You are on page 1of 3

AJB Advance Article published on July 26, 2010, as 10.3732/ajb.1000170.

The latest version is at http://www.amjbot.org/cgi/doi/10.3732/ajb.1000170


American Journal of Botany: e000–e000. 2010.

AJB Primer Notes & Protocols in the Plant Sciences

DEVELOPMENT OF MICROSATELLITE MARKERS IN LUPINUS


LUTEUS (FABACEAE) AND CROSS-SPECIES AMPLIFICATION
IN OTHER LUPINE SPECIES1

Lorena B. Parra Gonzalez2, Shannon C. K. Straub3, Jeff J. Doyle3,


Paula E. Mora Ortega2, Haroldo E. Salvo Garrido2,4, and Iván J. Maureira Butler2,5
2Agro Aquaculture Nutritional Genomic Center (CGNA), Plant Biotechnology Unit INIA-Carillanca P.O. Box 58-D, Temuco,
Chile; 3L.H. Bailey Hortorium, Department of Plant Biology, Cornell University, 412 Mann Library, Ithaca, New York 14853
USA; 4Institute of Agricultural Research (INIA), P.O. Box 58-D, Temuco, Chile

• Premise of the study: Microsatellite primers were developed in Lupinus luteus L., an emerging temperate protein crop, to in-
vestigate genetic diversity, population structure, and to facilitate the generation of better yellow lupine varieties.
• Methods and Results: Thirteen polymorphic primer sets were evaluated in a European and Eastern European accession collec-
tion of L. luteus. The primers amplified di-, tri-, and tetranucleotide repeats with 2–4 alleles per locus. These revealed a moder-
ate to low level of genetic variation, as indicated by an average observed heterozygosity of 0.0126. Select loci also amplified
successfully in the closely related species L. hispanicus Boiss. & Reut. and in the New World species L. mutabilis Sweet.
• Conclusions: These results indicate the utility of primers for the study of genetic diversity across L. luteus populations and
related lupine species. The use of these microsatellite markers will facilitate the implementation of several molecular breeding
strategies in yellow lupine.

Key words: Lupinus hispanicus; Lupinus luteus; Lupinus mutabilis; protein crop.

Lupinus luteus L. (Fabaceae) belongs to a large and diverse abundance in plant genomes make them an ideal marker sys-
genus comprising more than 200 annual and perennial herba- tem for high throughput genotyping and germplasm charac-
ceous species growing in a wide range of climatic and soil con- terization (Varshney et al., 2005). To date, few studies have
ditions (Drummond, 2008). It is widely distributed across the reported the use of molecular markers in lupine species.
Mediterranean region, but it is not clear how much of this range Most of the efforts have been focused on the generation of
is native, and how much involves naturalization due to human molecular markers and genetic maps of L. angustifolius
cultivation (Petterson et al., 1998). Lupinus luteus possesses a (Nelson et al., 2006) and L. albus (Phan et al., 2007). There
mixed mating system with outcrossing rates of up to 40% are no reports of development and use of molecular markers
(Wallace et al., 1954). Several Lupinus species are cultivated in populations of L. luteus, L. hispanicus Boiss. & Reut. (the
and used as human food or animal feed. The major cultivated closest and still interfertile sister species of yellow lupine;
species are the narrow-leaved lupine (L. angustifolius L.), white Swiecicki et al., 1999), and L. mutabilis (the only lupine cul-
lupine (L. albus L.), yellow lupine (L. luteus), and tarwi or cho- tivated in the New World; Petterson et al., 1998). In this study,
cho (L. mutabilis Sweet) (Petterson et al., 1998). Yellow lupine we report the isolation and characterization of 14 polymor-
seeds have the highest protein content and twice the cysteine phic SSR loci (13 sets of primers) generated from the ge-
and methionine content of most other lupines (Glencross et al., nome of L. luteus. Additionally, these loci were tested for
2004). However, despite its highly nutritional qualities, there is cross-amplification in L. hispanicus and L. mutabilis.
a lack of genetic and molecular tools to aid the genetic breeding
of this species.
Microsatellite (simple sequence repeats, SSR) markers METHODS AND RESULTS
are well known for their versatility as molecular tools for
genetic analysis. Their high reproducibility, low cost, and Genomic DNA from one L. luteus individual was used to construct a DNA
library enriched for various di-, tri-, and tetranucleotide repeats following
Dopman et al. (2004). Colonies positive for a microsatellite-containing insert
1 were lysed and 1 ml used as a template for cycle sequencing using BigDye
Manuscript received 13 May 2010; revision accepted 12 June 2010.
Terminator v3.1 chemistry (Applied Biosystems, Carlsbad, CA). Products puri-
The authors thank Steven M. Bogdanowicz, Evolutionary Genetics fied by ethanol precipitation were sequenced on 3730 DNA Analyzers (Applied
Core Facility, Department of Ecology and Evolutionary Biology, Cornell Biosystems) at the Life Sciences Core Laboratories Center at Cornell University.
University, for his academic and technical support during the repeat- Sequences were visualized and unique microsatellite containing sequences
enriched L. luteus library construction. This research was funded by identified using Sequencher 4.7 (Gene Codes, Ann Arbor, MI). Flanking prim-
the National Commission for Scientific & Technological Research ers were designed for each microsatellite using the program Primer 3 Version
(FONDECYT Project No.1080520), Chile. 3.12 (Rozen and Skaletsky, 2000) and oligonucleotides were synthesized by
5 Author for correspondence: ivan.maureira.butler@cgna.cl
Sigma Genosys (Sigma Aldrich, St. Louis, MO).
Eighty-five individuals belonging to a Lupinus luteus core collection were
doi:10.3732/ajb.1000170 used for microsatellite genotyping. The collection includes accessions for Poland,

