Lakshman - Thesis PDF

MOLECULAR AND ULTRASTRUCTURAL
PATHOLOGY OF THIRAM (TMTD - TETRA METHYL THIURAM

DISULFIDE) INDUCED TIBIAL DYSCHONDROPLASIA (TD) IN
BROILERS
By
M. LAKSHMAN
M. V. Sc.,
THESIS SUBMITTED TO THE

SRI VENKATESWARA VETERINARY UNIVERSITY
IN PARTIAL FULFILMENT OF THE REQUIREMENTS
FOR THE AWARD OF THE DEGREE OF
DOCTOR OF PHILOSOPHY
(IN THE FACULTY OF VETERINARY SCIENCE)
DEPARTMENT OF VETERINARY PATHOLOGY

COLLEGE OF VETERINARY SCIENCE, TIRUPATI
SRI VENKATESWARA VETERINARY UNIVERSITY
TIRUPATI - 517 502
AUGUST, 2011
i
CERTIFICATE
Mr. M.LAKSHMAN has satisfactorily prosecuted the course of research
and that the thesis entitled “MOLECULAR AND ULTRASTRUCTURAL
PATHOLOGY OF THIRAM (TMTD - TETRA METHYL THIURAM
DISULFIDE) INDUCED TIBIAL DYSCHONDROPLASIA (TD) IN
BROILERS” submitted is the result of original research work and is of sufficiently
high standard to warrant its presentation to the examination. I also certify that the
thesis or part thereof has not been previously submitted by him for a degree of any
University.
Major Advisor
Date:
Place: Hyderabad (Dr. Y. ANJANEYULU)
Associate Professor
Department of Veterinary Pathology
College of Veterinary Science
Rajendranagar, Hyderabad-30.
ii
CERTIFICATE
This is to certify that the thesis entitled “MOLECULAR AND

ULTRASTRUCTURAL PATHOLOGY OF THIRAM (TMTD- TETRA
METHYL THIURAM DISULFIDE) INDUCED TIBIAL
DYSCHONDROPLASIA (TD) IN BROILERS” submitted in partial fulfillment of
the requirements for the degree of DOCTOR OF PHILOSOPHY of Sri
Venkateswara Veterinary University Tirupati, is a record of the bonafide research
work carried out by M. LAKSHMAN under our guidance and supervision. The
subject of the thesis has been approved by the Student Advisory Committee.
No part of this thesis has been submitted for any other degree or diploma.
the published part has been fully acknowledged. All assistance and help received
during the course of investigations have been duly acknowledged by the author of
the thesis.
(Dr. Y. ANJANEYULU)
Chairman of the Advisory Committee
Thesis approved by the Student’s Advisory Committee
CHAIRMAN: Dr. Y. ANJANEYULU __________________

Associate Professor
Department of Vety. Pathology
Rajendranagar, Hyderabad – 500 030.
MEMBER: Dr. Ch. SRILATHA __________________

Professor & University Head
Department of Vety. Pathology
Tirupati – 517 502.
MEMBER: Dr. T. S. CHANDRA SEKHARA RAO __________________

Dean, Faculty of Veterinary Science
Sri Venkateswara Veterinary University
MEMBER: Dr. D. SRINIVASULU __________________

Professor & University Head
Department of Vety. Microbiology
iii
ACKNOWLEDGEMENTS
It gives me immense pleasure to express my deep sense of reverence and gratitude to my
major advisor Dr. Y. Anjaneyulu, Associate Professor, Department of Veterinary Pathology,
College of Veterinary Science, Rajendranagar, Hyderabad, for his profound interest, valuable
guidance, concrete suggestions, constant encouragement and constrictive criticism in planning
and presentation of the investigation reported in this thesis.
I express my heartfelt gratitude and deep sense of reverence to member of my advisory
committee Dr. Ch. Srilatha, Professor and University Head, Department of Veterinary
Pathology, College of Veterinary Science, Tirupati for her inspiring and affectionate guidance,
unending benevolence and constant encouragement during my research.
I humbly place on record my heartfelt thanks to Dr. T. S. Chandrasekhar Rao, Associate
Dean, College of Veterinary Science, Tirupati, for his clear and concrete ideas at basic stage of
research.
I shall remain grateful to Dr. D. Srinivasulu, Professor and University Head,
Department of Veterinary Science, College of Veterinary Science, Tirupati, for his cordiality and
the help which is green in remembrance during my Ph.D. studies.
I am extremely thankful to Dr. M.R. Reedy, Principal Scientist and his team PDP,
Rajendranagar, Hyderabad, for their involvement and able guidance to carry out molecular
studies in their laboratory.
I express my sincere thanks to the Head Department of Pathology and staff of the
laboratory, SVIMS, Tirupati, for extension of their help to carry out Immunohistochemistry
work in their laboratory.
I am immensely thankful to Dr. Ch. Ramakrishna, Scientist, NRCM, Changicherla,
Hyderabad, for his co-operation to carry out histopathological studies in his laboratory.
I am very grateful to Dr. A. Anand Kumar, Associate Professor& Head and
Dr. M. Maduri, Associate Professor, Department of Pathology, College of veterinary Science,
Rajendranagar, Hyderabad for their support.
I humbly place my sincere gratitude to the staff of RUSKA Labs, College of Veterinary
Science, Rajendranagar, Hyderabad for their involvement to carry out the experiment of my
Ph.D. Research Project.
I am grateful to Dr. Krishna Kumar, Reader Loyola Degree College, Secundrabad and
Dr. P. Anand Kumar, Associate Professor and Head Department of Microbiology, NTR College
iv
of Veterinary Science Gannavaram, for their appropriate guidance in research and preparation
thesis manuscript.
I shall be ever thankful to Dr. S.T. Viroji Rao and Dr. Chinni Pritham, for their help to
carry out their statistical analysis of my research work.
I am extremely thankful to Dr. K. Sujatha, Dr. Shashidar Babu, and Dr. K. Sathish
Assistant Professors, Department Pathology, College of Veterinary Science, Tirupati, for their
co-operation during my course of study.
I take it is privilege to express my heartfelt thanks and gratitude to my beloved kids
Mekela Bharath, Rachana, and Yashvanth for their love and affection constant inspection
great tolerance at the inconvenience and co-operation extended during my Doctoral programme.
Rhetoric is not enough to express my gratitude and regards from my inner core of the
heart to my beloved wife late Smt. M. Malathi and my mother late Smt. M. Venkatamma for
their whole hearted co-operation, constant encouragement, unstinted patience, caring love &
affection and cheerfulness during my course work and I lost them before completion of my
research, hence I am dedicating this basic scientific material to committed scientific community
in the honor of my wife and mother. Which enable me to acquire the present qualification,
further I express my happiness and sincere thanks to my father M. Anjaiah for his constant
approach and taking care of kids during my research project and analysis of the data, in his
absence it would have not been possible to shape the thesis work.
I express my deep sense of reverence to my beloved friend whose cardial love, affection
and constant encouragement helped me to complete my Doctoral programme and brace the
difficult situations.
I am happy to express my sincere gratitude to Mr. M. Karimullah Technician,
Department of Pathology, for his help and co-operation.
I express my love and worm regards to my brothers, sisters, in-laws and relatives whose
affection and encouragement helped me in completion of present investigation.
I take this opportunity to convey my thanks to Mr. Srikanth palavai, for his help in
preparation of quality images in befitting manner.
I thank the Sri Venkateswara Veterinary University for extending financial support
that enabled me to complete my research work.
(M.LAKSHMAN)
v
DECLARATION
I M. Lakshman here by declare that the thesis entitled “MOLECULAR
AND ULTRASTRUCTURAL PATHOLOGY OF THIRAM (TMTD- TETRA
METHYL THIURAM DISULFIDE) INDUCED TIBIAL
DYSCHONDROPLASIA (TD) IN BROILERS” submitted to Sri Venkateswara
Veterinary University Tirupati, for the degree of DOCTOR OF PHILOSOPHY is
the result of original research work carried done by me. I also declare that the
materials contained in this thesis have not been published earlier.
Date: (M. LAKSHMAN)
LIST OF CONTENTS
vi
Chapt.
Title Page No.
No.
I INTRODUCTION 1-4
II REVIEW OF LITERATURE 5-36
2.1 Thiram (tetramethyl thiuram disulfide - TMTD) 5

2. 2 Tetramethyl thiuram disulfide (TMTD) induced tibial
6-8
dyschondroplasia (TD)
2. 3 Effect of TMTD on growth rate and egg production 8-10
2. 4 Tibial dyschondroplasia( TD) 10-12
2.5 Pathogenesis of tibial dyschondroplasia (TD) 12-15
2.6 Clinical signs of tibial dyschondroplasia (TD) 15-17
2.7 Hematological parameters in TMTD induced TD 17-18
2.8 Serum biochemical parameters in TMTD induced TD 18
2.8.1 Serum protein , glucose and cholesterol 18
2.8.2 Serum enzymes (ALP,ALT,AST and GGT) 19-20
2.8.3 Serum calcium and phosphorus in TMTD induced TD 20-21
2.9 Gross pathology of tibial dyschondroplasia (TD) 21-22
2.10 Histopathology in TMTD induced TD 22
2.10.1 Tibial bone growth plate cartilage (TGPC) 22-25
2.10.2 Liver and Kidney 25-26
2.11 Immunohistochemistry of tibial dyschondroplasia (TD) 26
2.12 Ultrastructural pathology tibial dyschondroplasia (TD) 28
2.13 Molecular pathology tibial dyschondroplasia (TD) 32-35
vii
Prevention of TD by addition of CuSo4 hepato protective
2.14 35-36
agents and toxin binder
III MATERIALS AND METHODS 37-49
3.1 Growth rate 38
3.2 Feed consumption and conversion ratio 38
3.3 Haematology 39
3.3.1 Collection of blood for haematological parameters 39
3.4 Serum biochemistry 39
3.4.1 Collection of blood for serum separation 39-40
3.4.2 Serum biochemistry 40
3.4.3 Serum enzymes and calcium 40
3.5 Morphometry of tibia, liver and kidneys 40
3.5.1 Weights of tibial bones , liver and kidneys 41
3.5.2 Length and diameter of tibial bones 41
3.6 Necropsy observations 41
3.7 Gross pathology of tibial bones, liver and kidneys 41
3.8 Histopathological studies 42

Histopathology employing Haematology and Eosin(H&
42
3.8.1 E) for tibial bone growth plate cartilage (TGPC), liver and
kidney
Histopathology of tibial bone growth rate cartilage
3.8.2 42-43
(TGPC), employing Koneff’s stain
3.9 Immunohistochemical studies 43
Immunohistochemistry of VEGF, VEGFR1, Bcl-2,
3.9.1 43-44
MMP2 and MMP3
3.10 Molecular pathology of tibial dyschondroplasia (TD) 45
Material collection for quantitative real time polymerase

3.10.1 45
chain reaction (QRT - PCR)
3.10.2 RNA isolation and reverse transcription ( RT) 46
viii
3.10.3 cDNA synthesis (for one reaction) 46
3.10.4 Real-Time PCR 47
3.11 Ultrastructural pathology of tibial dyschondroplasia (TD) 47

Transmission Electron Microscopy (TEM) of tibial bone
3.11.1 48
growth plate cartilage (TGPC), liver and kidney.
Scanning Electron Microscopy (TEM) of tibial bone
3.11.2 49
growth plate cartilage (TGPC), liver and kidney.
3.12 Statistical analysis 49
IV RESULTS 50-122
4.1 General observation and clinical signs 50
4.2 Mortality pattern 53
4.3 Body weight gains 53
4.4 Feed consumption and Feed conversion ratio (FCR) 53
4.5 Haematological parameters 53
4.5.1 Total erythrocyte count (TEC) 58
4.5.2 Haemoglobin concentration (Hb) 58
4.5.3 Packed cell volume (PCV) 58 & 61
4.5.4 Erythrocyte indices 61
4.5.4.1 Mean corpuscular value (MCV) 61
4.5.4.2 Mean corpuscular haemoglobin (MCH) 61
4.5.4.3 Mean corpuscular haemoglobin concentration (MCHC) 61
4.5.5 Total leukocytes count (TLC) 62
4.5.6 Differential leucocytes count (DLC) 62
4.5.6.1 Heterophils count 62
4.5.6.2 Lymphocyte count 62
4.5.6.3 Eosinophil count 62 - 63
4.5.6.4 Monocytes count 63
ix
4.6 Biochemical parameters 63
4.6.1 Serum Glucose 63
4.6.2 Serum Cholesterol 63 & 66
4.6.3 Total proteins (TP) 66
4.6.4 Serum Albumin (A) 66
4.6.5 Serum Globulin (G) 66-67
4.6.6 Albumin: Globulin (A/ G) ratio 67
4.7 Serum enzymes 67
4.7.1 Aspartate amino transferase (AST) 67
4.7.2 Alanine amino transferase (ALT) 67 & 70

4.7.3 Gamma-Glutamyl transferase (GGT) 70
4.7.4 Alkaline phosphatase (ALP) 70
4.7.5 Serum calcium 70 & 71
4.8 Morphometry 71
4.8.1 Weights of tibial bones (g) 71
4.8.2 Weights of liver (g) 71
4.8.3 Weights kidney (g) 74
4.8.4 Length of tibial bones (cm) 74
4.8.5 Diameter of tibial bones (cm) 74
4.9 Gene expression 75
4.9.1 VEGF 75
4.9.2 VEGFR1 75
4.9.3 Bcl-2 75 & 78
4.9.4 MMP-2 78
4.9.5 MMP-3 78
4.10 Gross pathology 78

Gross pathology of tibial bones growth plate cartilage
4.10.1 78-79
(TGPC)
x
4.10.2 Gross pathology of liver and kidney 79 & 81
4.11 Histopathology 81
Histopathology of tibial bones growth plate cartilage
4.11.1 81-88
(TGPC) employed H&E
4.11.2 88 & 95
(TGPC) employed Koneff’s satin
4.11.3 Histopathology of liver 95 & 97
4.11.4 Histopathology of Kidney 97

Immunohistochemistry of tibial bones growth plate
4.12 104
cartilage (TGPC)
4.12.1 Expression of anti apoptotic protein (Bcl-2) 104
4.12.2 Expression of vascular endothelial growth factor (VEGF) 105
4.13 Ultra structural pathology 105
Transmission electron microscopy (TEM) of tibial growth 105,108 -

4.13.1
plate cartilage 109
4.13.2 Transmission electron microscopy (TEM) of liver 109&113
4.13.3 Transmission electron microscopy (TEM) of kidney 113&117
Scanning electron microscopy (SEM) of proximal

4.13.4 117
extremity of tibial bone
4.13.5 Scanning electron microscopy (SEM) of liver 117&122
4.13.6 Scanning electron microscopy (SEM) of kidney 122
Amplicans of different genes in tibial growth plate

4.14 122
cartilage chondrocytes (TGPC) in QRT-PCR
Amplification plots and dissociation curve for different
4.14.1 122
genes (VEGF, VEGFR1, Bcl-2,MMP2 and MMP3)
V DISCUSSION 128-148
5.1 General observation and clinical signs 128
5.2 Body weight gains 128-129
5.3 Feed conversion ratio (FCR) 129
5.4 Haematological parameters 129
xi
5.4.1 Total erythrocyte count (TEC) 129-130
5.4.2 Haemoglobin concentration (Hb) 130
5.4.3 Packed cell volume (PCV) 130-131
5.4.4 Erythrocyte indices (MCV, MCH and MCHC) 131

Total leukocytes count (TLC) and Differential leucocytes
5.4.5 131
count (DLC)
Biochemical parameters (Glucose, Cholesterol, TP and
5.5 131-132
A/G ratio)
5.6 Serum enzymes (AST,ALT,GGT,ALP and Calcium) 132-133
Morphometry (weights of tibial bones , liver and kidney;
5.7 133
length and diameter of tibial bones)
5.8 Gene expression 133
5.8.1 VEGF 133 - 134
5.8.2 VEGFR1 134 -135
5.8.3 Bcl-2 135
5.8.4 MMP-2 136
5.8.5 MMP-3 136
5.9 Gross pathology 137
5.10 Histopathology 137
5.10.1 Tibial bones growth plate cartilage (TGPC) 137

5.10.1.1 137- 139
(TGPC) employed H&E
5.10.1.2 139 -140
(TGPC) employed Koneff’s satin
5.10.2 Histopathology of liver 140
5.10.3 Histopathology of Kidney 141
Immunohistochemistry of tibial bones growth plate

5.11 141
cartilage (TGPC)
5.11.1 Expression of anti apoptotic protein (Bcl-2) 141 -142
5.11.2 Expression of vascular endothelial growth factor (VEGF) 142 -143
xii
5.12 Ultra structural pathology 143
Transmission electron microscopy (TEM) of tibial growth
5.12.1 143 -145
plate cartilage
5.12.2 Transmission electron microscopy (TEM) of liver 145 -146
5.12.3 Transmission electron microscopy (TEM) of kidney 146 -147

Scanning electron microscopy (SEM) of proximal
5.12.4 147
extremity of tibial bone and cartilage
5.12.5 Scanning electron microscopy (SEM) of liver 147
5.12.6 Scanning electron microscopy (SEM) of kidney 148
VI SUMMAERY 149-152
VII LITERATURE CITED 153-161
xiii
LIST OF ILLUSTRATIONS
Plate Title Page

No. No.
1 Clinical sings of experimental birds group wise - 1st week 51
Fig.1 Apparently healthy birds
Fig.2 Birds sitting on sternal recumbency and widened legs
Fig.3 Birds sitting on sternal recumbency and more widened legs
Fig.4 Birds showing sternal recumbency, outward stretching and widening

of legs
Fig.5 Birds showing sternal recumbency and widening of legs
Fig.6 Bird sitting on hock joint
Fig.7 Birds on sternal recumbency and back ward stretching of leg
Fig.8 Birds sitting on hock joint and appears to be normal
Fig.9 Birds on sternal recumbency and sitting on hocks
2 Clinical sings of experimental birds group wise - 5th week 52
Fig.1
Fig.4
Fig.5
Apparently healthy birds
Fig.6
Fig.9
Fig.10
Fig.2 Birds sitting on hock joints and outward stretching of legs
Fig.3 Birds sitting on hock joints with curled toes
Fig.7 Birds on sternal recumbency, sitting on hock joints and back ward
stretching of legs
Fig.8 Birds showing spraddle legs and sternal recumbency sitting on

hock joints
Fig.11 Birds showing curled toes and sitting on hock joints
xiv
Fig.12 Birds sitting on hock joints and mild back ward stretching of legs
3 Mean values of body weight gain in birds of different experimental 54

groups
Fig.1 Graph showing weekly body weight gains (g)
4 Mean values of feed conversion ratio (FCR) in birds of different 55

experimental groups
Fig.1 Graph showing feed conversion ratio (g)
5 Mean values of total erythrocyte count (millions/μl), haemoglobin 56

concentration (g %) and packed cell volume (%) in birds of different
experimental groups
Fig.1 Graph showing total erythrocyte count (millions/μl)
Fig.2 Graph showing haemoglobin concentration (g %)
Fig.3 Graph showing packed cell volume (%)
6 Mean values of mean corpuscular volume (fl), mean corpuscular 57

haemoglobin (pg) and mean corpuscular haemoglobin concentration
(g/dl) in birds of different experimental groups
Fig.1 Graph showing mean corpuscular volume (fl)
Fig.2 Graph showing mean corpuscular haemoglobin (pg)
Fig.3 Graph showing mean corpuscular haemoglobin concentration (g/dl)
7 Mean values of total leukocyte count (thousands/μl) in birds of different 59

experimental groups
Fig.1 Graph showing total leukocyte count (thousands/μl)
8 Mean values of differential leukocyte count (%) in birds of different 60

experimental groups
Fig.1 Graph showing heterophils (%)
Fig.2 Graph showing lymphocytes (%)
Fig.3 Graph showing eosinophils (%)
Fig.4 Graph showing monocytes (%)
9 Mean values of glucose (g/dl), cholesterol (mg/dl) and total protein 64

xv
Fig.1 Graph showing glucose (g/dl)
Fig.2 Graph showing cholesterol (mg/dl)
Fig.3 Graph showing total protein (g/dl)
10 Mean values of albumin, globulin and A/G ratio (g/dl) in birds of 65

different experimental groups
Fig.1 Graph showing albumin (g/dl)
Fig.2 Graph showing globulin (g/dl)
Fig.3 Graph showing A/G ratio (g/dl)
11 Mean values of AST, ALT, and GGT (IU/ml) in birds of different 68

experimental groups
Fig.1 Graph showing AST (IU/ml)
Fig.2 Graph showing ALT (IU/ml)
Fig.3 Graph showing GGT (IU/ml)
12 Mean values of ALP (IU/ml) and calcium (mg/dl) in birds of different 69

experimental groups
Fig.1 Graph showing ALP (IU/ml)
Fig.2 Graph showing calcium (mg/dl)
13 Mean values of weights (g) of tibia, liver and kidney of in birds of 72

Fig.1 Graph showing tibia weights (g)
Fig.2 Graph showing liver weights (g)
Fig.3 Graph showing kidney weights (g)
14 Mean values of Tibial length (cm) and diameter (cm) of in birds of 73

Fig.1 Graph showing Tibial length (cm)
Fig.2 Graph showing diameter (cm)
15 Mean CT values of gene expression of different genes (VEGF, VEFGR1 76

and Bcl-2) in birds of different experimental groups
Fig.1 C
Graph showing T values of VEGF gene expression
xvi
Fig.2 Graph showing CT values of VEFGR1 gene expression
Fig.3 C
Graph showing T values of Bcl-2 gene expression
16 Mean CT values of gene expression of different genes (MMP2 and 77

MMP3) in experimental birds
Fig.1 C
Graph showing T values of MMP2 gene expression
Fig.2 Graph showing CT values of MMP3 gene expression
17 Showing the gross changes of tibial bones, live, and kidney of 80

experimental birds groups wise - 1st and 5th week
Fig.1 Abnormal shortening and bending of tibial bones of group II,VII and
XII in comparison with other groups- 1st week
Fig.2 Abnormal shortening, bending and thinning of tibial bones of group

II,III,VII,VIII and XII in comparison with other group - 5th week
Fig.3 Cross sections of proximal extremity of tibial bones showing

abnormal widening of growth plate cartilage of group II and III in
comparison with other groups - 1st week
Fig.4 Cross sections of proximal extremity of tibial bones showing

abnormal widening of growth plate cartilage of group II and III in
comparison with other groups - 5th week
Fig.5 Abnormal size, shape and color of liver and kidney of group
II,III,VII,VIII,IX,XI and XII in comparison with other groups -1st
week
Fig.6 Abnormal size, shape and color of liver and kidney of group
II,III,VII,VIII,IX,XI and XII in comparison with other groups -5th
week
18 Photomicrographs of histopathological changes of cartilage in birds of 85

different experimental groups - 5th day
Fig.1 Group I: Section showing dilated blood vessel with blood. Note the
chondrocytes arrangement in rows with centrally placed nuclei.
H&E:50µm
Fig.2 Group III: Section showing few chondrocytes with swollen nucleus
and pyknotic nuclei in some. Also note many empty chondrocytes
that are oval shaped. H&E:50µm
xvii
Fig.3 Group IV: Section showing dilated blood vessel with blood. Note the
arrangement of chondrocytes in clusters which are small with
pyknotic nuclei. H&E:100µm
Fig.4 Group V: Section showing dilated blood vessel with moderate

congestion. Note the clusters of chondrocytes with varied stages of
nucleus. H&E :50µm
Fig.5 Group VIII: Section showing numerous blood vessels which are
empty. Clusters of tightly packed chondrocytes are seen with dense
nuclei. H&E:200µm
Fig.6 Group X: Section showing dilated blood vessel with blood. Clusters
of chondrocytes are seen with swollen and varied stages of nucleus.
H&E:50µm

Fig.1 Group I: Section showing dilated blood vessel with blood.

