071–19078.
State, M. W., & Šestan, N. (2012). Neuroscience. The emerging biology of autism spectrum
Strauss, K. A., Puffenberger, E. G., Huentelman, M. J., Gottlieb, S., Dobrin, S. E.,
Parod, J. M., et al. (2006). Recessive symptomatic focal epilepsy and mutant
contactin-associated protein-like 2. The New England Journal of Medicine, 354,
1370–1377.
Stumm, M., Klopocki, E., Gasiorek-Wiens, A., Knoll, U., Wirjadi, D., Sarioglu, N., et al.
(2007). Molecular cytogenetic characterisation of an interstitial deletion 12p detected by
prenatal diagnosis. Prenatal Diagnosis, 27, 475–478.
Sultana, R., Yu, C. E., Yu, J., Munson, J., Chen, D., Hua, W., et al. (2002). Identification of
a novel gene on chromosome 7q11.2 interrupted by a translocation breakpoint in a pair
of autistic twins. Genomics, 80, 129–134.
Sundaram, S. K., Kumar, A., Makki, M. I., Behen, M. E., Chugani, H. T., & Chugani, D. C.
(2008). Diffusion tensor imaging of frontal lobe in autism spectrum disorder. Cerebral
Cortex, 18, 2659–2665.
Tabata, H., Kanatani, S., & Nakajima, K. (2009). Differences of migratory behavior between
direct progeny of apical progenitors and basal progenitors in the developing cerebral cor-
tex. Cerebral Cortex, 19, 2092–2105.
Takatsuki, S., Nakamura, R., Haga, Y., Mitsui, K., Hashimoto, T., Shimojima, K., et al.
(2010). Severe pulmonary emphysema in a girl with interstitial deletion of
2q24.2q24.3 including ITGB6. American Journal of Medical Genetics Part A, 152A,
1020–1025.
Talkowski, M. E., Rosenfeld, J. A., Blumenthal, I., Pillalamarri, V., Chiang, C., Heilbut, A.,
et al. (2012). Sequencing chromosomal abnormalities reveals neurodevelopmental loci
that confer risk across diagnostic boundaries. Cell, 149, 525–537.
Tarabykin, V., Stoykova, A., Usman, N., & Gruss, P. (2001). Cortical upper layer neurons
derive from the subventricular zone as indicated by Svet1 gene expression. Development,
128, 1983–1993.
The Boulder Committee (1970). Embryonic vertebrate central nervous system: Revised ter-
minology. The Boulder Committee. The Anatomical Record, 166, 257–261.
Thornton, G. K., & Woods, C. G. (2009). Primary microcephaly: Do all roads lead to Rome?
Trends in Genetics, 25, 501–510.
Tissir, F., & Goffinet, A. M. (2003). Reelin and brain development. Nature Reviews Neuro-
science, 4, 496–505.
Traylor, R. N., Dobyns, W. B., Rosenfeld, J. A., Wheeler, P., Spence, J. E.,
Bandholz, A. M., et al. (2012). Investigation of TBR1 hemizygosity: Four individuals
with 2q24 microdeletions. Molecular Syndromology, 3, 102–112.
Uppal, N., & Hof, P. R. (2013). Discrete cortical neuropathology in autism spectrum dis-
orders. In J. D. Buxbaum (Ed.), The neuroscience of autism spectrum disorders (pp. 313–325).
San Diego: Academic Press.
Van Buggenhout, G., Van Ravenswaaij-Arts, C., Mc Maas, N., Thoelen, R., Vogels, A.,
Smeets, D., et al. (2005). The del(2)(q32.2q33) deletion syndrome defined by clinical and
molecular characterization of four patients. European Journal of Medical Genetics, 48,
276–289.
Valiente, M., & Marı́n, O. (2010). Neuronal migration mechanisms in development and
disease. Current Opinion in Neurobiology, 20, 68–78.
459, 528–533.
Wegiel, J., Kuchna, I., Nowicki, K., Imaki, H., Marchi, E., Ma, S. Y., et al. (2010). The
tic changes. Acta Neuropathologica, 119, 755–770.
Weinstein, M., Ben-Sira, L., Levy, Y., Zachor, D. A., Ben Itzhak, E., Artzi, M., et al. (2011).
Abnormal white matter integrity in young children with autism. Human Brain Mapping,
32, 534–543.
Weiss, L. A., Escayg, A., Kearney, J. A., Trudeau, M., MacDonald, B. T., Mori, M., et al.
(2003). Sodium channels SCN1A, SCN2A and SCN3A in familial autism. Molecular
Wolff, J. J., Gu, H., Gerig, G., Elison, J. T., Styner, M., Gouttard, S., et al. (2012). Differ-
ences in white matter fiber tract development present from 6 to 24 months in infants with
autism. The American Journal of Psychiatry, 169, 589–600.
Wonders, C. P., & Anderson, S. A. (2006). The origin and specification of cortical interneu-
rons. Nature Reviews Neuroscience, 7, 687–696.
Xu, Q., Cobos, I., De La Cruz, E., Rubenstein, J. L., & Anderson, S. A. (2004). Origins of
cortical interneuron subtypes. The Journal of Neuroscience, 24, 2612–2622.
Yokota, Y., Gashghaei, H. T., Han, C., Watson, H., Campbell, K. J., & Anton, E. S. (2007).
Radial glial dependent and independent dynamics of interneuronal migration in the
developing cerebral cortex. PLoS One, 2, e794.
Zhang, L., Song, N. N., Chen, J. Y., Huang, Y., Li, H., & Ding, Y. Q. (2011). Satb2 is
required for dendritic arborization and soma spacing in mouse cerebral cortex. Cerebral
Cortex, 22(7), 1510–1519.
CHAPTER SEVEN
Motor Skill in Autism Spectrum

Disorders: A Subcortical View
Leanne Chukoskie*,1, Jeanne Townsend†, Marissa Westerfield*
*Institute for Neural Computation, University of California, San Diego, California, USA
†
Department of Neurosciences, University of California, San Diego, California, USA
1
Corresponding author: e-mail address: lchukoskie@ucsd.edu
Contents
1. Why Study Motor Skill in Autism? 208
1.1 Motor skill as foundational in development 209
1.2 Early signs are motor 210
1.3 Correlation with social and communication skill 211
2. Overview of Motor Skill Deficits 212
2.1 Gross motor skills 212
2.2 Fine motor skills 215
2.3 Dyspraxia 216
2.4 Eye movements 217
3. Mapping Autism Motor Skill Findings into a Useful Framework 218
3.1 Cortico–subcortical loops for motor control 218
3.2 How do autism motor skill deficits fit in this framework? 225
4. Can We Intervene? 228
4.1 Motor skill training in rodents 230
4.2 Motor training for children with ASD? 232
4.3 Motor training for older adults with ASD? 233
5. Summary 234
References 235
Abstract
The earliest observable symptoms of autism spectrum disorders (ASDs) involve motor
behavior. There is a growing awareness of the developmental importance of impaired
motor function in ASD and its association with social skill. Compromised motor function
requires increased attention, leaving fewer resources available for processing environ-
mental stimuli and learning. This knowledge suggests that the motor system—which
we know to be trainable—may be a gateway to improving outcomes of individuals liv-
ing with ASD. In this review, we suggest a framework borrowed from machine learning
to examine where, why, and how motor skills are different in individuals with ASD.

http://dx.doi.org/10.1016/B978-0-12-418700-9.00007-1
208 Leanne Chukoskie et al.
1. WHY STUDY MOTOR SKILL IN AUTISM?

Autism is a behaviorally defined disorder characterized by deficits in
social engagement, atypical verbal and nonverbal communication, and a
focus on ritualized behaviors and restricted interests. Despite its absence
from diagnostic criteria, differences in motor skills in individuals with autism
spectrum disorder (ASD) have been observed from the earliest descriptions
of the disorder (Kanner, 1943).
In his landmark 1943 description of autism, Leo Kanner noted uneven
motor development, including clumsy gait and gross motor performance, in
a few of the 11 cases he described. Kanner also reported that many of the
mothers of these children noted with surprise that the infants failed to
“assume at any time an anticipatory posture preparatory to being picked
up” and even at 2 or 3 years of age failed to adjust their bodies to the posture
of the person holding them—something typical infants do by 3 or 4 months
of age (Kanner, 1943).
Hans Asperger reported motor clumsiness in all four of the case studies he
presented in his initial 1944 paper (Asperger & Frith, 1991). As did Kanner,
Asperger noted both gross and fine motor abnormalities; for example, he
remarked that “atrocious handwriting” (due to an inability to control the
pen) was a common trait in most autistic individuals. A more evocative
description of the flavor of motor impairments is found in observations of
a child known as “Harro L.”:
His movements never unfolded naturally and spontaneously. . .from the proper
co-ordination of the motor system as a whole. Instead, it seemed as if he could
only manage to move those muscular parts to which he directed a conscious effort
of will. (p. 57)
Asperger pointed out that when trying to understand the difficulty autistic
children had in learning practical, everyday skills, it was impossible to tease
apart motor clumsiness from lack of understanding and believed that the two
deficits were in fact linked.
As the ASDs are considered as part of a larger collection of neu-
rodevelopmental disorders, it might be expected that cooccurring neurolog-
ical symptoms are common and both eye and body movement deficits
would fall in this category. However, several studies suggest that motor skill
deficits may be central to our current conception of ASD (Fournier,
Hass, Naik, Lodha, & Cauraugh, 2010; Hilton, Zhang, Whilte, Klohr, &
Constantino, 2012; Mostofsky and Ewen, 2011). In ASD, the symptoms
Motor Skill in Autism Spectrum Disorders 209
frequently observed include motor skill delays, deficits, and atypical move-
ment patterns (Fournier, Hass, et al., 2010; Jansiewicz et al., 2006; Maski,
Jeste, & Spence, 2011). Children with ASD showed greater impairments
in motor skill on a standardized motor testing battery when compared to
children diagnosed with other neurodevelopmental disorders (Dewey,
Cantell, & Crawford, 2007). The children with autism were also the only
group to show impairments in gestural skills. An insightful recent study of
Hilton and Constantino (Hilton et al., 2012) examined the performance
of 83 sibling pairs, some concordant and some discordant for autism, using
a comprehensive and standardized motor skill battery and found that motor
performance was strongly correlated with the diagnostic status but not with
sibship. The authors argue that given the highly heritable nature of ASD,
this finding suggests that motor measures should factor into the diagnosis
of autism.
1.1. Motor skill as foundational in development

From early in development, children use both fine and gross motor skills to
indicate wants and needs. Bushnell and Boudreau (1993) summarized the
perspective that motor skills establish a developmental plan or “timetable”
for development in other domains. For example, gestures in infancy appear
to pave the way for later language use (Iverson & Goldin-Meadow, 2005).
A recent research suggests a model in which early motor exploratory behav-
ior, such as learning to reach, serves as a scaffold for later prosocial-looking
behaviors (Libertus & Needham, 2010). A case in point is a novel study of
motor control in young infants that demonstrated advanced development of
social skills in babies who wore “sticky mittens” that allowed them to grasp
and control objects that they could not otherwise reach or grasp (Libertus &
Needham, 2010). A large study of typical development found that better
motor function in early infancy was associated with better development
of language and nonverbal cognition at 2–3 years of age (van Batenburg-
Eddes, Henrichs et al., 2013). Further, a study of school readiness in typical
kindergarten children found that fine motor skills and attention were pre-
dictors of later academic achievement (Grissmer, Grimm, Aiyer,
Murrah, & Steele, 2010).
An evidence for the association of motor function and social and cogni-
tive development also comes from studies of developmental motor disor-
ders. A study of 122 toddlers with cerebral palsy found a strong
relationship between motor skills and social development (Whittingham,
Fahey, Rawicki, & Boyd, 2010). Taken together, these studies suggest that
one might consider atypical motor development as a critical factor in the
further development of symptoms that characterize autism in children aged
two and older.
1.2. Early signs are motor

By examining home movies for infants later diagnosed with ASD,
Teitelbaum and colleagues noted frequent atypical motor milestones in
addition to the occurrence of atypical mouth postures, lateral asymmetries,
and failures in the reflexive preparation to brace for a fall (Teitelbaum et al.,
2004; Teitelbaum, Teitelbaum, Nye, Fryman, & Maurer, 1998). Baranek
(1999) coded sensorimotor behaviors in videos of 9- to 12-month-old
infants in three groups: those who were later diagnosed with autism, those
later diagnosed with a developmental delay, and those with typical develop-
ment. Infants who were later diagnosed with autism exhibited a higher fre-
quency of unusual postures, atypical orienting, and object-directed
behaviors and atypical responses to the infant’s own name and social touch.
Some have questioned whether the differences observed from the retrospec-
tive video are more indicative of delays and not true deficits in ASD
(Ozonoff et al., 2008), but others have shown that atypical motor skill per-
sists through adolescence and adulthood (Glazebrook, Elliott, & Szatmari,
2008; Nazarali, Glazebrook, & Elliott, 2009; Perry, Minassian, Lopez,
Maron, & Lincoln, 2007; Travers, Powell, Klinger, & Klinger, 2013;
Weiss, Moran, Parker, & Foley, 2013). Hypotonia (51%), dyspraxia
(34%), and toe walking (19%) were the most common motor symptoms
found in a retrospective clinical neurological record review, with both
hypotonia and dyspraxia being more common early in development
(Ming, Brimacombe, & Wagner, 2007).
When researchers began to prospectively examine baby siblings of indi-
viduals with ASD in early infancy, who tend to be diagnosed with autism at a
higher rate than the general population (18.7% recurrence according to a
recent study; Ozonoff et al., 2011), the researchers noted that the very first
signs of atypical development were motor. In 2005, Zwaigenbaum and col-
leagues and others (Landa & Garrett-Mayer, 2006; Ozonoff et al., 2010;
Zwaigenbaum et al., 2005) reported early signs observable in baby siblings
who go on to develop autism. Deficits were observed in orienting behavior
including atypical eye contact, social smiles, visual tracking, and orienting to
the child’s own name and in the timing and disengagement of fixation. More
recently, Landa and colleagues (Flanagan, Landa, Bhat, & Bauman, 2012)
reported that 6-month-olds at high risk for ASD had more head lag when
pulled up to a seated position. Both Ozonoff et al. (2010) and Landa and
Garrett-Mayer (2006) observed an increasing trend toward atypicality
between the first and second year, with gross and fine motor differences
in the high-risk ASD siblings emerging in one study (Landa & Garrett-
Mayer, 2006) that measured them. High- and low-risk infants were not sta-
tistically distinguishable by motor skill differences at 6 months, but over
the following 8 months, low- and high-risk groups became more distinct.
At 24 months, the ASD-diagnosed group also differed in motor skill from
children who were diagnosed with language delay.
It also appears that early motor skill development is a strong predictor of
ASD outcome in later childhood. Sutera et al. (2007) reported that motor
skills at 2 years old were the best predictors of outcome in ASD at 8 years
old. This is an important research that needs further study, as there are very
few solid predictors of outcome in ASD.
1.3. Correlation with social and communication skill

Although poor motor coordination was a part of the original descriptions of
ASD, specific aspects of motor skill deficits and the implications of these def-
icits for cognitive and social function have only recently begun to receive
attention. Several studies have shown that the level of motor impairment
is correlated with the level of social impairment in individuals with ASD
(Dziuk et al., 2007; Haswell, Izawa, Dowell, Mostofsky, & Shadmehr,
2009; Hsu et al., 2004; Moruzzi, Ogliari, Ronald, Happe, & Battaglia,
2011). Communication delays were present in approximately 70% of the
siblings of individuals with ASD who also showed early motor delays
(Bhat, Galloway, & Landa, 2012). One could imagine how impaired early
motor development could derail the development of social communication
as the building blocks of joint attention include appropriately timed gesture
and gaze-following.
In addition, data showing the tightly bound interaction of attention and
motor function suggest that compromised motor function requires increased
attention, leaving fewer resources to process and learn (Cherng, Liang,
Chen, & Chen, 2009; Huang & Mercer, 2001; Laufer, Ashkenazi, &
Josman, 2008; Tsai, Pan, Cherng, & Wu, 2009). Despite the growing evi-
dence that underscores the importance of early motor behavior that scaffolds
later social skills in typical development (Libertus & Needham, 2011), this
remains an understudied domain in ASD and we are only beginning to

understand the possible origins of atypical motor behaviors in ASD
(Greffou et al., 2012; Haswell et al., 2009). The impact of motor perfor-
mance on attention has also been observed in other disorders such as devel-
opmental coordination disorder (DCD) (Laufer et al., 2008; Tsai et al., 2009)
and cerebral palsy (Reilly, van Donkelaar, Saavedra, & Woollacott, 2008).
2. OVERVIEW OF MOTOR SKILL DEFICITS

Generalized motor deficits are common in ASD, but we lack a body of
quantitative, model-driven studies yielding specific results tied to the mech-
anism. Clinical studies with a neurology focus have a rich history of using neu-
rological “soft signs” to assess motor skill deficits (Haas et al., 1996). Although
these tests have been quite useful for diagnostic purposes and have highlighted
the generalized motor deficits of individuals diagnosed with autism, they have
not been as useful for research studies aimed at quantifying types and levels of
motor impairment. For this purpose, normalized, comprehensive motor tests
permit motor skill evaluations in an age- and sex-specific manner. When tests
like these are used, they reveal that motor deficits in autism encompass gross
and fine, static and dynamic, and simple and complex. Note, however, that in
several studies, lower intellectual ability seems to be related to poorer motor
skill across many tasks (Mostofsky et al., 2006).
2.1. Gross motor skills

We review results of research suggesting deficits in three gross motor skills in
individuals with ASD. Although we have discussed results as generic to ASD,
there is a tremendous amount of heterogeneity in the presentation of the
disorder—motor skill included. Some researchers, notably Rinehart and col-
leagues, have made a point of noting larger gross motor deficits in individuals
with autism than in individuals with Asperger’s syndrome (Nayate et al.,
2012). But as others have not found differences between these groups
(Ghaziuddin & Butler, 1998; Ghaziuddin, Butler, Tsai, & Ghaziuddin,
1994; Jansiewicz et al., 2006; Manjiviona & Prior, 1995) and recent studies
question our ability to reliably distinguish between these diagnostic categories
(Lord et al., 2012), we will describe the results together. In fact, in the latest
version of the Diagnostic and Statistical Manual (V), Asperger’s syndrome is no
longer listed as a diagnosis (Association, A. P., 2013).
2.1.1 Balance
Balance deficits have been measured using scientific grade force plates across
a wide age range of individuals with ASD and normal intelligence (Chang,
Wade, Stoffregen, Hsu, & Pan, 2010; Fournier, Kimberg, et al., 2010;
Kohen-Raz, Volkmar, & Cohen, 1992; Minshew, Sung, Jones, &
Furman, 2004; Molloy, Dietrich, & Bhattacharya, 2003). In an early study
from Minshew et al. (2004), the impairments were most pronounced in con-
ditions that perturbed either visual (eyes closed or sway-referenced sur-
roundings) or somatosensory stimulation (sway-referenced platform).
Recently, Travers et al. (2013) demonstrated impaired balance in adoles-
cents and adults with ASD using the low-cost Wii Balance Board
(WBB), which has been favorably evaluated with respect to the scientific
grade force plate (Clark et al., 2010; Huurnink, Fransz, Kingma, & van
Dieen, 2013), had excellent test–retest reliability, and performed better than
the widely used Balance Error Scoring System (Chang, Levy, Seay, & Goble,
2013). Here too, individuals were found to have impaired balance under
“challenged” conditions, in this case while standing on one leg.
2.1.2 Gait
Static and dynamic balance skills are essential to functional gait performance.
Balance skill reflects sensorimotor status through the complex integration of
sensory feedback and coordinated motor responses to keep one’s center of mass
over the body’s base of support. Several studies of gait have reported atypical
gait in individuals with ASD. Qualitative evaluations have revealed a lack of
smoothness or overall coordination, atypical trunk and arm postures, or asym-
metrical gait (Esposito, Venuti, Apicella, & Muratori, 2011; Hallett et al., 1993;
Rinehart et al., 2006; Shetreat-Klein, Shinnar, & Rapin, 2012). Quantitative
evaluations have confirmed the lack of smoothness and irregular trunk move-
ments and in addition have shown significant differences in other spatial and
temporal gait parameters (Nobile et al., 2011; Vernazza-Martin et al., 2005;
Vilensky, Damasio, & Maurer, 1981; Weiss et al., 2013). While the specific gait
parameters identified as abnormal vary from study to study, shorter step/stride
length in ASD is a common finding. Atypical gait might result directly from
difficulties in balance (Lajoie, Teasdale, Bard, & Fleury, 1993), although hypo-
tonia may also play a role (Calhoun, Longworth, & Chester, 2011).
2.1.3 Reaching
There are relatively few studies of true reaching behavior in ASD; however,
several findings bear on reaching. Children with ASD appear to be slower in
performing anticipatory postural adjustments, such as one would make to grab

or let go of a heavy object (Schmitz, Martineau, Barthelemy, & Assaiante,
2003). Children with ASD also failed to anticipate making a hand movement
that was very predictable—a departure from what is observed in typical chil-
dren (Rinehart et al., 2006). However, the failure of this movement is likely in
the anticipation, not in the ability to execute the movement. Mon-Williams
and colleagues (van Swieten et al., 2010) showed that adolescents with ASD
performed a single hand-turning movement in a manner similar to their typ-
ically developing age-matched peers. The distribution of starting and ending
hand postures was normal in autism but very atypical in children with DCD.
Several studies suggest deficits in sequential reach planning for individuals
with ASD. Cattaneo and colleagues (Cattaneo et al., 2007) measured electro-
myography (EMG) responses of the mouth-opening muscle during a two-
step movement involving picking up a small item and placing it either in a
cup secured to the shoulder or in the mouth. A food item indicated that
the target was the mouth, and a small paper ball indicated that the movement
should be to the shoulder cup EMG. Typically developing children showed
EMG evidence of preparation for food arrival at the mouth at least 1 s in
advance of grasping the piece of food to move it to the mouth. Children with
ASD did not show any mouth-opening EMG activity until the food was
grasped. In a follow-up experiment (Fabbri-Destro, Cattaneo, Boria, &
Rizzolatti, 2009) that required children to pick up an object and then reach
to place it in either a small or large cup, children with ASD did not show evi-
dence in their first movement of the plan required for the second movement.
These studies illustrate a lack of integration of movements that compose a
sequence, and importantly most movements are not singular but executed
as part of a sequence.
Both the anecdotal reports and the few studies of arm movement
trajectory reveal variability in the movement itself (Glazebrook, Elliott, &
Lyons, 2006; Glazebrook, Gonzalez, Hansen, & Elliott, 2009; Mari,
Castiello, Marks, Marraffa, & Prior, 2003). This is interesting since reaching
movements are typically very repeatable both within and across subjects.
One suggestion for the degree of variability has been the injection of noisy
or biased sensory feedback into the movement. Several studies have asked
how vision and proprioception contribute to reaching in ASD.
Glazebrook et al. (2009) found longer duration and more variable
movements when vision was normal versus when it was occluded at the
launch of the movement, suggesting that visual guidance was somehow
problematic. Mari et al. (2003) showed differences in timing of a
reach-to-grasp movement that varied with intellectual ability in a sample of

20 children with ASD, with children who had the lowest IQ ranges also hav-
ing the slowest, almost parkinsonian movements. The control children were
matched for age, intellectual ability, and handedness, yet did not share the
variance in movement quality and timing observed in the ASD group.
Mostofsky and colleagues conducted a quantitative and theory-driven
examination of the contribution of sensory feedback to a learned arm move-
ment in a novel force field environment (Haswell et al., 2009). In this and a
follow-up study comparing children with ASD to children with attention-
deficit/hyperactivity disorder (ADHD) (Izawa et al., 2012), the investigators
examined how the newly learned contingencies transferred when the arm
position was shifted toward the right. The pattern of movement trajectories
observed in the transfer suggested a greater reliance on proprioceptive input
over visual input (Haswell et al., 2009). Compared to children with ADHD,
children with ASD showed a pattern of generalization suggesting a greater
reliance on proprioceptive input (Izawa et al., 2012). These results were inter-
preted as possibly resulting from local overconnectivity in cortex, which has
been reported by other groups (Belmonte et al., 2004; Muller et al., 2011).
2.2. Fine motor skills

Fine motor skills have been studied most often as a part of larger motor skill
batteries and have recently been the focus of a number of investigations.
A large study of 10- to 14-year-old children with ASD reported that 79%
of the children showed fine motor skill deficits as part of the Movement
Assessment Battery for Children (Green et al., 2009). One report found that
gross and fine motor skill deficits were roughly equivalent in children with
ASD (Provost, Heimerl, & Lopez, 2007). Grasping is an important early
motor skill for an infant exploring his or her world. At school age, items
to manipulate become smaller and handwriting becomes increasingly nec-
essary, demanding improved fine motor control.
In a recent study examining precision grip, the researchers examined
temporal execution of grip onset with respect to load onset and peak grip
force. Both ASD and developmentally delayed groups had developmental
trajectories between ages 2 and 6 that differed in comparison with typical
children on two measures of grip timing, but not force (David, Baranek,
Wiesen, Miao, & Thorpe, 2012). These results suggest that problems with
timing patterns of action affect fine motor control in addition to other timing
problems in gross motor patterns, such as gait.
Illegible handwriting was specifically noted by Hans Asperger in his initial

description of this disorder (Asperger & Frith, 1991). Fuentes and colleagues
led a study of handwriting in individuals with ASD quantifying this observa-
tion, especially noting deficits in letter form quality, and reporting the corre-
lation to overall motor performance (Fuentes, Mostofsky, & Bastian, 2009).
Handwriting is interesting in that it requires more than just fine motor skill
but also visual perceptual and visuomotor-integration skill together with pro-
prioception (Kushki, Chau, & Anagnostou, 2011). Since various researchers
have reported consistently poor visuomotor integration (Fulkerson &
Freeman, 1980; Mayes & Calhoun, 2003), it is not surprising that handwriting
skill is particularly weak in individuals with ASD.
2.3. Dyspraxia
The term dyspraxia (or apraxia for the more severe form) refers to difficulty
in organizing, planning, or executing skilled movement, which impairs
movement fluidity and speed, and importantly is out of proportion to
any underlying motor deficits. Not surprisingly, this has been difficult to
assess clearly in ASD because the contribution of “underlying motor def-
icits” remains to be concretely characterized. What is that “something
extra” that is dyspraxia? Several batteries have been used to measure
impairment with the “conceptualization” of the movement (Weimer,
Schatz, Lincoln, Ballantyne, & Trauner, 2001). These batteries typically
include subtests to assess spatial orientation, movement selection and
sequencing, imitation, spontaneous tool use, limb kinetics, and oral–facial
skills. These batteries emphasize learned, purposeful movements that are
often performed as a sequence, and it is perhaps the motor sequence, which
is “something extra.” Using one of these test batteries, Mostofsky and col-
leagues reported lower levels of simple motor skill in addition to dyspraxia
(Dowell, Mahone, & Mostofsky, 2009). This suggests that there may be
deficits in both simple motor skill and the “something extra” that is
dyspraxia. Oral–motor dyspraxia such as difficulty in imitating mouth
shapes and noises or spontaneously producing them by name is relatively
common, and perhaps, it includes the failure of the incredibly complex
machinery of the mouth and tongue to engage both sequentially and in
concert in order to produce comprehensible speech (Belmonte et al.,
2013; Larson & Mostofsky, 2008). It is intriguing to consider how a deeper
understanding of oral–motor praxis could be translated to interventions for
those that are minimally verbal.
2.4. Eye movements

Studies of eye movement behavior are somewhat more developed than
other studies of motor behavior in autism, with many studies of eye move-
ments and attention potentially indicating failures of motor planning. Most
studies have focused on the social aspect of looking behavior (see, e.g., Klin,
Jones, Schultz, Volkmar, & Cohen, 2002; McPartland, Webb, Keehn, &
Dawson, 2011) but have neglected details regarding saccade metrics and
timing. A few studies that explicitly examined eye movement metrics during
standard visually guided target tasks have found increased variability in trial-
to-trial amplitude in the saccades of individuals with ASD (Johnson et al.,
2012; Luna, Doll, Hegedus, Minshew, & Sweeney, 2007; Takarae,
Minshew, Luna, & Sweeney, 2004). Other studies examined disengagement
of attention in addition to eye movement metrics (Elsabbagh et al., 2009;
Kawakubo et al., 2007; Landry & Bryson, 2004; Zwaigenbaum et al.,
2005). Although this literature is mixed, many studies find a hypometria
in the primary saccade that is often compensated by secondary or “correc-
tive” saccades (Johnson et al., 2012; Takarae et al., 2004). Since the refrac-
tory period is at least 100 ms, this inaccuracy is problematic in terms of
gathering information from dynamic scenes. A recent eye tracking study
of a magician’s performance suggests that these differences may hamper
an ASD individual’s ability to successfully collect information from a
dynamic environment (Kuhn, Kourkoulou, & Leekam, 2010). Over the
course of development, the accumulation of missed information can lead
to deficits in social and communicative behaviors.
The goal of a smooth-pursuit eye movement is to match the position
and velocity of a typically small moving target. These eye movements are
interesting to examine as they require accurate sensory estimation of target
velocity and an accurate motor plan incorporating initially an internal
model-based estimate of target error and later the actual target error.
Takarae, Minshew, Luna, Krisky, and Sweeney (2004) measured smooth-
pursuit eye movements in individuals with ASD and found lower velocity
during the later “closed-loop” phase of smooth pursuit and also lower veloc-
ity during the initial “open-loop” phase and hypometria in the initial catch-
up saccade, but only for rightward step-ramp target trajectories moving away
from the fovea. The closed-loop velocity deficit was the most robust for
older individuals with ASD, suggesting some sort of developmental matu-
ration that fails to occur in individuals with ASD. Importantly, no differ-
ences were found in the latency to initiate either pursuit or saccade.
There are many ways to mark eye movement latency and doing so can be
difficult in atypical eye movements. Since pursuit and saccade latency deficits
were expected given the other pattern of deficits and saccade latency delays
were observed elsewhere, it would be useful to see a replication of this result.
3. MAPPING AUTISM MOTOR SKILL FINDINGS

INTO A USEFUL FRAMEWORK
The cerebellum and basal ganglia each have different local circuit
architectures and synaptic learning mechanisms (Doya, 1999, 2000) that
are specialized for different types of information processing. We might best
approach an understanding of subcortical motor processing in ASD by ask-
ing what each area is specialized to learn. Motor skill learning and perfor-
mance are, of course, the integrated product of activity in multiple
cortical and subcortical brain regions. However, recent models of motor skill
learning from Doya and Hikosaka (Hikosaka, Nakamura, Sakai, &
Nakahara, 2002) clarify the particular importance of the basal ganglia and
cerebellum in optimizing motor skills during learning. Here, we review
results that suggest differences in function and connectivity in the basal gang-
lia and the cerebellum as they relate to motor skill in autism and place them
in the context of a larger framework of motor skill learning.
3.1. Cortico–subcortical loops for motor control

The anatomy suggests that both basal ganglia and cerebellum serve both
motor and nonmotor functions (for a review, see Bostan, Dum, & Strick,
2013). Both basal ganglia and cerebellum, through their feedback architec-
tures, are likely involved in optimizing motor skills during learning
(Hikosaka et al., 2002). Each area has unique computations and neither area
acts in isolation—it is the joint actions of these subcortical components along
with their cortical targets that support motor skill learning and the perfor-
mance of dexterous motor skill.
In the following two sections, we will describe what current modeling
(Doya, 1999, 2000) and experimental results (Houk & Wise, 1995)
have determined to be the canonical computations occurring in the
corticocerebellar and cortico-basal ganglia loops. Although our focus here
remains on motor skill learning and production, the neuronal machinery
of each subcortical area is likely performing the same sort of computation
for nonmotor functions.
3.1.1 Corticocerebellar loops

The cerebellum is commonly thought of as a motor coordination and con-
trol structure, though detailed anatomical tracing studies have revealed a
repeating pattern of loops through associative brain areas, including parietal,
limbic, and prefrontal cortices (Bostan et al., 2013), and a host of imaging
studies suggest that it is involved in processes beyond motor control and
coordination including attention (Allen, Buxton, Wong, & Courchesne,
1997; Kellermann et al., 2012; Le, Pardo, & Hu, 1998), working memory
(Durisko & Fiez, 2010; Hautzel, Mottaghy, Specht, Muller, & Krause,
2009), spatial processing (Fink et al., 2000; Stoodley, Valera, &
Schmahmann, 2012), and language (Desmond & Fiez, 1998; Schlosser
et al., 1998; Xiang et al., 2003). Returning our focus to the motor aspects
of the cerebellum, connections with primary motor cortex (M1) are best
known. However, the region of the dentate cerebellar nucleus that repre-
sents the arm appears to project not only to M1 but also to the ventral
and dorsal subdivisions of premotor cortex and the supplementary motor
area. These findings suggest that an integrated map of the body is represented
within the motor domain of the dentate and its connections.
Doya (1999, 2000)’s framework applies machine learning concepts to
different brain areas’ computational contributions (see Fig. 7.1). In this
framework, the cerebellum is specialized for supervised learning as its
Figure 7.1 Regions of the brain with substantial contributions to motor skill and the
computations believed to be central to each region. Reproduced with permission from
Doya (2000).
canonical computation. The role of the cerebellum for motor skill is to

maintain an accurate internal model of the motor system. It does this by con-
tinually updating the current state of the motor system by comparing the
predicted sensory feedback from a motor command to the actual feedback.
The result of this comparison is an error signal, making this computation a
form of “supervised” learning.
3.1.2 Cerebellar findings in ASD

A comprehensive review of the cerebellum in terms of anatomy, physiology,
and contribution to behavior in ASD was recently published (Fatemi et al.,
2012) and can also be found in Chapter 1 of this volume by Becker and
Stoodley. Here, we will focus on atypical aspects of the cerebellum that
are likely to bear on motor skill learning and performance.
The most consistent findings are in the cerebellar hemispheres and ver-
mis. Autopsy studies have found reduced numbers of Purkinje cells in the
cerebellar vermis and hemispheres, with cerebellar anatomical abnormality
found in 21–25 of all 29 (72–86%) cases in which the cerebellum was exam-
ined by six independent lab groups (Bailey et al., 1998; Bauman & Kemper,
1994; Fehlow, Bernstein, Tennstedt, & Walther, 1993; Kemper & Bauman,
1998; Ritvo et al., 1986; Williams, Hauser, Purpura, DeLong, & Swisher,
1980; and reviewed in Bauman & Kemper, 2005). Purkinje cell loss in
autism is patchy, and the amount and distribution of loss across the cerebellar
hemispheres and vermis differ from individual to individual. Neural ectopias
in the inferior cerebellar peduncle and malformation of the inferior olives, a
crucial afferent structure of the cerebellum, have been found (Bailey et al.,
1998; Kemper & Bauman, 1998; Rodier, Ingram, Tisdale, Nelson, &
Romano, 1996).
Structural imaging studies of the cerebellum have repeatedly revealed
hypoplasia or underdevelopment of the cerebellar vermis. The first quanti-
tative MRI studies identified abnormally reduced size of cerebellar hemi-
spheres (Gaffney, Tsai, Kuperman, & Minchin, 1987; Murakami,
Courchesne, Press, Yeung-Courchesne, & Hesselink, 1989) and subregions
within the vermis in autistic children and adults (Courchesne, Hesselink,
Jernigan, & Yeung-Courchesne, 1987; Courchesne, Yeung-Courchesne,
Press, Hesselink, & Jernigan, 1988). Twelve additional studies with a total
of several hundred subjects from seven independent labs reported signifi-
cantly reduced size in one or another subregion of the vermis (Carper &
Courchesne, 2000; Ciesielski & Akshoomoff, 1990; Ciesielski, Harris,
Hart, & Pabst, 1997; Ciesielski & Knight, 1994; Courchesne et al., 2001,
1994; Hashimoto et al., 1995; Kates et al., 1998; Kaufmann et al., 2003;
Levitt et al., 1999; Saitoh, Courchesne, Egaas, Lincoln, & Schreibman,
1995; Zilbovicius et al., 1995) or hemispheres (Courchesne et al., 2001)
or in overall cerebellar gray matter (McAlonan et al., 2002). In some few
cases, cerebellar size reduction is so substantial as to be detected by visual
inspection (Miles & Hillman, 2000). Some studies have associated anatom-
ical abnormality with severity of symptoms (Ecker et al., 2012; O’Halloran,
Kinsella, & Storey, 2012). Functional imaging studies of the cerebellum
reveal an unfortunate mix of results—increases, decreases, and unchanged
activation in children with ASD. These discrepancies could emerge from
methodological differences, age-related differences between typical and
neurodevelopmentally delayed populations, and artifact-creating movement
during scanning (Brown & Jernigan, 2012). Looking at motor production
during a finger-tapping task that was designed to be cognitively simple,
thereby isolating movement, has revealed an increase in activity in the ipsi-
lateral anterior cerebellum along with cerebellar regions not typically rec-
ruited for finger tapping (Allen, Muller, & Courchesne, 2004). However,
during another finger-tapping task, Mostofsky and colleagues showed
decreased ipsilateral anterior cerebellar activity and increased supplementary
motor cortical activity in children with high-functioning autism (Mostofsky
et al., 2009).
3.1.3 Cortico-basal ganglia loops

The complexity of basal ganglia circuitry has impeded the progress of map-
ping information from anatomical descriptions to functional descriptions in
behaving animals, despite receiving decades of intense study. The striatum
(caudate and putamen) is the gateway to the basal ganglia, and it collects
information from all areas of the cortex and portions of the thalamus and
the amygdala. Striatal medium spiny neurons (MSNs) have two projection
patterns. The “direct” pathway is from the striatum to the internal segment
of the globus pallidus (GPi) and substantia nigra pars reticulata (SNr). In the
classic model of basal ganglia function, the direct pathway facilitates move-
ment by releasing tonic inhibition of the thalamus. The “indirect” pathway
is modulatory and has MSNs projecting to the external segment of the
globus pallidus (GPe) and the subthalamus, which in turn project back to
the GPi. In the classic model, the indirect pathway is thought to inhibit
movement. MSNs of both pathways receive dopaminergic modulatory
input from the substantia nigra pars compacta (SNc); however, the receptors
on direct and indirect pathway MSNs are different and are believed to be
primary to the different actions of the two pathways (Graybiel, Aosaki,

Flaherty, & Kimura, 1994).
The role of basal ganglia in its connections with the cortex appears to be
in selecting the correct action from many based on expected value (Balleine,
Delgado, & Hikosaka, 2007; Graybiel, 1995a, 1995b) through reinforce-
ment learning (see Fig. 7.1). Past experience with reward and costs associated
with different behaviors are maintained in the basal ganglia with dopamine
neurons contributing to a prediction of expected reward. In this view, the
role of the basal ganglia is to select the most appropriate (most rewarding)
movement for the current state and suppress all others for individual and
sequential movements. Current studies of basal ganglia contributions to
movement are more nuanced and focused on the early learning of coordi-
nating movement sequences and mapping action policies to changing move-
ment goals (Kravitz & Kreitzer, 2012; Shmuelof & Krakauer, 2011). Yet
another view suggests that the direct and indirect pathways, instead of facil-
itating and inhibiting movements, are better thought of as comparing the
benefits of a certain action plan (direct pathway) with the costs (indirect
pathway) (Hwang, 2013).
Reinforcement learning (see Fig. 7.1) is based on a calculation of error
between expectation and actual reward. Reward in this setting is an odd
concept because a successful movement can be considered to be rewarding
in and of itself (Shadmehr, Orban de Xivry, Xu-Wilson, & Shih, 2010).
However, recent eye movement data reveal that movements to more valued
targets tend to be faster (Shadmehr, 2010; Shadmehr et al., 2010). These data
offer a perspective that considers not only the rewarding aspects of each
movement but also the costs associated with each movement—in this case,
the costs associated with delaying reward. Although most examinations of
reinforcement learning concern a simple two-alternative forced-choice par-
adigm, reinforcement learning appears to be successful in guiding optimal
choice in a more complex environment, for example, in learning an “opti-
mal” habit (Desrochers, Jin, Goodman, & Graybiel, 2010; Sejnowski, 2010)
and in finding a hidden target with one’s eye movements (Chukoskie,
Snider, Mozer, Krauzlis, & Sejnowski, 2013).
Redgrave and colleagues have suggested a framework in which the basal
ganglia are considered in terms of specialization for “goal-directed” versus
“habitual” movement (Redgrave et al., 2010), with the dorsomedial basal
ganglia being goal-directed and the dorsolateral being habit-directed.
Goal-directed movements are flexible but slow to learn and require consid-
erable computation, whereas habitual movements are fast but inflexible.
Which system should be engaged for a given scenario? Daw, Niv, and Dayan
(2005) proposed a method for choosing which action system is the best by
minimizing the uncertainty of predictions produced by the goal or habit
systems.
3.1.4 Basal ganglia findings in ASD

The basal ganglia are hypothesized to be crucial for skill-based learning
(Hikosaka et al., 2002). Not surprisingly, given the motor deficits observed
in ASD, several researchers have specifically examined the basal ganglia for
differences that might explain the motor and other behaviors observed in
ASD. Vilensky and colleagues measured several aspects of gait in children
with autism (Vilensky et al., 1981) and noted that many atypical aspects
of gait were reminiscent of gait in Parkinson’s disease. Hence, these authors
and others suggested looking at the basal ganglia as a possible source of motor
dysfunction in autism. Several anatomical imaging studies have found that
the basal ganglia size relative to the rest of the brain or basal ganglia shape
is different in individuals with ASD (Ecker et al., 2012; Hollander et al.,
2005; Langen, Durston, Staal, Palmen, & van Engeland, 2007; Sears
et al., 1999). In addition, the shape of different right posterior putamen
and bilateral anterior putamen of the basal ganglia predicts aspects of motor
dysfunction in boys with ASD (Qiu, Adler, Crocetti, Miller, & Mostofsky,
2010). The right posterior putamen, which forms a circuit with right motor
cortex, is believed to be involved with sensory guidance for goal-directed
movements, while bilateral anterior putamen connects with bilateral
premotor regions and is involved with the selection and sequencing of
skilled movements.
Beyond the relative size and shape of the basal ganglia, the connections to
and from the basal ganglia may be atypical, leading to altered communica-
tion between this motor and reward region and various regions of the cor-
tex. The results have been heterogeneous, likely due to differing methods
and also different pathways examined. Atypical reward processing has been
studied using functional imaging, comparing responses due to social versus
monetary rewards (Scott-Van Zeeland, Dapretto, Ghahremani, Poldrack, &
Bookheimer, 2010). These authors found reduced ventral striatal responses
to both social and monetary rewards in children with ASD as compared to
typically developing children. In addition, ventral striatal activity was asso-
ciated with poorer social functioning.
Di Martino and colleagues examined resting-state functional connectiv-
ity in a large population of children with ASD compared with both
typically developing children and also typical adults (Di Martino et al.,
2011) and consistently found atypically increased resting-state connectivity
in children with ASD. Interestingly, a study of connectivity in children,
who had ASD, ADHD, or both, found that the children diagnosed with
both had dysfunctional striatal circuitry, but not the children diagnosed
with ASD alone (Di Martino et al., 2013). This result suggests that comor-
bid symptoms are likely contributing to the heterogeneity of responses
observed in ASD. Fractional anisotropy (FA) of white matter tracts con-
necting the putamen with the frontal cortex was lower in adults with
autism (Langen et al., 2012). Performance on a go/no-go task was corre-
lated with FA in this white matter tract, suggesting that the inhibitory con-
trol needed for a go/no-go task is at least partially mediated by this tract.
A recent report showed dramatically decreased task-based connectivity
from reward-related regions of the basal ganglia to the posterior superior
temporal sulcus, a region believed to be involved in speech sound percep-
tion (Abrams et al., 2013).
Both basal ganglia volume and connectivity measures have been com-
pared with motor performance, again with mixed findings. Hardan,
Kilpatrick, Keshavan, and Minshew (2003) examined motor performance
with the grooved pegboard task, grip strength, and finger tapping. The
authors aimed to compare motor deficits observed in ASD to basal ganglia
volume estimates, but found no volume differences between the children
with ASD and typically developing children. Takarae and colleagues
showed increased bilateral activation of frontostriatal circuitry during a visu-
ally guided saccade task (Takarae, Minshew, Luna, & Sweeney, 2007).
Mostofsky and colleagues (Qiu et al., 2010) reported that the shape of the
basal ganglia is predictive of motor dysfunction using the PANESS assess-
ment battery and also social and communication skills. A correlation
between repetitive behaviors and the volume of the right caudate and total
putamen was reported (Dichter, 2012; Estes et al., 2011; Hollander
et al., 2005).
3.1.5 The cerebellum and basal ganglia are reciprocally connected

The cerebellum and basal ganglia have multiple loops that appear to be sep-
arated for motor and associative functions. These different subcortical loops
specialize in different types of computation for the purpose of learning, and
both of these subcortical systems have been reported to be atypical in both
anatomical and functional studies. Until recently, it was believed that these
two important subcortical systems interacted only via cortical areas through
which they both looped. However, we now know that the basal ganglia and
the cerebellum are reciprocally connected through disynaptic subcortical
connections (Bostan et al., 2013). These newly identified pathways recipro-
cally connect motor and associative regions of the cerebellum and basal
ganglia. Importantly, connections between the basal ganglia and cerebellum
bring “reinforcement learning” machinery together with “supervised learn-
ing” machinery.
What benefits would such a connection bring? There is not a precise
answer to that question, but optimal control theory offers a useful perspec-
tive. Todorov and Jordan have argued that we make movements to reach a
more rewarding state (Todorov & Jordan, 2002). Optimal control theory
describes a formal way to link motor costs, expected rewards, noise from
sensory feedback, and internal models of a movement. In this framework,
the basal ganglia and cerebellum are both engaged in feedback loops to opti-
mize motor control. The basal ganglia calculate expected costs of motor
commands and expected rewards of sensory feedback, whereas the cerebel-
lum, through internal models, predicts the visual and proprioceptive feed-
back expected as a consequence of a particular motor command. Through
feedback, both of these areas contribute to the refinement of future motor
commands, which would be essential in learning a motor skill and especially
a sequence of motor skills.
3.2. How do autism motor skill deficits fit in this framework?

Using the breadth and depth of the literature on motor control in typical
individuals and macaque monkeys, we can begin to evaluate whether
motor skill differences observed in individuals with ASD are deficits at
some level of motor planning or execution or instead a compensation made
to accommodate the demands of an altered nervous system state
(Shadmehr & Krakauer, 2008). For example, patients with acquired cere-
bellar damage may reach slowly as a learned response to an inability to pre-
dict sensory consequences of movements, and this inability is magnified in
an attempt to control fast movements. For a neurodevelopmental disorder
such as ASD, the problem is likely even more complex, because the system
adapts to new abilities that come on line during development as would be
expected, but it is also compensating for deficits or inabilities that arise in
the system as new movement behaviors are learned. Here, we consider the
computations of the cerebellum and basal ganglia in terms of the motor skill
deficits observed in ASD.
3.2.1 Is there a problem with the “supervised learning” circuitry

of the cerebellum? (Fig. 7.1)
Certainly, this could be the case as the major output neurons—the Purkinje
cells—are the leading cited anatomical finding in postmortem histological
analyses, a finding that has been echoed in animal models of autism
symptomology including maternal immune activation (Shi et al., 2009)
and Tsc1 TSC1 (Tsai et al., 2012) and Gabrb3 knockout mice (DeLorey,
Sahbaie, Hashemi, Homanics, & Clark, 2008).
The cerebellum has been generalized as the site for prediction and prep-
aration for coordinating motor action, but not only for movement. Cer-
tainly, many of the motor results observed in autism can generally be
categorized as a deficit in preparation or prediction for a movement plan.
Note that we would not expect a complete failure in preparation or predic-
tion because other areas of the motor system compensate for congenital or
acquired deficits of the cerebellum. Perhaps, a deficit in the circuitry, which
calculates and makes the motor error comparison, could produce this pattern
of deficits. Variability in either the target representation or the copy of the
motor command (corollary discharge) would result in a noisy error signal
(Kording & Wolpert, 2006).
Pursuit eye movement experiments have indicated that a “closed-loop”
or “feedback-involved” velocity deficit suggests either cerebellar or long-
range cortical pathology in individuals with ASD. The middle temporal
(area MT) and middle superior temporal (area MST) cortical areas contrib-
ute to the pursuit process with area MST combining the extraretinal infor-
mation about eye movement with pure sensory information about motion
(Chukoskie & Movshon, 2009). The role of the cerebellum in delivering
precise feedback and controlling movement variability also makes it relevant
to the saccade timing and metrical differences observed in individuals with
ASD (Luna et al., 2007; Nowinski, Minshew, Luna, Takarae, & Sweeney,
2005; Takarae et al., 2004). In fact, fMRI activation of the oculomotor ver-
mis was reduced in individuals with ASD compared to typically developing
individuals during a saccade task (Takarae et al., 2007).
Adaptation is perhaps the classic cerebellar task. The internal model of
the relevant effector system (arm, leg, eye, etc.) must be altered to accom-
modate the ongoing changes in that movement effector system throughout
the life of the organism. Adaptation experiments were designed to under-
stand the motor learning that must accompany an ever-changing motor sys-
tem. If the cerebellum is affected as we expect in ASD, then we would
anticipate deficits in adaptation. In a study using both a ball-throwing task
with prism goggles and a novel-reaching task with forces imposed via a
robotic arm (Gidley Larson, Bastian, Donchin, Shadmehr, & Mostofsky,
2008), children with ASD learned quickly and exhibited typical aftereffects,
suggesting that a failure to update the internal model is not the source of
motor skill deficits in autism. However, recent data suggest that this is indeed
an area of concern in individuals with ASD, at least where eye movements
are concerned. In a recent saccade adaptation experiments in individuals
with ASD (Mosconi et al., 2013), approximately 30% of the subjects with
ASD did not adapt at all (compared with 6% of control subjects). Those indi-
viduals with ASD who did adapt did so more slowly and also showed
increased trial-to-trial variability in saccade amplitudes. Another recent sac-
cade adaptation experiment revealed similar results but notably also exam-
ined adaptation of children with Asperger’s syndrome ( Johnson, Rinehart,
White, Millist, & Fielding, 2013). The authors found weaker adaptation in
children with autism and Asperger’s syndrome compared to typically devel-
oped children. These results indicate deficits in the learning mechanisms of
the oculomotor vermis; however, the increased amplitude variability could
result in “noisy” information feeding into the calculated error signal
(Havermann & Lappe, 2010).
3.2.2 Is the basal ganglia “reinforcement learning circuitry” different

in ASD?
If one role of the basal ganglia is to help select the best action for the situation
in a timely manner, then the slow movements and difficulty with creating
movement sequences suggest that we should look further at the basal ganglia.
Basic motor deficits, such as in initiation and accuracy, can lead to poor or
absent reinforcement. In addition, what is rewarding in autism is quite likely
to be different than in typical development, and this may factor into how
individuals with ASD move. Targets that are valued differently by the actor
elicit different movements, in terms of latencies, movement speed, and accu-
racy. Motivation also impacts response vigor purportedly through tonic
dopamine levels (Niv, Daw, Joel, & Dayan, 2007). Although we do not
yet have the data in autism, the framework for comparison exists. Specifi-
cally, with respect to saccades, a thorough analysis of the main
sequence—the relationship between movement amplitude and velocity—
appears to be modified by one’s willingness to wait for the target reward
(Shadmehr et al., 2010). For example, the inclination to discount reward
over time is increased for young children—they would prefer to have
one marshmallow now versus two in a few minutes. The higher temporal
discount rate for children nicely matches their faster saccades for any given
amplitude. Similar data exist for individuals with schizophrenia (who also
have a higher temporal discount rate (Shadmehr et al., 2010). However,
we still lack data that span a range of directions and amplitudes in a matched
sample of individuals with ASD and typically developed individuals.
Some regions of the basal ganglia are more specialized for “goals” versus
“habits” (Redgrave et al., 2010). By examining the activity of particular
regions of the basal ganglia with respect to each other, one might learn
whether individuals with ASD have a biased use of basal ganglia circuitry,
for example, they may be more goal-directed in their actions versus habitual.
Referring back to Daw and colleagues’ perspective on using uncertainty to
choose which action system to use (Daw et al., 2005), it is possible that goal-
directed or habitual actions might be noisier in individuals with ASD, bias-
ing the choice toward the more reliable system.
3.2.3 Functional connectivity, including in cortex, likely impacts motor

skill in ASD
Modern perspectives on autism (Abrahams & Geschwind, 2010;
Geschwind & Levitt, 2007) along with both diffusion tensor imaging
(Ameis et al., 2011; Shukla, Keehn, & Muller, 2010; Wolff et al., 2012)
and postmortem anatomy (Zikopoulos & Barbas, 2010) data hold that
intercortical connectivity is atypical in ASD. This result has myriad impli-
cations for motor planning, not the least of which is the feedback of sensory
information to inform planning of future motor commands. We know from
many reports that sensory perception is atypical in many individuals with
ASD, though this too suffers from a lack of quantification in most studies.
Whether this also means that the neural representation of a sensory event
in terms of location and timing is atypical remains an open question, but
if it does, it would also impact the quality of motor skill.
4. CAN WE INTERVENE?
What happens in the brain during motor skill learning? This question
can be asked at many levels, including synaptic and subsynaptic, functional
motor maps and activity, and at a range of temporal scales. Figure 7.2 rep-
resents a summary of motor skill training effects modifying the efficacy of
synapses in the cerebellum and basal ganglia based on animal research
findings.
A
Climbing
Parallel fibers
fiber
Purkinje cells
B
Pyramidal cells
Cortex
Striatum
MSNs
Interneuron
Figure 7.2 (A) Summary of acrobatic motor skill training-induced plasticity in the cerebel-
lum. Yellow stars indicate putative sites for training-induced synaptic strengthening. Par-
allel fiber (red) to Purkinje cell (blue) synapses were significantly increased, while climbing
fiber (yellow) synapses showed a trend toward increasing. (B) Stars indicate putative sites of
training-induced plasticity in the basal ganglia. Medium spiny neurons of the direct (green)
and indirect (blue) pathways are depicted along with descending input from cortical pyra-
midal cells (black, purple) and striatal interneurons (yellow). Adapted with permission from
Kreitzer and Malenka (2008).
Two models of motor skill learning propose interactions between two

cortical–subcortical circuits, but these models differ in the specialty of those
two loops (for a review, see Dayan & Cohen, 2011). Hikosaka et al. (2002)
described a framework for interpreting which areas are involved in sequen-
tial motor skill learning. The authors propose two parallel loops specialized
for learning spatial and motor features of sequences. In this model, the two
loops are connected through premotor and supplementary cortical areas, and
the “spatial coordinate” loop involves associative frontoparietal cortices
connecting with associative regions of the striatum and cerebellum. The
“motor coordinate” loop connects primary and sensorimotor cortices with
the motor regions of the striatum and cerebellum. Functionally, the spatial
coordinate loop is faster but requires more attention and executive function
resources. The motor coordinate loop can be considered more habitual in
that learning is slow and implicit but once learned, attentional load is
low. This framework and that of Redgrave may create useful links by relat-
ing goals and spatial coordinate loops on one hand and habits and motor
coordinate loops on the other (Redgrave et al., 2010). Doyon and colleagues
(Doyon, Penhune, & Ungerleider, 2003) also proposed a two-loop model
with interactions between them essential for motor skill learning. However,
in this model, fast learning demanded both loops through the cortex, stria-
tum, and thalamus as well as cortex, cerebellum, and thalamus. More recent
data demonstrating disynaptic connections between the cerebellum and
basal ganglia (Bostan et al., 2013) could provide further insight into the
motor learning-related activity of these loops.
4.1. Motor skill training in rodents

Motor training works by reorganizing brain connectivity. Animal research
has revealed several neural mechanisms that underlie behavioral improve-
ments that result from motor training. Studies of forelimb-reaching training
in rats, which takes place over only 10–14 days, create an expansion of the
forelimb region in primary motor cortex (Greenough, Larson, & Withers,
1985), and it is known how the motor map plasticity induced by this training
is regulated (Conner, Culberson, Packowski, Chiba, & Tuszynski, 2003). At
a finer level of detail, researchers have studied the changes in dendritic spine
movement and contact as training progresses (Fu, Yu, Lu, & Zuo, 2012).
Greenough and colleagues (Black, Isaacs, Anderson, Alcantara, &
Greenough, 1990) have observed synaptogenesis in the cerebellum, at the
level of rat Purkinje cells (see Fig. 7.2A) after “acrobatic” training, involving
whole-body balance coordination to navigate obstacles. Synaptogenesis was

observed in contrast to increased cerebellar vascularization in the para-
median lobule when the rats ran with no special coordination or balance
corrections for the same amount of time as the acrobatic training. A later
study showed that the increase in molecular layer volume after acrobatic
training was due to a change in the parallel fiber (PF) synapses onto Purkinje
cells (Kleim et al., 1998). Climbing fibers (CFs) have a large physiological
effect on Purkinje cell response in experiments comparing CF versus PF
stimulation. In the acrobatic rat study, CF-Purkinje cell synapses showed
a trend toward an increase in number but did not increase significantly in
the Kleim et al.’s study. The cerebellar synaptogenesis effects were observed
in typical young adult rats; however, the training effects are also observed in
animals, which experienced early life brain damage. Both the behavioral and
cellular changes were observed in rats with a cerebellar deficit resulting from
perinatal alcohol exposure (Klintsova et al., 1998, 2002). Recent studies
have also detailed the emergence of PF multisynapse boutons contacting
Purkinje cell spines as a result of motor training (Lee et al., 2013).
Naviaux et al. (2013) recently showed that antipurinergic therapy in
young maternal immune activation mice appeared to prevent the dramatic
Purkinje cell loss typically observed in that animal model. The idea of inter-
vention to prevent the development of further dysfunction suggests consid-
eration of optimal time windows for certain motor interventions. However,
it is also worth noting that balance skill training in elderly people is effective
at preventing falls (Clemson et al., 2012; Granacher, Gollhofer, Hortobagyi,
Kressig, & Muehlbauer, 2013; Sherrington, Tiedemann, Fairhall, Close, &
Lord, 2011), demonstrating clearly that motor plasticity continues into
later life.
Our understanding of how motor learning engages plasticity in the basal
ganglia has expanded substantially in the past decade, but many questions still
remain. Disruptions of long-term potentiation, by blocking NMDA recep-
tors from cortical projections onto MSNs of the dorsomedial striatum, also
impair goal-directed learning (Yin, Knowlton, & Balleine, 2005). Blocking
dopamine receptors in the direct pathway (D1 receptors) in the dorsomedial
striatum decreases reward-dependent learning in a saccadic eye movement
task (Nakamura & Hikosaka, 2006). Rodent models of Parkinson’s disease
have also suggested that long-term depression at indirect pathway synapses is
essential for normal movement (Kreitzer & Malenka, 2007). Kreitzer and
Malenka (2008) reviewed the literature and indicated sites of likely plasticity
given our understanding of the connectivity between cortex and striatum
and between direct and indirect pathway MSNs (see Fig. 7.2B). These phys-
iological measures of synaptic plasticity echo the structural changes reported
in the cerebellum and motor cortex during acrobatic training. This is still a
rather active area of research in which the recent development of
optogenetic techniques applied to the basal ganglia (Kravitz et al., 2010)
is especially promising for unifying our understanding of the changes motor
learning creates across different brain regions.
4.2. Motor training for children with ASD?