American Journal of Botany: e1–e3, 2010; http://www.amjbot.org/ © 2010 Botanical Society of America
e1

Copyright 2010 by the Botanical Society of America


e2 American Journal of Botany [Vol. 0

Table 1. Characteristics of 13 genomic microsatellite primers developed in Lupinus luteus. Shown for each primer pair are the forward and reverse
sequence, repeat type, allele range size (bp), number of alleles (and cross-amplification), annealing temperature when run individually (Ta), observed
heterozygosity, and the GenBank accession number. All values are based on 85 samples representing European and Eastern European accessions.

Allele range Observed


Primer Sequence Repeat size (bp) No. of allelesb Ta(C) heterozygosity GenBank

Lup_P1A11 F: TCAATCAAGGAACCAAATAATGC (CAA)5 263–266 2 55 0.0235 HM193909


R: CTTTCAAATGTAATCAACTCCAAT
Lup_P1B02 F: ATTGATAAATTGCAAGGAAGATGG (CAA)6 281–284 2 h(2),m 50 0.0000 HM193910
R: AACCACTATGCATCATTTATATTATA
Lup_P1C01 F: TTCTCCTCACGCCCTATTACATGA (GAA)7 333–339 2 60 0.0118 HM193911
R: CGAAAATATATTGCAGAAGGTGG
Lup_P1C02 F: GTTTCCACCAAATTCATCATAACT (GAA)9 320–329 3 55 0.0235 HM193912
R: CAAATTTAAAAACAAAATCTCACATACA
Lup_P1D05 F: TTGACGTGACCCACTTCATTGT (GTT)6 gtggttgct 358–361 2 h(2),m 55 0.0000 HM193913
R: GAGAGCGTTAAAGCAAGGGCTG (GTT)6
Lup_P2C09 F: CATATGCTTTTAACCAACAAG (GAA)9 ggagaagga 365–371 3 h(1) 55 0.0000 HM193914
R: AAACAACCTCTCCACTTGC (GAA)19
Lup_P2D05 F: GAACTGGGTTGGATTAGTAG (CAA)5 283–286 2 h(1),m 55 0.0000 HM193915
R: GGTTCAAGAATTCACTGG
Lup_P8C06 F: CTATTGCCCTCCCGCTGTTC (CAA)6 138–141 2 h(1),m 60 0.0000 HM193916
R: CAATGTCGAATCATCAGACCC
Lup_CT067 F: GTTTCCACACTCCATTTCAG (AT)10 gca (CT)16 168–172 3 55 0.0471 HM193917
R: CATATCCATGAAAACATAGCC
Lup_CT156 F: CCACAAAATCCATTCATTCTC (TA)2 ttca (TA)6 266–270 2 h(1) 55 0.0000 HM193918
R: GGTTCCAAGTTTAATCCCA
Lup_CT38Aa F: GTCACATTCTGATTGTAGC (CAA)20 257–260 2 h,m 55 0.0235 HM193919
Lup_CT38Ba R: TCCAACTTCTTTTGGTCC 247–253 3 h,m 0.0118
Lup_CT12760 F: TGACACAATCCTCAACGCTC (AAAC)5 198–266 4 60 0.0000 HM193920
R: GGAACGATCTAAGCCATCCA
Lup_CT20380 F: ATACACTTTCCCATCGCCAC (CAT)6 ggtgttcatg 162–192 3h 60 0.0353 HM193921
R: GCTGCAGAAAGTGAGCAGAA (ATC)6
a Marker Lup_CT38 amplified two distinct bands and were annotated as loci A and B.
b Positive cross-amplification using L. hispanicus and L. mutabilis samples are denoted by the letters h and m, respectively. Number of DNA fragments
(band size) shared between L. luteus and L. hispanicus are shown within parentheses.