Chondrocytes are seen arranged in rows with centrally placed nuclei.
H&E:50µm
Fig.2 Group III: Section showing swollen distorted chondrocytes that are
arranged in helter shelter manner. Also observe majority of
chondrocytes which are empty and few with pyknotic nuclei.
H&E:50µm
Fig.3 Group IV: Section showing dilated vessel with congestion. Few
chondrocytes distorted and distributed in helter shelter manner while
few are oval with pyknotic nuclei and few are empty. H&E:50µm
Fig.4 Group VIII: Section showing more of proliferating zone containing

flattened chondrocytes with lacunas. The hypertrophied zone
containing varied size and shaped chondrocytes with condensed
nucleus. H&E:50µm
Fig.5 Group X: Section showing extremely dilated capillary with large

amount of blood. Clusters of chondrocytes are arranged in rows and
groups with eosinophilic nuclei and also observe few empty cells.
H&E:50µm
20 Photomicrographs of histopathological changes (H&E) of cartilage in 87

birds of different experimental groups - 15th day
Fig.1 Group I: Section showing clusters of chondrocytes with dark nucleus

and abundant matrix. H&E:50µm
Fig.2 Group III: Section showing swollen empty oval shaped chondrocytes
xviii
and few chondrocytes are seen with pyknotic nuclei. H&E:25µm
Fig.3 Group IV: Section showing swollen chondrocytes arranged in

clusters with eosinophilic and pyknotic nuclei. H&E:50µm
Fig.4 Group V: Section showing large dilated vessel filled with blood.
Chondrocytes are seen in clusters having distorted eosinophilic
nucleus. H&E: 50µm

different experimental groups - 1st week
Fig.1 Group I: Section showing all layers (hyaline, proliferating,

prehypertrophic and hypertrophic zones) with proper arrangement of
chondrocytes (cord like structures). Few capillaries are seen in
hyaline and proliferating zones. H&E: 200μm
Fig.2 Group II: Section showing swollen chondrocytes, with emerging

capillary from prehypertrophid zone to hypertrophid zone. Few
chondrocytes are disorganized with pyknotic nuclei. H&E: 100μm
Fig.3 Group IV: Section showing numerous emerging capillaries filled

with blood. Chondrocytes are disorganized containing pyknotic
nuclei. H&E: 200μm
Fig.4 Group VII: Section showing an emerging capillary middle of the

section. Chondrocytes are in the farm of clusters with eosinophilic
nuclei. Also note few cells with dark and dense nucleus while few
cells are empty. H&E: 100μm

different experimental groups - 1st week
Fig.5 Group VIII: Section showing numerous emerging and dilated blood
vessels. Note the arrangement of chondrocytes in rows with dark and
pyknotic nuclei. Few cells are with eosinophilic nuclei while few are
empty. H&E: 100μm
Fig.6 Group IX: Section showing numerous emerging vessels with blood.
Note the swollen, distorted chondrocytes distributed in helter shelter
manner. Few cells are oval with pyknotic nuclei, chromatolysis, and
faint matrix. Other cells are empty. H&E: 100μm
Fig.7 Group X: Section showing round chondrocytes with prominent

nuclei. All the cells are organized in line with emerging capillary.
H&E: 100μm
Fig.8 Group XII: Section showing arrangements of chondrocytes in cord

like rows. The cells are swollen with eosinophilic nucleus and scanty
matrix. Moderate congestion is also seen. H&E: 50μm
xix
different experimental groups - 3rd week
Fig.1 Group I: Section showing number of chondrocytes arranged in rows

and columns along with number of dilated vessels. H&E:200µm
Fig.2 Group II: Section showing large number of chondrocytes with

different size and shape without nucleus. Few cells are with pyknotic
nuclei. H&E:50µm
Fig.3 Group III: Section showing few swollen chondrocytes with pyknotic
nuclei. Majority of the chondrocytes are in clusters and empty, they
are in clusters. Also note the large dilated blood vessel. H&E:50µm
Fig.4 Group IV: Section showing condensed chondrocytes with numerous

capillaries filled with blood. H&E:100µm
Fig.5 Group V: Section showing rows of round and condensed

chondrocytes with eosinophilic pyknotic nucleus. Few degenerated
chondrocytes were also seen. H&E:50µm
Fig.6 Group VI: Section showing rows of elongated chondrocytes with

eosinophilic pyknotic nucleus. Note few degenerated chondrocytes
also. H&E:50µm

different experimental groups - 3rd week
Fig.7 Group VII: Section showing pyknotic nucleus with disorganized

chondrocytes. Note oval chondrocytes around the blood vessel.
H&E: 50μm
Fig.8 Group VIII: Section Showing eosinophilic pyknotic nuclei.

Chondrocytes arranged in large clusters with few empty cells.
H&E: 50μm
Fig.9 Group IX: Section showing chondrocytes are arranged in rows and
clusters. Few cells showing pyknotic nucleus with karyorrhexis.
Also note few empty chondrocytes. H&E: 50μm
Fig.10 Group X: Section showing greatly dilated vessel filled with blood
with uniform chondrocytes on either side of the vessel. H&E:
50μm
Fig.11 Group XI: Section showing clusters of chondrocytes arranged in

rows and cords filled with optimum sized nucleus but eosinophilic
in nature. Also note marked dilated blood vessel. H&E: 50μm
Fig.12 Group XII: Section showing plenty of empty oval shaped

chondrocytes. Few cells are with pyknotic nuclei and vary in size
xx
and shape. H&E: 50μm

different experimental groups- 5th week
Fig.1 Group I: Section showing organized chondrocytes along with number

of blood vessels. H&E:100µm
Fig.2 Group II: Section showing disorganized chondrocytes with

condensed nucleus and a dilated blood vessel.H&E:50µm
Fig.3 Group III: Section showing disorganized chondrocytes with varied

size and shaped nucleus along with few blood vessels. H&E:50µm
Fig.4 Group IV: Section showing chondrocytes with pyknotic and

eosinophilic nuclei. Also note blood vessels in the centre H&E:50µm
Fig.5 Group V: Section showing swollen empty and disorganized

chondrocytes. Few cells are seen with dense nucleus while others are
empty. Blood vessels showing marked dilation and congestion.
H&E:50µm
Fig.6 Group VI: Section showing large number of swollen and empty
chondrocytes. Few cells are with large nucleus.H&E:50µm

different experimental groups - 5th week
Fig.7 Group VII: Section showing disorderly arranged chondrocytes with

pyknotic nuclei and most of them are oval. Few cells are seen
without nucleus. H&E:50µm
Fig.8 Group VIII: Section showing large masses of empty chondrocytes

which are different in shape with few cells having pyknotic nuclei.
Note the congestion of blood vessel also. H&E:50µm
Fig.9 Group IX: Section showing swollen chondrocytes arranged in rows

and columns with large eosinophilic nucleus. H&E:50µm
Fig.10 Group X: Section showing few empty chondrocytes and few with
nucleus. H&E:50µm
Fig.11 Group XI: Section showing organized chondrocytes with few of

them empty. Notice the dilated capillaries in the section.
H&E:100µm
Fig.12 Group XII: Section showing swollen chondrocytes with dilated

blood vessels. Section is also showing few empty chondrocytes.
H&E:50µm
xxi
27 Photomicrographs of histopathological changes (Koneff’s stain) of 96
cartilage in birds of different experimental groups
Fig.1 Group III: Section showing disorderly arranged chondrocytes with

pyknotic nuclei. Note few empty chondrocytes. Koneff’s stain:25µm
Fig.2 Group IV: Section showing reorganization of chondrocytes with

proliferation of blood vessels. Koneff’s stain:50µm
Fig.3 Group V: Section showing chondrocytes arranged in rows and

clusters with dilated blood vessels. Koneff’s stain:50µm
Fig.4 Group VIII: Section showing large oval empty chondrocytes, with
pyknotic nuclei and abundant matrix. Koneff’s stain:25µm
Fig.5 Group X: Section showing large oval chondrocytes arranged in

clusters. Koneff’s stain:25µm
28 Photomicrographs of histopathological changes of liver in birds of 98

Fig.1 Group III: Section showing greater dilation of sinusoids, mild to

moderate fatty change and marked thickening of the vessels. H&
E:50µm
Fig.2 Group IV: Section showing moderate dilation of CV along with

dilation and congestion of sinusoidal spaces. H&E:50µm
Fig.3 Group V: Section showing congestion of CV, marked dilation of

sinusoids. Note moderate fatty changes also. H&E:25µm
Fig.4 Group VIII: Section showing dilated vessel and bile duct hyperplasia.
H&E:50µm
Fig.5 Group X: Section showing moderate congestion of CV along with

sinusoidal dilation and congestion. Also note moderate fatty changes
and focal aggregates of round cells. H&E:50µm

Fig.1 Group III: Section showing moderate dilation and of congestion of

central vein. H&E :50µm
Fig.2 Group IV: Section showing mild dilation and congestion of CV, loss
of architecture of hepatic cords with focal areas of dilated sinusoids.
H&E:50µm
xxii
Fig.3 Group V: Section showing marked dilation of CV with desquamation
of endothelium. Marked dilation of sinusoidal spaces. H&E:50µm
Fig.4 Group VIII: Section showing mild sinusoidal congestion, moderate

fatty change and degeneration of hepatocytes. Few cells are with
pyknotic nuclei. H&E:50µm
Fig.5 Group X: Section showing congestion of CV and marked dilation of

sinusoidal spaces. H&E:50µm

Fig.1 Group III: Section showing mild congestion of CV, and few
hepatocytes with degenerative changes. Marked dilation of sinusoidal
spaces is also seen H&E 25µm
Fig.2 Group IV: Section showing marked dilation of sinusoidal spaces and
few hepatocytes with mild fatty change. H&E 50µm
Fig.3 Group VIII: Section showing moderate dilation of sinusoidal spaces

and focal areas of congestion. H&E 50µm
31 Photomicrographs of histopathological changes of kidney in birds of 101

Fig.1 Group III: Section showing moderate intertubular dilation and

shrunken glomeruli. H&E:50µm
Fig.2 Group IV: Section showing marked dilation of tubules with shrunken
glomeruli. H&E:50µm
Fig.3 Group V: Section showing moderate intertubular dilation and mild

hemorrhages. H&E:50µm
Fig.4 Group VIII: Section showing hyper cellular glomeruli with very mild
dilation of tubules. H&E:50µm
Fig.5 Group X: Section showing large focal round cell aggregates and
hyaline casts in the tubules with marked intertubular dilation.
H&E:25µm

Fig.1 Group III: Section showing moderate dilation of tubules. Note the
shrunken glomeruli and also marked dilation and congestion of blood
vessel. H&E:50µm
xxiii
Fig.2 Group V: Section showing few tubules with cystic dilation and
shrunken glomeruli. H&E:50µm
Fig.3 Group X: Section showing focal round cell aggregates and dilated
tubules with hyaline casts. H&E:50µm

Fig.1 Group III: Section showing hyper cellularity of interstitium.

Moderate to marked cystic dilation of tubules. Note few tubules with
hyaline casts and shrunken glomeruli. H&E:50µm
Fig.2 Group IV: Section showing mild degeneration of tubular epithelium

along with marked dilation of tubules with hyaline casts. H&E:25µm
Fig.3 Group V: Section showing moderate cystic dilatation of tubules and

intertubular hemorrhages. H&E:50µm
Fig.4 Group VIII: Section showing moderate to marked cystic dilation of

tubules. Note the congestion and dilation of inter tubular vessels,
along with focal round cell aggregates H&E:100µm
34 Photomicrographs of immunohistochemical (Bcl-2) changes of cartilage 106

in birds of different experimental groups
Fig.1 Group I: Section showing dark dense nucleus without reaction of

antigen as the staining intensity is not seen. IHC:25µm
Fig.2 Group III: Section showing large chondrocytes without nucleus and
few cells with pyknotic nucleus. Note increased staining intensity
(brown colour) is the indication for apaptosis IHC:50µm
Fig.3 Group IV: Section showing more number of chondrocytes with

pyknotic nucleus. Note mild staining intensity reaction of antigen.
IHC:50µm
Fig.4 Group V: Section showing pyknotic nucleus, with out staining

reaction of antigen. IHC:50µm
Fig.5 Group VIII: Section showing large chondrocytes without nucleus.

Note few cells with pyknotic nucleus and increased staining intensity
(brown colour) is the indication for apaptosis. IHC:25µm
Fig.6 Group X: Section showing pyknotic nucleus without staining

reaction of antigen. Note the emerging capillaries. IHC:50µm
35 Photomicrographs of immunohistochemical (VEGF) changes of 107

Fig.1 Group I: Section showing numerous vessels without staining reaction
xxiv
of endothelium. IHC:200µm
Fig.2 Group III: Section showing dilated vessels with intense staining
reaction of endothelium. IHC:25µm
Fig.3 Group IV: Section showing vessels with intense staining reaction of
endothelium. IHC:100µm
Fig.4 Group V: Section showing vessels mild staining reaction of

endothelium IHC:100µm
Fig.5 Group VIII: Section showing vessels with intense staining reaction of
Fig.6 Group X: Section showing vessel with very mild staining reaction of
36 Transmission electron micrographs showing ultrastructural changes of 110

cartilage in birds of different experimental groups - 5th day
Fig.1 Group I: Section showing normal Nucleus with RER and abundant
matrix. Urenyl acetate and lead citrate: 15120 x
Fig.2 Group III: Section showing pyknotic nucleus with margination of

chromatin material, shrunken mitochondria, and few are vacuolated
mitochondria. Urenyl acetate and lead citrate: 18900 x
Fig.3 Group IV: Section showing round nucleus with eccentrically placed
nucleolus, distorted RER, shrunken mitochondria and vesicular
cytoplasm. Urenyl acetate and lead citrate: 11340 x
Fig.4 Group V: Section showing round nucleuses with eccentrically placed

nucleolus, loss of other organelles. Urenyl acetate and lead citrate:
13230 x
Fig.5 Group VIII: Section showing pyknotic nuclei, dilated and distorted
RER, shrunken mitochondria, electron dense granules in the
Fig.6 Group X: Section showing round nucleus, with faint nucleolus mild
dilated RER with oval shaped dense mitochondria. Urenyl acetate
and lead citrate: 9450 x

Fig.1 Group I: Section showing round nucleus, RER between two

nucleuses, number of mitochondria with different size and shape.
Urenyl acetate and lead citrate: 11340 x
xxv
Fig.2 Group III: Section showing condensed nucleus shrunken
chondrocytes, with completely altered mitochondria, dilated inter
cellular junction, vesicular cytoplasm. Urenyl acetate and lead
citrate: 7560 x
Fig.3 Group IV: Section showing altered nucleus note the disrupted RER
and vacuolated mitochondria, vesicular cytoplasm. Urenyl acetate
Fig.4 Group V: Section showing shrunken chondrocytes with pyknotic

nucleus, vesicular nucleoplasma. Note the condensed and vesicular
Fig.5 Group VIII: Section showing elongated chondrocyte with cone

shaped electron dense nucleus. Note the dilated vesicular
mitochondria and complete loss of other cell organelle. Urenyl
acetate and lead citrate. 18900 x
Fig.6 Group X: Section showing elongated chondrocyte with round

nucleus. Disrupted RER and altered mitochondria. Urenyl acetate

Fig.1 Group I: Section showing round nucleus with other cell organelle and
clear RER and mitochondria. Urenyl acetate and lead citrate: 5670 x
Fig.2 Group III: Section showing shrunken chondrocytes, with dense

nucleus with margination of chromatin and disintegrated nucleolus.
Note the complete disruption of RER and numerous condensed
Fig.3 Group IV: Section showing swollen nucleus, with loose inter cellular
junction, margination of chromatin and disintegration of nucleolus.
Note the vesicular cytoplasm. Urenyl acetate and lead citrate:15120 x
Fig.4 Group V: Section showing condensed chondrocytes with swollen

vesicular mitochondria, electron dense round uniform fat like bodies
were seen in shrunken chondrocytes. Urenyl acetate and lead citrate:
6615 x
Fig.5 Group VIII: Section showing elongated nucleus, with dilated nuclear
membranes. Note altered mitochondria and large vesicular
Fig.6 Group X: Section showing round nucleus without nucleolus, mild

dilated nuclear membranes, elongated and condensed mitochondria,
disrupted RER vesicular cytoplasm. Urenyl acetate and lead citrate:
15120 x
xxvi
liver in birds of different experimental groups - 5th day
Fig.1 Group I: Section showing intercellular junction, with electron dense

chromatin. Urenyl acetate and lead citrate: 18900 x
Fig.2 Group III: Section showing swollen nucleus, margination of

chromatin, disrupted nucleolus. Observe the swollen mitochondria
with loss of matrix. Urenyl acetate and lead citrate: 18900 x
Fig.3 Group IV: Section showing swollen nucleus with margination of

chromatin. Observe the electron dense granular material throughout
field. Urenyl acetate and lead citrate: 28350 x
Fig.4 Group V: Section showing swollen nucleus with loss of margins.

Note complete loss of cell organelle. Urenyl acetate and lead citrate:
28350 x
Fig.5 Group VIII: Section showing shrunken cells with pyknotic nucleus
and scanty chromatin margination. Note complete loss of cellular
architecture and cytoplasmic vaccuolation Urenyl acetate and lead
citrate: 7560 x
Fig.6 Group X: Section showing loss intercellular junction margins,

condensed nucleus with mild margination of chromatin. Urenyl
acetate and lead citrate: 9450 x

Fig.1 Group I: Section showing inter cellular junction, dilated vessels and
round nucleus. Urenyl acetate and lead citrate: 66150x
Fig.2 Group III: Section showing swollen nucleus with margination of

chromatin. Observe the cytoplasmic vaccuolation and condensed
mitochondria with loss of matrix. Urenyl acetate and lead citrate:
13230 x
Fig.3 Group IV: Section showing swollen nucleus with margination of

chromatin. Observe the swollen mitochondria and electron dense
flocculent material in cytoplasm. Urenyl acetate and lead citrate:
15120 x
Fig.4 Group V: Section showing swollen nucleus with margination of

chromatin. Note the faint mitochondria and electron dense granules
throughout field. Urenyl acetate and lead citrate: 22680 x
Fig.5 Group VIII: Section showing moderately enlarged nucleus with

eccentrically placed nucleolus, and margination of chromatin. Note
the swollen mitochondria with scanty and faint matrix.
xxvii
Fig.6 Group X: Section showing moderately enlarged nucleus and mild

margination of chromatin. Observe the swollen, mitochondria with
scanty and faint matrix. Urenyl acetate and lead citrate: 15120 x

Fig.1 Group I: Section showing intercellular junction, dilated vessel and

round nucleus. Urenyl acetate and lead citrate: 7560 x
Fig.2 Group III: Section showing swollen nucleus with margination of

chromatin. Note the vacuolated mitochondria and cytoplasmic
vaccuolation. Urenyl acetate and lead citrate: 11340 x
Fig.3 Group IV: Section showing mild to moderately swollen nucleus with
mild margination of chromatin. Observe the electron dense flocculent
material in cytoplasm. Urenyl acetate and lead citrate: 13230 x
Fig.4 Group V: Section showing swollen and elongated nucleus with

margination of chromatin. Note electron dense granules throughout
field. Urenyl acetate and lead citrate: 22680 x
Fig.5 Group VIII: Section showing marginated chromatin in one nucleus

and centrically placed nucleolus in one other cell. Note that complete
loss of other cytoplasmic organelle. Urenyl acetate and lead citrate:
9450 x
Fig.6 Group X: Section showing moderately enlarged nucleus and

prominent cytoplasmic vaccuolation. Urenyl acetate and lead citrate:
7560 x

kidney in birds of different experimental groups - 5th day
Fig.1 Group I: Section showing intertubular junction with intact epithelial

cells. Urenyl acetate and lead citrate: 3780 x
Fig.2 Group III: Section showing intertubular junction with moderately

swollen nucleus and condensed vacuolated mitochondria of epithelial
cells. Urenyl acetate and lead citrate: 7560 x
Fig.3 Group IV: Section showing hemorrhagic dilated interstium. Note the
shrunken and distorted tubule with necrotic epithelial cells. Urenyl
Fig.4 Group VIII: Section showing shrunken epithelial cells with numerous
electron dense fat bodies, pyknotic nucleus and margination of
chromatin. Observe the vacuolated cytoplasm. Urenyl acetate and
xxviii
lead citrate: 6615 x
Fig.5 Group X: Section showing distorted and necrotic epithelial cells with
pyknotic nuclei and condensed nucleolus. Note the loose inter
cellular junction and swollen mitochondria. Urenyl acetate and
lead citrate: 4725 x

Fig.1 Group I: Section showing intact tubule with proper arranged

epithelial cells. Urenyl acetate and lead citrate: 4725 x
Fig.2 Group III: Section showing narrowed lumen with swollen epithelial
cells, nucleus with disrupted chromatin. Note the condensed
Fig.3 Group IV: Section showing dilated lumen with intact epithelial cells.
Fig.4 Group V: Section showing distorted epithelial cells with varied size
and shape of nucleus. Observe the condensed mitochondria, brush
boarder and loose inter cellular junction. Urenyl acetate and lead
citrate: 4725 x
Fig.5 Group VIII: Section showing distorted epithelial cells with varied
size and shape of nucleus. Observe the condensed mitochondria.
Note the brush boarder with loose inter cellular junction. Urenyl
Fig.6 Group X: Section showing distorted epithelial cells with altered

nucleus and mitochondria. Note the loss of brush boarder and
narrowed lumen. Urenyl acetate and lead citrate: 6615 x

Fig.1 Group I: Section showing intact tubule with proper arranged

epithelial cells. Urenyl acetate and lead citrate: 4725 x
Fig.2 Group III: Section showing narrowed lumen with swollen epithelial
cells. Observe the disrupted chromatin and condensed mitochondria.
Fig.3 Group IV: Section showing narrowed lumen with intact epithelial
cells and note cytoplasmic vaccuolation. Urenyl acetate and lead
citrate: 3780 x
Fig.4 Group VIII: Section showing distorted epithelial cells with swollen
nucleus and margination of chromatin. Note the elongated
xxix
Fig.5 Group X: Section showing distorted epithelial cells with altered
nucleus and mitochondria. Observe the loss of brush boarder and
dilated lumen filled with blood. Urenyl acetate and lead citrate:
3780 x
45 Scanning electron micrographs showing ultrastructural changes of 121

Fig.1 Group I: Specimen showing normal Haversian syem
Fig.2 Group III: Specimen showing necrotic area and completely altered
Haversian system
Fig.3 Group IV: Specimen showing moderately altered Haversian system

and mild haemorrhge
Fig.4 Group V: Specimen showing narrowed Haversian system
Fig.5 Group VIII: Specimen showing completely altered Haversian system

and haemorrhges
Fig.6 Group X: Specimen showing completely altered Haversian system

and severe haemorrhages
46 Scanning electron micrographs showing ultrastructural changes of liver 123

in birds of different experimental groups
Fig.1 Group I: Specimen liver showing normal architecture
Fig.2 Group III: Specimen showing dilated blood vessels and necrotic
parenchyma
Fig.3 Group IV: Specimen showing severe dilation of blood vessels altered
parenchyma
Fig.4 Group V: Specimen showing altered parenchyma , congestion and

haemorrhage
Fig.5 Group VIII: Specimen showing severe dilation of blood vessel and
necrosis of parenchyma
Fig.6 Group X: Specimen showing mild dilation of parenchma and altered

architecture
47 Scanning electron micrographs showing ultrastructural changes of 124

kidney in birds of different experimental groups
Fig.1 Group I: Specimen showing normal tubular arrangement with normal

lumen
xxx
Fig.2 Group III: Specimen showing swollen tubules with completely
closed lumen and hemorrhages
Fig.3 Group IV: Specimen showing mild swelling of tubular epithelium

and narrowed lumen
Fig.4 Group V: Specimen showing narrow tubules and severe hemorrhages
Fig.5 Group VIII: Section showing moderately swollen tubules with

complete closure of lumen
Fig.6 Group X: Specimen showing mild dilated interstitium
48 Amplicans of the genes in tibial growth plate cartilage chondrocytes in 125

quantitative real time reverse transcriptase PCR (QRTPCR)
Fig.1 Bcl-2 gene amplicans
Fig.2 VEGF gene amplicans
Fig.3 VEGFR1
Fig.4 MMP2 gene amplicans
49 Amplification plots for different genes (VEGF, VEGFR1, Bcl-2, MMP2 126
and MMP3
Fig.1 Amplification plots of different genes (VEGFR1, Bcl-2, MMP2 and