The insidious aspect of motor skill failure is that it feeds upon itself. Those
with less motor skill are less likely to move and therefore less likely to
develop improved motor skill. In a culture saturated with the performance
of elite athletes who train year-round to maintain their status as such, it seems
hardly necessary to make the point that training improves motor skill. How-
ever, one might rightly question whether motor training will be similarly
successful in individuals with ASD and whether training can alter the specific
differences observed in, for example, a proprioceptive bias in an internal
model for reaching behavior (Haswell et al., 2009).
To answer this question, we consider two points. First, one of the widely
used and successful early interventions for ASD is known as DIR/Floortime
(Greenspan et al., 2008). This, in addition to sensorimotor integration ther-
apy, has been used by occupational therapists for children with ASD (Baranek,
2002). One of the aims of these interventions is to help the child plan appro-
priate movements that assist his or her engagement with the surrounding envi-
ronment. Second, although we found no published studies of balance training
for individuals with ASD, balance training, using the WBB and games,
has been successful for individuals with Down’s syndrome (Berg, Becker,
Martian, Primrose, & Wingen, 2012; Wuang, Chiang, Su, & Wang, 2011)
and largely successful for individuals with cerebral palsy (Deutsch, Borbely,
Filler, Huhn, & Guarrera-Bowlby, 2008; Shih, Shih, & Chu, 2010).
Ramstrand and colleagues (Ramstrand & Lygnegard, 2012) failed to find bal-
ance improvements in children with cerebral palsy after WBB training,
while Jelsma and colleagues ( Jelsma, Pronk, Ferguson, & Jelsma-Smit,
2013) found improvements in balance but not in other markers of fitness such
as speed of running, agility, or time to go up and down stairs in this population.
A recent study of children with degenerative ataxia found significant improve-
ment in dynamic balance following training with Kinect Xbox games
(Ilg et al., 2012).
Training motor skills may have additional benefits beyond those specific
to motor function. Recent findings in typically developing infants show that
early infant milestones such as learning to reach are foundational for later
social skill components such as social gaze preference (Libertus &
Needham, 2011). Coordination and speed of movement correlate positively
with cognitive measures in typical preschool aged boys and girls (Planinsec,
2002). Studies of DCD, in which there is substantial overlap with ASD
(Kopp, Beckung, & Gillberg, 2010; Piek & Dyck, 2004), show poorer social
skills in individuals with greater motor deficits. A recent paper also reveals
that poorer balance skills are associated with increased repetitive behaviors
(Radonovich, Fournier, & Hass, 2013). These data suggest that training-
induced improvements in a foundational motor skill, such as balance, might
have positive effects on other autism symptoms.
4.3. Motor training for older adults with ASD?

ASD is a relatively “modern” disorder; the children first described by Kanner
and Asperger would be turning 80 this year. There is as yet little published
research focused specifically on older adults with ASD; other than the data
suggesting a higher mortality rate (Bilder et al., 2013; Gillberg, Billstedt,
Sundh, & Gillberg, 2010; Shavelle, Strauss, & Pickett, 2001), recent papers
have primarily highlighted the lack of knowledge in this area (Happe &
Charlton, 2012; Janicki, Henderson, & Rubin, 2008; Mukaetova-
Ladinska, Perry, Baron, & Povey, 2012; Piven & Rabins, 2011). There
may be abnormal age-related structural changes in adults with ASD
(Murphy, Beecham, Craig, & Ecker, 2011), but even if the developmental
trajectory in ASD does not differ from that of typical older adults, ASD-
related motor deficits should be of special concern. Balance skill and muscle
strength degrade in the elderly, leading to an increased risk of falls. The Cen-
ters for Disease Control and Prevention reports that falls are the leading cause
of injury among adults 65 and older and projects that the total direct and
indirect cost of fall injuries among the elderly is expected to reach $55.9 bil-
lion in 2020 (Older Adult Falls Data & Hallgato, Gyori-Dani, Pekar,
Janacsek, & Nemeth, 2013). Motor systems that are already compromised
are likely to be more susceptible to age-related degradation, and given
the increasing rates of autism, this could be a major public health concern.
Interventions targeting balance and core and lower-limb strength in typical
elderly have shown to be effective at reducing the risk of falls (Clemson et al.,
2012; Granacher et al., 2013; Sherrington et al., 2011). As the ASD
population ages, with intrinsically less balance skill, we should expect an

increasing incidence of falls unless interventions specifically target a change
in motor competence.
5. SUMMARY
This review of data on motor skills with anatomical and connectivity
differences in individuals with ASD places us in a position to consider what
questions, if answered, would take us to the next step in understanding the
motor skill in ASD. The questions in Box 7.1 are the proverbial tip of the
iceberg, but attempting to answer them will take us to the next stage of our
understanding.
Despite the increased interest in motor skills in autism, most of the
reports described earlier contain primarily descriptive data. If we are to
use motor skill differences to understand more about the nervous system
in autism, we need more quantitative and computational characterizations
of the motor control differences in individuals with ASD. In this review,
we have examined the data from the perspective of subcortical motor
centers—the cerebellum and basal ganglia and their cortical loops—as a
starting point for understanding the acquisition and performance of skilled
movements in ASD. We have also pointed to areas of movement research
in typically developing individuals that might be beneficial to consider for
understanding motor skill in ASD. By thinking about the types of compu-
tational roles performed by the different motor regions, we can design
future motor skill experiments that probe these roles explicitly and,
through greater understanding of motor skill deficits, design effective
interventions.
BOX 7.1 Open questions about motor skill in individuals with ASD
What does the developmental trajectory of motor skill look like in ASD?
Where are the delays?
Where are the deficits?
How reliable is the sensory and corollary discharge feedback in
individuals ASD?
Is there a bias for goal-directed or habitual movements in individuals
with ASD?
What differences exist in terms of motor costs and sensory rewards in ASD
compared with typical development?
REFERENCES
Abrahams, B. S., & Geschwind, D. H. (2010). Connecting genes to brain in the autism spec-
trum disorders. Archives of Neurology, 67(4), 395–399. http://dx.doi.org/10.1001/
archneurol.2010.47.
Abrams, D. A., Lynch, C. J., Cheng, K. M., Phillips, J., Supekar, K., Ryali, S., et al. (2013).
Underconnectivity between voice-selective cortex and reward circuitry in children with
autism. Proceedings of the National Academy of Sciences of the United States of America, 110(29),
12060–12065. http://dx.doi.org/10.1073/pnas.1302982110.
Allen, G., Buxton, R. B., Wong, E. C., & Courchesne, E. (1997). Attentional activation of
the cerebellum independent of motor involvement. Science, 275(5308), 1940–1943.
Allen, G., Muller, R. A., & Courchesne, E. (2004). Cerebellar function in autism: Functional
magnetic resonance image activation during a simple motor task. Biological Psychiatry,
56(4), 269–278. http://dx.doi.org/10.1016/j.biopsych.2004.06.005.
Ameis, S. H., Fan, J., Rockel, C., Voineskos, A. N., Lobaugh, N. J., Soorya, L., et al. (2011).
Impaired structural connectivity of socio-emotional circuits in autism spectrum disor-
ders: A diffusion tensor imaging study. PLoS One, 6(11), e28044. http://dx.doi.org/
10.1371/journal.pone.0028044.
Asperger, H., & Frith, U. T. (1991). ‘Autistic psychopathology’ in childhood. In U. Frith
(Ed.), Autism and Asperger syndrome (pp. 37–92). New York, NY: Cambridge
University Press.
Association, A. P. (2013). Diagnostic and statistical manual of mental health disorders: DSM-5 (5th
ed.). Washington, DC: American Psychiatric Publishing.
A clinicopathological study of autism. Brain, 121(5), 889–905.
Balleine, B. W., Delgado, M. R., & Hikosaka, O. (2007). The role of the dorsal striatum in
reward and decision-making. The Journal of Neuroscience, 27(31), 8161–8165. http://dx.
doi.org/10.1523/JNEUROSCI.1554-07.2007.
Baranek, G. T. (1999). Autism during infancy: A retrospective video analysis of sensory-
motor and social behaviors at 9-12 months of age. Journal of Autism and Developmental
Disorders, 29(3), 213–224.
Baranek, G. T. (2002). Efficacy of sensory and motor interventions for children with autism.
Bauman, M. L., & Kemper, T. L. (1994). Neuroanatomic observations of the brain in autism.
In M. L. Bauman & T. L. Kemper (Eds.), The neurobiology of autism (pp. 119–145).
Baltimore: John Hopkins University Press.
Bauman, M. L., & Kemper, T. L. (2005). Neuroanatomic observations of the brain in autism:
A review and future directions. International Journal of Developmental Neuroscience, 23(2–3),
183–187. http://dx.doi.org/10.1016/j.ijdevneu.2004.09.006.
Belmonte, M. K., Allen, G., Beckel-Mitchener, A., Boulanger, L. M., Carper, R. A., &
Webb, S. J. (2004). Autism and abnormal development of brain connectivity. The Journal
of Neuroscience, 24(42), 9228–9231. http://dx.doi.org/10.1523/JNEUROSCI.3340-
04.2004.
Belmonte, M. K., Saxena-Chandhok, T., Cherian, R., Muneer, R., George, L., &
Karanth, P. (2013). Oral motor deficits in speech-impaired children with autism. Frontiers
in Integrative Neuroscience, 7, 47. http://dx.doi.org/10.3389/fnint.2013.00047.
Berg, P., Becker, T., Martian, A., Primrose, K. D., & Wingen, J. (2012). Motor control out-
comes following Nintendo Wii use by a child with Down syndrome. Pediatric Physical
Therapy, 24(1), 78–84. http://dx.doi.org/10.1097/PEP.0b013e31823e05e6.
Bhat, A. N., Galloway, J. C., & Landa, R. J. (2012). Relation between early motor delay and
later communication delay in infants at risk for autism. Infant Behavior & Development,
35(4), 838–846. http://dx.doi.org/10.1016/j.infbeh.2012.07.019.
Bilder, D., Botts, E. L., Smith, K. R., Pimentel, R., Farley, M., Viskochil, J., et al. (2013).
Excess mortality and causes of death in autism spectrum disorders: A follow up of the
1980s Utah/UCLA autism epidemiologic study. Journal of Autism and Developmental Dis-
orders, 43(5), 1196–1204. http://dx.doi.org/10.1007/s10803-012-1664-z.
Black, J. E., Isaacs, K. R., Anderson, B. J., Alcantara, A. A., & Greenough, W. T. (1990).
Learning causes synaptogenesis, whereas motor activity causes angiogenesis, in cerebellar
cortex of adult rats. Proceedings of the National Academy of Sciences of the United States of
America, 87(14), 5568–5572.
Bostan, A. C., Dum, R. P., & Strick, P. L. (2013). Cerebellar networks with the cerebral
cortex and basal ganglia. Trends in Cognitive Sciences, 17(5), 241–254. http://dx.doi.
org/10.1016/j.tics.2013.03.003.
Brown, T. T., & Jernigan, T. L. (2012). Brain development during the preschool years. Neu-
ropsychology Review, 22(4), 313–333. http://dx.doi.org/10.1007/s11065-012-9214-1.
Bushnell, E. W., & Boudreau, J. P. (1993). Motor development and the mind: The potential
role of motor abilities as a determinant of aspects of perceptual development. Child Devel-
opment, 64(4), 1005–1021.
Calhoun, M., Longworth, M., & Chester, V. L. (2011). Gait patterns in children with autism
[Research Support, Non-U.S. Gov’t]. Clinical Biomechanics, 26(2), 200–206. http://dx.
doi.org/10.1016/j.clinbiomech.2010.09.013.
Carper, R. A., & Courchesne, E. (2000). Inverse correlation between frontal lobe and cer-
ebellum sizes in children with autism. Brain, 123, 836–844.
Cattaneo, L., Fabbri-Destro, M., Boria, S., Pieraccini, C., Monti, A., Cossu, G., et al. (2007).
Impairment of actions chains in autism and its possible role in intention understanding.
17825–17830. http://dx.doi.org/10.1073/pnas.0706273104.
Chang, J. O., Levy, S. S., Seay, S. W., & Goble, D. J. (2013). An alternative to the balance
error scoring system: Using a low-cost balance board to improve the validity/reliability
of sports-related concussion balance testing. Clinical Journal of Sports Medicine (in press).
Chang, C. H., Wade, M. G., Stoffregen, T. A., Hsu, C. Y., & Pan, C. Y. (2010). Visual tasks and
postural sway in children with and without autism spectrum disorders. Research in Develop-
mental Disabilities, 31(6), 1536–1542. http://dx.doi.org/10.1016/j.ridd.2010.06.003.
Cherng, R. J., Liang, L. Y., Chen, Y. J., & Chen, J. Y. (2009). The effects of a motor and a
cognitive concurrent task on walking in children with developmental coordination disor-
der. Gait & Posture, 29(2), 204–207. http://dx.doi.org/10.1016/j.gaitpost.2008.08.003.
Chukoskie, L., & Movshon, J. A. (2009). Modulation of visual signals in macaque MT and
MST neurons during pursuit eye movement. Journal of Neurophysiology, 102(6),
3225–3233. http://dx.doi.org/10.1152/jn.90692.2008.
Chukoskie, L., Snider, J., Mozer, M. C., Krauzlis, R. J., & Sejnowski, T. J. (2013). Learning
where to look for a hidden target. Proceedings of the National Academy of Sciences of the
United States of America, 110(Suppl. 2), 10438–10445. http://dx.doi.org/10.1073/
pnas.1301216110.
Ciesielski, K. T., & Akshoomoff, E. (1990). Hypoplasia of cerebellar vermis in autism and
childhood leukemia. In: Paper presented at the 5th International Child Neurology Congress,
Tokyo, Japan.
Ciesielski, K. T., Harris, R. J., Hart, B. L., & Pabst, H. F. (1997). Cerebellar hypoplasia and
frontal lobe cognitive deficits in disorders of early childhood. Neuropsychologia, 35(5),
643–655, S0028-3932(96)00119-4.
Ciesielski, K. T., & Knight, J. E. (1994). Cerebellar abnormality in autism: A nonspecific
effect of early brain damage? Acta Neurobiologiae Experimentalis, 54(2), 151–154.
Clark, R. A., Bryant, A. L., Pua, Y., McCrory, P., Bennell, K., & Hunt, M. (2010). Validity
and reliability of the Nintendo Wii Balance Board for assessment of standing balance.
Gait & Posture, 31(3), 307–310. http://dx.doi.org/10.1016/j.gaitpost.2009.11.012.
Clemson, L., Fiatarone Singh, M. A., Bundy, A., Cumming, R. G., Manollaras, K.,
O’Loughlin, P., et al. (2012). Integration of balance and strength training into daily life
activity to reduce rate of falls in older people (the LiFE study): Randomised parallel trial.
British Medical Journal, 345, e4547. http://dx.doi.org/10.1136/bmj.e4547.
Conner, J. M., Culberson, A., Packowski, C., Chiba, A. A., & Tuszynski, M. H. (2003).
Lesions of the basal forebrain cholinergic system impair task acquisition and abolish
cortical plasticity associated with motor skill learning. Neuron, 38(5), 819–829,
S0896627303002885.
Courchesne, E., Hesselink, J. R., Jernigan, T. L., & Yeung-Courchesne, R. (1987). Abnor-
mal neuroanatomy in a nonretarded person with autism. Unusual findings with magnetic
resonance imaging. Archives of Neurology, 44(3), 335–341.
Courchesne, E., Karns, C. M., Davis, H. R., Ziccardi, R., Carper, R. A., Tigue, Z. D., et al.
(2001). Unusual brain growth patterns in early life in patients with autistic disorder: An
MRI study. Neurology, 57(2), 245–254.
Courchesne, E., Saitoh, O., Yeung-Courchesne, R., Press, G. A., Lincoln, A. J.,
Haas, R. H., et al. (1994). Abnormality of cerebellar vermian lobules VI and VII in
patients with infantile autism: Identification of hypoplastic and hyperplastic subgroups
with MR imaging. AJR: American Journal of Roentgenology, 162(1), 123–130.
Courchesne, E., Yeung-Courchesne, R., Press, G. A., Hesselink, J. R., & Jernigan, T. L.
(1988). Hypoplasia of cerebellar vermal lobules VI and VII in autism. New England Journal
of Medicine, 318(21), 1349–1354.
David, F. J., Baranek, G. T., Wiesen, C., Miao, A. F., & Thorpe, D. E. (2012). Coordination
of precision grip in 2-6 years-old children with autism spectrum disorders compared to
children developing typically and children with developmental disabilities. Frontiers in
Integrative Neuroscience, 6, 122. http://dx.doi.org/10.3389/fnint.2012.00122.
Daw, N. D., Niv, Y., & Dayan, P. (2005). Uncertainty-based competition between prefron-
tal and dorsolateral striatal systems for behavioral control. Nature Neuroscience, 8(12),
1704–1711. http://dx.doi.org/10.1038/nn1560.
Dayan, E., & Cohen, L. G. (2011). Neuroplasticity subserving motor skill learning. Neuron,
72(3), 443–454. http://dx.doi.org/10.1016/j.neuron.2011.10.008.
autism spectrum disorder. Behavioural Brain Research, 187(2), 207–220. http://dx.doi.
org/10.1016/j.bbr.2007.09.009.
Desmond, J. E., & Fiez, J. A. (1998). Neuroimaging studies of the cerebellum: Language, learn-
ing and memory. Trends in Cognitive Sciences, 2(9), 355–362, S1364-6613(98)01211-X.
Desrochers, T. M., Jin, D. Z., Goodman, N. D., & Graybiel, A. M. (2010). Optimal habits
can develop spontaneously through sensitivity to local cost. Proceedings of the National
Academy of Sciences of the United States of America, 107(47), 20512–20517. http://dx.
doi.org/10.1073/pnas.1013470107.
Deutsch, J. E., Borbely, M., Filler, J., Huhn, K., & Guarrera-Bowlby, P. (2008). Use of a
low-cost, commercially available gaming console (Wii) for rehabilitation of an adolescent
with cerebral palsy. Physical Therapy, 88(10), 1196–1207. http://dx.doi.org/10.2522/
ptj.20080062.
Dewey, D., Cantell, M., & Crawford, S. G. (2007). Motor and gestural performance in chil-
dren with autism spectrum disorders, developmental coordination disorder, and/or atten-
tion deficit hyperactivity disorder. Journal of the International Neuropsychological Society, 13(2),
246–256. http://dx.doi.org/10.1017/S1355617707070270.
(2011). Aberrant striatal functional connectivity in children with autism. Biological Psy-
chiatry, 69(9), 847–856. http://dx.doi.org/10.1016/j.biopsych.2010.10.029.
Di Martino, A., Zuo, X. N., Kelly, C., Grzadzinski, R., Mennes, M., Schvarcz, A., et al.
(2013). Shared and distinct intrinsic functional network centrality in autism and
attention-deficit/hyperactivity disorder. Biological Psychiatry, 74(8), 623–632. http://
dx.doi.org/10.1016/j.biopsych.2013.02.011.
Dichter, G. S. (2012). Functional magnetic resonance imaging of autism spectrum disorders.
Dialogues in Clinical Neuroscience, 14(3), 319–351.
Dowell, L. R., Mahone, E. M., & Mostofsky, S. H. (2009). Associations of postural knowl-
edge and basic motor skill with dyspraxia in autism: Implication for abnormalities in dis-
tributed connectivity and motor learning. Neuropsychology, 23(5), 563–570. http://dx.
doi.org/10.1037/a0015640.
Doya, K. (1999). What are the computations of the cerebellum, the basal ganglia and the
cerebral cortex? Neural Networks, 12(7–8), 961–974, S0893-6080(99)00046-5.
Doya, K. (2000). Complementary roles of basal ganglia and cerebellum in learning and motor
control. Current Opinion in Neurobiology, 10(6), 732–739, S0959-4388(00)00153-7.
Doyon, J., Penhune, V., & Ungerleider, L. G. (2003). Distinct contribution of the cortico-
striatal and cortico-cerebellar systems to motor skill learning. Neuropsychologia, 41(3),
252–262, S0028393202001586.
Durisko, C., & Fiez, J. A. (2010). Functional activation in the cerebellum during working
memory and simple speech tasks. Cortex, 46(7), 896–906. http://dx.doi.org/10.1016/
j.cortex.2009.09.009.
Dziuk, M. A., Gidley Larson, J. C., Apostu, A., Mahone, E. M., Denckla, M. B., &
Mostofsky, S. H. (2007). Dyspraxia in autism: Association with motor, social, and com-
municative deficits. Developmental Medicine and Child Neurology, 49(10), 734–739. http://
dx.doi.org/10.1111/j.1469-8749.2007.00734.x.
Ecker, C., Suckling, J., Deoni, S. C., Lombardo, M. V., Bullmore, E. T., Baron-Cohen, S.,
et al. (2012). Brain anatomy and its relationship to behavior in adults with autism spec-
trum disorder: A multicenter magnetic resonance imaging study. Archives of General Psy-
chiatry, 69(2), 195–209. http://dx.doi.org/10.1001/archgenpsychiatry.2011.1251.
Elsabbagh, M., Volein, A., Holmboe, K., Tucker, L., Csibra, G., Baron-Cohen, S., et al.
(2009). Visual orienting in the early broader autism phenotype: Disengagement and facil-
itation. Journal of Child Psychology and Psychiatry, 50(5), 637–642. http://dx.doi.org/
10.1111/j.1469-7610.2008.02051.x.
Esposito, G., Venuti, P., Apicella, F., & Muratori, F. (2011). Analysis of unsupported gait in
toddlers with autism. Brain & development, 33(5), 367–373. http://dx.doi.org/10.1016/j.
braindev.2010.07.006.
Estes, A., Shaw, D. W., Sparks, B. F., Friedman, S., Giedd, J. N., Dawson, G., et al. (2011).
Basal ganglia morphometry and repetitive behavior in young children with
autism spectrum disorder. Autism Research, 4(3), 212–220. http://dx.doi.org/
10.1002/aur.193.
Fabbri-Destro, M., Cattaneo, L., Boria, S., & Rizzolatti, G. (2009). Planning actions in
autism. Experimental Brain Research, 192(3), 521–525. http://dx.doi.org/10.1007/
s00221-008-1578-3.
11(3), 777–807. http://dx.doi.org/10.1007/s12311-012-0355-9.
Fehlow, P., Bernstein, K., Tennstedt, A., & Walther, F. (1993). Early infantile autism and
excessive aerophagy with symptomatic megacolon and ileus in a case of Ehlers-Danlos
syndrome. Pädiatrie und Grenzgebiete, 31(4), 259–267.
Fink, G. R., Marshall, J. C., Shah, N. J., Weiss, P. H., Halligan, P. W., Grosse-Ruyken, M.,
et al. (2000). Line bisection judgments implicate right parietal cortex and cerebellum as
assessed by fMRI. Neurology, 54(6), 1324–1331.
Flanagan, J. E., Landa, R., Bhat, A., & Bauman, M. (2012). Head lag in infants at risk for
autism: A preliminary study. The American Journal of Occupational Therapy, 66(5),
577–585. http://dx.doi.org/10.5014/ajot.2012.004192.
Fournier, K. A., Hass, C. J., Naik, S. K., Lodha, N., & Cauraugh, J. H. (2010). Motor coor-
dination in autism spectrum disorders: A synthesis and meta-analysis. Journal of Autism and
Developmental Disorders, 40(10), 1227–1240. http://dx.doi.org/10.1007/s10803-010-
0981-3.
Fournier, K. A., Kimberg, C. I., Radonovich, K. J., Tillman, M. D., Chow, J. W.,
Lewis, M. H., et al. (2010). Decreased static and dynamic postural control in children
with autism spectrum disorders. Gait & Posture, 32(1), 6–9. http://dx.doi.org/
10.1016/j.gaitpost.2010.02.007.
Fu, M., Yu, X., Lu, J., & Zuo, Y. (2012). Repetitive motor learning induces coordinated
formation of clustered dendritic spines in vivo. Nature, 483(7387), 92–95. http://dx.
doi.org/10.1038/nature10844.
Fuentes, C. T., Mostofsky, S. H., & Bastian, A. J. (2009). Children with autism show specific
handwriting impairments. Neurology, 73(19), 1532–1537. http://dx.doi.org/10.1212/
WNL.0b013e3181c0d48c.
Fulkerson, S. C., & Freeman, W. M. (1980). Perceptual-motor deficiency in autistic children.
Perceptual and Motor Skills, 50(1), 331–336.
Gaffney, G. R., Tsai, L. Y., Kuperman, S., & Minchin, S. (1987). Cerebellar structure in
autism. American Journal of Diseases of Children, 141(12), 1330–1332.
Geschwind, D. H., & Levitt, P. (2007). Autism spectrum disorders: Developmental discon-
nection syndromes. Current Opinion in Neurobiology, 17(1), 103–111. http://dx.doi.org/
10.1016/j.conb.2007.01.009.
Ghaziuddin, M., & Butler, E. (1998). Clumsiness in autism and Asperger syndrome: A further
report. Journal of Intellectual Disability Research, 42(Pt. 1), 43–48.
Ghaziuddin, M., Butler, E., Tsai, L., & Ghaziuddin, N. (1994). Is clumsiness a marker for
Asperger syndrome? Journal of Intellectual Disability Research, 38(Pt. 5), 519–527.
Gidley Larson, J. C., Bastian, A. J., Donchin, O., Shadmehr, R., & Mostofsky, S. H. (2008).
Acquisition of internal models of motor tasks in children with autism. Brain, 131(Pt. 11),
2894–2903. http://dx.doi.org/10.1093/brain/awn226.
Gillberg, C., Billstedt, E., Sundh, V., & Gillberg, I. C. (2010). Mortality in autism:
A prospective longitudinal community-based study. Journal of Autism and Developmental
Disorders, 40(3), 352–357. http://dx.doi.org/10.1007/s10803-009-0883-4.
Glazebrook, C. M., Elliott, D., & Lyons, J. (2006). A kinematic analysis of how young adults
with and without autism plan and control goal-directed movements. Motor Control,
10(3), 244–264.
Glazebrook, C. M., Elliott, D., & Szatmari, P. (2008). How do individuals with autism plan
their movements? Journal of Autism and Developmental Disorders, 38(1), 114–126. http://
dx.doi.org/10.1007/s10803-007-0369-1.
Glazebrook, C., Gonzalez, D., Hansen, S., & Elliott, D. (2009). The role of vision for online
control of manual aiming movements in persons with autism spectrum disorders. Autism,
13(4), 411–433. http://dx.doi.org/10.1177/1362361309105659.
Granacher, U., Gollhofer, A., Hortobagyi, T., Kressig, R. W., & Muehlbauer, T. (2013).
The importance of trunk muscle strength for balance, functional performance, and fall
prevention in seniors: A systematic review. Sports Medicine, 43(7), 627–641. http://dx.
doi.org/10.1007/s40279-013-0041-1.
Graybiel, A. M. (1995a). The basal ganglia. Trends in Neurosciences, 18(2), 60–62, 0166-2236
(95)80019-X.
Graybiel, A. M. (1995b). Building action repertoires: Memory and learning functions of the
basal ganglia. Current Opinion in Neurobiology, 5(6), 733–741, 0959-4388(95)80100-6.
Graybiel, A. M., Aosaki, T., Flaherty, A. W., & Kimura, M. (1994). The basal ganglia and
adaptive motor control. Science, 265(5180), 1826–1831.
Green, D., Charman, T., Pickles, A., Chandler, S., Loucas, T., Simonoff, E., et al. (2009).
Impairment in movement skills of children with autistic spectrum disorders. Developmen-
tal Medicine and Child Neurology, 51(4), 311–316. http://dx.doi.org/10.1111/j.1469-
8749.2008.03242.x.
Greenough, W. T., Larson, J. R., & Withers, G. S. (1985). Effects of unilateral and bilateral
training in a reaching task on dendritic branching of neurons in the rat motor-sensory
forelimb cortex. Behavioral and Neural Biology, 44(2), 301–314.
Greenspan, S. I., Brazelton, T. B., Cordero, J., Solomon, R., Bauman, M. L., Robinson, R.,
et al. (2008). Guidelines for early identification, screening, and clinical management of
children with autism spectrum disorders. Pediatrics, 121(4), 828–830. http://dx.doi.org/
10.1542/peds.2007-3833.
Greffou, S., Bertone, A., Hahler, E. M., Hanssens, J. M., Mottron, L., & Faubert, J. (2012).
Postural hypo-reactivity in autism is contingent on development and visual environ-
ment: A fully immersive virtual reality study. Journal of Autism and Developmental Disorders,
42(6), 961–970. http://dx.doi.org/10.1007/s10803-011-1326-6.
Grissmer, D., Grimm, K. J., Aiyer, S. M., Murrah, W. M., & Steele, J. S. (2010). Fine motor
skills and early comprehension of the world: Two new school readiness indicators. Devel-
opmental Psychology, 46(5), 1008–1017. http://dx.doi.org/10.1037/a0020104.
Haas, R. H., Townsend, J., Courchesne, E., Lincoln, A. J., Schreibman, L., & Yeung-
Courchesne, R. (1996). Neurologic abnormalities in infantile autism. Journal of Child
Neurology, 11(2), 84–92.
Hallett, M., Lebiedowska, M. K., Thomas, S. L., Stanhope, S. J., Denckla, M. B., &
Rumsey, J. (1993). Locomotion of autistic adults [Comparative Study]. Archives of Neu-
rology, 50(12), 1304–1308.
Hallgato, E., Gyori-Dani, D., Pekar, J., Janacsek, K., & Nemeth, D. (2013). The differential
consolidation of perceptual and motor learning in skill acquisition. Cortex, 49(4),
1073–1081. http://dx.doi.org/10.1016/j.cortex.2012.01.002.
Happe, F., & Charlton, R. A. (2012). Aging in autism spectrum disorders: A mini-review.
Gerontology, 58(1), 70–78. http://dx.doi.org/10.1159/000329720.
Hardan, A. Y., Kilpatrick, M., Keshavan, M. S., & Minshew, N. J. (2003). Motor perfor-
mance and anatomic magnetic resonance imaging (MRI) of the basal ganglia in autism.
Journal of Child Neurology, 18(5), 317–324.
Hashimoto, T., Tayama, M., Murakawa, K., Yoshimoto, T., Miyazaki, M., Harada, M.,
et al. (1995). Development of the brainstem and cerebellum in autistic patients. Journal
of Autism and Developmental Disorders, 25, 1–18.
Haswell, C. C., Izawa, J., Dowell, L. R., Mostofsky, S. H., & Shadmehr, R. (2009). Rep-
resentation of internal models of action in the autistic brain. Nature Neuroscience, 12(8),
970–972. http://dx.doi.org/10.1038/nn.2356.
Hautzel, H., Mottaghy, F. M., Specht, K., Muller, H. W., & Krause, B. J. (2009). Evidence of
a modality-dependent role of the cerebellum in working memory? An fMRI study com-
paring verbal and abstract n-back tasks. NeuroImage, 47(4), 2073–2082. http://dx.doi.
org/10.1016/j.neuroimage.2009.06.005.
Havermann, K., & Lappe, M. (2010). The influence of the consistency of postsaccadic visual
errors on saccadic adaptation. Journal of Neurophysiology, 103(6), 3302–3310. http://dx.
doi.org/10.1152/jn.00970.2009.
Hikosaka, O., Nakamura, K., Sakai, K., & Nakahara, H. (2002). Central mechanisms of motor
skill learning. Current Opinion in Neurobiology, 12(2), 217–222, S0959438802003070.
Hilton, C. L., Zhang, Y., Whilte, M. R., Klohr, C. L., & Constantino, J. (2012). Motor
impairment in sibling pairs concordant and discordant for autism spectrum disorders.
Autism, 16(4), 430–441. http://dx.doi.org/10.1177/1362361311423018.
Hollander, E., Anagnostou, E., Chaplin, W., Esposito, K., Haznedar, M. M., Licalzi, E., et al.
(2005). Striatal volume on magnetic resonance imaging and repetitive behaviors in
autism. Biological Psychiatry, 58(3), 226–232. http://dx.doi.org/10.1016/j.
biopsych.2005.03.040.
Houk, J. C., & Wise, S. P. (1995). Distributed modular architectures linking basal ganglia,
cerebellum, and cerebral cortex: Their role in planning and controlling action. Cerebral
Cortex, 5(2), 95–110.
Hsu, H. C., Chen, C. L., Cheng, P. T., Chen, C. H., Chong, C. Y., & Lin, Y. Y. (2004). The
relationship of social function with motor and speech functions in children with autism.
Chang Gung Medical Journal, 27(10), 750–757, 2710/271006.
Huang, H. J., & Mercer, V. S. (2001). Dual-task methodology: Applications in studies of
cognitive and motor performance in adults and children. Pediatric Physical Therapy,
13(3), 133–140, 00001577-200110000-00005.
Huurnink, A., Fransz, D. P., Kingma, I., & van Dieen, J. H. (2013). Comparison of a lab-
oratory grade force platform with a Nintendo Wii Balance Board on measurement of
postural control in single-leg stance balance tasks. Journal of Biomechanics, 46(7),
1392–1395. http://dx.doi.org/10.1016/j.jbiomech.2013.02.018.
Hwang, E. J. (2013). The basal ganglia, the ideal machinery for the cost-benefit analysis of
action plans. Front Neural Circuits, 7, 121. http://dx.doi.org/10.3389/fncir.2013.00121.
Ilg, W., Schatton, C., Schicks, J., Giese, M. A., Schols, L., & Synofzik, M. (2012). Video
game-based coordinative training improves ataxia in children with degenerative ataxia.
Neurology, 79(20), 2056–2060. http://dx.doi.org/10.1212/WNL.0b013e3182749e67.
Iverson, J. M., & Goldin-Meadow, S. (2005). Gesture paves the way for language develop-
ment. Psychological Science, 16(5), 367–371. http://dx.doi.org/10.1111/j.0956-
7976.2005.01542.x.
Izawa, J., Pekny, S. E., Marko, M. K., Haswell, C. C., Shadmehr, R., & Mostofsky, S. H.
(2012). Motor learning relies on integrated sensory inputs in ADHD, but over-
selectively on proprioception in autism spectrum conditions. Autism Research, 5(2),
124–136. http://dx.doi.org/10.1002/aur.1222.
Janicki, M. P., Henderson, C. M., & Rubin, I. L. (2008). Neurodevelopmental conditions
and aging: Report on the Atlanta Study Group Charrette on Neurodevelopmental Con-
ditions and Aging. Disability and Health Journal, 1(2), 116–124. http://dx.doi.org/
10.1016/j.dhjo.2008.02.004.
Jansiewicz, E. M., Goldberg, M. C., Newschaffer, C. J., Denckla, M. B., Landa, R., &
Mostofsky, S. H. (2006). Motor signs distinguish children with high functioning autism
and Asperger’s syndrome from controls. Journal of Autism and Developmental Disorders,
36(5), 613–621. http://dx.doi.org/10.1007/s10803-006-0109-y.
Jelsma, J., Pronk, M., Ferguson, G., & Jelsma-Smit, D. (2013). The effect of the Nintendo
Wii Fit on balance control and gross motor function of children with spastic hemiplegic
cerebral palsy. Developmental Neurorehabilitation, 16(1), 27–37. http://dx.doi.org/
10.3109/17518423.2012.711781.
Johnson, B. P., Rinehart, N. J., Papadopoulos, N., Tonge, B., Millist, L., White, O., et al.
(2012). A closer look at visually guided saccades in autism and Asperger’s disorder. Fron-
tiers in Integrative Neuroscience, 6, 99. http://dx.doi.org/10.3389/fnint.2012.00099.
Johnson, B. P., Rinehart, N. J., White, O., Millist, L., & Fielding, J. (2013). Saccade adap-
tation in autism and Asperger’s disorder. Neuroscience, 243, 76–87. http://dx.doi.org/
10.1016/j.neuroscience.2013.03.051.
Kanner, L. (1943). Autistic disturbances of affective contact. Nervous Child, 2(3), 217–250.
Kates, W. R., Mostofsky, S. H., Zimmerman, A. W., Mazzocco, M. M., Landa, R.,
Warsofsky, I. S., et al. (1998). Neuroanatomical and neurocognitive differences in a pair
of monozygous twins discordant for strictly defined autism. Annals of Neurology, 43(6),
782–791.
Kaufmann, W. E., Cooper, K. L., Mostofsky, S. H., Capone, G. T., Kates, W. R.,
Newschaffer, C. J., et al. (2003). Specificity of cerebellar vermian abnormalities in
autism: A quantitative magnetic resonance imaging study. Journal of Child Neurology,
18(7), 463–470.
Kawakubo, Y., Kasai, K., Okazaki, S., Hosokawa-Kakurai, M., Watanabe, K.,
Kuwabara, H., et al. (2007). Electrophysiological abnormalities of spatial attention in
adults with autism during the gap overlap task. Clinical Neurophysiology, 118(7),
1464–1471. http://dx.doi.org/10.1016/j.clinph.2007.04.015.
Kellermann, T., Regenbogen, C., De Vos, M., Mossnang, C., Finkelmeyer, A., & Habel, U.
(2012). Effective connectivity of the human cerebellum during visual attention. The Journal
of Neuroscience, 32(33), 11453–11460. http://dx.doi.org/10.1523/JNEUROSCI.0678-
12.2012.
Kemper, T. L., & Bauman, M. (1998). Neuropathology of infantile autism. Journal of Neu-
ropathology and Experimental Neurology, 57(7), 645–652.
Kleim, J. A., Swain, R. A., Armstrong, K. A., Napper, R. M., Jones, T. A., &
Greenough, W. T. (1998). Selective synaptic plasticity within the cerebellar cortex fol-
lowing complex motor skill learning. Neurobiology of Learning and Memory, 69(3),
274–289. http://dx.doi.org/10.1006/nlme.1998.3827.
Klin, A., Jones, W., Schultz, R., Volkmar, F., & Cohen, D. (2002). Visual fixation patterns
during viewing of naturalistic social situations as predictors of social competence in indi-
viduals with autism. Archives of General Psychiatry, 59(9), 809–816, yoa10221.
Klintsova, A. Y., Cowell, R. M., Swain, R. A., Napper, R. M., Goodlett, C. R., &
Greenough, W. T. (1998). Therapeutic effects of complex motor training on motor per-
formance deficits induced by neonatal binge-like alcohol exposure in rats. I. Behavioral
results. Brain Research, 800(1), 48–61, S0006-8993(98)00495-8.
Klintsova, A. Y., Scamra, C., Hoffman, M., Napper, R. M., Goodlett, C. R., &
Greenough, W. T. (2002). Therapeutic effects of complex motor training on motor per-
formance deficits induced by neonatal binge-like alcohol exposure in rats: II.
A quantitative stereological study of synaptic plasticity in female rat cerebellum. Brain
Research, 937(1–2), 83–93, S0006899302024927.
Kohen-Raz, R., Volkmar, F. R., & Cohen, D. J. (1992). Postural control in children with
autism. Journal of Autism and Developmental Disorders, 22(3), 419–432.
Kopp, S., Beckung, E., & Gillberg, C. (2010). Developmental coordination disorder and
other motor control problems in girls with autism spectrum disorder and/or
attention-deficit/hyperactivity disorder. Research in Developmental Disabilities, 31(2),
350–361. http://dx.doi.org/10.1016/j.ridd.2009.09.017.
Kording, K. P., & Wolpert, D. M. (2006). Probabilistic mechanisms in sensorimotor control.
Novartis Foundation Symposium, 270, 191–198, discussion 198-202, 232-197.
Kravitz, A. V., Freeze, B. S., Parker, P. R., Kay, K., Thwin, M. T., Deisseroth, K., et al.
(2010). Regulation of Parkinsonian motor behaviours by optogenetic control of basal
ganglia circuitry. Nature, 466(7306), 622–626. http://dx.doi.org/10.1038/nature09159.
Kravitz, A. V., & Kreitzer, A. C. (2012). Striatal mechanisms underlying movement, rein-
forcement, and punishment. Physiology (Bethesda), 27(3), 167–177. http://dx.doi.org/
10.1152/physiol.00004.2012.
Kreitzer, A. C., & Malenka, R. C. (2007). Endocannabinoid-mediated rescue of striatal LTD
and motor deficits in Parkinson’s disease models. Nature, 445(7128), 643–647. http://dx.
doi.org/10.1038/nature05506.
Kreitzer, A. C., & Malenka, R. C. (2008). Striatal plasticity and basal ganglia circuit function.
Neuron, 60(4), 543–554. http://dx.doi.org/10.1016/j.neuron.2008.11.005.
Kuhn, G., Kourkoulou, A., & Leekam, S. R. (2010). How magic changes our expectations
about autism. Psychological Science, 21(10), 1487–1493. http://dx.doi.org/10.1177/
0956797610383435.
Kushki, A., Chau, T., & Anagnostou, E. (2011). Handwriting difficulties in children with
autism spectrum disorders: A scoping review. Journal of Autism and Developmental Disor-
ders, 41(12), 1706–1716. http://dx.doi.org/10.1007/s10803-011-1206-0.
Lajoie, Y., Teasdale, N., Bard, C., & Fleury, M. (1993). Attentional demands for static and
dynamic equilibrium. Experimental Brain Research, 97(1), 139–144.
Landa, R., & Garrett-Mayer, E. (2006). Development in infants with autism spectrum dis-
orders: A prospective study. Journal of Child Psychology and Psychiatry, 47(6), 629–638.
http://dx.doi.org/10.1111/j.1469-7610.2006.01531.x.
Landry, R., & Bryson, S. E. (2004). Impaired disengagement of attention in young children
with autism. Journal of Child Psychology and Psychiatry, 45(6), 1115–1122. http://dx.doi.
org/10.1111/j.1469-7610.2004.00304.x.
Langen, M., Durston, S., Staal, W. G., Palmen, S. J., & van Engeland, H. (2007). Caudate
nucleus is enlarged in high-functioning medication-naive subjects with autism. Biological
Psychiatry, 62(3), 262–266. http://dx.doi.org/10.1016/j.biopsych.2006.09.040.
Langen, M., Leemans, A., Johnston, P., Ecker, C., Daly, E., Murphy, C. M., et al. (2012).
Fronto-striatal circuitry and inhibitory control in autism: Findings from diffusion tensor
imaging tractography. Cortex, 48(2), 183–193. http://dx.doi.org/10.1016/j.
cortex.2011.05.018.
Larson, J. C. G., & Mostofsky, S. H. (2008). Evidence that the pattern of visuomotor
sequence learning is altered in children with autism. Autism Research, 1(6), 341–353.
http://dx.doi.org/10.1002/Aur.54.
Laufer, Y., Ashkenazi, T., & Josman, N. (2008). The effects of a concurrent cognitive task on
the postural control of young children with and without developmental coordination
disorder. Gait & Posture, 27(2), 347–351. http://dx.doi.org/10.1016/j.gaitpost.
2007.04.013.
Le, T. H., Pardo, J. V., & Hu, X. (1998). 4T-fMRI study of nonspatial shifting of selective
attention: Cerebellar and parietal contributions. Journal of Neurophysiology, 79(3),
1535–1548.
Lee, K. J., Park, I. S., Kim, H., Greenough, W. T., Pak, D. T., & Rhyu, I. J. (2013). Motor
skill training induces coordinated strengthening and weakening between neighboring
synapses. The Journal of Neuroscience, 33(23), 9794–9799. http://dx.doi.org/10.1523/
JNEUROSCI.0848-12.2013.
Levitt, J. G., Blanton, R., Capetillo-Cunliffe, L., Guthrie, D., Toga, A., & McCracken, J. T.
(1999). Cerebellar vermis lobules VIII-X in autism. Progress in Neuro-Psychopharmacology
and Biological Psychiatry, 23(4), 625–633.
Libertus, K., & Needham, A. (2010). Teach to reach: The effects of active vs. passive reaching
experiences on action and perception. Vision Research, 50(24), 2750–2757. http://dx.doi.
org/10.1016/j.visres.2010.09.001.
Libertus, K., & Needham, A. (2011). Reaching experience increases face preference in
3-month-old infants. Developmental Science, 14(6), 1355–1364. http://dx.doi.org/
10.1111/j.1467-7687.2011.01084.x.
Lord, C., Petkova, E., Hus, V., Gan, W., Lu, F., Martin, D. M., et al. (2012). A multisite
study of the clinical diagnosis of different autism spectrum disorders. Archives of General
Psychiatry, 69(3), 306–313. http://dx.doi.org/10.1001/archgenpsychiatry.2011.148.
Luna, B., Doll, S. K., Hegedus, S. J., Minshew, N. J., & Sweeney, J. A. (2007). Maturation of
executive function in autism. Biological Psychiatry, 61(4), 474–481. http://dx.doi.org/
10.1016/j.biopsych.2006.02.030.
Manjiviona, J., & Prior, M. (1995). Comparison of Asperger syndrome and high-functioning
autistic children on a test of motor impairment. Journal of Autism and Developmental Dis-
orders, 25(1), 23–39.
Mari, M., Castiello, U., Marks, D., Marraffa, C., & Prior, M. (2003). The reach-to-grasp
movement in children with autism spectrum disorder. Philosophical Transactions of the
Royal Society of London Series B, Biological Sciences, 358(1430), 393–403. http://dx.doi.

org/10.1098/rstb.2002.1205.
Maski, K. P., Jeste, S. S., & Spence, S. J. (2011). Common neurological co-morbidities in
autism spectrum disorders. Current Opinion in Pediatrics, 23(6), 609–615. http://dx.doi.
org/10.1097/MOP.0b013e32834c9282.
Mayes, S. D., & Calhoun, S. L. (2003). Analysis of WISC-III, Stanford-Binet:IV, and aca-
demic achievement test scores in children with autism. Journal of Autism and Developmental
Disorders, 33(3), 329–341.
McAlonan, G. M., Daly, E., Kumari, V., Critchley, H. D., van Amelsvoort, T., Suckling, J.,
et al. (2002). Brain anatomy and sensorimotor gating in Asperger’s syndrome. Brain,
125(Pt. 7), 1594–1606.
McPartland, J. C., Webb, S. J., Keehn, B., & Dawson, G. (2011). Patterns of visual attention
to faces and objects in autism spectrum disorder. Journal of Autism and Developmental Dis-
orders, 41(2), 148–157. http://dx.doi.org/10.1007/s10803-010-1033-8.
Miles, J. H., & Hillman, R. E. (2000). Value of a clinical morphology examination in autism
[see comments]. American Journal of Medical Genetics, 91(4), 245–253.
Ming, X., Brimacombe, M., & Wagner, G. C. (2007). Prevalence of motor impairment in
autism spectrum disorders. Brain Dev, 29(9), 565–570. http://dx.doi.org/10.1016/j.
braindev.2007.03.002.
Minshew, N. J., Sung, K., Jones, B. L., & Furman, J. M. (2004). Underdevelopment of the
postural control system in autism. Neurology, 63(11), 2056–2061, 63/11/2056.
Molloy, C. A., Dietrich, K. N., & Bhattacharya, A. (2003). Postural stability in children
643–652.
Moruzzi, S., Ogliari, A., Ronald, A., Happe, F., & Battaglia, M. (2011). The nature of
covariation between autistic traits and clumsiness: A twin study in a general population
sample. Journal of Autism and Developmental Disorders, 41(12), 1665–1674. http://dx.doi.
org/10.1007/s10803-011-1199-8.
Mosconi, M. W., Luna, B., Kay-Stacey, M., Nowinski, C. V., Rubin, L. H., Scudder, C.,
et al. (2013). Saccade adaptation abnormalities implicate dysfunction of cerebellar-
dependent learning mechanisms in autism spectrum disorders (ASD). PLoS One, 8(5),
e63709. http://dx.doi.org/10.1371/journal.pone.0063709.
Mostofsky, S. H., Dubey, P., Jerath, V. K., Jansiewicz, E. M., Goldberg, M. C., &
Denckla, M. B. (2006). Developmental dyspraxia is not limited to imitation in children
with autism spectrum disorders. Journal of the International Neuropsychological Society, 12(3),
314–326.
Mostofsky, S. H., Powell, S. K., Simmonds, D. J., Goldberg, M. C., Caffo, B., & Pekar, J. J.
(2009). Decreased connectivity and cerebellar activity in autism during motor task per-
formance. Brain, 132(Pt. 9), 2413–2425. http://dx.doi.org/10.1093/brain/awp088.
Mostofsky, S. H., & Ewen, J. B. (2011). Altered connectivity and action model formation in
autism is autism. The Neuroscientist : A Review Journal Bringing Neurobiology, Neurology and
Psychiatry, 17(4), 437–448.
Mukaetova-Ladinska, E. B., Perry, E., Baron, M., & Povey, C. (2012). Ageing in people
with autistic spectrum disorder. International Journal of Geriatric Psychiatry, 27(2),
109–118. http://dx.doi.org/10.1002/gps.2711.
Muller, R. A., Shih, P., Keehn, B., Deyoe, J. R., Leyden, K. M., & Shukla, D. K. (2011).
Underconnected, but how? A survey of functional connectivity MRI studies in autism
spectrum disorders. Cerebral Cortex, 21(10), 2233–2243. http://dx.doi.org/10.1093/
cercor/bhq296.
Murakami, J. W., Courchesne, E., Press, G. A., Yeung-Courchesne, R., & Hesselink, J. R.
(1989). Reduced cerebellar hemisphere size and its relationship to vermal hypoplasia in
autism. Archives of Neurology, 46(6), 689–694.
Murphy, D. G., Beecham, J., Craig, M., & Ecker, C. (2011). Autism in adults. New biolog-
ical findings and their translational implications to the cost of clinical services. Brain
Research, 1380, 22–33. http://dx.doi.org/10.1016/j.brainres.2010.10.042.
Nakamura, K., & Hikosaka, O. (2006). Role of dopamine in the primate caudate nucleus in
reward modulation of saccades. The Journal of Neuroscience, 26(20), 5360–5369. http://dx.
doi.org/10.1523/JNEUROSCI.4853-05.2006.
Naviaux, R. K., Zolkipli, Z., Wang, L., Nakayama, T., Naviaux, J. C., Le, T. P., et al.
(2013). Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse
model. PLoS One, 8(3), e57380. http://dx.doi.org/10.1371/journal.pone.0057380.
Nayate, A., Tonge, B. J., Bradshaw, J. L., McGinley, J. L., Iansek, R., & Rinehart, N. J.
(2012). Differentiation of high-functioning autism and Asperger’s disorder based on
neuromotor behaviour. Journal of Autism and Developmental Disorders, 42(5), 707–717.
http://dx.doi.org/10.1007/s10803-011-1299-5.
Nazarali, N., Glazebrook, C. M., & Elliott, D. (2009). Movement planning and repro-
gramming in individuals with autism. Journal of Autism and Developmental Disorders,
39(10), 1401–1411. http://dx.doi.org/10.1007/s10803-009-0756-x.
Niv, Y., Daw, N. D., Joel, D., & Dayan, P. (2007). Tonic dopamine: Opportunity costs and
the control of response vigor. Psychopharmacology, 191(3), 507–520. http://dx.doi.org/
10.1007/s00213-006-0502-4.
Nobile, M., Perego, P., Piccinini, L., Mani, E., Rossi, A., Bellina, M., et al. (2011). Further
evidence of complex motor dysfunction in drug naive children with autism using auto-
matic motion analysis of gait [Research Support, Non-U.S. Gov’t]. Autism: The Interna-
tional Journal of Research and Practice, 15(3), 263–283. http://dx.doi.org/10.1177/
1362361309356929.
Nowinski, C. V., Minshew, N. J., Luna, B., Takarae, Y., & Sweeney, J. A. (2005). Oculo-
motor studies of cerebellar function in autism. Psychiatry Research, 137(1–2), 11–19.
http://dx.doi.org/10.1016/j.psychres.2005.07.005.
O’Halloran, C. J., Kinsella, G. J., & Storey, E. (2012). The cerebellum and neuropsycholog-
ical functioning: A critical review. Journal of Clinical and Experimental Neuropsychology,
34(1), 35–56. http://dx.doi.org/10.1080/13803395.2011.614599.
Ozonoff, S., Iosif, A. M., Baguio, F., Cook, I. C., Hill, M. M., Hutman, T., et al. (2010).
A prospective study of the emergence of early behavioral signs of autism. Journal of
the American Academy of Child and Adolescent Psychiatry, 49(3), 256–266, e251-252,
00004583-201003000-00009.
Ozonoff, S., Young, G. S., Carter, A., Messinger, D., Yirmiya, N., Zwaigenbaum, L., et al.
(2011). Recurrence risk for autism spectrum disorders: A Baby Siblings Research Consor-
tium Study. Pediatrics, 128(3), e488–e495. http://dx.doi.org/10.1542/peds.2010-2825.
Ozonoff, S., Young, G. S., Goldring, S., Greiss-Hess, L., Herrera, A. M., Steele, J., et al.
(2008). Gross motor development, movement abnormalities, and early identification
of autism. Journal of Autism and Developmental Disorders, 38(4), 644–656. http://dx.doi.
org/10.1007/s10803-007-0430-0.
Perry, W., Minassian, A., Lopez, B., Maron, L., & Lincoln, A. (2007). Sensorimotor gating
deficits in adults with autism. Biological Psychiatry, 61(4), 482–486. http://dx.doi.org/
10.1016/j.biopsych.2005.09.025.
Piek, J. P., & Dyck, M. J. (2004). Sensory-motor deficits in children with developmental coor-
dination disorder, attention deficit hyperactivity disorder and autistic disorder. Human
Movement Science, 23(3–4), 475–488. http://dx.doi.org/10.1016/j.humov.2004.08.019.
Piven, J., & Rabins, P. (2011). Autism spectrum disorders in older adults: Toward defining a
research agenda. Journal of the American Geriatrics Society, 59(11), 2151–2155. http://dx.
doi.org/10.1111/j.1532-5415.2011.03632.x.
Planinsec, J. (2002). Relations between the motor and cognitive dimensions of preschool
girls and boys. Perceptual and Motor Skills, 94(2), 415–423.
Provost, B., Heimerl, S., & Lopez, B. R. (2007). Levels of gross and fine motor development
in young children with autism spectrum disorder. Physical & Occupational Therapy in Pedi-
atrics, 27(3), 21–36.
Qiu, A., Adler, M., Crocetti, D., Miller, M. I., & Mostofsky, S. H. (2010). Basal ganglia
shapes predict social, communication, and motor dysfunctions in boys with autism spec-
trum disorder. Journal of the American Academy of Child and Adolescent Psychiatry, 49(6),
539–551. http://dx.doi.org/10.1016/j.jaac.2010.02.012, 551.e1-4.
Radonovich, K. J., Fournier, K. A., & Hass, C. J. (2013). Relationship between postural con-
trol and restricted, repetitive behaviors in autism spectrum disorders. Frontiers in Integra-
tive Neuroscience, 7, 28. http://dx.doi.org/10.3389/fnint.2013.00028.
Ramstrand, N., & Lygnegard, F. (2012). Can balance in children with cerebral palsy improve
through use of an activity promoting computer game? Technology and Health Care, 20(6),
501–510. http://dx.doi.org/10.3233/THC-2012-0696.
Redgrave, P., Rodriguez, M., Smith, Y., Rodriguez-Oroz, M. C., Lehericy, S.,
Bergman, H., et al. (2010). Goal-directed and habitual control in the basal ganglia: Impli-
cations for Parkinson’s disease. Nature Reviews Neuroscience, 11(11), 760–772. http://dx.
doi.org/10.1038/nrn2915.
Reilly, D. S., van Donkelaar, P., Saavedra, S., & Woollacott, M. H. (2008). Interaction between
the development of postural control and the executive function of attention. Journal of Motor
Behavior, 40(2), 90–102. http://dx.doi.org/10.3200/Jmbr.40.2.90-102.
Rinehart, N. J., Bellgrove, M. A., Tonge, B. J., Brereton, A. V., Howells-Rankin, D., &
Bradshaw, J. L. (2006). An examination of movement kinematics in young people with
high-functioning autism and Asperger’s disorder: Further evidence for a motor planning
deficit. Journal of Autism and Developmental Disorders, 36(6), 757–767. http://dx.doi.org/
10.1007/s10803-006-0118-x.
Rinehart, N. J., Tonge, B. J., Bradshaw, J. L., Iansek, R., Enticott, P. G., & McGinley, J.
(2006). Gait function in high-functioning autism and Asperger’s disorder: Evidence for
basal-ganglia and cerebellar involvement? [Research Support, Non-U.S. Gov’t]. Euro-
pean Child & Adolescent Psychiatry, 15(5), 256–264. http://dx.doi.org/10.1007/s00787-
006-0530-y.
Ritvo, E. R., Freeman, B. J., Scheibel, A. B., Duong, T., Robinson, H., Guthrie, D., et al.
(1986). Lower Purkinje cell counts in the cerebella of four autistic subjects: Initial find-
ings of the UCLA-NSAC Autopsy Research Report. The American Journal of Psychiatry,
143(7), 862–866.
Rodier, P. M., Ingram, J. L., Tisdale, B., Nelson, S., & Romano, J. (1996). Embryological
origin for autism: Developmental anomalies of the cranial nerve motor nuclei. The Journal
of Comparative Neurology, 370(2), 247–261. http://dx.doi.org/10.1002/(SICI)1096-9861
(19960624)370:2<247::AID-CNE8>3.0.CO;2-2.
Saitoh, O., Courchesne, E., Egaas, B., Lincoln, A. J., & Schreibman, L. (1995). Cross-
sectional area of the posterior hippocampus in autistic patients with cerebellar and corpus
callosum abnormalities. Neurology, 45(2), 317–324.
Schlosser, R., Hutchinson, M., Joseffer, S., Rusinek, H., Saarimaki, A., Stevenson, J., et al.
(1998). Functional magnetic resonance imaging of human brain activity in a verbal flu-
ency task. Journal of Neurology, Neurosurgery, and Psychiatry, 64(4), 492–498. http://dx.doi.
org/10.1136/jnnp.64.4.492.
Schmitz, C., Martineau, J., Barthelemy, C., & Assaiante, C. (2003). Motor control and chil-
dren with autism: Deficit of anticipatory function? Neuroscience Letters, 348(1), 17–20,
S030439400300644X.
Scott-Van Zeeland, A. A., Dapretto, M., Ghahremani, D. G., Poldrack, R. A., &
Bookheimer, S. Y. (2010). Reward processing in autism. Autism Research, 3(2),
53–67. http://dx.doi.org/10.1002/aur.122.
Sears, L. L., Vest, C., Mohamed, S., Bailey, J., Ranson, B. J., & Piven, J. (1999). An MRI
study of the basal ganglia in autism. Progress in Neuro-Psychopharmacology & Biological Psy-
chiatry, 23(4), 613–624, S0278584699000202.
Sejnowski, T. J. (2010). Learning optimal strategies in complex environments. Proceedings of
the National Academy of Sciences of the United States of America, 107(47), 20151–20152.
http://dx.doi.org/10.1073/pnas.1014954107.
Shadmehr, R. (2010). Control of movements and temporal discounting of reward. Current
Opinion in Neurobiology, 20(6), 726–730. http://dx.doi.org/10.1016/j.conb.2010.08.017.
Shadmehr, R., & Krakauer, J. W. (2008). A computational neuroanatomy for motor control.
Experimental Brain Research, 185(3), 359–381. http://dx.doi.org/10.1007/s00221-008-
1280-5.
Shadmehr, R., Orban de Xivry, J. J., Xu-Wilson, M., & Shih, T. Y. (2010). Temporal dis-
counting of reward and the cost of time in motor control. The Journal of Neuroscience,
30(31), 10507–10516. http://dx.doi.org/10.1523/JNEUROSCI.1343-10.2010.
Shavelle, R. M., Strauss, D. J., & Pickett, J. (2001). Causes of death in autism. Journal of Autism
and Developmental Disorders, 31(6), 569–576.
Sherrington, C., Tiedemann, A., Fairhall, N., Close, J. C., & Lord, S. R. (2011). Exercise to
prevent falls in older adults: An updated meta-analysis and best practice recommenda-
tions. New South Wales Public Health Bulletin, 22(3–4), 78–83. http://dx.doi.org/
10.1071/NB10056.
Shetreat-Klein, M., Shinnar, S., & Rapin, I. (2012). Abnormalities of joint mobility and gait
in children with autism spectrum disorders. Brain & Development, http://dx.doi.org/
10.1016/j.braindev.2012.02.005.
Shi, L., Smith, S. E., Malkova, N., Tse, D., Su, Y., & Patterson, P. H. (2009). Activation
of the maternal immune system alters cerebellar development in the offspring. Brain,
Behavior, and Immunity, 23(1), 116–123. http://dx.doi.org/10.1016/j.bbi.2008.07.012.
Shih, C. H., Shih, C. T., & Chu, C. L. (2010). Assisting people with multiple disabilities
actively correct abnormal standing posture with a Nintendo Wii balance board through
controlling environmental stimulation. Research in Developmental Disabilities, 31(4),
936–942. http://dx.doi.org/10.1016/j.ridd.2010.03.004.
Shmuelof, L., & Krakauer, J. W. (2011). Are we ready for a natural history of motor learning?
Neuron, 72(3), 469–476. http://dx.doi.org/10.1016/j.neuron.2011.10.017.
Shukla, D. K., Keehn, B., & Muller, R. A. (2010). Regional homogeneity of fMRI time
series in autism spectrum disorders. Neuroscience Letters, 476(1), 46–51. http://dx.doi.
org/10.1016/j.neulet.2010.03.080.
Stoodley, C. J., Valera, E. M., & Schmahmann, J. D. (2012). Functional topography of the
cerebellum for motor and cognitive tasks: An fMRI study. NeuroImage, 59(2),
1560–1570. http://dx.doi.org/10.1016/j.neuroimage.2011.08.065.
Sutera, S., Pandey, J., Esser, E. L., Rosenthal, M. A., Wilson, L. B., Barton, M., et al. (2007).
Predictors of optimal outcome in toddlers diagnosed with autism spectrum disorders.
Journal of Autism and Developmental Disorders, 37(1), 98–107. http://dx.doi.org/
10.1007/s10803-006-0340-6.
Takarae, Y., Minshew, N. J., Luna, B., Krisky, C. M., & Sweeney, J. A. (2004). Pursuit eye
movement deficits in autism. Brain, 127(Pt. 12), 2584–2594. http://dx.doi.org/10.1093/
brain/awh307.
Takarae, Y., Minshew, N. J., Luna, B., & Sweeney, J. A. (2004). Oculomotor abnormalities
parallel cerebellar histopathology in autism. Journal of Neurology, Neurosurgery, and Psychi-
atry, 75(9), 1359–1361. http://dx.doi.org/10.1136/jnnp.2003.022491.
Takarae, Y., Minshew, N. J., Luna, B., & Sweeney, J. A. (2007). Atypical involvement of
frontostriatal systems during sensorimotor control in autism. Psychiatry Research,
156(2), 117–127. http://dx.doi.org/10.1016/j.pscychresns.2007.03.008.
Teitelbaum, O., Benton, T., Shah, P. K., Prince, A., Kelly, J. L., & Teitelbaum, P. (2004).
Eshkol-Wachman movement notation in diagnosis: The early detection of Asperger’s
syndrome. Proceedings of the National Academy of Sciences of the United States of America,
101(32), 11909–11914. http://dx.doi.org/10.1073/pnas.0403919101.
Teitelbaum, P., Teitelbaum, O., Nye, J., Fryman, J., & Maurer, R. G. (1998). Movement
analysis in infancy may be useful for early diagnosis of autism. Proceedings of the National
Academy of Sciences of the United States of America, 95(23), 13982–13987.
Todorov, E., & Jordan, M. I. (2002). Optimal feedback control as a theory of motor coor-
dination. Nature Neuroscience, 5(11), 1226–1235. http://dx.doi.org/10.1038/nn963.
Travers, B. G., Powell, P. S., Klinger, L. G., & Klinger, M. R. (2013). Motor difficulties in
autism spectrum disorder: Linking symptom severity and postural stability. Journal of
Autism and Developmental Disorders, 43(7), 1568–1583. http://dx.doi.org/10.1007/
s10803-012-1702-x.
mice. Nature, 488(7413), 647–651. http://dx.doi.org/10.1038/nature11310.
Tsai, C. L., Pan, C. Y., Cherng, R. J., & Wu, S. K. (2009). Dual-task study of cognitive and
postural interference: A preliminary investigation of the automatization deficit hypoth-
esis of developmental co-ordination disorder. Child: Care, Health and Development, 35(4),
551–560. http://dx.doi.org/10.1111/j.1365-2214.2009.00974.x.
van Batenburg-Eddes, T., Henrichs, J., Schenk, J. J., Sincer, I., de Groot, L., Hofman, A.,
et al. (2013). Early infant neuromotor assessment is associated with language and non-
verbal cognitive function in toddlers: the generation R study. Jurnal of Developmental
and Behavioral Pediatrics, 34(5), 326–334.
van Swieten, L. M., van Bergen, E., Williams, J. H., Wilson, A. D., Plumb, M. S.,
Kent, S. W., et al. (2010). A test of motor (not executive) planning in developmental
coordination disorder and autism. Journal of Experimental Psychology Human Perception
and Performance, 36(2), 493–499. http://dx.doi.org/10.1037/a0017177.
Vernazza-Martin, S., Martin, N., Vernazza, A., Lepellec-Muller, A., Rufo, M., Massion, J.,
et al. (2005). Goal directed locomotion and balance control in autistic children. Journal of
Autism and Developmental Disorders, 35(1), 91–102.
Vilensky, J. A., Damasio, A. R., & Maurer, R. G. (1981). Gait disturbances in patients with
autistic behavior: A preliminary study. Archives of Neurology, 38(10), 646–649.
Weimer, A. K., Schatz, A. M., Lincoln, A., Ballantyne, A. O., & Trauner, D. A. (2001).
“Motor” impairment in Asperger syndrome: Evidence for a deficit in proprioception.
Journal of Developmental and Behavioral Pediatrics, 22(2), 92–101.
Weiss, M. J., Moran, M. F., Parker, M. E., & Foley, J. T. (2013). Gait analysis of teenagers
and young adults diagnosed with autism and severe verbal communication disorders.
Frontiers in Integrative Neuroscience, 7, 33. http://dx.doi.org/10.3389/fnint.2013.00033.
Whittingham, K., Fahey, M., Rawicki, B., & Boyd, R. (2010). The relationship between
motor abilities and early social development in a preschool cohort of children with cere-
bral palsy. Research in Developmental Disabilities, 31(6), 1346–1351. http://dx.doi.org/
10.1016/j.ridd.2010.07.006.
Williams, R. S., Hauser, S. L., Purpura, D. P., DeLong, G. R., & Swisher, C. N. (1980).
Autism and mental retardation: Neuropathologic studies performed in four retarded per-
sons with autistic behavior. Archives of Neurology, 37(12), 749–753.
Wolff, J. J., Gu, H., Gerig, G., Elison, J. T., Styner, M., Gouttard, S., et al. (2012). Differ-
ences in white matter fiber tract development present from 6 to 24 months in infants with
autism. The American Journal of Psychiatry, 169(6), 589–600. http://dx.doi.org/10.1176/
appi.ajp.2011.11091447.
Wuang, Y. P., Chiang, C. S., Su, C. Y., & Wang, C. C. (2011). Effectiveness of virtual reality
using Wii gaming technology in children with Down syndrome. Research in Developmen-
tal Disabilities, 32(1), 312–321. http://dx.doi.org/10.1016/j.ridd.2010.10.002.
Xiang, H., Lin, C., Ma, X., Zhang, Z., Bower, J. M., Weng, X., et al. (2003). Involvement of
the cerebellum in semantic discrimination: An fMRI study. Human Brain Mapping, 18(3),
208–214. http://dx.doi.org/10.1002/hbm.10095.
Yin, H. H., Knowlton, B. J., & Balleine, B. W. (2005). Blockade of NMDA receptors in the
dorsomedial striatum prevents action-outcome learning in instrumental conditioning.
The European Journal of Neuroscience, 22(2), 505–512. http://dx.doi.org/10.1111/
j.1460-9568.2005.04219.x.
Zikopoulos, B., & Barbas, H. (2010). Changes in prefrontal axons may disrupt the network in
autism. The Journal of Neuroscience, 30(44), 14595–14609. http://dx.doi.org/10.1523/
JNEUROSCI.2257-10.2010.
Zilbovicius, M., Murayama, N., Garreau, B., Leroy-Willig, A., Barthelemy, C.,
Salamon, G., et al. (1995). Hypoplasia of vermal lobules I-V, but not of lobules
VI-VII, in childhood autism. Neurology, 45(Suppl. 4), A162.
Zwaigenbaum, L., Bryson, S., Rogers, T., Roberts, W., Brian, J., & Szatmari, P. (2005).
Behavioral manifestations of autism in the first year of life. International Journal of Develop-
mental Neuroscience, 23(2–3), 143–152. http://dx.doi.org/10.1016/j.ijdevneu.2004.05.001.
CHAPTER EIGHT
Orchestration of
Neurodevelopmental Programs
by RBFOX1: Implications for
Autism Spectrum Disorder
Brent R. Bill*, Jennifer K. Lowe*,†, Christina T. DyBuncio*,†,
Brent L. Fogel†,1
*Department of Psychiatry, David Geffen School of Medicine, Center for Autism Research and Treatment
and Center for Neurobehavioral Genetics, Semel Institute for Neuroscience and Human Behavior, University
of California, Los Angeles, California, USA
†
Program in Neurogenetics, Department of Neurology, David Geffen School of Medicine, University of
California, Los Angeles, California, USA
1
Corresponding author: e-mail address: bfogel@ucla.edu
Contents
1. Neurodevelopment and the RBFOX1 RNA Splicing Factor 252
2. RBFOX1 Genetic Variation and Autism Spectrum Disorder 253
3. The Contributions of RBFOX1 Model Systems to Molecular Pathogenesis 258
4. A Model for the Dysregulation of RBFOX1 in Human Neurodevelopmental Disease 259
Acknowledgments 263
References 263
Abstract
Neurodevelopmental and neuropsychiatric disorders result from complex interactions
between critical genetic factors and as-yet-unknown environmental components. To
gain clinical insight, it is critical to develop a comprehensive understanding of these
genetic components. RBFOX1, an RNA splicing factor, regulates expression of large
genetic networks during early neuronal development, and haploinsufficiency causes
severe neurodevelopmental phenotypes including autism spectrum disorder (ASD),
intellectual disability, and epilepsy. Genomic testing in individuals and large patient
cohorts has identified phenotypically similar cases possessing copy number variations
in RBFOX1, implicating the gene as an important cause of neurodevelopmental dis-
ease. However, a significant proportion of the observed structural variation is inherited
from phenotypically normal individuals, raising questions regarding overall pathoge-
nicity of variation at the RBFOX1 locus. In this chapter, we discuss the molecular, cel-
lular, and clinical evidence supporting the role of RBFOX1 in neurodevelopment and
present a comprehensive model for the contribution of structural variation in RBFOX1
to ASD.