Ukraine, the former Soviet Union, Spain, Germany, Morocco, Belarus, Portugal, for cross-amplification in two other Lupinus species. Nine loci amplified in L. his-
Netherlands, Israel, and Hungary. Polish accessions were kindly provided by panicus, and several DNA fragments showed similar or identical allele sizes to
W. K. Swiecicki, Institute of Plant Genetics, Polish Academy of Sciences, Poznan, those observed in L. luteus (Table 1). Only six loci amplified in L. mutabilis. The
Poland. The rest were obtained from the Western Regional PI Station, USDA, lower success rate for amplification in L. mutabilis vs. L. hispanicus might have
ARS, WRPIS, Washington State University, Regional Plant Introduction Station, been predicted given the close genetic relationship between L. luteus and L. hispani-
Pullman, Washington, USA (Appendix S1). The cross-amplification of these cus and the earlier divergence between New and Old World lupines (Drummond,
SSR primer pairs was determined with six accessions each of L. hispanicus and 2008). The low proportion of polymorphic SSR markers revealed low levels of
L. mutabilis, all obtained from the Western Regional PI Station, USDA, ARS, genetic variation for L. luteus. This behavior has been reported before in other lu-
WRPIS. DNA was extracted using CTAB buffer according to the method of pine species such as L. angustifolius (Annicchiarico and Carroni, 2009) and L. poly-
Doyle and Doyle (1987). The extracted DNA was quantified using a Synergy HT phyllus Lindl. (Käss and Wink, 1997).
Multimode Microplate Reader (Biotek Instruments, Winooski, VT) and diluted to
50 ng/μl by microliter in TE buffer (10 mM TRIS, 1 mM EDTA pH 7,5).
Amplification of SSR regions was performed in 20-μl PCR reactions containing CONCLUSIONS
100 ng of genomic DNA, 0.2 mM dNTPs, 2 mM MgCl2, 1× PCR buffer, 2.5%
DMSO, 1 U Taq polymerase (Agilent Technologies (formerly Stratagene), Santa
Clara, CA) and 5 pmoles of each reverse and forward SSR primer. PCRs were
The development of SSR markers is an important step in un-
performed in a Peltier thermal cycler (MJ Research, St. Bruno, Quebec, Canada) derstanding the genetic makeup of L. luteus. Assessment and uti-
using a touchdown protocol as follows: 94°C for 5 min; 5 cycles of 1 min at 94°C, lization of the variation contained within this species will facilitate
1 min at 55–65°C decreasing 1°C per cycle, 2 min at 72°C followed by 35 cycles of the breeding of better yielding varieties with higher nutritional
1 min at 94°C, 1 min at 50–60°C and 2 min at 72°C. A final extension at 72°C was value. Cross-species amplification in L. hispanicus and L. muta-
performed for 10 min. PCR products were separated on 6% denaturing polyacryl- bilis has opened an opportunity for comparative studies among
amide gels, run in TBE buffer at 60 watts for 3–4 hours and visualized using silver
stain procedures. Standard population genetics metrics were calculated using Pop-
these and other lupine species. In addition, the use of these mark-
Gene version 1.32 (http://www.ualberta.ca/~fyeh/index.htm). ers will facilitate the follow up introgression of favorable varia-
From 271 positive clones, 99 clearly showed microsatellite inserts. Ninety- tion from L. hispanicus (e.g., resistance to waterlogging, cold,
two primer pairs were designed and initially screened using eight L. luteus and diseases) into L. luteus.
accessions and two accessions each for L. hispanicus and L. mutabilis represent-
ing diversity across their geographic ranges. Only 13 (14%) SSR markers were
polymorphic among the L. luteus accessions. One marker, Lup_CT38, amplified LITERATURE CITED
two independent fragments and was scored as two polymorphic loci (Lup_CT38A
and Lup_CT38B). All polymorphic markers were screened against the 85 L. lu- Annicchiarico, P., and A. M. Carroni. 2009. Diversity of white and
teus accessions and six accessions each of L. hispanicus and L. mutabilis. narrow-leafed lupin genotype adaptive response across climatically-
All 14 analyzed loci showed allelic frequencies significantly deviating from ex- contrasting Italian environments and implications for selection.
pected Hardy–Weinberg proportions (P < 0.001). The 14 SSR loci were also tested Euphytica 166: 71–81.
August 2010] AJB Primer Notes & Protocols—LUPINUS LUTEUS genomic microsatellites e3