MMP3)
Fig.2
50 Dissociation curve for different genes (VEGF, VEGFR1, Bcl-2, MMP2 127
and MMP3
Fig.1 Dissociation curve of different genes (VEGFR1, Bcl-2, MMP2 and

MMP3)
Fig.2
xxxi
LIST OF TABLES
Table Title Page

No. No.
1 Showing experimental design 37
2 Showing primers used for QRT- PCR 45
Mean values of weekly body weight gains (g) in birds of different

3 54
experimental groups
Mean values of feed conversion ratio (FCR- g) in birds of different

4 55
experimental groups
Mean values of total erythrocyte count (millions/μl), haemoglobin

5 concentration (g %) and packed cell volume (%) in birds of different 56
experimental groups
Mean values of erythrocyte indices (MCV-fl, MCH-pg and MCHC-

6 57
g/dl) in birds of different experimental groups
Mean values of total leukocyte count (thousands/μl) in birds of

7 59
Mean values of differential leukocyte count (%) in birds of different

8 60
experimental groups
Mean values of glucose (g/dl), cholesterol (mg/dl) and total protein

9 64
Mean values of albumin (g/dl), globulin (g/dl) and A/G ratio (g/dl) in
10 64
birds of different experimental groups
xxxii
Mean values of AST, ALT, and GGT (IU/ml) in birds of different
11 65
experimental groups
Mean values of ALP (IU/ml) and calcium (mg/dl) in birds of different

12 68
experimental groups
Mean values of weights (g) of tibia, liver and kidney of in birds of

13 72
Mean values of tibial length (cm) and diameter (cm) in birds of

14 73
Mean CT values of gene expression of different genes (VEGF, VEFGR1

15 76
and Bcl-2) in birds of different experimental groups
Mean CT values of gene expression of different genes (MMP2 and

16 77
MMP3) in experimental birds
Mean values of total erythrocyte count (millions/μl), haemoglobin

17 concentration (g %) and packed cell volume (%) in birds of different Annex
experimental groups – ANOVA showed in Annexure -I
Mean values of erythrocyte indices (MCV-fl, MCH-pg and MCHC-
18 g/dl) in birds of different experimental groups – ANOVA showed in Annex
Annexure-I
Mean values of total leukocyte count (thousands/μl) birds of different
19 Annex
Mean values of differential leukocyte count (%) in birds of different

20 Annex
Values of glucose (g/dl), cholesterol (mg/dl) and total protein (g/dl) in

21 Annex
birds of different experimental groups – ANOVA showed in Annexure -I
Mean values of albumin (g/dl), globulin (g/dl) and A/G ratio (g/dl) in
22 Annex
birds of different experimental groups – ANOVA showed in Annexure -I
Mean values of AST, ALT, and GGT (IU/ml) in birds of different

23 Annex
Mean values of ALP (IU/ml) and calcium (mg/dl) in birds of different

24 Annex
Mean values of weights (g) of liver, kidney and tibia of in birds of

25 Annex
different experimental groups – ANOVA showed in Annexure -I
Mean values of tibial length (cm) and diameter (cm) in birds of

26 Annex
different experimental groups – ANOVA showed in Annexure -I
Mean CT values of gene expression of different genes (VEGF, VEFGR1

27 and Bcl-2) in birds of different experimental groups – ANOVA showed Annex
in Annexure -I
xxxiii
Mean CT values of gene expression of different genes (MMP2 and
28 Annex
MMP3) in experimental birds – ANOVA showed in Annexure -I
Gross tibial growth plate cartilage lesions during 5th, 10th and 15th day
29 79
of experiment
Gross tibial growth plate cartilage lesions during 1st, 3rd, and 5th week
30 79
of experiment
Histopathological lesions in TMTD treated birds during 5th, 10th, and

31 84
15th day
Histopathological lesions in TMTD treated birds during 1st, 3rd, and 5th
32 88
week of age
Composition of herbal product and chemical product sponsored by

33 Neospark Drugs and Chemicals Pvt. Ltd., Hyderabad showed in Annex
Annexure -I
Details of feed ingredients and its nutritive values of starter and

34 finisher diets of experiment as per the NRC recommendations showed Annex
in Annexure -I
35 The composition of decalcifying solutions showed in Annexure -I Annex
36 List of reagents used for Immunohistochemistry showed in Annexure -I Annex
37 Details of Immunohistochemistry protocols used showed in Annexure-I Annex
Compassion of 0.2 M Sodium Phosphate buffer (pH 7.3) showed in

38 Annex
Annexure -I
39 Compassion of 2.5% EM grade gluteroldehyde showed in Annexure -I Annex
Compassion of 1 % Osmium tetra oxide stock solution (OsO4) showed

40 Annex
in Annexure -I
Compassion of saturated Urenyl acetate and Reynolds’ Lead citrate –

41 Annex
(pH12) showed in Annexure -I
Compassion of SPI - CHEM Araldite 6005 Embedding Kit showed in

42 Annex
Annexure -I
xxxiv
Name of the student : M. LAKSHMAN
Title of the thesis : “Molecular and ultrastructural pathology of Thiram
(TMTD - Tetra methyl thiuram disulfide) induced
tibial dyschondroplasia (TD) in broilers”
Degree to which it is : Doctor of Philosophy
submitted
Faculty : Veterinary Science
Department : Department of Veterinary Pathology
Major adviser : DR.Y.ANJANEYULU
Associate Professor
Department of Pathology
Rajendranagar, Hyderabad-500 030.
University : Sri Venkateswara Veterinary University Tirupati –
517502
Year of submission : June, 2011
ABSTRACT
Tibial dyschondroplasia (TD) is a major metabolic cartilage disease of young

poultry, in which the tibial growth plate cartilage (TGPC) fail to undergo osteogenic
transition leading to the retention of thickened white opaque a vascular cartilage
plug at the end of the proximal tibia and tibio-tarsal bones. Thiram is a systemic
fungicide used as a seed protectant and is available in different forms dust, flowable
and wettable powder. Thiram is the model fungicide which induces the TD in
broilers.
Four hundred and twenty (420) day-old male broilers chicks were wing
banded, individually weighed and distributed into twelve groups of 35 chicks each,
reared under identical managemental conditions in separate battery brooder pens for
a period of 35 days. Group I was fed with basal diet served as absolute control,
group II and III were fed with 60 ppm and 100 ppm of TMTD. Group IV, V and VI
were fed with 200 ppm CuSo4, LivOrdain-FS and USCura Tox-FS at the rate of
1g/kg diet as respective positive controls. Group VII and VIII were fed with 60 ppm
and 100 ppm of TMTD and 200 ppm of CuSo4 as an ameliorative agent. Where as
group IX and X were fed with 60 ppm and 100 ppm of TMTD and LivOrdain-FS at
the rate of 1g/kg diet, XI and XII groups were fed with USCura Tox-FS at the rate of
1g/kg diet and daily observed for clinical signs. Weekly weight gains and feed
conversion ratio (FCR) were statistically analyzed and found significantly (P≤ 0.01)
lower weight gains and higher FCR values in TMTD treated groups.
Six birds from I, III, IV, VII and X were sacrificed on 5th, 10th and 15th day
and TGPC paired samples were collected for gene (s) expression (QRT-PCR),
ultrastructural pathology (TEM & SEM) and immunohistochemistry. Further, six
birds from each group sacrificed at end of 1st, 3rd and 5th week, and blood was
collected for haemato-biochemical studies. Tibial bones, liver and kidney samples
were also collected for histopathological and ultrastructural studies.
The results were statistically analyzed. Significantly (P≤0.01) lower values
were found in TEC, Hb, PCV, TLC and DLC during 1st, 3rd and 5th week of
experiment in respective groups (II, III, IV, VIII, XI, X and XII). The results
xxxv
revealed that TMTD exhibited a partial suppressive action on erythrpoiesis,
leucopoiesis and Hb synthesis in addition to causation of severe TD lesions.
Serum biochemistry showed significantly (P≤ 0.01) lower values of glucose
(IV, VII and IX), cholesterol (II, III and X), total protein and A/G ratio (III, IV, IX
and XI) during the experimental period. The lower values of AST and ALT were
recorded in groups II, IV, VI, VII, IX and X. The GGT and ALP values were lower
in groups V, IX, XI, XII and IV, V and XII respectively. Lower calcium levels were
observed in groups II, VIII and XII. Overall the ameliorative agents did not show
significant effect on haemato-biochemical parameters.
The regulation of different TD specific genes was studied in this experiment.
Significantly (P≤ 0.01) lower CT values of VEGF, VEGFR1 and Bcl-2 were recorded
in groups III, VIII and X. Lower CT values of MMP2 was observed in group V, VIII
and X, where as MMP3 it was observed in groups IV, VIII and X during 5th ,10th
and 15th day of experiment. Up and down regulation of respective genes are playing
a vital role in causation and repair of TD lesion.
Tibial bone, liver and kidney weights, length and diameter of tibial bones
were calculated. They revealed highly significant lower values in TMTD treated
birds when compared with other groups.
The graded lesions (+, ++ and +++) of longitudinally sectioned tibial growth
plate cartilage showed higher score at its widest point in TMTD treated samples over
other groups.
The changes like shrinkage, congestion of liver and kidneys were moderate
to sever in group II and III, mild in group VII, VIII, X and XII and mild enlargement
of the organs were observed in group IV, V and VI than group I.
The TGPC revealed marked changes in hypertrophic zone than the other
zones. Based on severity the lesions were classified as mild (+), moderate (++) and
severe (+++). Mild lesions were characterized by slight thickening of proliferating
zone, transitional zone, and hypertrophic zone and were characterized by pyknotic
nucleoli, disintegrating nucleolus and empty clusters of chondrocytes. The moderate
lesions were summarized as pyknotic, chromatolytic, degenerating nucleus and the
chondrocytes are ovoid without nucleus with more of eosinophilic matrix. Severe
lesions were characterized by grater thickening of proliferating zone, grater thinning
of hyaline zone, absence of chromatin material and empty clefts like chondrocytes
are grouped in clusters.
These graded lesions were prominent in group II, III, XII and followed by
group VII, X, VIII, IX and XI during 5th,10th and 15th day and 1st, 3rd and 5th week of
experimental period.
The sections also revealed pyknotic nuclei, empty (in few), oval and large
disorganized clusters of chondrocytes in group III. Proliferating blood vessels,
reorganization of chondrocytes with dark dens centrally placed nucleus with few
empty cells were observed in group IV, where as group V showed dilated vessels
and clusters of chondrocytes are in rows as that of normal. Group VIII sections
showed large oval empty chondrocytes, with more of matrix, few with pyknotic
nuclei. The sections of group X were large oval chondrocytes with nucleus, more of
matrix and cells are in the form of clusters than rows.
Liver and kidney samples from all the groups were studied. Severe dilation
of CV, mild dilatation of sinusoids, mild to moderate fatty change, hydropic
degeneration of perivascular area and shrunken hepatocytes, with thickened wall of
the blood vessels and karyorrhexic and pyknotic nuclei observed in group III
samples. Dilation of sinusoids, moderate congestion of CV, moderate fatty change
xxxvi
and focal aggregates of MNC’s were observed in groups III, VIII and X samples.
Mild to moderate lesions were revealed in group IV and V.
The kidney sections of group III showed moderate to severe lesions like
intertubular dilatation, shrunken glomeruli. Group IV sections showed grater
dilatation of tubules, shrunken glomeruli, hyaline casts and mild degeneration of
tubular epithelium. Mild to moderate intertubular haemorrhages, focal areas of
cystic dilatation, shrunken glomeruli, degenerating tubular epithelium were observed
in group V. Group VIII sections revealed moderate cystic dilatation of tubules,
degenerating tubular epithelium. Focal aggregates of mononuclear cells, focal areas
of hyaline casts, greater intertubular dilatation was observed in group X samples.
The changes were mild in early age and pronounced as the treatment advanced.
Immunohistochemistry of TGPC was studied in groups I, III, IV, V, VIII and
X for detection of specific anti apoptotic (Bcl-2) antigen which was detected in the
chondrocytes of groups III, VIII and X with varied stages of intensive reaction of
antigen. Group I, IV and V were revealed without reaction.
Expression of VEGF was done for detection of endothelial cellular changes
of blood vessels by using monoclonal antibodies against VEGF antigen. Increased
intensity of reaction was found in group III and IV and mild staining reaction was
also observed in groups V, VIII and X.
The TGPC, liver and kidney samples from different groups (I, III, IV, V,
VIII and X) during 5th, 10th and 15th day were used for transmission and scanning
electron microscopy (TEM and SEM).
The TEM lesions in hypertrophic zone of TGPC were characterized by
dilatation and vesiculation of rough endoplasmic reticulum (RER), enlargement of
para-nuclear space, and swollen mitochondria with electron-dense flocculent
material, loss of matrix and dilatation of Golgi saccules and nuclear chromatin
margination which is indicative of apoptosis was observed in group III and VIII. In
few sections o group III increased the lucency of cytoplasm of necrotic chondrocytes
were also found. Group IV and V the changes were consisted of a well developed
ribbon shaped RER with dilated regions in the vicinity of Golgi complex and
secondary vacuoles. Group X revealed round nucleus, with faint nucleolus mild
dilated RER, dense mitochondria was observed. Chondrocytes of 15th day revealed
large lipid inclusions, vesiculated and disarranged stacks of rough ER along with
apoptotic cells which had cytoplasmic crescentric cap like structures of condensed
chromatin is indicative of apoptosis and early cell death.
The TEM of liver sections of group II and III revealed moderate to severe
changes like margination of chromatin, disrupted nucleolus, and swollen
mitochondria with loss of matrix, cytoplasmic vaccuolation was observed. Mild to
moderate changes were also observed in group IV and V. Group VIII samples
revealed shrunken hepatocytes with pyknotic nucleus and scanty chromatin
margination, complete loss of cellular architecture, cytoplasmic vaccuolation
distorted nuclear membrane and loss of other organelle.
The kidney samples of group II and III revealed moderate to severe lesions
like swelling of nucleus, margination of chromatin, condensed and vacuolated
mitochondria, and narrow tubular lumen. Group IV and V showed mild to moderate
changes with the presence of brush boarder appearance in PCT. Samples of group
VIII revealed shrunken tubules with electron dense numerous fat bodies, pyknotic
nucleus, margination of chromatin, cytoplasmic vacuoles and vacuolated
mitochondria. Group X samples showed distorted and necrotic epithelial cells with
xxxvii
pyknotic nuclei, condensed nucleolus, loose inter cellular junction, swollen
mitochondria, loss of brush boarder and narrowed tubular lumen.
The SEM lesions of tibial bone growth plate cartilage of group III revealed
necrotic areas of cartialginous structures and complete loss of haversion sysytem
group IV sample showed a moderate alteration of haversion system and also the
haemorrhges were observed. Group V cartialge sample showed a narrowed
haversion system but appeared to be normal. The VIII and X group samples revealed
completely altered haversion system with moderate haemorrhges were observed.
The liver samples of group III revealed moderate to severe dilatation of CV
with perivesicular space and necrotic parenchyma. Thin slices of group IV samples
showed severe dilatation of blood vessels altered hepatic parenchyma, in group V
revealed an altered parenchyma, congestion and haemorrhages.The samples of
group VIII exhibited severe dilataion of blood vessels and necrosis of hepatic
parenchyma. Group X slices were revealed a mild dilataion of vessels and altered
hepatic architexure.
The kidney samples of group III revealed moderate swelling of tubules with
completely closed lumen and haemorrhages, the group IV showed an intertubular
dilatation, a mild swelling tubules and narrowed tubular lumen. Severe
haemorrhages and narrowed tubules were observed in group V. Group VIII samples
were showed a moderately swollen tubules with complete closure of tubular lumen,
a mild intertubular dilatation was seen among group X samples.
On perusal of literature limited information is available about TMTD
induced TD pathogenesis at molecular, ultrastructural level and ameliorative agents.
The present proved that the TMTD is a potential fungicide to induce TD at 60 ppm
and 100 ppm and an attempt was made with different ameliorative agents to counter
act the TMTD effect. The ameliorative agents which were used in this experiment
did not repair TD lesion completely, up and down regulation of TD specific genes,
apoptotic and other sub-cellular changes like RER dilation, changes in the
mitochondrial structure and nucleus, specific antigen reaction in
immunohistochemistry and graded histopathological lesions of TD affected
chondrocytes were moderate to severe in groups II and III, mild to moderate in
groups IV, VIII and X and mild in other groups comparatively control.
Preliminary attempt has been made to study the cellular and sub cellular
changes in liver and kidney due to its vital role in detoxification and excretion of
metabolites and toxic substances. The changes were pronounced in TMTD treated
groups followed by CuSo4 and other ameliorative groups. Thiram caused damage to
the liver and kidney. The body weight gains and FCR was excellent in LivOrdain,
CuSo4 and US CuraTox groups over TMTD treated groups.
The result of this study high lighted the importance of further investigation in
this area to minimize the economic losses due to TD in broilers.
xxxviii
CHAPTER - I
INTRODUCTION
Live stock play an important role in the economics of most tropical countries
where majority of house holds in rural areas are associated with livestock production
(Edwards, 2004).The demand for live stock products grows continuously in the
foreseeable future, contributing for economic growth of the nation. But recent events
suggest that the predicted economic gain is not being realized due to various disease
outbreaks affecting livestock. In Indian subcontinent, livestock sector considered to
alleviate rural poverty and address the food security issues is being plagued by
shifting agriculture systems. The agrarian revolution has triggered invention and
usage of various crop, grain and seed protectants like systemic fungicides,
pesticides, fertilizers and insecticides which are posing challenges to the livestock
and feed industry. In the next 20 years there will be increased demand for livestock
products as personal incomes grow in heavily populated countries (Wrathall et al.,
2004).
Andhra Pradesh (AP) being the leader in poultry meat and egg production
contributing upto 30% and 15% export to other states of India respectively. Poultry
industry is providing employment to more than 3 million people and is contributing
Rs. 29,000 crores to National Gross Domestic Product (GDP). Andhra Pradesh is
contributing 12-15% of the agriculture National GDP through poultry industry
alone. The public and the private sectors have worked together to achieve this
phenomenal rise in production. Poultry industry is now recognized as one of the
most progressive and innovative among the agricultural / livestock industries of the
country with tremendous potential for employment due to large scale involvement of
xxxix
man power (Jyoti Palod, 2005). In the changing scenario, exposure of animals and
birds to insecticides / pesticide toxicity even for a short duration induces a state of
stress leading to various behavioral and biochemical changes (Sakomoto, 1997,
Beisel, 1996 and Hassig et al., 1996). Earlier studies (Kalita, 2004) dwelt only on
acute toxicity of environmental pollutants. Limited information is available on
clinicopathological (Boone et al., 2005), pathobiochemical, pathoanatomical and
immunopathological alterations due to low dose of pesticide toxicity in birds
(Germeloc et al., 2004, Krishna Kumar and Rajender 2010, and Krishna Kumar
2011).
The pesticides and fungicides used in the grain crop cultivation are numerous
like organochlorine pesticides, organophosphorus pesticides, pyrithroids,
Dimethyldithiocarbomate (DMTC), Pyrrolidine Dithiocarbomate (PDTC) and
Ethylene Bisdithiocarbamates (EBDC’s). Thiram belongs to the EBDC chemical
class, and the chemical name is Tetra Methyl Thiuram Disulfide (TMTD). The
common names in different parts of the globe are thiram (USA), thiuram (Japan),
and TMTD (USSR), TMT and TMTDS. Trade names include AAtack, Arasan,
Aules, Fermide 850, Fernasan, FMC 2070, Hexathir, Mercuram, Micropearls,
Nomersan, Pomarsol, Puralin, Rezifilm, Rhodiasan Express, Spotrete, Tersan,
Thiosan, Thiotex, Thiramad, TMTD 50 Borches, Thirasan, Thirame, Thiuramin,
Tiuramyl, Tirampa, TMTC, Trametan, Tuads and Tulisan (Hayes and Laws, 1990
and Meister, 1992).
The TMTD is a fungicide used in prevention of crop damage in the field and
protection of harvested crops from deterioration in storage or transport as mentioned
by National Institute of Safety and Health (NIOSH). Thiram was registered as a
general use pesticide by the U.S. Environmental Protection Agency (EPA). TMTD
xl
is used as a seed protectant, and also to protect the fruits, vegetables, ornamental and
turf crops from a variety of fungal diseases. It is also used as animal repellent to
protect fruit trees and ornamentals from damage by rabbits, rodents and deer. TMTD
can also be used in the treatment of human scabies, as a sun screen and as a
bactericide applied directly to the skin or incorporated into soaps (Hayes and Laws,
1990). TMTD is available in the form of dust, flowable, wettable powder (WP),
water dispersible granules and water suspension formulations and in mixtures with
other fungicides (Hayes and Laws, 1990 and Meister, 1992).
Predictions about combined effects of chemicals at No Observable Effect of
Chemical (NOEC) are rarely found in literature (Cynthia Rider and Gerald Le Blanc,
2005). Hayes and Laws (1990) studied the NOEC for thiram at 100 ppm (4.9
mg/kg/day) levels in experimental animals. There is inadequate literature available
regarding interaction of diseases of poultry and toxicities caused by environmental
pollutants (Fairbrother et al., 2004 and Kacmar et al., 1999). Similarly, information
on the effect of TMTD in causation of tibial dyschondroplasia (TD) in broilers is
meager in India (Lakshman, 2004 and Subapriya et al., 2007a, b & c).
Pesticides are also implicated in the large scale decline of wild life species
including birds (Ross and William, 2003) and application of biochemical
measurements as a tool to predict changes in their population has been advocated.
These measurements (Biomarkers) provide a rapid quantitative estimate of the toxic
effects at sub lethal level (Rath et al., 2007).
Thiram is a model and proven chemical to cause tibial dyschondroplasia
(TD) in broiler birds leading to weight losses and leg deformities (Rath et al., 2007,
and Tian et al., 2009). The TD is a cartilage abnormality which occurred in the
tibiotarsometatarsus of young rapidly growing chicks. The TD affected birds
xli
assumed unusual posture with a tendency to squat, which eventually led to lameness
and reluctancy to move. The condition is characterized by accumulation of immature
chondrocytes, delayed or deficient blood vessel penetration, failure of proper
endochondral ossification results in abnormal enlargement and deformation of entire
tibiotarsometatarsus / epiphyseo-metaphyseal region (Leach and Nesheim 1965;
Siller, 1970; Siller and Duff, 1970 and Riddell et al., 1971, Lakshman et al., 2002
and Subapriya et al., 2007c).
Available literature stresses more on the clinicopathological aspects of the
disease rather than on pathogenesis and molecular and ultra structural changes.
Hence, this study aims to evaluate the following aspects:
OBJECTIVES OF STUDY
1) To induce TD in broiler chicken by feeding them with graded levels of
thiram and to observe the development of Tibial Dyschondroplasia (TD)
and to evaluate the performance of birds.
2) To evaluate hematobiochemical changes in TD (Hematology, Serum

Biochemistry and Serum Enzymes).
3) To study the morphometry of tibial bones, liver and kidney weights of

birds.
4) To study the gross and histopathological changes of tibia, liver and
kidney, and histochemical changes in tibial cartilage.
5) To study the ultra structural (SEM and TEM) changes in TD affected

chondrocytes emphasizing on mitochondrial changes in different stages
and all other organelles.
6) To study the expression of selective gene (s) associated with

angiogenesis and cell survival in growth plate cartilage.
7) To study the ameliorative effect if any of copper sulphate (CuSo4),