http://dx.doi.org/10.1016/B978-0-12-418700-9.00008-3
252 Brent R. Bill et al.
1. NEURODEVELOPMENT AND THE RBFOX1 RNA

SPLICING FACTOR
During development, a series of intricate programs of gene regulation
must specifically occur within neurons, resulting in both temporal and spatial
patterns of distinct gene expression. This results in an organized program of
molecular and cellular actions and interactions that translate into the connec-
tivity that underlies the function of the neurotypical human brain. Not sur-
prisingly, disruption of these regulatory programs has been shown to cause a
broad range of neurodevelopmental disorders including autism spectrum
disorder (ASD), schizophrenia, and many others (Bill & Geschwind,
2009; Fogel et al., 2012 Pescosolido, Yang, Sabbagh, & Morrow, 2012).
Over the past decade, we have come to better understand the workings
of various aspects of this complex system through the study of key regulatory
factors that guide these neurodevelopmental cascades. Many of these factors
directly influence gene expression through transcription and/or pre-mRNA
alternative splicing, both fundamental processes to the development of
tissue-specific genetic programs.
The RBFOX1 gene (also referred to as A2BP1 or FOX1) encodes a
splicing regulatory factor, specifically expressed in neurons and muscle,
responsible for widespread effects, both enhancing and inhibiting the
alternative splicing of many cellular pre-mRNAs (Fogel et al., 2012;
Underwood, Boutz, Dougherty, Stoilov, & Black, 2005; Wang et al.,
2008). Several lines of evidence indicate that RBFOX1 regulates the
alternative splicing of large tissue-specific gene networks including multi-
species comparative genomics of splicing regulatory elements (Yeo,
Nostrand, & Liang, 2007), bioinformatic analysis of genes alternatively
spliced during embryonic cell differentiation (Yeo, Xu, et al., 2007),
genome-wide target site prediction strategies (Zhang et al., 2008),
genome-wide transcriptome assessment (Wang et al., 2008), multispecies
RNA-binding protein motif analysis (Ray et al., 2013), and gene-specific
knockdown in differentiated human neural progenitor cell lines (Fogel
et al., 2012). In addition to mediating alternative splicing, functional roles
for RBFOX1 have been identified in the transcriptional regulation of addi-
tional gene networks by directly mediating RNA stability (Ray et al., 2013),
influencing transcription (Usha & Shashidhara, 2010), or indirectly through
effects on other regulators of gene expression (Fogel et al., 2012).
RBFOX1 and ASD 253
2. RBFOX1 GENETIC VARIATION AND AUTISM

SPECTRUM DISORDER
The available molecular and cellular evidence described earlier sup-
ports RBFOX1 as a high-level regulatory factor in early brain development,
so it is not surprising that a growing number of patients with
neurodevelopmental phenotypes have been identified with mutations
disrupting RBFOX1. These phenotypes, some of which are quite severe,
include syndromes of ASD, intellectual disability, and epilepsy as well as
other neuropsychiatric phenotypes.
The RBFOX1 gene is quite large, spanning 2.4 MB on chromosome
16p13.3, making it one of the largest genes in the human genome. It must
be noted that the nomenclature used to describe the RBFOX1 genetic archi-
tecture over the years has not been consistent across the literature, and it can
often be difficult to compare the functional significance of reported variants.
This is due, in part, to the fact that the RBFOX1 gene utilizes multiple pro-
moters and undergoes a wide variety of alternative splicing in a tissue-
specific fashion, with many of the functional cellular transcripts likely not
yet characterized or annotated (Fogel et al., 2012; Underwood et al.,
2005) (Fig. 8.1). Furthermore, the major neuronal transcripts initially
reported in the literature for humans have been shown to actually be
muscle-specific transcripts, the same as originally reported in the mouse
(Fogel et al., 2012). We advocate the use of the naming scheme first pub-
lished in Underwood et al. (Fogel et al., 2012; Underwood et al., 2005) for
describing variants found in patients (Fig. 8.1A; Supplemental Table 1,
http://dx.doi.org/10.1016/B978-0-12-418700-9.00008-3). Standardized
nomenclature is particularly important for determining the pathogenicity
of an individual sequence or structural change likely to affect neuron-
specific transcripts or isoforms.
One of the earliest clinical descriptions of a neurodevelopmental pheno-
type associated with RBFOX1 was of two patients with likely ASD, mental
retardation, and epilepsy associated with haploinsufficiency caused by
de novo translocations involving chromosome 16 (Bhalla et al., 2004). This
was followed by the description of another patient with a similar syndrome,
also caused by a haploinsufficiency due to a de novo translocation, which
incorporated validated rating scales to clinically diagnose the patient with
autism (Martin et al., 2007). These two initial case reports provided strong
Figure 8.1 RBFOX1 genomic architecture and copy number variation associated with
autism spectrum disorder. (A) RBFOX1 gene structure is complex with multiple transcrip-
tional start sites, translational start sites, multiple isoforms, and alternate endings. The
distribution of CNVs associated with autism spectrum disorder in the RBFOX1 locus
(HG19-chr16: 5289804–7763340) is shown and compared to the database of genomic
variants. (B) Exons 1A–1E. (C) Exons 8–21. Observed structural variation is shown clus-
tered at the 5' untranslated region between exons 1 and 7. Single nucleotide polymor-
phisms related to the locus and showing genome-wide associated in ASD also follow a
similar distribution pattern (green). Red bars, deletions; blue bars, duplications; brown
bars, insertions and deletions; black bars, unknown feature.
RBFOX1 and ASD 255
confirmatory evidence of causality between RBFOX1 mutation and

human disease, resulting in its classification as an ASD candidate gene
(Simons Foundation Autism Research Initiative gene database; https://
sfari.org/).
Other structural variations in RBFOX1, most notably copy number var-
iations (CNVs; arbitrarily defined as deletions or duplications >1 kb in size),
have also been associated with human neurodevelopmental disease. CNVs
occur commonly in the population and represent a significant source of
human genetic variation (Fogel & Geschwind, 2012) (Database of Genomic
Variants, DGV; http://dgv.tcag.ca/dgv/app/home) (Iafrate et al., 2004).
The link between RBFOX1 CNVs and autism has been suggested by the
presence of de novo CNVs within ASD cohorts (Sebat et al., 2007) and in
samples from isolated autistic patients (Wintle et al., 2011). More recently,
a number of case reports have highlighted specific RBFOX1 CNVs linked to
ASD. Mikhail et al. reported a 3-year-old microcephalic boy with develop-
mental delay, language delay, and an intragenic deletion involving noncod-
ing exons 6 and 1D in RBFOX1 of unknown inheritance status as his parents
could not be tested (Mikhail et al., 2011). Davis et al. reported the case of a
12-year-old boy with autism determined through validated rating scales,
global hypotonia, a mild developmental left hemiparesis, and deficits in
motor planning and coordination with the dominant right hand (Davis
et al., 2012). The patient was found to have a deletion involving noncoding
exon 5 of RBFOX1 inherited through the father who was not clinically
evaluated (Davis et al., 2012). Most recently, Zhao reported 13 patients with
deletions (1 maternally inherited involving noncoding exon 6, 1 de novo
involving multiple coding exons between 1D and 10, and the inheritance
of the rest could not be determined) and 1 patient with a duplication (of
undetermined inheritance) within the RBFOX1 locus (Zhao, 2013).
Two patients in this report were excluded from phenotypic analysis due
to (1) the finding of an alternate Mendelian genetic diagnosis in addition
to a deletion involving RBFOX1 exon 5, and (2) the presence of multiple
nonneurological congenital anomalies of unclear etiology in a patient with
an RBFOX1 duplication involving exons 1D and 7 (Zhao, 2013). The
major clinical findings in the other patients (who all possessed intronic dele-
tions except for one that involved noncoding exon 6) included global devel-
opmental delay (58%), epilepsy (50%), macro- or microcephaly (50%), and
renal problems (33%) (Zhao, 2013). Of note, 50% of the patients with epi-
lepsy also had developmental delay, one patient with epilepsy but without
developmental delay was noted as intellectually disabled, and one patient
with developmental delay but without epilepsy was given a clinical diagnosis
of autism (Zhao, 2013). The extent of the clinical evaluation for ASD each
patient received in this cohort was unfortunately not reported, so it cannot
be assumed the other patients lacked such phenotypes.
In general, it has been presumed that the aforementioned CNVs lead to
reduced RBFOX1 expression. If true, then it would be consistent with the
observations that RBFOX1 haploinsufficiency results in a syndrome charac-
terized primarily by neurodevelopmental and neurological phenotypes
including ASD, intellectual disability, and epilepsy (Bhalla et al., 2004;
Martin et al., 2007). Data from knockdown studies in human neural progen-
itor cell lines modeling haploinsufficiency during neuronal differentiation
demonstrate widespread changes in RNA splicing and gene expression
(Fogel et al., 2012), and studies of the Rbfox1 neural-specific knockout
mouse show alterations in synaptic transmission, increased membrane excit-
ability, and a predisposition to seizures (Gehman et al., 2011). Interestingly,
whole transcriptome analysis in the brains of autistic patients reveals
decreased levels of RBFOX1 and dysregulation of RBFOX1-dependent
alternative splicing (Voineagu et al., 2011), similar to the effects seen in
haploinsufficient neuronal cell lines (Fogel et al., 2012). However, in the
majority of cases, the impact of the identified CNV to RBFOX1 expression
or function is unclear, as evidenced by the presence of identical CNVs in
controls and unaffected family members (Fig. 8.1B and C).
To better understand the contribution of structural variation in RBFOX1
to the development of autism and related disorders, we compiled all publi-
shed CNVs including those from two of the largest ASD cohorts, the Autism
Genetic Resource Exchange (AGRE), a primarily multiplex cohort of fam-
ilies with multiple affected siblings, and the Simons Simplex Cohort (SSC),
which contains families with only a single affected child (Fig. 8.1B and C). In
the AGRE cohort, we found that 2.2% of patients carried a CNV in the
RBFOX1 locus compared to 0.7% of unaffected siblings (OR 3.19,
p ¼ 0.006, 95% CI (1.27, 10.28)). In contrast, the SSC did not show a signif-
icantly increased odds ratio, with 2.6% of probands and 2.4% of their normal
siblings having a CNV (OR 1.11, p ¼ 0.77, 95% CI (0.59, 2.12)). While we
cannot rule out ascertainment bias or differences in population structure,
these data demonstrate a significant enrichment of RBFOX1 CNVs in a mul-
tiplex but not in a simplex cohort. This analysis reveals two additional striking
features. The first is that, irrespective of cohort, CNVs in RBFOX1 tend to be
inherited from an unaffected parent. Second, we observe a locational bias of
CNVs toward the 50 untranslated exons 1–7 (Fig. 8.1B) compared to the
RBFOX1 and ASD 257
constitutively translated exons 8–21 (Fig. 8.1C) with a preponderance of

ASD-related deletions occurring in the intron prior to exon 7, which con-
tains a potential translational start site (Fig. 8.1B). Although it is tempting to
speculate that these CNVs lead to a correlative alteration of the expression
level of RBFOX1, qualitatively, we also observe a large number of CNVs
in this intron within unaffected individuals in the DGV (Iafrate et al.,
2004) (Fig. 8.1B and C). Although the CNVs in the DGV appear to be some-
what smaller overall than those in those identified in ASD patients, we unfor-
tunately cannot conclude that larger CNVs have a higher impact on
phenotype, primarily due to differences in acquisition between the groups.
Therefore, taking all these observations together, we conclude that while
RBFOX1 CNVs confer a heritable risk of developing ASD, the majority
of RBFOX1 CNVs do not cause haploinsufficiency in isolation and other
factors, genetic or environmental, likely contribute.
Further complicating this clinical landscape, the phenotypic spectrum of
disease associated with disruption of RBFOX1 regulation and/or function
appears to extend into a cacophony of other phenotypes, some commonly
found in ASD patients, such as epilepsy and developmental delay. RBFOX1
CNVs have been reported in patients with idiopathic generalized epilepsy,
including one patient with epilepsy and ASD that removes exon 7 (Lal et al.,
2013). Additionally, the intron prior to exon 7 has a high number of CNVs
identified within the International Standard for Cytogenomic Arrays (ISCA)
database (https://www.iscaconsortium.org/) that are associated with pheno-
types such as global developmental, intellectual, and speech delay. It is pos-
sible that these reports could reflect populations that are on the ASD
spectrum but incompletely characterized. RBFOX1 CNVs have also been
identified in populations of individuals with schizophrenia (International
Schizophrenia Consortium, 2008; Melhem et al., 2011; Priebe et al.,
2013; Xu et al., 2008), however at a very low rate. The strongest evidence
for this association is an increased risk for male-specific schizophrenia (OR
8.2, 95% CI 0.8–84.4) due to duplications occurring just prior to exon 6,
predicted to be inherited from a single founder event (Melhem et al.,
2011). Finally, various cancer cells also show structural variation in
RBFOX1 (Andersen et al., 2011; Bass et al., 2011; Linnebacher et al.,
2013), suggesting either a potential postdevelopmental role in cellular
growth and/or differentiation in other tissues or disease consequences of
aberrant expression/regulation of RBFOX1 in nonspecific tissues.
Finally, although unlikely to be directly causative, RBFOX1 single
nucleotide polymorphism (SNP) variants have also be implicated in autism
(Wang et al., 2009) as well as a diverse array of other human conditions

including Alzheimer disease (Kohannim et al., 2012), bipolar disorder
(Le-Niculescu et al., 2009), attention-deficit hyperactivity disorder (Elia
et al., 2010), schizoaffective disorder (Hamshere et al., 2009), obesity
(Ma et al., 2010), and refractive error (Stambolian et al., 2013). It is unclear
whether these SNPs may, in some cases, cosegregate with other rare
sequence or structural variants directly influencing RBFOX1 expression
or regulation.
3. THE CONTRIBUTIONS OF RBFOX1 MODEL SYSTEMS

TO MOLECULAR PATHOGENESIS
The first member of the RBFOX1 family of alternative splicing factors
was initially reported in a search for modifiers of sexual differentiation in
C. elegans (Hodgkin, Zellan, & Albertson, 1994). Feminization on X (fox-1)
was identified as a dominant factor that feminizes XO males and causes high
levels of male lethality due to its ability to splice the xol-1 (XO (male) lethal-
ity) gene (Kuroyanagi, 2009). The Drosophila melanogaster homologue
(dA2bp1, also known as CG3206) and zebrafish homologues (rbfox1 and
rbfox1l) were subsequently identified and shown upon constitutive knock-
down to be embryonic lethal, suggesting an early role in embryogenesis
(Bajpai, Sambrani, Stadelmayer, & Shashidhara, 2004; Gallagher et al.,
2011; Hodgkin et al., 1994). Although the mechanism underlying this early
lethality has not been explained, it provides one potential explanation for the
high sequence conservation in RBFOX1 observed from worms to humans
and the lack of CNVs found within the coding region of patient and control
samples (Fig. 8.1C). Human RBFOX1 was original identified through its
interaction with ataxin-2, the protein causing the neurodegenerative disease
spinocerebellar ataxia type 2 (SCA2) (Shibata, Huynh, & Pulst, 2000).
Although the functional significance of this interaction is not yet fully under-
stood, it likely contributes to ataxin-2’s established role in RNA processing
and translation (Lim & Allada, 2013). Interestingly, RBFOX1 is present in
other protein–protein and gene interaction networks related to cerebellar
ataxia (Fogel & Perlman, 2011; Lim et al., 2006), and it affects the splicing
and transcription of other ataxia genes in human neural progenitor cells
(Fogel et al., 2012), an intriguing observation given that cerebellar dysfunc-
tion may contribute to the autistic phenotype (Fatemi et al., 2012).
Jin and coworkers were the first to confirm that zebrafish rbfox1l was
involved in alternative RNA splicing (Jin et al., 2003). They demonstrated
RBFOX1 and ASD 259
that rbfox1l could bind to an intronic GCAUG pentanucleotide and affect

splicing by repressing exon inclusion if the binding site was upstream or
enhancing inclusion if the site were downstream ( Jin et al., 2003). The
mechanism of repressing exon inclusion involves the hindrance of pre-
spliceosomal complexes (Kuroyanagi, 2009) and can be overcome by over-
expression of spliceosomal components (Zhou & Lou, 2008). By extension,
reduction of RBFOX1 due to haploinsufficiency in patients could allow
spliceosome factors to outcompete RBFOX1 for binding, thereby altering
splicing for some targets. The mechanism for enhancing exon inclusion is
less well defined. Sun and coworkers demonstrated that the c-terminus of
RBFOX1 is required for this process, implicating protein–protein interac-
tions as key to enhancing exon usage (Sun, Zhang, Fregoso, & Krainer,
2012). Our recent studies of splicing in human neural progenitor cell lines
demonstrated globally that downstream sequences tend to function as
enhancers, while upstream sequences can mediate both repression and
enhancement of specific exons (Fogel et al., 2012), suggesting a role for local
context in determining the function of RBFOX1. Furthermore, only 56%
of the splicing events colocalized with the canonical RBFOX1 binding site,
suggesting an interplay of both direct and indirect regulatory mechanisms, or
possibly noncanonical binding sites that have yet to be discovered (Fogel
et al., 2012).
4. A MODEL FOR THE DYSREGULATION OF RBFOX1

IN HUMAN NEURODEVELOPMENTAL DISEASE
As discussed earlier, a great deal of scientific evidence supports a role
for RBFOX1 in the regulation of gene expression during human
neurodevelopment. Clinical evidence further supports an association with
neurodevelopmental disease in humans when haploinsufficient. The obser-
vation of noncoding de novo structural variants in RBFOX1 in patients with
ASD would be consistent with the hypothesis that such variation leads to
haploinsufficiency. However, the finding that the majority of structural var-
iation in these patients is inherited, including variants similar to those seen de
novo (Fig. 8.1), appears to counteract that hypothesis. An imprinting effect
seems unlikely as there does not appear to be a sex preference to CNV inher-
itance and disease association. How then does one reconcile this data with
the scientific evidence? One possible conclusion is that much of the noncod-
ing structural variation seen is in fact nonpathogenic and the observation of
multiple CNVs in ASD patients is the product of the large size of the
RBFOX1 gene, the commonality of structural variation in the human

genome (Fogel & Geschwind, 2012), and an increased rate in the occurrence
of such variation at that locus (Bass et al., 2011; Yi & Li, 2005). However, if
this were the case, it would be expected that CNVs in RBFOX1 would
occur at equal frequency in the population as a whole, without enrichment
in ASD cohorts. Therefore, the finding of an enrichment in inherited
RBFOX1 CNVs using stringent criteria in a large multiplex ASD cohort,
but not in a large simplex cohort as described earlier, points to a different
interpretation (see Fig. 8.2). In this model, RBFOX1 CNVs confer an
increased risk of developing ASD, dependent upon unknown genetic or
environmental factors that influence RBFOX1-regulated cellular programs.
Regulation of splicing factors can have profound consequences with
regard to neurodevelopmental outcome. There are two examples of Rbfox1
transcriptional regulation. In zebrafish, the homeobox transcription factor
Otp in complex with phospho-CREB binds the rbfox1 promoter in response
to physical or osmotic stress (Amir-Zilberstein et al., 2012). Subsequently,
Rbfox1 regulates splicing of the PACAP receptor, pac1, that in turn mod-
ulates corticotropin-releasing hormone (Crh) levels, stimulating recovery
from stress (Amir-Zilberstein et al., 2012). Increases in Crh can manifest
as increased anxiety or disturbances of sleep (Holsboer & Ising, 2008), both
of which are common in ASD (Mazzone, Ruta, & Reale, 2012; Richdale &
Schreck, 2009). A second candidate transcriptional regulator is Myt1l, which
can bind four distinct binding sites in the Rbfox1 promoter (Hu et al., 2013).
In an analysis of human and mouse expression data, consistent coexpression
is seen between RBFOX1 and MYT1L in a dataset from patients with
frontotemporal dementia (chosen due to an observed twofold reduction
of MYT1L) and in two large databases that collate expression data: the
UCLA Gene Expression Tool and COXPRESdb (Bill, unpublished obser-
vation; Chen-Plotkin et al., 2008; Day, Carlson, Dong, O’Connor, &
Nelson, 2007; Day et al., 2009; Obayashi & Kinoshita, 2011). Since MYT1L
has been shown to be critical for the transdifferentiation of IPSCs
(Takahashi & Yamanaka, 2006) and has been associated with ASD
(Meyer, Axelsen, Sheffield, Patil, & Wassink, 2012), intellectual delay and
obesity (Stevens et al., 2011), and schizophrenia (Lee et al., 2012; Van
Den Bossche et al., 2013; Vrijenhoek et al., 2008), this is a finding of par-
ticular clinical relevance. As the regulation of RBFOX1 transcription is not
yet fully understood, it is possible that CNVs in the 5’ UTR may interfere
with this process, either constitutively or in response to certain stressors
requiring modifications in RBFOX1 expression (Fig. 8.2).
RBFOX1 and ASD 261
Cellular stress
Adaptive Adaptive
transcriptional alternative
regulation splicing
Altered
RBFOX1 RBFOX1
function
adapts cell
to stressor
RNA splicing
Autism
spectrum
disorder
Transcription
Routine 1. Impaired routine function
function (e.g., Haploinsufficiency)
2. Impaired adaptive response
(e.g., Potential role for CNVs?)
Normal brain
development
Figure 8.2 Proposed model for RBFOX1 dysregulation in autism spectrum disorder. Dur-
ing neurodevelopment, RBFOX1 regulates large genetic networks via direct effects on
RNA splicing, mRNA stability, and transcriptional regulation as well as indirect effects on
gene transcription leading to normal neuronal development. If this function is disrupted
(e.g., by haploinsufficiency of RBFOX1), development is sufficiently perturbed resulting
in autism spectrum disorder (ASD). As discussed in the text, RBFOX1 may play a further
role in the adaptive response to cellular stress by regulating RNA splicing or transcrip-
tional effects in response to environmental stimuli to maintain normal function. If this
process is perturbed, this may also result in ASD. Inherited structural variation (CNVs)
may damage RBFOX1 RNA processing or transcriptional signals and thus impair this
adaptive response, thereby increasing the risk of ASD occurring upon exposure to cer-
tain environmental stressors during critical stages in neurodevelopment.
It is known that many genes, including RBFOX1, undergo extensive

alternative splicing (Fogel et al., 2012; Underwood et al., 2005) and that
such splicing patterns can be altered by changes to the cellular environment
(Lee, Tang, & Black, 2009). Rbfox1 RNA has been shown to be regulated
via effects on RNA stability (Pistoni et al., 2013) and alternative splicing
(Damianov & Black, 2010; Lee et al., 2009). Rbfox1 can autoregulate the
splicing of its own RNA-binding domain creating a functional dominant
negative, and thus regulate its own activity (Damianov & Black, 2010). Fur-
thermore, Lee et al. have demonstrated that cellular depolarization, known
to widely affect RNA splicing, causes alternative splicing of murine Rbfox1
in neurons, resulting in a change in subcellular localization of the protein and
subsequent reversal of the effects of depolarization on the splicing of other
Rbfox1 targets, which they interpret as a novel adaptive mechanism to
chronic stimuli (Lee et al., 2009). Regulation of RBFOX1 alternative splic-
ing in response to cellular stressors could therefore play a meaningful role in
neurodevelopment and provide another possible regulatory mechanism
CNVs may affect (Fig. 8.2).
Given the extensive networks of genes regulated both directly and indi-
rectly by RBFOX1 (Fogel et al., 2012; Ray et al., 2013), it is likely that var-
ious stimuli could occur throughout the course of neuronal development
that require an adaptive response from RBFOX1, alone or in conjunction
with other factors, to maintain normal expression profiles. Therefore, it
may be supposed that mutations in RBFOX1 could exist which impair
these adaptive responses while having no, or minimal, effect on routine
function. Applying this scenario to human neurodevelopment, noncoding
variation that directly disrupts RBFOX1 expression would act to cause
haploinsufficiency and therefore disease, whereas variation altering accessory
regulatory responses (e.g., various target binding sequences) would only lead
to disease under cellular conditions requiring function of those elements. If
such conditions are rare, or only transient, then the ability to mount a limited
adaptive response may be tolerated, but if the condition is such that the adap-
tive response is essential for normal brain development, this inability to
respond could result in disease. This synergizes well with the suspected con-
tribution of environmental factors to ASD if exposure occurs during critical
points in brain development (Herbert, 2010) and suggests a mechanism
whereby variation in the RBFOX1 gene could modify ASD risk under cer-
tain conditions, but not others. Families tend to stay in the same environ-
ment for long periods of time, and, therefore, children are often exposed
to the same environmental stressors as their siblings. If RBFOX1 CNVs con-
fer ASD risk in a particular environmental context, the pathogenicity of such
variants would be most apparent in families with multiple affected children.
This model could explain why enrichment of RBFOX1 CNVs is seen in a
multiplex, but not a simplex, cohort, as shown earlier. Further work will be
RBFOX1 and ASD 263
essential to confirm this hypothesis as well as to identify and characterize

such regulatory elements and determine what cellular or environmental sig-
nals trigger their use. If validated, therapies stimulating such factors or
inhibiting the triggering signals could be useful to minimize ASD risk in
families with known pathogenic CNVs in RBFOX1 and possibly other
genes as well. Until such evidence is available, however, we must continue
to observe caution in the interpretation of inherited RBFOX1 CNVs as
pathogenic when passed on from unaffected individuals.
ACKNOWLEDGMENTS
The authors wish to thank Stephan Sanders for his invaluable assistance with the assessment of
copy number variation in the autism cohorts as well as Daniel H. Geschwind (D.H.G.) for his
support and helpful suggestions. Data in this chapter were obtained from the ISCA
Consortium database (www.iscaconsortium.org), which generates this information using
NCBI’s database of genomic structural variation (dbVar, www.ncbi.nlm.nih.gov/dbvar/),
study nstd37. Samples and associated phenotype data were provided by ISCA. We
gratefully acknowledge the resources provided by the Autism Genetic Resource
Exchange (AGRE) Consortium and the participating AGRE families. The Autism
Genetic Resource Exchange is a program of Autism Speaks and is supported, in part, by
Grant 1U24MH081810 from the National Institute of Mental Health to Clara M.
Lajonchere (PI). This work was supported by the National Institutes of Health
(9R01MH100027 to D.H.G. and K08MH086297 to B.L.F.) and Simons SFARI award
206744 to D.H.G.
REFERENCES
Amir-Zilberstein, L., Blechman, J., Sztainberg, Y., Norton, W. H., Reuveny, A.,
Borodovsky, N., et al. (2012). Homeodomain protein otp and activity-dependent splic-
ing modulate neuronal adaptation to stress. Neuron, 73(2), 279–291.
Andersen, C. L., Lamy, P., Thorsen, K., Kjeldsen, E., Wikman, F., Villesen, P., et al. (2011).
Frequent genomic loss at chr16p13.2 is associated with poor prognosis in colorectal can-
cer. International Journal of Cancer, 129(8), 1848–1858.
Bajpai, R., Sambrani, N., Stadelmayer, B., & Shashidhara, L. S. (2004). Identification of a
novel target of D/V signaling in Drosophila wing disc: Wg-independent function of
the organizer. Gene Expression Patterns, 5(1), 113–121.
Bass, A. J., Lawrence, M. S., Brace, L. E., Ramos, A. H., Drier, Y., Cibulskis, K., et al.
(2011). Genomic sequencing of colorectal adenocarcinomas identifies a recurrent
VTI1A-TCF7L2 fusion. Nature Genetics, 43(10), 964–968.
Bhalla, K., Phillips, H. A., Crawford, J., McKenzie, O. L., Mulley, J. C., Eyre, H., et al.
(2004). The de novo chromosome 16 translocations of two patients with abnormal phe-
notypes (mental retardation and epilepsy) disrupt the A2BP1 gene. Journal of Human
Genetics, 49(6), 308–311.
Bill, B. R., & Geschwind, D. H. (2009). Genetic advances in autism: Heterogeneity and con-
vergence on shared pathways. Current Opinion in Genetics & Development, 19(3), 271–278.
Chen-Plotkin, A. S., Geser, F., Plotkin, J. B., Clark, C. M., Kwong, L. K., Yuan, W., et al.
(2008). Variations in the progranulin gene affect global gene expression in
frontotemporal lobar degeneration. Human Molecular Genetics, 17(10), 1349–1362.
Damianov, A., & Black, D. L. (2010). Autoregulation of Fox protein expression to produce
dominant negative splicing factors. RNA, 16(2), 405–416.
Davis, L. K., Maltman, N., Mosconi, M. W., Macmillan, C., Schmitt, L., Moore, K., et al.
(2012). Rare inherited A2BP1 deletion in a proband with autism and developmental
hemiparesis. American Journal of Medical Genetics Part A, 158A(7), 1654–1661.
Day, A., Carlson, M. R., Dong, J., O’Connor, B. D., & Nelson, S. F. (2007). Celsius:
A community resource for Affymetrix microarray data. Genome Biology, 8(6), R112.
Day, A., Dong, J., Funari, V. A., Harry, B., Strom, S. P., Cohn, D. H., et al. (2009). Disease
gene characterization through large-scale co-expression analysis. PLoS ONE, 4(12),
e8491.
Elia, J., Gai, X., Xie, H. M., Perin, J. C., Geiger, E., Glessner, J. T., et al. (2010). Rare struc-
tural variants found in attention-deficit hyperactivity disorder are preferentially associ-
ated with neurodevelopmental genes. Molecular Psychiatry, 15(6), 637–646.
11(3), 777–807.
Fogel, B. L., & Geschwind, D. H. (2012). Clinical neurogenetics. In R. Daroff, G. Fenichel,
J. Jankovic, & J. Mazziotta (Eds.), Neurology in clinical practice (6th ed., pp. 704–734).
Philadelphia, PA: Elsevier.
Fogel, B. L., & Perlman, S. (2011). Cerebellar disorders: Balancing the approach to cerebellar
ataxia. In N. Gálvez-Jiménez & P. J. Tuite (Eds.), Uncommon causes of movement disorders
(1st ed., pp. 198–216). Cambridge, NY: Cambridge University Press.
Fogel, B. L., Wexler, E., Wahnich, A., Friedrich, T., Vijayendran, C., Gao, F., et al. (2012).
RBFOX1 regulates both splicing and transcriptional networks in human neuronal devel-
opment. Human Molecular Genetics, 21(19), 4171–4186.
Gallagher, T. L., Arribere, J. A., Geurts, P. A., Exner, C. R., McDonald, K. L., Dill, K. K.,
et al. (2011). Rbfox-regulated alternative splicing is critical for zebrafish cardiac and skel-
etal muscle functions. Developmental Biology, 359(2), 251–261.
Gehman, L. T., Stoilov, P., Maguire, J., Damianov, A., Lin, C. H., Shiue, L., et al. (2011).
The splicing regulator Rbfox1 (A2BP1) controls neuronal excitation in the mammalian
brain. Nature Genetics, 43(7), 706–711.
Hamshere, M. L., Green, E. K., Jones, I. R., Jones, L., Moskvina, V., Kirov, G., et al. (2009).
Genetic utility of broadly defined bipolar schizoaffective disorder as a diagnostic concept.
The British Journal of Psychiatry, 195(1), 23–29.
Herbert, M. R. (2010). Contributions of the environment and environmentally vulnerable
physiology to autism spectrum disorders. Current Opinion in Neurology, 23(2), 103–110.
Hodgkin, J., Zellan, J. D., & Albertson, D. G. (1994). Identification of a candidate primary
sex determination locus, fox-1, on the X chromosome of Caenorhabditis elegans.
Development, 120(12), 3681–3689.
Holsboer, F., & Ising, M. (2008). Central CRH system in depression and anxiety—Evidence
from clinical studies with CRH1 receptor antagonists. European Journal of Pharmacology,
583(2–3), 350–357.
Hu, J., Ho, A. L., Yuan, L., Hu, B., Hua, S., Hwang, S. S., et al. (2013). Neutralization of
terminal differentiation in gliomagenesis. Proceedings of the National Academy of Sciences of
the United States of America, 110(36), 14520–14527.
Iafrate, A. J., Feuk, L., Rivera, M. N., Listewnik, M. L., Donahoe, P. K., Qi, Y., et al. (2004).
Detection of large-scale variation in the human genome. Nature Genetics, 36(9), 949–951.
International Schizophrenia Consortium. (2008). Rare chromosomal deletions and duplica-
tions increase risk of schizophrenia. Nature, 455(7210), 237–241.
Jin, Y., Suzuki, H., Maegawa, S., Endo, H., Sugano, S., Hashimoto, K., et al. (2003).
A vertebrate RNA-binding protein Fox-1 regulates tissue-specific splicing via the
pentanucleotide GCAUG. The EMBO Journal, 22(4), 905–912.
RBFOX1 and ASD 265
Kohannim, O., Hibar, D. P., Jahanshad, N., Stein, J. L., Hua, X., Toga, A. W., et al. (2012).
Predicting temporal lobe volume on Mri from genotypes using L(1)–L(2) regularized
regression. Proceedings of IEEE International Symposium on Biomedical Imaging, 1160–1163.
Kuroyanagi, H. (2009). Fox-1 family of RNA-binding proteins. Cellular and Molecular Life
Sciences, 66(24), 3895–3907.
Lal, D., Trucks, H., Moller, R. S., Hjalgrim, H., Koeleman, B. P., de Kovel, C. G., et al.
(2013). Rare exonic deletions of the RBFOX1 gene increase risk of idiopathic gener-
alized epilepsy. Epilepsia, 54(2), 265–271.
Lee, Y., Mattai, A., Long, R., Rapoport, J. L., Gogtay, N., & Addington, A. M. (2012).
Microduplications disrupting the MYT1L gene (2p25.3) are associated with schizophre-
nia. Psychiatric Genetics, 22(4), 206–209.
Lee, J. A., Tang, Z. Z., & Black, D. L. (2009). An inducible change in Fox-1/A2BP1 splicing
modulates the alternative splicing of downstream neuronal target exons. Genes & Devel-
opment, 23(19), 2284–2293.
Le-Niculescu, H., Patel, S. D., Bhat, M., Kuczenski, R., Faraone, S. V., Tsuang, M. T., et al.
(2009). Convergent functional genomics of genome-wide association data for bipolar
disorder: Comprehensive identification of candidate genes, pathways and mechanisms.
American Journal of Medical Genetics Part B, Neuropsychiatric Genetics, 150B(2), 155–181.
Lim, C., & Allada, R. (2013). ATAXIN-2 activates PERIOD translation to sustain circadian
rhythms in Drosophila. Science, 340(6134), 875–879.
Lim, J., Hao, T., Shaw, C., Patel, A. J., Szabo, G., Rual, J. F., et al. (2006). A protein-protein
interaction network for human inherited ataxias and disorders of Purkinje cell degener-
ation. Cell, 125(4), 801–814.
Linnebacher, M., Ostwald, C., Koczan, D., Salem, T., Schneider, B., Krohn, M., et al.
(2013). Single nucleotide polymorphism array analysis of microsatellite-stable,
diploid/near-diploid colorectal carcinomas without the CpG island methylator pheno-
type. Oncology Letters, 5(1), 173–178.
Ma, L., Hanson, R. L., Traurig, M. T., Muller, Y. L., Kaur, B. P., Perez, J. M., et al. (2010).
Evaluation of A2BP1 as an obesity gene. Diabetes, 59(11), 2837–2845.
Martin, C. L., Duvall, J. A., Ilkin, Y., Simon, J. S., Arreaza, M. G., Wilkes, K., et al. (2007).
Cytogenetic and molecular characterization of A2BP1/FOX1 as a candidate gene for
autism. American Journal of Medical Genetics Part B, Neuropsychiatric Genetics, 144(7), 869–876.
Mazzone, L., Ruta, L., & Reale, L. (2012). Psychiatric comorbidities in asperger syndrome and
high functioning autism: Diagnostic challenges. Annals of General Psychiatry, 11(1), 16.
Melhem, N., Middleton, F., McFadden, K., Klei, L., Faraone, S. V., Vinogradov, S., et al.
(2011). Copy number variants for schizophrenia and related psychotic disorders in Oce-
anic Palau: Risk and transmission in extended pedigrees. Biological Psychiatry, 70(12),
1115–1121.
Meyer, K. J., Axelsen, M. S., Sheffield, V. C., Patil, S. R., & Wassink, T. H. (2012).
Germline mosaic transmission of a novel duplication of PXDN and MYT1L to two male
half-siblings with autism. Psychiatric Genetics, 22(3), 137–140.
Mikhail, F. M., Lose, E. J., Robin, N. H., Descartes, M. D., Rutledge, K. D.,
Rutledge, S. L., et al. (2011). Clinically relevant single gene or intragenic deletions
encompassing critical neurodevelopmental genes in patients with developmental delay,
mental retardation, and/or autism spectrum disorders. American Journal of Medical Genetics
Part A, 155A(10), 2386–2396.
Obayashi, T., & Kinoshita, K. (2011). COXPRESdb: A database to compare gene
coexpression in seven model animals. Nucleic Acids Research, 39(Database issue),
D1016–D1022.
Pescosolido, M. F., Yang, U., Sabbagh, M., & Morrow, E. M. (2012). Lighting a path:
Genetic studies pinpoint neurodevelopmental mechanisms in autism and related disor-
ders. Dialogues in Clinical Neuroscience, 14(3), 239–252.
Pistoni, M., Shiue, L., Cline, M. S., Bortolanza, S., Neguembor, M. V., Xynos, A., et al.
(2013). Rbfox1 downregulation and altered calpain 3 splicing by FRG1 in a mouse
model of Facioscapulohumeral muscular dystrophy (FSHD). PLoS Genetics, 9(1),
e1003186.
Priebe, L., Degenhardt, F., Strohmaier, J., Breuer, R., Herms, S., Witt, S. H., et al. (2013).
Copy number variants in German patients with schizophrenia. PLoS ONE, 8(7),
e64035.
Ray, D., Kazan, H., Cook, K. B., Weirauch, M. T., Najafabadi, H. S., Li, X., et al. (2013).
A compendium of RNA-binding motifs for decoding gene regulation. Nature,
499(7457), 172–177.
Richdale, A. L., & Schreck, K. A. (2009). Sleep problems in autism spectrum disorders: Prev-
alence, nature, & possible biopsychosocial aetiologies. Sleep Medicine Reviews, 13(6),
403–411.
Strong association of de novo copy number mutations with autism. Science,
316(5823), 445–449.
Shibata, H., Huynh, D. P., & Pulst, S. M. (2000). A novel protein with RNA-binding motifs
interacts with ataxin-2. Human Molecular Genetics, 9(9), 1303–1313.
Stambolian, D., Wojciechowski, R., Oexle, K., Pirastu, M., Li, X., Raffel, L. J., et al. (2013).
Meta-analysis of genome-wide association studies in five cohorts reveals common var-
iants in RBFOX1, a regulator of tissue-specific splicing, associated with refractive error.
Stevens, S. J., van Ravenswaaij-Arts, C. M., Janssen, J. W., Klein Wassink-Ruiter, J. S., van
Essen, A. J., Dijkhuizen, T., et al. (2011). MYT1L is a candidate gene for intellectual
disability in patients with 2p25.3 (2pter) deletions. American Journal of Medical Genetics
Part A, 155A(11), 2739–2745. http://dx.doi.org/10.1002/ajmg.a.34274.
Sun, S., Zhang, Z., Fregoso, O., & Krainer, A. R. (2012). Mechanisms of activation and
repression by the alternative splicing factors RBFOX1/2. RNA, 18(2), 274–283.
Takahashi, K., & Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell, 126(4), 663–676.
Underwood, J. G., Boutz, P. L., Dougherty, J. D., Stoilov, P., & Black, D. L. (2005). Homo-
logues of the Caenorhabditis elegans Fox-1 protein are neuronal splicing regulators in
mammals. Molecular and Cellular Biology, 25(22), 10005–10016.
Usha, N., & Shashidhara, L. S. (2010). Interaction between Ataxin-2 binding protein 1 and
Cubitus-interruptus during wing development in Drosophila. Developmental Biology,
341(2), 389–399.
Van Den Bossche, M. J., Strazisar, M., Cammaerts, S., Liekens, A. M., Vandeweyer, G.,
Depreeuw, V., et al. (2013). Identification of rare copy number variants in high burden
schizophrenia families. American Journal of Medical Genetics Part B, Neuropsychiatric Genetics,
162B(3), 273–282. http://dx.doi.org/10.1002/ajmg.b.32146.
474(7351), 380–384.
Vrijenhoek, T., Buizer-Voskamp, J. E., van der Stelt, I., Strengman, E., Sabatti, C., Geurts
van Kessel, A., et al. (2008). Recurrent CNVs disrupt three candidate genes in schizo-
phrenia patients. American Journal of Human Genetics, 83(4), 504–510.
Wang, E. T., Sandberg, R., Luo, S., Khrebtukova, I., Zhang, L., Mayr, C., et al. (2008).
Alternative isoform regulation in human tissue transcriptomes. Nature, 456(7221),
470–476.
459(7246), 528–533.
RBFOX1 and ASD 267
Wintle, R. F., Lionel, A. C., Hu, P., Ginsberg, S. D., Pinto, D., Thiruvahindrapduram, B.,
et al. (2011). A genotype resource for postmortem brain samples from the Autism Tissue
Program. Autism Research, 4(2), 89–97.
Xu, B., Roos, J. L., Levy, S., van Rensburg, E. J., Gogos, J. A., & Karayiorgou, M. (2008).
Strong association of de novo copy number mutations with sporadic schizophrenia.
Nature Genetics, 40(7), 880–885.
Yeo, G. W., Nostrand, E. L., & Liang, T. Y. (2007). Discovery and analysis of evolutionarily
conserved intronic splicing regulatory elements. PLoS Genetics, 3(5), e85.
Yeo, G. W., Xu, X., Liang, T. Y., Muotri, A. R., Carson, C. T., Coufal, N. G., et al. (2007).
Alternative splicing events identified in human embryonic stem cells and neural progen-
itors. PLoS Computational Biology, 3(10), 1951–1967.
Yi, S., & Li, W. H. (2005). Molecular evolution of recombination hotspots and highly
recombining pseudoautosomal regions in hominoids. Molecular Biology and Evolution,
22(5), 1223–1230.
Zhang, C., Zhang, Z., Castle, J., Sun, S., Johnson, J., Krainer, A. R., et al. (2008). Defining
the regulatory network of the tissue-specific splicing factors Fox-1 and Fox-2. Genes &
Development, 22(18), 2550–2563.
Zhao, W. W. (2013). Intragenic deletion of RBFOX1 associated with neurodevelopmental/
neuropsychiatric disorders and possibly other clinical presentations. Molecular Cytogenetics,
6(1), 26.
Zhou, H. L., & Lou, H. (2008). Repression of prespliceosome complex formation at two
distinct steps by Fox-1/Fox-2 proteins. Molecular and Cellular Biology, 28(17),
5507–5516.
CHAPTER NINE
Immune Dysregulation in Autism

Spectrum Disorder
Elaine Y. Hsiao1
Division of Biology and Biological Engineering, Division of Chemistry and Chemical Engineering,
California Institute of Technology, Pasadena, California, USA
1
Corresponding author: e-mail address: ehsiao@caltech.edu
Contents
1. Introduction: The Autism Spectrum 270
2. Genetic and Environmental Contributions to ASD 272
3. Immune Activation as a Primary Risk Factor for ASD 273
3.1 Maternal immune activation 273
3.2 Maternal autoantibody production 276
4. Immune-Related Genetic Risk Factors for ASD 278
4.1 Major histocompatibility complex molecules 279
5. Postnatal Immune Dysregulation in ASD 280
5.1 Neuroimmune abnormalities 280
5.2 Peripheral immune abnormalities in ASD 285
6. Immune Contributions to ASD Pathogenesis 287
7. Immune-Related Therapies for ASD 289
8. Conclusion 290
References 292
Abstract
Autism spectrum disorder (ASD) is a highly heterogeneous disorder diagnosed based
on the presence and severity of core abnormalities in social communication and repet-
itive behavior, yet several studies converge on immune dysregulation as a feature of
ASD. Widespread alterations in immune molecules and responses are seen in the brains
and periphery of ASD individuals, and early life immune disruptions are associated with
ASD. This chapter discusses immune-related environmental and genetic risk factors for
ASD, emphasizing population-wide studies and animal research that reveal potential
mechanistic pathways involved in the development of ASD-related symptoms. It further
reviews immunologic pathologies seen in ASD individuals and how such abnormalities
can impact neurodevelopment and behavior. Finally, it evaluates emerging evidence for
an immune contribution to the pathogenesis of ASD and a potential role for immuno-
modulatory effects in current treatments for ASD.

http://dx.doi.org/10.1016/B978-0-12-418700-9.00009-5
270 Elaine Y. Hsiao
1. INTRODUCTION: THE AUTISM SPECTRUM