Dopman, E. B., S. M. Bogdanowicz, and R. G. Harrison. 2004. genes and conserved synteny with Medicago truncatula. Theoretical
Genetic mapping of sexual isolation between E and Z pheromone and Applied Genetics 113: 225–238.
strains of the European corn borer (Ostrinia nubilalis). Genetics 167: Petterson, D. S. 1998. Composition and food uses of lupins. In J. S.
301–309. Gladstones, C. A. Atkins, J. Hamblin [eds.], Lupins as crop plants:
Doyle, J. J., and J. L. Doyle. 1987. A rapid isolation procedure for small Biology, production and utilization, 353–384. CAB International,
quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. London, UK.
Drummond, C. S. 2008. Diversification of Lupinus (Leguminosae) in Phan, H. T., S. R. Ellwood, K. Adhikari, M. N. Nelson, and R. P.
the western New World: Derived evolution of perennial life history Oliver. 2007. The first genetic and comparative map of white lupin
and colonization of montane habitats. Molecular Phylogenetics and (Lupinus albus L.): Identification of QTLs for anthracnose resistance
Evolution 48: 408–421. and flowering time, and a locus for alkaloid content. DNA Research
Glencross, B. D., C. G. Carter, N. Duijster, D. R. Evans, K. Dods, 14: 59–70.
P. McCafferty, W. E. Hawkins, et al. 2004. A comparison of Rozen, S., and H. J. Skaletsky. 2000. Primer3 on the WWW for general
the digestibility of a range of lupin and soybean protein products users and for biologist programmers. In S. Krawetz and S. Misener
when fed to either Atlantic salmon (Salmo salar) or rainbow trout [eds.], Bioinformatics methods and protocols: Methods in molecular
(Oncorhynchus mykiss). Aquaculture (Amsterdam, Netherlands) 237: biology, 365–386. Humana Press, Totowa, New York, USA.
333–346. Swiecicki, W., W. K. Swiecicki, and T. Nijaki. 1999. Lupinus ×his-
Käss, E., and M. Wink. 1997. Phylogenetic relationships in the panicoluteus—An interspecific hybrid of Old World lupins. Acta
Papilionoideae (family Leguminosae) based on nucleotide sequences Societatis Botanicorum Poloniae 68: 217–220.
of cpDNA (rbcL) and ncDNA (ITS 1 and 2). Molecular Phylogenetics Varshney, R. K., A. Graner, and M. E. Sorrels. 2005. Genetic
and Evolution 8: 65–88. microsatellite markers in plants: Features and applications. Trends in
Nelson, M. N., H. T. Phan, S. R. Ellwood, P. N. Moolhuijzen, J. Biotechnology 23: 48–55.
Hane, A. Williams, C. E. O’Lone, et al. 2006. The first gene- Wallace, A. T., W. T. Hanson, and P. Decker. 1954. Natural crosspol-
based map of Lupinus angustifolius L.—Location of domestication lination in blue and yellow lupines. Agronomy Journal 46: 59–60.