LivOrdain (Herbal product -HP) and US Cura Tox (Chemical product -
CP) in TMTD induced TD.
xlii
CHAPTER - II
REVIEW OF LITERATURE
In agricultural practice, tetramethyl thiuram disulfide (TMTD) is used as one
of the most effective seed protectants and for grain storage, both in the form of
powder as well as slurry. The popular name of TMTD is thiram and trade names
include Arasan, Fernasan, Nomersan, Fomarsol, Tersan, Thiosan, Thiuramyl,
Thiuram, and thyrid-75 WP (Nene and Thapliyal, 1982).Thiram, as a protective
dithiocarbamate and a systemic fungicide, is widely used for foliar treatment in
fruits, vegetables, and ornamentals to control a number of fungal diseases (Tomlin,
1994).
2.1 THIRAM (TETRAMETHYL THIURAM DISULFIDE - TMTD)
As per the WHO the common name is Thiram, the identity can be made by
International Union of Pure and Applied Chemistry (IUPAC) as a Tetramethyl
thiuram disulfide and the Chemical Abstract Service (CAS) can made as
Tetramethyl thioperoxy dicarbonic diamide and the CAS registration number is 137-
26-8, the molecular formula is C6H12N2S4 the molecular weight is 240.4 and the
structural formula is as fallows.
The lethal dosage (LD50
) in rats (male and female) 560 mg/kg bwt, rat (male and female) 630 mg/kg bwt (as
xliii
a 20% suspension in propylene glycol) in mouse it is 1350 mg/kg bwt, in rabbit it is
210 mg/kg bwt and Sheep 225 mg/kg bwt.
2.2 TETRAMETHYL THIURAM DISULPHIDE (TMTD) INDUCED

TIBIAL DYSCHONDROPLASIA (TD)
Experimental studies by Vargas et al., (1983) revealed that TMTD
incorporated in broiler starter ration from day one to eight weeks of age (graded
levels of 30, 60, 120 and 240 ppm) caused TD and noticed leg abnormalities as
early as fifth day and pathological lesions in joints, especially in femoro-tibial
articulation, by the end of third week.
Veltmann et al., (1985) reported the first known incidence of TD in Single
Comb White Leg Horn (SCWLH) chicks when fed with dietary TMTD at 30mg/kg
without compromising on growth or bone mineralization. They recorded the highest
incidence of 40% TD in four week old birds. Veltmann and Linton (1986) observed
TD in SCWLH chicks induced by TMTD at different dosages i.e., at 30 and 60
mg/kg diet over a period of 6-weeks and reported a significantly higher incidence
and severity of TD in layer chicks. They recorded the highest incidence of 69% in 6
week old birds when fed with 60 mg/kg diet.
Edwards (1987) investigated the incidence of TD in chickens as a result of
dietary addition of thiuram, disulfiram and trace element mixture. He conducted two
experiments to determine the effect of thiuram or disulfiram @ 30 ppm on
development of TD in chicks either in the presence or absence of trace elements
such as Al, Ba, Br, Cr, F, Fe, I, Li, Mn, Mo, Ni, Si, Sn, Sr, V and Zn. The incidence
and severity of TD was lower in chicks fed on diet containing trace elements
whereas it was significantly higher in chicks fed with thiuram or disulfiram diet. In a
third experiment which involved addition of trace elements, he found no significant
xliv
effect on TD. Lastly in the fourth experiment addition of thiuram or disulfiram to the
diet had lowered the absorption of calcium from the gastrointestinal tract but did not
influence the biological half life of calcium in the chick.
Lakshman et al., (2002) conducted an experimental study in broiler chicks to
find out the effect of TMTD at the rate 30 ppm in inducing TD and the ameliorative
effect of CuSo4 at the rate 200 ppm. They found a positive effect of CuSo4 against
TMTD induced TD between 5th to 8th weeks of age.
Rath et al., (2004 & 2005) studied the mechanism of thiram induced TD in
chickens at 100 ppm level and stated that severe TD lesion developed in 90 % of the
birds in two days due to the suppression of chondrocyte maturation related gene
expression. In another study Rath et al., (2007) evaluated the efficacy of vitamin D3
or its metabolites on thiram induced (100 ppm and 50 ppm) TD in chickens and
concluded that vitamin D3 had not shown any useful effect. They further conducted
an experiment in young broilers to study gene expression changes related to
vascularization in TD by using thiram @ 100 ppm level for a period of 48 and 166
hours. They found an increase in the expression of VEGF gene by thiram at 48 hours
and continued beyond 166 hours. But they also found out a suppression of vascular
endothelial growth factor (VEGF) receptor gene and antiapaptotic (Bcl-2) gene at 48
hours post exposure to thiram. Down regulation of Bcl-2 receptor was observed even
at 166 hours, but not the case with VEGF receptor gene, statistically. They
concluded that failure of gene expression has resulted in the endothelial cell death
which compromised on vascularization, cartilage remodeling and removal of dead
chondrocytes leading to TD.
Stav et al., (2007) studied the differential regulation of Matrix
metalloproteinases (MMPs) namely MMP-2, 3, 9 and 13 by insitu hybridization
xlv
analysis and quantitative real-time polymerase chain reaction (QRT - PCR) in
chicken and turkey growth plate chondrocytes by using thiram as sensitive chemical.
All the MMPs diminished (P < 0.05) during this study and recovered later upon the
withdrawal of thiram. They concluded that MMP expression and growth plate
impairment were linked and this was facilitated by MMP 2 and 9.
Subapriya et al., (2007c) observed patho-morphological changes in broilers
by incorporating thiram at 15, 30, and 60 ppm in the diet for four weeks from the
day of hatch and observed a reduction in weight gain, lameness, abnormal bending
of tibial bones, enlarged hock joints and sternal recumbency. Tibio tarsus exhibited a
white opaque and unmineralised cartilage plug with thinning of the growth plate and
thickening of the hypertrophic layer, histologically.
2.3 EFFECT OF TMTD ON GROWTH RATE AND EGG PRODUCTION
Waibel et al., (1955) reported that during the summer of 1954, hens in
certain poultry farms of Minnesota suddenly laid soft shelled eggs. After thorough
investigation they found that ‘Arasan’ (TMTD) seed protectants were responsible
for egg production disturbances. They further studied the effect of dietary TMTD on
the growth rate of chicks and poults and observed retarded growth rate at 37.5 ppm
and leg weakness at 150 to 300 ppm levels. In another study Ackrson and Mussel
(1955) stated that Arasan was toxic for growing chicks with persistent depression in
their growth rate.
Waibel et al., (1957) studied the effect of TMTD toxicity in chicks, poults
and goslings, and observed that chicks and goslings were very sensitive to the
dietary poisoning at 40 ppm and 150 ppm respectively. Turkey poults however
appeared to be more resistant at 200 ppm levels. At 20 ppm level the chicks were
xlvi
slightly heavier than the controls and at 125 ppm growth rate was half that of the
control group.
Vargas et al., (1983) also reported a depression in growth rate in chickens
fed with 30, 60, 120 and 240 ppm of TMTD for eight weeks. Early clinical signs and
depression in growth was recorded on 5th day of feeding in groups fed with higher
doses i.e., 120 and 240 ppm whereas after 3 weeks of age it was seen in all groups.
According to Veltmann et al., (1985) differences in body weights were
insignificant at 30 ppm level of TMTD fed to chicks, but their histology revealed,
Tibial dyschondroplasia (TD). Veltmann and Linton (1986) studied the influence of
TMTD (@ 30 or 60 mg per kg diet) on the performance, incidence and severity of
TD in Single Comb White Leghorn (SCWLH) chicks. They reported that body
weights at three weeks of age and bone ash at four and six weeks of age of chicks
fed either with 30 or 60 mg TMTD/kg were significantly lower than that of controls.
However the dietary TMTD significantly increased the incidence and severity of TD
in layer chicks with the highest incidence of 69% in 6 weeks old birds.
Similarly Weidong Wu et al., (1990 and 1993) noticed an insignificant
reduction in growth rate in broiler chicks fed with thiram at 37 ppm and a significant
depression in growth rate at 75 ppm in comparison with mycotoxins induced
changes.
A correlation study between body weight gain and TD in Turkeys by Rath et
al., (1994) showed a significantly higher body weight gain with mild doses of
TMTD but without any TD lesion. Whereas in an experimental study conducted by
Rao et al., 1996, both layers and broilers, revealed a significant reduction in their
body weight and complete cessation of egg production within three days of feeding
TMTD diet at 30 mg/kg and 315 mg/kg doses respectively.
xlvii
Lakshman (2004a) mentioned that there was no significant effect on weight
gain in broilers at 30 ppm level of TMTD diet during first week of age, whereas at
8th week there was a significant reduction in weight along with weakness in legs. A
case of thiram contaminated leg abnormality in broilers in Andhra Pradesh (AP) was
also reported by Lakshman (2004b).
Balasubramaniam and Sukumar (2008) reported huge economic loses due to
poisoning in commercial layers in Tamilnadu when jowar was contaminated with
thiram. Leach and Monsonego-Ornan (2007) presented a 4 decade review on TD, in
which they gave emphasis on gene expression and endoplasmic reticulum (ER)
stress occurring in avascular transition zone of the growth plate leading to cartilage
abnormality.
Experiment on broiler chicks was conducted by Subapriya et al., (2007b) to
study the dose and time relationship in feeding TMTD at 15, 30 and 60 ppm levels
for four weeks of age and observed that severe depression in body weight gain in all
groups and a significant reduction in weight gain at 60 ppm level.
2.4 TIBIAL DYSCHONDROPLASIA (TD)
Siller (1970) observed unusual posture with a tendency to squat, which
eventually led to lameness and reluctancy in movement in five weeks old fowl. The
affected birds had retarded growth rate resulting in smaller than normal size. Most
striking features of TD affected birds were marked swelling of femoro-tibial joints,
enlargement of proximal extremity of the tibio-tarsus through midshaft wherein both
the epiphysis and metaphysis were involved. The increase in size of tibial head was
mainly due to a mass of translucent cartilaginous tissue below the indistinctly
defined growth cartilage layer under the dense white epiphysis.
xlviii
Riddell et al., (1971) reported widespread sub-clinical incidence of TD in
broiler chickens in Western Canada and observed abnormality in mature
metaphyseal cartilage of tibio-tarsus stated that severely affected birds often had
similar cartilaginous mass in proximal tarso-metatarsus with a marked bowing of
tibia because of which they were reluctant to move.
Edwards (1985) investigated the effects of age versus diet, potassium levels,
TMTD and ionophores in the diet on the development of TD and observed that
potassium supplementation of corn-soya bean meal diet (0.88 percent potassium)
had no effect on the incidence of TD. However, supplementation of a low potassium
(0.3%) corn-corngulten meal animal protein diet increased the incidence of TD. The
addition of thiuram to the diet caused an increase in TD. When thiuram was added to
the TD inducing diet it also caused a decrease in bone ash and in total and ultra
filterable plasma calcium levels. A significant negative correlation was obtained
between the incidence and score of TD and bone ash of the ends and middles of the
tibia when thiuram was fed.
Thorp et al., (1991) stated that the assessment of avian tibial
dyschondroplasia (TD) was based on examination of slices of the proximal
tibiotarsus with the naked eye. Their study examined the incidence and severity of
TD in broilers under four different dietary regimes and compared the efficacy of
naked eye assessment with histopathological examination. The diets contained
reduced levels of calcium relative to phosphorus with adequate (diet-1) and high
(diet-2) levels of vitamin D3 supplementation; a very low calcium diet (diet-3) and a
standard diet (diet-4) were also included. Gross examination suggested that TD was
present in 80 per cent, 79 per cent and 27 per cent of tibiotarsi from birds on diets 1,
xlix
2 and 4, respectively. However, histological examination indicated TD,
correspondingly, to be present in 18 percent, 39 percent and 6 percent of tibiotarsi.
Orth and Cook (1994) in their review on avian TD stated that growth plate
cartilage accumulates in the metaphyseal region of the tibiotarsus where growth
plate chondrocytes necrosed prematurely in the hypertrophic zone. This immature
cartilage resists vascularization due to which the growth rate of the birds slows down
and leads to economic losses. Thiram was found to be one of the causes for avian
TD.
Leach and Monsonego-Ornan (2007), stressed up on the need to have an
integrated approach involving a wide variety of scientists: poultry scientists, skeletal
biologists and pathologists. TD is regarded as a disease of rapid growth plate that
occurs in many avian species. In their report, they emphasized on gene expressions
and endoplasmic reticulum (ER) stress.
2.5 PATHOGENESIS OF TIBAIL DYSCHONDROPLASIA (TD)
Leach and Nesheim (1965) and (1972) reported that tibio-tarsal and tarso-
metatarsal cartilage abnormality in young rapidly growing chicks was due to
inherited physiological defect, the expression of which was under dietary influence
and that which resulted in development of low and high incidence strains through
family selection. Further they opined that the high incidence of susceptible strain
abnormality could easily be altered by dietary manipulation of mineral mixture
which had changed the acid-base or cation-anion base. McCapes (1967) described
that the cartilage abnormality in chicken was very much similar to that of turkey
osteodystrophy.
l
Incidence of cartilage abnormality in broiler chickens was investigated by
Hemsley (1970) in Australia who observed its widespread sub-clinical prevalence in
four different strains wherein the affected birds showed lameness and characteristic
“plug” of metaphyseal cartilage distal to proximal epiphyseal ends of tibia and (or)
metatarsus. Laursen-Jones (1970) observed similar type of cartilage abnormality
confined to proximal ends of tibia in chickens during postmortem examination.
According to Siller and Duff (1970) tibail dyschondroplasia condition was
confined apparently to broilers of different strains under widely varying conditions
and observed that bilateral symmetrical lesions were restricted to proximal ends of
both tibio-tarsi and tarso- metatarsi of which the incidence and severity was
considerably greater in the former. Further, they mentioned that the fundamental
lesion was a persistent over grown cone of primitive diaphyseal cartilage which was
probably due to deficient or delayed blood vessel penetration. This resulted in
improper enchondral ossification, enlargement and deformation of the growth plate,
because of which cortical bone weakness and bending of the head of tibio-tarsus
occurred.
Similar report on TD was also made by Wise and Jennings (1972) in
domestic meat type poultry of four weeks of age than in two weeks, wherein the
characteristic ‘uncalcified plug’ lesion of proximal metaphyseal cartilage of
tibiotarsus and some times tarsometatarsus was observed.
Dennis et al., (1974) mentioned that chicken TD was characterized by
impaired endochondral ossification of tibio-tarsus, which led to the presence of an
abnormal mass of cartilaginous tissue adjacent to epiphyseal growth plate.
Examination of the components of mass revealed that the content of proteoglycan
and collagen differed considerably from that of articular cartilage, but was similar to
li
that of growth plate of normal and TD effected birds of same age. No gross
difference existed in the proportion of soluble collagen in both types of cartilage.
Therefore, the authors suggested that abnormal cartilage formation was probably due
to penetration of epiphyseal plate during early development. In vitro incubation of
cartilage slices resulted in lower rate of proteoglycan biosynthesis coupled with
degeneration, thus became a possible factor in prevention of normal osteogenesis.
Riddell (1976) studied the pathogenesis of TD by comparing certain features
of growth plate vascular supply between two strains and observed that there was no
significant difference in the vascular tunnels at zone of hypertrophy but it was
significantly higher in proximal plate than the distal plate in both strains.
Leach and Gay (1987) stated that abnormal cartilage development was
associated with chondrodystrophy, TD and rickets and opined that the former
condition resulted due to many nutrient deficiencies and was characterized by short,
thick bones and narrowed epiphyseal growth plate. An etiological experiment by Bai
and Cook (1994) to study TD like lesion in light-type chicks fed with cysteine
supplemented diets revealed large mass of abnormal opaque cartilage extending into
proximal tibio-tarsal metaphysis.
Rath et al., (1997) studied TD and reported that metabolic defect of the
growth plate resulted in retention of cartilage plug that failed to resorb and undergo
endochondral bone formation. They mentioned that this condition was common in
rapidly growing meat-type poultry characterized by impaired resorption of cartilage,
remodeling and vascularization.
In another study Rath et al., (1998) reported that chondrocytes of affected
growth plate failed to undergo developmental transitions which led to endochondral
ossification and opined that this was a metabolic disorder of growth plate cartilage in
lii
fast-growing, meat type poultry and was characterized by retention of vascular
cartilage beyond the stage of bone formation.
A detailed study on avian TD was carried out by Pines et al., (2005) who
stated that it was the most prevalent skeletal abnormality which caused huge
economic loss and posed as a major animal welfare problem. They described that
this condition was characterized by un-calcified and un-vascularized cartilage which
extended from epiphysis to metaphysis. They made an attempt to differentiate
between mammalian and avian growth plate disorder and suggested
multidisciplinary research at various levels like genetic approach based on
microarray technology, chicken genome project together with cell and organ culture
methodology, genetic selection, nutritional manipulations and environmental
approaches for a better understanding of molecular mechanisms of TD thus paving
the way for future reduction in its incidence.
2.6 CLINICAL SIGNS OF TIBAIL DYSCHONDROPLASIA (TD)
Clinical signs of TMTD toxicity were studied in chicks, poults and goslings
by Waibel et al., (1955 and 1957) and reported that the birds showed retardation of
growth, loss of weight and weakness in legs. This syndrome was characterized by
inability to stand, enlarged hocks, crooked and curled toes and in certain cases
perosis and spraddles. These symptoms occurred within a week at higher dosage
level (100 ppm).
Vargas et al., (1983) first observed lameness, reluctance in movement of
birds at five days age after feeding TMTD at 120 and 240 ppm levels. Later they
noticed enlarged hock joints, shortening and twisting of the tibio-metatarsal bones,
crooked toes and curled toes. All the affected birds stood on their hock joints
whereas some of the affected birds walked short steps and crossed their legs. The
liii
most striking feature was abnormal bowing and bending of femoro-tibio-tarsal
bones.
In another study Veltmann and Linton (1986) observed swelling and bowing
of femoral-tibial joint in birds fed with 100 mg/ kg TMTD diet, but not so when fed
with 30 mg or 60 mg /kg TMTD diet.
Ramljak et al., (1988) studied TMTD toxicity as a possible cause of leg
weakness in broiler chicks by examining a suspected field case of poisoning wherein
they found thiram in four feed samples of starter ration. Chicks fed with this ration
developed typical clinical signs of TD in one or both the legs. Postmortem
examination revealed swollen hock joints with displacement of achilles tendon from
the inter-condylar surface and slight catarrhal enteritis.
Fallavena et al., (1991) recorded the occurrence of locomotors problems in
TD like bowing of tibio-tarsus in 18,250 male birds of three different broiler strains
reared under similar nutritional and managemental conditions. Leg problems were
observed in 1.5% birds without any significant difference among strains.
Weidong Wu et al, (1990 and 1993) studied leg shape abnormality in TMTD
induced incidences of TD when fed with 37 and 75 ppm wherein they mentioned
that at lower level there was no sign of abnormality.
However, Lakshman et al., (2002) reported signs of lameness, reluctance in
movement in broilers at five weeks age when fed with TMTD diet at 30 ppm level
and in later age groups more than 90% of birds showed enlarged hock joints,
crooked and curled toes. They mentioned that most of the affected birds stood on
their hock joints where as some of them walked with short steps or wobbling gait
and stated that the most striking feature was the abnormal bowing and bending of
femoral-tibiotarsus.
liv
Rath et al., (2004) studied the comparative efficacy of different
dithiocarbamates like DMTC (Sodium dimethyldithiocarbomate) and PDTC
(pyrrolidine dithiocarbomate) with TMTD to induce TD in poultry. They observed
increased incidence of TD and significant depression of growth rate at 50 ppm of
TMTD than at 100 ppm of DMTC or PDTC respectively.
Subapriya et al., (2007c) recorded lameness, enlarged hock joints, shortened
tibio-tarsus, extended hind limbs, sterna recumbence, curled toes and straddles in
chicks that were fed with 15 – 60 ppm levels of TMTD for more than 21 days.
2.7 HAEMATOLOGICAL PARAMETERS IN TMTD INDUCED TD
Weidong Wu et al., (1990) in their study on prevention of thiram (35 ppm)
induced TD in birds fed with 200 ppm each of Cu and Zn for 1-17days recorded
insignificant values of heamatocrit.
Regarding TLC of layers in thiram induced experiment there was a
significant decrease in lymphocytes and a sharp increase in heterophils, other cells
remained within normal limits as reported by Rao et al., (1996). Rath et al., (2004)
in their study stated that there was a profound effect on several hematological values
of white blood cells, and hematocrit (p≤ 0.05) was indicative of thiram induced
stress. In contrast, Subapriya et al., (2007a) observed changes in different
hematological parameters and expressed that there was no significant difference in
PCV and Hb levels.
2.8 SERUM BIOCHEMICAL PARAMETERS IN TMTD INDUCED TD
2.8.1 SERUM PROTEIN, GLUCOSE AND CHOLESTEROL
Walser et al., (1982) observed a significant decrease in serum total proteins
(p<0.05) in chickens affected by TD by feeding Fusarium @ 2, 5 and 10 percent
levels.
lv
Coles (1986) and Mishra et al., (1998) reported hyper cholesterolemia in rats
exposed to thiram at 5, 10, 25 ppm for 180 and 360 days. Akin to their observations,
Subapriya et al., (2007a) recorded a significant (p<0.05) difference in serum
cholesterol in birds fed with thiram at 15, 30 and 60 ppm levels.
Rath et al., (2004) conducted a comparative study to observe the efficacy of
different dithiocarbomates which induced TD in poultry for a period of three weeks.
They reported insignificant values of serum total proteins, glucose, cholesterol,
triglyceride and enzyme creatine kinase. Similarly Subapriya et al., (2007a) reported
insignificant values of serum proteins, albumin, globulin and albumin: globulin ratio
in thiram induced TD in broiler chickens fed with different levels of toxin (15, 30
and 60 ppm) and also no significant difference in serum glucose levels.
2.8.2 SERUM ENZYMES (Alkaline Phosphatase - ALP, Alanine Amino