In 1943, Leo Kanner described in vivid detail the background and
symptoms of 11 children with what he termed “early infantile autism”
(Kanner, 1968). The behavioral abnormalities he depicted—impaired social
communication and restricted interests or repetitive behaviors—now form
the core diagnostic criteria for autism spectrum disorder (ASD), a serious
neurodevelopmental condition afflicting one in 88 children in the United
States, as of 2008 (Autism and Developmental Disabilities Monitoring
Network Surveillance Year 2008 Principle Investigators and Centers for
Disease Control and Prevention, 2012). According to the 5th edition of
the Diagnostic and Statistical Manual of Mental Disorders (DSM), ASD is
diagnosed in individuals exhibiting three social communication or interac-
tion deficits and at least two symptoms of restricted or repetitive behaviors.
There are a variety of specific symptoms that classify within each diagnostic
category. As such, the same overall ASD diagnosis includes individuals that
vary symptomatically under the two characteristic domains for ASD.
Not only is there a spectrum in the presence and severity of core diag-
nostic features, but there is also a myriad of comorbid conditions associated
with ASD (Fig. 9.1) (Bauman, 2010; Kohane et al., 2012). In fact, Kanner
noted symptoms of many prevalent ASD comorbidities in his seminal
descriptions of autistic children, including enlarged head circumference,
aggression, intellectual disability, and feeding abnormalities (Kanner,
1968). Today, it is estimated that up to 30% of ASD children display
macrocephaly (Fidler, Bailey, & Smalley, 2000), up to 70% exhibit aggres-
sive behavior (Kanne & Mazurek, 2011) and/or intellectual disability
(Yeargin-Allsopp, 2002), and up to 91% present with gastrointestinal prob-
lems (Coury et al., 2012). In addition, seizures and epilepsy are seen in an
estimated 46% of ASD individuals (Spence & Schneider, 2009), and addi-
tional behavioral issues such as hyperactivity, anxiety, and sleep disruption
are common. A number of metabolic and immunologic abnormalities are
also reported in some ASD individuals, raising the possibility of identifying
peripheral biomarkers and surrogate markers for subsets of ASD.
The striking clinical heterogeneity of ASD, along with its dependence on
behavioral diagnostic criteria, makes it especially challenging to identify uni-
versal molecular biomarkers, etiologies, and treatments for the disorder. It
has thus become important to evaluate the molecular underpinnings of dis-
ease in well-defined subclasses of ASD. A recent study proposes that ASD
Immune Dysregulation in Autism Spectrum Disorder 271
Intellectual Immune
disability dysfunction
Seizures/ Gastrointestinal
epilepsy symptoms
Repetitive/
Impaired social Metabolic
stereotyped
Aggression communication abnormalities
behavior
Hyperactivity Macrocephaly
Sleep
Anxiety
deficiency
Figure 9.1 Comorbidities of ASD. Although ASD is diagnosed based on the presence
of stereotypical behavior and impairments in social communication, a wide variety of
medical comorbidities are observed in ASD individuals. The striking heterogeneity
of ASD points to the need to tailor research to well-defined subsets of ASD individuals.
cases can be classified into four principal subgroups characterized by the

presence of ASD-associated circadian and sensory dysfunction, stereotyped
behavior, neurodevelopmental delay, and/or immune abnormalities (Sacco
et al., 2012). Furthermore, genetic studies confined to well-delineated sub-
sets of ASD have uncovered novel pathways that might underlie specific
autism-related symptoms and comorbidities. For example, the ASD-
associated allelic variant of the gene encoding the Met receptor tyrosine
kinase (MET) is specifically enriched in ASD individuals with comorbid gas-
trointestinal conditions, and not in those without, demonstrating that dis-
tinct genetic susceptibility factors may increase the risk for particular
subsets of ASD (Campbell et al., 2009) (discussed in detail in this volume,
Section 5).
This chapter discusses immune dysregulation as a primary comorbidity
seen in subsets of individuals with ASD. Immune-related environmental
272 Elaine Y. Hsiao
and genetic risk factors for ASD are examined, drawing from both human
and animal studies that reveal a role for immune activation in the etiology of
ASD-related behavioral and neuropathologic abnormalities. In addition,
several postnatal immune disturbances that have been reported in ASD indi-
viduals are reviewed and evaluated in the context of emerging evidence
supporting a primary role for immune molecules in the regulation of neu-
rodevelopmental processes and an increasing appreciation for the influence
of peripheral immunity on the brain and behavior.
2. GENETIC AND ENVIRONMENTAL CONTRIBUTIONS

TO ASD
ASD is a highly heritable disorder caused by a combination of multiple
genetic and environmental risk factors. Consistent with a genetic contribu-
tion to the disorder, concordance for ASD is stronger for monozygotic twins
than for dizygotic twins (Bailey et al., 1995; Folstein & Rutter, 1977;
Rosenberg et al., 2009; Spence & Schneider, 2009; Steffenburg et al.,
1989). In addition, de novo mutations, single-nucleotide polymorphisms
(SNPs), and copy number variations (CNVs), in several genes, have been
found to increase the risk for ASD. Many of the affected genes, such as those
encoding neuroligin-3, neurexin-1, SH3 and multiple ankyrin repeat
domains 3 (SHANK3), and contactin-associated protein-2 (CNTNAP2),
are known to regulate synaptic function, and several ASD-associated CNVs
are enriched in genes required for normal synaptic transmission (Delorme
et al., 2013; Noh et al., 2013; Toro et al., 2010). Such genetic abnormalities
thus represent a direct mechanism for impairing neurodevelopment. Despite
recent advances in genome-wide association, whole-genome and whole-
exome sequencing analyses, however, it is estimated that the susceptibility
genes and mutations uncovered to date collectively account for <20% of
ASD cases (Abrahams & Geschwind, 2010). The fact that very few cases
of ASD can be attributed to a defined genetic etiology has motivated efforts
to identify environmental risk factors for ASD. Furthermore, the dramatic
rise in ASD prevalence in recent years has raised the question of whether
elevated exposure to environmental agents, such as toxins, air pollutants,
and dietary changes, might contribute to the increasing diagnosis of ASD.
Additional studies reveal that the concordance of ASD among dizygotic
twins is higher than that for nontwin siblings (Constantino, Zhang, Frazier,
Abbacchi, & Law, 2010; Hallmayer et al., 2011), suggesting an important
role for environmental risk factors in the etiology of ASD. A recent large
twin study highlights shared environment as a major component in ASD

risk, accounting for 62% of ASD twin concordance, whereas genetic factors
contribute 38% liability (Hallmayer et al., 2011). Furthermore, genome-
wide examination of DNA methylation patterns in discordant twins reveals
numerous ASD-associated epigenetic changes, suggesting that environmen-
tal insults can trigger epigenetic modifications that contribute to the herita-
bility of ASD (Wong et al., 2013). In addition, a variety of environmental
risk factors have been identified to increase ASD risk, including maternal
exposure to the teratogens, valproic acid (VPA) and thalidomide, early life
exposure to environmental toxins, and advanced paternal age (Chaste &
Leboyer, 2012). Early life immune activation is of particular interest, given
strong evidence from epidemiological, clinical, and animal research
supporting a role for inflammation and immune dysfunction in the etiology
and clinical presentation of ASD (Patterson, 2012).
3. IMMUNE ACTIVATION AS A PRIMARY RISK FACTOR

FOR ASD
3.1. Maternal immune activation
Maternal immune activation (MIA) is regarded a principal nongenetic cause
of autism. After the 1964 rubella pandemic, 8–13% of children born to
infected mothers developed features of autism, representing an over 200-
fold increase in ASD prevalence at the time (Chess, 1971). In a landmark
study examining over 10,000 ASD cases out of all children born in Denmark
from 1980 to 2005, a significant association was found between maternal
viral infection during the first trimester of pregnancy and increased autism
risk (Atladottir et al., 2010). A similar link was reported in another large epi-
demiological study that included over 4000 ASD cases from all residents of
Stockholm County, Sweden (Lee et al., 2012). In addition, infections with a
variety of microorganisms, including influenza, cytomegalovirus, varicella,
and rubeola, have each been associated with an increased risk for ASD, lead-
ing to the current understanding that it is not the particular pathogen but
rather a more generalized activation of the maternal immune system that
is responsible (Atladottir, Henriksen, Schendel, & Parner, 2012; Zerbo
et al., 2012). Consistent with this, elevated levels of several inflammatory
markers in maternal serum and amniotic fluid are linked to ASD in the off-
spring, as are maternal fever and antibiotic treatment (Abdallah et al., 2012;
Atladottir et al., 2012; Brown, 2012; Brown et al., 2013). Importantly, MIA
can be induced in both rodent and nonhuman primate models in the absence
274 Elaine Y. Hsiao
of active infection; injection of microbial antigens, such as the cell wall com-
ponent lipopolysaccharide (LPS), or of viral mimics, such as the double-
stranded RNA poly(I:C), sufficiently yields offspring with neuropathologic,
behavioral, and peripheral abnormalities analogous to those observed in
human ASD (Harvey & Boksa, 2012; Hsiao & Patterson, 2012a). Moreover,
maternal exposure to particular recombinant cytokines alone can recapitu-
late many features of MIA in fetal and adult offspring, including brain gene
expression profiles and ASD-related behavioral deficits (Garay, Hsiao,
Patterson, & McAllister, 2012; Patterson, 2011). Altogether, these several
large epidemiological studies and corroborative animal models point to a
primary role for MIA in the etiology of ASD.
Animal models of MIA exhibit strong face and construct validity for
human ASD. Importantly, offspring of immune-activated mothers exhibit
the cardinal diagnostic symptoms of ASD; in mice, MIA offspring exhibit
decreased number and quality of ultrasonic vocalizations, as a primary mode
of communication, in addition to altered olfactory communication,
impaired social interactions, and elevated repetitive marble burying and
self-grooming, among other ASD-related behavioral abnormalities
(Malkova, Yu, Hsiao, Moore, & Patterson, 2012). Similar impairments
are replicated in monkey models for MIA, where rhesus macaque offspring
of immune-activated mothers display abnormal eye tracking, decreased
vocalizations, abnormal social behavior, and increased stereotypical behavior
(Bauman et al., 2011). In addition, numerous ASD-related neurochemical
alterations, synaptic abnormalities, and neuropathologies are observed in
rodent models of MIA (Baharnoori, Bhardwaj, and Srivastava, 2013;
Forrest et al., 2012; Harvey & Boksa, 2012).
An increasing number of findings from animal models are uncovering
potential mechanisms by which MIA can lead to core symptoms of ASD
in the offspring. It is now well understood that maternal responses to
immune insults are rapidly transferred to the developing embryo; shortly
after maternal injection with LPS or poly(I:C), proinflammatory cytokines
are elevated in the placenta, amniotic fluid, and fetal brain itself (Arrode-
Bruses & Bruses, 2012; Mandal, Marzouk, Donnelly, & Ponzio, 2011;
Meyer, Feldon, & Fatemi, 2009; Meyer et al., 2006). In the placenta, the
cytokine interleukin (IL)-6 is highly upregulated, and its signaling through
placental trophoblast cells alters levels of endocrine factors critical toward
normal embryonic development (Hsiao & Patterson, 2011). In addition,
elevated levels of placental IL-1b and tumor necrosis factor (TNF)-a after
MIA cause severe placental damage, resulting in dysregulated vascular
permeability and abnormal transport of maternal growth factors, oxygen,

and nutrients to the developing embryo (Carpentier, Dingman, &
Palmer, 2011; Girard, Tremblay, Lepage, & Sebire, 2010). Further evidence
supports an early breakdown of immune tolerance at the maternal–fetal
interface, with increased activation of decidual immune cells and infiltration
of maternal leukocytes into fetal tissues (Hsiao & Patterson, 2012b). Such
early placental responses to MIA might play an important role in amplifying
MIA-induced signals and propagating MIA effects to the growing fetus.
The fetal brain itself experiences an early response to MIA, with rapid
induction of proinflammatory cytokines and corresponding alterations in
gene expression. MIA by inoculation with influenza, poly(I:C), or recom-
binant IL-6 evokes strong gene expression changes in the embryonic brain,
with overlapping upregulation of crystallin family genes (Garbett, Hsiao,
Kalman, Patterson, & Mirnics, 2012). It is also reported that MIA induces
activation of microglia in the fetal brain and alters neurogenesis ( Jonakait,
Pratt, Acevedo, & Ni, 2012). How these early effects lead to specific behav-
ioral and neuropathologic symptoms in the adult offspring is currently
unclear. However, there is evidence that MIA causes dynamic, age- and
region-specific alterations in brain cytokine profiles throughout postnatal
development (Garay et al., 2012). In light of the increasing appreciation
for the role of immune-related molecules in normal brain processes, such
as microglial pruning, synaptic development, and neural differentiation
(Bitzer-Quintero & Gonzalez-Burgos, 2012; Garay & McAllister, 2010),
it is possible that MIA-induced changes in brain cytokines can cause serious
detriment to neurodevelopment. Furthermore, a recent study reports that
MIA induces epigenetic alterations in brains from juvenile offspring,
suggesting another mechanism by which acute insults during prenatal life
can lead to persistent detrimental effects on the brain and behavior (Tang,
Jia, Kast, & Thomas, 2013).
In addition to MIA, there is some evidence suggesting that early postnatal
infection is associated with ASD. A recent epidemiological study reports that
hospitalization due to infection during the first year of life is linked to
increased risk for autism (Abdallah et al., 2012). This finding is consistent
with a previous study demonstrating slightly elevated risk for ASD within
the first month of birth (Rosen, Yoshida, & Croen, 2007), but no difference
when the first 2 years of life are considered. In addition, several congenital
infections are reported in ASD children (Ivarsson, Bjerre, Vegfors, &
Ahlfors, 1990; Sweeten, Posey, & McDougle, 2004; Yamashita,
Fujimoto, Nakajima, Isagai, & Matsuishi, 2003). Such postnatal infections
276 Elaine Y. Hsiao
might result from a genetic or environmental predisposition; that is, children

that go on to develop ASD may be genetically or physiologically more
susceptible to infection. Several studies support this notion; in models
of gene–environment interactions, transgenic mice displaying a genetic pre-
disposition to autism exhibit exacerbated responses to environmental chal-
lenges such as MIA (Abazyan et al., 2010; Ehninger et al., 2012; Vuillermot
et al., 2012). Furthermore, in “two-hit” models, prenatal immune activation
predisposes to physiological abnormalities induced by a second “hit,” such as
postnatal stress or immune activation (Bilbo, 2013; Giovanoli et al., 2013).
Overall, the preponderance of evidence indicates that early life immune
activation itself, or in combination with additional susceptibility factors,
increases the risk for ASD.
3.2. Maternal autoantibody production

Self-reactive antibodies are increasingly recognized as causative agents in the
development of many neurological disorders, including myasthenia gravis,
Sydenham’s chorea, and PANDAS (pediatric autoimmune neuropsychiatric
disorders associated with streptococcal infections) (Vincent, Bien, Irani, &
Waters, 2011). For autism, a variety of maternal immunoglobulin (Ig) anti-
bodies that react against fetal proteins have been identified in ASD mothers.
Some such “autoantibodies” have been shown to react against neural com-
ponents, including myelin basic protein and GAD65 in cerebellar Purkinje
cells, and many have broad reactivity against antigens from fetal brain lysates
(Braunschweig & Van de Water, 2012; Fox, Amaral, & Van de Water, 2012;
Mostafa & Al-Ayadhi, 2011; Rout, Mungan, & Dhossche, 2012). Remark-
ably, a specific subset of maternal autoantibodies, demonstrated to react
against fetal brain proteins at 37 and 73 kDa molecular mass, is highly pre-
dictive of autism diagnoses and present in up to 12% of mothers with ASD
children (Braunschweig & Van de Water, 2012; Fox et al., 2012). This raises
the exciting possibility of using the detection of 37/73 kDa reactive mater-
nal autoantibodies as an effective molecular diagnostic for a substantial frac-
tion of ASD cases.
That maternal autoantibodies can contribute to the pathogenesis of ASD
symptoms is strongly supported by animal studies. Injection of ASD-
associated Ig into pregnant mice sufficiently causes autism-related behavioral
abnormalities, including elevated anxiety, hyperactivity, decreased social
behavior, and abnormal ultrasonic vocalizations (Braunschweig, Golub,
et al., 2012; Dalton et al., 2003; Singer et al., 2009). Similar results are seen
in rhesus macaques, where pregnant monkeys exposed to Ig pooled

from ASD mothers yield offspring with nonsocial behavior, whole-body
stereotypies, and hyperactivity (Bauman et al., 2013; Martin et al., 2008).
Furthermore, in humans, the presence of maternal autoantibodies correlates
with impaired expressive language in ASD children (Braunschweig,
Duncanson, et al., 2012). ASD children born to mothers positive for the
autoantibodies reactive against the 37/73 kDa fetal antigens also exhibit
more severe macrocephaly compared to ASD controls, characterized by
enlargement of gray and white matter of the frontal lobe (Nordahl et al.,
2013). Collectively, these animal studies and correlation analyses in human
ASD indicate that maternal autoantibody production can contribute to the
development of ASD symptoms in a subset of autistic individuals.
Much remains to be explored regarding the mechanisms underlying how
maternal autoantibodies impair offspring development. Though not yet
tested in animal models, it is hypothesized that reactive antibodies in the
maternal bloodstream can cross the placenta, enter the fetal circulation,
and access the brain via a premature blood–brain barrier. Autoantibodies
with the 37/73 kDa reactivity against fetal brain antigens have been resolved
from sera derived from both postpartum and gestational ASD mothers,
supporting a possible prenatal effect of autoantibody production on offspring
development. Interestingly, autoantibodies are also found in ASD individ-
uals themselves and correlate with the severity of some autism-related
behaviors (Goines et al., 2011). However, whether autoantibodies in
ASD individuals are associated with the presence of autoantibodies in
ASD mothers, and whether autoantibodies isolated from ASD individuals
and their mothers overlap in antigen reactivity, is unclear. It is important
to note that many autoantibodies are detected at some frequency in sera
of typically developing controls, and one particular study reports that the
presence of certain antifetal brain antibodies is not predictive of ASD
(Morris, Zimmerman, & Singer, 2009). Perhaps this is the case for many
autoantibodies except the 37/73 kDa-reactive form, which is observed spe-
cifically in ASD cases and not controls. Of particular interest are recent
reports revealing that the target 37 and 73 kDa antigens are proteins
involved in neurogenesis, neuronal growth cone function, and protein fold-
ing (Braunschweig et al., 2013). However, that many of the antigenic targets
for ASD-associated autoantibodies are not specifically expressed in the brain
raises the interesting question of whether ASD-associated autoantibodies
might exert effects outside of the central nervous system that contribute
to the pathogenesis of autism-related symptoms.
278 Elaine Y. Hsiao
Finally, another unexplored area in this regard is the underlying cause of

maternal autoantibody production. In many autoimmune-related neurolog-
ical disorders, autoantibodies are produced in response to microbial infec-
tion, where molecular mimicry of antigenic components of the pathogen
leads to cross-reactivity of antibodies with homologous self-proteins. In this
sense, it is interesting to consider a possible convergent mechanism for
maternal autoantibody production and some cases of maternal infection.
The rate of autoimmune diseases or allergies is higher in families with autism,
particularly in the mother, demonstrating another link between maternal
immune status and increased risk for ASD in the offspring (Atladottir
et al., 2009; Comi, Zimmerman, Frye, Law, & Peeden, 1999; Keil et al.,
2010). Furthermore, since MIA has long-term effects on prenatal and post-
natal immunity, including signs of decreased maternal immune tolerance
of the semiallogeneic fetus, there is a potential basis for autoreactivity
(Patterson, 2011). Also interesting is the enrichment of maternal autoanti-
body production in subsets of ASD mothers exhibiting an autism-associated
common variant of the gene encoding the MET kinase. This association
of the 37/73 kDa autoantibody subtype with a known genetic risk factor
for ASD suggests that the autism-associated MET-c allele may predispose to
immune dysregulation and autoantibody production (Heuer, Braunschweig,
Ashwood, Van de Water, & Campbell, 2011). Overall, both MIA and maternal
autoantibody production represent immune-related susceptibility factors that
are associated with increased risk for ASD.
4. IMMUNE-RELATED GENETIC RISK FACTORS FOR ASD

While much research on the genetic basis of autism has focused on
genes involved in synapse formation and activity, it is important to note that
many SNPs and CNVs identified as genetic risk factors for ASD are impli-
cated in the development and function of the immune system. In a recent
study examining pathways perturbed in autism-associated CNVs and linkage
loci, immune-related networks were identified as the most highly affected,
with primary losses in genes encoding alpha interferons (IFNs) and gains in
genes encoding C–C motif chemokine ligands (Saxena et al., 2012). In addi-
tion, analysis of autism-associated SNPs in immune-related genes reveals
CD99L2, JARID2, and TPO as candidates significantly linked to ASD
(Ramos, Sajuthi, Langefeld, & Walker, 2012). CD99L2 encodes CD99
antigen-like protein 2, which serves as an adhesion molecule that regulates
extravasation of immune cells, while JARID2 and TPO encode the
transcriptional repressor Jumonji homologue and the enzyme thyroid per-

oxidase, respectively, both of which are implicated in autoimmune disease
and inflammation (Brown, 2009; Vijai et al., 2013).
4.1. Major histocompatibility complex molecules

Particularly notable for its strong association with autism risk and important
role in both immunity and neurodevelopment is the region containing
human leukocyte antigen (HLA) genes. HLA refers to the major histocom-
patibility complex (MHC) locus in humans, which contains a large number
of genes involved in immunological processes such as antigen presentation,
T-cell restriction, and complement activation, among many others. Several
HLA genes and haplotypes are linked to higher incidence of autism, includ-
ing HLAA2 of the class I region, the DRb1*04 allele of the class II region,
and the C4B allele of the class III region. In addition, the relative risks for
ASD are up to 20 for particular HLA alleles (Torres, Westover, &
Rosenspire, 2012). Associations between autism and HLA haplotypes are
further supported by recent findings demonstrating higher frequency of
the DRb1*11 allele and reduced frequency of the DRb1*03 allele in autistic
children compared to controls (Mostafa, Shehab, & Al-Ayadhi, 2013). Var-
ious HLA genes are implicated in autoimmune diseases, such as systemic
lupus erythematosus and psoriasis, representing another possible interaction
between genetic predisposition, immune dysregulation, and ASD endo-
phenotypes. Several HLA polymorphisms are also associated with increased
risk for schizophrenia (Crespi & Thiselton, 2011; Irish Schizophrenia
Genomics Consortium and the Wellcome Trust Case Control
Consortium 2, 2012; Jia et al., 2012), which is interesting in light of emerg-
ing evidence supporting convergent etiologic, molecular, and therapeutic
pathways between schizophrenia and autism (de Lacy & King, 2013;
Hamlyn, Duhig, McGrath, & Scott, 2013).
While MHC molecules have long been regarded for their central roles in
adaptive immunity, they are now being appreciated for their impact on brain
development and behavior. Class I MHC molecules expressed by neurons
during development are important for the regulation of synapse density and
neural connectivity (Elmer & McAllister, 2012; Needleman & McAllister,
2012; Shatz, 2009). Also, MHC peptides critically convey olfactory infor-
mation to sensory neurons, enabling genotypic discrimination between
mice and perhaps contributing to the abnormal mating preference, aggres-
sion, and nurturing behavior exhibited by MHC-deficient strains (Sturm
280 Elaine Y. Hsiao
et al., 2013). Similar mechanisms have been identified across various species,
including humans, leading to the notion that MHC is central to social sig-
naling and the formation of social memories (Ruff, Nelson, Kubinak, &
Potts, 2012). It is interesting to speculate that ASD-associated HLA poly-
morphisms might therefore influence abnormal social interactions, as a core
diagnostic domain of autism. Directly testing this hypothesis is difficult,
however, in light of challenges inherent to translating HLA genotypes to
animal models. Advances in the development of “humanized” mouse
models containing HLA alleles have been useful for studying T-cell
responses restricted by human MHC molecules, but no such systems have
been developed for the study of neural phenotypes (Kotturi et al., 2009).
Future studies aimed toward assessing the influence of particular MHC dis-
ruptions on autism-related symptoms will be important for better under-
standing the neurological bases for subtypes of ASD.
Altogether, both environmental and genetic risk factors support a role for
immune dysregulation in the development of ASD symptoms. MIA and
maternal autoantibody production represent immune-related environmen-
tal risk factors whose influences during prenatal or early postnatal life can
contribute to the development of ASD in the offspring. Polymorphisms
in the HLA system, and in other immune-related genes, can have severe
consequences on neurodevelopment, as well as the developing immune sys-
tem. Understanding how early life immune insults impact fetal brain devel-
opment and ultimately result in cardinal symptoms of ASD will shed light on
potential targets for better diagnosis and treatment of subsets of ASD
individuals.
5. POSTNATAL IMMUNE DYSREGULATION IN ASD

5.1. Neuroimmune abnormalities
5.1.1 Microglia
In addition to the several immune-related environmental and genetic risk
factors found to increase autism risk, emerging evidence highlights a role
for postnatal immune dysfunction in the clinical manifestation of ASD
symptoms. Striking immune abnormalities are seen in the brains and periph-
ery of autistic individuals. A relatively well-replicated pathology observed in
postmortem brains from ASD patients is increased microglial abundance and
activation. Increased levels of HLA-DRþ microglia are seen in the cerebel-
lum, cerebral cortex, and white matter of brains from autistic individuals
(Vargas, Nascimbene, Krishnan, Zimmerman, & Pardo, 2005). Increased
density of microglia is also observed in the dorsolateral prefrontal cortex and

in the visual and fronto-insular cortex (Tetreault et al., 2012). Morpholog-
ical assessments suggest that greater proportions of microglia from ASD
brains exhibit an activated state, characterized by an amoeboid shape,
enlarged soma, and thicker, more retracted processes (Morgan et al.,
2010; Tetreault et al., 2012). Consistent with these findings in postmortem
brain, positron emission tomography imaging studies of living autistic indi-
viduals demonstrate increased binding of a microglial ligand in various brain
regions, which is used as a measure of microglial activation (Suzuki et al.,
2013). Such abnormalities in microglial status can greatly influence neuro-
genesis and activity, as suggested by reports of abnormal microglial–neuronal
spatial organization in human ASD brains (Morgan et al., 2012).
Many animal models for autism recapitulate this microglial pathology,
including the inbred Black and Tan BRachyury (BTBR) mouse strain
(Heo, Zhang, Gao, Miller, & Lawrence, 2011), mice after neonatal terbu-
taline exposure (Zerrate et al., 2007), offspring of maternal VPA exposure,
and offspring of maternal poly(I:C) exposure (Ratnayake, Quinn, Castillo-
Melendez, Dickinson, & Walker, 2012). Whether microglia abnormalities
contribute to behavioral or neuropathologic symptoms is unclear, but recent
seminal studies demonstrate that alterations in microglial number and func-
tion can contribute to the development or persistence of abnormal behavior
and physiology. Remarkably, replacement of microglia by bone marrow
transplant effectively reverses the severe stereotypical grooming phenotype
exhibited by mice deficient in the homeobox transcription factor, Hoxb8
(Chen et al., 2010). Similarly, in a mouse model for Rett syndrome, recon-
stitution of microglia by bone marrow transplant sufficiently ameliorates
key symptoms of the disorder, including apneas and abnormal breathing
patterns, body weight, and locomotion (Derecki et al., 2012). These studies
clearly illustrate that pathological behaviors and symptoms can be reversed in
adult mice and further raise the question of whether similar improvements
can be seen by treating or replacing microglia in mouse models for autism.
5.1.2 Transcriptome changes

In addition to specific alterations in microglia levels and activation, postmor-
tem brains from autistic individuals exhibit global changes in gene expression
that reflect altered immune status. Microarray analysis of the temporal cortex
from autistic brains reveals significant overexpression of immune response
pathways (Garbett et al., 2008). A similar transcriptomic analysis of frontal
and temporal cortex from another cohort of ASD brains also demonstrates
282 Elaine Y. Hsiao
a significant association of autism with altered expression of a network of

immune-related genes, alongside another module of genes relevant to neu-
rodevelopment (Voineagu et al., 2011). A recent whole-genome analysis of
transcript levels and CNVs in autistic prefrontal cortex reveals that immune
system response genes are among the most significantly dysregulated, in
addition to genes involved in DNA damage and apoptosis (Chow et al.,
2012). Notably, alterations in the expression of immune-related genes are
commonly seen in brains from both young and adult ASD individuals,
suggesting that abnormalities are established early in neural development
and persist through adult life. Changes in the expression of gene modules
related to inflammation and the immune response are reported to correlate
with the severity of particular autism-related behaviors (Ginsberg, Rubin,
Falcone, Ting, & Natowicz, 2012), pointing to a potential contribution
of neuroimmune dysregulation to the development of core ASD symptoms.
Interestingly, susceptibility genes identified from autism genome-wide
association studies are enriched in ASD-associated gene modules related
to neurodevelopment, but not those related to immunity, suggesting that
alterations in the brain expression of immune-related genes do not arise from
a genetic predisposition to ASD (Voineagu et al., 2011). Consistent with
this, a recent evaluation of immune-related genes present in microarray
and proteomic screens versus genetic analyses from ASD individuals reports
that immune-related genes are significantly enriched among the susceptibil-
ity factors identified from microarray and proteomics studies, but not from
genetic linkage studies, suggesting that immune alterations might arise from
a pathway that is independent of genetic predisposition to ASD (Ziats &
Rennert, 2013). In addition, a recent study proposes that upregulation of
immune expression pathways might relate to the strong gender dimorphism
of ASD males over females, based on results demonstrating overrepresenta-
tion of immune-related networks in normal male brains compared to female
brains (Ziats & Rennert, 2013).
5.1.3 Brain cytokine dysregulation

Consistent with ASD-associated microglial activation and brain trans-
criptomic alterations in immune-related genes, brains from autistic individ-
uals also exhibit abnormal cytokine profiles. Elevated levels of transforming
growth factor (TGF)-b1 and macrophage chemoattractant protein (MCP)-1
are observed in the anterior cingulate gyrus and cerebellum of ASD brains
(Vargas et al., 2005). In addition, the anterior cingulate gyrus exhibits dra-
matically increased levels of IL-6, at 31.4-fold higher in ASD compared to
controls, as well as elevated levels of several other cytokines and chemokines

associated with a proinflammatory state. Similar differences are seen in the
frontal cortex, where significantly elevated levels of the proinflammatory
cytokines IL-6, TNF-a, IFN-g, IL-8, and granulocyte monocyte colony-
stimulating factor (GM-CSF) are observed in ASD compared to controls
(Li et al., 2009). Another study reports increased levels of IL-6 in the cer-
ebellum of autistic brains as well (Wei et al., 2011), though this difference
was not seen in a previous cohort (Vargas et al., 2005). Interestingly,
increased expression of the immunomodulatory transcription factor, nuclear
factor kappa-light-chain-enhancer of activated B-cells (NF-kB), is observed
in orbitofrontal cortex of autistic brains versus controls, particularly in astro-
cytes and microglia (Young, Campbell, Lynch, Suckling, & Powis, 2011).
This suggests that overactivation of NF-kB pathways in brains of ASD indi-
viduals may form the basis for ASD-associated increases in brain
proinflammatory cytokines. In addition, elevated levels of proinflammatory
cytokines are also observed in cerebrospinal fluid of ASD individuals com-
pared to controls (Vargas et al., 2005). Collectively, these studies point to
widespread elevation of cytokines known to be proinflammatory in various
regions of the ASD brain.
5.1.4 An emerging role for immune molecules in brain development

There is an increasing appreciation that autism-associated neuroimmune
dysregulation, from increased expression of immune-related gene networks
to microglial activation and cytokine production, can contribute to the
pathogenesis of ASD. More than representing a detrimental, inflammatory
state, molecules traditionally acknowledged for their roles in the immune
system are now being recognized for their importance in normal neuro-
development (Table 9.1). In the absence of infection, cytokines and
chemokines are expressed in the healthy developing brain and involved
in directing a variety of neural processes, including neurogenesis, migration,
differentiation, synapse formation, synaptic transmission, and synaptic plas-
ticity (Deverman & Patterson, 2009). Furthermore, they are produced not
only by microglia, as the canonical immune cells of the brain, but also by
neurons and astrocytes. Similarly, activation of microglia, as measured by cell
morphology or surface marker expression, need not represent a phagocytic
or cytotoxic mediator of inflammation or cellular damage. During normal
development, active microglia play an important role in synaptic pruning,
eliminating excess neurons and synapses to promote efficient synaptic trans-
mission (Tremblay et al., 2011). In addition, microglia play a supportive role
Table 9.1 Immune molecules in normal neurodevelopment
Immune system Central nervous system
Immune
molecules Expression Function Expression Function
Cytokines All nucleated cells Cell signaling: immune All major cell subtypes— Cell signaling: neural
activation: T-cell stimulation, neurons, microglia, induction, neurogenesis,
proliferation, cytotoxicity, Ig astrocytes, gliogenesis, maintenance of
production, chemotaxis; oligodendrocytes, neural stem cells and
hematopoiesis: immune endothelial cells progenitors, neuronal fate
maturation, differentiation, specification, differentiation,
homing; lymphoid organ progenitor migration, axon
development pathfinding, proliferation,
synapse elimination
MHC Class I All nucleated cells Peptide binding; antigen All major cell subtypes— Peptide binding: synapse
presentation, cross- neurons, microglia, elimination, synaptic
presentation, antigen- astrocytes, transmission, synaptic
processing, inhibition of NK oligodendrocytes, connectivity, synaptic
cells endothelial cells plasticity neurite outgrowth,
pheromone perception
MHC Class II Antigen-presenting Peptide binding; antigen Microglia, macrophages, Peptide binding: antigen
cells: dendritic cells, presentation, antigen loading astrocytes presentation, antigen loading
macrophages, B-cells
Complement Primarily liver Antigen binding, proteases; Microglia, astrocytes Antigen binding; synapse
system hepatocytes, but also clearance of infectious agents, elimination, elimination of
macrophages, opsonization, chemotaxis, cell dead or damaged cells
monocytes, epithelial lysis, antigen aggregation,
cells B-cell activation, elimination
of dead or damaged cells
Immunoglobulin B-cells Antigen binding; clearance of N/A N/A
infectious agents, complement
activation, effector cell
activation
to neurons in the remodeling of circuit connectivity and regulation of

plasticity and function in the healthy brain. Novel roles for the complement
system, in tagging target cells for synaptic pruning (Stephan, Barres, &
Stevens, 2012), and for MHC class I proteins, in regulating neurite out-
growth, cortical connectivity, and synaptic plasticity (Elmer & McAllister,
2012), further contribute to this emerging redefinition of immune mole-
cules as fundamental signaling factors in normal brain development.
That immune-related changes in the brain can directly affect neu-
rodevelopmental processes implicated in ASD raises the compelling notion
of whether ASD-associated neuroimmune dysregulation could converge on
the prevailing theory of synaptic dysfunction as the underlying basis for
autism. Moreover, could environmental risk factors for ASD that result in
neuroimmune abnormalities cause similar effects on neurodevelopment as
do genetic risk factors identified to disrupt synaptic components? Further
research into the endogenous roles of immune molecules in the developing
brain will help uncover pathways that are likely to be disrupted in response
to ASD-associated neuroimmune dysregulation.
5.2. Peripheral immune abnormalities in ASD

5.2.1 Blood protein markers
Numerous studies have uncovered striking peripheral immune dys-
regulation in ASD individuals, ranging from alterations in blood levels of
immune markers and abnormalities in leukocyte functional responses to
global changes in the blood transcriptome. There are several reports of
altered cytokine, chemokine, and growth factor levels in plasma derived
from autistic individuals (Careaga & Ashwood, 2012; Goines &
Ashwood, 2013; Michel, Schmidt, & Mirnics, 2012; Onore, Careaga, &
Ashwood, 2012). Most of these findings involve increases in
proinflammatory factors, including IL-1b, IL-6, IL-17 (Al-Ayadhi &
Mostafa, 2012), chemokine (C–C motif ) ligand (CCL)1, and CCL5,
alongside decreases in levels of anti-inflammatory factors such as TGF-b,
consistent with an activated immune condition. Notably, a recent
population-wide study of over 300 ASD cases demonstrates significant
decreases in the cytokines IFN-g, IL-4, and IL-10 in neonatal blood, suggesting
an early life suppression of T helper cell (Th)1 and Th2 responses (Abdallah
et al., 2012) and a temporally dynamic alteration in peripheral immune function
in ASD. Interestingly, no differences in peripheral cytokine profiles is found
between ASD individuals and their non-ASD siblings, pointing to a potential
genetic basis accounting for shared peripheral cytokine changes in ASD
286 Elaine Y. Hsiao
(Napolioni et al., 2013). Specific cytokine alterations are seen, however, upon
subclassification of ASD individuals into those exhibiting nonverbal commu-
nication, early regression, and gastrointestinal complications.
Aside from cytokine and chemokines, altered levels of specific Ig sub-
types, and decreased levels of total Ig, are reported in ASD, despite no dif-
ferences in general functionality of Ig-producing B-cells (Heuer, Rose,
Ashwood, & Van de Water, 2012). Moreover, increased levels of comple-
ment proteins, including the lytic component C1q (Corbett et al., 2007) and
complement factor I (Momeni et al., 2012), and decreased levels of circu-
lating adhesion molecules platelet endothelial adhesion molecule-1
(PECAM-1) and P-selectin (Onore, Nordahl, et al., 2012), are reported
in sera of ASD individuals, altogether pointing to several blood
immunophenotypes relevant to ASD.
5.2.2 Leukocyte abundance and function

In addition to alterations in circulating levels of immune markers, many dif-
ferences in innate and adaptive immune responses are seen in ASD individ-
uals compared to controls (Careaga & Ashwood, 2012; Goines & Ashwood,
2013; Michel et al., 2012; Onore, Careaga, et al., 2012). Helper T (Th) cells
derived from ASD individuals exhibit increased signs of activation and cyto-
kine responses suggestive of a bias toward Th2-type cells. Also, cytotoxic
(CD8) T cells from ASD individuals are reported to be skewed toward effec-
tor cell phenotypes, as measured by expression of the surface marker CD26
(Ashwood, Corbett, et al., 2011). Several studies have replicated that natural
killer (NK) cells harvested from ASD individuals display decreased lytic
capacity, but no deficit in the ability to produce cytolytic proteins
(Enstrom et al., 2009; Vojdani et al., 2008; Warren, Foster, &
Margaretten, 1987). Monocytes are also altered in ASD but, in contrast
to NK cells, exhibit hyperfunctional cytokine responses to stimulation
and upregulated expression of activation markers. In addition, it was recently
reported that ASD individuals display increased frequency of circulating
myeloid dendritic cells, consistent with elevations in innate immune
responses (Breece et al., 2013).
5.2.3 Blood transcriptome

Gene expression studies utilizing peripheral blood cells and lymphoblastic
cell lines have demonstrated that ASD individuals can be distinguished from
controls based on genome-wide expression profiles. DNA microarray ana-
lyses of over 100 lymphoblastoid lines from individuals with idiopathic
autism reveal several differentially expressed genes, classifying into pathways

relevant to neurodevelopment, metabolism, immunity, and gastrointestinal
function (Hu, Nguyen, et al., 2009; Hu, Sarachana, et al., 2009).
In addition, alterations in global signatures of miRNAs are seen in ASD
lymphoblasts compared to controls (Ghahramani Seno et al., 2011;
Sarachana, Zhou, Chen, Manji, & Hu, 2010) and also relevant to neurolog-
ical development, hormone metabolism, circadian rhythm, and gastrointes-
tinal abnormalities (Sarachana et al., 2010). In one study of the whole-blood
gene expression, several differences in NK cell cytotoxicity pathway genes
were associated with ASD, consistent with functional assays demonstrating
ASD-related abnormalities in NK cell activity (Gregg et al., 2008).
Remarkably, a recent study of 170 ASD cases reports that whole-blood
gene expression profiling can discriminate ASD patients from controls with
73% accuracy; that is, 73% of ASD cases can be identified by a unique
peripheral expression signature, raising the exciting prospect of a novel
blood-based diagnostic for ASD (Kong et al., 2012). Importantly, changes
in the gene expression of peripheral blood mononuclear cells are detectable
even in infants and toddlers that go on to develop ASD, demonstrating that
molecular biomarkers of ASD are present in circulating immune cells even
prior to traditional behavioral diagnosis (Glatt et al., 2012). In another study,
lymphoblast transcriptomic profiles effectively distinguished controls from
ASD individuals harboring the specific genetic abnormalities 15q11–q13
duplication and fragile mutation in FMR1 (Nishimura et al., 2007), indi-
cating that ASD-associated genetic alterations have a robust effect on gene
expression of circulating immune cells. Together, these results suggest that
gene expression signatures present in the blood can uniquely characterize
individuals with autism from controls. In addition, transcriptome changes
in the blood can identify particular ASD syndromes based on genetic pre-
disposition. It will be interesting to determine whether particular gene
expression signatures correlate with particular ASD-associated symptoms
and comorbidities. Furthermore, that changes in blood gene expression sig-
natures are detectable even as a prodromal symptom of autism strongly sug-
gests that ASD is characterized by persistent peripheral immune
dysregulation and altered immunologic function.
6. IMMUNE CONTRIBUTIONS TO ASD PATHOGENESIS

Whether abnormalities in peripheral immunity actually contribute to
the development or manifestation of ASD symptoms is unclear, but several
288 Elaine Y. Hsiao
lines of evidence suggest that changes in systemic immune responses can

affect the brain and behavior. Perhaps most well regarded is the effect of
peripheral immune challenge on induction of downstream brain cytokine
responses and sickness behavior via activation of vagal nerve afferents
(Dantzer, O’Connor, Freund, Johnson, & Kelley, 2008). In addition, active
transport mechanisms are reported for several cytokines and direct effects
may be induced at circumventricular organs (McCusker & Kelley, 2013).
Immune effects on behavior are also evident in immunodeficient mice,
where athymic and severe combined immunodeficiency, recombination
activating gene, and T-cell receptor knockout mice exhibit several behav-
ioral abnormalities (Brynskikh, Warren, Zhu, & Kipnis, 2008; Cushman,
Lo, Huang, Wasserfall, & Petitto, 2003; Kipnis, Cohen, Cardon, Ziv, &
Schwartz, 2004; Mombaerts et al., 1994). Moreover, immunologic abnor-
malities are implicated in a variety of neuropsychiatric and neurodegenera-
tive disorders.
Findings from animal models also support the notion that immune
abnormalities can contribute to ASD symptoms. Modeling MIA in mice
leads to persistent postnatal immune dysregulation in MIA offspring, char-
acterized by decreased regulatory T cells, hyperresponsive CD4þ T cells,
and elevated neutrophilic and granulocytic cells (Hsiao, McBride, Chow,
Mazmanian, & Patterson, 2012). Interestingly, correcting these immune
abnormalities by bone marrow transplant leads to improvements in repeti-
tive and anxiety-like behavior in the MIA offspring. Immune irregularities
have also been seen in the BTBR mouse strain, which displays autism-
related stereotypies and reductions in social communication. BTBR mice
exhibit increased levels of peripheral CD4þ T cells, peripheral B-cells,
and serum and brain Ig levels, among other immune abnormalities (Heo
et al., 2011). There are also immune abnormalities in the mouse model
for autism based on maternal VPA exposure. VPA offspring exhibit
decreased thymic mass, impaired splenocyte responses to stimulation, and
elevated production of reactive oxygen species by peritoneal macrophages
(Schneider et al., 2008). Whether immune changes might contribute to
behavioral abnormalities in BTBR mice and VPA offspring is unclear.
Importantly, several autism-associated abnormalities in peripheral
immunity correlate with the severity of core behavioral and neurological
symptoms. Levels of particular plasma cytokines are associated with
the degree of impaired communication, stereotypy, and hyperactivity in
autistic individuals, as assessed by the Autism Diagnostic Interview, Revised
(ADI-R) and Aberrant Behaviors Checklist (ABC) (Ashwood et al., 2008;
Ashwood, Krakowiak, et al., 2011a; Grigorenko et al., 2008). Similarly,

ASD-associated alterations in particular plasma Igs are associated with
severity in ABC parameters (Heuer et al., 2008). Several such behavioral
correlations have been made for blood protein levels in ASD, including
PECAM-1, IL-17A, MCP-1, eotaxin, CCL5, and TGF-b, among others
(Al-Ayadhi & Mostafa, 2012; Ashwood et al., 2008; Ashwood, Krakowiak,
et al., 2011b; Onore, Nordahl, et al., 2012). In addition, increased levels of mye-
loid dendritic cells in ASD individuals are associated with ASD-associated
enlargements in the amygdala, in addition to severity of gastrointestinal com-
plications and stereotypies (Breece et al., 2013). Moreover, in a study of autism-
related symptoms in 22q11.2 deletion syndrome, a genetic disorder that confers
elevated risk for autism and immune dysfunction, peripheral increases in IL-12,
IFN-g, and IL-6, relative to IL-10, exhibit a significant positive association
with the severity of social impairments and repetitive behaviors as measured
by the ADI-R (Ross, Guo, Coleman, Ousley, & Miller, 2013). That alterations
in peripheral immunity correspond to severity of ASD behaviors and neuropa-
thologies suggests that there is an interaction between core ASD symptoms and
immune dysfunction and further raises the possibility that immune abnormal-
ities in the periphery can influence neural responses and behavior in ASD
individuals.
7. IMMUNE-RELATED THERAPIES FOR ASD

Despite strong evidence of widespread immune dysregulation in ASD
and known effects of immune modulation on the brain and behavior, there
are very few controlled studies on the efficacy of immunomodulatory ther-
apies for treating core symptoms of ASD. Intravenous Ig treatment has been
tested in a small number of ASD case studies and is reported to provide
symptomatic benefit for up to 20% of treated individuals (Gupta,
Samra, & Agrawal, 2010). The anti-inflammatory antibiotic minocycline
corrects synaptic abnormalities and communication deficits in mouse
models of fragile syndrome (Rotschafer, Trujillo, Dansie, Ethell, &
Razak, 2012) and is showing promising effects in treating symptoms in
fragile patients (Hagerman, Lauterborn, Au, & Berry-Kravis, 2012).
However, a small pilot study reports no symptomatic effect of minocycline
on behavioral abnormalities in individuals with regressive autism, though
several biological effects of treatment are seen on altering levels of cytokine
and neurotrophic factors in the blood and cerebrospinal fluid (Swedo et al.,
2010). The antibiotic D-cycloserine treats repetitive behavior and decreased
290 Elaine Y. Hsiao
social interactions in animal models for ASD (Deutsch et al., 2012) and also
reduces social withdrawal in a small cohort of ASD children (Posey et al.,
2004). Whether these effects are mediated by its anti-inflammatory proper-
ties and/or by its role as a partial NMDA-receptor agonist is not clear.
In addition, several of the antidepressant and antipsychotic drugs com-
monly used to treat ASD are known to exhibit immunomodulatory prop-
erties. Risperidone and aripiprazole, the only two drugs FDA-approved for
the treatment of irritability in ASD, both have immunologic effects, altering
T-cell differentiation, microglial activation, and serum cytokine levels,
among other immunologic responses (Cecchelli, Grassi, & Pallanti, 2010;
Chen et al., 2011, 2012; Ching & Pringsheim, 2012; Kim et al., 2001;
Richtand et al., 2012; Zhang et al., 2004). The selective serotonin reuptake
inhibitor, fluoxetine, reduces stereotypical behavior in a double-blind
placebo-controlled trial of adults with ASD (Hollander et al., 2012) and also
confers several effects on innate and adaptive cellular immune responses of
T cells and NK cells (Basterzi et al., 2010; Frick, Rapanelli, Cremaschi, &
Genaro, 2009; Nunez et al., 2006; Rogoz, Kubera, Rogoz, Basta-Kaim, &
Budziszewska, 2009). In addition, the acetylcholinesterase inhibitors
galantamine and donepezil ameliorate social impairment, irritability, and
inattention in ASD children (Hohnadel, Bouchard, & Terry, 2007;
Nicolson, Craven-Thuss, & Smith, 2006) and exhibit primary effects on
activation of the cholinergic anti-inflammatory pathway (Hardan &
Handen, 2002; Pavlov et al., 2009). Further studies are needed to determine
whether the immunomodulatory properties of these drugs are necessary to
confer beneficial effects on ASD symptoms.
8. CONCLUSION
Increasing evidence highlights widespread immune dysregulation
as an important component of ASD (Fig. 9.2). Several prenatal immune
insults and postnatal immune abnormalities may be involved in the devel-
opment and/or persistence of ASD symptoms. The study of MIA and mater-
nal autoantibody production as primary immune-related environmental
risk factors for ASD can uncover critical pathways underlying the develop-
ment of autism symptoms and key targets for improving the diagnosis
and treatment of significant subsets of ASD. The mechanisms discovered
might also apply broadly to other prenatal risk factors for ASD, such as
premature birth, advanced paternal age, and maternal thalidomide, VPA,
Figure 9.2 Immune involvement in ASD. Several immune-related environmental

risk and genetic factors increase the risk for ASD. Maternal immune activation during
pregnancy is regarded a primary nongenetic cause of autism and, in animal models,
sufficiently leads to the development of core neuropathologic, immunologic, and
behavioral symptoms of autism. The presence of particular maternal autoantibodies
reactive against fetal brain antigens is predictive of ASD in the offspring, and translation
to animal models also demonstrates that maternal autoantibody exposure yields mice
with autism-related behavioral abnormalities. Furthermore, a variety of immune abnor-
malities have been observed in the brains and periphery of ASD individuals, and recent
studies indicate a critical role for immune molecules in regulating neurodevelopment
and behavior. Overall, the numerous early life and later life immune irregularities seen in
ASD suggest a potential role for immune dysregulation in the development or manifes-
tation of ASD symptoms.
and pesticide exposure, since proinflammatory signatures are commonly

seen across each of these insults. Several genetic risk factors for ASD are rel-
evant to both brain and immune function, including those affecting various
HLA haplotypes, MET kinase, and complement CD4 protein. Very few of
these immune-related genetic susceptibility factors for ASD have been trans-
lated to animal models and evaluated for ASD-related immune and behav-
ioral symptoms. Such future studies will be important for identifying
converging pathways for several related environmental and genetic risk fac-
tors for ASD. In addition, ASD individuals exhibit various symptoms of
immune dysregulation in the brain and periphery, the etiologies and
functional consequences of which are not well understood. In light of an
emerging appreciation that immune molecules critically regulate neuro-
development and that peripheral immune alterations can affect the brain
and behavior, additional studies examining the effect of ASD-associated
immune abnormalities on core ASD behavioral and neuropathologic symp-
toms are highly warranted. Investigation in these areas will sharpen our
292 Elaine Y. Hsiao
understanding of the role of immune dysregulation in ASD and inform bet-

ter diagnostic and therapeutic approaches for the identification and treat-
ment of defined subclasses of ASD individuals.
REFERENCES
Abazyan, B., Nomura, J., Kannan, G., Ishizuka, K., Tamashiro, K. L., Nucifora, F., et al.
(2010). Prenatal interaction of mutant DISC1 and immune activation produces adult
psychopathology. Biological Psychiatry, 68, 1172–1181.
Abdallah, M. W., Hougaard, D. M., Norgaard-Pedersen, B., Grove, J., Bonefeld-
Jorgensen, E. C., & Mortensen, E. L. (2012). Infections during pregnancy and after birth,
and the risk of autism spectrum disorders: A register-based study utilizing a Danish his-
toric birth cohort. Turk psikiyatri dergisi—Turkish Journal of Psychiatry, 23, 229–236.
Abrahams, B. S., & Geschwind, D. H. (2010). Connecting genes to brain in the autism spec-
trum disorders. Archives of Neurology, 67, 395–399.
Al-Ayadhi, L. Y., & Mostafa, G. A. (2012). Elevated serum levels of interleukin-17A in chil-
dren with autism. Journal of Neuroinflammation, 9, 158.
Arrode-Bruses, G., & Bruses, J. L. (2012). Maternal immune activation by poly I:C induces
expression of cytokines IL-1beta and IL-13, chemokine MCP-1 and colony stimulating
factor VEGF in fetal mouse brain. Journal of Neuroinflammation, 9, 83.
Ashwood, P., Corbett, B. A., Kantor, A., Schulman, H., Van de Water, J., & Amaral, D. G.
(2011). In search of cellular immunophenotypes in the blood of children with autism.
PLoS One, 6, e19299.
Ashwood, P., Enstrom, A., Krakowiak, P., Hertz-Picciotto, I., Hansen, R. L., Croen, L. A.,
et al. (2008). Decreased transforming growth factor beta1 in autism: A potential link
between immune dysregulation and impairment in clinical behavioral outcomes. Journal
of Neuroimmunology, 204, 149–153.
Ashwood, P., Krakowiak, P., Hertz-Picciotto, I., Hansen, R., Pessah, I., & Van de Water, J.
(2011a). Elevated plasma cytokines in autism spectrum disorders provide evidence
of immune dysfunction and are associated with impaired behavioral outcome. Brain,
Behavior, and Immunity, 25, 40–45.
Ashwood, P., Krakowiak, P., Hertz-Picciotto, I., Hansen, R., Pessah, I. N., & Van de
Water, J. (2011b). Associations of impaired behaviors with elevated plasma chemokines
in autism spectrum disorders. Journal of Neuroimmunology, 232, 196–199.
Atladottir, H. O., Henriksen, T. B., Schendel, D. E., & Parner, E. T. (2012). Autism after
infection, febrile episodes, and antibiotic use during pregnancy: An exploratory study.
Pediatrics, 130, e1447–e1454.
Atladottir, H. O., Pedersen, M. G., Thorsen, P., Mortensen, P. B., Deleuran, B.,
Eaton, W. W., et al. (2009). Association of family history of autoimmune diseases and
autism spectrum disorders. Pediatrics, 124, 687–694.
Atladottir, H. O., Thorsen, P., Ostergaard, L., Schendel, D. E., Lemcke, S., Abdallah, M.,
et al. (2010). Maternal infection requiring hospitalization during pregnancy and autism
spectrum disorders. Journal of Autism and Developmental Disorders, 40, 1423–1430.
Autism and Developmental Disabilities Monitoring Network Surveillance Year 2008 Prin-
ciple Investigators; Centers for Disease Control and Prevention. (2012). Prevalence of
autism spectrum disorders—Autism and Developmental Disabilities Monitoring Net-
work, 14 sites, United States, 2008. MMWR Surveillance Summaries, 61, 1–19.
Baharnoori, M., Bhardwaj, S. K., & Srivastava, L. K. (2013). Effect of maternal lipopolysac-
charide administration on the development of dopaminergic receptors and transporter in
the rat offspring. PLoS One, 8, e54439.
Medicine, 25, 63–77.
Basterzi, A. D., Yazici, K., Buturak, V., Cimen, B., Yazici, A., Eskandari, G., et al. (2010).
Effects of venlafaxine and fluoxetine on lymphocyte subsets in patients with major
depressive disorder: A flow cytometric analysis. Progress in Neuro-Psychopharmacology &
Biological Psychiatry, 34, 70–75.
Bauman, M. L. (2010). Medical comorbidities in autism: Challenges to diagnosis and treat-
ment. Neurotherapeutics, 7, 320–327.
Bauman, M. D., Iosif, A. M., Ashwood, P., Braunschweig, D., Lee, A., Schumann, C. M.,
et al. (2013). Maternal antibodies from mothers of children with autism alter brain
growth and social behavior development in the rhesus monkey. Translational Psychiatry,
3, e278.
Bauman, M. D., Iosif, A. M., Smith, S. E., Bregere, C., Zadran, S., Amaral, D. G., et al.
(2011). A nonhuman primate model of maternal immune activation. In: Program No.
778.06/Y29. 2011 Neuroscience Meeting Planner. Paper presented at Society for Neuroscience,
Washington, DC.
Bilbo, S. D. (2013). Frank A. Beach Award: Programming of neuroendocrine function by
early-life experience: A critical role for the immune system. Hormones and Behavior,
63, 684–691.
Bitzer-Quintero, O. K., & Gonzalez-Burgos, I. (2012). Immune system in the brain:
A modulatory role on dendritic spine morphophysiology? Neural Plasticity, 2012,
348642.
Braunschweig, D., Duncanson, P., Boyce, R., Hansen, R., Ashwood, P., Pessah, I. N., et al.
(2012). Behavioral correlates of maternal antibody status among children with autism.
Journal of Autism and Developmental Disorders, 42, 1435–1445.
Braunschweig, D., Golub, M. S., Koenig, C. M., Qi, L., Pessah, I. N., Van de Water, J., et al.
(2012). Maternal autism-associated IgG antibodies delay development and produce anx-
iety in a mouse gestational transfer model. Journal of Neuroimmunology, 252, 56–65.
Braunschweig, D., Krakowiak, P., Duncanson, P., Boyce, R., Hansen, R. L., Ashwood, P.,
et al. (2013). Autism-specific maternal autoantibodies recognize critical proteins in
developing brain. Translational Psychiatry, 3, e277.
Braunschweig, D., & Van de Water, J. (2012). Maternal autoantibodies in autism. Archives of
Neurology, 69, 693–699.
Breece, E., Paciotti, B., Nordahl, C. W., Ozonoff, S., Van de Water, J. A., Rogers, S. J., et al.
(2013). Myeloid dendritic cells frequencies are increased in children with autism spec-
trum disorder and associated with amygdala volume and repetitive behaviors. Brain,
Behavior, and Immunity, 31, 69–75.
Brown, R. S. (2009). Autoimmune thyroid disease: Unlocking a complex puzzle. Current
Opinion in Pediatrics, 21, 523–528.
Brown, A. S. (2012). Epidemiologic studies of exposure to prenatal infection and risk of
schizophrenia and autism. Developmental Neurobiology, 72, 1272–1276.
Brown, A. S., Sourander, A., Hinkka-Yli-Salomaki, S., McKeague, I. W., Sundvall, J., &
Surcel, H. M. (2013). Elevated maternal C-reactive protein and autism in a national birth
cohort. Molecular Psychiatry, http://dx.doi.org/10.1038/mp.2012.197.
Brynskikh, A., Warren, T., Zhu, J., & Kipnis, J. (2008). Adaptive immunity affects learning
behavior in mice. Brain, Behavior, and Immunity, 22, 861–869.
Campbell, D. B., Buie, T. M., Winter, H., Bauman, M., Sutcliffe, J. S., Perrin, J. M., et al.
(2009). Distinct genetic risk based on association of MET in families with co-occurring
autism and gastrointestinal conditions. Pediatrics, 123, 1018–1024.
Careaga, M., & Ashwood, P. (2012). Autism spectrum disorders: From immunity to
behavior. Methods in Molecular Biology, 934, 219–240.
294 Elaine Y. Hsiao
Carpentier, P. A., Dingman, A. L., & Palmer, T. D. (2011). Placental TNF-alpha signaling in
illness-induced complications of pregnancy. The American Journal of Pathology, 178,
2802–2810.
Cecchelli, C., Grassi, G., & Pallanti, S. (2010). Aripiprazole improves depressive symptoms
and immunological response to antiretroviral therapy in an HIV-infected subject with
resistant depression. Case Report Medical, 2010, 836214.
Chaste, P., & Leboyer, M. (2012). Autism risk factors: Genes, environment, and gene-
environment interactions. Dialogues in Clinical Neuroscience, 14, 281–292.
Chen, M. L., Tsai, T. C., Lin, Y. Y., Tsai, Y. M., Wang, L. K., Lee, M. C., et al. (2011).
Antipsychotic drugs suppress the AKT/NF-kappaB pathway and regulate the differen-
tiation of T-cell subsets. Immunology Letters, 140, 81–91.
Chen, M. L., Tsai, T. C., Wang, L. K., Lin, Y. Y., Tsai, Y. M., Lee, M. C., et al. (2012).
Risperidone modulates the cytokine and chemokine release of dendritic cells and induces
TNF-alpha-directed cell apoptosis in neutrophils. International Immunopharmacology, 12,
197–204.
Chen, S. K., Tvrdik, P., Peden, E., Cho, S., Wu, S., Spangrude, G., et al. (2010). Hema-
topoietic origin of pathological grooming in Hoxb8 mutant mice. Cell, 141, 775–785.
Chess, S. (1971). Autism in children with congenital rubella. Journal of Autism and Childhood
Schizophrenia, 1, 33–47.
Ching, H., & Pringsheim, T. (2012). Aripiprazole for autism spectrum disorders (ASD).
Cochrane Database of Systematic Reviews, 5, CD009043.
Chow, M. L., Pramparo, T., Winn, M. E., Barnes, C. C., Li, H. R., Weiss, L., et al. (2012).
Age-dependent brain gene expression and copy number anomalies in autism suggest dis-
tinct pathological processes at young versus mature ages. PLoS Genetics, 8, e1002592.
Comi, A. M., Zimmerman, A. W., Frye, V. H., Law, P. A., & Peeden, J. N. (1999). Familial
clustering of autoimmune disorders and evaluation of medical risk factors in autism.
Journal of Child Neurology, 14, 388–394.
Constantino, J. N., Zhang, Y., Frazier, T., Abbacchi, A. M., & Law, P. (2010). Sibling recur-
rence and the genetic epidemiology of autism. The American Journal of Psychiatry, 167,
1349–1356.
Corbett, B. A., Kantor, A. B., Schulman, H., Walker, W. L., Lit, L., Ashwood, P., et al.
(2007). A proteomic study of serum from children with autism showing differential
expression of apolipoproteins and complement proteins. Molecular Psychiatry, 12,
292–306.
Coury, D. L., Ashwood, P., Fasano, A., Fuchs, G., Geraghty, M., Kaul, A., et al. (2012).
Gastrointestinal conditions in children with autism spectrum disorder: Developing a
research agenda. Pediatrics, 130(Suppl. 2), S160–S168.
Crespi, B. J., & Thiselton, D. L. (2011). Comparative immunogenetics of autism and schizo-
phrenia. Genes, Brain, and Behavior, 10, 689–701.
Cushman, J., Lo, J., Huang, Z., Wasserfall, C., & Petitto, J. M. (2003). Neurobehavioral
changes resulting from recombinase activation gene 1 deletion. Clinical and Diagnostic
Laboratory Immunology, 10, 13–18.
Dalton, P., Deacon, R., Blamire, A., Pike, M., McKinlay, I., Stein, J., et al. (2003). Maternal
neuronal antibodies associated with autism and a language disorder. Annals of Neurology,
53, 533–537.
Dantzer, R., O’Connor, J. C., Freund, G. G., Johnson, R. W., & Kelley, K. W. (2008).
From inflammation to sickness and depression: When the immune system subjugates
the brain. Nature Reviews Neuroscience, 9, 46–56.
de Lacy, N., & King, B. H. (2013). Revisiting the relationship between autism and schizo-
phrenia: Toward an integrated neurobiology. Annual Review of Clinical Psychology, 9,
555–587.
Delorme, R., Ey, E., Toro, R., Leboyer, M., Gillberg, C., & Bourgeron, T. (2013). Progress
toward treatments for synaptic defects in autism. Nature Medicine, 19, 685–694.
Derecki, N. C., Cronk, J. C., Lu, Z., Xu, E., Abbott, S. B., Guyenet, P. G., et al. (2012).
Wild-type microglia arrest pathology in a mouse model of Rett syndrome. Nature, 484,
105–109.
Deutsch, S. I., Pepe, G. J., Burket, J. A., Winebarger, E. E., Herndon, A. L., & Benson, A. D.
(2012). D-cycloserine improves sociability and spontaneous stereotypic behaviors in
4-week old mice. Brain Research, 1439, 96–107.
Deverman, B. E., & Patterson, P. H. (2009). Cytokines and CNS development. Neuron, 64,
61–78.
Ehninger, D., Sano, Y., de Vries, P. J., Dies, K., Franz, D., Geschwind, D. H., et al. (2012).
Gestational immune activation and Tsc2 haploinsufficiency cooperate to disrupt fetal
survival and may perturb social behavior in adult mice. Molecular Psychiatry, 17, 62–70.
Elmer, B. M., & McAllister, A. K. (2012). Major histocompatibility complex class I proteins
in brain development and plasticity. Trends in Neurosciences, 35, 660–670.
Enstrom, A. M., Lit, L., Onore, C. E., Gregg, J. P., Hansen, R. L., Pessah, I. N., et al. (2009).
Altered gene expression and function of peripheral blood natural killer cells in children
with autism. Brain, Behavior, and Immunity, 23, 124–133.
Fidler, D. J., Bailey, J. N., & Smalley, S. L. (2000). Macrocephaly in autism and other pervasive
developmental disorders. Developmental Medicine and Child Neurology, 42, 737–740.
Folstein, S., & Rutter, M. (1977). Infantile autism: A genetic study of 21 twin pairs. Journal of
Child Psychology and Psychiatry, and Allied Disciplines, 18, 297–321.
Forrest, C. M., Khalil, O. S., Pisar, M., Smith, R. A., Darlington, L. G., & Stone, T. W.
(2012). Prenatal activation of Toll-like receptors-3 by administration of the viral mimetic
poly(I:C) changes synaptic proteins, N-methyl-D-aspartate receptors and neurogenesis
markers in offspring. Molecular Brain, 5, 22.
Fox, E., Amaral, D., & Van de Water, J. (2012). Maternal and fetal antibrain antibodies in
development and disease. Developmental Neurobiology, 72, 1327–1334.
Frick, L. R., Rapanelli, M., Cremaschi, G. A., & Genaro, A. M. (2009). Fluoxetine directly
counteracts the adverse effects of chronic stress on T cell immunity by compensatory and
specific mechanisms. Brain, Behavior, and Immunity, 23, 36–40.
Garay, P. A., Hsiao, E. Y., Patterson, P. H., & McAllister, A. K. (2012). Maternal immune
activation causes age- and region-specific changes in brain cytokines in offspring
throughout development. Brain, Behavior, and Immunity, 31, 54–68.
Garay, P. A., & McAllister, A. K. (2010). Novel roles for immune molecules in neural devel-
opment: Implications for neurodevelopmental disorders. Frontiers in Synaptic Neuroscience,
2, 136.
Garbett, K., Ebert, P. J., Mitchell, A., Lintas, C., Manzi, B., Mirnics, K., et al. (2008).
Immune transcriptome alterations in the temporal cortex of subjects with autism.
Neurobiology of Disease, 30, 303–311.
Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., & Mirnics, K. (2012). Effects of
maternal immune activation on gene expression patterns in the fetal brain. Translation
Psychiatry, 2, e98.
Ghahramani Seno, M. M., Hu, P., Gwadry, F. G., Pinto, D., Marshall, C. R., Casallo, G.,
et al. (2011). Gene and miRNA expression profiles in autism spectrum disorders. Brain
Research, 1380, 85–97.
Ginsberg, M. R., Rubin, R. A., Falcone, T., Ting, A. H., & Natowicz, M. R. (2012). Brain
transcriptional and epigenetic associations with autism. PLoS One, 7, e44736.
Giovanoli, S., Engler, H., Engler, A., Richetto, J., Voget, M., Willi, R., et al. (2013). Stress
in puberty unmasks latent neuropathological consequences of prenatal immune activa-
tion in mice. Science, 339, 1095–1099.
296 Elaine Y. Hsiao
Girard, S., Tremblay, L., Lepage, M., & Sebire, G. (2010). IL-1 receptor antagonist protects
against placental and neurodevelopmental defects induced by maternal inflammation.
Journal of Immunology, 184, 3997–4005.
Glatt, S. J., Tsuang, M. T., Winn, M., Chandler, S. D., Collins, M., Lopez, L., et al. (2012).
Blood-based gene expression signatures of infants and toddlers with autism. Journal of the
American Academy of Child and Adolescent Psychiatry, 51(934–944), e932.
Goines, P. E., & Ashwood, P. (2013). Cytokine dysregulation in autism spectrum disorders
(ASD): Possible role of the environment. Neurotoxicology and Teratology, 36, 67–81.
Goines, P., Haapanen, L., Boyce, R., Duncanson, P., Braunschweig, D., Delwiche, L., et al.
(2011). Autoantibodies to cerebellum in children with autism associate with behavior.
Brain, Behavior, and Immunity, 25, 514–523.
Gregg, J. P., Lit, L., Baron, C. A., Hertz-Picciotto, I., Walker, W., Davis, R. A., et al. (2008).
Gene expression changes in children with autism. Genomics, 91, 22–29.
Grigorenko, E. L., Han, S. S., Yrigollen, C. M., Leng, L., Mizue, Y., Anderson, G. M., et al.
(2008). Macrophage migration inhibitory factor and autism spectrum disorders. Pediatrics,
122, e438–e445.
Gupta, S., Samra, D., & Agrawal, S. (2010). Adaptive and innate immune responses in autism:
Rationale for therapeutic use of intravenous immunoglobulin. Journal of Clinical Immu-
nology, 30, 90–96.
Hagerman, R., Lauterborn, J., Au, J., & Berry-Kravis, E. (2012). Fragile syndrome and
targeted treatment trials. Results and Problems in Cell Differentiation, 54, 297–335.
Archives of General Psychiatry, 68, 1095–1102.
Hamlyn, J., Duhig, M., McGrath, J., & Scott, J. (2013). Modifiable risk factors for schizo-
phrenia and autism—Shared risk factors impacting on brain development. Neurobiology of
Disease, 53, 3–9.
Hardan, A. Y., & Handen, B. L. (2002). A retrospective open trial of adjunctive donepezil in
children and adolescents with autistic disorder. Journal of Child and Adolescent Psychophar-
macology, 12, 237–241.
Harvey, L., & Boksa, P. (2012). Prenatal and postnatal animal models of immune activation:
Relevance to a range of neurodevelopmental disorders. Developmental Neurobiology Special
Issue: Neuroimmunology in Development and Disease, 72, 1335–1348.
Heo, Y., Zhang, Y., Gao, D., Miller, V. M., & Lawrence, D. A. (2011). Aberrant immune
responses in a mouse with behavioral disorders. PLoS One, 6, e20912.
Heuer, L., Ashwood, P., Schauer, J., Goines, P., Krakowiak, P., Hertz-Picciotto, I., et al.
(2008). Reduced levels of immunoglobulin in children with autism correlates with
behavioral symptoms. Autism Research, 1, 275–283.
Heuer, L., Braunschweig, D., Ashwood, P., Van de Water, J., & Campbell, D. B. (2011).
Association of a MET genetic variant with autism-associated maternal autoantibodies
to fetal brain proteins and cytokine expression. Translation Psychiatry, 1, e48.
Heuer, L. S., Rose, M., Ashwood, P., & Van de Water, J. (2012). Decreased levels of total
immunoglobulin in children with autism are not a result of B cell dysfunction. Journal of
Neuroimmunology, 251, 94–102.
Hohnadel, E., Bouchard, K., & Terry, A. V., Jr. (2007). Galantamine and donepezil attenuate
pharmacologically induced deficits in prepulse inhibition in rats. Neuropharmacology, 52,
542–551.
Hollander, E., Soorya, L., Chaplin, W., Anagnostou, E., Taylor, B. P., Ferretti, C. J., et al.
(2012). A double-blind placebo-controlled trial of fluoxetine for repetitive behaviors and
global severity in adult autism spectrum disorders. The American Journal of Psychiatry, 169,
292–299.
Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., & Patterson, P. H. (2012).
Modeling an autism risk factor in mice leads to permanent immune dysregulation.
12776–12781.
Hsiao, E. Y., & Patterson, P. H. (2011). Activation of the maternal immune system induces
endocrine changes in the placenta via IL-6. Brain, Behavior, and Immunity, 25, 604–615.
Hsiao, E. Y., & Patterson, P. H. (2012a). Immune involvement in autism spectrum disorder
as a basis for animal models. Autism, S1.
Hsiao, E. Y., & Patterson, P. H. (2012b). Placental regulation of maternal-fetal interactions
and brain development. Developmental Neurobiology, 72, 1317–1326.
Hu, V. W., Nguyen, A., Kim, K. S., Steinberg, M. E., Sarachana, T., Scully, M. A., et al.
(2009). Gene expression profiling of lymphoblasts from autistic and nonaffected sib pairs:
Altered pathways in neuronal development and steroid biosynthesis. PLoS One, 4, e5775.
(2009). Gene expression profiling differentiates autism case-controls and phenotypic var-
iants of autism spectrum disorders: Evidence for circadian rhythm dysfunction in severe
autism. Autism Research, 2, 78–97.
Irish Schizophrenia Genomics Consortium and the Wellcome Trust Case Control Consor-
tium 2. (2012). Genome-wide association study implicates HLA-C*01:02 as a risk factor
at the major histocompatibility complex locus in schizophrenia. Biological Psychiatry, 72,
620–628.
Ivarsson, S. A., Bjerre, I., Vegfors, P., & Ahlfors, K. (1990). Autism as one of several disabil-
ities in two children with congenital cytomegalovirus infection. Neuropediatrics, 21,
102–103.
Jia, P., Wang, L., Fanous, A. H., Pato, C. N., Edwards, T. L., & Zhao, Z. (2012). Network-
assisted investigation of combined causal signals from genome-wide association studies in
schizophrenia. PLoS Computational Biology, 8, e1002587.
Jonakait, G. M., Pratt, L., Acevedo, G., & Ni, L. (2012). Microglial regulation of cholinergic
differentiation in the basal forebrain. Developmental Neurobiology, 72, 857–864.
Kanne, S. M., & Mazurek, M. O. (2011). Aggression in children and adolescents with ASD:
Prevalence and risk factors. Journal of Autism and Developmental Disorders, 41, 926–937.
Kanner, L. (1968). Autistic disturbances of affective contact. Acta Paedopsychiatrica, 35,
100–136.
Keil, A., Daniels, J. L., Forssen, U., Hultman, C., Cnattingius, S., Soderberg, K. C., et al.
(2010). Parental autoimmune diseases associated with autism spectrum disorders in off-
spring. Epidemiology, 21, 805–808.
Kim, D. J., Kim, W., Yoon, S. J., Go, H. J., Choi, B. M., Jun, T. Y., et al. (2001). Effect of
risperidone on serum cytokines. The International Journal of Neuroscience, 111, 11–19.
Kipnis, J., Cohen, H., Cardon, M., Ziv, Y., & Schwartz, M. (2004). T cell deficiency leads to
cognitive dysfunction: Implications for therapeutic vaccination for schizophrenia and
other psychiatric conditions. Proceedings of the National Academy of Sciences of the United
States of America, 101, 8180–8185.
Kohane, I. S., McMurry, A., Weber, G., MacFadden, D., Rappaport, L., Kunkel, L., et al.
(2012). The co-morbidity burden of children and young adults with autism spectrum
disorders. PLoS One, 7, e33224.
Kong, S. W., Collins, C. D., Shimizu-Motohashi, Y., Holm, I. A., Campbell, M. G.,
Lee, I. H., et al. (2012). Characteristics and predictive value of blood transcriptome sig-
nature in males with autism spectrum disorders. PLoS One, 7, e49475.
Kotturi, M. F., Assarsson, E., Peters, B., Grey, H., Oseroff, C., Pasquetto, V., et al. (2009). Of
mice and humans: How good are HLA transgenic mice as a model of human immune
responses? Immunome Research, 5, 3.
298 Elaine Y. Hsiao
Lee, B. K., Dalman, C., Newschaffer, C. J., Burstyn, I., Blomstrom, A., Idring, S., et al.
(2012). Maternal hospitalization for infection during pregnancy and risk of autism spec-
trum disorders. In: Paper presented at IMFAR, Toronto, Canada.
Li, X., Chauhan, A., Sheikh, A. M., Patil, S., Chauhan, V., Li, X. M., et al. (2009). Elevated
immune response in the brain of autistic patients. Journal of Neuroimmunology, 207,
111–116.
Malkova, N. V., Yu, C. Z., Hsiao, E. Y., Moore, M. J., & Patterson, P. H. (2012). Maternal
immune activation yields offspring displaying mouse versions of the three core symptoms
of autism. Brain, Behavior, and Immunity, 26, 607–616.
Mandal, M., Marzouk, A. C., Donnelly, R., & Ponzio, N. M. (2011). Maternal immune
stimulation during pregnancy affects adaptive immunity in offspring to promote devel-
opment of TH17 cells. Brain, Behavior, and Immunity, 25, 863–871.
Martin, L. A., Ashwood, P., Braunschweig, D., Cabanlit, M., Van de Water, J., &
Amaral, D. G. (2008). Stereotypies and hyperactivity in rhesus monkeys exposed to
IgG from mothers of children with autism. Brain, Behavior, and Immunity, 22, 806–816.
McCusker, R. H., & Kelley, K. W. (2013). Immune-neural connections: How the immune
system’s response to infectious agents influences behavior. The Journal of Experimental
Biology, 216, 84–98.
Meyer, U., Feldon, J., & Fatemi, S. H. (2009). In-vivo rodent models for the experimental
investigation of prenatal immune activation effects in neurodevelopmental brain disor-
ders. Neuroscience and Biobehavioral Reviews, 33, 1061–1079.
Meyer, U., Nyffeler, M., Engler, A., Urwyler, A., Schedlowski, M., Knuesel, I., et al. (2006).
The time of prenatal immune challenge determines the specificity of inflammation-
mediated brain and behavioral pathology. The Journal of Neuroscience, 26, 4752–4762.
Michel, M., Schmidt, M. J., & Mirnics, K. (2012). Immune system gene dysregulation in
autism and schizophrenia. Developmental Neurobiology, 72, 1277–1287.
Mombaerts, P., Mizoguchi, E., Ljunggren, H. G., Iacomini, J., Ishikawa, H., Wang, L., et al.
(1994). Peripheral lymphoid development and function in TCR mutant mice. Interna-
tional Immunology, 6, 1061–1070.
Momeni, N., Brudin, L., Behnia, F., Nordstrom, B., Yosefi-Oudarji, A., Sivberg, B., et al.
(2012). High complement factor I activity in the plasma of children with autism spectrum
disorders. Autism Research and Treatment, 2012, 868576.
Morgan, J. T., Chana, G., Abramson, I., Semendeferi, K., Courchesne, E., & Everall, I. P.
(2012). Abnormal microglial-neuronal spatial organization in the dorsolateral prefrontal
cortex in autism. Brain Research, 1456, 72–81.
Morgan, J. T., Chana, G., Pardo, C. A., Achim, C., Semendeferi, K., Buckwalter, J., et al.
(2010). Microglial activation and increased microglial density observed in the dorsolateral
prefrontal cortex in autism. Biological Psychiatry, 68, 368–376.
Morris, C. M., Zimmerman, A. W., & Singer, H. S. (2009). Childhood serum anti-fetal brain
antibodies do not predict autism. Pediatric Neurology, 41, 288–290.
Mostafa, G. A., & Al-Ayadhi, L. Y. (2011). A lack of association between hyperserotonemia
and the increased frequency of serum anti-myelin basic protein auto-antibodies in autistic
children. Journal of Neuroinflammation, 8, 71.
Mostafa, G. A., Shehab, A. A., & Al-Ayadhi, L. Y. (2013). The link between some alleles on
human leukocyte antigen system and autism in children. Journal of Neuroimmunology, 255,
70–74.
Napolioni, V., Ober-Reynolds, B., Szelinger, S., Corneveaux, J. J., Pawlowski, T., Ober-
Reynolds, S., et al. (2013). Plasma cytokine profiling in sibling pairs discordant for autism
spectrum disorder. Journal of Neuroinflammation, 10, 38.
Needleman, L. A., & McAllister, A. K. (2012). The major histocompatibility complex and
autism spectrum disorder. Developmental Neurobiology, 72, 1288–1301.
Nicolson, R., Craven-Thuss, B., & Smith, J. (2006). A prospective, open-label trial of
galantamine in autistic disorder. Journal of Child and Adolescent Psychopharmacology, 16,
621–629.
Nishimura, Y., Martin, C. L., Vazquez-Lopez, A., Spence, S. J., Alvarez-Retuerto, A. I.,
Sigman, M., et al. (2007). Genome-wide expression profiling of lymphoblastoid cell lines
distinguishes different forms of autism and reveals shared pathways. Human Molecular
Genetics, 16, 1682–1698.
Noh, H. J., Ponting, C. P., Boulding, H. C., Meader, S., Betancur, C., Buxbaum, J. D., et al.
(2013). Network topologies and convergent aetiologies arising from deletions and dupli-
cations observed in individuals with autism. PLoS Genetics, 9, e1003523.
Nordahl, C. W., Braunschweig, D., Iosif, A. M., Lee, A., Rogers, S., Ashwood, P., et al.
(2013). Maternal autoantibodies are associated with abnormal brain enlargement in a
subgroup of children with autism spectrum disorder. Brain, Behavior, and Immunity,
30, 61–65.
Nunez, M. J., Balboa, J., Rodrigo, E., Brenlla, J., Gonzalez-Peteiro, M., & Freire-Garabal, M.
(2006). Effects of fluoxetine on cellular immune response in stressed mice. Neuroscience
Letters, 396, 247–251.
Onore, C., Careaga, M., & Ashwood, P. (2012). The role of immune dysfunction in the
pathophysiology of autism. Brain, Behavior, and Immunity, 26, 383–392.
Onore, C. E., Nordahl, C. W., Young, G. S., Van de Water, J. A., Rogers, S. J., &
Ashwood, P. (2012). Levels of soluble platelet endothelial cell adhesion molecule-1
and P-selectin are decreased in children with autism spectrum disorder. Biological
Psychiatry, 72, 1020–1025.
Patterson, P. H. (2011). Maternal infection and immune involvement in autism. Trends in
Molecular Medicine, 17, 389–394.
Patterson, P. H. (2012). Maternal infection and autism. Brain, Behavior, and Immunity, 26, 393.
Pavlov, V. A., Parrish, W. R., Rosas-Ballina, M., Ochani, M., Puerta, M., Ochani, K., et al.
(2009). Brain acetylcholinesterase activity controls systemic cytokine levels through the
cholinergic anti-inflammatory pathway. Brain, Behavior, and Immunity, 23, 41–45.
Posey, D. J., Kem, D. L., Swiezy, N. B., Sweeten, T. L., Wiegand, R. E., & McDougle, C. J.
(2004). A pilot study of D-cycloserine in subjects with autistic disorder. The American
Journal of Psychiatry, 161, 2115–2117.
Ramos, P. S., Sajuthi, S., Langefeld, C. D., & Walker, S. J. (2012). Immune function genes
CD99L2, JARID2 and TPO show association with autism spectrum disorder. Molecular
Autism, 3, 4.
Ratnayake, U., Quinn, T. A., Castillo-Melendez, M., Dickinson, H., & Walker, D. W.
(2012). Behaviour and hippocampus-specific changes in spiny mouse neonates after
treatment of the mother with the viral-mimetic Poly I:C at mid-pregnancy. Brain, Behav-
ior, and Immunity, 26, 1288–1299.
Richtand, N. M., Ahlbrand, R., Horn, P., Tambyraja, R., Grainger, M., Bronson, S. L.,
et al. (2012). Fluoxetine and aripiprazole treatment following prenatal immune activa-
tion exert longstanding effects on rat locomotor response. Physiology & Behavior, 106,
171–177.
Rogoz, Z., Kubera, M., Rogoz, K., Basta-Kaim, A., & Budziszewska, B. (2009). Effect of
co-administration of fluoxetine and amantadine on immunoendocrine parameters in rats
subjected to a forced swimming test. Pharmacological Reports, 61, 1050–1060.
Rosen, N. J., Yoshida, C. K., & Croen, L. A. (2007). Infection in the first 2 years of life and
autism spectrum disorders. Pediatrics, 119, e61–e69.
Rosenberg, R. E., Law, J. K., Yenokyan, G., McGready, J., Kaufmann, W. E., & Law, P. A.
(2009). Characteristics and concordance of autism spectrum disorders among 277 twin
pairs. Archives of Pediatrics & Adolescent Medicine, 163, 907–914.
300 Elaine Y. Hsiao
Ross, H. E., Guo, Y., Coleman, K., Ousley, O., & Miller, A. H. (2013). Association of
IL-12p70 and IL-6:IL-10 ratio with autism-related behaviors in 22q11.2 deletion syn-
drome: A preliminary report. Brain, Behavior, and Immunity, 31, 76–81.
Rotschafer, S. E., Trujillo, M. S., Dansie, L. E., Ethell, I. M., & Razak, K. A. (2012). Min-
ocycline treatment reverses ultrasonic vocalization production deficit in a mouse model
of Fragile Syndrome. Brain Research, 1439, 7–14.
Rout, U. K., Mungan, N. K., & Dhossche, D. M. (2012). Presence of GAD65 autoanti-
bodies in the serum of children with autism or ADHD. European Child & Adolescent
Ruff, J. S., Nelson, A. C., Kubinak, J. L., & Potts, W. K. (2012). MHC signaling during social
communication. Advances in Experimental Medicine and Biology, 738, 290–313.
Sacco, R., Lenti, C., Saccani, M., Curatolo, P., Manzi, B., Bravaccio, C., et al. (2012). Clus-
ter analysis of autistic patients based on principal pathogenetic components. Autism
Research, 5, 137–147.
Sarachana, T., Zhou, R., Chen, G., Manji, H. K., & Hu, V. W. (2010). Investigation of post-
transcriptional gene regulatory networks associated with autism spectrum disorders by
microRNA expression profiling of lymphoblastoid cell lines. Genome Medicine, 2, 23.
Saxena, V., Ramdas, S., Ochoa, C. R., Wallace, D., Bhide, P., & Kohane, I. (2012). Struc-
tural, genetic, and functional signatures of disordered neuro-immunological develop-
ment in autism spectrum disorder. PLoS One, 7, e48835.
Schneider, T., Roman, A., Basta-Kaim, A., Kubera, M., Budziszewska, B., Schneider, K.,
et al. (2008). Gender-specific behavioral and immunological alterations in an animal
model of autism induced by prenatal exposure to valproic acid. Psychoneuroendocrinology,
33, 728–740.
Shatz, C. J. (2009). MHC class I: An unexpected role in neuronal plasticity. Neuron, 64,
40–45.
Singer, H. S., Morris, C., Gause, C., Pollard, M., Zimmerman, A. W., & Pletnikov, M.
(2009). Prenatal exposure to antibodies from mothers of children with autism produces
neurobehavioral alterations: A pregnant dam mouse model. Journal of Neuroimmunology,
211, 39–48.
Spence, S. J., & Schneider, M. T. (2009). The role of epilepsy and epileptiform EEGs in
autism spectrum disorders. Pediatric Research, 65, 599–606.
Steffenburg, S., Gillberg, C., Hellgren, L., Andersson, L., Gillberg, I. C., Jakobsson, G., et al.
(1989). A twin study of autism in Denmark, Finland, Iceland, Norway and Sweden.
Journal of Child Psychology and Psychiatry, and Allied Disciplines, 30, 405–416.
Stephan, A. H., Barres, B. A., & Stevens, B. (2012). The complement system: An unexpected
role in synaptic pruning during development and disease. Annual Review of Neuroscience,
35, 369–389.
Sturm, T., Leinders-Zufall, T., Macek, B., Walzer, M., Jung, S., Pommerl, B., et al. (2013).
Mouse urinary peptides provide a molecular basis for genotype discrimination by nasal
sensory neurons. Nature Communications, 4, 1616.
Suzuki, K., Sugihara, G., Ouchi, Y., Nakamura, K., Futatsubashi, M., Takebayashi, K., et al.
(2013). Microglial activation in young adults with autism spectrum disorder. JAMA
Swedo, S. E., Buckley, A. W., Thurm, A., Lee, L. C., Azhagira, A., & Pardo, C. (2010).
Pilot study of minocycline treatment for autism. In: Paper presented at IMFAR, Philadel-
phia, PA.
Sweeten, T. L., Posey, D. J., & McDougle, C. J. (2004). Brief report: Autistic disorder in
three children with cytomegalovirus infection. Journal of Autism and Developmental
Disorders, 34, 583–586.
Tang, B., Jia, H., Kast, R. J., & Thomas, E. A. (2013). Epigenetic changes at gene promoters
in response to immune activation in utero. Brain, Behavior, and Immunity, 30, 168–175.
Tetreault, N. A., Hakeem, A. Y., Jiang, S., Williams, B. A., Allman, E., Wold, B. J., et al.
(2012). Microglia in the cerebral cortex in autism. Journal of Autism and Developmental
Disorders, 42, 2569–2584.
Toro, R., Konyukh, M., Delorme, R., Leblond, C., Chaste, P., Fauchereau, F., et al. (2010).
Key role for gene dosage and synaptic homeostasis in autism spectrum disorders. Trends in
Genetics: TIG, 26, 363–372.
Torres, A. R., Westover, J. B., & Rosenspire, A. J. (2012). HLA immune function genes in
autism. Autism Research and Treatment, 2012, 959073.
Tremblay, M. E., Stevens, B., Sierra, A., Wake, H., Bessis, A., & Nimmerjahn, A. (2011).
The role of microglia in the healthy brain. The Journal of Neuroscience, 31, 16064–16069.
Vargas, D. L., Nascimbene, C., Krishnan, C., Zimmerman, A. W., & Pardo, C. A. (2005).
Neuroglial activation and neuroinflammation in the brain of patients with autism. Annals
of Neurology, 57, 67–81.
Vijai, J., Kirchhoff, T., Schrader, K. A., Brown, J., Dutra-Clarke, A. V., Manschreck, C.,
et al. (2013). Susceptibility loci associated with specific and shared subtypes of lymphoid
malignancies. PLoS Genetics, 9, e1003220.
Vincent, A., Bien, C. G., Irani, S. R., & Waters, P. (2011). Autoantibodies associated with
diseases of the CNS: New developments and future challenges. Lancet Neurology, 10,
759–772.
380–384.
Vojdani, A., Mumper, E., Granpeesheh, D., Mielke, L., Traver, D., Bock, K., et al. (2008).
Low natural killer cell cytotoxic activity in autism: The role of glutathione, IL-2 and
IL-15. Journal of Neuroimmunology, 205, 148–154.
Vuillermot, S., Joodmardi, E., Perlmann, T., Ogren, S. O., Feldon, J., & Meyer, U. (2012).
Prenatal immune activation interacts with genetic Nurr1 deficiency in the development
of attentional impairments. The Journal of Neuroscience, 32, 436–451.
Warren, R. P., Foster, A., & Margaretten, N. C. (1987). Reduced natural killer cell
activity in autism. Journal of the American Academy of Child and Adolescent Psychiatry,
26, 333–335.
Wei, H., Zou, H., Sheikh, A. M., Malik, M., Dobkin, C., Brown, W. T., et al. (2011). IL-6 is
increased in the cerebellum of autistic brain and alters neural cell adhesion, migration and
synaptic formation. Journal of Neuroinflammation, 8, 52.
Wong, C. C., Meaburn, E. L., Ronald, A., Price, T. S., Jeffries, A. R., Schalkwyk, L. C.,
et al. (2013). Methylomic analysis of monozygotic twins discordant for autism spectrum
disorder and related behavioural traits. Molecular Psychiatry, http://dx.doi.org/10.1038/
mp.2013.41.
Yamashita, Y., Fujimoto, C., Nakajima, E., Isagai, T., & Matsuishi, T. (2003). Possible asso-
ciation between congenital cytomegalovirus infection and autistic disorder. Journal of
Autism and Developmental Disorders, 33, 455–459.
Yeargin-Allsopp, M. (2002). Past and future perspectives in autism epidemiology. Molecular
Psychiatry, 7(Suppl. 2), S9–S11.
Young, A. M., Campbell, E., Lynch, S., Suckling, J., & Powis, S. J. (2011). Aberrant
NF-kappaB expression in autism spectrum condition: A mechanism for neuro-
inflammation. Frontiers in Psychiatry, 2, 27.
Zerbo, O., Iosif, A. M., Walker, C., Ozonoff, S., Hansen, R. L., & Hertz-Picciotto, I.
(2012). Is maternal influenza or fever during pregnancy associated with autism or devel-
opmental delays? Results from the CHARGE (CHildhood Autism Risks from Genetics
and Environment) Study. Journal of Autism and Developmental Disorders, 43, 25–33.
Zerrate, M. C., Pletnikov, M., Connors, S. L., Vargas, D. L., Seidler, F. J.,
Zimmerman, A. W., et al. (2007). Neuroinflammation and behavioral abnormalities after
302 Elaine Y. Hsiao
neonatal terbutaline treatment in rats: Implications for autism. The Journal of Pharmacology
and Experimental Therapeutics, 322, 16–22.
Zhang, X. Y., Zhou, D. F., Cao, L. Y., Zhang, P. Y., Wu, G. Y., & Shen, Y. C. (2004).
Changes in serum interleukin-2, -6, and -8 levels before and during treatment with
risperidone and haloperidol: Relationship to outcome in schizophrenia. The Journal of
Clinical Psychiatry, 65, 940–947.
Ziats, M. N., & Rennert, O. M. (2013). Sex-biased gene expression in the developing brain:
Implications for autism spectrum disorders. Molecular Autism, 4, 10.
CHAPTER TEN
Autism Susceptibility Genes

and the Transcriptional Landscape
of the Human Brain
Shingo Miyauchi1, Irina Voineagu
School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, Australia
1
Corresponding author: e-mail address: i.voineagu@unsw.edu.au
Contents
1. Introduction 303
2. ASD Susceptibility Genes 305
3. ASD Brain Transcriptome Studies 307
4. Transcriptional Properties of ASD Genes in the Normal Human Brain 308
5. Conclusions and Further Directions 315
Acknowledgments 315
References 315
Abstract
Autism is the most severe end of a spectrum of neurodevelopmental conditions, autism
spectrum disorders (ASD). ASD are genetically heterogeneous, and hundreds of genes
have been implicated in the etiology of the disease. Here, we discuss the contribution of
brain transcriptome studies in advancing our understanding of the genetic mechanisms
of ASD and review recent work characterizing the spatial and temporal variation of the
human brain transcriptome, with a focus on the relevance of these data to autism
susceptibility genes.
1. INTRODUCTION
Autism is a neurodevelopmental disorder characterized by language
deficits, difficulties with social interactions, and repetitive and restrictive
behaviors (Kanner, 1968). It has a prevalence of 1 in 166 individuals
(Fombonne, 2009) and occurs more frequently in males than in females.
The clinical picture is highly heterogeneous, with large differences in symp-
tom severity between patients. In addition, autism patients often suffer from
comorbid conditions such as epilepsy, intellectual disability, anxiety, and
depression (Kim & Lord, 2013). Thus, autism is currently conceptualized

http://dx.doi.org/10.1016/B978-0-12-418700-9.00010-1
304 Shingo Miyauchi and Irina Voineagu
as a spectrum of conditions (autism spectrum disorders, ASD) rather than a

single clinical entity (Abrahams & Geschwind, 2008). At one end of the
spectrum, patients with severe autism cannot lead an independent life and
need permanent care, while at the other end, Asperger’s syndrome patients
have normal language development and often complete college education.
Due to ASD’s clinical heterogeneity and its variable developmental trajec-
tory, patients often receive variable diagnoses from different clinicians
and/or at different times throughout development (Lord et al., 2012). In
an attempt to improve the consistency of ASD diagnosis, the latest edition
of the Diagnostic and Statistical Manual of Mental Disorders (DSM-V) proposed
significant changes in the ASD diagnostic criteria. The new criteria proposed
a single diagnosis of ASD, with several levels of severity, instead of distinct
diagnostic entities for autistic disorder, Asperger’s syndrome, and pervasive
developmental disorder not otherwise specified (Skuse, 2012).
The complexities of ASD clinical assessment and diagnostic ascertain-
ment are mirrored by an equally challenging genetic landscape. The high
heritability of ASD demonstrated by twin studies (Bailey et al., 1995;
Steffenburg et al., 1989), together with the identification of numerous
genetic syndromes with high incidence of autism (fragile X syndrome, Tim-
othy syndrome, tuberous sclerosis, and others; Abrahams & Geschwind,
2008), has motivated intense research efforts toward identifying the genetic
mechanisms of ASD. Over the past two decades, linkage studies, candidate
gene resequencing, and genome-wide association studies (GWAS) have
demonstrated that ASD is genetically highly heterogeneous: although hun-
dreds of genes have been implicated in ASD, none of these genes are
involved in more than 2% of ASD cases (Abrahams & Geschwind, 2008;
State & Levitt, 2011). Collectively, a genetic diagnosis can be achieved in
<25% of ASD cases (Abrahams & Geschwind, 2008). Recently, exome
sequencing studies (Neale et al., 2012; O’Roak et al., 2011, 2012;
Sanders et al., 2012; Yu et al., 2013) have evaluated the contribution of
de novo single-nucleotide variants (SNVs) and copy number variants
(CNVs) to ASD genetics and confirmed the previously observed high
degree of genetic heterogeneity in ASD.
Thus, it is apparent that in order to advance our understanding of ASD
genetics, it is necessary to examine not only the DNA sequence variation but
also the functional output of the genome. Here, we discuss the role of brain
transcriptome studies in further understanding the genetic basis of ASD.
After an overview of ASD susceptibility genes, we discuss the results of
recent work examining transcriptome changes associated with ASD in the
human brain. We then review several studies that characterized the spatial
Autism Susceptibility Genes and the Transcriptional Landscape of the Human Brain 305
and temporal gene expression variation in the normal human brain and dis-
cuss the relevance of these data for understanding the transcriptional varia-
tion of ASD susceptibility genes.
2. ASD SUSCEPTIBILITY GENES

Syndromic forms of ASD are single-gene disorders with high inci-
dence of autistic symptoms. For instance, 60–80% of patients with Timothy
syndrome (caused by CACNA1C mutations; Splawski et al., 2004), 25% of
patients with fragile X syndrome (caused by FMR1 mutations; Dolen et al.,
2007), and around 20% of tuberous sclerosis patients (caused by TSC1/
TSC2 mutations; Wiznitzer, 2004) are diagnosed with autism. Although
rare among ASD patients, syndromic ASDs provide strong evidence for
the involvement of the affected gene in ASD pathogenesis. On the other
hand, defining causative genes implicated in nonsyndromic ASD is less
straightforward. It is currently estimated that each patient with non-
syndromic ASD carries multiple genetic variants, including rare variants
with higher effect sizes and common variants with lower effect sizes
(Murdoch & State, 2013; State & Levitt, 2011). Yet none of these genetic
variants are necessary or sufficient to cause the disease, making the causal
relationship between genes and ASD difficult to demonstrate. Conse-
quently, ASD susceptibility genes are defined based on accumulating evi-
dence from multiple approaches. Here, we briefly outline the main types
of studies used to support the involvement of specific genes in ASD.
Linkage studies (reviewed in Cantor, 2009; Freitag, 2007) have
attempted to identify chromosomal regions that harbor genetic variants
causally implicated in ASD and have provided initial evidence for ASD het-
erogeneity: ASD linkage peaks were rarely significant at a genome-wide
level and were difficult to replicate across studies.
GWAS aim to identify common genetic variants, that is, single-
nucleotide polymorphisms (SNPs) that are more frequent among ASD cases
than among nonaffected individuals. Several large ASD GWAS have been
published to date and each identified a single SNP significantly associated
with ASD at genome-wide levels (Anney et al., 2010; State & Levitt,
2011; Wang et al., 2009; Weiss, Arking, Daly, & Chakravarti, 2009). In
addition, association studies have also been carried out for selected candidate
genes. Candidate gene association studies (Carayol et al., 2011; Li, Zou, &
Brown, 2012; Song et al., 2011; Zhou et al., 2011) were generally con-
ducted with smaller cohorts than GWAS, and thus independent replication
for this type of studies is particularly important.
A number of cytogenetic abnormalities have been observed in ASD

cases, which occur at a higher frequency in ASD than in the general pop-
ulation (reviewed in Cook & Scherer, 2008; State, 2010). The maternal
duplication of chromosome 15q11–13 and microdeletions/micro-
duplications of chromosome 16p.11.2 are the most frequent, each of them
occurring in around 1% of ASD cases.
Several studies have demonstrated that ASD cases carry a higher burden
of de novo CNVs than the general population, but each of the de novo CNVs
is rare among ASD cases (Morrow, 2010; Pinto et al., 2010; Sebat et al.,
2007). In addition to de novo CNVs, rare inherited CNVs are also considered
to be pathogenic if overrepresented among ASD patients.
The contribution of de novo SNVs in coding regions has been assessed by
candidate gene resequencing and more recently by exome sequencing stud-
ies (Neale et al., 2012; O’Roak et al., 2011, 2012; Sanders et al., 2012; Yu
et al., 2013). Deleterious SNVs have been found to occur more frequently in
ASD cases than in their unaffected relatives, but this observation only held
true when the analysis was restricted to genes expressed in the brain. Sim-
ilarly to de novo CNVs, each de novo SNV was rare among ASD cases, and
most of the deleterious SNVs identified by exome sequencing studies have
been detected in only one ASD patient.
Finally, animal models are a powerful tool in assessing the causal relation-
ship between genes and the ASD phenotype (Provenzano, Zunino,
Genovesi, Sgado, & Bozzi, 2012). Although the clinical picture of ASD is
not entirely equivalent to the ASD-like phenotypes tested by behavioral par-
adigms, behavioral changes observed in animal models provide strong evi-
dence for the pathogenic effect of gene disruption and allow in-depth
cellular and molecular studies.
In summary, ASD susceptibility genes are defined based on one or more
lines of evidence from the following:
• ASD-associated SNPs within or close to the gene
• Linkage peaks or recurrent cytogenetic abnormalities spanning the gene
• De novo CNVs or rare CNVs within the coding sequence, observed with
a higher frequency in ASD cases than in unrelated controls or unaffected
family members
• De novo pathogenic SNVs with a higher frequency in ASD cases than in
unrelated controls or unaffected family members
• Animal models showing ASD-related behaviors
Several databases curate the literature for evidence linking specific genes
to ASD (Banerjee-Basu & Packer, 2010; Xu et al., 2012). The SFARI
gene database contains manually curated data and ranks the evidence
supporting each of the ASD susceptibility genes into “syndromic,”

“high confidence,” “strong candidate,” “suggestive evidence,” “minimal
evidence,” “hypothesized,” and “not supported” based on the cumulative
level of evidence.
3. ASD BRAIN TRANSCRIPTOME STUDIES

Given the genetic heterogeneity of ASD, an important question that
needs to be addressed is whether the wide variety of genetic variants
observed in ASD patients ultimately affects a common set of molecular path-
ways. It is conceivable that the function of a core set of genes may be
perturbed either directly by DNA sequence changes or indirectly by changes
in regulatory genes. While protein function cannot yet be assessed on a
genome-wide scale, several methods including microarrays and next-
generation sequencing allow genome-wide quantification of transcriptional
output and thus provide an overall measure of gene function.
Most transcriptome studies of ASD have used readily available blood and
lymphoblast cell lines (Enstrom et al., 2009; Gregg et al., 2008; Hu, Frank,
Heine, Lee, & Quackenbush, 2006; Hu, Nguyen, et al., 2009; Hu,
Sarachana, et al., 2009; Nishimura et al., 2007; Nord et al., 2011) and have
recently been reviewed elsewhere (Lintas, Sacco, & Persico, 2010;
Voineagu, 2012). Brain transcriptome studies on the other hand have been
limited due to the limited availability of postmortem tissue from ASD
patients. Initial brain studies based on a small number of samples have shown
dysregulation of genes encoding AMPA receptor subunits in ASD brain
(Purcell, Jeon, Zimmerman, Blue, & Pevsner, 2001). More recently, we
and others identified common transcriptional changes in a large subset of
ASD brain samples, showing an upregulation of genes implicated in immune
and inflammatory responses and a downregulation of neuronal synaptic
genes (Garbett et al., 2008; Voineagu et al., 2011). Gene expression differ-
ences were found to be attenuated between neocortical areas in ASD brain,
but the overall brain transcriptome organization and transcriptional differ-
ences between neocortex and cerebellum were preserved in ASD brain
(Ginsberg, Rubin, & Natowicz, 2013; Voineagu et al., 2011). Another study
focused on mitochondria-related genes and investigated their expression
levels in multiple brain regions by quantitative real-time PCR arrays
(Anitha et al., 2012). This study demonstrated dysregulation of several
mitochondria-related genes in ASD brain, some of which were brain-region
specific. Ziats et al. investigated for the first time the expression of long non-
coding RNAs in ASD brain (Ziats & Rennert, 2013). Although the number
of individuals included in this study was small (two ASD cases and two con-
trols), it identified several hundreds of long noncoding RNAs differentially
expressed between ASD brain and controls. The findings highlighted the
informative value of noncoding RNA expression in the brain (discussed
in more detail in this volume, Chapter 2). Chow et al. focused on prefrontal
cortex (PFC) and investigated gene expression changes in ASD brain in dif-
ferent age groups (Chow et al., 2012). This study found evidence for the
dysregulation of functional pathways regulating cell number, cortical pat-
terning, and differentiation in young autistic PFC and dysregulation of sig-
naling and repair pathways in adult autistic PFC.
Transcriptome studies of ASD brain are just beginning to emerge, and a
complete picture of the transcriptional changes occurring in ASD brain
would require larger sample sizes than currently available and extensive
characterization of the brain transcriptome, including noncoding RNAs,
alternative promoters, and alternative splicing isoform regulation. In addi-
tion, understanding the significance of ASD-associated transcriptional
changes is still limited due to the yet incomplete understanding of the normal
human brain transcriptome variation. In the following section, we discuss
recent progress in characterizing the spatial and temporal variation in the
normal human brain and its genetic control, as well as insights from these
studies into the transcriptional regulation of ASD genes.
4. TRANSCRIPTIONAL PROPERTIES OF ASD GENES

IN THE NORMAL HUMAN BRAIN
Most of the studies investigating the brain transcriptome and its
genetic control have been carried out in animal models (Guryev et al.,
2008; Henrichsen et al., 2009). Recently, a few studies have extended
the characterization of brain transcriptome to human tissue, on a large num-
ber of samples, allowing appropriate statistical power (Colantuoni et al.,
2011; Hawrylycz et al., 2012; Kang et al., 2011). Colantuoni et al. examined
temporal transcriptome dynamics across development and aging in PFC, as
well as the underlying genetic control of gene expression. Kang et al. inves-
tigated both spatial and temporal transcriptome variations across brain
regions and during development and adult life. This study also estimated
the association between genetic polymorphisms and gene expression in
the human brain. Hawrylycz et al. generated a transcriptional atlas of the
human brain by sampling hundreds of anatomically defined regions in
two individuals (Hawrylycz et al., 2012). Collectively, these studies aimed to

address several fundamental aspects of the transcriptome variation in the nor-
mal human brain: spatial variation across brain regions, temporal variation
during development and aging, and interindividual variation attributable
to genetic differences. All three studies were conducted using microarray-
based genome-wide expression profiling with larger numbers of samples
than previous investigations of brain transcriptome variation.
Colantuoni et al. focused on the temporal dynamics of gene expression
and analyzed PFC samples from 269 individuals. 38 of these samples were
fetal (14–20 gestational weeks), while the rest spanned a wide spectrum
of ages, from birth to the 80s. The rate of change in gene expression was
found to be much faster during fetal development, in the 6-week window
examined, than at any other stage in human life. The most dramatic change
in gene expression was observed at birth, at the transition between fetal brain
and infant brain, reflecting the major contribution of environment in shap-
ing brain gene expression. This study also noted a reversal of fetal gene
expression changes during postnatal life: of the genes undergoing expression
changes both in fetal brain and in postnatal life, three quarters were found to
reverse the direction of expression change at birth. When assessing the asso-
ciation of SNPs with PFC gene expression, Colantuoni et al. found around
1600 SNPs affecting gene expression and confirmed the previous observa-
tions that the association between SNPs and gene expression depends on the
SNP location relative to the transcription start site. Interestingly, there was
no correlation between the genetic distance between individuals and the
similarity of their brain transcriptome profiles. These data indicate that gene
expression variation attributable to genetic differences between individuals is
of lower magnitude than gene expression changes occurring in PFC across
the life span of a given individual.
Kang et al. investigated both temporal and spatial dynamics of gene
expression in the human brain. This study investigated 16 brain regions from
57 subjects across several time periods: embryonic, early/mid/late fetal, neo-
natal, early/late infancy, early/middle/late childhood, adolescence, and
young/middle/late adulthood. The 16 brain regions examined included
the cerebellum, thalamus, striatum, amygdala, hippocampus, and 11 areas
of the neocortex, totaling 1340 tissue samples. As previously shown,
more subtle gene expression differences were observed among neocortical
areas than between neocortex and the other brain regions. Notably, the
transcriptional profiles of brain regions were more dissimilar in the fetal brain
than those in postnatal life, indicating that spatial transcriptional variation is
particularly pronounced during development. Similar to Colantuoni et al.,

the study by Kang et al. showed dramatic changes in gene expression trajec-
tories at birth, for individual genes as well as functional gene groups. For
example, genes involved in synapse development increased in expression
throughout embryonic and fetal development, continued to increase in
expression at a slower rate during postnatal development and then reached
a plateau during adult life. An opposite trend was observed for genes impli-
cated in cell proliferation, which decreased during development and then
reached a low-level plateau during adult life. These patterns of gene expres-
sion are likely to reflect the dynamic cellular remodeling during brain devel-
opment. Kang et al. also examined the spatial and temporal variations of
alternative splicing isoform expression, by estimating differential exon usage
(DEU) for all expressed genes, across brain regions, and temporal periods.
Remarkably, DEU was highly variable during fetal development but not
during postnatal development or adult life: 83.0% of the expressed genes
showed temporal DEU across fetal development, but only 0.9% were tem-
porally regulated during postnatal development and 1.4% during adulthood.
Overall, the results of these two large-scale studies highlight the marked
transcriptional changes occurring in the developing brain, at both gene and
splicing isoform level, and demonstrate that the postnatal development
period is characterized by temporally regulated gene expression.
These data can inform several fundamental questions regarding the tran-
scriptional regulation of ASD genes in the brain. What are the transcriptional
properties of ASD genes in the human brain? In particular, how does the
expression of ASD genes vary during fetal and postnatal development?
Do all ASD genes follow a similar trend? Are the expression changes
observed in young ASD brains the result of perturbed transcriptional regu-
lation during development?
We examined the temporal variation of ASD gene expression for autism
susceptibility genes using the data from Colantuoni et al. As a reference, we
used the SFARI gene database (Banerjee-Basu & Packer, 2010) and assessed
all genes ranked as having at least suggestive evidence of involvement in
ASD (n ¼ 37). Table 10.1 shows the correlation between gene expression
and age for three distinct age groups: fetal development, postnatal develop-
ment (including infancy and childhood, age <10 years), and teen/adult (age
>10 years). Interestingly, the majority of ASD genes showed a decrease in
expression during postnatal development (Table 10.1 and Fig. 10.1). More
than half of the ASD genes decreased in expression during postnatal devel-
opment (r2 0.5)—PTCHD1, CACNA1C, NRXN1, NLGN4X,
GRIK2, AUTS2, CACNA1H, HOXA1, CNTN4, FOXP2, NLGN3,
Table 10.1 Temporal variation of ASD gene expression in human prefrontal cortex
Gene Fetal Postnatal
symbol Probe ID development development Teen/adult
ADA HEEBO-086- 0.27 0.21 0.35
HCA86H10
ADSL HEEBO-098- 0.23 0.18 0.36
HCA98B15
AHI1 HEEBO-028- 0.15 0.43 0.34
HCC28J10
ALDH5A1 HEEBO-020- 0.35 0.21 0.40
HCC20P12
ARX HEEBO-053- 0.04 0.51 0.04
HCC53O18
ASTN2 HEEBO-099- 0.39 0.02 0.14
HCA99O1
ATP10A HEEBO-036- 0.08 0.05 0.13
HCC36A3
AUTS2 HEEBO-009- 0.12 0.74 0.32
HCC9K20
CACNA1C HEEBO-008- 0.70 0.84 0.13
HCC8D3
CACNA1H HEEBO-015- 0.00 0.72 0.65
HCC15B22
CDKL5 HEEBO-049- 0.05 0.40 0.19
HCC49I11
CNTN4 HEEBO-106- 0.45 0.61 0.01
HCA106E4
CNTNAP2 HEEBO-023- 0.51 0.27 0.19
HCC23G17
DMD HEEBO-016- 0.00 0.02 0.17
HCC16E16
DMPK HEEBO-043- 0.15 0.23 0.27
HCC43J4
FMR1 HEEBO-017- 0.22 0.58 0.31
HCC17G21
FOXP2 HEEBO-108- 0.58 0.59 0.19
HCE108M2
Continued
Table 10.1 Temporal variation of ASD gene expression in human prefrontal cortex—
cont'd
GRIK2 HEEBO-050- 0.27 0.79 0.06
HCC50I12
HOXA1 HEEBO-104- 0.32 0.61 0.09
HCA104I3
LAMB1 HEEBO-012- 0.18 0.20 0.37
HCC12B20
MECP2 HEEBO-020- 0.10 0.02 0.28
HCC20K22
MET HEEBO-009- 0.30 0.50 0.00
HCC9C1
NF1 HEEBO-050- 0.14 0.51 0.05
HCC50L6
NLGN3 HEEBO-028- 0.20 0.57 0.31
HCC28J4
NLGN4X HEEBO-009- 0.67 0.81 0.45
HCC9P3
NRXN1 HEEBO-092- 0.35 0.82 0.08
HCA92O3
OXTR HEEBO-047- 0.39 0.15 0.11
HCC47J2
PTCHD1 HEEBO-013- 0.80 0.84 0.22
HCC13H16
RAI1 HEEBO-031- 0.14 0.33 0.03
HCC31M8
RBFOX1 HEEBO-060- 0.01 0.37 0.08
HCC60A14
RELN HEEBO-013- 0.39 0.48 0.29
HCC13P23
SCN1A HEEBO-048- 0.02 0.19 0.38
HCC48F10
SEMA5A HEEBO-068- 0.60 0.51 0.39
HCC68P24
SHANK3 HEEBO-068- 0.56 0.40 0.06
HCC68M15
Table 10.1 Temporal variation of ASD gene expression in human prefrontal cortex—
cont'd
SLC9A6 HEEBO-039- 0.60 0.23 0.23
HCC39I18
TSC2 HEEBO-085- 0.09 0.49 0.20
HCA85M3
UBE3A HEEBO-069- 0.12 0.43 0.13
HCC69P17
The table lists Spearman correlation coefficients of normalized expression values versus age. Age groups:
fetal development, postnatal development (age <10 years), and teen/adult (age 10 years). For ASD
genes covered by multiple probes, the probe showing the highest expression correlation with age
is shown.
Data from Colantuoni et al. (2011).
Figure 10.1 ASD gene expression variation in the normal human brain. Y-axis: Spearman
correlation coefficients from Table 10.1. Data from Colantuoni et al. (2011).
ARX, NF1, and SEMA5A—or showed a trend toward the decreased

expression RELN, UBE3A, AHI1, SHANK3, CDKL5, RBFOX1, and
RAI1 (0.3 < r2 < 0.5). By contrast, only three genes increased in expres-
sion during infancy and childhood: TSC2, MET, and FMR1. As noted in
the study by Colantuoni et al., the rate of expression variation is generally
reduced for most genes during adult life as compared to childhood or fetal
periods, and this observation held true for ASD genes. However, a few inter-
esting exceptions could be noted such as CACNA1H, which maintains a
similar rate of expression downregulation throughout postnatal develop-
ment and aging. Notably, for some ASD genes, distinct isoforms showed
opposite trends of transcriptional variation during development: for exam-
ple, SHANK3 and RBFOX1 (Fig. 10.2).
CACNA1H HEEBO-015-HCC15B22 SEMA5A HEEBO-068-HCC68P24 MET HEEBO-009-HCC9C1 SCN1A HEEBO-048-HCC48F10
1.5 1.0 0
0.5 1
–1
0.5 0.0
–2 0
–1.0 –3
–0.5 –1
–4
–1.5 –2.0 –2
–5
0 20 40 60 80 0 20 40 60 80 0 20 40 60 80 0 20 40 60 80
Age (years) Age (years) Age (years) Age (years)
RBFOX1 HEEBO-060-HCC60A14 RBFOX1 HEEBO-033-HCC33E11 SHANK3 HEEBO-068-HCC68M15 SHANK3 HEEBO-049-HCC19O8

0.5
0.5
1.5
–1.0
0.0 0.0
1.0
–1.5
–0.5 0.5
–0.5
–2.0 0.0
–1.0
–1.0 –0.5
–2.5
–1.5
0 20 40 60 80 0 20 40 60 80 0 20 40 60 80 0 20 40 60 80
Age (years) Age (years) Age (years) Age (years)
Figure 10.2 Scatter plots of ASD gene expression values versus age for selected genes. Y-axis: normalized expression values from Colantuoni
et al. (2011). Distinct colors reflect distinct 10-year age intervals.
5. CONCLUSIONS AND FURTHER DIRECTIONS