Transferase - ALT, Aspartate Amino Transferase - AST, and Gamma
Glutamyl Transferase - GGT)
Tanabe and Wilcox (1960) mentioned that serum alkaline phosphatase (SAP)
level was extremely high in young chicks and reached a low level in adult stage.
They inferred that these changes corresponded with growth rate and also due to
differences in bone formation.
Rath et al., (1994 and 2004) observed SAP and aryl sulfate activity in severe
TD lesions in turkeys and in poultry fed with thiram (100 ppm) and reported that
both enzymes exhibited significantly lower activity (p<0.05). This indicated failure
of cartilage calcification and matrix degradation in turkeys but not so in poultry.
They mentioned that SAP activity was significantly elevated whereas alanine amino
transferase (ALT) and aspartate amino transferase (AST) showed insignificant
results in poultry which indicate negative effect of thiram on SAP but not so on ALT
and AST respectively.
lvi
Lakshman (2004) recorded marginally higher SAP activity in broilers fed
with 30 ppm thiram diet between 5 and 8 weeks of age and observed that as the age
advanced, SAP activity also increased. Rath et al., (2007) observed no substantial
differences in serum concentration of ALT, AST, gamma glutamyltransferase
(GGT), creatine kinase, and alkaline phosphatase (ALP) between different treatment
groups with vitD3 metabolites and 100 ppm and 50 ppm thiram. These observations
suggest that there is no much damaging effect on muscle, liver, or bone damaging
effects of thiram. Whereas, Subapriya et al., (2007a) reported insignificant activity
of SAP, ALT, AST and GGT in TD affected chickens stating that thiram had no
influence.
Li et al., (2007) conducted an experiment to study the effect of thiram on
antioxidant capacity of liver in broilers. Thiram fed at 50 and 100 mg / kg diet which
resulted in increased TD scores, serum AST activity and malondialdehyde (MDA)
content of liver and a decreased activity of super oxide dismutase (SOD) and
glutathione peroxidase (GSH-Px).
2.8.3 SERUM CALCIUM AND PHOSPHORUS IN TMTD INDUCED TD
Edwards (1988) studied the effect of change in the dietary calcium-to-
phosphorous ratio with relation to TD. The calcium: phosphorous varied from 0.8 to
1.8 in the 480 batch of cockerels. The lower Ca: P ratio (0.8) resulted in the increase
of TD upto 68 to 79%.
Rath et al., (1994 and 2004) mentioned that there was no difference in Ca
and P levels in turkeys with severe TD lesion and in poultry fed with thiram at the
rate 100 ppm and ruled out the possibility of imbalance in calcium and phosphorus
metabolism that could contribute for development of TD.
lvii
Lakshman (2004) observed significantly higher mean values of calcium (Ca)
in thiram fed broilers (30 ppm) with advancing age (5-8 weeks) and opined that such
elevation could be due to interference of TMTD with calcium mineralization
process.
Rath et al., (2007) evaluated the efficacy of vitamin D3 or its metabolites on
thiram-induced (100 ppm and 50 ppm) tibial dyschondroplasia in chickens and
recorded significantly decreased Ca and P levels.
In another study Subapriya et al., (2007a) also reported a significant decrease
in the serum calcium level in the birds fed with 60 ppm thiram. There was no
significant variation in birds fed with lower levels (15 or 30 ppm) of thiram and
attributed that this fact could be due to thiram which at higher levels inhibited
calcium absorption from intestines.
2.9 GROSS PATHOLOGY OF TIBIAL DYSCHONDROPLASIA (TD)
Vargas et al., (1983) and Veltmann et al., (1986) studied TD in broilers up to
eight weeks of age by feeding graded levels of TMTD at the rate 30, 60, 120 and
240 ppm respectively. The most striking feature was swelling and abnormal bowing
of femoro-tibial joint on fifth day characterized by a white opaque mass of cartilage
developed distally to epiphyseal plate. Similar report was also made by Lakshman et
al., (2002) and Subapriya et al., (2007c).
Vargas et al., (1983) stated that in higher levels of TMTD (120 and 240
ppm) the lesion extended up to some distance down the shaft and graded the lesion
as mild, moderate and severe as per age (5 day to 3 weeks) and dose (ascending
levels).
Veltmann et al., (1985) studied TMTD (120 and 240 ppm) induced TD in
growing layers and reported that the condition was characterized by an abnormal
lviii
plug of non vascularized, unmineralised, white opaque cartilage in the proximal end
of the tibio-tarsus.
Weidong Wu et al., (1990) reported that thiram induced abnormal cartilage
formation in tibio-tarsus in the broilers wherein they described that there was
retention of uncalcified and avascular cartilage plug in proximal metaphysis.
Rao et al., (1996) recorded gross changes in different organs of layers fed
with TMTD at different levels of 79, 158, 236, and 315mg/kg diet wherein they
observed varying degrees of severe congestion in liver, kidney, lungs and brain
from 158 mg/kg diet onward.
Lakshman et al., (2002) studied TMTD (at the rate 30 ppm) induced TD in
broilers and reported that the condition was characterized by an abnormal plug of
non vascularized, unmineralised, white opaque cartilage in the proximal end of the
tibio-tarsus. They graded the lesions as mild + (<2mm), moderate ++ (2mm to
5mm) and severe +++ (>5mm) and recorded gross changes in liver and kidney
such as mild enlargement, moderate congestion in both organs and pale focal areas
in liver. Similar lesions were described by Subapriya et al., (2007c).
Rath et al., (2004) studied the comparative efficacy of different
dithiocarbomates to induce TD in poultry in which they observed that there was no
relative change in liver weights. In another study Rath et al., (2007) mentioned that
TD as a major metabolic cartilage disease in fast growing chicken which was
induced by them within 48 hrs of feeding thiram diet at the rate 100 ppm and was
characterized by distention of proximal growth plates of tibia, lack of blood vessels
and inability to form bone.
Perusal of literature revealed scanty information on the morphometrical
studies of viscera in birds affected with TD.
lix
2.10 HISTOPATHOLOGY TD
2.10.1 TIBIAL BONE GROWTH PLATE CARTILAGE (TGPC)
Several authors described that the fundamental lesion in TD of fowl was a
large mass of abnormal cartilage confined to proximal metaphysis of tibio-tarsus and
tarso-metatarsus. This was characterized by accumulation of immature chondrocytes
and delayed or deficient blood vessel penetration which led to failure of proper
endochondral ossification resulting in enlargement and deformation of entire
epiphyseo-metaphyseal region (Leach and Nesheim, 1965; Siller, 1970, Siller and
Duff, 1970 and Riddell et al., 1971).
Riddell et al., (1971) studied TD in broiler chickens and reported failure of
vascularization of a large mass of mature cartilage that affected epiphyseal lines of
tibio-tarsus and tarso-metatarsus. They further noticed reduced tunneling,
calcification and improper bone formation that interfered with the formation of
surrounding cortical bone, which was either absent or very thin and fragile.
Riddell (1976) studied the pathogenesis of TD in chickens and observed that
vascular tunnels invading the zone of hypertrophy in proximal growth plate were
significantly fewer in high-incidence chickens than in low-incidence chickens.
Vargas et al., (1983) observed pathological changes in TMTD (30, 60,120
and 240 ppm) fed chickens (day old to 8 weeks of age) and classified the lesions as
mild, moderate, and severe. Moderate lesions consisted of small chondrocytes with
uniform eosinophylic cytoplasm and pyknotic nuclei. The cartilaginous matrix was
abundant and slightly basophilic. In severe cases the zone of proliferation was
thickened without any cellular abnormality, but was penetrated by fewer vessels that
traversed and appeared as empty clefts usually by a necrotic cartilaginous matrix.
The tip of the abnormal cartilage was surrounded by a thin and irregular layer of
spongy bone. Michael et al., (1992) also noted large “plugs” of cartilage attached to
lx
metaphyseal growth plate which had occluded blood vessels in the epiphysis and
physis in six weeks old birds.
Veltmann et al., (1985) observed a mass of white opaque cartilage of
proximal tibio-tarsal growth plates of 3 - 4 week old layer chicks fed with 30 mg /
kg of TMTD diet and found that it was un-mineralized with partly hypertrophic
chondrocytes characterized by pyknotic nuclei and shrunken eosinophylic
cytoplasm.
Bai and Cook (1994) studied TD like lesion in fowl fed with cysteine and
reported widened pre-hypertrophic and proliferative zones in contrast to the one in
normal growth plate. Rath et al., (1994) reported that TD lesion in turkeys had
hemorrhagic areas populated with large numbers of erythrocytes, often necrotic cells
and heterophils which was indicative of inflammation. The striking feature was the
presence of multi nucleated chondrocytes adjacent to the lesion.
Throp et al., (1991) reported that the proliferative zone in growth plate of 3
weeks old birds consisted of flattened chondrocytes whereas the transitional zone
had rounded chondrocytes with abundant matrix.
Tselepis et al., (1996) studied the distribution and expression of
macromolecules in cartilage matrix in avian TD and observed an accumulation of
transitional chondrocyte like cells, some of which had pyknotic nuclei and strong
eosinophylic cytoplasm.
Lakshman et al., (2002) conducted an experiment to study TD lesions in
broilers fed with TMTD diet and classified the lesions as mild, moderate and severe
among which the former consisted of a thickened zone of hypertrophied cartilage
with irregular blood vessel penetration from metaphysis. Moderate lesion consisted
of small spherical or oval chondrocytes with pyknotic nuclei and many vacuoles
lxi
were present in the slightly thick proliferating layer and zone of hypertrophic
cartilage. In severe lesions, they described thickening of both these zones up to
metaphysis and invasion of few blood vessels.
Comparative efficacy of various dithiocarbomate was studied by Rath et al.,
(2004) in inducing TD in poultry. Affected areas of growth plates of chicks fed for
two days with thiram showed interesting differences in chondrocyte morphology and
blood capillaries. Thiram affected chondrocytes in mature cartilage were
characterized by nuclear shrinkage and empty lacunae during later times and also
involution of capillaries. Whereas chondrocytes did not differ much from those of
control in 15 day old birds fed with thiram. The authors opined that as the age had
advanced viz. at 28 days, chondrocytes showed further shrinkage and empty
lacunae.
Growth plate in TD in poultry showed irregular cell differentiation of
chondrocytes with consequent aberrant cartilage vascularization and mineralization
(Pines et al., 2005). In another study on thiram toxicosis in broiler chickens
Subapriya et al., (2007c) observed that the epiphyseal hyaline cartilage in earlier
groups was normal in both control and TMTD fed birds. Thinning of growth plate
and the proliferating layer was characterized by lack of parallel arrangement of
chondrocytes which resulted in irregular columns. In transitional layer, abnormal
thickening was associated with ovoid chondrocytes and eosinophylic matrix while
thickened hypertrophic layer revealed empty vascular invasion, eosinophylic matrix,
pyknotic nuclei and empty capsules along with non-nucleated chondrocytes.
2.10.2 LIVER AND KIDNEY
Walser et al., (1982) observed pale and enlarged kidneys in 80% of the
chicks that were affected with TD due to Fusareum roseum diet. They revealed
lxii
diffuse tubular nephrosis and occasional accumulation of urates in tubular lumen of
kidney. Dose dependent degenerative changes in the liver and kidney of layers were
reported by Rao et al., (1996) who studied the effect of thiram on the performance
of birds at different dosages (79, 158, and 315 mg / kg diet).
Lakshman (2004) recorded mild hepatic changes in liver and mild hydropic
degeneration of proximal and distal convoluted tubules in kidneys during seventh
and eight week of age when fed with 30 ppm of TMTD.
Subapriya et al., (2007c) reported several microscopic changes in livers of
birds fed with different doses of thiram. At 15 ppm level venous and sinusoidal
congestion, vaculative degeneration of hepatocytes, macro and micro vesicular fatty
changes, Kupffer cell hypertrophy, focal mononuclear cell collection, portal vein
congestion, peri-portal fibrosis and biliary hyperplasia were observed. Occasionally
degeneration of bile duct epithelium occurred. Focal necrosis, marked biliary
hyperplasia, periductular mononuclear infiltration was noticed in 30 ppm group,
whereas in 60 ppm group hepatic parenchyma showed diffuse micro vesicular fatty
changes, lymphocyte infiltration, micro-granuloma and peri-venous fibrosis during
second week of age. Same authors observed congestion, tubular epithelial
degeneration and necrosis in sections of kidney of birds fed with at 30 and 60 ppm
thiram. These changes were also noticed in groups fed with 15 ppm level during
fourth week along with focal interstitial mononuclear cell infiltration in 30 ppm 60
ppm thiram fed group.
2.11 IMMUNOHISTOPATHOLOGY OF TIBIAL DYSCHONDROPLASIA

(TD)
Histochemical demonstration of acid phosphatase (ACP) in TD affected
growth plate cartilage of chicks was studied in two experiments by Lawler et al.,
lxiii
(1988) wherein Fusaroium equiseti was fed in intervals of 7 days up to 28 days and
in intervals of 2 days up to 6 days in experiments I and II respectively. They
observed significant decrease of ACP in cells at day 21 in experiment I and at day 6
in experiment II which suggested to be an insufficient magnitude.
According to Rath et al., (1994) activity of both enzymes alkaline
phosphatase (AKP) and aryl sulfate (ASP) decreased in TD affected turkeys which
probably led to premature death of chondrocytes in growth plate. Compared the
profiles of non-collagenous and collagenous proteins in normal and TD affected
tissues by in vitro biotinylation of epiphyseal cartilage followed by sequential
extraction using 4 M guanidine hydrochloric acid (GuHCL) and pepsin digestion
respectively. Electrophoretically separated proteins were analyzed on Western blot
and observed for any differences between normal and TD cartilages. They opined
that bitinylation enhanced detectibility of extracted proteins; however no major
differences existed in patterns of both protein types between the two groups.
Pines et al., (2005) highlighted the possible cause of TD in turkeys and
broilers were expression of MMPs which played an important role in cartilage
vascularization and noted that increased MMP-9 and enhanced vascularization were
associated with mechanical loading. Gay et al., (1985 and 2007) studied the
immunolocalization of vascularization factors in normal, TD and Rachitic cartilage
and demonstrated the presence of vascular endothelial growth factor (VEGF), its
receptor Fik-1and matrix metalloproteinases MMP-9 and MMP-13 in all tissues. In
most cases immunostaining was intracellular except in the vicinity of blood vessels
where the matrix was also stained. Results suggested that the expression of these
four proteins was not a key factor in development of the avascular cartilage in
avian.
lxiv
Crucial role of matrix metalloproteinases (MMP) in growth plate
vascularization and ossification processes involving proteolytic cleavage and
remodeling of extra cellular matrix (ECM) in TD lesion was studied by Simsa et al.,
(2007) who explained differential regulation of MMPs in cultured chondrocytes
from chicken and turkeys. They noticed that retinoic acid (RA) elevated MMP-2
activity in both species, but in chicken it only induced MMP-9 activity. In contrast
MMP-9 activity in turkey chondrocytes was induced by phorbol 12-myristate 13-
acetate (PMA) treatment. The authors specified that thiram reduced MMP-2 and
MMP-13 activity in both chicken and turkey chondrocytes in vitro although a
tenfold concentration was required. These results suggested that mechanism of
MMP regulation differed in the GP of these closely related avian species thus
altering the matrix assembly as exemplified by TD development.
Tian et al., (2009) studied the thiram induced TD in broilers for
identification of differentially expressed genes in growth plate cartilage. Col I
(collagen type I) and Hsp90 (heat shock protein) were detected by
immunohistochemistry at different stages of TD which involves in matrix
formation, endochondral ossification, developmental regulation, electron transport
in the mitochondrial respiratory chain and vascularization.
2.12 ULTRASTRUCTURAL PATHOLOGY OF TIBIAL

DYSCHONDROPLASIA (TD)
Scanty information is available from the review of literature on
ultrastructural studies of growth plate cartilage cells, liver and kidney in birds of
thiram induced TD.
According to Lowther et al., (1974) Tibial dyschondroplasia is characterized
by impaired endochondral ossification and by the presence of an abnormal mass of
lxv
cartilaginous tissue adjacent to the epiphyseal growth plate in the tibiotarsus of
chickens. The proteoglycan and collagen content of this cartilaginous mass from
chickens with tibial dyschondroplasia, according to them, differed considerably from
that of hyaline articular cartilage but was similar to that of epiphyseal growth plate
cartilage from normal birds of the same age or from birds with the abnormality. The
purified proteoglycan subunits extracted from the abnormal cartilage and from
normal epiphyseal plate cartilage, by the authors, appeared to be identical in respect
to molecular weight and composition. Their findings indicated that the abnormal
cartilage mass is formed by proliferation of epiphyseal plate cartilage during early
development.
Brighton et al., (1978) studied the role of mitochondria in growth plate
calcification of a rachitic model and in a normal growth plate of rats. They opined
that the matrix calcification begins at the level in the bottom of the growth plate
hypertrophic zone as the mitochondria at this level lose calcium. Calcification in the
growth plate is a complex biophysical and biochemical phenomenon that is not
completely understood at the present time. Their findings are in support of
hypothesis that mitochondria play an important role in matrix calcification.
Howlet et al., (1984) stated that the vascularity of the growth plate has an
important role in the pathogenesis of certain diseases of long bones as well as a vital
role in regulating their growth in length. Broiler chickens often suffer tibial
dyschondroplasia, which produces significant deformities in chickens of marketable
age (7-9 weeks). Dyschondroplasia of this type is considered to be a direct
consequence of an inadequate metaphyseal vascular supply. They examined the fine
detail of the vascular supply of the normal proximal tibial growth plate, to provide a
lxvi
basis for studying possible vascular involvement in the pathogenesis of this form of
dyschondroplasia.
According to Hargest et al., (1985) early EM changes were seen in rapidly
growing chickens and other animals affected by TD. Chondrocytes in apparently
hypertrophic zone of the growth plate appeared normal but at EM level, cells of
proximal portion of lesion underwent necrotic changes which suggested energy
depletion. They observed that the changes included dilatation and vesiculation of
rough endoplasmic reticulum (RER), enlargement of para-nuclear space, swollen
mitochondria with electron-dense flocculent material, and dilatation of Golgi
saccules. Few cells contained crescentric caps of condensed nuclear chromatin
margination which is indicative of apoptosis. Necrotic cells have shown
karyorrhexic and pyknotic nuclei with an amorphous osmiophilic masses.
Further they opined that cytoplasm consisted of a well developed ribbon
shaped RER with dilated regions in the vicinity of Golgi complex and secondary
vacuoles.
Ultrastructural changes in TD lesions induced by Fusarium roseum toxicity
in chicks was recorded by Haynes and Walser (1986) who conducted an experiment
on chicks that were divided into two groups of which one was treated twice daily
with TDP-1(a mycotoxin produced by Fusarium roseum) and the other was controls.
Treated birds were sacrificed in intervals of two days up to 14 days for evaluation of
lesions. The lesions were absent in initial six days, however some birds developed
mild lesions after 4 and 6 days of toxin diet. Beyond this period they observed
moderate to severe lesions characterized by intracellular lipid accumulation and
necrotic chondrocytes. Abundant ER dilated with large vacuoles, Golgi associated
vacuoles, and peri-cellular matrix around chondrocytes was seen. In few cells
lxvii
mineral aggregates in interstitial septa and lipid vacuoles were observed of which
the former increased the lucency of cytoplasm of necrotic chondrocytes.
Ling et al., (1995) also recorded EM changes in samples of growth plate
cartilage lesion of high and low incidence TD affected birds collected in intervals of
seven days up to 21 days of age. Only after 21 days necrotic chondrocytes in
prehypertrophic zone of high incidence group contained large lipid inclusions,
vesiculated and disarranged stacks of rough ER along with apoptotic cells which had
similar cytoplasmic features and crescentric caps of condensed chromatin.
Further, comparative studies by Ohyama et al., (1997) on programmed cell
death in epiphyseal growth plate of normal and dyschondroplastic male broiler
chicks revealed minimal level of apoptosis in affected cartilage. Their finding was
linked to impairment of apoptosis, as a result of which the tissue contained immature
cells that outlived their normal life span. In the same experiment the authors
examined cells in TD growth plate by TEM and stated that nuclear membrane
appeared crenated without any evidence of chromatin condensation. In contrast cells
bordering vascular channels showed evidence of cell death and apoptosis with
peripheral chromatin condensation.
Christopher and Irving (2002) made a review over the fate of the terminally
differentiated chondrocytes evidence for micro-environmental regulation of
chondrocytes apoptosis. They strongly suggest that the terminally differentiated cells
are deleted from the cartilage by apoptosis. Indeed, morphological, biochemical, and
end-labeling techniques confirm that death is through the apoptotic pathway. Since
the induction of apoptosis is spatially and temporally linked to the removal of the
cartilage matrix, this activity is associated with Ca2+, Pi, and arg-gly-asp {(peptide
sequence) (RGD)} containing peptides of extra cellular matrix proteins.
lxviii
2.13 MOLECULAR PATHOLOGY OF TIBIAL DYSCHONDROPLASIA
(TD)
Isolation and characterization of chicken Bcl-2 gene was done by Yutaka et
al., (1992) in variety of tissues including lymphoid and neuronal organs in adult
and embryonic stages. Recent studies indicated that Bcl-2 gene had the ability to
block apoptosis of hematopoietic cells. The authors described that this gene was
homologous to human Bcl-2 protein and consisted of two regions which surrounded
a totally non-homologous region. Its transcripts were detected in thymus, spleen,
kidney, heart, ovary and brain. The primary transcript was spliced to encode a
25,687 delton (233 a.a protein). In adult birds expression of Bcl-2 gene was much
less in bursa Fabricius, whereas in the embryo it was extensively expressed. These
findings made the authors to conclude that homologue of human Bcl-2 gene existed
in chicken.
Knopov et al., (1995) conducted a study on gene expression and AKP activity
associated with chondrocyte differentiation in the epiphysis of normal and TD
affected turkeys. They noted that osteopontin (OPN) and collagen type X were
expressed by hypertrophic cells in both GP and secondary ossification centre,
parallel to manifestation of AKP activity. In TD lesions they found that collagen
type II expression was restricted to non-hypertrophic chondrocytes of upper part of
GP whereas OPN or collagen type X expression was not seen.
Neufeld et al., (1999) studied the expression of VEGF gene and concluded
that its receptors were highly specific mitogen for vascular endothelial cells. As a
result five isoforms of this gene were generated by alternative splicing from a
single gene. Various forms of VEGF gene bind to two tyrosine kinase receptors
viz., VEGFR-1 (flt-1) and VEGFR-2 (KDR/flk-1) which were expressed almost
lxix
exclusively in endothelial cells. The authors explained that the expression of this
gene was potentiated in response to hypoxia by activated oncogenes and a variety
of cytokines which induced cell proliferation, migration and had inhibited
apoptosis. In vivo VEGF gene induced angiogenesis as well as peri-abilization of
blood vessels and played a central role in regulation of vasculogenesis.
Rath et al., (2006) conducted an experimental model to study the
pathogenesis and prevention of thiram induced TD by 50-100 ppm dietary induction
of TMTD for two days. The birds fed with 100 ppm toxin were monitored for
expression of selective genes associated with vascularization and cell survival at 48
and 166 h after feeding. RT-PCR and capillary electrophoresis were used to
determine the expression of VEGF, its receptor VEGFR and anti apoptotic protein
Bcl-2 genes. Results showed maximal suppression of both genes at 48h where
sporadic capillary endothelial cell death was observed by histochemical methods.
Except for Bcl-2 this suppression was not evident at 166 h when the lesion was
visually discernible with chondrocyte death. Further analysis suggested that dead
cells in the lesion seemed to be related to early death of capillary endothelial cells
which expressed VEGFR through which VEGF transduced signals for angiogenesis.
Thiram initiated cell death was also evident in Bcl-2 gene suppression.
VEGF gene expression related to vascularization in TD affected broilers fed
with 100 ppm thiram to a week old chicks for 48 h was observed by Rath et al.,
(2007) who recorded the expression of this genes for its receptors VEGFR1,
VEGFR2 and Bcl-2 in GP cartilage at 48h and 166 h respectively. RT-PCR and
capillary electrophoresis was employed for determination of expression of this gene
relative to 18S gene as an internal strand. The authors found that there was an
increase in VEGF expression in thiram fed chicks at 48 h which in turn remained
lxx
elevated above the control level at 166 h. Suppression of genes encoding both VEGF
receptors and Bcl-2 was evident at 48 h in thiram-fed chickens when there was
absence of any visible distension of GP. Although presence of a significant
distension of GP in thiram treated birds was seen at 166 h, the expression of VEGF
receptors was still lower. The authors opined that some early effects of thiram on GP
might have led to failure of genes encoding VEGF receptors and Bcl-2 thus resulting
in endothelial cell death. Incomplete vascularization and cartilage remodeling in
addition to removal of dead chondrocytes caused TD lesions.
Gene expression of four members of MMP family (MMP- 2, 3, 9 and 13) in
thiram induced TD lesions and the process of recovery from TD by in-situ
hybridization analysis and QRT-PCR was studied in three groups of broilers. One
group was fed with thiram enriched diet, second recovery group fed with thiram diet
during first week of experiment followed by normal diet from second week and
lastly third group birds were control (Dan et al., 2009). According to them a model
was established for induction and recovery of TD and the results obtained showed
that even though MMP diminished in the TD lesion (p<0.05) the growth plate was
able to repair itself and reappear during the process of recovery from TD. They
finally suggested that the results strengthened the link between MMP expression and
growth-plate impairment.
Hasky-Negev et al., (2008) observed the expression of MMP during
vascularization and ossification of normal and impaired avian growth plate wherein
they reported that MMP gene regulated angiogenesis during endochondral
ossification which in turn was impaired in TD and rickets. Known family members
important for endochondral ossification viz., MMP2, 3, 9 and 13 were expressed in
normal and impaired conditions. Expression of MMP-3, 9 and 13 was reduced in the
lxxi
lesion and was lined up parallel to expulsion of blood vessels which extended up to
the border of the lesion without penetrating it. In contrast MMP-2 had over
expressed in racketic lesion than that of TD lesion. Another observation recorded by
them was that racketic lesions were populated with proliferative chondrocytes and
hypertrophic markers, whereas TD lesions were filled with chondrocytes. As per the
findings, authors suggested that MMP-3, 9 and 13 played a role in vascularization
and ossification process, whereas MMP-2 was related to chondrocyte differentiation
and was involved in cartilage remodeling in avian growth plate.
2.14 PREVENTION OF TD BY ADDITION OF CuSO4, HEPATO

PROTECTIVE AGENT AND A TOXIN BINDER
Possibility of prevention of thiram induced dyschondroplasia in broiler
chicks by using copper and other trace elements as a diet supplement was
investigated by Weidong Wu et al., (1990). They stated that copper sulphate diet
reduced the incidence and severity of this condition unlike zinc sulphate or
manganese sulphate. However, all the three trace elements prevented the adverse
effect of thiram on primary humoral immunity. The authors strongly suggested that
either thiram interfered with the metabolism of trace elements or the latter reduced
thiram toxicity. Based on these observations they concluded that the etiology of
thiram induced dyschondroplasia was distinct from that of dyschondroplasia which
could not be prevented by dietary copper supplementation.
Lakshman et al., (2002) conducted an experiment to study the ameliorative
effect of copper sulphate in broilers. They observed that epiphyseal growth plate
cartilage abnormality increased with advanced age in group I (Basal diet) and group
II (TMTD diet at the rate 30 ppm) birds with scores recorded between ++ (>2mm to
< 5mm) and +++ (> 5mm) respectively. However, in group III (TMTD at the rate 30
lxxii
ppm and CuSO4 at the rate 200 ppm) only one bird scored ++ where as rest of the
birds showed only + score which indicated that CuSO4 addition had an ameliorative
effect on TMTD diet.
Since the available information on this aspect was very scanty, it has
prompted the present study as to how CuSO4, hepato protectants and toxin binders
play a role in prevention of thiram induced tibial dyschondroplasia. The study of
gene expression and specific protein analysis responsible for TD is an emerging
research pursuit in the establishment and pathogenesis of tibial dyschondroplasia.
Hence, this study may trigger new insights in to the molecular pathogenesis and
ultra structural studies of tibial dyschondroplasia.
lxxiii
CHAPTER III
MATERIALS AND METHODS
In the present study, a total of four hundred and twenty (420) day-old male
broilers chicks of Cobb strain were procured from Venkateswara Hatcheries Pvt.
Ltd, Hyderabad. On arrival, all the birds were wing banded, individually weighed
and distributed into twelve groups of 35 chicks each. They were housed at Poultry
Experimental Station (PES), Department of Poultry Science, College of Veterinary
Science, Rajendranagar, Hyderabad in separate battery brooder pens and reared
under identical managemental conditions throughout the experimental period (35
days). The experiment design adopted for the present study is shown in Table 1.
Table 1: Experimental design.