Although no universal pattern of developmental gene regulation
appears to apply to all ASD genes, the data from Colantuoni et al. indicated
a common property of most ASD genes to decrease in expression during
postnatal development. Characterizing gene expression variation during a
specific developmental period in the normal brain provides valuable infor-
mation for interpreting age-dependent gene expression differences between
ASD and controls. For example, genes decreasing in expression during nor-
mal postnatal development would be predicted to be upregulated in young
ASD brains if gene expression changes in young ASD brains were caused by
altered developmental regulation of gene expression. Overall, placing trans-
criptome studies of ASD postmortem brain in the context of a well-
characterized transcriptional landscape of the human brain would greatly
enhance the biological interpretation of transcriptional changes associated
with ASD.
Assessing alternative isoform regulation, noncoding RNA expression
and lowly abundant transcripts by next-generation sequencing is expected
to generate a more complete picture of the human brain transcriptome
in the near future. Transcriptome studies on ASD brain are also expected
to increase in complexity by the widespread use of next-generation sequenc-
ing. Not least, effective integration of disease-specific transcriptome data
and normal human brain expression data will require the development of
appropriate bioinformatics methods for integration of multiple trans-
criptome datasets as well as transcriptome and epigenome data.
ACKNOWLEDGMENTS
We would like to thank Monica Nguyen for proof-reading the manuscript. This work has
been supported by a NARSAD Young Investigator Grant (IV).
REFERENCES
of a new neurobiology. Nature Reviews Genetics, 9, 341–355.
Anitha, A., Nakamura, K., Thanseem, I., Yamada, K., Iwayama, Y., Toyota, T., et al. (2012).
Brain region-specific altered expression and association of mitochondria-related genes in
autism. Molecular Autism, 3, 12.
Anney, R., Klei, L., Pinto, D., Regan, R., Conroy, J., Magalhaes, T. R., et al. (2010).
A genome-wide scan for common alleles affecting risk for autism. Human Molecular
Genetics, 19, 4072–4082.
Medicine, 25, 63–77.
Banerjee-Basu, S., & Packer, A. (2010). SFARI Gene: An evolving database for the autism
research community. Disease Models & Mechanisms, 3, 133–135.
Cantor, R. M. (2009). Molecular genetics of autism. Current Psychiatry Reports, 11, 137–142.
Carayol, J., Sacco, R., Tores, F., Rousseau, F., Lewin, P., Hager, J., et al. (2011). Converging
evidence for an association of ATP2B2 allelic variants with autism in male subjects. Bio-
logical Psychiatry, 70, 880–887.
Chow, M. L., Pramparo, T., Winn, M. E., Barnes, C. C., Li, H. R., Weiss, L., et al. (2012).
Age-dependent brain gene expression and copy number anomalies in autism suggest dis-
tinct pathological processes at young versus mature ages. PLoS Genetics, 8, e1002592.
Colantuoni, C., Lipska, B. K., Ye, T., Hyde, T. M., Tao, R., Leek, J. T., et al. (2011).
Temporal dynamics and genetic control of transcription in the human prefrontal cortex.
Nature, 478, 519–523.
Cook, E. H., Jr., & Scherer, S. W. (2008). Copy-number variations associated with neuro-
psychiatric conditions. Nature, 455, 919–923.
Dolen, G., Osterweil, E., Shankaranarayana Rao, B. S., Smith, G. B., Auerbach, B. D.,
Chattarji, S., et al. (2007). Correction of fragile X syndrome in mice. Neuron, 56, 955–962.
Enstrom, A. M., Lit, L., Onore, C. E., Gregg, J. P., Hansen, R. L., Pessah, I. N., et al. (2009).
Altered gene expression and function of peripheral blood natural killer cells in children
with autism. Brain, Behavior, and Immunity, 23, 124–133.
Fombonne, E. (2009). Epidemiology of pervasive developmental disorders. Pediatric Research,
65, 591–598.
Freitag, C. M. (2007). The genetics of autistic disorders and its clinical relevance: A review of
the literature. Molecular Psychiatry, 12, 2–22.
Garbett, K., Ebert, P. J., Mitchell, A., Lintas, C., Manzi, B., Mirnics, K., et al. (2008).
Immune transcriptome alterations in the temporal cortex of subjects with autism. Neu-
robiology of Disease, 30, 303–311.
Ginsberg, M. R., Rubin, R. A., & Natowicz, M. R. (2013). Patterning of regional gene
expression in autism: New complexity. Scientific Reports, 3, 1831.
Gregg, J. P., Lit, L., Baron, C. A., Hertz-Picciotto, I., Walker, W., Davis, R. A., et al. (2008).
Gene expression changes in children with autism. Genomics, 91, 22–29.
Guryev, V., Saar, K., Adamovic, T., Verheul, M., van Heesch, S. A., Cook, S., et al. (2008).
Distribution and functional impact of DNA copy number variation in the rat. Nature
Genetics, 40, 538–545.
Hawrylycz, M. J., Lein, E. S., Guillozet-Bongaarts, A. L., Shen, E. H., Ng, L., Miller, J. A.,
et al. (2012). An anatomically comprehensive atlas of the adult human brain trans-
criptome. Nature, 489, 391–399.
Henrichsen, C. N., Vinckenbosch, N., Zöllner, S., Chaignat, E., Pradervand, S., Schütz, F.,
et al. (2009). Segmental copy number variation shapes tissue transcriptomes. Nature
Genetics, 41, 424–429.
Hu, V. W., Frank, B. C., Heine, S., Lee, N. H., & Quackenbush, J. (2006). Gene expression
profiling of lymphoblastoid cell lines from monozygotic twins discordant in severity
of autism reveals differential regulation of neurologically relevant genes. BMC Genomics,
7, 118.
Hu, V. W., Nguyen, A., Kim, K. S., Steinberg, M. E., Sarachana, T., Scully, M. A., et al.
(2009). Gene expression profiling of lymphoblasts from autistic and nonaffected sib pairs:
Altered pathways in neuronal development and steroid biosynthesis. PLoS One, 4, e5775.
(2009). Gene expression profiling differentiates autism case-controls and phenotypic var-
iants of autism spectrum disorders: Evidence for circadian rhythm dysfunction in severe
autism. Autism Research, 2, 78–97.
Kang, H. J., Kawasawa, Y. I., Cheng, F., Zhu, Y., Xu, X., Li, M., et al. (2011). Spatio-
temporal transcriptome of the human brain. Nature, 478, 483–489.
Kanner, L. (1968). Autistic disturbances of affective contact. Acta Paedopsychiatrica, 35, 100–136.
Kim, S. H., & Lord, C. (2013). The behavioral manifestations of autism spectrum disorders.
In The neuroscience of autism spectrum disorders (pp. 25–37). Oxford, UK: Elsevier.
Li, X., Zou, H., & Brown, W. T. (2012). Genes associated with autism spectrum disorder.
Brain Research Bulletin, 88, 543–552.
Lintas, C., Sacco, R., & Persico, A. M. (2010). Genome-wide expression studies in Autism
spectrum disorder, Rett syndrome, and Down syndrome. Neurobiology of Disease, 45(1),
57–68.
Lord, C., Petkova, E., Hus, V., Gan, W., Lu, F., Martin, D. M., et al. (2012). A multisite study
of the clinical diagnosis of different autism spectrum disorders. Archives of General Psychiatry,
69, 306–313.
Morrow, E. M. (2010). Genomic copy number variation in disorders of cognitive develop-
ment. Journal of the American Academy of Child and Adolescent Psychiatry, 49, 1091–1104.
Murdoch, J. D., & State, M. W. (2013). Recent developments in the genetics of autism spec-
trum disorders. Current Opinion in Genetics & Development, 23(3), 310–315.
Neale, B. M., Kou, Y., Liu, L., Ma’ayan, A., Samocha, K. E., Sabo, A., et al. (2012). Patterns and
rates of exonic de novo mutations in autism spectrum disorders. Nature, 485, 242–245.
Nishimura, Y., Martin, C. L., Vazquez-Lopez, A., Spence, S. J., Alvarez-Retuerto, A. I.,
Sigman, M., et al. (2007). Genome-wide expression profiling of lymphoblastoid cell lines
distinguishes different forms of autism and reveals shared pathways. Human Molecular
Genetics, 16, 1682–1698.
Nord, A. S., Roeb, W., Dickel, D. E., Walsh, T., Kusenda, M., O’Connor, K. L., et al.
(2011). Reduced transcript expression of genes affected by inherited and de novo CNVs
in autism. European Journal of Human Genetics, 19(6), 727–731.
tions. Nature Genetics, 43, 585–589.
mutations. Nature, 485, 246–250.
Pinto, D., Pagnamenta, A. T., Klei, L., Anney, R., Merico, D., Regan, R., et al. (2010).
Functional impact of global rare copy number variation in autism spectrum disorders.
Nature, 466, 368–372.
Provenzano, G., Zunino, G., Genovesi, S., Sgado, P., & Bozzi, Y. (2012). Mutant mouse
models of autism spectrum disorders. Disease Markers, 33, 225–239.
Purcell, A. E., Jeon, O. H., Zimmerman, A. W., Blue, M. E., & Pevsner, J. (2001).
Postmortem brain abnormalities of the glutamate neurotransmitter system in autism.
Neurology, 57, 1618–1628.
Sanders, S. J., Murtha, M. T., Gupta, A. R., Murdoch, J. D., Raubeson, M. J., Jeremy
Willsey, A., et al. (2012). De novo mutations revealed by whole-exome sequencing
are strongly associated with autism. Nature, 485, 237–241.
Strong association of de novo copy number mutations with autism. Science, 316, 445–449.
Skuse, D. H. (2012). DSM-5’s conceptualization of autistic disorders. Journal of the American
Academy of Child and Adolescent Psychiatry, 51, 344–346.
Song, R. R., Zou, L., Zhong, R., Zheng, X. W., Zhu, B. B., Chen, W., et al. (2011). An
integrated meta-analysis of two variants in HOXA1/HOXB1 and their effect on the risk
of autism spectrum disorders. PLoS One, 6, e25603.
Splawski, I., Timothy, K. W., Sharpe, L. M., Decher, N., Kumar, P., Bloise, R., et al. (2004).
Ca(V)1.2 calcium channel dysfunction causes a multisystem disorder including arrhyth-
mia and autism. Cell, 119, 19–31.
State, M. W. (2010). The genetics of child psychiatric disorders: Focus on autism and
Tourette syndrome. Neuron, 68, 254–269.
State, M. W., & Levitt, P. (2011). The conundrums of understanding genetic risks for autism
spectrum disorders. Nature Neuroscience, 14, 1499–1506.
Steffenburg, S., Gillberg, C., Hellgren, L., Andersson, L., Gillberg, I. C., Jakobsson, G., et al.
(1989). A twin study of autism in Denmark, Finland, Iceland, Norway and Sweden. Jour-
nal of Child Psychology and Psychiatry, 30, 405–416.
Voineagu, I. (2012). Gene expression studies in autism: Moving from the genome to the
transcriptome and beyond. Neurobiology of Disease, 45, 69–75.
380–384.
459, 528–533.
Weiss, L. A., Arking, D. E., Daly, M. J., & Chakravarti, A. (2009). A genome-wide linkage
and association scan reveals novel loci for autism. Nature, 461, 802–808.
Wiznitzer, M. (2004). Autism and tuberous sclerosis. Journal of Child Neurology, 19, 675–679.
Xu, L. M., Li, J. R., Huang, Y., Zhao, M., Tang, X., & Wei, L. (2012). AutismKB: An
evidence-based knowledgebase of autism genetics. Nucleic Acids Research, 40,
D1016–D1022.
Yu, T. W., Chahrour, M. H., Coulter, M. E., Jiralerspong, S., Okamura-Ikeda, K.,
Ataman, B., et al. (2013). Using whole-exome sequencing to identify inherited causes
of autism. Neuron, 77, 259–273.
Zhou, X., Xu, Y., Wang, J., Zhou, H., Liu, X., Ayub, Q., et al. (2011). Replication of the
association of a MET variant with autism in a Chinese Han population. PLoS One, 6,
e27428.
Ziats, M. N., & Rennert, O. M. (2013). Aberrant expression of long noncoding RNAs in
autistic brain. Journal of Molecular Neuroscience, 49, 589–593.
INDEX
Note: Page numbers followed by “f ” indicate figures and “t ” indicate tables.
A SFARI gene database, 306–307

Abnormal cerebellar activation, autism single-nucleotide polymorphisms
complex motor tasks, 12 (SNPs), 306
explicit and implicit processing, facial syndromic forms, 305
expressions, 12 Autism. See also Autism spectrum disorders
functional imaging, 11–12 (ASDs)
lobule VII dysfunction, 12–13 conditions, 303–304
A2BP1. See RBFOX1 gene definition, 303–304
Animal models Autism genes
songbird models, 119 CADPS2 protein, 16
ultrasonic vocalizations, rodents, 116–119 En2 knockout mice, 14–15
Antipurinergic therapy, 231 extracellular matrix protein reelin, 15–16
ASD brain transcriptome studies Foxp2 gene, 15
AMPA receptor subunits, 307–308 Gabrb3 gene, 16–17
ASD postmortem brain, 315 MET gene, 15–16
blood and lymphoblast cell lines, 307–308 PTEN, 16
common transcriptional change, ROR-alpha, 15
307–308 Autism Genetic Resource Exchange
gene expression differences, 307–308 (AGRE), 256–257
gene expression values vs. age for selected Autism spectrum disorders (ASDs). See
genes, 314f also ASD models
genetic heterogeneity, 307 aberrant genetic programs, 137
genetic variants, 307 abnormal cerebellar activation, 11–13
long noncoding RNAs, 307–308 antidepressant and antipsychotic drugs,
mitochondria-related genes, 290
dysregulation, 307–308 autistic children, 270
prefrontal cortex (PFC), 307–308 autoimmune studies, 13–14
spatial and temporal variation, 308 candidate genes, 168–169
ASD models causative genes, 136–137
cerebellum, 78–80 central nervous system (CNS), 137–138
GABAergic interneurons, 74–78 cerebellar organization, 3–5
serotonergic neurons, 69–74 cerebellar pathology, 8–9
striatum, 81–83 cerebellar phenotypes, rodent models,
ASDs. See Autism spectrum disorders 17–19
(ASDs) clinical heterogeneity, 270–271
ASD susceptibility genes clinical imaging and animal studies,
cytogenetic abnormalities, 306 137–138
de novo CNVs, 306 communication (see Communication)
de novo SNVs complexities, assessment and diagnosis,
animal models, 306 304
in coding regions, 306 connectivity and circuit activity in human
GWAS, 306 brain, 157–158
319
320 Index
Autism spectrum disorders (ASDs) synaptogenesis and neural circuit

(Continued ) dynamics, 137
de novo mutations, 135–136 transcriptional dysregulation, neocortical
description, 2, 62 circuit assembly (see Transcriptional
diagnostic features, 270, 271f dysregulation)
“disconnection syndrome”, 157–158 Autoantibody production
DNA sequence variation, 304–305 autoimmune-related neurological
“early infantile autism”, 270 disorders, 278
environmental and genetic factors, 37/73 kDa reactivity, 277
272–273, 290–292, 291f maternal bloodstream, 277
evidence, mouse genetics, 20–21 maternal immunoglobulin (Ig), 276
gene encoding, 270–271 MIA, 278
genes encode proteins, 136–137 pathogenesis, ASD, 276–277
genes, mouse cerebellar development, protein and GAD65, 276
14–17 Autoimmune studies, ASD, 13–14
genetic, clinical and neurobiological
findings, 157–158 B
genetic risk factors, 278–280 Balance deficits, 213
genetics (see Genetics, ASD) Basal ganglia
human MET gene (see Human MET ASD, 223–224
gene, autism risk factor) and cerebellum, 224–225
immune dysregulation, 271–272 cortico-basal ganglia loops, 221–223
immunomodulatory therapies, 289–290 “reinforcement learning circuitry”,
intracellular molecular pathways, 227–228
156–157 Biomarkers, 46
language dysfunction, 157–158 Blood protein markers, 285–286
maternal autoantibody production Blood transcriptome, 286–287
(see autoantibody production) Brain cytokine dysregulation, 282–283
MET receptor tyrosine kinase-mediated Brain development and function
signaling (see MET receptor tyrosine BDNF, 43–44
kinase) GABA, 43
MIA (see Maternal immune activation MALAT1, 42–43
(MIA)) neurogenesis, 42
motor impairment, 6–8 synaptogenesis, 42–43
motor skill (see Motor skill) Brain development, MET receptor tyrosine
neurodevelopmental syndromes, kinase
135–136 Barrington’s nucleus, 146–147
neuron behavior, 156–157 brainstem circuitry, 146–147
pathogenesis, 287–289 CA1 region, 147–148
pathogenic mutations, 136–137 FOXP2, 148–149
postnatal immune dysregulation Hgf and Met transcripts, 145
(see Postnatal immune dysregulation, high-resolution immunohistochemistry
ASD) staining, 145–146
risk genes, 63, 168–169 in situ hybridization, 145–146
rodent behavioral assays, 66–69 intrinsic regulatory mechanism, 148–149
structural neuroimaging, 9–11 macaque brain, 147
submicron-scale structure, 136–137 mouse neocortex, 147
symptoms, cerebellar disorders, 5–6 primate brain, 147
Index 321
rodent brain, 147 cortical-striatal-thalamic circuitry,

subcellular distribution, 147–148 100–101, 100f
ultrastructural study, 147–148 FOXP2 and FOXP1, 101–102
Western blotting, 145–146 genes and molecular pathways, 119
genome-wide studies, 122
human-specific trait, 98
C in vivo, animal models, 123
Ca2þ-dependent activator protein for and language (see Language, ASD)
secretion 2 (CADPS2), 16 meta-analyses, 123–124
CADPS2. See Ca2þ-dependent activator micro-arrays and RNA-seq, 120
protein for secretion 2 (CADPS2) neurodevelopmental disorders, 98
Cancer and LncRNAs olivedrab2 module, 120–122, 121f
HOX genes, 40–41 synapse formation, 120
MEG3, 41 thalamus and basal ganglia, 101
PTEN, 40 transgenic techniques/viral approaches,
CCAS. See Cerebellar cognitive affective 123
syndrome (CCAS) WGCNA, 120–122
Cerebellar cognitive affective syndrome Conditional deletion, 66, 70–71, 76,
(CCAS), 5 83–84
Cerebellum Contactin-associated protein-like 2
abnormal activation, autism, 11–13 (CNTNAP2)
ASD models, 78–80 ASD-related behaviors, 108–109
autism genes, mouse, 14–17 clustering potassium channels, 108
autoimmune studies, 13–14 description, 107–108
differences, autism, 9–11 drug treatment, 108–109
disorders, 5–6 genetic manipulations, 108–109
motor impairments, ASD, 7t human frontal cortex, 108
neurons, 2 knockout mice, 108–109
organization, 3–5 mouse models, 108–109
pathology, autism, 8–9 Copy number variations (CNVs)
phenotypes, rodent models, 17–19 DGV, 256–257
Cerebral cortex organization, 172–174 human neurodevelopmental disease,
CFs. See Climbing fibers (CFs) 255–256
Chromatin immunoprecipitation coupled to RBFOX1 CNVs, 255–257, 259–260,
promoter microarrays (ChIP-chip), 262–263
103–104 Cortico-basal ganglia loops
Climbing fibers (CFs), 230–231 “goal-directed” vs. “habitual” movement,
CNTNAP2. See Contactin-associated 222–223
protein-like 2 (CNTNAP2) reinforcement learning, 222
CNVs. See Copy number variations (CNVs) striatal medium spiny neurons, 221–222
Communication Corticocerebellar loops, 219–220
animal models (see Animal models) Cortico–subcortical loops, motor control
brain lesion studies, 99 basal ganglia and cerebellum, 218
cerebellum, 100–101 basal ganglia findings, ASD, 223–224
cognitive functions, 98 cerebellar findings, ASD, 220–221
convergent signaling networks, cerebellum and basal ganglia, 224–225
120–122 cortico-basal ganglia loops, 221–223
cortical-cortical connections, 99 corticocerebellar loops, 219–220
322 Index
D molecular pathways downstream,

Diagnostic and Statistical Manual of Mental 110–115, 115f
Disorders (DSM-V), 303–304 neocortex and striatum, 109
DIR/Floortime, 232 signaling pathways, brain, 109
Dyspraxia, 216 transcriptional targets, 110–115
Dysregulation, RBFOX1 FOXP2 (forkhead box P2)
alternative splicing, 261–262 animal models, 103
cellular depolarization, 261–262 ASD genes, 103–104
de novo structural variants, ASD, 259–260 ChIP-chip, 103–104
model, 261f and CNTNAP2, 107
RBFOX1 CNVs, 259–260, 262–263 DNA binding motif, 104
zebra fish, 260 ENCODE dataset, 104
forkhead transcription factors, 102–103
gene database, 103–104, 105t
E gene expression microarrays, 104–107
Encyclopedia of DNA Elements
genetic variation, 103–104
(ENCODE), 104
human frontal pole-specific coexpression
Epigenetics
module, 120–122
Antisense Igf2r (Air), 40
language and ASD, 122–123
HOTAIR, cancer, 40–41
and MET, 107
Xist, 38–40
molecular evolution, 102–103
Eye movements
songbird models, 119
closed-loop velocity deficit, 217–218 USVs, 103, 118–119
description, 217
Fragile X syndrome (FXS), 5, 9, 18
pursuit and saccade latency deficits,
FXS. See Fragile X syndrome (FXS)
217–218
G
F GABA. See g-aminobutyric acid (GABA)
FEZ family zinc finger 2 GABAergic interneurons, ASD models
axonal projections, 187–188 benzodiazepines, 77–78
dendrites morphological development, GABA, 74–75
189 GABAA receptor, 75
description, 186 5-HT receptors, 78
genetic findings, 186–187, 186f Mecp2 mouse model, 76, 77
L5 molecular identity, 187–188 Reeler mice, 78
neocortical expression, 187 g-Aminobutyric acid (GABA), 74–75. See
Fine motor skills also GABAergic interneurons, ASD
description, 215 models
illegible handwriting, 216 Genetics, ASD
precision grip, 215 mouse models, ASD risk genes, 66
FOX1. See RBFOX1 gene protein–protein interaction networks,
FOXP1 (forkhead box P1) 64–65
ASD genes, 110–115, 111t SHANK3 gene, 63–64
cognitive behavioral studies, 110–115 WES, 63–65, 65t
genetic variation, 110 Genetic variation, RBFOX1
human frontal pole-specific coexpression AGRE, 256–257
module, 120–122 alternative splicing, 253
immune function, striatum, 110–115 CNVs, 254f, 255–256, 257
Index 323
genomic architecture, 254f I

haploinsufficiency, 253–255, 256 Imaging. See Neuroimaging
SNP variants, 257–258 International Standard for Cytogenomic
transcriptome analysis, 256 Arrays (ISCA), 257
Genome-wide association studies (GWAS), ISCA. See International Standard for
48, 49f, 304 Cytogenomic Arrays (ISCA)
Genomic imprinting, 40
Gross motor skills
J
balance, 213
Joubert syndrome (JS), 5
gait, 213
JS. See Joubert syndrome (JS)
reaching, 213–215
GWAS. See Genome-wide association
studies (GWAS) L
Language, ASD
CNTNAP2, 107–109
H convergent signaling networks, 120–122
Hepatocyte growth factor (HGF) FOXP1, 109–115
alleviates neuronal injury, rat, 144–145 FOXP2, 102–107
axonal growth ganglion neurons, neurobiology, 123–124
143–144 Layer-dependent identities and
cerebellar granule neurons, 142–143 connectivities
chick embryos, 142 FEZ family zinc finger 2, 186–189
cranial motor axons, 143–144 SATB2, 189–192
gonadotropin hormone, 142–143 Sox5, 183–185
hippocampal neurons, 143–144 TBR1, 178–183
human mesenchymal stem cells, TFs, 177–178
144–145 LncRNAs. See Long noncoding RNAs
mesenchymal–epithelial interactions, (lncRNAs)
138–139 Long noncoding RNAs (LncRNAs)
molecular components, 157–158 ASD, 47–48
motor neuron survival and synergizes, brain, 41–47
144–145 cancer, 40–41
neuroprotective effects, 144–145 description, 38
PI3K pathway, 143–144 genetic mechanisms, 38–40
protective effect, 144–145 neurodevelopmental and
“scatter factor”, 138–139 neurodegenerative disorders, 39t
uPAR, 142–143
HGF. See Hepatocyte growth factor (HGF) M
Human leukocyte antigen (HLA) genes, Major histocompatibility complex (MHC),
279–280 279–280
Human MET gene, autism risk factor Maternal immune activation (MIA)
candidate gene, 149–150 animal models, 274
genetic and pathophysiological evidence, autism, 273–274
150–151 brain cytokines, 275
genotype and functional activation, 151 epidemiological study, 275–276
rs1858830 “C” allelic association, 150, fetal brain, 275
151 immune tolerance, maternal–fetal
SERPINE1 gene, 150–151 interface, 274–275
324 Index
Maternal immune activation (MIA) Molecular pathogenesis, RBFOX1

(Continued ) Drosophila melanogaster and zebra fish
infections, microorganisms, 273–274 homologues, 258
maternal injection, 274–275 exon inclusion, 258–259
maternal serum and amniotic fluid, human RBFOX1, 258
273–274 Motor impairment, autistic individuals
microbial antigens, 273–274 cerebellar, 6–8, 7t
prenatal immune activation, 275–276 dyspraxia, 6
Maternally expressed gene 3 (MEG3), 41 gesture and imitation, lack of, 8
MEG3. See Maternally expressed gene 3 infants, 8
(MEG3) performance, motor tasks, 8
MET receptor tyrosine kinase Motor skill
adaptor proteins, 139, 141 correlation, social and communication
brain development (see Brain skill, 211–212
development, MET receptor cortico–subcortical loops
tyrosine kinase) (see Cortico–subcortical loops,
cancer cells, 141–142 motor control)
cerebellar granule neurons, 142–143 dyspraxia, 216
chick embryos, 142 eye movements, 217–218
cranial motor axons, 143–144 fine, 215–216
downstream effector proteins, 139 functional connectivity, 228
gonadotropin hormone, 142–143 gestures, infancy, 209
and HGF, 138–139 gross, 212–215
hippocampal neurons, 143–144 head lag, 210–211
mesenchymal-epithelial interactions, orienting behavior, 210–211
138–139 “reinforcement learning circuitry”,
molecular signaling events, 142 227–228
neural development and functional sensorimotor behaviors, infants, 210
connectivity (see Neural social and cognitive development,
development, MET) 209–210
neuronal growth and morphology, “supervised learning” circuitry, 219f,
143–144 226–227
neurotrophic/neuroprotective factor, training (see Motor training)
144–145 Motor training
NMDA receptor subunit NR2B and acrobatic motor skill training-induced
PSD-95 protein, 144 plasticity, 228, 229f
nonneuronal cells, 141 children, 232–233
PI3K pathway, 143–144 older adults, 232–233
potential molecular signaling pathways, rodents, 230–232
139, 140f “spatial coordinate” and “motor
RAS pathways, 141–142 coordinate” loop, 230
STAT3 transcription factor, 141–142 Mouse models, autism
a- and b-subunits, 139 Fmr1-deficient mice, 18
tyrosine kinase domain, 139 maternal deficiency, 18–19
uPAR-deficient mice, 142–143 Neuroligin-3 (Nlgn3) mice, 19
MHC. See Major histocompatibility Shank3 mouse models, 19
complex (MHC) Ube3am-/pþ mice, 18–19
MIA. See Maternal immune activation (MIA) valproic acid (VPA) rat model, 17
Index 325
N Neurogenesis
ncRNAs. See Noncoding RNAs defects, 176
(ncRNAs) early cortical, mouse, 175–176
Neocortical circuit assembly, transcriptional gliogenesis, 173f
dysregulation. See Transcriptional neocortical projection neurons, 175
dysregulation Neuroimaging
Neocortical inhibitory interneurons, 177 cerebellar hypoplasia, 10
Neocortical projection neurons vermal lobules, 10
CNTNAP2 absence, 176–177 voxel-based morphometry studies,
neurogenesis, 175–176 10–11, 11f
postmigratory neurons, 175 Neuroimmune abnormalities
preplate (PP), 174–175 brain cytokine dysregulation, 282–283
Reeler mutation, 176 immune molecules, brain development,
RGCs, 174 283–285, 284t
subtypes, 174 microglia, 280–281
Neural circuit wiring, 169, 193 transcriptome changes, 281–282
Neural development, MET Neuronal migration
disconnection syndrome and defects, 176–177, 192
pathophysiology, 152 definition, 169–170
functional and structural imaging studies, neocortical minicolumns, 169–170
154–155 Reeler mutant, 176
GABAergic interneurons, 152 Satb2 absence, 192
intracellular mechanisms, 152 Noncoding RNAs (ncRNAs)
laser scanning photostimulation (LSPS), categories, 36
155–156 long (see Long noncoding RNAs
mature synapses, 152–153 (LncRNAs))
Metfx/fx and Emx1cre neurons, small, 36–38
153–154
neuroanatomical and functional mapping, P
155–156 Peripheral immune abnormalities, ASD
neurogenetic and neuroanatomical blood protein markers, 285–286
approaches, 155–156 blood transcriptome, 286–287
neurological dysfunction, 153–154 leukocyte abundance and function, 286
physiological role, 152–153 Postnatal immune dysregulation, ASD
synaptic proteins, 152–153 neuroimmune abnormalities
Neurodegenerative diseases (see Neuroimmune abnormalities)
BC200 RNA, 44 peripheral immune abnormalities,
lncRNAs, 44 285–287
Neurodevelopmental disorders
FMR1 genes, 45 R
HAR1, 46–47 Radial glial cells (RGCs), 173f, 174
RMST, 46 RAR-related orphan receptor alpha
schizophrenia, 45 (ROR-alpha), 15
UBE3A-ATS, 46 RBFOX1 gene
Neurodevelopmental programs, RBFOX1. dysregulation, 259–263
See RBFOX1 gene genetic variation and ASD, 253–258
Neurodevelopment, immune molecules, model systems, 258–259
283–285, 284t RNA splicing factor, 252
326 Index
Reaching behavior, ASD Sox5. See Sex-determining region Y-box 5

ADHD, 215 (Sox5)
EMG responses, mouth-opening muscle, Special AT-rich sequence-binding protein 2
214 (SATB2)
hand movement, 213–214 callosal defects, 191–192
visual guidance, 214–215 description, 189
Receptor tyrosine kinase (RTK). See MET genetic findings, 189–190, 190f
receptor tyrosine kinase intracortical projection neurons, 191–192
Reinforcement learning, 222, 224–225, layer-dependent expression, Auts2,
227–228 190–191
RGCs. See Radial glial cells (RGCs) neuronal migration, 192
RNA splicing factor, 252 Striatum
Rodent behavioral assays dorsal and ventral, 81
communication, 67 FOXP2, 81–82
hyperactivity, 68 functional imaging studies, 81
mouse models functions, 66 SHANK3, 82–83
restricted behaviors/resistance to change, “Supervised learning” circuitry, 226–227
68
social behavior paradigms, 67 T
urinary scent marking behavior, 67–68 T-box brain factor 1 (TBR1)
AUTS2 and Reelin RELN regulation, 180
S de novo mutations, 178–180
SATB2. See Special AT-rich sequence- early corticofugal circuits, 181
binding protein 2 (SATB2) genetic findings, ASD, 178–180, 179f
Serotonergic neurons, ASD models intracortical connections, 181–182
Fev gene, 70–71 neocortical gene expression and function,
5-HT neurons, 69 178, 179f
phenotypes, genetic mouse models, 71, neonatal mouse cortex, 180–181
72t postnatal neocortex, 181–182
Slc6a4-/- mice, 71 SP, 182–183
synaptic 5-HT activity, 74 Tbr1-null mouse, 180
TRAP, 74 TBR1. See T-box brain factor 1 (TBR1)
Sex-determining region Y-box 5 (Sox5) Transcriptional dysregulation
CST formation, 184 ASD-related layer-dependent identity
embryonic neocortex, 184 and connectivity (see Layer-
genetic findings, 183–184, 183f dependent identities and
intragenic microdeletions, 183–184 connectivities)
L5 marker genes, 185 cerebral cortex organization, 172–174
neocortical gene expression and function, neocortical inhibitory interneurons, 177
179f, 184 neocortical projection neurons,
Sox5-deficient mice, 184, 185 generation and migration, 174–177
Small ncRNA transcription factors (TFs), 168
genetic regulation, 36–37 Transcriptional properties, ASD genes
miRNAs, 37 correlation between genetic distance, 309
siRNA, 37–38 development and aging in PFC, 308–309
sub-classes, 36–37 differential exon usage (DEU), 309–310
Social and communication skill, 211–212 expression during infancy and childhood,
Songbird models, 119 310–314
Index 327
gene expression and age, correlation, 311t manipulation, pup, 116, 118f
gene expression variation in human brain, mutations, 116–118
313f NLGN4 knockout mice, 116–118
genes involved in synapse development, SHANK2 knockout females, 118
309–310 speech and language disorders, 118–119
rate of change in gene expression, 309 Urokinase-type plasminogen activator
temporal and spatial dynamics, 309–310 receptor (uPAR), 142–143, 152
temporally regulated gene expression, 310
temporal variation, 310–314 V
Translating ribosome affinity purification Voxel-based morphometry studies, 10–11,
(TRAP), 74 11f
TRAP. See Translating ribosome affinity
purification (TRAP)
W
U Weighted gene coexpression network
Ultrasonic vocalizations (USVs) analysis (WGCNA), 120–122
autistic-like communication, 116–118
communication, 116 X
experimental set up, 116, 117f X-chromosome inactivation (XCI), 38–40
Foxp2 mutant mice, 116, 118–119 X-inactive specific transcript (Xist), 38–40
CONTENTS OF RECENT VOLUMES
Volume 37 Section V: Psychophysics, Psychoanalysis,

and Neuropsychology
Section I: Selectionist Ideas and Neurobiology
Phantom Limbs, Neglect Syndromes, Repressed
Selectionist and Instructionist Ideas in Memories, and Freudian Psychology
Neuroscience V. S. Ramachandran
Olaf Sporns
Neural Darwinism and a Conceptual Crisis
Population Thinking and Neuronal Selection: in Psychoanalysis
Metaphors or Concepts? Arnold H. Modell
Ernst Mayr
A New Vision of the Mind
Selection and the Origin of Information Oliver Sacks
Manfred Eigen
INDEX
Section II: Development and Neuronal
Populations
Morphoregulatory Molecules and Selectional
Dynamics during Development
Volume 38
Kathryn L. Crossin Regulation of GABAA Receptor Function and
Gene Expression in the Central Nervous System
Exploration and Selection in the Early Acquisition
A. Leslie Morrow
of Skill
Esther Thelen and Daniela Corbetta Genetics and the Organization of the Basal
Ganglia
Population Activity in the Control of Movement
Robert Hitzemann, Yeang Olan, Stephen Kanes,
Apostolos P. Georgopoulos
Katherine Dains, and Barbara Hitzemann
Section III: Functional Segregation and
Structure and Pharmacology of Vertebrate
Integration in the Brain
GABAA Receptor Subtypes
Reentry and the Problem of Cortical Integration Paul J. Whiting, Ruth M. McKernan, and Keith
Giulio Tononi A. Wafford
Coherence as an Organizing Principle of Cortical Neurotransmitter Transporters: Molecular
Functions Biology, Function, and Regulation
Wolf Singerl Beth Borowsky and Beth J. Hoffman
Temporal Mechanisms in Perception Presynaptic Excitability
Ernst Pöppel Meyer B. Jackson
Section IV: Memory and Models Monoamine Neurotransmitters in Invertebrates
and Vertebrates: An Examination of the Diverse
Selection versus Instruction: Use of Computer
Enzymatic Pathways Utilized to Synthesize and
Models to Compare Brain Theories
Inactivate Biogenic Amines
George N. Reeke, Jr.
B. D. Sloley and A. V. Juorio
Memory and Forgetting: Long-Term and Gradual
Neurotransmitter Systems in Schizophrenia
Changes in Memory Storage
Gavin P. Reynolds
Larry R. Squire
Physiology of Bergmann Glial Cells
Implicit Knowledge: New Perspectives on
Thomas Müller and Helmut Kettenmann
Unconscious Processes
Daniel L. Schacter INDEX
329
330 Contents of Recent Volumes
Volume 39 Calcium Antagonists: Their Role in

Neuroprotection
Modulation of Amino Acid-Gated Ion Channels A. Jacqueline Hunter
by Protein Phosphorylation
Stephen J. Moss and Trevor G. Smart Sodium and Potassium Channel Modulators:
Their Role in Neuroprotection
Use-Dependent Regulation of GABAA Tihomir P. Obrenovich
Receptors
Eugene M. Barnes, Jr. NMDA Antagonists: Their Role in
Neuroprotection
Synaptic Transmission and Modulation in the Danial L. Small
Neostriatum
David M. Lovinger and Elizabeth Tyler Development of the NMDA Ion-Channel
Blocker, Aptiganel Hydrochloride, as a Neuro-
The Cytoskeleton and Neurotransmitter protective Agent for Acute CNS Injury
Receptors Robert N. McBurney
Valerie J. Whatley and R. Adron Harris
The Pharmacology of AMPA Antagonists
Endogenous Opioid Regulation of Hippocampal and Their Role in Neuroprotection
Function Rammy Gill and David Lodge
Michele L. Simmons and Charles Chavkin
GABA and Neuroprotection
Molecular Neurobiology of the Cannabinoid Patrick D. Lyden
Receptor
Mary E. Abood and Billy R. Martin Adenosine and Neuroprotection
Bertil B. Fredholm
Genetic Models in the Study of Anesthetic Drug
Action Interleukins and Cerebral Ischemia
Victoria J. Simpson and Thomas E. Johnson Nancy J. Rothwell, Sarah A. Loddick, and Paul
Stroemer
Neurochemical Bases of Locomotion and Ethanol
Stimulant Effects Nitrone-Based Free Radical Traps as Neuro-
Tamara J. Phillips and Elaine H. Shen protective Agents in Cerebral Ischemia and Other
Pathologies
Effects of Ethanol on Ion Channels Kenneth Hensley, John M. Carney, Charles
Fulton T. Crews, A. Leslie Morrow, Hugh A. Stewart, Tahera Tabatabaie, Quentin Pye,
Criswell, and George Breese and Robert A. Floyd
INDEX Neurotoxic and Neuroprotective Roles of Nitric
Oxide in Cerebral Ischemia
Volume 40 Turgay Dalkara and Michael A. Moskowitz
Mechanisms of Nerve Cell Death: Apoptosis or A Review of Earlier Clinical Studies on Neuro-
Necrosis after Cerebral Ischemia protective Agents and Current Approaches
R. M. E. Chalmers-Redman, A. D. Fraser, Nils-Gunnar Wahlgren
W. Y. H. Ju, J. Wadia, N. A. Tatton, and
INDEX
W. G. Tatton
Changes in Ionic Fluxes during Cerebral Ischemia
Tibor Kristian and Bo K. Siesjo Volume 41
Techniques for Examining Neuroprotective Section I: Historical Overview
Drugs in Vitro
Rediscovery of an Early Concept
A. Richard Green and Alan J. Cross
Jeremy D. Schmahmann
Techniques for Examining Neuroprotective
Section II: Anatomic Substrates
Drugs in Vivo
Mark P. Goldberg, Uta Strasser, and Laura The Cerebrocerebellar System
L. Dugan Jeremy D. Schmahmann and Deepak N. Pandya
Contents of Recent Volumes 331
Cerebellar Output Channels Olivopontocerebellar Atrophy and Friedreich’s

Frank A. Middleton and Peter L. Strick Ataxia: Neuropsychological Consequences of
Bilateral versus Unilateral Cerebellar Lesions
Cerebellar-Hypothalamic Axis: Basic Circuits and
Thérèse Botez-Marquard and Mihai I. Botez
Clinical Observations
Duane E. Haines, Espen Dietrichs, Gregory Posterior Fossa Syndrome
A. Mihailoff, and E. Frank McDonald Ian F. Pollack
Section III. Physiological Observations Cerebellar Cognitive Affective Syndrome
Jeremy D. Schmahmann and Janet C. Sherman
Amelioration of Aggression: Response to
Selective Cerebellar Lesions in the Inherited Cerebellar Diseases
Rhesus Monkey Claus W. Wallesch and Claudius Bartels
Aaron J. Berman
Neuropsychological Abnormalities in Cerebellar
Autonomic and Vasomotor Regulation Syndromes—Fact or Fiction?
Donald J. Reis and Eugene V. Golanov Irene Daum and Hermann Ackermann
Associative Learning Section VI: Theoretical Considerations
Richard F. Thompson, Shaowen Bao, Lu Chen,
Cerebellar Microcomplexes
Benjamin D. Cipriano, Jeffrey S. Grethe,
Masao Ito
Jeansok J. Kim, Judith K. Thompson,
Jo Anne Tracy, Martha S. Weninger, and Control of Sensory Data Acquisition
David J. Krupa James M. Bower
Visuospatial Abilities Neural Representations of Moving Systems
Robert Lalonde Michael Paulin
Spatial Event Processing How Fibers Subserve Computing Capabilities:
Marco Molinari, Laura Petrosini, and Liliana Similarities between Brains and Machines
G. Grammaldo Henrietta C. Leiner and Alan L. Leiner
Section IV: Functional Neuroimaging Studies Cerebellar Timing Systems
Richard Ivry
Linguistic Processing
Julie A. Fiez and Marcus E. Raichle Attention Coordination and Anticipatory Control
Natacha A. Akshoomoff, Eric Courchesne, and
Sensory and Cognitive Functions
Jeanne Townsend
Lawrence M. Parsons and Peter T. Fox
Context-Response Linkage
Skill Learning
W. Thomas Thach
Julien Doyon
Duality of Cerebellar Motor and Cognitive
Section V: Clinical and Neuropsychological
Functions
Observations
James R. Bloedel and Vlastislav Bracha
Executive Function and Motor Skill Section VII: Future Directions
Learning
Mark Hallett and Jordon Grafman Therapeutic and Research Implications
Jeremy D. Schmahmann
Verbal Fluency and Agrammatism
Marco Molinari, Maria G. Leggio, and Maria
C. Silveri
Classical Conditioning Volume 42
Diana S. Woodruff-Pak Alzheimer Disease
Mark A. Smith
Early Infantile Autism
Margaret L. Bauman, Pauline A. Filipek, and Neurobiology of Stroke
Thomas L. Kemper W. Dalton Dietrich
Free Radicals, Calcium, and the Synaptic Vesicle Recycling at the Drosophila Neuromuscu-
Plasticity-Cell Death Continuum: Emerging lar Junction
Roles of the Trascription Factor NFkB Daniel T. Stimson and Mani Ramaswami
Mark P. Mattson
Ionic Currents in Larval Muscles of Drosophila
AP-I Transcription Factors: Short- and Long- Satpal Singh and Chun-Fang Wu
Term Modulators of Gene Expression in the Brain
Development of the Adult Neuromuscular
Keith Pennypacker
System
Ion Channels in Epilepsy Joyce J. Fernandes and Haig Keshishian
Istvan Mody
Controlling the Motor Neuron
Posttranslational Regulation of Ionotropic Gluta- James R. Trimarchi, Ping Jin, and Rodney
mate Receptors and Synaptic Plasticity K. Murphey
Xiaoning Bi, Steve Standley, and Michel Baudry
Heritable Mutations in the Glycine, GABAA, and
Nicotinic Acetylcholine Receptors Provide New
Insights into the Ligand-Gated Ion Channel
Volume 44
Receptor Superfamily Human Ego-Motion Perception
Behnaz Vafa and Peter R. Schofield A. V. van den Berg
INDEX Optic Flow and Eye Movements
M. Lappe and K.-P. Hoffman
The Role of MST Neurons during Ocular Track-
Volume 43 ing in 3D Space
K. Kawano, U. Inoue, A. Takemura, Y. Kodaka,
Early Development of the Drosophila Neuromus-
and F. A. Miles
cular Junction: A Model for Studying Neuronal
Networks in Development Visual Navigation in Flying Insects
Akira Chiba M. V. Srinivasan and S.-W. Zhang
Development of Larval Body Wall Muscles Neuronal Matched Filters for Optic Flow
Michael Bate, Matthias Landgraf, and Mar Ruiz Processing in Flying Insects
Gómez Bate H. G. Krapp
Development of Electrical Properties and Synaptic A Common Frame of Reference for the Analysis
Transmission at the Embryonic Neuromuscular of Optic Flow and Vestibular Information
Junction B. J. Frost and D. R. W. Wylie
Kendal S. Broadie
Optic Flow and the Visual Guidance of
Ultrastructural Correlates of Neuromuscular Locomotion in the Cat
Junction Development H. Sherk and G. A. Fowler
Mary B. Rheuben, Motojiro Yoshihara, and
Stages of Self-Motion Processing in Primate
Yoshiaki Kidokoro
Posterior Parietal Cortex
Assembly and Maturation of the Drosophila Larval F. Bremmer, J.-R. Duhamel, S. B. Hamed, and
Neuromuscular Junction W. Graf
L. Sian Gramates and Vivian Budnik
Optic Flow Analysis for Self-Movement
Second Messenger Systems Underlying Plasticity Perception
at the Neuromuscular Junction C. J. Duffy
Frances Hannan and Yi Zhong
Neural Mechanisms for Self-Motion Perception
Mechanisms of Neurotransmitter Release in Area MST
J. Troy Littleton, Leo Pallanck, and Barry R. A. Andersen, K. V. Shenoy, J. A. Crowell,
Ganetzky and D. C. Bradley
Computational Mechanisms for Optic Flow Epilepsy-Associated Plasticity in gamma-

Analysis in Primate Cortex Amniobutyric Acid Receptor Expression,
M. Lappe Function and Inhibitory Synaptic Properties
Douglas A. Coulter
Human Cortical Areas Underlying the Perception
of Optic Flow: Brain Imaging Studies Synaptic Plasticity and Secondary Epileptogenesis
M. W. Greenlee Timothy J. Teyler, Steven L. Morgan, Rebecca
N. Russell, and Brian L. Woodside
What Neurological Patients Tell Us about the Use
of Optic Flow Synaptic Plasticity in Epileptogenesis: Cel-
L. M. Vaina and S. K. Rushton lular Mechanisms Underlying Long-Lasting
Synaptic Modifications that Require New Gene
INDEX
Expression
Oswald Steward, Christopher S. Wallace, and Paul
F. Worley
Volume 45 Cellular Correlates of Behavior
Mechanisms of Brain Plasticity: From Normal Emma R. Wood, Paul A. Dudchenko, and Howard
Brain Function to Pathology Eichenbaum
Philip. A. Schwartzkroin
Mechanisms of Neuronal Conditioning
Brain Development and Generation of Brain David A. T. King, David J. Krupa, Michael
Pathologies R. Foy, and Richard F. Thompson
Gregory L. Holmes and Bridget McCabe
Plasticity in the Aging Central Nervous System
Maturation of Channels and Receptors: Conse- C. A. Barnes
quences for Excitability
Secondary Epileptogenesis, Kindling, and
David F. Owens and Arnold R. Kriegstein
Intractable Epilepsy: A Reappraisal from the Per-
Neuronal Activity and the Establishment of spective of Neuronal Plasticity
Normal and Epileptic Circuits during Brain Thomas P. Sutula
Development
Kindling and the Mirror Focus
John W. Swann, Karen L. Smith, and
Dan C. McIntyre and Michael O. Poulter
Chong L. Lee
Partial Kindling and Behavioral Pathologies
The Effects of Seizures of the Hippocampus of the
Robert E. Adamec
Immature Brain
Ellen F. Sperber and Solomon L. Moshe The Mirror Focus and Secondary Epileptogenesis
B. J. Wilder
Abnormal Development and Catastrophic
Epilepsies: The Clinical Picture and Relation to Hippocampal Lesions in Epilepsy: A Historical
Neuroimaging Review
Harry T. Chugani and Diane C. Chugani Robert Naquet
Cortical Reorganization and Seizure Generation Clinical Evidence for Secondary Epileptogensis
in Dysplastic Cortex Hans O. Luders
G. Avanzini, R. Preafico, S. Franceschetti,
Epilepsy as a Progressive (or Nonprogressive
G. Sancini, G. Battaglia, and V. Scaioli
“Benign”) Disorder
Rasmussen’s Syndrome with Particular Refer- John A. Wada
ence to Cerebral Plasticity: A Tribute to Frank
Pathophysiological Aspects of Landau-Kleffner
Morrell
Syndrome: From the Active Epileptic Phase to
Fredrick Andermann and Yuonne Hart
Recovery
Structural Reorganization of Hippocampal Marie-Noelle Metz-Lutz, Pierre Maquet, Annd De
Networks Caused by Seizure Activity Saint Martin, Gabrielle Rudolf, Norma Wioland,
Daniel H. Lowenstein Edouard Hirsch, and Chriatian Marescaux
Local Pathways of Seizure Propagation in Neurosteroids and Behavior

Neocortex Sharon R. Engel and Kathleen A. Grant
Barry W. Connors, David J. Pinto, and Albert
Ethanol and Neurosteroid Interactions in the
E. Telefeian
Brain
Multiple Subpial Transection: A Clinical A. Leslie Morrow, Margaret J. VanDoren, Rebekah
Assessment Fleming, and Shannon Penland
C. E. Polkey
Preclinical Development of Neurosteroids as
The Legacy of Frank Morrell Neuroprotective Agents for the Treatment of
Jerome Engel, Jr. Neurodegenerative Diseases
Paul A. Lapchak and Dalia M. Araujo
Clinical Implications of Circulating Neurosteroids
Andrea R. Genazzani, Patrizia Monteleone,
Volume 46 Massimo Stomati, Francesca Bernardi, Luigi
Cobellis, Elena Casarosa, Michele Luisi, Stefano
Neurosteroids: Beginning of the Story
Luisi, and Felice Petraglia
Etienne E. Baulieu, P. Robel, and M. Schumacher
Neuroactive Steroids and Central Nervous System
Biosynthesis of Neurosteroids and Regulation of
Disorders
Their Synthesis
Mingde Wang, Torbjörn Bäckström, Inger
Synthia H. Mellon and Hubert Vaudry
Sundström, Göran Wahlström, Tommy Olsson,
Neurosteroid 7-Hydroxylation Products in the Di Zhu, Inga-Maj Johansson, Inger Björn, and
Brain Marie Bixo
Robert Morfin and Luboslav Stárka
Neuroactive Steroids in Neuropsychopharma-
Neurosteroid Analysis cology
Ahmed A. Alomary, Robert L. Fitzgerald, Rainer Rupprecht and Florian Holsboer
and Robert H. Purdy
Current Perspectives on the Role of Neu-
Role of the Peripheral-Type Benzodiazepine rosteroids in PMS and Depression
Receptor in Adrenal and Brain Steroidogenesis Lisa D. Griffin, Susan C. Conrad, and Synthia
Rachel C. Brown and Vassilios Papadopoulos H. Mellon
Formation and Effects of Neuroactive Index
Steroids in the Central and Peripheral Nervous
System
Roberto Cosimo Melcangi, Valerio Magnaghi, Volume 47
Mariarita Galbiati, and Luciano Martini
Introduction: Studying Gene Expression in Neu-
Neurosteroid Modulation of Recombinant and ral Tissues by in Situ Hybridization
Synaptic GABAA Receptors W. Wisden and B. J. Morris
Jeremy J. Lambert, Sarah C. Harney, Delia Belelli,
Part I: In Situ Hybridization with Radiolabelled
and John A. Peters
Oligonucleotides
GABAA-Receptor Plasticity during Long-Term In Situ Hybridization with Oligonucleotide
Exposure to and Withdrawal from Progesterone Probes
Giovanni Biggio, Paolo Follesa, Enrico Sanna, Wl. Wisden and B. J. Morris
Robert H. Purdy, and Alessandra Concas
Cryostat Sectioning of Brains
Stress and Neuroactive Steroids Victoria Revilla and Alison Jones
Maria Luisa Barbaccia, Mariangela Serra, Robert
Processing Rodent Embryonic and Early Postnatal
H. Purdy, and Giovanni Biggio
Tissue for in Situ Hybridization with
Neurosteroids in Learning and Memory Processes Radiolabelled Oligonucleotides
Monique Vallée, Willy Mayo, George F. Koob, and David J. Laurie, Petra C. U. Schrotz,
Michel Le Moal Hannah Monyer, and Ulla Amtmann
Processing of Retinal Tissue for in Situ Molecular Modeling of Ligand-Gated Ion

Hybridization Channels: Progress and Challenges
Frank Müller Ed Bertaccini and James R. Trudel
Processing the Spinal Cord for in Situ Hybridiza- Alzheimer’s Disease: Its Diagnosis and
tion with Radiolabelled Oligonucleotides Pathogenesis
A. Berthele and T. R. Tölle Jillian J. Kril and Glenda M. Halliday
Processing Human Brain Tissue for in Situ DNA Arrays and Functional Genomics in
Hybridization with Radiolabelled Neurobiology
Oligonucleotides Christelle Thibault, Long Wang, Li Zhang, and
Louise F. B. Nicholson Michael F. Miles
In Situ Hybridization of Astrocytes and Neurons INDEX
Cultured in Vitro
L. A. Arizza-McNaughton, C. De Felipe, and
S. P. Hunt
Volume 49
In Situ Hybridization on Organotypic Slice
What Is West Syndrome?
Cultures
Olivier Dulac, Christine Soufflet, Catherine Chiron,
A. Gerfin-Moser and H. Monyer
and Anna Kaminski
Quantitative Analysis of in Situ Hybridization
The Relationship between encephalopathy and
Histochemistry
Abnormal Neuronal Activity in the Developing
Andrew L. Gundlach and Ross D. O’Shea
Brain
Part II: Nonradioactive in Situ hybridization Frances E. Jensen
Nonradioactive in Situ Hybridization Using Alka- Hypotheses from Functional Neuroimaging
line Phosphatase-Labelled Oligonucleotides Studies
S. J. Augood, E. M. McGowan, B. R. Finsen, Csaba Juhász, Harry T. Chugani, Ouo Muzik,
B. Heppelmann, and P. C. Emson and Diane C. Chugani
Combining Nonradioactive in Situ Hybridization Infantile Spasms: Unique Sydrome or General
with Immunohistological and Anatomical Age-Dependent Manifestation of a Diffuse
Techniques Encephalopathy?
Petra Wahle M. A. Koehn and M. Duchowny
Nonradioactive in Situ Hybridization: Simplified Histopathology of Brain Tissue from Patients with
Procedures for Use in Whole Mounts of Mouse Infantile Spasms
and Chick Embryos Harry V. Vinters
Linda Ariza-McNaughton and Robb Krumlauf
Generators of Ictal and Interictal Electroencepha-
INDEX lograms Associated with Infantile Spasms: Intra-
cellular Studies of Cortical and Thalamic Neurons
M. Steriade and I. Timofeev
Cortical and Subcortical Generators of Normal
Volume 48 and Abnormal Rhythmicity
David A. McCormick
Assembly and Intracellular Trafficking of GABAA
Receptors Eugene Role of Subcortical Structures in the Pathogenesis
Barnes of Infantile Spasms: What Are Possible Subcortical
Mediators?
Subcellular Localization and Regulation of
F. A. Lado and S. L. Moshé
GABAA Receptors and Associated Proteins
Bernhard Lüscher and Jean-Marc Fritschy D1 What Must We Know to Develop Better
Dopamine Receptors Therapies?
Richard Mailman Jean Aicardi
The Treatment of Infantile Spasms: An Evidence- Volume 50

Based Approach
Mark Mackay, Shelly Weiss, and O. Carter Part I: Primary Mechanisms
Snead III How Does Glucose Generate Oxidative Stress In
ACTH Treatment of Infantile Spasms: Mecha- Peripheral Nerve?
nisms of Its Effects in Modulation of Neuronal Irina G. Obrosova
Excitability
Glycation in Diabetic Neuropathy: Characteris-
K. L. Brunson, S. Avishai-Eliner, and
tics, Consequences, Causes, and Therapeutic
T. Z. Baram
Options
Neurosteroids and Infantile Spasms: The Paul J. Thornalley
Deoxycorticosterone Hypothesis
Part II: Secondary Changes
Michael A. Rogawski and Doodipala
S. Reddy Protein Kinase C Changes in Diabetes: Is the
Concept Relevant to Neuropathy?
Are there Specific Anatomical and/or Transmitter
Joseph Eichberg
Systems (Cortical or Subcortical) That Should Be
Targeted? Are Mitogen-Activated Protein Kinases
Phillip C. Jobe Glucose Transducers for Diabetic Neuropathies?
Tertia D. Purves and David R. Tomlinson
Medical versus Surgical Treatment: Which Treat-
ment When Neurofilaments in Diabetic Neuropathy
W. Donald Shields Paul Fernyhough and Robert E. Schmidt
Developmental Outcome with and without Apoptosis in Diabetic Neuropathy
Successful Intervention Aviva Tolkovsky
Rochelle Caplan, Prabha Siddarth, Gary
Nerve and Ganglion Blood Flow in Diabetes:
Mathern, Harry Vinters, Susan Curtiss,
An Appraisal
Jennifer Levitt, Robert Asarnow, and
Douglas W. Zochodne
W. Donald Shields
Part III: Manifestations
Infantile Spasms versus Myoclonus: Is There a
Connection? Potential Mechanisms of Neuropathic Pain in
Michael R. Pranzatelli Diabetes
Nigel A. Calcutt
Tuberous Sclerosis as an Underlying Basis for
Infantile Spasm Electrophysiologic Measures of Diabetic Neu-
Raymond S. Yeung ropathy: Mechanism and Meaning
Joseph C. Arezzo and Elena Zotova
Brain Malformation, Epilepsy, and Infantile
Spasms Neuropathology and Pathogenesis of Diabetic
M. Elizabeth Ross Autonomic Neuropathy
Robert E. Schmidt
Brain Maturational Aspects Relevant to Patho-
physiology of Infantile Spasms Role of the Schwann Cell in Diabetic Neuropathy
G. Auanzini, F. Panzica, and S. Franceschetti Luke Eckersley
Gene Expression Analysis as a Strategy to Under- Part IV: Potential Treatment
stand the Molecular Pathogenesis of Infantile
Polyol Pathway and Diabetic Peripheral
Spasms
Neuropathy
Peter B. Crino
Peter J. Oates
Infantile Spasms: Criteria for an Animal Model
Nerve Growth Factor for the Treatment of
Carl E. Stafstrom and Gregory
Diabetic Neuropathy: What Went Wrong, What
L. Holmes
Went Right, and What Does the Future Hold?
INDEX Stuart C. Apfel
Angiotensin-Converting Enzyme Inhibitors: Diabetes, the Brain, and Behavior: Is There a

Are there Credible Mechanisms for Beneficial Biological Mechanism Underlying the Association
Effects in Diabetic Neuropathy? between Diabetes and Depression?
Rayaz A. Malik and David R. Tomlinson A. M. Jacobson, J. A. Samson, K. Weinger,
and C. M. Ryan
Clinical Trials for Drugs Against Diabetic Neu-
ropathy: Can We Combine Scientific Needs With Schizophrenia and Diabetes
Clinical Practicalities? David C. Henderson and Elissa R. Ettinger
Dan Ziegler and Dieter Luft
Psychoactive Drugs Affect Glucose Transport and
INDEX the Regulation of Glucose Metabolism
Donard S. Dwyer, Timothy D. Ardizzone,
and Ronald J. Bradley
Volume 51 INDEX
Energy Metabolism in the Brain

Leif Hertz and Gerald A. Dienel
Volume 52
Neuroimmune Relationships in Perspective
The Cerebral Glucose-Fatty Acid Cycle: Evolu-
Frank Hucklebridge and Angela Clow
tionary Roots, Regulation, and (Patho) physio-
logical Importance Sympathetic Nervous System Interaction with the
Kurt Heininger Immune System
Virginia M. Sanders and Adam P. Kohm
Expression, Regulation, and Functional Role of
Glucose Transporters (GLUTs) in Brain Mechanisms by Which Cytokines Signal the Brain
Donard S. Dwyer, Susan J. Vannucci, Adrian J. Dunn
and Ian A. Simpson
Neuropeptides: Modulators of Immune
Insulin-Like Growth Factor-1 Promotes Neu- Responses in Health and Disease
ronal Glucose Utilization During Brain Develop- David S. Jessop
ment and Repair Processes
Brain–Immune Interactions in Sleep
Carolyn A. Bondy and Clara M. Cheng
Lisa Marshall and Jan Born
CNS Sensing and Regulation of Peripheral
Neuroendocrinology of Autoimmunity
Glucose Levels
Michael Harbuz
Barry E. Levin, Ambrose A. Dunn-Meynell, and
Vanessa H. Routh Systemic Stress-Induced Th2 Shift and Its Clinical
Implications
Glucose Transporter Protein Syndromes
Ibia J. Elenkov
Darryl C. De Vivo, Dong Wang, Juan M. Pascual,
and Yuan Yuan Ho Neural Control of Salivary S-IgA Secretion
Gordon B. Proctor and Guy H. Carpenter
Glucose, Stress, and Hippocampal Neuronal
Vulnerability Stress and Secretory Immunity
Lawrence P. Reagan Jos A. Bosch, Christopher Ring, Eco J. C. de Geus,
Enno C. I. Veerman, and Arie V. Nieuw
Glucose/Mitochondria in Neurological
Amerongen
Conditions
John P. Blass Cytokines and Depression
Angela Clow
Energy Utilization in the Ischemic/Reperfused
Brain Immunity and Schizophrenia: Autoimmunity,
John W. Phillis and Michael H. O’Regan Cytokines, and Immune Responses
Fiona Gaughran
Diabetes Mellitus and the Central Nervous
System Cerebral Lateralization and the Immune System
Anthony L. McCall Pierre J. Neveu
Behavioral Conditioning of the Immune System Section V: Neurodegenerative Disorders