Group No. of birds Treatment
I 35 Basal diet (BD)
II 35 BD + 60 ppm TMTD
III 35 BD + 100 ppm TMTD
IV 35 BD + 200 ppm CuSo4
V 35 BD+ LivOrdain-FS at the rate 1g/kg (HP)
VI 35 BD + US Cura Tox-FS at the rate 1g/kg (CP)
VII 35 BD + 60 ppm TMTD + 200 ppm CuSo4
VIII 35 BD +100 ppm TMTD + 200 ppm CuSo4
IX 35 BD + 60 ppm TMTD + LivOrdain – FS at the rate 1g/kg
X 35 BD +100 ppm TMTD + LivOrdain –FS at the rate 1g/kg
XI 35 BD+60 pm TMTD + US Cura Tox-FS at the rate 1g/kg
XII 35 BD+100 pm TMTD + US Cura Tox-FS at the rate 1g/kg
Composition of LivOrdain FS powder and US CuraTox FS is given in the
Annexure I as Table 33, (sponsored by Neospark Drugs and Chemicals Private
Limited, Hyderabad).
All the chicks were vaccinated against Marek’s Disease (MD) on the day of
hatch at hatchery and brought to the experimental shed where they were vaccinated
lxxiv
as per the standard protocol against Infectious Bronchitis (IB) on day one, F1 strain
Newcastle Disease (ND) on 5th day followed by La Sota strain booster dose on 21st
day and mild strain of infectious bursal disease (IBD) on 14th day and booster with
intermediate strain booster on 28th day. During 1st week vitamin A and B-complex
were added in drinking water along with water sanitizer. Birds had free access to
fresh feed and water ad libitum every day till the end of the experiment. Feed
composition (%) and its ingredients were formulated as per the National Research
Council (NRC) recommendations shown in Annexure I as Table 34.
The growing birds were observed thrice daily for clinical signs of TD and
mortality if any. Periodical weighing of birds and feed consumption was noted at
weekly intervals.
3.1 GROWTH RATE

Individual body weight of each bird from all groups was recorded to the
nearest gram with electronic weighing balance on day one and subsequently at
weekly intervals i.e., on 7th, 14th, 21st, 28th, and 35th days of experiment for studying
the growth rate and weight gains.
3.2 FEED CONSUMPTION AND CONVERSION RATIO (FCR)
Weekly data on feed consumption and number of chicks for each week was
meticulously maintained for calculating the average feed consumption and
conversion ratio for each group as follows:
Total feed consumed / week

Average feed consumption = -------------------------------------
Number of birds fed / week
Average fed consumed / bird / week

Average feed conversion = ---------------------------------------------
Average weight gain / bird / week
3.3 HAEMATOLOGY
lxxv
3.3.1 Collection of blood for haematological parameters
Six birds from each group (I to XII) were sacrificed at the end of 1st, 3rd, and
5th week of age, and 2 ml of blood from each bird was collected in anticoagulant
coated vaccutainers {(Potassium based Ethylene Di Amine Tetra Acetic Acid, K3-
EDTA tube, 13 mm x 75 mm, 2 ml (Rapid Diagnostic Pvt. Ltd., Delhi)} for whole
blood analysis. All the samples were estimated for total erythrocyte count (TEC),
haemoglobin concentration (Hb), packed cell volume (PCV) erythrocyte indices
viz. (i) mean corpuscular cell volume (MCV), (ii) mean corpuscular haemoglobin
(MCH), and (iii) mean corpuscular haemoglobin concentration (MCHC), total
leukocyte count (TLC) and differential leukocyte count (DLC). All the above
parameters were estimated with semi automatic blood cell counter (PE 6800- Procan
Electronics, supplied by Aspen Diagnostics Pvt. Ltd., Delhi) by using blood
analyzing commercial kits as per the manufacturer’s protocols (Rapid Diagnostics
Pvt. Ltd., Delhi) and all results were tabulated for statistical analysis.
3.4 SERUM BIOCHEMISTRY
3.4.1 Collection of blood for serum separation
Approximately 3 ml of blood was collected from each of the sacrificed bird
from the respective groups into clot promoting (Vit K- coated) vaccutainers (clot
activator tube-plain 13 mm x 75 mm, 5 ml (Rapid Diagnostic Pvt. Ltd., Delhi).
These samples were allowed to clot for 3-4 hours, and centrifuged (Sigma 1-13-
bench top laboratory centrifuge, USA) at 20k rpm for 15 minutes and serum was
taken into eppendorf tubes and used for serum biochemistry and serum enzymes
estimation with semi-automatic biochemical analyzer (Star 21 plus - Aspen
diagnostics Pvt. Ltd., Delhi) by using Aspen biochemical kits (Rapid Diagnostics
lxxvi
Pvt. Ltd., Delhi) as per the manufacturer’s protocols and the results were statistically
analyzed.
3.4.2 Serum biochemistry
The following serum biochemical profiles were analyzed at the end of 1st,
3rd, and 5th week. Total proteins (TP) and albumin (A) were estimated as per Dumas
method (Dumas et al., 1971), globulin (G) was calculated from TP and albumin.
Glucose (Glu) was estimated by glucose oxidase (GOD) method (Trinder, 1969) and
cholesterol by cholesterol dehyrogenase/peroxidase (CHOD/POD) method by using
commercial reagent kits in semi auto analyzer (Star 21 plus - Aspen diagnostics Pvt.
Ltd., Delhi). All values were tabulated to check the significant difference.
3.4.3 Serum enzymes and calcium
The following serum enzymes were analyzed in respective groups (I to XII)
and intervals as mentioned above. Aspartate amino transferase (AST), alanine amino
transferase (ALT), serum alkaline phosphatase (SAP) and gamma-
glutamyltransferase (GGT) were estimated by International Federation of Clinical
Chemistry (IFCC) method (Shaw et al., 1983) and serum calcium was estimated by
o-cresophthalein complexone (oCPC) method ( Eisaku et al., 2009) by using
commercial reagent kits in semi auto analyzer and values were tabulated for
statistical analysis.
3.5 MORPHOMETRY OF TIBIA, LIVER AND KIDNEYS
During sacrifice of experimental birds, organ morphometry was carried out by
using electronic balance (Afcoset - FX 400, Burmah trading company, Mumbai) to
weigh the tibial bones, liver, and kidneys. The digital vernier callipers (Annapurna
Scientifics, Hyderabad) were used for measuring the length and width (at proximal
extremity) of the respective tibial bones of either side.
lxxvii
3.5.1 Weights of tibial bones, liver and kidneys (g)
Soon after the collection of blood the organs were dissected, cleaned from
extra attachments if any, particularly with tibial bones, liver and kidneys weights (g)
were recorded and tabulated for statistical analysis.
3.5.2 Length and diameter of tibial bones (cm)
The tibial bones of respective groups (I to XII) were measured by using digital
Vernier callipers for its length (cm) and width (cm) at the proximal extremity of the
bones. The values were tabulated for statistical analysis.
3.6 NECROPSY OBSERVATIONS
A detailed post mortem examination was conducted on each of the six
sacrificed birds from groups I, III, IV, V, VIII and X during 5th, 10th, and 15th day
and the tissue samples were collected for molecular pathology (quantitative real time
polymerase chain reaction - QRT-PCR), ultrastructural pathology (TEM and SEM)
and immunohistochemistry.
3.7 GROSS PATHOLOGY OF TIBIAL BONES, LIVER AND KIDNEY

The tibial bones were collected and sectioned longitudinally and gross
changes in epiphyseal growth plate cartilage, if any and damage was assessed by
means of score at the width of widest point of the epiphyseal growth plate cartilage.
The epiphyseal growth plate cartilage with width > 3 mm was considered as
abnormal during 5th, 10th and 15th day and 1st, 3rd, and 5th week of age and the score
was shown in the table. In all birds the changes in liver and kidneys were also
recorded. The TD growth plate cartilage abnormality scoring was made, and the
scoring pattern is as shown below (Lakshman et al., 2002).
+ Mild (>1mm width at the widest point) lesion
++ Moderate (>1mm < 3mm width at the widest point) lesion
lxxviii
+++ Severe (>3mm width at the widest point) lesion
3.8 HISTOPATHOLOGICAL STUDIES
The liver and kidney samples were collected and fixed in 10% neutral buffer
formalin (NBF) for subsequent histopathological examination as per the standard
procedure (Luna, 1968).
The tibial bones were also collected and longitudinally sectioned and gross
changes were recorded. One portion of each tibia was fixed in Zenker-formalin for
48 hours for Koneff’s stain and one portion used for routine Haemotoxylin and
Eosin (H&E) staining (Luna, 1968).
3.8.1 Histopathology employing Haemotoxylin and Eosin (H&E) for tibial

bone growth plate cartilage (TGPC), liver and kidney
The fixed tissues were processed and paraffin sections of 4-5 µ were made
and stained with haemotoxylin and eosin as described by Luna (1968).
3.8.2 Histopathology of tibial bone growth plate cartilage (TGPC) employing

Koneff’s stain
Bone and growth plate cartilage were processed as described (Luna, 1968).
The fixed tissue samples were transferred into decalcifying solution, comprising of
equal quantities of solution A and B (The composition of decalcifying solutions
shown in Annexure I).
Decalcification was done by changing the solution at 24 hours interval till
the bones were completely decalcified. The end point of decalcification was
assessed by the chemical method as suggested by Luna (1968).
The slides were stained with Harris haemotoxylin for 10 minutes, which was
followed by washing in distilled water and staining with analine blue solution for
20-30 minutes. Both staining and differentiation was accomplished in the above
lxxix
solution and brought to the desired degree by checking under microscope from time
to time after rinsing the slide in distilled water. The sections were stained until the
structures of nuclei were clear, the freshly laid down bone was blue and the old bone
was red. Further, the sections were washed in distilled water followed by two
changes of absolute alcohol to which two drops of 2% phosphomolybdic acid
solution has been added for each 50 ml of alcohol. Sections were dehydrated,
cleared and mounted in DPX mountant.
Hyaline cartilage and pre-osseous substance stained blue. Bone stained bright
red or reddish brown. The matrix of vascular zone of epiphyseal disc and remnants
of matrix stained green.
3.9 IMMUNOHISTOCHEMICAL STUDIES
Tibial bone growth plate cartilages (TGPC) were processed as described
(Bancraft et al., 1994). The VEGF and Bcl-2 were detected in
immunohistochemistry by using polyclonal and monoclonal antibodies specific to
human VEGF and Bcl-2.
3.9.1 Immunohistochemistry of VEGF, VEGFR1, Bcl-2, MMP2 and MMP3

gene markers in tibial growth plate cartilage (TGPC)
Immunohistochemistry was performed on formalin fixed, paraffin embedded
sections using the super sensitive polymer HRP (horse-radish peroxidase) - kit label
method. Appropriate controls were included. After application of antibodies;
immune reactivity was visualized using 3, 3 Di-amino benzidine tetra chloride as a
chromogen.
The reagents used in immunohistochemistry are given in Annexure I and the
procedure of the immunohistochemistry is described below in detail as per the
manufacturers protocol (Biogenex- Bangalore).
lxxx
The paraffin sections (2-3 μ) were mounted on APES (Amino Propyl
Triethoxy Silane) coated slides and incubated at 370 C overnight. Then deparafinised
rehydrated and rinsed in tris {(hydroxymethyl) aminomethane (T.B.S)} buffer saline
(Gan, 1987; Gan, & William 1988) of pH 7.6. These sections were treated for
antigen retrieval by heat method using pressure cooker-till 3 whistles in tris EDTA
(pH 9.0). Surroundings were wiped and first reagent (Super Sensitive polymer of
HRP kit) was added to block the endogenous peroxidase for 15 minutes in 3%
H2O2.Sections were then washed in tris buffer, the surrounding of the sections were
wiped and the power block (secondary kit) for blocking of the unwanted antigenic
sites was added. Then incubated with primary antibody for 30 minutes at room
temperature in a moist chamber to prevent drying and washed three times with tris
buffer (5 minutes each). Later, incubated with enhancer for 30 minutes at room
temperature. Afterwards 3 (washings) changes were made with buffer (5 minutes
each), secondary antibody was added and incubated for 30 minutes which was
subjected to buffer wash for 3 changes (5 minutes each). Development was done
with chromogen concentrated buffer substrate (1 ml of substrate + 1 drop of
chromogen) kept for 5 to 15 minutes and washed well in buffer. Then the sections
were washed thoroughly in running tap water for 10 minutes. The nucleus was
stained with Harris’s haemotoxylin for 15 seconds and checked for bluing under
microscope. After satisfactory observation, the sections were washed under tap
water, dehydrated and mounted in DPX mountant.
lxxxi
3.10 MOLECULAR PATHOLOGY OF TIBIAL DYSCHONDROPLASIA
(TD)
3.10.1 Material collection for Quantitative Real Time – Polymerase Chain

Reaction (QRT-PCR)
In control, higher dose of toxin group and CuSo4 and herbal ameliorated
groups (Groups I, III, IV, V, VIII and X) tissue samples were collected for RTPCR,
Immunohistochemistry, special staining and ultrastructural study. Six birds from
each group were used for material collection of tibial growth plate cartilage by
cervical disarticulation on 5th, 10th, and 15th day respectively. After sacrifice, the
birds were de-skinned and under strict aseptic precautions the growth plate cartilage
was collected and transferred on ice blocks for relative Quantitative Real Time PCR
processing.
The levels of selective gene expression associated with angiogenesis and cell
survival in growth plate cartilage of TD affected birds was assessed in Quantitative
Real Time-Polymerase Chain Reaction (QRT-PCR) by using the following primers
of Oligos-25nmol each of which procured from Genetix Biotech Asia Pvt. Ltd.,
(shown in the Table 2). The primer sequences adopted in this study were from Rath
et al., (2007) and Dan et al., (2009).
Table 2: Primers used for QRT- PCR
Gene Forward Reverse

VEGF GGAAGCCCAACGAAGTTATC AACCCGCACATCTCATCAG
VEGFR1 GCAGGCAGCTTGAAAGAAAC GCTGGCCTTTCATGACTCTC
Bcl-2 GCAGGCAGCTTGAAAGAAAC GCTGGCCTTTCATGACTCTC
MMP-2 ATTCTGGCCTGATCTGCCAG GCCCCTATCCAGGTTGCTG
MMP-3 CTTTGGGCTGGAGGTGACC CCGTGGGAAGGTGCTGTATG
Note: VEGF - Vascular endothelial growth factor, VEGFR1 - Vascular endothelial
growth factor receptor, Bcl-2 - Antiapaptotic protein (marker) and
MMP - Matrix metalloproteinases. House keeping gene β actin was selected as
control through out the real time PCR studies.
lxxxii
3.10.2 RNA Isolation and Reverse Transcription (RT)
Proximal tibial growth plate cartilage pieces were aseptically collected from
different groups (I, III, IV, VI, VIII, and X) at different intervals and utilized for
RNA isolation. The sample material was made into small pieces in a sterile petridis
and digested for fifteen minutes in 1ml of trizol (Fermentas Life Sciences, Canada)
at room temperature. The supernatant portion was removed and 200µL of
chloroform (Fermentas Life Sciences, Canada) was added to each sample and
shaken vigorously for ten minutes on orbital shaker (Neolab, Mumbai, India) at
room temperature. All the tubes were centrifuged (Centra-MP4-International
Equipment Comp.) for 15 minutes at 13000 rpm at 40C. Upper aqueous phase was
transferred into other tubes and equal volume of isopropanol (Fermentas Life
Sciences, Canada ) was added to each tube and kept at -200C for 20 minutes (Deep
freezer - Blue Star, India) and then centrifuged at 13000 rpm for 10 minutes. The
supernatant part was decanted and the pellets were washed with 1ml of cold ethanol
(Fermentas Life Sciences, Canada) by vortexing, centrifuging for 5 minutes at 13000
rpm and then air dried after decanting. The pellets were dissolved in 30µL of RNA
storage buffer (Fermentas Life Sciences, Canada) to make required volume used for
cDNA synthesis.
3.10.3 cDNA Synthesis (for one reaction)
For preparation of cDNA in step I, 5 µl of isolated RNA was used by adding
1 µl of Oligo dT and 6µl of RNase free water (Fermentas Life Sciences, Canada).
Total of 12µl quantity was incubated at 700C for 5 minutes and snap cooled on ice.
In step II, 4 µl of 5x RT buffer and 1 µl of Superasin and 2µl of 10 mm dNTP was
added and incubated at 370C for 5 minutes. Finally 1µl of RT (Reverse
Transcriptase) enzyme (Fermentas Life Sciences, Canada) was added to each tube
lxxxiii
and incubated in two steps at 420C for 60 minutes and at 700C for 10 minutes and
used for analysis by using conventional PCR (ESCO-Swift Maxi, USA) instrument.
3.10.4 Real-Time PCR
One µL of cDNA was used for RT-PCR with a fluorescent dye SYBR Green
I (Absolute QPCR SYBR Green Mix; Fermentas Life Sciences) to monitor DNA
synthesis using specific primers. Beata (β) actin (Fermentas Life Sciences, Canada)
was used for normalizing control and the primers employed are listed in Table 3.
The PCR was carried out in Stratagene Mx 3000PTM (Agilnet Technologies,
USA) using the following cycling protocol: a 950C denaturation step for 15 minutes
followed by 40 cycles of 950C denaturation (15 seconds), 600C annealing (30
seconds) and 720C extension (30 seconds). Gene expression was normalized to the
house keeping gene 18S. The amplified PCR product was analyzed with Stratagene
Mx 3000PTM soft ware (Agilnet Technologies, USA). At the end of the RT-PCR a
melting curve was determined to verify the presence of a single amplicon (Reich et
al., 2008).
3.11 ULTRASTRUCTURAL PATHOLOGY OF TIBIAL

DYSCHONDROPLASIA (TD)
The samples of tibial growth plate cartilage for ultrastructural pathology
were collected from another six birds from respective groups (I, III, IV, VI, VIII,
and X) on 5th, 10th, and 15th day by cervical disarticulation. All birds were
deskinned, aseptically the growth plate cartilage were collected, washed with
phosphate buffer saline (PBS composition shown in Annexure I) and fixed in 2.5%
glutaraldehyde (composition shown in Annexure I) and processed for EM studies as
per the standard protocol described by Bozzala and Russels (1998).
lxxxiv
3.11.1 Transmission Electron Microscopy (TEM) of tibial bone growth plate
cartilage (TGPC), liver and kidney
The growth plate cartilage from birds of these groups was used for electron
microscopy (EM) studies. Both Transmission Electron Microscopy (TEM) and
Scanning Electron Microscopy (SEM) were done for the samples. Soon after
cervical dislocation, the growth plates which were associated with TD lesion of
proximal tibia were quickly exposed. Thin slices of tissue (cartilage, liver, and
kidney) were dissected into 2.5% gluteraldehyde (S.D. fine chemicals, Mumbai) in
0.1M phosphate buffer (pH 7.3 stored at 40C), washed in buffer, post fixed in 1%
osmium tetraoxide (OsO4 - Annexure-I) (Sigma Aldrich, USA) in 0.1 M phosphate
buffer, dehydrated with ascending grades of acetone (Qualigens fine chemicals,
Mumbai) and embedded in Spurr’s (Spurr, 1969) resin (SPI-supplies, araldite 6005
Embedding Kit, USA) and were incubated (universal incubator-NSW-151) over
night at 450C for complete polymerization of the tissue. Semi thin (1000 – 1500 nm
thickness) section were made with ultra microtome (Leica ultra cut UCT - GA- D/E-
100,Germany) for identification of the area and were stained with 1% toludine blue
(Qualigens fine chemicals, Mumbai) observed under advanced student research
microscope (Olympus - AX 70, USA) to locate exact area to be sectioned for TEM.
Then, ultra thin sections were made (500 -700 nm thickness) mounted on hexagonal
copper grids (SPI supplies, USA) allowed to air dry for over night and were stained
with saturated urenyl acetate (composition shown in Annexure I) and 1% Reynolds’s
lead citrate (composition shown in Annexure I) as per Bozzala and Russels (1998)
protocol. All grids were dried at room temperature and observed under transmission
electron microscope (TEM - Hitachi - H-7500, Japan).
lxxxv
3.11.2 Scanning Electron Microscopy (SEM) of tibial bone growth plate
cartilage (TGPC), liver and kidney
Samples from the same birds were used for SEM. Thin slices of tissue
(cartilage, liver, and kidney) were dissected into 2.5% gluteraldehyde in 0.1M
phosphate buffer (pH 7.3 stored at 40C), washed in buffer, post fixed in 1% osmium
tetraoxide (OsO4) in 0.1 M phosphate buffer, dehydrated with ascending grades
alcohol (Qualigens fine chemicals, Mumbai) and subjected for critical point drier
(CPD- Electron Microscopy Sciences, USA) and sputter coated (Auto fine coater
JEOL - JFC -1600, Japan) with gold palladium, observed under scanning electron
microscope (SEM- JEOL - JSM – 5600, Japan).
3.12 STATISTICAL ANALYSIS
The data obtained was subjected to statistical analysis (Snedecor and
Cochran, 1994) by using SPSS soft ware. The quantitative gene expression for real
2 -∆∆C
time PCR was made by using T (delta delta threshold cycles) and by the
comparative CT methods (Kenneth and Schmittgen 2001, Schmittgen and Livak,
2008).
lxxxvi
CHAPTER - IV
RESULTS
The results of experimental study to evaluate the molecular and
ultrastructural pathology of thiram (TMTD) induced tibial dyschondroplasia (TD)
with amelioration effect of copper sulfate, LivOrdain-FS (Herbal product, HP), and
US CuraTox-FS (Chemical product, CP) in broiler chicken are presented.
The present research work was designed to study the effect of thiram on
different selected parameters at definite time periods in different groups of
experimental birds.
4.1 GENERAL OBSERVATION AND CLINICAL SIGNS