Frank Hucklebridge
Parkinson’s Disease
Psychological and Neuroendocrine Correlates of L. V. P. Korlipara and A. H. V. Schapira
Disease Progression
Huntington’s Disease: The Mystery Unfolds?
Julie M. Turner-Cobb
Åsa Petersén and Patrik Brundin
The Role of Psychological Intervention in Mod-
Mitochondria in Alzheimer’s Disease
ulating Aspects of Immune Function in Relation
Russell H. Swerdlow and Stephen J. Kish
to Health and Well-Being
J. H. Gruzelier Contributions of Mitochondrial Alterations,
Resulting from Bad Genes and a Hostile Envi-
INDEX
ronment, to the Pathogenesis of Alzheimer’s Disease
Mark P. Mattson
Volume 53 Mitochondria and Amyotrophic Lateral Sclerosis

Richard W. Orrell and Anthony H. V. Schapira
Section I: Mitochondrial Structure and Function
Section VI: Models of Mitochondrial Disease
Mitochondrial DNA Structure and Function
Models of Mitochondrial Disease
Carlos T. Moraes, Sarika Srivastava, Ilias
Danae Liolitsa and Michael G. Hanna
Kirkinezos, Jose Oca-Cossio, Corina van Waveren,
Markus Woischnick, and Francisca Diaz Section VII: Defects of b Oxidation Including
Carnitine Deficiency
Oxidative Phosphorylation: Structure, Function,
and Intermediary Metabolism Defects of b Oxidation Including Carnitine
Simon J. R. Heales, Matthew E. Gegg, and John Deficiency
B. Clark K. Bartlett and M. Pourfarzam
Import of Mitochondrial Proteins Section VIII: Mitochondrial Involvement in Aging
Matthias F. Bauer, Sabine Hofmann, and Walter
The Mitochondrial Theory of Aging: Involve-
Neupert
ment of Mitochondrial DNA Damage and Repair
Section II: Primary Respiratory Chain Disorders Nadja C. de Souza-Pinto and Vilhelm A. Bohr
Mitochondrial Disorders of the Nervous System: INDEX
Clinical, Biochemical, and Molecular Genetic
Features
Volume 54
Dominic Thyagarajan and Edward Byrne Unique General Anesthetic Binding Sites Within
Distinct Conformational States of the Nicotinic
Section III: Secondary Respiratory Chain Disorders
Acetylcholine Receptor
Friedreich’s Ataxia Hugo R. Ariaas, William, R. Kem, James
J. M. Cooper and J. L. Bradley R. Truddell, and Michael P. Blanton
Wilson Disease Signaling Molecules and Receptor Transduction
C. A. Davie and A. H. V. Schapira Cascades That Regulate NMDA Receptor-
Mediated Synaptic Transmission
Hereditary Spastic Paraplegia
Suhas. A. Kotecha and John F. MacDonald
Christopher J. McDermott and Pamela J. Shaw
Behavioral Measures of Alcohol Self-Administration
Cytochrome c Oxidase Deficiency
and Intake Control: Rodent Models
Giacomo P. Comi, Sandra Strazzer, Sara Galbiati,
Herman H. Samson and Cristine L. Czachowski
and Nereo Bresolin
Dopaminergic Mouse Mutants: Investigating
Section IV: Toxin Induced Mitochondrial
the Roles of the Different Dopamine Receptor
Dysfunction
Subtypes and the Dopamine Transporter
Toxin-Induced Mitochondrial Dysfunction Shirlee Tan, Bettina Hermann, and Emiliana
Susan E. Browne and M. Flint Beal Borrelli
Drosophila melanogaster, A Genetic Model System Gene Therapy for Mucopolysaccharidosis

for Alcohol Research A. Bosch and J. M. Heard
Douglas J. Guarnieri and Ulrike Heberlein
INDEX
INDEX
Volume 56
Volume 55
Behavioral Mechanisms and the Neurobiology of
Section I: Virsu Vectors For Use in the Nervous Conditioned Sexual Responding
System Mark Krause
Non-Neurotropic Adenovirus: a Vector for Gene NMDA Receptors in Alcoholism
Transfer to the Brain and Gene Therapy of Neu- Paula L. Hoffman
rological Disorders
P. R. Lowenstein, D. Suwelack, J. Hu, X. Yuan, Processing and Representation of Species-Specific
M. Jimenez-Dalmaroni, S. Goverdhama, and Communication Calls in the Auditory System of
M.G. Castro Bats
George D. Pollak, Achim Klug, and Eric E. Bauer
Adeno-Associated Virus Vectors
E. Lehtonen and L. Tenenbaum Central Nervous System Control of Micturition
Gert Holstege and Leonora J. Mouton
Problems in the Use of Herpes Simplex Virus as a
Vector The Structure and Physiology of the Rat Auditory
L. T. Feldman System: An Overview
Manuel Malmierca
Lentiviral Vectors
J. Jakobsson, C. Ericson, N. Rosenquist, and Neurobiology of Cat and Human Sexual Behavior
C. Lundberg Gert Holstege and J. R. Georgiadis
Retroviral Vectors for Gene Delivery to Neural INDEX

Precursor Cells
K. Kageyama, H. Hirata, and J. Hatakeyama
Section II: Gene Therapy with Virus Vectors for Volume 57
Specific Disease of the Nervous System
Cumulative Subject Index of Volumes 1–25
The Principles of Molecular Therapies for
Glioblastoma
G. Karpati and J. Nalbatonglu
Volume 58
Oncolytic Herpes Simplex Virus
J. C. C. Hu and R. S. Coffin Cumulative Subject Index of Volumes 26–50
Recombinant Retrovirus Vectors for Treatment

of Brain Tumors
N. G. Rainov and C. M. Kramm Volume 59
Adeno-Associated Viral Vectors for Parkinson’s Loss of Spines and Neuropil
Disease Liesl B. Jones
I. Muramatsu, L. Wang, K. Ikeguchi, K-i
Schizophrenia as a Disorder of Neuroplasticity
Fujimoto, T. Okada, H. Mizukami, Y. Hanazono,
Robert E. McCullumsmith, Sarah M. Clinton, and
A. Kume, I. Nakano, and K. Ozawa
James H. Meador-Woodruff
HSV Vectors for Parkinson’s Disease
The Synaptic Pathology of Schizophrenia: Is
D. S. Latchman
Aberrant Neurodevelopment and Plasticity to
Gene Therapy for Stroke Blame?
K. Abe and W. R. Zhang Sharon L. Eastwood
Neurochemical Basis for an Epigenetic Vision of Oct-6 Transcription Factor

Synaptic Organization Maria Ilia
E. Costa, D. R. Grayson, M. Veldic, and
NMDA Receptor Function, Neuroplasticity, and
A. Guidotti
the Pathophysiology of Schizophrenia
Muscarinic Receptors in Schizophrenia: Is There Joseph T. Coyle and Guochuan Tsai
a Role for Synaptic Plasticity?
INDEX
Thomas J. Raedler
Serotonin and Brain Development
Monsheel S. K. Sodhi and Elaine Sanders-Bush
Volume 60
Presynaptic Proteins and Schizophrenia
Microarray Platforms: Introduction and Applica-
William G. Honer and Clint E. Young
tion to Neurobiology
Mitogen-Activated Protein Kinase Signaling Stanislav L. Karsten, Lili C. Kudo, and Daniel
Svetlana V. Kyosseva H. Geschwind
Postsynaptic Density Scaffolding Proteins at Experimental Design and Low-Level Analysis of
Excitatory Synapse and Disorders of Synaptic Microarray Data
Plasticity: Implications for Human Behavior B. M. Bolstad, F. Collin, K. M. Simpson,
Pathologies R. A. Irizarry, and T. P. Speed
Andrea de Bartolomeis and Germano Fiore
Brain Gene Expression: Genomics and Genetics
Prostaglandin-Mediated Signaling in Schizophrenia Elissa J. Chesler and Robert W. Williams
S. Smesny
DNA Microarrays and Animal Models of Learning
Mitochondria, Synaptic Plasticity, and and Memory
Schizophrenia Sebastiano Cavallaro
Dorit Ben-Shachar and Daphna Laifenfeld
Microarray Analysis of Human Nervous System
Membrane Phospholipids and Cytokine Interac- Gene Expression in Neurological Disease
tion in Schizophrenia Steven A. Greenberg
Jeffrey K. Yao and Daniel P. van Kammen
DNA Microarray Analysis of Postmortem Brain
Neurotensin, Schizophrenia, and Antipsychotic Tissue
Drug Action Károly Mirnics, Pat Levitt, and David A. Lewis
Becky Kinkead and Charles B. Nemeroff
INDEX
Schizophrenia, Vitamin D, and Brain
Development
Alan Mackay-Sim, François FÉron, Darryl Eyles, Volume 61
Thomas Burne, and John McGrath
Section I: High-Throughput Technologies
Possible Contributions of Myelin and Oligoden-
Biomarker Discovery Using Molecular Profiling
drocyte Dysfunction to Schizophrenia
Approaches
Daniel G. Stewart and Kenneth L. Davis
Stephen J. Walker and Arron Xu
Brain-Derived Neurotrophic Factor and the
Proteomic Analysis of Mitochondrial Proteins
Plasticity of the Mesolimbic Dopamine Pathway
Mary F. Lopez, Simon Melov, Felicity Johnson,
Oliver Guillin, Nathalie Griffon, Jorge Diaz,
Nicole Nagulko, Eva Golenko, Scott Kuzdzal,
Bernard Le Foll, Erwan Bezard, Christian Gross,
Suzanne Ackloo, and Alvydas Mikulskis
Chris Lammers, Holger Stark, Patrick Carroll, Jean-
Charles Schwartz, and Pierre Sokoloff Section II: Proteomic Applications
S100B in Schizophrenic Psychosis NMDA Receptors, Neural Pathways, and Protein
Matthias Rothermundt, Gerald Ponath, and Volker Interaction Databases
Arolt Holger Husi
Dopamine Transporter Network and Pathways Neuroimaging Studies in Bipolar Children and
Rajani Maiya and R. Dayne Mayfield Adolescents
Rene L. Olvera, David C. Glahn, Sheila
Proteomic Approaches in Drug Discovery
C. Caetano, Steven R. Pliszka, and Jair C. Soares
and Development
Holly D. Soares, Stephen A. Williams, Peter Chemosensory G-Protein-Coupled Receptor
J. Snyder, Feng Gao, Tom Stiger, Christian Rohlff, Signaling in the Brain
Athula Herath, Trey Sunderland, Karen Putnam, Geoffrey E. Woodard
and W. Frost White
Disturbances of Emotion Regulation after Focal
Section III: Informatics Brain Lesions
Antoine Bechara
Proteomic Informatics
Steven Russell, William Old, Katheryn Resing, The Use of Caenorhabditis elegans in Molecular
and Lawrence Hunter Neuropharmacology
Jill C. Bettinger, Lucinda Carnell, Andrew
Section IV: Changes in the Proteome by Disease
G. Davies, and Steven L. McIntire
Proteomics Analysis in Alzheimer’s Disease: New
INDEX
Insights into Mechanisms of Neurodegeneration
D. Allan Butterfield and Debra Boyd-Kimball
Proteomics and Alcoholism
Volume 63
Frank A. Witzmann and Wendy N. Strother Mapping Neuroreceptors at work: On the Defini-
tion and Interpretation of Binding Potentials after
Proteomics Studies of Traumatic Brain Injury
20 years of Progress
Kevin K. W. Wang, Andrew Ottens,
Albert Gjedde, Dean F. Wong, Pedro Rosa-Neto,
William Haskins, Ming Cheng Liu, Firas
and Paul Cumming
Kobeissy, Nancy Denslow, SuShing Chen, and
Ronald L. Hayes Mitochondrial Dysfunction in Bipolar Disorder:
From 31P-Magnetic Resonance Spectroscopic
Influence of Huntington’s Disease on the Human
Findings to Their Molecular Mechanisms
and Mouse Proteome
Tadafumi Kato
Claus Zabel and Joachim Klose
Large-Scale Microarray Studies of Gene Expres-
Section V: Overview of the Neuroproteome
sion in Multiple Regions of the Brain in Schizo-
Proteomics—Application to the Brain phrenia and Alzeimer’s Disease
Katrin Marcus, Oliver Schmidt, Heike Schaefer, Pavel L. Katsel, Kenneth L. Davis, and Vahram
Michael Hamacher, AndrÅ van Hall, and Helmut Haroutunian
E. Meyer
Regulation of Serotonin 2C Receptor PRE-
INDEX mRNA Editing By Serotonin
Claudia Schmauss
The Dopamine Hypothesis of Drug Addiction:
Volume 62 Hypodopaminergic State
Miriam Melis, Saturnino Spiga, and Marco Diana
GABAA Receptor Structure–Function Studies:
A Reexamination in Light of New Acetylcholine Human and Animal Spongiform Encephalopa-
Receptor Structures thies are Autoimmune Diseases: A Novel Theory
Myles H. Akabas and Its supporting Evidence
Bao Ting Zhu
Dopamine Mechanisms and Cocaine Reward
Aiko Ikegami and Christine L. Duvauchelle Adenosine and Brain Function
Bertil B. Fredholm, Jiang-Fan Chen, Rodrigo
Proteolytic Dysfunction in Neurodegenerative
A. Cunha, Per Svenningsson, and Jean-Marie Vaugeois
Disorders
Kevin St. P. McNaught INDEX
Volume 64 Mechanistic Connections Between Glucose/

Lipid Disturbances and Weight Gain Induced by
Section I. The Cholinergic System Antipsychotic Drugs
John Smythies Donard S. Dwyer, Dallas Donohoe, Xiao-Hong
Section II. The Dopamine System Lu, and Eric J. Aamodt
John Symythies Serotonin Firing Activity as a Marker for Mood
Section III. The Norepinephrine System Disorders: Lessons from Knockout Mice
John Smythies Gabriella Gobbi
Section IV. The Adrenaline System INDEX

John Smythies
Section V. Serotonin System
John Smythies Volume 66
INDEX Brain Atlases of Normal and Diseased Populations
Arthur W. Toga and Paul M. Thompson
Neuroimaging Databases as a Resource for
Scientific Discovery
Volume 65 John Darrell Van Horn, John Wolfe, Autumn
Agnoli, Jeffrey Woodward, Michael Schmitt, James
Insulin Resistance: Causes and Consequences
Dobson, Sarene Schumacher, and Bennet Vance
Zachary T. Bloomgarden
Modeling Brain Responses
Antidepressant-Induced Manic Conversion:
Karl J. Friston, William Penny, and Olivier David
A Developmentally Informed Synthesis of the
Literature Voxel-Based Morphometric Analysis Using Shape
Christine J. Lim, James F. Leckman, Christopher Transformations
Young, and AndrÉs Martin Christos Davatzikos
Sites of Alcohol and Volatile Anesthetic Action on The Cutting Edge of f MRI and High-Field
Glycine Receptors f MRI
Ingrid A. Lobo and R. Adron Harris Dae-Shik Kim
Role of the Orbitofrontal Cortex in Rein- Quantification of White Matter Using Diffusion-
forcement Processing and Inhibitory Tensor Imaging
Control: Evidence from Functional Magnetic Hae-Jeong Park
Resonance Imaging Studies in Healthy Human
Perfusion f MRI for Functional Neuroimaging
Subjects
Geoffrey K. Aguirre, John A. Detre, and Jiongjiong
Rebecca Elliott and Bill Deakin
Wang
Common Substrates of Dysphoria in Stimulant
Functional Near-Infrared Spectroscopy: Potential
Drug Abuse and Primary Depression: Therapeutic
and Limitations in Neuroimaging Studies
Targets
Yoko Hoshi
Kate Baicy, Carrie E. Bearden, John Monterosso,
Arthur L. Brody, Andrew J. Isaacson, and Edythe Neural Modeling and Functional Brain Imaging:
D. London The Interplay Between the Data-Fitting and Sim-
ulation Approaches
The Role of cAMP Response Element–Binding
Barry Horwitz and Michael F. Glabus
Proteins in Mediating Stress-Induced Vulnerability
to Drug Abuse Combined EEG and fMRI Studies of Human
Arati Sadalge Kreibich and Julie A. Blendy Brain Function
V. Menon and S. Crottaz-Herbette
G-Protein–Coupled Receptor Deorphanizations
Yumiko Saito and Olivier Civelli INDEX
Volume 67 Let’s Talk Together: Memory Traces Revealed by

Cooperative Activation in the Cerebral Cortex
Distinguishing Neural Substrates of Heterogeneity Jochen Kaiser, Susanne Leiberg, and Werner
Among Anxiety Disorders Lutzenberger
Jack B. Nitschke and Wendy Heller
Human Communication Investigated With Mag-
Neuroimaging in Dementia netoencephalography: Speech, Music, and
K. P. Ebmeier, C. Donaghey, and N. J. Dougall Gestures
Prefrontal and Anterior Cingulate Contributions Thomas R. Knösche, Burkhard Maess, Akinori
to Volition in Depression Nakamura, and Angela D. Friederici
Jack B. Nitschke and Kristen L. Mackiewicz Combining Magnetoencephalography and Func-
Functional Imaging Research in Schizophrenia tional Magnetic Resonance Imaging
H. Tost, G. Ende, M. Ruf, F. A. Henn, and Klaus Mathiak and Andreas J. Fallgatter
A. Meyer-Lindenberg Beamformer Analysis of MEG Data
Neuroimaging in Functional Somatic Syndromes Arjan Hillebrand and Gareth R. Barnes
Patrick B. Wood Functional Connectivity Analysis in
Neuroimaging in Multiple Sclerosis Magnetoencephalography
Alireza Minagar, Eduardo Gonzalez-Toledo, James Alfons Schnitzler and Joachim Gross
Pinkston, and Stephen L. Jaffe Human Visual Processing as Revealed by
Stroke Magnetoencephalographys
Roger E. Kelley and Eduardo Gonzalez-Toledo Yoshiki Kaneoke, Shoko Watanabe, and Ryusuke
Kakigi
Functional MRI in Pediatric Neurobehavioral
Disorders A Review of Clinical Applications of
Michael Seyffert and F. Xavier Castellanos Magnetoencephalography
Andrew C. Papanicolaou, Eduardo M. Castillo,
Structural MRI and Brain Development Rebecca Billingsley-Marshall, Ekaterina Pataraia,
Paul M. Thompson, Elizabeth R. Sowell, Nitin and Panagiotis G. Simos
Gogtay, Jay N. Giedd, Christine N. Vidal, Kiralee
M. Hayashi, Alex Leow, Rob Nicolson, Judith INDEX
L. Rapoport, and Arthur W. Toga
Neuroimaging and Human Genetics
Georg Winterer, Ahmad R. Hariri, David Volume 69
Goldman, and Daniel R. Weinberger Nematode Neurons: Anatomy and Anatomical
Neuroreceptor Imaging in Psychiatry: Theory and Methods in Caenorhabditis elegans
Applications David H. Hall, Robyn Lints, and Zeynep Altun
W. Gordon Frankle, Mark Slifstein, Peter Investigations of Learning and Memory in
S. Talbot, and Marc Laruelle Caenorhabditis elegans
INDEX Andrew C. Giles, Jacqueline K. Rose, and
Catharine H. Rankin
Neural Specification and Differentiation
Volume 68 Eric Aamodt and Stephanie Aamodt
Fetal Magnetoencephalography: Viewing the Sexual Behavior of the Caenorhabditis elegans
Developing Brain In Utero Male
Hubert Preissl, Curtis L. Lowery, and Hari Eswaran Scott W. Emmons
Magnetoencephalography in Studies of Infants The Motor Circuit
and Children Stephen E. Von Stetina, Millet Treinin, and David
Minna Huotilainen M. Miller III
Mechanosensation in Caenorhabditis elegans Volume 71

Robert O’Hagan and Martin Chalfie
Autism: Neuropathology, Alterations of the
GABAergic System, and Animal Models
Christoph Schmitz, Imke A. J. van Kooten, Patrick
Volume 70 R. Hof, Herman van Engeland, Paul H. Patterson,
and Harry W. M. Steinbusch
Spectral Processing by the Peripheral Auditory
The Role of GABA in the Early Neuronal
System Facts and Models
Development
Enrique A. Lopez-Poveda
Marta Jelitai and Emı´lia Madarasz
Basic Psychophysics of Human Spectral
GABAergic Signaling in the Developing
Processing
Cerebellum
Brian C. J. Moore
Chitoshi Takayama
Across-Channel Spectral Processing
Insights into GABA Functions in the Developing
John H. Grose, Joseph W. Hall III, and Emily Buss
Cerebellum
Speech and Music Have Different Requirements Mońica L. Fiszman
for Spectral Resolution
Role of GABA in the Mechanism of the Onset of
Robert V. Shannon
Puberty in Non-Human Primates
Non-Linearities and the Representation of Ei Terasawa
Auditory Spectra
Rett Syndrome: A Rosetta Stone for Understand-
Eric D. Young, Jane J. Yu, and Lina
ing the Molecular Pathogenesis of Autism
A. J. Reiss
Janine M. LaSalle, Amber Hogart, and Karen
Spectral Processing in the Inferior Colliculus N. Thatcher
Kevin A. Davis
GABAergic Cerebellar System in Autism: A Neu-
Neural Mechanisms for Spectral Analysis in the ropathological and Developmental Perspective
Auditory Midbrain, Thalamus, and Cortex Gene J. Blatt
Monty A. Escabı´ and Heather L. Read
Reelin Glycoprotein in Autism and Schizophrenia
Spectral Processing in the Auditory Cortex S. Hossein Fatemi
Mitchell L. Sutter
Is There A Connection Between Autism,
Processing of Dynamic Spectral Properties of Prader-Willi Syndrome, Catatonia, and GABA?
Sounds Dirk M. Dhossche, Yaru Song, and
Adrian Rees and Manuel S. Malmierca Yiming Liu
Representations of Spectral Coding in the Human Alcohol, GABA Receptors, and Neuro-
Brain developmental Disorders
Deborah A. Hall, PhD Ujjwal K. Rout
Spectral Processing and Sound Source Effects of Secretin on Extracellular GABA and
Determination Other Amino Acid Concentrations in the Rat
Donal G. Sinex Hippocampus
Hans-Willi Clement, Alexander Pschibul, and
Spectral Information in Sound Localization
Eberhard Schulz
Simon Carlile, Russell Martin, and Ken McAnally
Predicted Role of Secretin and Oxytocin in the
Plasticity of Spectral Processing
Treatment of Behavioral and Developmental
Dexter R. F. Irvine and Beverly A. Wright
Disorders: Implications for Autism
Spectral Processing In Cochlear Implants Martha G. Welch and David A. Ruggiero
Colette M. McKay
Immunological Findings in Autism
INDEX Hari Har Parshad Cohly and Asit Panja
Correlates of Psychomotor Symptoms in Autism Shared Susceptibility Region on Chromosome 15

Laura Stoppelbein, Sara Sytsma-Jordan, and Leilani Between Autism and Catatonia
Greening Yvon C. Chagnon
GABRB3 Gene Deficient Mice: A Potential Current Trends in Behavioral Interventions for
Model of Autism Spectrum Disorder Children with Autism
Timothy M. DeLorey Dorothy Scattone and Kimberly R. Knight
The Reeler Mouse: Anatomy of a Mutant Case Reports with a Child Psychiatric Exploration
Gabriella D’Arcangelo of Catatonia, Autism, and Delirium
Jan N. M. Schieveld
Shared Chromosomal Susceptibility Regions
Between Autism and Other Mental Disorders ECT and the Youth: Catatonia in Context
Yvon C. Chagnon index Frank K. M. Zaw
INDEX Catatonia in Autistic Spectrum Disorders: A Med-
ical Treatment Algorithm
Volume 72 Max Fink, Michael A. Taylor, and Neera
Ghaziuddin
Classification Matters for Catatonia and Autism in
Children Psychological Approaches to Chronic Catatonia-
Klaus-Jürgen Neumärker Like Deterioration in Autism Spectrum Disorders
Amitta Shah and Lorna Wing
A Systematic Examination of Catatonia-Like
Clinical Pictures in Autism Spectrum Disorders Section V: Blueprints
Lorna Wing and Amitta Shah Blueprints for the Assessment, Treatment, and
Catatonia in Individuals with Autism Spectrum Future Study of Catatonia in Autism Spectrum
Disorders in Adolescence and Early Adulthood: Disorders
A Long-Term Prospective Study Dirk Marcel, Dhossche, Amitta Shah, and Lorna
Masataka Ohta, Yukiko Kano, and Yoko Nagai Wing
Are Autistic and Catatonic Regression Related? A INDEX

Few Working Hypotheses Involving GABA,
Purkinje Cell Survival, Neurogenesis, and ECT
Dirk Marcel Dhossche and Ujjwal Rout
Volume 73
Psychomotor Development and Psychopathology
Chromosome 22 Deletion Syndrome and
in Childhood
Schizophrenia
Dirk M. J. De Raeymaecker
Nigel M. Williams, Michael C. O’Donovan, and
The Importance of Catatonia and Stereotypies in Michael J. Owen
Autistic Spectrum Disorders
Characterization of Proteome of Human Cere-
Laura Stoppelbein, Leilani Greening, and Angelina
brospinal Fluid
Kakooza
Jing Xu, Jinzhi Chen, Elaine R. Peskind,
Prader–Willi Syndrome: Atypical Psychoses and Jinghua Jin, Jimmy Eng, Catherine Pan,
Motor Dysfunctions Thomas J. Montine, David R. Goodlett, and
Willem M. A. Verhoeven and Siegfried Tuinier Jing Zhang
Towards a Valid Nosography and Psychopathol- Hormonal Pathways Regulating Intermale and
ogy of Catatonia in Children and Adolescents Interfemale Aggression
David Cohen Neal G. Simon, Qianxing Mo, Shan Hu,
Carrie Garippa, and Shi-Fang Lu
Is There a Common Neuronal Basis for Autism
and Catatonia? Neuronal GAP Junctions: Expression, Function,
Dirk Marcel Dhossche, Brendan T. Carroll, and and Implications for Behavior
Tressa D. Carroll Clinton B. McCracken and David C. S. Roberts
Effects of Genes and Stress on the Neurobiology of Artistic Changes in Alzheimer’s Disease
Depression Sebastian J. Crutch and Martin N. Rossor
J. John Mann and Dianne Currier
Section IV: Cerebrovascular Disease
Quantitative Imaging with the Micropet Small-
Stroke in Painters
Animal Pet Tomograph
H. Bäzner and M. Hennerici
Paul Vaska, Daniel J. Rubins, David L. Alexoff,
and Wynne K. Schiffer Visuospatial Neglect in Lovis Corinth’s Self-
Portraits
Understanding Myelination through Studying its
Olaf Blanke
Evolution
Rüdiger Schweigreiter, Betty I. Roots, Art, Constructional Apraxia, and the Brain
Christine Bandtlow, and Robert M. Gould Louis Caplan
INDEX Section V: Genetic Diseases
Neurogenetics in Art
Alan E. H. Emery
Volume 74 A Naı̈ve Artist of St Ives
Evolutionary Neurobiology and Art F. Clifford Rose
C. U. M. Smith
Van Gogh’s Madness
Section I: Visual Aspects F. Clifford Rose
Perceptual Portraits Absinthe, The Nervous System and Painting
Nicholas Wade Tiina Rekand
The Neuropsychology of Visual Art: Conferring Section VI: Neurologists as Artists
Capacity
Anjan Chatterjee Sir Charles Bell, KGH, FRS, FRSE
(1774–1842)
Vision, Illusions, and Reality Christopher Gardner-Thorpe
Christopher Kennard
Section VII: Miscellaneous
Localization in the Visual Brain
Peg Leg Frieda
George K. York
Espen Dietrichs
Section II: Episodic Disorders
The Deafness of Goya (1746–1828)
Neurology, Synaesthesia, and Painting F. Clifford Rose
Amy Ione
INDEX
Fainting in Classical Art
Philip Smith
Migraine Art in the Internet: A Study of 450
Contemporary Artists
Klaus Podoll
Volume 75
Introduction on the Use of the Drosophila Embry-
Sarah Raphael’s Migraine with Aura as Inspiration
onic/Larval Neuromuscular Junction as a Model
for the Foray of Her Work into Abstraction
System to Study Synapse Development and
Klaus Podoll and Debbie Ayles
Function, and a Brief Summary of Pathfinding
The Visual Art of Contemporary Artists with and Target Recognition
Epilepsy Catalina Ruiz-Cañada and Vivian Budnik
Steven C. Schachter
Development and Structure of Motoneurons
Section III: Brain Damage Matthias Landgraf and Stefan Thor
Creativity in Painting and Style in Brain- The Development of the Drosophila Larval Body
Damaged Artists Wall Muscles
Julien Bogousslavsky Karen Beckett and Mary K. Baylies
Organization of the Efferent System and Structure ID, Ego, and Temporal Lobe Revisited
of Neuromuscular Junctions in Drosophila Shirley M. Ferguson and Mark Rayport
Andreas Prokop
Section II: Stereotaxic Studies
Development of Motoneuron Electrical Proper-
Olfactory Gustatory Responses Evoked by
ties and Motor Output
Electrical Stimulation of Amygdalar Region in
Richard A. Baines
Man Are Qualitatively Modifiable by Interview
Transmitter Release at the Neuromuscular Content: Case Report and Review
Junction Mark Rayport, Sepehr Sani, and Shirley M. Ferguson
Thomas L. Schwarz
Section III: Controversy in Definition of Behav-
Vesicle Trafficking and Recycling at the Neuro- ioral Disturbance
muscular Junction: Two Pathways for Endocytosis
Pathogenesis of Psychosis in Epilepsy. The
Yoshiaki Kidokoro
“Seesaw” Theory: Myth or Reality?
Glutamate Receptors at the Drosophila Neuromus- Shirley M. Ferguson and Mark Rayport
cular Junction
Section IV: Outcome of Temporal Lobectomy
Aaron DiAntonio
Memory Function After Temporal Lobectomy for
Scaffolding Proteins at the Drosophila Neuromus-
Seizure Control: A Comparative Neuropsy chi-
cular Junction
atric and Neuropsychological Study
Bulent Ataman, Vivian Budnik, and Ulrich Thomas
Shirley M. Ferguson, A. John McSweeny, and Mark
Synaptic Cytoskeleton at the Neuromuscular Rayport
Junction
Life After Surgery for Temporolimbic Seizures
Catalina Ruiz-Cañada and Vivian Budnik
Shirley M. Ferguson, Mark Rayport, and Carolyn
Plasticity and Second Messengers During Synapse A. Schell
Development
Appendix I
Leslie C. Griffith and Vivian Budnik
Mark Rayport
Retrograde Signaling that Regulates Synaptic
Appendix II: Conceptual Foundations of Studies
Development and Function at the Drosophila Neu-
of Patients Undergoing Temporal Lobe Surgery
romuscular Junction
for Seizure Control
Guillermo Marqués and Bing Zhang
Mark Rayport
Activity-Dependent Regulation of Transcription
INDEX
During Development of Synapses
Subhabrata Sanyal and Mani Ramaswami
Experience-Dependent Potentiation of Larval
Neuromuscular Synapses
Volume 77
Christoph M. Schuster Regenerating the Brain
David A. Greenberg and Kunlin Jin
Selected Methods for the Anatomical Study of
Drosophila Embryonic and Larval Neuromuscular Serotonin and Brain: Evolution, Neuroplasticity,
Junctions and Homeostasis
Vivian Budnik, Michael Gorczyca, and Andreas Efrain C. Azmitia
Prokop
INDEX
Therapeutic Approaches to Promoting Axonal
Regeneration in the Adult Mammalian Spinal Cord
Volume 76 Sari S. Hannila, Mustafa M. Siddiq, and Marie
T. Filbin
Section I: Physiological Correlates of Freud’s
Evidence for Neuroprotective Effects of Antipsy-
Theories
chotic Drugs: Implications for the Pathophysio-
The ID, the Ego, and the Temporal Lobe logy and Treatment of Schizophrenia
Shirley M. Ferguson and Mark Rayport Xin-Min Li and Haiyun Xu
Neurogenesis and Neuroenhancement in the Patho- Schizophrenia and the a7 Nicotinic Acetylcholine
physiology and Treatment of Bipolar Disorder Receptor
Robert J. Schloesser, Guang Chen, and Husseini Laura F. Martin and Robert Freedman
K. Manji
Histamine and Schizophrenia
Neuroreplacement, Growth Factor, and Small Jean-Michel Arrang
Molecule Neurotrophic Approaches for Treating
Cannabinoids and Psychosis
Parkinson’s Disease
Deepak Cyril D’Souza
Michael J. O’Neill, Marcus J. Messenger, Viktor
Lakics, Tracey K. Murray, Eric H. Karran, Philip Involvement of Neuropeptide Systems in Schizo-
G. Szekeres, Eric S. Nisenbaum, and Kalpana phrenia: Human Studies
M. Merchant Ricardo Cáceda, Becky Kinkead, and Charles
B. Nemeroff
Using Caenorhabditis elegans Models of Neuro-
degenerative Disease to Identify Neuroprotective Brain-Derived Neurotrophic Factor in Schizo-
Strategies phrenia and Its Relation with Dopamine
Brian Kraemer and Gerard D. Schellenberg Olivier Guillin, Caroline Demily, and Florence
Thibaut
Neuroprotection and Enhancement of Neurite
Outgrowth With Small Molecular Weight Com- Schizophrenia Susceptibility Genes: In Search of a
pounds From Screens of Chemical Libraries Molecular Logic and Novel Drug Targets for a
Donard S. Dwyer and Addie Dickson Devastating Disorder
Joseph A. Gogos
INDEX
INDEX
Volume 78
Neurobiology of Dopamine in Schizophrenia
Olivier Guillin, Anissa Abi-Dargham, and Marc Volume 79
Laruelle
The Destructive Alliance: Interactions of
The Dopamine System and the Pathophysiology Leukocytes, Cerebral Endothelial Cells, and the
of Schizophrenia: A Basic Science Perspective Immune Cascade in Pathogenesis of Multiple
Yukiori Goto and Anthony A. Grace Sclerosis
Alireza Minagar, April Carpenter, and J. Steven
Glutamate and Schizophrenia: Phencyclidine,
Alexander
N-methyl-D-aspartate Receptors, and Dopamine–
Glutamate Interactions Role of B Cells in Pathogenesis of Multiple
Daniel C. Javitt Sclerosis
Behrouz Nikbin, Mandana Mohyeddin Bonab,
Deciphering the Disease Process of Schizophrenia:
Farideh Khosravi, and Fatemeh Talebian
The Contribution of Cortical GABA Neurons
David A. Lewis and Takanori Hashimoto The Role of CD4 T Cells in the Pathogenesis of
Multiple Sclerosis
Alterations of Serotonin Transmission in
Tanuja Chitnis
Schizophrenia
Anissa Abi-Dargham The CD8 T Cell in Multiple Sclerosis: Suppressor
Cell or Mediator of Neuropathology?
Serotonin and Dopamine Interactions in Rodents
Aaron J. Johnson, Georgette L. Suidan, Jeremiah
and Primates: Implications for Psychosis and Anti-
McDole, and Istvan Pirko
psychotic Drug Development
Gerard J. Marek Immunopathogenesis of Multiple Sclerosis
Smriti M. Agrawal and V. Wee Yong
Cholinergic Circuits and Signaling in the Patho-
physiology of Schizophrenia Molecular Mimicry in Multiple Sclerosis
Joshua A. Berman, David A. Talmage, and Lorna Jane E. Libbey, Lori L. McCoy, and Robert
W. Role S. Fujinami
Molecular “Negativity” May Underlie Multiple Detection of Cortical Lesions Is Dependent on

Sclerosis: Role of the Myelin Basic Protein Family Choice of Slice Thickness in Patients with
in the Pathogenesis of MS Multiple Sclerosis
Abdiwahab A. Musse and George Harauz Ondrej Dolezal, Michael G. Dwyer, Dana
Horakova, Eva Havrdova, Alireza Minagar, Srivats
Microchimerism and Stem Cell Transplantation in
Balachandran, Niels Bergsland, Zdenek Seidl,
Multiple Sclerosis
Manuela Vaneckova, David Fritz, Jan Krasensky,
Behrouz Nikbin, Mandana Mohyeddin Bonab, and
and Robert Zivadinov
Fatemeh Talebian
The Role of Quantitative Neuroimaging
The Insulin-Like Growth Factor System in
Indices in the Differentiation of Ischemia from
Multiple Sclerosis
Demyelination: An Analytical Study with Case
Daniel Chesik, Nadine Wilczak, and Jacques De
Presentation
Keyser
Romy Hoque, Christina Ledbetter, Eduardo
Cell-Derived Microparticles and Exosomes in Gonzalez-Toledo, Vivek Misra, Uma Menon,
Neuroinflammatory Disorders Meghan Kenner, Alejandro A. Rabinstein,
Lawrence L. Horstman, Wenche Jy, Roger E. Kelley, Robert Zivadinov, and
Alireza Minagar, Carlos J. Bidot, Alireza Minagar
Joaquin J. Jimenez, J. Steven Alexander,
and Yeon S. Ahn HLA-DRB1*1501, -DQB1*0301, -DQB1*0302,
-DQB1*0602, and -DQB1*0603 Alleles Are
Multiple Sclerosis in Children: Clinical, Diagnos- Associated with More Severe Disease
tic, and Therapeutic Aspects Outcome on MRI in Patients with Multiple
Kevin Rostásy Sclerosis
Robert Zivadinov, Laura Uxa, Alessio Bratina,
Migraine in Multiple Sclerosis
Antonio Bosco, Bhooma Srinivasaraghavan, Alireza
Debra G. Elliott
Minagar, Maja Ukmar, Su yen Benedetto, and
Multiple Sclerosis as a Painful Disease Marino Zorzon
Meghan Kenner, Uma Menon, and
Glatiramer Acetate: Mechanisms of Action in
Debra Elliott
Multiple Sclerosis
Multiple Sclerosis and Behavior Tjalf Ziemssen and Wiebke Schrempf
James B. Pinkston, Anita Kablinger, and Nadejda
Alekseeva Evolving Therapies for Multiple Sclerosis
Elena Korniychuk, John M. Dempster,
Cerebrospinal Fluid Analysis in Multiple Eileen O’Connor, J. Steven Alexander, Roger
Sclerosis E. Kelley, Meghan Kenner, Uma Menon, Vivek
Francisco A. Luque and Stephen L. Jaffe Misra, Romy Hoque, Eduardo C. Gonzalez-
Toledo, Robert N. Schwendimann, Stacy Smith,
Multiple Sclerosis in Isfahan, Iran
and Alireza Minagar
Mohammad Saadatnia, Masoud Etemadifar,
and Amir Hadi Maghzi Remyelination in Multiple Sclerosis
Divya M. Chari
Gender Issues in Multiple Sclerosis
Robert N. Schwendimann and Nadejda Trigeminal Neuralgia: A Modern-Day Review
Alekseeva Kelly Hunt and Ravish Patwardhan
Differential Diagnosis of Multiple Sclerosis Optic Neuritis and the Neuro-Ophthalmology of
Halim Fadil, Roger E. Kelley, and Eduardo Multiple Sclerosis
Gonzalez-Toledo Paramjit Kaur and Jeffrey L. Bennett
Prognostic Factors in Multiple Sclerosis Neuromyelitis Optica: New Findings on
Roberto Bergamaschi Pathogenesis
Dean M. Wingerchuk
Neuroimaging in Multiple Sclerosis
Robert Zivadinov and Jennifer L. Cox INDEX
Volume 80 Balachandran, Niels Bergsland, Zdenek Seidl,

Manuela Vaneckova, David Fritz, Jan Krasensky,
Epilepsy in the Elderly: Scope of the Problem and Robert Zivadinov
Ilo E. Leppik
The Role of Quantitative Neuroimaging Indices
Animal Models in Gerontology Research in the Differentiation of Ischemia from Demyelin-
Nancy L. Nadon ation: An Analytical Study with Case Presentation
Animal Models of Geriatric Epilepsy Romy Hoque, Christina Ledbetter, Eduardo
Lauren J. Murphree, Lynn M. Rundhaugen, and Gonzalez-Toledo, Vivek Misra, Uma Menon,
Kevin M. Kelly Meghan Kenner, Alejandro A. Rabinstein, Roger
E. Kelley, Robert Zivadinov, and Alireza Minagar
Life and Death of Neurons in the Aging
Cerebral Cortex HLA-DRB1*1501, -DQB1*0301,-DQB1
John H. Morrison and Patrick R. Hof *0302,-DQB1*0602, and -DQB1*0603 Alleles
Are Associated with More Severe Disease Out-
An In Vitro Model of Stroke-Induced Epilepsy: come on MRI in Patients with Multiple Sclerosis
Elucidation of the Roles of Glutamate and Robert Zivadinov, Laura Uxa, Alessio Bratina,
Calcium in the Induction and Maintenance of Antonio Bosco, Bhooma Srinivasaraghavan,
Stroke-Induced Epileptogenesis Alireza Minagar, Maja Ukmar, Su yen Benedetto,
Robert J. DeLorenzo, David A. Sun, Robert E. and Marino Zorzon
Blair, and Sompong Sambati
Glatiramer Acetate: Mechanisms of Action in
Mechanisms of Action of Antiepileptic Drugs Multiple Sclerosis
H. Steve White, Misty D. Smith, and Karen Tjalf Ziemssen and Wiebke Schrempf
S. Wilcox
Evolving Therapies for Multiple Sclerosis
Epidemiology and Outcomes of Status Epilepticus Elena Korniychuk, John M. Dempster,
in the Elderly Eileen O’Connor, J. Steven Alexander,
Alan R. Towne Roger E. Kelley, Meghan Kenner, Uma Menon,
Diagnosing Epilepsy in the Elderly Vivek Misra, Romy Hoque, Eduardo C. Gonzalez-
R. Eugene Ramsay, Flavia M. Macias, and Toledo, Robert N. Schwendimann, Stacy Smith,
A. James Rowan and Alireza Minagar
Pharmacoepidemiology in Community-Dwelling Remyelination in Multiple Sclerosis

Elderly Taking Antiepileptic Drugs Divya M. Chari
Dan R. Berlowitz and Mary Jo V. Pugh Trigeminal Neuralgia: A Modern-Day Review
Use of Antiepileptic Medications in Nursing Homes Kelly Hunt and Ravish Patwardhan
Judith Garrard, Susan L. Harms, Lynn E. Eberly, Optic Neuritis and the Neuro-Ophthalmology of
and Ilo E. Leppik Multiple Sclerosis
Differential Diagnosis of Multiple Sclerosis Paramjit Kaur and Jeffrey L. Bennett
Halim Fadil, Roger E. Kelley, and Eduardo Neuromyelitis Optica: New Findings on
Gonzalez-Toledo Pathogenesis
Prognostic Factors in Multiple Sclerosis Dean M. Wingerchuk
Roberto Bergamaschi INDEX
Neuroimaging in Multiple Sclerosis
Robert Zivadinov and Jennifer L. Cox
Volume 81
Detection of Cortical Lesions Is Dependent
Epilepsy in the Elderly: Scope of the Problem
on Choice of Slice Thickness in Patients with
Ilo E. Leppik
Multiple Sclerosis
Ondrej Dolezal, Michael G. Dwyer, Dana Animal Models in Gerontology Research
Horakova, Eva Havrdova, Alireza Minagar, Srivats Nancy L. Nadon
Animal Models of Geriatric Epilepsy Outcomes in Elderly Patients With Newly

Lauren J. Murphree, Lynn M. Rundhaugen, Diagnosed and Treated Epilepsy
and Kevin M. Kelly Martin J. Brodie and Linda J. Stephen
Life and Death of Neurons in the Aging Recruitment and Retention in Clinical Trials of
Cerebral Cortex the Elderly
John H. Morrison and Patrick R. Hof Flavia M. Macias, R. Eugene Ramsay, and
A. James Rowan
An In Vitro Model of Stroke-Induced Epilepsy:
Elucidation of the Roles of Glutamate and Treatment of Convulsive Status Epilepticus
Calcium in the Induction and Maintenance of David M. Treiman
Stroke-Induced Epileptogenesis Treatment of Nonconvulsive Status Epilepticus
Robert J. DeLorenzo, David A. Sun, Robert Matthew C. Walker
E. Blair, and Sompong Sambati
Antiepileptic Drug Formulation and Treatment
Mechanisms of Action of Antiepileptic Drugs in the Elderly: Biopharmaceutical Considerations
H. Steve White, Misty D. Smith, and Barry E. Gidal
Karen S. Wilcox
INDEX
Epidemiology and Outcomes of Status Epilepticus
in the Elderly
Alan R. Towne
Diagnosing Epilepsy in the Elderly Volume 82

R. Eugene Ramsay, Flavia M. Macias, Inflammatory Mediators Leading to Protein Mis-
and A. James Rowan folding and Uncompetitive/Fast Off-Rate Drug
Pharmacoepidemiology in Community-Dwelling Therapy for Neurodegenerative Disorders
Elderly Taking Antiepileptic Drugs Stuart A. Lipton, Zezong Gu, and Tomohiro
Dan R. Berlowitz and Mary Jo V. Pugh Nakamura
Use of Antiepileptic Medications in Nursing Innate Immunity and Protective Neu-

Homes roinflammation: New Emphasis on the Role of
Judith Garrard, Susan L. Harms, Lynn E. Eberly, Neuroimmune Regulatory Proteins
and Ilo E. Leppik M. Griffiths, J. W. Neal, and P. Gasque
Glutamate Release from Astrocytes in Physiolog-
Age-Related Changes in Pharmacokinetics:
ical Conditions and in Neurodegenerative Disor-
Predictability and Assessment Methods
ders Characterized by Neuroinflammation
Emilio Perucca
Sabino Vesce, Daniela Rossi, Liliana Brambilla, and
Factors Affecting Antiepileptic Drug Pharmacoki- Andrea Volterra
netics in Community-Dwelling Elderly
The High-Mobility Group Box 1 Cytokine
James C. Cloyd, Susan Marino,
Induces Transporter-Mediated Release of
and Angela K. Birnbaum
Glutamate from Glial Subcellular Particles
Pharmacokinetics of Antiepileptic Drugs in Elderly (Gliosomes) Prepared from In Situ-Matured
Nursing Home Residents Astrocytes
Angela K. Birnbaum Giambattista Bonanno, Luca Raiteri, Marco
Milanese, Simona Zappettini, Edon Melloni,
The Impact of Epilepsy on Older Veterans Marco Pedrazzi, Mario Passalacqua, Carlo
Mary Jo V. Pugh, Dan R. Berlowitz, and Tacchetti, Cesare Usai, and Bianca Sparatore
Lewis Kazis
The Role of Astrocytes and Complement System
Risk and Predictability of Drug Interactions in the in Neural Plasticity
Elderly Milos Pekny, Ulrika Wilhelmsson, Yalda
René H. Levy and Carol Collins Rahpeymai Bogestål, and Marcela Pekna
New Insights into the Roles of Metalloproteinases Differential Modulation of Type 1 and Type 2
in Neurodegeneration and Neuroprotection Cannabinoid Receptors Along the Neuroimmune
A. J. Turner and N. N. Nalivaeva Axis
Sergio Oddi, Paola Spagnuolo, Monica Bari,
Relevance of High-Mobility Group Protein Antonella D’Agostino, and Mauro Maccarrone
Box 1 to Neurodegeneration
Silvia Fossati and Alberto Chiarugi Effects of the HIV-1 Viral Protein Tat on Central
Neurotransmission: Role of Group I Meta-
Early Upregulation of Matrix Metalloproteinases botropic Glutamate Receptors
Following Reperfusion Triggers Neuro-
Elisa Neri, Veronica Musante, and Anna Pittaluga
inflammatory Mediators in Brain Ischemia in Rat
Diana Amantea, Rossella Russo, Micaela Gliozzi, Evidence to Implicate Early Modulation of Inter-
Vincenza Fratto, Laura Berliocchi, G. Bagetta, leukin-1b Expression in the Neuroprotection
G. Bernardi, and M. Tiziana Corasaniti Afforded by 17b-Estradiol in Male Rats Under-
gone Transient Middle Cerebral Artery Occlusion
The (Endo)Cannabinoid System in Multiple Olga Chiappetta, Micaela Gliozzi, Elisa Siviglia,
Sclerosis and Amyotrophic Lateral Sclerosis
Diana Amantea, Luigi A. Morrone, Laura
Diego Centonze, Silvia Rossi, Alessandro Berliocchi, G. Bagetta, and M. Tiziana Corasaniti
Finazzi-Agrò, Giorgio Bernardi, and Mauro
Maccarrone A Role for Brain Cyclooxygenase-2 and Prosta-
glandin-E2 in Migraine: Effects of Nitroglycerin
Chemokines and Chemokine Receptors: Multi- Cristina Tassorelli, Rosaria Greco, Marie Therèse
purpose Players in Neuroinflammation
Armentero, Fabio Blandini, Giorgio Sandrini, and
Richard M. Ransohoff, LiPing Liu, and Astrid Giuseppe Nappi
E. Cardona
The Blockade of K+-ATP Channels has Neuro-
Systemic and Acquired Immune Responses in protective Effects in an In Vitro Model of Brain
Alzheimer’s Disease Ischemia
Markus Britschgi and Tony Wyss-Coray
Robert Nisticò, Silvia Piccirilli, L. Sebastianelli,
Neuroinflammation in Alzheimer’s Disease and Giuseppe Nisticò, G. Bernardi, and N. B. Mercuri
Parkinson’s Disease: Are Microglia Pathogenic
Retinal Damage Caused by High Intraocular
in Either Disorder?
Pressure-Induced Transient Ischemia is Prevented
Joseph Rogers, Diego Mastroeni, Brian Leonard,
by Coenzyme Q10 in Rat
Jeffrey Joyce, and Andrew Grover
Carlo Nucci, Rosanna Tartaglione, Angelica
Cytokines and Neuronal Ion Channels in Health Cerulli, R. Mancino, A. Spanò, Federica Cavaliere,
and Disease Laura Rombolà, G. Bagetta, M. Tiziana
Barbara Viviani, Fabrizio Gardoni, and Marina Corasaniti, and Luigi A. Morrone
Marinovich
Evidence Implicating Matrix Metalloproteinases
Cyclooxygenase-2, Prostaglandin E2, and Micro- in the Mechanism Underlying Accumulation of
glial Activation in Prion Diseases IL-1b and Neuronal Apoptosis in the Neocortex
Luisa Minghetti and Maurizio Pocchiari of HIV/gp120-Exposed Rats
Rossella Russo, Elisa Siviglia, Micaela Gliozzi,
Glia Proinflammatory Cytokine Upregulation as a
Diana Amantea, Annamaria Paoletti,
Therapeutic Target for Neurodegenerative
Laura Berliocchi, G. Bagetta, and
Diseases: Function-Based and Target-Based
M. Tiziana Corasaniti
Discovery Approaches
Linda J. Van Eldik, Wendy L. Thompson, Neuroprotective Effect of Nitroglycerin in a
Hantamalala Ralay Ranaivo, Heather A. Behanna, Rodent Model of Ischemic Stroke: Evaluation
and D. Martin Watterson of Bcl-2 Expression
Rosaria Greco, Diana Amantea, Fabio Blandini,
Oxidative Stress and the Pathogenesis of Neuro-
Giuseppe Nappi, Giacinto Bagetta, M. Tiziana
degenerative Disorders
Corasaniti, and Cristina Tassorelli
Ashley Reynolds, Chad Laurie, R. Lee Mosley, and
Howard E. Gendelman INDEX
Volume 83 Seizures in Pregnancy: Diagnosis and

Management
Gender Differences in Pharmacological Response Robert L. Beach and Peter W. Kaplan
Gail D. Anderson
Management of Epilepsy and Pregnancy:
Epidemiology and Classification of Epilepsy: An Obstetrical Perspective
Gender Comparisons Julian N. Robinson and Jane Cleary-Goldman
John C. McHugh and Norman Delanty
Pregnancy Registries: Strengths, Weaknesses, and
Hormonal Influences on Seizures: Basic Bias Interpretation of Pregnancy Registry Data
Neurobiology Marianne Cunnington and John Messenheimer
Cheryl A. Frye
Bone Health in Women With Epilepsy: Clinical
Catamenial Epilepsy Features and Potential Mechanisms
Patricia E. Penovich and Sandra Helmers Alison M. Pack and Thaddeus S. Walczak
Epilepsy in Women: Special Considerations for Metabolic Effects of AEDs: Impact on Body
Adolescents Weight, Lipids and Glucose Metabolism
Mary L. Zupanc and Sheryl Haut Raj D. Sheth and Georgia Montouris
Contraception in Women with Epilepsy: Pharma- Psychiatric Comorbidities in Epilepsy
cokinetic Interactions, Contraceptive Options, W. Curt Lafrance, Jr., Andres M. Kanner, and
and Management Bruce Hermann
Caryn Dutton and Nancy Foldvary-Schaefer
Issues for Mature Women with Epilepsy
Reproductive Dysfunction in Women with Epi- Cynthia L. Harden
lepsy: Menstrual Cycle Abnormalities, Fertility,
and Polycystic Ovary Syndrome Pharmacodynamic and Pharmacokinetic Interac-
Jürgen Bauer and Déirdre Cooper-Mahkorn tions of Psychotropic Drugs with Antiepileptic
Drugs
Sexual Dysfunction in Women with Epilepsy: Andres M. Kanner and Barry E. Gidal
Role of Antiepileptic Drugs and Psychotropic
Medications Health Disparities in Epilepsy: How Patient-
Mary A. Gutierrez, Romila Mushtaq, and Glen Oriented Outcomes in Women Differ from Men
Stimmel Frank Gilliam
Pregnancy in Epilepsy: Issues of Concern INDEX

John DeToledo
Teratogenicity and Antiepileptic Drugs: Potential
Mechanisms Volume 84
Mark S. Yerby
Normal Brain Aging: Clinical, Immunological,
Antiepileptic Drug Teratogenesis: What are the Neuropsychological, and Neuroimaging Features
Risks for Congenital Malformations and Adverse Maria T. Caserta, Yvonne Bannon, Francisco
Cognitive Outcomes? Fernandez, Brian Giunta, Mike R. Schoenberg,
Cynthia L. Harden and Jun Tan
Teratogenicity of Antiepileptic Drugs: Role of Subcortical Ischemic Cerebrovascular Dementia
Pharmacogenomics Uma Menon and Roger E. Kelley
Raman Sankar and Jason T. Lerner
Cerebrovascular and Cardiovascular Pathology in
Antiepileptic Drug Therapy in Pregnancy I: Alzheimer’s Disease
Gestation-InducedEffectsonAEDPharmacokinetics Jack C. de la Torre
Page B. Pennell and Collin A. Hovinga
Neuroimaging of Cognitive Impairments in
Antiepileptic Drug Therapy in Pregnancy II: Fetal Vascular Disease
and Neonatal Exposure Carol Di Perri, Turi O. Dalaker, Mona K. Beyer,
Collin A. Hovinga and Page B. Pennell and Robert Zivadinov
Contributions of Neuropsychology and Neuro- GluK1 Receptor Antagonists and Hippocampal

imaging to Understanding Clinical Subtypes Mossy Fiber Function
of Mild Cognitive Impairment Robert Nisticò, Sheila Dargan, Stephen
Amy J. Jak, Katherine J. Bangen, Christina M. Fitzjohn, David Lodge, David E. Jane, Graham
E. Wierenga, Lisa Delano-Wood, Jody Corey- L. Collingridge, and Zuner A. Bortolotto
Bloom, and Mark W. Bondi
Monoamine Transporter as a Target Molecule
Proton Magnetic Resonance Spectroscopy in for Psychostimulants
Dementias and Mild Cognitive Impairment Ichiro Sora, BingJin Li, Setsu Fumushima, Asami
H. Randall Griffith, Christopher C. Stewart, Fukui, Yosefu Arime, Yoshiyuki Kasahara, Hiroaki
and Jan A. den Hollander Tomita, and Kazutaka Ikeda
Application of PET Imaging to Diagnosis Targeted Lipidomics as a Tool to Investigate
of Alzheimer’s Disease and Mild Cognitive Endocannabinoid Function
Impairment Giuseppe Astarita, Jennifer Geaga, Faizy Ahmed,
James M. Noble and Nikolaos Scarmeas and Daniele Piomelli
The Molecular and Cellular Pathogenesis The Endocannabinoid System as a Target for
of Dementia of the Alzheimer’s Type: An Novel Anxiolytic and Antidepressant Drugs
Overview Silvana Gaetani, Pasqua Dipasquale, Adele
Francisco A. Luque and Stephen L. Jaffe Romano, Laura Righetti, Tommaso Cassano,
Alzheimer’s Disease Genetics: Current Status and Daniele Piomelli, and Vincenzo Cuomo
Future Perspectives
GABAA Receptor Function and Gene Expression
Lars Bertram
During Pregnancy and Postpartum
Frontotemporal Lobar Degeneration: Insights Giovanni Biggio, Maria Cristina Mostallino, Paolo
from Neuropsychology and Neuroimaging Follesa, Alessandra Concas, and Enrico Sanna
Andrea C. Bozoki and Muhammad U. Farooq
Early Postnatal Stress and Neural Circuit Underly-
Lewy Body Dementia ing Emotional Regulation
Jennifer C. Hanson and Carol F. Lippa Machiko Matsumoto, Mitsuhiro Yoshioka,
and Hiroko Togashi
Dementia in Parkinson’s Disease
Bradley J. Robottom and William J. Weiner Roles of the Histaminergic Neurotransmission
Early Onset Dementia on Methamphetamine-Induced Locomotor Sen-
Halim Fadil, Aimee Borazanci, Elhachmia Ait Ben sitization and Reward: A Study of Receptors
Haddou, Mohamed Yahyaoui, Elena Korniychuk, Gene Knockout Mice
Stephen L. Jaffe, and Alireza Minagar Naoko Takino, Eiko Sakurai, Atsuo Kuramasu,
Nobuyuki Okamura, and Kazuhiko Yanai
Normal Pressure Hydrocephalus
Glen R. Finney Developmental Exposure to Cannabinoids
Causes Subtle and Enduring Neurofunctional
Reversible Dementias Alterations
Anahid Kabasakalian and Glen R. Finney Patrizia Campolongo, Viviana Trezza, Maura
INDEX Palmery, Luigia Trabace, and Vincenzo Cuomo
Neuronal Mechanisms for Pain-Induced Aver-

sion: Behavioral Studies Using a Conditioned
Place Aversion Test
Volume 85 Masabumi Minami
Involvement of the Prefrontal Cortex in Problem Bv8/Prokineticins and their Receptors: A New
Solving Pronociceptive System
Hajime Mushiake, Kazuhiro Sakamoto, Naohiro Lucia Negri, Roberta Lattanzi, Elisa Giannini,
Saito, Toshiro Inui, Kazuyuki Aihara, and Jun Michela Canestrelli, Annalisa Nicotra,
Tanji and Pietro Melchiorri
P2Y6-Evoked Microglial Phagocytosis Neurotrophic and Neuroprotective Actions of