The experimental birds in group I, IV, V, and VI were apparently healthy
throughout the experimental period and were treated as positive controls with basal
diet (BD), copper sulphate (CuSo4) 200 ppm, LivOrdain-FS, and US Cura Tox-FS at
the rate 1g/kg diet respectively. The clinical signs noticed after 24 hours of feeding
of TMTD (60 ppm and 100 ppm) in group II and III which were treated as negative
controls. They exhibited clinical sings like huddling, not willing to move, less feed
and water intake. Subsequently, they showed hock sitting posture, unable to getup,
spraddle legs, shivering, lateral and sternal recumbency, extension, and / or
widening of legs and wings, twisting of toes, resting on sternum with backward
stretching of legs, wobbling gait and imbalance in standing (Plate 1, Fig. 1 - 9).
The above symptoms were also observed in groups VII, VIII, IX, X, XI, and
XII but to the lesser extent than group II and III birds which were depicted in plate 2
(Fig. 1-12).
50
4.2 MORTALITY PATTERN
lxxxvii
During the 2nd week mortality of 5 and 3 birds in group II and III, 3 birds in
other groups (VII, VIII, X and XII) was observed. During 3rd week, 2 birds from
group III, 3 birds from group VIII succumbed. These deaths were due to starvation
as the birds were unable to getup and take feed and water.
4.3 BODY WEIGHT GAINS (g)

The mean body weight gain (g) of the birds (form 1st to 5th week of age) is
presented in Table 3 and the graph depicted in plate 3. Right from the end of first
week, there was a drop in body weight gain in respective groups. The lowest
cumulative mean value (621 g) was recorded in group III and the highest cumulative
mean value (1114 g) was observed in group V. These results were highly significant
(P ≤ 0.01) between groups during the experimental period.
4.4 FEED CONSUMPTION AND FEED CONVERSION RATIO (FCR)

The feed consumption (g) in different groups during the experimental period
and calculated FCR are shown in Table 4 and the graphically presented in plate 4.
The total feed consumption in different experimental groups during 1st to 5th week of
age, and also the cumulative means were highly significant (P≤ 0.01). At the end of
the experiment, the lowest cumulative mean value (2.94) was observed in group III
and the highest cumulative mean value (3.26) was recorded in group VIII.
4.5 HAEMATOLOGICAL PARAMETERS

All haematological parameters related to erythrocytes (TEC, Hb, PCV,
MCV,MCH and MCHC) mean values are shown in the Table 5 and 6 . The
respective graphs are depicted in plate 5 and 6 (Fig. 1, 2 and 3). Similarly, the
53
leukocytes related parameters (TLC and DLC) are shown in Table 7 and 8 and
related graphs are depicted in plate 7 and 8 (Fig. 1, 2, 3 and 4).
4.5.1 Total erythrocyte count (TEC)
lxxxviii
During 1st week, the decrease in mean values (2.47, 2.85 and 2.87) were
recorded in groups II, X and III and groups I, VII, XI and XII recorded highly
significant (P ≤ 0.01) increase in these values (3.28, 3.32, 3.10 and 3.15). During 3rd
week, lower values (3.37) were recorded in groups II and III, and higher values
(3.55, 3.63 and 3.67) were observed in VII, IX and VI. The lowest value (3.35) was
also recorded in group I. By the end of experiment (5th week) lower values were
observed in group VIII and XI, significantly higher value (3.43) was recorded in
group I in comparison with other treatment groups.
4.5.2 Haemoglobin concentration (Hb)

During 1st week, lower mean values (7.37 and 7.75) of Hb were recorded in
group III and X, and higher values (9.17 and 9.20) were recorded in group I and VII.
During 5th week, lower mean value (8.53) was observed in group VIII and higher
values (11.07, 11.27 and 11.93,) were recorded in X, II and IX. The haemoglobin
concentration did not show any significant difference during the 3rd week of
experiment.
4.5.3 Packed cell volume (PCV)
Significantly lower mean values of PCV were recorded in group III, VIII, IX
and X, and higher values were observed in group I and XI during the 1st week of
experiment. During 3rd week it was not significant, but at the end of experiment (5th
58
week) highly significant lower value (30.00) was recorded in group IV and higher
values (41.33 and 41.50) were recorded in group XI and IX.
4.5.4 ERYTHROCYTE INDICES

4.5.4.1 Mean corpuscular value (MCV)
The lower mean value (154.50) of MCV was recorded in group VIII and
higher mean value (179.83) was observed in group III (100 ppm TMTD) during 1st
week of experiment. During 3rd week significantly lower values (128.83, 129.17 and
130.17) were observed in groups II, IV and V respectively and the higher value
lxxxix
(136.83) was recorded in group XII. By the end of experiment (5th week) the lower
value was recorded in group II and higher value was observed in group XI.
4.5.4.2 Mean corpuscular haemoglobin (MCH)

The lowest MCH mean (36.67) was observed in group II and the highest
mean value (40.50) was recorded in group III during 1st week of experiment. During
3rd week, lower value was recorded in group XII and the higher value was observed
in group XI and I in which group XI was treated with ameliorative agent. By the end
(5th week) of the study, lower value (31.00) was observed in group I and higher
value was recorded in group VIII (100 ppm TMTD and 200 ppm CuSo4).
4.5.4.3 Mean corpuscular haemoglobin concentration (MCHC)
The MCHC was not significant during 1st week of experiment. However,
during the 3rd week the lowest value (27.67) was observed in group II (60 ppm
TMTD) and significantly higher value (30.83) was recorded in group IX. During 5th
week, lower mean value (21.83) was recorded in group I compared to treated
groups.
61
4.5.5 Total leukocytes count (TLC)

During the 1st week, significantly (P ≤ 0.01) decreased mean value (1084) of
TLC was recorded in group XII (100 ppm TMTD and US CuraTox 1g/kg) and
increase in mean value (3579) was observed in group I. During 3rd week lower mean
value (1011) was recorded in group II (60 ppm TMTD) and higher value (2716) was
recorded in group I. At the end of the study, (5th week) lower value (2128) was
recorded in group XI and the higher value (3466) was observed in group I.
4.5.6 Differential leucocytes count (DLC)

4.5.6.1 Heterophils count
Highly significant (P ≤ 0.01) decrease in mean value (16.00) of heterophils
was recorded in group VIII and the increased mean value (39.17) was observed in
xc
group I during 1st week of experiment. During 3rd week, lower mean value (18.33)
was recorded in group IX and higher value was observed in group X. The
heterophils were not significant during the 5th week of experiment.
4.5.6.2 Lymphocyte count

The lowest mean value (51.33) of lymphocytes was recorded in group I, and
the highest mean value (79.50) was observed in groups VIII during 1st week of
experiment. Significantly (P ≤ 0.01) lower mean value (64.67) was recorded in
group X and higher value (75.00) was observed in group II (60 ppm TMTD) during
2nd week of experiment. At the end of the experiment (5th week) the mean
lymphocyte values were not significant.
4.5.6.3 Eosinophil count

Low mean values (2.00) of eosinophils were observed in groups VIII and IX,
and the highest value (5.33) was recorded in group I during 1st week of experiment.
62
During 2nd week of experiment, the lower value (1.5) was recorded in group III and
significantly (P ≤ 0.01) higher value (3.17) was observed in group I. During 5th
week, there was no significant difference among the treatment groups.
4.5.6.4 Monocytes count

The lowest mean value (2.33) of monocyte counts was observed in group III
and the highest value (5.67) was recorded in group II during 1st week of experiment
and it was not significant (P ≥ 0.05) during 3rd and 5th week of experiment.
4.6 BIOCHEMICAL PARAMETERS

The serum biochemical parameters (glucose, cholesterol, total protein,
albumin, globulin and A/G ratio) are tabulated in Table 9 and 10 and related graphs
are depicted in plate 9 and 10 (Fig. 1, 2 & 3).
4.6.1 Serum glucose

During 1st week, the serum glucose value was significantly lower (76.67) in
group VII and higher (122.83) in group VIII. Significantly (P ≤ 0.01) lower value
xci
(97.67) was recorded in group IV and higher value (145.00) was observed in group I
during 3rd week of experiment. At the end of experiment (5th week) the lower mean
glucose value (177.17) was recoded in group IX and the higher values were
observed in groups II (60 ppm TMTD), VII (60 ppm TMTD and 200 ppm CuSo4)
and VIII (100 ppm TMTD and 200 ppm CuSo4).
4.6.2 Serum cholesterol

Highly significant (P≤ 0.01) decrease in mean values (118 and 126.50) of
cholesterol were recorded in groups II and III (60 and 100 ppm TMTD) respectively
and increase in mean value (131) observed in group I during 1st week of experiment.
63
During 3rd week, lower cholesterol value (113.42) was recorded in group III and
higher value (164.16) was observed in group IX. At the end of experiment (5th day)
significantly lower value (117.50) was recorded in group X and higher values
(140.83 and 142.67) were observed in groups V and XI respectively.
4.6.3 Total proteins (TP)

Significantly (P ≤ 0.01) lower mean values (4.12 and 4.27) of total protein
were recorded in group III and IV, and the highest mean value (5.67) was observed
in group V during 1st week of experiment. During 3rd week, lower value (4.45) was
observed in group XI and the higher value (5.29) was observed in group X. At the
end of experiment (5th week) significantly (P ≤ 0.01) lower value (5.37) was
recorded in group IX and higher values were observed in groups I, VI and XI.
4.6.4 Serum Albumin (A)

Significantly (P ≤ 0.01) lower mean value (2.28) of albumin was observed in
group VI and the highest value (3.47) was recorded in group IX during the 1st week
of experiment. During 3rd week, lower values (2.73 and 2.75) were observed in
groups I and III and higher values (3.32 and 3.33) were recorded in groups VI and
VII. At the end of experiment (5th week), lower value (2.43) was recorded in group
IV (200 ppm CuSo4) and higher values (3.47 and 3.50) were observed in groups I
and X.
xcii
4.6.5 Serum globulin (G)
During 1st week of experiment, lowest mean value (1.37) of serum globulin
was recorded in group IV and the highest value (2.78) was observed in group V.
During 3rd week of experiment, significantly (P ≤ 0.01) lower value (1.10) was
recorded in group IX and higher value (2.13) was observed in group III (100
66
ppm TMTD). During 5th week, lowest value was recorded in (2.63) in group III and
highest value (4.33) was observed in group IV (200 ppm CuSo4).
4.6.6 Albumin: Globulin (A/ G) ratio
Significantly (P ≤ 0.01) lower mean value (0.33) of A/G ratio was recorded
in group III and the highest mean value (2.32) was recorded in group IV during 1st
week of experiment. During 3rd and 5th weeks, the A/G ratio was not significant
among the treatment groups.
4.7 SERUM ENZYMES
Serum enzymes parameters (AST, ALT, GGT, ALP and serum calcium are
depicted in Table 11 and 12 and relevant graphs are shown in plate 11 and 12 (Fig.
1, 2 & 3 and Fig. 1 and 2).
4.7.1 Aspartate amino transferase (AST)

Significantly (P ≤ 0.01) decreased mean values (17.17 and 18.00) of AST
were observed in groups IV and VI, and elevated mean values (31.50 and 31.67)
were recorded in groups II and XI during 1st week of experiment. During 3rd week,
lower value (24.92) was observed in group IX and higher value (30.75) was recoded
in group IV. By the end of experiment (5th week), lower mean value (15.67) was
recorded in group II and higher values (31.33 and 31.50) were recorded in groups V
and XI.
4.7.2 Alanine amino transferase (ALT)
xciii
Highly significant (P ≤ 0.01) decrease in mean value (14.50) of ALT was
observed in group VII and increased mean value (30.83) was observed in group VI
during 1st week of experiment. During 3rd week of experiment, lower mean value
67
(15.17) of ALT was observed in group IX and higher value (22.25) was recorded in
group IV. Significantly lower mean value (15.50) was recorded in group X and
higher mean value (31.00) was observed in group III (100 ppm TMTD) during 5th
week of experiment.
4.7.3 Gamma-Glutamyl transferase (GGT)
Highly significant (P ≤ 0.01) lower mean value (12.25) of GGT was recorded
in groups V and XII and higher values (20.25 and 20.33) were observed in groups
IX and X during 1st week of experiment. By 3rd week of experiment, the lower mean
value (11.58) was recorded in group XI and higher mean value (18.25) was observed
in group IV. At the end of experiment (5th week) the lower mean value (11.83) was
recorded in group IX and higher value (20.00) was observed in group X.
4.7.4 Alkaline phosphatase (ALP)

Significantly (P ≤ 0.01) lowest mean value (104.33) was recorded in group V
and the highest mean value (141) was observed in group VIII during 1st week of
study. During 3rd week group VIII recoded lower value (107.50) and higher value
(125.08) was recorded for group VI. By the end of experiment (5th week) the lowest
value (110.17) was recorded in group IV and the highest value (131.50) was
observed in group V.
4.7.5 Serum calcium

Significant decrease in mean value (14.25) of calcium was recorded in group
VIII and increased mean value (24.17) was observed in group VII during 1st week of
experiment. During 3rd week of experiment, lower mean (13.33) was recorded in
group XII and higher value (24.17) was observed in group VIII. By the end of
experiment (5th week) significantly (P ≤ 0.01) lower means (12.67, 13.17 and
70
xciv
3.33) were recorded in groups XII, VIII and II respectively, when compared to other
groups.
4.8 MORPHOMETRY
The mean values of tibial bones, liver and kidney are depicted in Table 13
and 14 and corresponding graphs are shown in plate 13 (Fig. 1, 2 & 3) and 14 (Fig. 1
and 2).
4.8.1 Weights of tibial bones (g)

During 1st week, significantly (P ≤ 0.01) lower mean value (1.22) of tibial
bone weight was recorded in group II and the higher value (3.37) was observed in
group IV. The lowest mean value (3.91) was observed in group III and highest
values (12.91 and 12.95) were recorded in groups V and I during 3rd week of
experiment. During 5th week, lower values (16.11 and 16.12) were recorded in
groups III and II respectively and higher values (28.30 and 28.51) were observed in
group VI and group I.
4.8.2 Weights of liver (g)
Significantly lower mean values (2.44, 2.56 and 2.70) of liver weights were
recorded in groups II, IX and VII and higher value was observed in group IV during
1st week of experiment. During 3rd week significantly (P ≤ 0.01) lower value (6.35)
was observed in group IX and higher values (21.85 and 22.43) were recorded in
group I and group IV. By the end of experiment (5th week), lowest mean value
(12.98) was recorded in group VIII while the highest value (42.57) was observed in
group V.
71
4.8.3 Weights of kidney (g)

During 1st week, significantly (P ≤ 0.01) lower mean value (0.61) was
recorded in group II and higher mean value (1.22) was observed in group I. Highly
significant reduction in mean value (1.65) was recorded in group II while higher
xcv
values (6.40 and 6.52) were observed in groups I (control) and IV (200 ppm CuSo 4)
during 3rd week of experiment. By the end (5th week), highly significant decrease in
mean values (2.51 and 2.53) were recorded in groups II and III which were fed with
60 ppm and 100 ppm of TMTD and elevated mean value (8.81) was observed in
group I.
4.8.4 Length of tibial bones (cm)

During 1st week, the length of tibial bone recorded lower mean value (3.63)
for group IX (60 ppm TMTD and 1g/kg LivOrdain-FS) and higher mean values
(4.63, 4.60 and 4.57) were recorded for groups I, II and III respectively.
Significantly decrease in mean values (5.15 and 5.22) were recorded for group II and
III respectively and increased value (7.42) was observed in group I during 3rd week
of experiment. By the end (5th week), lower mean value (7.38) was recorded in
group VIII while higher value (9.03) was observed in group I.
4.8.5 Diameter of tibial bones (cm)

Lower mean value (0.21) of tibial diameter was recorded in group II and the
higher mean (0.60) was observed in group I during 1st week of experiment. During
3rd week, significantly (P ≤ 0.01) lower means (0.61) were recorded both in group II
and III which were fed with 60 and 100 ppm of TMTD and the higher value (1.21)
was observed in group I. During 5th week, lower values (1.17 and 1.25) were
observed in group VIII and X and higher value (1.51) was recorded in group I.
74
4.9 GENE EXPRESSION
The analyzed the CT values for all the selected genes, VEGF, VEGFR1, Bcl-
2, MMP-2 and MMP-3 are shown in the Table 15 and 16. Consistent results were
obtained with the standardized test and the associated graphs are shown in plate 15
(Fig. 1, 2 & 3) and 16 (Fig. 1 & 2).
4.9.1 VEGF
xcvi
During 5th day of experiment, significantly (P ≤ 0.01) lower mean C
T value
(33.92) was observed in group III and the higher mean value (38.78) was recorded in
group X. By the 10th day of experiment significantly lower mean value (30.59) was
observed in group X and higher value (37.68) was recorded in group III. During 15th
day of experiment, lower value (29.16) was recorded in group VIII and higher value
(38.06) was observed in group I.
4.9.2 VEGFR1
C
Significantly (P ≤ 0.01) decreased mean T value (20.47) of VEGFR1 was
observed in group III and higher value (22.29) was recorded in group V during 5th
day of experiment. During 10th day, lower value (18.10) was recorded in group VIII
and higher value (22.09) was observed in group I. By the 15th day of experiment,
significantly lower value (18.44) was recorded in group VIII and higher value
(21.85) was recorded in group III.
4.9.3 Bcl – 2
Significantly (P ≤ 0.01) lower mean CT value (19.73) of Bcl-2 was recorded
in group III and higher value (21.68) was observed in group X during 5th day of
experiment. During 10th day, significantly lower values (18.71 and 18.74) were
recorded for groups VIII and X respectively. By the 15th day of experiment, lowest
75
value (18.26) was recorded in group VIII and highest value (21.81) was observed in
group III.
4.9.4 MMP2
During 5th day of experiment highly significant (P ≤ 0.01) lower mean C
T
values (28.34) was recorded in group X and higher value (36.94) was observed in
group V. By the 10th day of experiment, lower value (26.28) was observed in group
X and higher value (32.250) was recorded in group IV. During 15th day, lowest
value (24.25) was observed in group VIII and highest value (29.10) was recorded in
group I.
4.9.5 MMP3
xcvii
Significantly (P ≤ 0.01) lower mean CT value (21.02) of MMP3 was recorded
in group IV and highest value (23.55) was observed in group V during 5th day of
experiment. During 10th day decreased mean values (19.42 and 19.46) were recorded
in groups VIII and X and increased value 23.66) was observed in group I. By the
15th day of experiment, significantly lower value (19.37) was observed in group VIII
and higher value (22.48) was recorded in group IV.
4.10 GROSS PATHOLOGY

4.10.1 Gross pathology of tibial bones growth plate cartilage (TGPC)
In the present study gross lesions were predominantly observed in tibial bone
growth plate cartilage (TGPC) as this was the focal and targeted organ in TMTD
induced TD in broilers. Gross pathological changes were noticed soon after 24 hours
of feeding the experimental diets. The significant gross changes of tibial bones were
observed in group II and III (length, weight, decreased diameter and slight bending
78
at proximal extremity) where as groups VII, VIII, IX, X, XI, and XII showed mild to
moderate changes like reduction in length, weight, slight bending at proximal
extremity, and mild increase in diameter of proximal extremity (Plate 17, Fig. 1- 4).
The birds of control group I, group IV (BD + CuSo4 200 ppm), group V (BD +
LivOrdian 1g/kg diet) and group VI (BD + US Cura Tox 1g/kg diet) did not reveal
any gross changes in the tibial bones. All the tibial bones were longitudinally
sectioned and the lesions of growth plate cartilage at its widest point was measured
and graded as mild (+), moderate (++) and severe (+++) lesions are shown in Table
29 and 30 for the respective days and weeks.
Table 29: Gross tibial growth plate cartilage lesions during 5th, 10th and 15th
day (width at the widest point) of experiment.
Number of birds + Mild ++ Moderate +++ Sever

and age (>1mm) (>1mm <3mm) (>3mm)
xcviii
36 birds - 5th day 11 4 3
36 birds - 10th day 3 9 6
36 birds - 15th day 2 4 12
Total (108 birds) 16 17 21
Table 30: Gross tibial growth plate cartilage lesions during 1st, 3rd and 5th week
(width at the widest point) of experiment.
Number of birds + Mild ++ Moderate +++ Sever
and age (>1mm) (>1mm <3mm) (>3mm)
72 birds -1st week 13 11 48
rd
72 birds -3 week 9 18 45
72 birds -5th week 11 19 42
Total (216 birds) 33 48 135
4.10.2 Gross pathology of liver and kidney
Gross lesions observed in liver and kidney included shrinkage of liver and
kidneys which were more in group II and III. Where as in group VII, VIII, X and
XII showed mild shrinkage of liver and kidney. However, moderate enlargement
was noticed in group IV, V, VI than group I. Mild to moderate congestion of liver
79
and kidneys and oozing of bloody exudates from cut surface was also observed in
group II and III birds which is depicted in plate 17 (Fig. 5 and 6) where as other
organs did not reveal any gross pathological changes.
4.11 HISTOPATHOLOGY
4.11.1 Histopathology of tibial bones growth plate cartilage (TGPC)
In general, the histopathological changes in TD induced tibial bone growth
plate cartilage showed remarkable changes in hypertrophic zone than the other zones
viz epiphyseal hyaline zone, proliferating zone, transitional zone, and
prehypertrophic zones irrespective of the age of the birds. In all the treated birds
tibial growth plate cartilage samples revealed marked changes like swollen, oval and
misshapen, clusters of empty clefts like chondrocytes. Significantly most of the
affected chondrocytes revealed pyknotic nuclei, karyorrhexis, and disintegration of
xcix
chromatin material. Some sections revealed eosinophilic nuclei and some showed
swollen nucleus. The zone wise changes are as follows.
In all cases, the epiphyseal hyaline cartilage zone was of normal in thickness
both in control and treatment groups.
Moderate thickening of proliferating zone was observed in group II and
group III cartilage sections in addition to the changes described above. Mild
thickening was also noticed in other groups (VII, VIII, IX, X, XI, and XII) and
apparently normal chondrocytes were seen in group IV and V.
The proliferating zone was characterized by lack of parallel arrangement of