Kazuhide Inoue, Schuichi Koizumi, Ayako Kataoka, an Enhancer of Ganglioside Biosynthesis
Hidetoshi Tozaki-Saitoh, and Makoto Tsuda Jin-ichi Inokuchi
PPAR and Pain Involvement of Endocannabinoid Signaling in the
Takehiko Maeda and Shiroh Kishioka Neuroprotective Effects of Subtype 1 Meta-
botropic Glutamate Receptor Antagonists in
Involvement of Inflammatory Mediators in Neu-
Models of Cerebral Ischemia
ropathic Pain Caused by Vincristine
Elisa Landucci, Francesca Boscia, Elisabetta Gerace,
Norikazu Kiguchi, Takehiko Maeda, Yuka
Tania Scartabelli, Andrea Cozzi, Flavio Moroni,
Kobayashi, Fumihiro Saika, and Shiroh Kishioka
Guido Mannaioni, and Domenico E.
Nociceptive Behavior Induced by the Endogenous Pellegrini-Giampietro
Opioid Peptides Dynorphins in Uninjured Mice:
NF-kappaB Dimers in the Regulation of
Evidence with Intrathecal N-ethylmaleimide
Neuronal Survival
Inhibiting Dynorphin Degradation
Ilenia Sarnico, Annamaria Lanzillotta, Marina
Koichi Tan-No, Hiroaki Takahashi, Osamu
Benarese, Manuela Alghisi, Cristina Baiguera,
Nakagawasai, Fukie Niijima, Shinobu Sakurada,
Leontino Battistin, PierFranco Spano, and Marina
Georgy Bakalkin, Lars Terenius, and Takeshi
Pizzi
Tadano
Oxidative Stress in Stroke Pathophysiology:
Mechanism of Allodynia Evoked by Intrathecal
Validation of Hydrogen Peroxide Metabolism as a
Morphine-3-Glucuronide in Mice
Pharmacological Target to Afford Neuroprotection
Takaaki Komatsu, Shinobu Sakurada,
Diana Amantea, Maria Cristina Marrone, Robert
Sou Katsuyama, Kengo Sanai, and Tsukasa
Nisticò, Mauro Federici, Giacinto Bagetta,
Sakurada
Giorgio Bernardi, and Nicola Biagio Mercuri
(–)-Linalool Attenuates Allodynia in Neuropathic
Role of Akt and ERK Signaling in the Neuro-
Pain Induced by Spinal Nerve Ligation in
genesis following Brain Ischemia
C57/Bl6 Mice
Norifumi Shioda, Feng Han, and Kohji Fukunaga
Laura Berliocchi, Rossella Russo, Alessandra
Levato, Vincenza Fratto, Giacinto Bagetta, Shinobu Prevention of Glutamate Accumulation and
Sakurada, Tsukasa Sakurada, Nicola Biagio Upregulation of Phospho-Akt may Account for
Mercuri, and Maria Tiziana Corasaniti Neuroprotection Afforded by Bergamot Essential
Oil against Brain Injury Induced by Focal Cerebral
Intraplantar Injection of Bergamot Essential Oil
Ischemia in Rat
into the Mouse Hindpaw: Effects on Capsaicin-
Diana Amantea, Vincenza Fratto, Simona Maida,
Induced Nociceptive Behaviors
Domenicantonio Rotiroti, Salvatore Ragusa,
Tsukasa Sakurada, Hikari Kuwahata, Soh
Giuseppe Nappi, Giacinto Bagetta, and
Katsuyama, Takaaki Komatsu, Luigi A. Morrone,
Maria Tiziana Corasaniti
M. Tiziana Corasaniti, Giacinto Bagetta,
and Shinobu Sakurada Identification of Novel Pharmacological Targets
to Minimize Excitotoxic Retinal Damage
New Therapy for Neuropathic Pain
Rossella Russo, Domenicantonio Rotiroti, Cristina
Hirokazu Mizoguchi, Chizuko Watanabe, Akihiko
Tassorelli, Carlo Nucci, Giacinto Bagetta, Massimo
Yonezawa, and Shinobu Sakurada
Gilberto Bucci, Maria Tiziana Corasaniti, and
Regulated Exocytosis from Astrocytes: Physiolog- Luigi Antonio Morrone
ical and Pathological Related Aspects
INDEX
Corrado Calı`ı´, Julie Marchaland, Paola Spagnuolo,
Julien Gremion, and Paola Bezzi
Glutamate Release from Astrocytic Gliosomes
Volume 86
Under Physiological and Pathological Conditions Section One: Hybrid Bionic Systems
Marco Milanese, Tiziana Bonifacino, Simona EMG-Based and Gaze-Tracking-Based Man–
Zappettini, Cesare Usai, Carlo Tacchetti, Machine Interfaces
Mario Nobile, and Giambattista Bonanno Federico Carpi and Danilo De Rossi
Bidirectional Interfaces with the Peripheral Section Four: Brain-Machine Interfaces and
Nervous System Space
Silvestro Micera and Xavier Navarro Adaptive Changes of Rhythmic EEG Oscillations
in Space: Implications for Brain–Machine
Interfacing Insect Brain for Space Applications
Interface Applications
Giovanni Di Pino, Tobias Seidl,
G. Cheron, A. M. Cebolla, M. Petieau,
Antonella Benvenuto, Fabrizio Sergi, Domenico
A. Bengoetxea, E. Palmero-Soler, A. Leroy, and
Campolo, Dino Accoto, Paolo Maria Rossini,
B. Dan
and Eugenio Guglielmelli
Validation of Brain–Machine Interfaces During
Section Two: Meet the Brain
Parabolic Flight
Meet the Brain: Neurophysiology
José del R. Millán, Pierre W. Ferrez, and Tobias
John Rothwell
Seidl
Fundamentals of Electroencefalography, Magne-
Matching Brain–Machine Interface Performance
toencefalography, and Functional Magnetic
to Space Applications
Resonance Imaging
Luca Citi, Oliver Tonet, and Martina Marinelli
Claudio Babiloni, Vittorio Pizzella, Cosimo Del
Gratta, Antonio Ferretti, and Gian Luca Romani Brain–Machine Interfaces for Space
Applications—Research, Technological Devel-
Implications of Brain Plasticity to Brain–Machine
opment, and Opportunities
Interfaces Operation: A Potential Paradox?
Leopold Summerer, Dario Izzo, and Luca Rossini
Paolo Maria Rossini
INDEX
Section Three: Brain Machine Interfaces, A New
Brain-to-Environment Communication Channel
An Overview of BMIs
Francisco Sepulveda Volume 87
Neurofeedback and Brain–Computer Interface: Peripheral Nerve Repair and Regeneration
Clinical Applications Research: A Historical Note
Niels Birbaumer, Ander Ramos Murguialday, Bruno Battiston, Igor Papalia, Pierluigi Tos, and
Cornelia Weber, and Pedro Montoya Stefano Geuna
Flexibility and Practicality: Graz Brain–Computer Development of the Peripheral Nerve
Interface Approach Suleyman Kaplan, Ersan Odaci, Bunyami Unal,
Reinhold Scherer, Gernot R. Müller-Putz, and Bunyamin Sahin, and Michele Fornaro
Gert Pfurtscheller
Histology of the Peripheral Nerve and Changes
On the Use of Brain–Computer Interfaces Out- Occurring During Nerve Regeneration
side Scientific Laboratories: Toward an Applica- Stefano Geuna, Stefania Raimondo, Giulia Ronchi,
tion in Domotic Environments Federica Di Scipio, Pierluigi Tos, Krzysztof Czaja,
F. Babiloni, F. Cincotti, M. Marciani, S. Salinari, and Michele Fornaro
L. Astolfi, F. Aloise, F. De Vico Fallani, and
Methods and Protocols in Peripheral Nerve
D. Mattia
Regeneration Experimental Research:
Brain–Computer Interface Research at the Part I—Experimental Models
Wadsworth Center: Developments in Noninva- Pierluigi Tos, Giulia Ronchi, Igor Papalia,
sive Communication and Control Vera Sallen, Josette Legagneux, Stefano Geuna, and
Dean J. Krusienski and Jonathan R. Wolpaw Maria G. Giacobini-Robecchi
Watching Brain TV and Playing Brain Ball: Methods and Protocols in Peripheral Nerve
Exploring Novel BCL Strategies Using Real– Regeneration Experimental Research: Part
Time Analysis of Human Intercranial Data II—Morphological Techniques
Karim Jerbi, Samson Freyermuth, Lorella Minotti, Stefania Raimondo, Michele Fornaro, Federica Di
Philippe Kahane, Alain Berthoz, and Jean-Philippe Scipio, Giulia Ronchi, Maria G. Giacobini-
Lachaux Robecchi, and Stefano Geuna
Methods and Protocols in Peripheral Nerve Enhancement of Nerve Regeneration and

Regeneration Experimental Research: Part III— Recovery by Immunosuppressive Agents
Electrophysiological Evaluation Damien P. Kuffler
Xavier Navarro and Esther Udina
The Role of Collagen in Peripheral Nerve
Methods and Protocols in Peripheral Nerve Repair
Regeneration Experimental Research: Part IV— Guido Koopmans, Birgit Hasse, and
Kinematic Gait Analysis to Quantify Peripheral Nektarios Sinis
Nerve Regeneration in the Rat
Gene Therapy Perspectives for Nerve Repair
Luı´s M. Costa, Maria J. Simões, Ana C. Maurıćio
Serena Zacchigna and Mauro Giacca
and Artur S.P. Varejão
Use of Stem Cells for Improving Nerve
Current Techniques and Concepts in Peripheral
Regeneration
Nerve Repair
Giorgio Terenghi, Mikael Wiberg, and
Maria Siemionow and Grzegorz Brzezicki
Paul J. Kingham
Artificial Scaffolds for Peripheral Nerve
Transplantation of Olfactory Ensheathing Cells
Reconstruction
for Peripheral Nerve Regeneration
Valeria Chiono, Chiara Tonda-Turo, and
Christine Radtke, Jeffery D. Kocsis, and Peter
Gianluca Ciardelli
M. Vogt
Conduit Luminal Additives for Peripheral
Manual Stimulation of Target Muscles has
Nerve Repair
Different Impact on Functional Recovery after
Hede Yan, Feng Zhang, Michael B. Chen, and
Injury of Pure Motor or Mixed Nerves
William C. Lineaweaver
Nektarios Sinis, Thodora Manoli, Frank Werdin,
Tissue Engineering of Peripheral Nerves Armin Kraus, Hans E. Schaller, Orlando
Bruno Battiston, Stefania Raimondo, Pierluigi Tos, Guntinas-Lichius, Maria Grosheva, Andrey
Valentina Gaidano, Chiara Audisio, Anna Scevola, Irintchev, Emanouil Skouras, Sarah Dunlop, and
Isabelle Perroteau, and Stefano Geuna Doychin N. Angelov
Mechanisms Underlying The End-to-Side Nerve Electrical Stimulation for Improving Nerve
Regeneration Regeneration: Where do we Stand?
Eleana Bontioti and Lars B. Dahlin Tessa Gordon, Olewale A. R. Sulaiman, and
Adil Ladak
Experimental Results in End-To-Side
Neurorrhaphy Phototherapy in Peripheral Nerve Injury:
Alexandros E. Beris and Marios G. Lykissas Effects on Muscle Preservation and Nerve
Regeneration
End-to-Side Nerve Regeneration: From the
Shimon Rochkind, Stefano Geuna, and
Laboratory Bench to Clinical Applications
Asher Shainberg
Pierluigi Tos, Stefano Artiaco, Igor Papalia, Ignazio
Marcoccio, Stefano Geuna, and Bruno Battiston Age-Related Differences in the Reinnervation
after Peripheral Nerve Injury
Novel Pharmacological Approaches to Schwann
Urosˇ Kovacˇicˇ, Janez Sketelj, and Fajko
Cells as Neuroprotective Agents for Peripheral
F. Bajrovic´
Nerve Regeneration
Valerio Magnaghi, Patrizia Procacci, and Neural Plasticity After Nerve Injury and
Ada Maria Tata Regeneration
Xavier Navarro
Melatonin and Nerve Regeneration
Ersan Odaci and Suleyman Kaplan Future Perspective in Peripheral Nerve
Reconstruction
Transthyretin: An Enhancer of Nerve
Lars Dahlin, Fredrik Johansson, Charlotta
Regeneration
Lindwall, and Martin Kanje
Carolina E. Fleming, Fernando Milhazes Mar,
Filipa Franquinho, and Mónica M. Sousa INDEX
Volume 88 Cocaine-Induced Breakdown of the Blood–Brain

Barrier and Neurotoxicity
Effects Of Psychostimulants On Neurotrophins: Hari S. Sharma, Dafin Muresanu, Aruna Sharma,
Implications For Psychostimulant-Induced and Ranjana Patnaik
Neurotoxicity
Francesco Angelucci, Valerio Ricci, Gianfranco Cannabinoid Receptors in Brain:
Spalletta, Carlo Caltagirone, Aleksander A. Mathé, Pharmacogenetics, Neuropharmacology, Neu-
and Pietro Bria rotoxicology, and Potential Therapeutic
Applications
Dosing Time-Dependent Actions of Emmanuel S. Onaivi
Psychostimulants
Intermittent Dopaminergic Stimulation causes
H. Manev and T. Uz
Behavioral Sensitization in the Addicted Brain
Dopamine-Induced Behavioral Changes and and Parkinsonism
Oxidative Stress in Methamphetamine-Induced Francesco Fornai, Francesca Biagioni, Federica
Neurotoxicity Fulceri, Luigi Murri, Stefano Ruggieri,
Taizo Kita, Ikuko Miyazaki, Masato Asanuma, Antonio Paparelli
Mika Takeshima, and George C. Wagner
The Role of the Somatotrophic Axis in
Acute Methamphetamine Intoxication: Brain Neuroprotection and Neuroregeneration of the
Hyperthermia, Blood–Brain Barrier, Brain Addictive Brain
Edema, and morphological cell abnormalities Fred Nyberg
Eugene A. Kiyatkin and Hari S. Sharma
INDEX
Molecular Bases of Methamphetamine-Induced
Neurodegeneration
Jean Lud Cadet and Irina N. Krasnova
Volume 89
Involvement of Nicotinic Receptors in Metham-
Molecular Profiling of Striatonigral and
phetamine- and MDMA-Induced Neurotoxicity:
Striatopallidal Medium Spiny Neurons: Past, Pre-
Pharmacological Implications
sent, and Future
E. Escubedo, J. Camarasa, C. Chipana,
Mary Kay Lobo
S. Garcıá-Ratés, and D.Pubill
BAC to Degeneration: Bacterial Artificial
Ethanol Alters the Physiology of Neuron–Glia
Chromosome (Bac)-Mediated Transgenesis for
Communication
Modeling Basal Ganglia Neurodegenerative
Antonio González and Ginés M. Salido
Disorders
Therapeutic Targeting of “DARPP-32”: Xiao-Hong Lu
A Key Signaling Molecule in the Dopiminergic
Behavioral Outcome Measures for the Assessment
Pathway for the Treatment of Opiate Addiction
Supriya D. Mahajan, Ravikumar Aalinkeel, of Sensorimotor Function in Animal Models of
Jessica L. Reynolds, Bindukumar B. Nair, Movement Disorders
Donald E. Sykes, Zihua Hu, Adela Bonoiu, Sheila M. Fleming
Hong Ding, Paras N. Prasad, and Stanley The Role of DNA Methylation in the Central
A. Schwartz Nervous System and Neuropsychiatric Disorders
Pharmacological and Neurotoxicological Actions Jian Feng and Guoping Fan
Mediated By Bupropion and Diethylpropion Heritability of Structural Brain Traits: An
Hugo R. Arias, Abel Santamarıá, and Syed F. Ali Endo-phenotype Approach to Deconstruct
Schizophrenia
Neural and Cardiac Toxicities Associated With
Nil Kaymaz and J. Van Os
3,4-Methylenedioxymethamphetamine
(MDMA) The Role of Striatal NMDA Receptors in Drug
Michael H. Baumann and Richard Addiction
B. Rothman Yao-Ying Ma, Carlos Cepeda, and Cai-Lian Cui
Deciphering Rett Syndrome With Mouse Genet- Part III—Transcranial Sonography in other
ics, Epigenomics, and Human Neurons Movement Disorders and Depression
Jifang Tao, Hao Wu, and Yi Eve Sun
Transcranial Sonography in Brain Disorders with
INDEX Trace Metal Accumulation
Uwe Walter
Transcranial Sonography in Dystonia
Volume 90 Alexandra Gaenslen
Part I: Introduction Transcranial Sonography in Essential Tremor
Heike Stockner and Isabel Wurster
Introductory Remarks on the History and Current
Applications of TCS VII—Transcranial Sonography in Restless Legs
Matthew B. Stern Syndrome
Jana Godau and Martin Sojer
Method and Validity of Transcranial Sonography
in Movement Disorders Transcranial Sonography in Ataxia
David Školoudı´k and Uwe Walter Christos Krogias, Thomas Postert and Jens Eyding
Transcranial Sonography—Anatomy Transcranial Sonography in Huntington’s Disease
Heiko Huber Christos Krogias, Jens Eyding and Thomas Postert
Transcranial Sonography in Depression
Part II: Transcranial Sonography in Parkinsons Milija D. Mijajlovic
Disease
Transcranial Sonography in Relation to SPECT Part IV: Future Applications and Conclusion
and MIBG Transcranial Sonography-Assisted Stereotaxy and
Yoshinori Kajimoto, Hideto Miwa and Tomoyoshi Follow-Up of Deep Brain Implants in Patients
Kondo with Movement Disorders
Diagnosis of Parkinson’s Disease—Transcranial Uwe Walter
Sonography in Relation to MRI Conclusions
Ludwig Niehaus and Kai Boelmans Daniela Berg
Early Diagnosis of Parkinson’s Disease INDEX
Alexandra Gaenslen and Daniela Berg
Transcranial Sonography in the Premotor Diag-
nosis of Parkinson’s Disease
Stefanie Behnke, Ute Schroder and Daniela Berg Volume 91
Pathophysiology of Transcranial Sonography Sig- The Role of microRNAs in Drug Addiction:
nal Changes in the Human Substantia Nigra A Big Lesson from Tiny Molecules
K. L. Double, G. Todd and S. R. Duma Andrzej Zbigniew Pietrzykowski
Transcranial Sonography for the Discrimination of The Genetics of Behavioral Alcohol Responses in
Idiopathic Parkinson’s Disease from the Atypical Drosophila
Parkinsonian Syndromes Aylin R. Rodan and Adrian Rothenfluh
A. E. P. Bouwmans, A. M. M. Vlaar, K. Srulijes,
Neural Plasticity, Human Genetics, and Risk for
W. H. Mess AND W. E. J. Weber
Alcohol Dependence
Transcranial Sonography in the Discrimination of Shirley Y. Hill
Parkinson’s Disease Versus Vascular Parkinsonism
Using Expression Genetics to Study the Neurobi-
Pablo Venegas-Francke
ology of Ethanol and Alcoholism
TCS in Monogenic Forms of Parkinson’s Disease Sean P. Farris, Aaron R. Wolen and Michael
Kathrin Brockmann and Johann Hagenah F. Miles
Genetic Variation and Brain Gene Expression in Neuroimaging of Dreaming: State of the Art and
Rodent Models of Alcoholism: Implications for Limitations
Medication Development Caroline Kussé, Vincenzo Muto, Laura Mascetti,
Karl Björk, Anita C. Hansson and Luca Matarazzo, Ariane Foret, Anahita Shaffii-Le
W. olfgang H. Sommer Bourdiec and Pierre Maquet
Identifying Quantitative Trait Loci (QTLs) and Memory Consolidation, The Diurnal Rhythm of
Genes (QTGs) for Alcohol-Related Phenotypes Cortisol, and The Nature of Dreams: A New
in Mice Hypothesis
Lauren C. Milner and Kari J. Buck Jessica D. Payne
Glutamate Plasticity in the Drunken Amygdala: Characteristics and Contents of Dreams
The Making of an Anxious Synapse Michael Schredl
Brian A. Mccool, Daniel T. Christian, Marvin
Trait and Neurobiological Correlates of Individ-
R. Diaz and Anna K. Läck
ual Differences in Dream Recall and Dream
Ethanol Action on Dopaminergic Neurons in Content
the Ventral Tegmental Area: Interaction with Mark Blagrove and Edward F. Pace-Schott
Intrinsic Ion Channels and Neurotransmitter
Consciousness in Dreams
Inputs
David Kahn and Tzivia Gover
Hitoshi Morikawa and Richard
A. Morrisett The Underlying Emotion and the Dream: Relat-
ing Dream Imagery to the Dreamer’s Underlying
Alcohol and the Prefrontal Cortex
Emotion can Help Elucidate the Nature of
Kenneth Abernathy, L. Judson Chandler and John
Dreaming
J. Woodward
Ernest Hartmann
BK Channel and Alcohol, A Complicated Affair
Dreaming, Handedness, and Sleep Architecture:
Gilles Erwan Martin
Interhemispheric Mechanisms
A Review of Synaptic Plasticity at Purkinje Neu- Stephen D. Christman and Ruth E. Propper
rons with a Focus on Ethanol-Induced Cerebellar
To What Extent Do Neurobiological Sleep-
Dysfunction
Waking Processes Support Psychoanalysis?
C. Fernando Valenzuela, Britta Lindquist and
Claude Gottesmann
Paula A. Zflmudio-Bulcock
The Use of Dreams in Modern Psychotherapy
INDEX
Clara E. Hill and Sarah Knox
INDEX
Volume 92
The Development of the Science of Dreaming Volume 93
Claude Gottesmann
Underlying Brain Mechanisms that Regulate
Dreaming as Inspiration: Evidence from Religion, Sleep-Wakefulness Cycles
Philosophy, Literature, and Film Irma Gvilia
Kelly Bulkeley
What Keeps Us Awake?—the Role of Clocks and
Developmental Perspective: Dreaming Across the Hourglasses, Light, and Melatonin
Lifespan and What This Tells Us Christian Cajochen, Sarah Chellappa and Christina
Melissa M. Burnham and Christian Conte Schmidt
REM and NREM Sleep Mentation Suprachiasmatic Nucleus and Autonomic Nervous
Patrick Mcnamara, Patricia Johnson, Deirdre System Influences on Awakening From Sleep
McLaren, Erica Harris,Catherine Beauharnais and Andries Kalsbeek, Chun-xia Yi, Susanne E. la
Sanford Auerbach Fleur, Ruud m. Buijs, and Eric Fliers
Preparation for Awakening: Self-Awakening Vs. Volume 95

Forced Awakening: Preparatory Changes in the
Pre-Awakening Period Introductory Remarks: Catechol-O-Methyl-
Mitsuo Hayashi, Noriko Matsuura and transferase Inhibition–An Innovative Approach
Hiroki Ikeda to Enhance L-dopa Therapy in Parkinson’s Dis-
ease with Dual Enzyme Inhibition
Circadian and Sleep Episode Duration Influences Erkki Nissinen
on Cognitive Performance Following the Process
of Awakening The Catechol-O-Methyltransferase Gene: its
Robert L. Matchock Regulation and Polymorphisms
Elizabeth M. Tunbridge
The Cortisol Awakening Response in Context
Angela Clow, Frank Hucklebridge and Distribution and Functions of Catechol-O-
Lisa Thorn Methyltransferase Proteins: Do Recent Findings
Change the Picture?
Causes and Correlates of Frequent Night Awak- Timo T. Myöhänen and Pekka T. Männistö
enings in Early Childhood
Amy Jo Schwichtenberg and Beth Goodlin-Jones Catechol-O-Methyltransferase Enzyme: Cofactor
S-Adenosyl-L-MethionineandRelatedMechanisms
Pathologies of Awakenings: The Clinical Problem Thomas Müller
of Insomnia Considered From Multiple Theory
Levels Biochemistry and Pharmacology of Catechol-
Douglas E. Moul O-Methyltransferase Inhibitors
Erkki nissinen and Pekka T. Männisto
The Neurochemistry of Awakening: Findings
from Sleep Disorder Narcolepsy The Chemistry of Catechol-O-Methyltransferase
Seiji Nishino and Yohei Sagawa Inhibitors
David A. Learmonth, László E. Kiss, and Patrıćio
INDEX Soares-da-Silva
Toxicology and Safety of COMT Inhibitors
Kristiina Haasio
Volume 94 Catechol-O-Methyltransferase Inhibitors in Pre-

clinical Models as Adjuncts of L-dopa Treatment
5-HT6 Medicinal Chemistry Concepció Marin and J. A. Obeso
Kevin G. Liu and Albert J. Robichaud
Problems with the Present Inhibitors and a Rele-
Patents vance of New and Improved COMT Inhibitors in
Nicolas Vincent Ruiz and Gloria Oranias Parkinson’s Disease
5-HT6 Receptor Charactertization Seppo Kaakkola
Teresa Riccioni Catechol-O-Methyltransferase and Pain
5-HT6 Receptor Signal Transduction: Second Oleg Kambur and Pekka T. Männistö
Messenger Systems INDEX
Xavier Codony, Javier Burgueño, Maria Javier
Ramı´rez and José Miguel Vela
Electrophysiology of 5-HT6 Receptors
Volume 96
Annalisa Tassone, Graziella Madeo, Giuseppe The Central Role of 5-HT6 Receptors in Modu-
Sciamanna, Antonio Pisani and Paola Bonsi lating Brain Neurochemistry
Lee A. Dawson
Genetic Variations and Association
Massimo Gennarelli and Annamaria Cattaneo 5-HT6 Receptor Memory and Amnesia: Behav-
ioral Pharmacology – Learning and Memory
Pharmacokinetics of 5-HT6 Receptor Ligands
Processes
Angelo Mancinelli
Alfredo Meneses, G. Pérez-Garcıá, R. Tellez,
INDEX T. Ponce-Lopez and C. Castillo
Behavioral Pharmacology: Potential Antidepres- Peripheral and Central Mechanisms of Orofacial

sant and Anxiolytic Properties Inflammatory Pain
Anna Wesołowska and Magdalena Jastrzbska- Barry J. Sessle
Wisek
The Role of Trigeminal Interpolaris-Caudalis
The 5-HT6 Receptor as a Target for Developing Transition Zone in Persistent Orofacial Pain
Novel Antiobesity Drugs Ke Ren and Ronald Dubner
David Heal, Jane Gosden and Sharon Smith
Physiological Mechanisms of Neuropathic Pain:
Behavioral and Neurochemical Pharmacology of The Orofacial Region
5-HT6 Receptors Related to Reward and Koichi Iwata, Yoshiki Imamura, Kuniya Honda and
Reinforcement Masamichi Shinoda
Gaetano Di Chiara, Valentina Valentini and
Neurobiology of Estrogen Status in Deep Cranio-
Sandro Fenu
facial Pain
5-HT6 Receptor Ligands and their Antipsychotic David A Bereiter and Keiichiro Okamoto
Potential
Macroscopic Connection of Rat Insular Cortex:
Jørn Arnt and Christina Kurre Olsen
Anatomical Bases Underlying its Physiological
5-HT6 Receptor Ligands as Antidementia Drugs Functions
Ellen Siobhan Mitchell Masayuki Kobayashi
Other 5-HT6 Receptor-Mediated Effects The Balance Between Excitation And Inhibition
Franco Borsini And Functional Sensory Processing in the
Somatosensory Cortex
INDEX
Zhi Zhang and Qian-Quan Sun
INDEX
Volume 97 Volume 98
Behavioral Pharmacology of Orofacial Movement
An Introduction to Dyskinesia—the Clinical
Disorders
Spectrum
Noriaki Koshikawa, Satoshi Fujita and Kazunori
Ainhi Ha and Joseph Jankovic
Adachi
L-dopa-induced Dyskinesia—Clinical Presenta-
Regulation of Orofacial Movement: Dopamine
tion, Genetics, And Treatment
Receptor Mechanisms and Mutant Models
L.K. Prashanth, Susan Fox and Wassilios
John L. Waddington, Gerard J. O’Sullivan and
G. Meissner
Katsunori Tomiyama
Experimental Models of L-DOPA-induced
Regulation of Orofacial Movement: Amino Acid
Dyskinesia
Mechanisms and Mutant Models
Tom H. Johnston and Emma L. Lane
Katsunori Tomiyama, Colm M.P. O’Tuathaigh,
and John L. Waddington Molecular Mechanisms of L-DOPA-induced
Dyskinesia
The Trigeminal Circuits Responsible for
Gilberto Fisone and Erwan Bezard
Chewing
Karl-Gunnar Westberg and Arlette Kolta New Approaches to Therapy
Jonathan Brotchie and Peter Jenner
Ultrastructural Basis for Craniofacial Sensory
Processing in the Brainstem Surgical Approach to L-DOPA-induced
Yong Chul Bae and Atsushi Yoshida Dyskinesias
Tejas Sankar and Andres M. Lozano
Mechanisms of Nociceptive Transduction and
Transmission: A Machinery for Pain Sensation Clinical and Experimental Experiences of
and Tools for Selective Analgesia Graft-induced Dyskinesia
Alexander M. Binshtok Emma L. Lane
Tardive Dyskinesia: Clinical Presentation and Homeostatic Control of Neural Activity:

Treatment A Drosophila Model for Drug Tolerance and
P.N. van Harten and D.E. Tenback Dependence
Alfredo Ghezzi and Nigel S. Atkinson
Epidemiology and Risk Factors for (Tardive)
Dyskinesia Attention in Drosophila
D.E. Tenback and P.N. van Harten Bruno van Swinderen
Genetics of Tardive Dyskinesia The roles of Fruitless and Doublesex in the Control
Heon-Jeong Lee and Seung-Gul Kang of Male Courtship
Brigitte Dauwalder
Animal Models of Tardive Dyskinesia
S.K. Kulkarni and Ashish Dhir Circadian Plasticity: from Structure to Behavior
Lia Frenkel and Marıá Fernanda Ceriani
Surgery for Tardive Dyskinesia
Stephane Thobois, Alice Poisson and Philippe Learning and Memory in Drosophila: Behavior,
Damier Genetics, and Neural Systems
Lily Kahsai and Troy Zars
Huntington’s Disease: Clinical Presentation and
Treatment Studying Sensorimotor Processing with Physiol-
M.J.U. Novak and S.J. Tabrizi ogy in Behaving Drosophila
Johannes D. Seelig and Vivek Jayaraman
Genetics and Neuropathology of Huntington’s
Disease: Huntington’s Disease Modeling Human Trinucleotide Repeat Diseases
Anton Reiner, Ioannis Dragatsis and Paula Dietrich in Drosophila
Zhenming Yu and Nancy M. Bonini
Pathogenic Mechanisms in Huntington’s Disease
Lesley Jones and Alis Hughes From Genetics to Structure to Function: Explor-
ing Sleep in Drosophila
Experimental Models of HD And Reflection on
Daniel Bushey and Chiara Cirelli
Therapeutic Strategies
Olivia L. Bordiuk, Jinho Kim and Robert J. Ferrante INDEX
Cell-based Treatments for Huntington’s Disease
Stephen B. Dunnett and Anne E. Rosser
Volume 100
Clinical Phenomenology of Dystonia
Structural Properties of Human Monoamine
Carlo Colosimo and Alfredo Berardelli
Oxidases A and B
Genetics and Pharmacological Treatment of Claudia Binda, Andrea Mattevi and
Dystonia Dale E. Edmondson
Susan Bressman and Matthew James
Behavioral Outcomes of Monoamine Oxidase
Experimental Models of Dystonia Deficiency: Preclinical and Clinical Evidence
A. Tassone, G. Sciamanna, P. Bonsi, G. Martella Marco Bortolato and Jean C. Shih
and A. Pisani
Kinetic Behavior and Reversible Inhibition of
Surgical Treatment of Dystonia Monoamine Oxidases—Enzymes that Many
John Yianni, Alexander L. Green and Tipu Want Dead
Z. Aziz Keith F. Tipton, Gavin P. Davey and
Andrew G. McDonald
INDEX
The Pharmacology of Selegiline
Kálmán Magyar
Volume 99 Type A Monoamine Oxidase Regulates Life and
Seizure and Epilepsy: Studies of Seizure- Death of Neurons in Neurodegeneration and
disorders in Drosophila Neuroprotection
Louise Parker, Iris C. Howlett, Zeid M. Rusan and Makoto Naoi, Wakako Maruyama,
Mark A. Tanouye Keiko Inaba-Hasegawa and Yukihiro Akao
Multimodal Drugs and their Future for Abnormalities in Metabolism and Hypothalamic–
Alzheimer’s and Parkinson’s Disease Pituitary–Adrenal Axis Function in Schizophrenia
Cornelis J. Van der Schyf and Werner J. Geldenhuys Paul C. Guest, Daniel Martins-de-Souza,
Natacha Vanattou-Saifoudine, Laura W. Harris
Neuroprotective Profile of the Multitarget Drug
and Sabine Bahn
Rasagiline in Parkinson’s Disease
Orly Weinreb, Tamar Amit, Peter Riederer, Immune and Neuroimmune Alterations in Mood
Moussa B.H. Youdim and Silvia A. Mandel Disorders and Schizophrenia
Roosmarijn C. Drexhage, Karin Weigelt, Nico van
Rasagiline in Parkinson’s Disease
Beveren, Dan Cohen, Marjan A. Versnel, Willem
L.M. Chahine and M.B. Stern
A. Nolen and Hemmo A. Drexhage
Selective Inhibitors of Monoamine Oxidase Type
Behavioral and Molecular Biomarkers in Transla-
B and the “Cheese Effect”
tional Animal Models for Neuropsychiatric
John P.M. Finberg and Ken Gillman
Disorders
A Novel Anti-Alzheimer’s Disease Drug, Ladostigil: Zoltán Sarnyai, Murtada Alsaif, Sabine Bahn,
Neuroprotective, Multimodal Brain-Selective Agnes Ernst, Paul C. Guest, Eva Hradetzky,
Monoamine Oxidase and Cholinesterase Inhibitor Wolfgang Kluge, Viktoria Stelzhammer and
Orly Weinreb, Tamar Amit, Orit Bar-Am and Hendrik Wesseling
Moussa B.H. Youdim
Stem Cell Models for Biomarker Discovery in
Novel MAO-B Inhibitors: Potential Therapeutic Brain Disease
Use of the Selective MAO-B Inhibitor PF9601N Alan Mackay-Sim, George Mellick and Stephen
in Parkinson’s Disease Wood
Mercedes Unzeta and Elisenda Sanz
The Application of Multiplexed Assay Systems for
INDEX Molecular Diagnostics
Emanuel Schwarz, Nico J.M. VanBeveren,
Paul C. Guest, Rauf Izmailov and
Volume 101 Sabine Bahn
General Overview: Biomarkers in Neuroscience Algorithm Development for Diagnostic Bio-
Research marker Assays
Michaela D. Filiou and Christoph W. Turck Rauf Izmailov, Paul C. Guest, Sabine Bahn and
Emanuel Schwarz
Imaging Brain Microglial Activation Using
Positron Emission Tomography and Translocator Challenges of Introducing New Biomarker Prod-
Protein-Specific Radioligands ucts for Neuropsychiatric Disorders into the
David R.J. Owen and Paul M. Matthews Market
The Utility of Gene Expression in Blood Cells for Sabine Bahn, Richard Noll, Anthony Barnes,
Diagnosing Neuropsychiatric Disorders Emanuel Schwarz and Paul C. Guest
Christopher H. Woelk, Akul Singhania, Josué Toward Personalized Medicine in the Neuropsy-
Pérez-Santiago, Stephen J. Glatt and Ming chiatric Field
T. Tsuang Erik H.F. Wong, Jayne C. Fox, Mandy
Proteomic Technologies for Biomarker Studies in Y.M. Ng and Chi-Ming Lee
Psychiatry: Advances and Needs Clinical Utility of Serum Biomarkers for Major
Daniel Martins-de-Souza, Paul C. Guest, Psychiatric Disorders
Natacha Vanattou-Saifoudine, Laura W. Harris Nico J.M. van Beveren and Witte
and Sabine Bahn J.G. Hoogendijk
Converging Evidence of Blood-Based Biomarkers
The Future: Biomarkers, Biosensors, Neu-
for Schizophrenia: An update
roinformatics, and E-Neuropsychiatry
Man K. Chan, Paul C. Guest, Yishai Levin,
Christopher R. Lowe
Yagnesh Umrania, Emanuel Schwarz, Sabine Bahn
and Hassan Rahmoune SUBJECT INDEX
Volume 102 Neurotrophic Factors and Peptides on the Whole

Body Hyperthermia-Induced Neurotoxicity:
The Function and Mechanisms of Nurr1 Action in Modulatory Roles of Co-morbidity Factors and
Midbrain Dopaminergic Neurons, from Develop- Nanoparticle Intoxication
ment and Maintenance to Survival Hari Shanker Sharma, Aruna Sharma, Herbert
Yu Luo Mössler and Dafin Fior Muresanu
Monoclonal Antibodies as Novel Neurotherapeutic Alzheimer’s Disease and Amyloid: Culprit or
Agents in CNS Injury and Repair Coincidence?
Aruna Sharma and Hari Shanker Sharma Stephen D. Skaper
The Blood–Brain Barrier in Alzheimer’s Disease: Vascular Endothelial Growth Factor and Other
Novel Therapeutic Targets and Nanodrug Angioglioneurins: Key Molecules in Brain
delivery Development and Restoration
Hari Shanker Sharma, Rudy J. Castellani, Mark José Vicente Lafuente, Naiara Ortuzar, Harkaitz
A. Smith and Aruna Sharma Bengoetxea, Susana Bulnes and Enrike G. Argandoña
Neurovascular Aspects of Amyotrophic Lateral INDEX
Sclerosis
Maria Carolina O. Rodrigues, Diana G.
Hernandez-Ontiveros, Michael K. Louis, Alison
Volume 103
E. Willing, Cesario V. Borlongan, Paul R. Sanberg, Lost and Found in Behavioral Informatics
Júlio C. Voltarelli and Svitlana Garbuzova-Davis Melissa A. Haendel and Elissa J. Chesler
Quercetin in Hypoxia-Induced Oxidative Stress: Biological Databases for Behavioral Neurobiology
Novel Target for Neuroprotection Erich J. Baker
Anand Kumar Pandey, Ranjana Patnaik, Dafin
A Survey of the Neuroscience Resource Land-
F. Muresanu, Aruna Sharma and Hari Shanker
scape: Perspectives from the Neuroscience Infor-
Sharma
mation Framework
Environmental Conditions Modulate Neuro- Jonathan Cachat, Anita Bandrowski, Jeffery S. Grethe,
toxic Effects of Psychomotor Stimulant Drugs Amarnath Gupta, Vadim Astakhov, Fahim Imam,
of Abuse Stephen D. Larson, and Maryann E. Martone
Eugene A. Kiyatkin and Hari Shanker Sharma
The Neurobehavior Ontology: An Ontology for
Central Nervous Tissue Damage after Hypoxia Annotation and Integration of Behavior and
and Reperfusion in Conjunction with Cardiac Behavioral Phenotypes
Arrest and Cardiopulmonary Resuscitation: Georgios V. Gkoutos, Paul N. Schofield, and
Mechanisms of Action and Possibilities for Robert Hoehndorf
Mitigation
Ontologies for Human Behavior Analysis and
Lars Wiklund, Cecile Martijn, Adriana Miclescu,
Their Application to Clinical Data
Egidijus Semenas, Sten Rubertsson and Hari
Janna Hastings and Stefan Schulz
Shanker Sharma
Text-Mining and Neuroscience
Interactions Between Opioids and Anabolic Kyle H. Ambert and Aaron M. Cohen
Androgenic Steroids: Implications for the
Development of Addictive Behavior Applying In Silico Integrative Genomics to
Fred Nyberg and Mathias Hallberg Genetic Studies of Human Disease: A Review
Scott F. Saccone
Neurotrophic Factors and Neurodegenerative
Diseases: A Delivery Issue SUBJECT INDEX
Barbara Ruozi, Daniela Belletti, Lucia Bondioli,
Alessandro De Vita, Flavio Forni, Maria Angela Volume 104
Vandelli and Giovanni Tosi
Cross Species Integration of Functional Genomics
Neuroprotective Effects of Cerebrolysin, a Experiments
Combination of Different Active Fragments of Jeremy J. Jay
Model Organism Databases in Behavioral Rho Signaling and Axon Regeneration

Neuroscience L. McKerracher, Gino B. Ferraro, and Alyson
Mary Shimoyama, Jennifer R. Smith, E. Fournier
G. Thomas Hayman, Victoria Petri, and
Neuron-Intrinsic Inhibitors of Axon Regenera-
Rajni Nigam
tion: PTEN and SOCS3
Accessing and Mining Data from Large-Scale Xueting Luo and Kevin K. Park
Mouse Phenotyping Projects INDEX
Hugh Morgan, Michelle Simon, and Ann-Marie
Mallon
Bioinformatics Resources for Behavior Studies Volume 106

in the Laboratory Mouse
Carol J. Bult Neurotrophic Factors and the Regeneration of
Adult Retinal Ganglion Cell Axons
Using Genome-Wide Expression Profiling to Alan R. Harvey, Jacob Wei Wei Ooi, and Jennifer
Define Gene Networks Relevant to the Study Rodger
of Complex Traits: From RNA Integrity to
Network Topology MBS: Signaling Endosomes and Growth Cone
M.A. O’Brien, B.N. Costin, and M.F. Miles Motility in Axon Regeneration
Michael B. Steketee and Jeffrey L. Goldberg
Genetic and Molecular Network Analysis of
Behavior Intrinsic Mechanisms Regulating Axon Regener-
Robert W. Williams and Megan K. Mulligan ation: An Integrin Perspective
Richard Eva, Melissa R. Andrews, Elske H.P.
Large-Scale Neuroinformatics for In Situ Hybrid- Franssen, and James W. Fawcett
ization Data in the Mouse Brain
Lydia L. Ng, Susan M. Sunkin, David Feng, The Role of Serotonin in Axon and Dendrite
Chris Lau, Chinh Dang, and Michael J. Hawrylycz Growth
Ephraim F. Trakhtenberg and Jeffrey L. Goldberg
Opportunities for Bioinformatics in the Classifica-
tion of Behavior and Psychiatric Disorders Inflammatory Pathways in Spinal Cord Injury
Elissa J. Chesler and Ryan W. Logan Samuel David, Juan Guillermo Zarruk, and Nader
Ghasemlou
SUBJECT INDEX
Combinatorial Therapy Stimulates Long-Distance
Regeneration, Target Reinnervation, and Partial
Volume 105 Recovery of Vision After Optic Nerve Injury in
Mice
Optic Nerve Disease and Axon Pathophysiology Silmara de Lima, Ghaith Habboub, and Larry I.
Alireza Ghaffarieh and Leonard A. Levin Benowitz
Role of Electrical Activity of Neurons for From Bench to Beside to Cure Spinal Cord
Neuroprotection Injury: Lost in Translation?
Takeshi Morimoto Andreas Hug and Norbert Weidner
Molecular Control of Axon Growth: Insights SUBJECT INDEX
from Comparative Gene Profiling and High-
Throughput Screening
Murray G. Blackmore
Gatekeeper Between Quiescence and Differentia-
Volume 107
tion: p53 in Axonal Outgrowth and Neurogenesis Neuromodulation: A More Comprehensive Con-
Giorgia Quadrato and Simone Di Giovanni cept Beyond Deep Brain Stimulation
Clement Hamani and Elena Moro
Cyclin-Dependent Kinase 5 in Axon Growth and
Regeneration Computational Models of Neuromodulation
Tao Ye, Amy K. Y. Fu, and Nancy Y. Ip Christopher R. Butson
Neurophysiology of Deep Brain Stimulation Bone Marrow Mesenchymal Stem Cell Trans-
Manuela Rosa, Gaia Giannicola, Sara Marceglia, plantation for Improving Nerve Regeneration
Manuela Fumagalli, Sergio Barbieri, and Alberto Priori Júlia Teixeira Oliveira, Klauss Mostacada, Silmara
de Lima, and Ana Maria Blanco Martinez
Neurophysiology of Cortical Stimulation
Jean-Pascal Lefaucheur Perspectives of Employing Mesenchymal Stem
Cells from the Wharton’s Jelly of the Umbilical
Neural Mechanisms of Spinal Cord Stimulation
Cord for Peripheral Nerve Repair
Robert D. Foreman and Bengt Linderoth
Jorge Ribeiro, Andrea Gartner, Tiago Pereira,
Magnetoencephalography and Neuromodulation Raquel Gomes, Maria Ascensão Lopes,
Alfons Schnitzler and Jan Hirschmann Carolina Gonçalves, Artur Varejão, Ana Lúcia
Luı´s, and Ana Colette Maurıćio
Current Challenges to the Clinical Translation of
Brain Machine Interface Technology Adipose-Derived Stem Cells and Nerve Regener-
Charles W. Lu, Parag G. Patil, and Cynthia A. ation: Promises and Pitfalls
Chestek Alessandro Faroni, Giorgio Terenghi, and
Adam J. Reid
Nanotechnology in Neuromodulation
Russell J. Andrews The Pros and Cons of Growth Factors and Cyto-
kines in Peripheral Axon Regeneration
Optogenetic Neuromodulation
Lars Klimaschewski, Barbara Hausott, and Doychin
Paul S. A. Kalanithi and Jaimie M. Henderson
N. Angelov
Diffusion Tensor Imaging and Neuromodulation:
Role of Inflammation and Cytokines in Peripheral
DTI as Key Technology for Deep Brain
Nerve Regeneration
Stimulation
P. Dubový, R. Jancˇálek, and T. Kubek
Volker Arnd Coenen, Thomas E. Schlaepfer, Niels
Allert, and Burkhard Mädler Ghrelin: A Novel Neuromuscular Recovery Pro-
moting Factor?
DBS and Electrical Neuro-Network Modulation
Raimondo Stefania, Ronchi Giulia, Geuna Stefano,
to Treat Neurological Disorders
Pascal Davide, Reano Simone, Filigheddu Nicoletta,
Amanda Thompson, Takashi Morishita, and
and Graziani Andrea
Michael S. Okun
Neuregulin 1 Role in Schwann Cell Regulation
Neuromodulation in Psychiatric Disorders
and Potential Applications to Promote Peripheral
Yasin Temel, Sarah A. Hescham, Ali Jahanshahi,
Nerve Regeneration
Marcus L. F. Janssen, Sonny K. H. Tan, Jacobus
Giovanna Gambarotta, Federica Fregnan, Sara
J. van Overbeeke, Linda Ackermans, Mayke
Gnavi, and Isabelle Perroteau
Oosterloo, Annelien Duits, Albert F. G. Leentjens,
and LeeWei Lim Extracellular Matrix Components in Peripheral
Nerve Regeneration
Ethical Aspects of Neuromodulation
Francisco Gonzalez-Perez, Esther Udina, and
Christiane Woopen
Xavier Navarro
SUBJECT INDEX
SUBJECT INDEX
Volume 108
Tissue Engineering and Regenerative Medicine:
Volume 109
Past, Present, and Future The Use of Chitosan-Based Scaffold to Enhance
António J. Salgado, Joaquim M. Oliveira, Albino Regeneration in the Nervous System
Martins, Fábio G. Teixeira, Nuno A. Silva, Sara Gnavi, Christina Barwig, Thomas Freier,
Nuno M. Neves, Nuno Sousa, and Rui L. Reis Kirsten Haarstert-Talini, Claudia Grothe, and
Stefano Geuna
Tissue Engineering and Peripheral Nerve Recon-
struction: An Overview Interfaces with the Peripheral Nerve for the Con-
Stefano Geuna, S. Gnavi, I. Perroteau, trol of Neuroprostheses
Pierluigi Tos, and B. Battiston Jaume del Valle and Xavier Navarro
The Use of Shock Waves in Peripheral Nerve The Neuropathology of Neurodegeneration with
Regeneration: New Perspectives? Brain Iron Accumulation
Thomas Hausner and Antal Nógrádi Michael C. Kruer
Phototherapy and Nerve Injury: Focus on Muscle Imaging of Iron
Response Petr Dusek, Monika Dezortova, and Jens Wuerfel
Shimon Rochkind, Stefano Geuna, and Asher
The Role of Iron Imaging in Huntington’s Disease
Shainberg
S.J.A. van den Bogaard, E.M. Dumas, and
Electrical Stimulation for Promoting Peripheral R.A.C. Roos
Nerve Regeneration
Lysosomal Storage Disorders and Iron
Kirsten Haastert-Talini and Claudia Grothe
Jose Miguel Bras
Role of Physical Exercise for Improving Post-
Manganese and the Brain
traumatic Nerve Regeneration
Karin Tuschl, Philippa B. Mills, and Peter T. Clayton
Paulo A.S. Armada-da-Silva, Cátia Pereira,
SandraAmado, and António P. Veloso Update on Wilson Disease
Aggarwal Annu and Bhatt Mohit
The Role of Timing in Nerve Reconstruction
Lars B. Dahlin An Update on Primary Familial Brain Calcification
R.R. Lemos, J.B.M.M. Ferreira, M.P. Keasey,
Future Perspectives in Nerve Repair and
and J.R.M. Oliveira
Regeneration
Pierluigi Tos, Giulia Ronchi, Stefano Geuna, and INDEX
Bruno Battiston
INDEX
Volume 111
Volume 110 History of Acupuncture Research
Yi Zhuang, Jing-jing Xing, Juan Li, Bai-Yun Zeng,
The Relevance of Metals in the Pathophysiology of and Fan-rong Liang
Neurodegeneration, Pathological Considerations
Effects of Acupuncture Needling with Specific
Kurt A. Jellinger
Sensation on Cerebral Hemodynamics and
Pantothenate Kinase-Associated Neurodegener- Autonomic Nervous Activity in Humans
ation (PKAN) and PLA2G6-Associated Neuro- Kouich Takamoto, Susumu Urakawa, Kazushige
degeneration (PLAN): Review of Two Major Sakai, Taketoshi Ono, and Hisao Nishijo
Neurodegeneration with Brain Iron Accumula-
Acupuncture Point Specificity
tion (NBIA) Phenotypes
Jing-jing Xing, Bai-Yun Zeng, Juan Li, Yi Zhuang,
Manju A. Kurian and Susan J. Hayflick
and Fan-rong Liang
Mitochondrial Membrane Protein-Associated
Acupuncture Stimulation Induces Neurogenesis
Neurodegeneration (MPAN)
in Adult Brain
Monika Hartig, Holger Prokisch, Thomas Meitinger,
Min-Ho Nam, Kwang Seok Ahn, and Seung-Hoon
and Thomas Klopstock
Choi
BPAN: The Only X-Linked Dominant NBIA
Acupuncture and Neurotrophin Modulation
Disorder
Marzia Soligo, Stefania Lucia Nori, Virginia Protto,
T.B. Haack, P. Hogarth, A. Gregory, P. Prokisch,
Fulvio Florenzano, and Luigi Manni
and S.J. Hayflick
Acupuncture Stimulation and Neuroendocrine
Neuroferritinopathy
Regulation
M.J. Keogh, C.M. Morris, and P.F. Chinnery
Jung-Sheng Yu, Bai-Yun Zeng, and
Aceruloplasminemia: An Update Ching-Liang Hsieh
Satoshi Kono
Current Development of Acupuncture Research
Therapeutic Advances in Neurodegeneration with in Parkinson’s Disease
Brain Iron Accumulation Bai-Yun Zeng, Sarah Salvage, and
Giovanna Zorzi and Nardo Nardocci Peter Jenner
Acupuncture Therapy for Stroke Patients Genetic Susceptibility and Neurotransmitters in

Xin Li and Qiang Wang Tourette Syndrome
Peristera Paschou, Thomas V. Fernandez,
Effects of Acupuncture Therapy on
Frank Sharp, Gary A. Heiman, and
Alzheimer’s Disease
Pieter J. Hoekstra
Bai-Yun Zeng, Sarah Salvage, and
Peter Jenner Pharmacological Animal Models of Tic Disorders
Kevin W. McCairn and Masaki Isoda
Acupuncture Therapy for Psychiatric Illness
Karen Pilkington Animal Models Recapitulating the Multifactorial
Origin of Tourette Syndrome
Acupuncture for the Treatment of Insomnia
Simone Macrì, Martina Proietti Onori, Veit
Kaicun Zhao
Roessner, and Giovanni Laviola
Acupuncture for the Treatment of Drug
Neuroendocrine Aspects of Tourette Syndrome
Addiction
Davide Martino, Antonella Macerollo, and
Cai-Lian Cui, Liu-Zhen Wu, and Yi-jing Li
James F. Leckman
Acupuncture Regulation of Blood Pressure:
Clinical Pharmacology of Dopamine-Modulating
Two Decades of Research
Agents in Tourette’s Syndrome
John C. Longhurst and Stephanie Tjen-A-Looi
Sabine Mogwitz, Judith Buse, Stefan Ehrlich, and
Effect and Mechanism of Acupuncture on Veit Roessner
Gastrointestinal Diseases
Clinical Pharmacology of Nondopaminergic
Toku Takahashi
Drugs in Tourette Syndrome
INDEX Andreas Hartmann
Antiepileptic Drugs and Tourette Syndrome
Volume 112 Andrea E. Cavanna and Andrea Nani
An Introduction to the Clinical Phenomenology Clinical Pharmacology of Comorbid Obsessive–
of Tourette Syndrome Compulsive Disorder in Tourette Syndrome
Davide Martino, Namrata Madhusudan, Panagiotis Valeria Neri and Francesco Cardona
Zis, and Andrea E. Cavanna
Clinical Pharmacology of Comorbid Attention
Functional Neuroanatomy of Tics Deficit Hyperactivity Disorder in Tourette
Irene Neuner, Frank Schneider, and N. Jon Shah Syndrome
Renata Rizzo and Mariangela Gulisano
Functional Imaging of Dopaminergic Neurotrans-
mission in Tourette Syndrome Emerging Treatment Strategies in Tourette
Bàrbara Segura and Antonio P. Strafella Syndrome: What’s in the Pipeline?
C. Termine, C. Selvini, G. Rossi, and
Nondopaminergic Neurotransmission in the
U. Balottin
Pathophysiology of Tourette Syndrome
Patrick T. Udvardi, Ester Nespoli, Francesca Rizzo, Tics and Other Stereotyped Movements as Side
Bastian Hengerer, and Andrea G. Ludolph Effects of Pharmacological Treatment
Marcos Madruga-Garrido and Pablo Mir
Reinforcement Learning and Tourette Syndrome
Stefano Palminteri and Mathias Pessiglione INDEX

Baker. The Social Skills Picture Book

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Baker. The Social Skills Picture Book

Uploaded by

Copyright:

Available Formats

INTERNATIONAL

First edition 2013

Copyright © 2013, Elsevier Inc. All Rights Reserved

No part of this publication may be reproduced, stored in a retrieval system

For information on all Academic Press publications

Printed and bound in USA

throughout brain development. One striking finding from the genomics

Autism Spectrum Disorder

International Review of Neurobiology, Volume 113 # 2013 Elsevier Inc. 1

Unlike the cerebral cortex, the cytoarchitecture of the cerebellar cortex

2012; Stoodley & Schmahmann, 2009). This provides a framework for

3. ASD SYMPTOMS IN PATIENTS WITH CEREBELLAR

followed by reduced prefrontal volume and an approximately 40-fold

4. MOTOR IMPAIRMENT IN AUTISTIC INDIVIDUALS

Table 1.1 Cerebellar motor impairments in ASD

5. CEREBELLAR PATHOLOGY IN AUTISM

(Allen, 2005; Bauman & Kemper, 2005; Whitney, Kemper, Bauman,

6. CEREBELLAR DIFFERENCES IN AUTISM: STRUCTURAL

Figure 1.3 Activation likelihood estimate (ALE) meta-analysis revealing GM differences

fronto-parietal cognitive control networks (Buckner et al., 2011). GM

7. ABNORMAL CEREBELLAR ACTIVATION IN AUTISM

bilaterally in lobule VIII (Paakki et al., 2010). Based on resting-state studies

in the right cerebellar hemisphere and verbal fluency scores (Kleinhans,

8. AUTOIMMUNE STUDIES IN ASD IMPLICATING

cerebellar proteins might be a cause of ASD. However, it is unclear which

9. AUTISM GENES IN MOUSE CEREBELLAR

of PC migration and dendritic differentiation (Park & Curran, 2008; Sweet,

Furthermore, rare variants in the human GABRB3 have been associated

10. CEREBELLAR PHENOTYPES IN RODENT MODELS

dramatic developmental increases in expression in the cerebellum during the

some cortical and hippocampal neurons (Albrecht et al., 1997; Dindot,

11. FUNCTIONAL EVIDENCE FROM MOUSE GENETICS

lacking CAPS2, a protein involved in neurotrophin release. Journal of Neuroscience,

Contribution of Long Noncoding

Projects aiming to characterize all of the functional elements in the mamma-

International Review of Neurobiology, Volume 113 # 2013 Elsevier Inc. 35

than 2% of the mammalian genome codes for proteins, a majority of what

Lührmann, & Tuschl, 2002). Endogenous siRNAs (endo-siRNAs) in

3. LncRNA IN FUNDAMENTAL GENETIC MECHANISMS

Table 2.1 LncRNAs implicated in neurodevelopmental and neurodegenerative

by introducing a targeted deletion of Xist into a single allele. Following dif-

5. LncRNAs IN THE BRAIN

5.1. Brain development and function

Abnormalities in these processes have been implicated in several neu-

regulating alternative splicing (Tripathi et al., 2010). This is particularly rel-

Kazantseva, Aid, Palm, & Timmusk, 2007). In neocortical regions of brain

5.2. Neurodegenerative diseases

5.3. Neurodevelopmental disorders

UBE3A-ATS is an lncRNA antisense to UBE3A within the 15q11–13

been implicated in SZ (Eastwood & Harrison, 2006; Impagnatiello et al.,

6. LncRNAs CONTRIBUTE TO ASD

androgen-responsive, suggesting a gender-specific component (Hu, 2013;

MSNP1AS: Chr 5p14.1 transcribed 3.9 kb non-coding anti-sense RNA

variants of autism spectrum disorders: Evidence for circadian rhythm dysfunction in

Identifying Essential Cell Types

International Review of Neurobiology, Volume 113 # 2013 Elsevier Inc. 61

1. INTRODUCTION TO CELL TYPES AND AUTISM

MECP2, and TSC1 or 2, respectively). Some of these genes have been

3. BRIEF REVIEW OF RODENT BEHAVIORAL ASSAYS

communicative behavior, as well as resistance to change, can be operation-

communication (Arakawa, Blanchard, Arakawa, Dunlap, & Blanchard,

4. ASD MODELS INVOLVING SEROTONERGIC NEURONS

the use of selective serotonin reuptake inhibitors (SSRIs) in the treatment of