flattened irregular columns of chondrocytes. There was reduced vascularity, oval
81
irregular chondrocytes with clusters and abundant matrix was observed among the
sections of group II and III.
The transitional zone was abnormally thickened with oval chondrocytes and
more of eosinophilic matrix in group II and group III and a slight variable change
were also recorded in other groups VII, VIII, IX, X, XI, and XII. Hypertrophic zone
was thickened and invaded by few blood vessels which appeared empty.
Eosinophilic matrix, pyknotic nuclei and empty capsules were seen. The bone
trabeculae appear to be normal but irregularly arranged. Defective cartilaginous
mass of cells and abrupt ossification, osteoblastic and osteoclastic activity and
transition of cartilage to bone tissue were seen in group II and III. The other groups
(VII, VIII, IX, X, XI, and XII) revealed mild to moderate changes where as groups I
and V were apparently normal. The sections of group VI revealed no significant
change but in group IV sections showed an irregular penetration of an emerging
capillaries (more in number) arising from diaphysis to metaphysis.
Mild changes similar to above sections were also observed in other groups
(VII, VIII, IX, X, XI, and XII). The sections of group IV, V, and VI did not show
any such changes Based on the above observations the lesions were classified as
c
mild (+), moderate (++) and severe (+++) as shown below in Table 31 (days) and
Table 32 (weeks) after the pictorial description.
Mild lesion (+): Mild lesions was characterized by thickening of
proliferating zone, transitional zone and hypertrophic zone with pyknotic nucleoli,
disintegrating nucleolus and empty clusters of chondrocytes.
Moderate lesion (++): Moderate lesion was characterized by thin hyaline zone,
thickened proliferating zone prehypertrophic and hypertrophic zones along with
pyknotic, chromatolytic and degenerating nucleus. The chondrocytes were ovoid
without nucleus and more of eosinophilic matrix.
82
Severe lesion (+++): These lesions were characterized by grater thickening of
proliferating zone, marked thinning of hyaline zone, absence of chromatin material
and empty cleft like chondrocytes grouped in clusters. The thickened hypertrophic
layer was invaded by few blood vessels which appeared empty. Eosinophilic matrix,
pyknotic nuclei and empty capsules were seen.
In general, there was dose dependent increase in the number of non nucleated
chondrocytes within the treatment groups when compared to the control group
during the entire experimental period. Further, it was characterized by reduced
vascularization, defective extra cellular matrix, clusters of ovoid chondrocytes
without nucleus. The cartilage cell arrangement was completely disturbed. The
above lesions were recorded with slight variation between ++ to +++ as per the dose
variation is concerned (60 ppm, 100 ppm). There was no significant change in the
days and weeks except empty cleft of chondrocytes, irregular penetration of
emerging capillaries. Over all in all groups the changes were very close as far as the
TD lesion is concerned. In the CuSo4, LivOrdain-FS, and US Cura Tox-FS groups
ci
not much variation was recorded. In CuSo4 fed groups (IV, VII and VIII) the
emerging capillaries were more with more of eosinophilic matrix.
The normal cartilage was characterized by proper arrangement of
chondrocytes (cord like structures and clusters) proliferating, prehypertrophic and
hyper trophic zones with centrally placed nuclei. Blood vessels were seen in all the
zones.
83
Six birds from each group (II, III, IV, V, VIII, and X) were sacrificed during the
days 5th, 10th, and 15th. A total of 90 tibial growth plate cartilage samples were used
for H&E staining out of which 59 samples revealed different grades of
histopathological changes in different groups (II) 18, (III) 18, (VIII) 10 and (X) 12,
where as in group IV one sample and in group V two samples revealed mild lesions.
Severe lesions were observed in group II and III which were fed with 60 ppm and
100 ppm of TMTD. Where as in ameliorative groups (VIII and X) mild lesions were
recorded (Plates 18, 19 and 20, Fig. 1- 6, Fig. 1-5 and Fig. 1- 4) during 5th, 10th and
15th day of experiment.
Table 31: Histopathological lesions in TMTD treated birds during 5th, 10th and
15th day
Groups Severity of lesions Total
& No. of samples
+ ++ +++
II- 60 ppm TMTD 5 9 4 18
III-100 ppm TMTD 4 7 7 18
IV-200 ppm CuSO4 1 - - 1
V- LivOrdain-FS @ of 1g/kg diet 2 - - 2
VIII-100ppm TMTD + 200ppm CuSO4 3 4 3 10
X-100ppmTMTD + LivOrdain-FS @ of 1g/kgdiet 3 5 4 12
Total 16 25 18 59
cii
Similarly, six birds from each group (I to XII) were sacrificed during the 1 st,
3rd, and 5th weeks and a total of 216 tibial growth plate cartilage samples were also
collected and used for H&E staining out of which 92 samples revealed different
grades of histopathological changes in different groups. Severe lesions (+++) were
observed in group II and III, while moderate lesions (++) were noticed in groups V
and VI. The other groups recorded mild (+) changes. The histopathological lesions
observed in different groups during 1st, 3rd and 5th week of age depicted in
84
plate 21, 22 (Fig. 1-4) plate23, 24 (Fig. 1-6) and in plate 25, 26 (Fig. 1- 6) in
respective intervals (weeks) of the experiment.
Table 32: Histopathological lesions in TMTD treated groups during 1st, 3rd, and
5th week of age.
Groups Severity of lesions Total
& No. of samples
+ ++ +++
I-BD (Basal diet) - - - -
II- 60 ppm TMTD 4 7 7 18
III-100 ppm TMTD 2 5 11 18
IV-200 ppm CuSO4 2 1 - 3
V- LivOrdain-FS @ of 1g/kg diet - - - -
VI- US CuraTox FS - - - -
VII-60 ppm TMTD +200ppm CuSO4 3 4 2 9
VIII-100 ppm TMTD + 200ppm CuSO4 2 3 2 7
IX-60 ppm TMTD + LivOrdain-FS @ of 1g/kg 4 3 - 7
diet
X-100 ppm TMTD + LivOrdain-FS @ of 1g/kg 4 5 - 9
diet
XI-60 ppm TMTD + US CuraTox-FS @ of 1g/kg 3 3 1 7
diet
XII-100ppm TMTD+ US CuraTox-FS @ of1g/kg 6 5 3 14
diet
Total 30 36 26 92
4.11.2 Histopathology of tibial bones growth plate cartilage (TGPC) using

Koneff’s stain
The special stain was employed only in 10th day samples of group I, III, IV,
VIII, and X based on the pathognomonic lesions revealed during 5th, 10th, and 15th
ciii
days of H&E study. There was not much difference in the histological changes when
compared with routine H&E satin. The lesions observed in group III sections
included pyknotic nuclei in few chondrocytes, few was empty and oval and large
disorganized clusters of chondrocytes. Group IV revealed proliferating blood
vessels, reorganization of chondrocytes with dark dense centrally placed nucleus
with few empty cells, where as group V sections revealed dilated vessels with blood
and chondrocytes were in rows and clusters with most of the cells having centrally
placed dense nuclei. Group VIII sections showed large oval empty chondrocytes
with more of matrix and pyknotic nuclei. The group X sections showed large oval
88
chondrocytes with nucleus, more of matrix and cells were in the form of clusters
than rows was presented in plate 27 (Fig. 1-5).
4.11.3 Histopathology of liver
Liver samples from all groups during days (5th, 10th, and 15th) and weeks (1st,
3rd, and 5th) were studied. The changes were observed in all groups during the above
period with dose difference (60 ppm and 100 ppm) which revealed similar changes
Sections from group III showed moderate to severe dilation of central vein
(CV) mild dilation of sinusoids, mild to moderate fatty change, hydropic
degeneration of perivascular area and shrunken hepatocytes. The wall of the blood
vessels was thickened with karyorrhexic and pyknotic nuclei. Sections of group IV
revealed moderate dilatation of CV, complete distortion of hepatic cords and focal
dilated sinusoids with focal areas of congestion and varied shape and size of the
nucleus. Where as in group V, the sections showed mild to moderate congestion of
CV with desquamation of endothelium, moderate to severe dilatation of sinusoids,
civ
moderate to sever fatty change and focal areas of degenerating hepatocytes. In some
sections, dark dense nucleus was observed.
The group VIII sections showed dilated vessels containing homogenous
material. Few sections revealed mild sinusoidal congestion, fatty change and
degeneration of hepatocytes with pyknotic nuclei. The sections of group X showed
moderate congestion of CV, dilated capillaries, greater dilatation of sinusoids,
sinusoidal congestion, mild to moderate fatty change and focal aggregates of
MNC’s.
95
The above described lesions were focused in plate 28 (Fig. 1-5) during 5th day, in
plate 29 (Fig. 1-5) for the period of 10th day and in plate 30 (Fig. 1-3) for the period
of 15th day of experiment.
4.11.4 Histopathology of Kidney

The samples from different groups (I to XII) and intervals (5th, 10th, and 15th
day 1st, 3rd, and 5th week) were used for histopathological observations and there
were no variable changes with respect to the dose and interval. In group III, sections
showed moderate to severe intertubular dilatation, shrunken glomeruli, with
optimum sized nucleus and the dilated area is filled with blood. On 15th day and in
subsequent weeks sections showed hyper cellularity of interstitium, moderate cystic
dilatation of tubules, hyaline casts, shrunken glomeruli, mild dilation of Bowmen’s
capsule. Sections of group IV showed greater dilatation of tubules, shrunken
glomeruli, hyaline casts and mild degeneration of tubular epithelium. Mild to
moderate intertubular and tubular dilatation with mild haemorrhages, shrunken
glomeruli, degenerating tubular epithelium were observed in group V. Sections of
group VIII revealed moderate cystic dilatation of tubules, degeneration of tubular
epithelium. Sections from group X exhibited large areas focal aggregates of
cv
mononuclear cells, focal areas of hyaline casts, greater intertubular dilatation and
congestion. The changes were mild in early age and pronounced as the treatment
advanced. The histopathological changes described above were depicted in plate
31(Fig. 1-5) for 5th day, in plate 32 (Fig. 1-4) for 10th day and in plate 33 (Fig. 1-4)
for 15th day of experiment.
97
4.12 IMMUNOHISTOCHEMISTRY OF GROWTH PLATE CARTILAGE

(TGPC)
Immunohistochemistry was done with paraffin embedding sections to
observe the apoptosis (Bcl-2) and endothelial growth factor (VEGF) reactions in
group I, III, IV, V, VIII and X during 5th,10th and 15th day of experiment.
4.12.1 Expression of anti apoptotic protein (Bcl-2)
Immunohistochemistry of different groups for detection of apoptotic changes
of nucleus of chondrocytes by using monoclonal antibodies against Bcl-2 antigen
expressed during the course of early cell death in which the nucleus is stained dark
with brown color indicate the presence of antigen. The antigen was detected in the
chondrocytes of group III with intensive reaction and large chondrocytes without
nucleus showing empty clefts like structures, where as in group IV intensely stained
dark dense nucleus in numerous chondrocytes without antigen reaction. In group V,
the samples revealed pyknotic nuclei and chromatolysis without stining reaction of
antigen and few cells were empty but chondrocytes were arranged in cords and
clusters. Where as in group VIII, the intensity of reaction was increased and the
pyknotic nuclei number was more and most of the cells were empty with cleft like
structures. In group X the chondrocytes appeared to have reorganised with dark
dense intensily stained nucleus and emerging capillaries. All these changes were
cvi
predominently observed in pre hypertrophic and hypertrophic zones of growth plate
cartilage lesions (Plate 34 - Fig. 1-6).
104
4.12.2 Expression of vascular endothelial growth factor (VEGF)

Vascular endothelial growth factor (VEGF) expression was done in paraffin
embedded section for detection of endothelial cellular changes of tibail bone growth
plate cartilage blood vessels of chondrocytes by using monoclonal antibodies against
VEGF antigen which is expressed during the course of TD pathogenesis. The
intensity of reaction was observed as brown color which indicated the extent damage
during the development of TD. Group I showed numerous vessels without staining
reaction of endothelium, on the contrary group III showed dilated vessels with
increased staining intensity reaction of endothelium. In group IV, the capillary
number was found to be increased with increased intensity of staining reaction, and
in groups V, VIII and X mild staining reaction of lining endothelium was observed
and focused in plate 35 (Fig.1-6).
4.13 ULTRA STRUCTURAL PATHOLOGY

The tibial growth plate chondrocytes, liver and kidney samples from
different groups (I, III, IV, V, VIII and X) during 5th, 10th and 15th day were used for
transmission electron microscopy (TEM) and sliced samples of the above organs
were also used for scanning electron microscopy (SEM). Semi thin sections (1500µ)
were stained with toludine blue to identify the pre hypertrophic and hypertrophic
zone of the growth plate cartilage, and changes in liver and kidney were also made
in the same pattern. Later ultra thin sections (100-140 µ) were made and the results
were discussed as below.
4.13.1 Transmission electron microscopy (TEM) of tibial growth plate cartilage
The ultrastructural changes of TD induced chondrocytes of hypertrophic
zone in groups III and VIII included the dilatation and vesiculation of rough
cvii
105
endoplasmic reticulum (RER), enlargement of para-nuclear space, swollen
mitochondria with electron-dense flocculent material, and loss of matrix and
dilatation of Golgi saccules. Few cells contained crescentric caps of condensed
nuclear chromatin margination which is indicative of apoptosis. Few cells showed
karyorrhexic and pyknotic nuclei with an amorphous osmiophilic masses. In most of
the samples cytoplasmic vaccuolation was seen. Abundant ER dilated with large
vacuoles, Golgi associated vacuoles and peri-cellular matrix around chondrocytes
was seen. In few cells, mineral aggregates in interstitial septa and lipid vacuoles
were observed of which the former increased the lucency of cytoplasm of necrotic
chondrocytes.
In group IV and V the changes consisted of well developed ribbon shaped
RER with dilated regions in the vicinity of Golgi complex and secondary vacuoles.
Some samples have round nucleus with eccentrically placed nucleolus, distorted
RER, shrunken mitochondria, vesicular/cytoplasm and loss of other organelles.
Group X revealed round nucleus, with faint nucleolus mild dilated RER with
oval shaped dense mitochondria. Few sections revealed shrunken chondrocytes,
pyknotic nucleus, dark dense nuclear membrane, vesicular nucleoplasma, condensed
and vesicular mitochondria along with elongated chondrocytes and round nucleus
with centrally placed nucleolus. EM changes in sections of 15th day chondrocytes in
prehypertrophic and hypertrophic zone treated group contained large lipid
inclusions, vesiculated and disarranged stacks of rough ER along with apoptotic
cells which had similar cytoplasmic features and crescentric caps of condensed
chromatin.
108
cviii
The other findings were much more related with apoptosis, as a result of
which the tissue contained immature cells that outlived their normal life span. In
some samples of group III, VIII the nuclear membrane appeared crenated with
condensation and margination of chromatin. In contrast cells bordering vascular
channels showed evidence of cell death and apoptosis with peripheral chromatin
condensation with loose inter cellular junctions. The above described TEM sub-
cellular changes were shown in plate 36 (Fig. 1-6) for 5th day, in plate 37 (Fig. 1-6)
during 10th day and in plate 38 (Fig. 1-6) for 15th day of experiment.
4.13.2 Transmission electron microscopy (TEM) of liver

The liver samples revealed the changes like margination of chromatin
material disrupted nucleolus and swollen mitochondria with loss of matrix. Some
sections of 10th and 15th day showed perinuclear swelling, cytoplasmic vacuolation.
Few mitochondria were condensed and others were swollen with loss of matrix.
Some sections of 15th day revealed swollen nucleus, margination of chromatin and
eccentrically placed nucleolus. Vacuolated mitochondria and cytoplasmic
vacuolation were observed a prominent lesion. In group IV sections showed swollen
nucleus, with margination of chromatin, large nucleolus and loss of other sub
cellular organelle. The electron dense granular material was also noticed throughout
field. The liver samples of 10th and 15th day of group IV showed moderately swollen
mitochondria and nucleus with perinuclear dilatation, margination of chromatin
material.
Some sections in group V showed swollen nucleus with loss of outer margins
and complete loss of cell organelle, and electron dense chromatin blocks in the
nucleoplasma with a faint mitochondria and electron dense granularity throughout
109
field. Group VIII samples of different periods (5th, 10th, and 15th day) revealed
shrunken hepatocytes with pyknotic nucleus and scanty chromatin margination,
cix
complete loss of cellular architecture, cytoplasmic vaccuolation distorted nuclear
membrane and loss of other organelle. Fifth day samples of group VIII revealed
moderately enlarged nucleus with eccentrically placed nucleolus, and margination of
chromatin material and swollen mitochondria with scanty and faint matrix. During
15th day group VIII sample showed additional feature like loss of nucleolus and
complete loss of other cytoplasmic organelle were noticed.
The sections of group X showed loss of intercellular junctions, condensed
nucleus with mild margination of chromatin and outer nuclear membrane with dark
faint blocks of chromatin, swollen and condensed mitochondria with scanty and
faint matrix with a prominent cytoplasmic vaccuolation was showed in plate 39, 40
and 41, Fig. 1-6.
4.13.3 Transmission electron microscopy (TEM) of kidney

The epithelial cells of kidney of group III revealed the changes like moderate
swelling of nucleus and condensed vacuolated mitochondria of tubular epithelial
cells, disrupted and marginated chromatin with narrow tubular lumen. In group IV, it
revealed dilated interstium filled with blood, shrunken and distorted tubule with
necrotic epithelial cells. Where as group V kidney samples revealed necrotic and
distorted tubular epithelial cells with electron dense granular material and faint
condensed mitochondria. The nucleus of tubular epithelial cells showed varied shape
and size, and few samples (10th and 15th day) revealed the brush border of proximal
convoluted tubules (PCT) and the cellular junction appears to be loose.
113
Where as in group VIII the epithelial cells were shrunken with electron dense
numerous fat bodies, pyknotic nucleus and margination of chromatin. Cytoplasmic
vacuoles and vacuolated mitochondria were also observed. As the age advanced the
changes in group VIII revealed distorted epithelial cells with varied shape and size
cx
of nucleus, condensed mitochondria, brush border of PCT, loose inter cellular
junction and necrotic epithelial cells. Group X irrespective of age showed distorted
and necrotic epithelial cells with pyknotic nuclei and condensed nucleolus loose
inter cellular junction, swollen mitochondria and loss of brush border and narrowed
tubular lumen. In contrast to this the group I samples revealed intertubular junction
with intact epithelium with properly arranged sub cellular organelle. The
ultrastructural changes of kidney for different periods (5th, 10th and 15th day) of
experiment are presented in plate 42, 43 and 44 (Fig. 1- 6).
4.13.4 Scanning electron microscopy (SEM) of proximal extremity of tibial

bone
The proximal extremity of tibial bone growth plate cartilage of group III
revealed necrotic areas of cartialginous structures and complete loss of Haversion
system. Group IV sample revealed moderate alteration of Haversian system with
few haemorrhges. Group V cartialge sample showed narrowed Haversion system but
appeared normal. The VIII and X group samples revealed completely altered
Haversian system with moderate haemorrhages (Plate 45, Fig. 1-6).
4.13.5 Scanning electron microscopy (SEM) of liver

Group III liver samples revealed moderate to severe dilatation of central vein
(CV) with perivesicular space and necrotic parenchyma. Thin slices of group IV
samples showed severe dilatation of blood vessels altered hepatic parenchyma.
Group V revealed an altered parenchyma, congestion and haemorrhages.The
117
samples of group VIII exhibited severe dialataion of blood vessels and necrosis of
hepatic parenchyma. Group X slices revealed mild dilataion of vessels and altered
hepatic architecture (Plate 46, Fig.1-6).
4.13.6 Scanning electron microscopy (SEM) of kidney

Group III kidney samples revealed moderate swelling of tubules with
completely closed lumen and haemorrhages. Intertubular dilatation, mild swelling of
cxi
tubules and narrowed tubular lumen were noticed in group IV. Marked
haemorrhages and narrowed tubules were observed in group V. Group VIII samples
revealed a moderately swollen tubules with complete closure of tubular lumen. Mild
intertubular dilatation was seen in group X samples (Plate 47, Fig. 1-6).
4.14 Amplicans of different genes in tibial growth plate cartilage chondrocytes

(TGPC) in QRT- PCR
The RT-PCR gel was run for the required experimental period and
synthesized gel pictures are depicted in plate 48 (Fig.1- 4) along with molecular
weights (bp) for Bcl-2, VEGF, VEGFR1 and MMP2.
4.14.1 Amplification plots and dissociation curve for different genes

(VEGF, VEGFR1, Bcl-2, MMP2 and MMP3)
The RT-PCR product for the selective genes (VEGF, VEGFR1, Bcl-2,
MMP2 and MMP3) related to pathogenesis of TMTD induced TD was amplified
and the amplification plots and dissociation curves and depicted in plate 49
(Fig.1and 2) and plate 50 (Fig. 1 and 2).
122
cxii
CHAPTER - V
DISCUSSION
5.1 GENERAL OBSERVATION AND CLINICAL SIGNS
In the present study, TD was induced by TMTD (60 ppm and 100 ppm) and
an attempt was made to counter act the TD lesion with certain ameliorative agents
was studied. Thiram treated groups exhibited clinical signs like huddling,
disinclination to move and reduced intake of feed and water. Subsequently, they
showed hock sitting posture, unable to getup, spraddle legs, showering, lateral and
sternal recumbency. Extension/or widening of legs and wings, twisting of toes,
backward stretching of legs and wobbling gait were observed in few birds. Similar
observations were made by several research groups (Waible et al., 1955 and 1957;
Vargas et al., 1983; Veltmann and Linton 1986; Ramljak et al., 1988; Weidong Wu
et al., 1990 and 1993; Lakshman et al., 2002; Rath et al., 2004 and Subapriya et al.,
2007b) by feeding of thiram at different levels in their respective experimental
period. The above symptoms were also observed in ameliorative groups (VII, VIII,
IX, X, XI, and XII) to a lesser extent when compared to thiram (II and III) fed
chicks. However, the birds survived till the end of the experiment in comparison
with group II and III in which few fatalities were recorded. These observations are
partly supported by the results of Weidong Wu et al., (1990 and 1993) and
Lakshman et al., (2002).
5.2 BODY WEIGHT GAINS (g)
In the present experiment the cumulative body weight gains (621and 664 g)
were significantly (P < 0.01) lower in TMTD treated groups (II and III) over other
groups of the experiment.
cxiii
This finding is in conformity with many research reports (Waible et al., 1955
and 1957; Ackerson and Mussehl 1955; Vargas et al., 1983; Veltmann and Linton
1986; Rao et al., 1996; Lakshman, 2004 and Subapriya et al., 2007b) of different
experiments carried out 60 ppm to 240 ppm of TMTD for a period of two days to
8weeks of age. Contrary to this Veltmann et al., (1985) and Weidong Wu et al.,
(1990 and 1993) Rath et al., (1994) Lakshman (2004) and Subapriya et al., (2007b)
reported insignificant difference in body weight gains at lower levels (15, 30 and 37
ppm) of TMTD.
Higher body weight gains (1105 and 1114 g) were recorded in the present
experiment in group IV and V. This could be due to the beneficiary effect of
ameliorative agents (CuSo4 and LivOrdian). These observations are in agreement
with findings of Weidong Wu et al., (1990) and Lakshman et al., (2002) who made a
first study on the role of CuSo4 (200 ppm) as an ameliorative agent against TD. The
significant finding of this experiment is that, the herbal product (LivOrdain) showed
better body weight gain than CuSo4 and UsCuraTox.
5.3 FEED CONVERSION RATIO (FCR)

The feed conversion ratio was significantly higher (2.94 and 2.79) in TMTD
fed groups and lower (2.18 and 2.41) in group IV (200 ppm CuSo 4) and V
(LivOrdain) indicating that better FCR in ameliorative groups reflected in higher
body weight gains.
5.4 HAEMATOLOGICAL PARAMETERS

5.4.1 Total erythrocyte count (TEC)
Significantly (P≤0.01) lower means (2.47, 2.85 and 2.87) of TEC were
recorded in group II, X and III during 1st week of experiment. During 3rd and 5th
week lower means were observed in groups II, III, VIII and XI. These results
indicated that TMTD might be exhibiting a suppressive action on erythrpoiesis. This
cxiv
observation is in accordance with opinion of Rath et al., (2004) who expressed mild
effect of TMTD on bone marrow in relation to erythrocyte production. There is a
need to study more in this regard as the TEC plays a pivotal role by supplying O2 to
the TD affect chondrocytes during its reconstruction when a suitable ameliorative
agent is used.
5.4.2 Haemoglobin concentration (Hb)

The haemoglobin concentration (7.37, 8.53 and 8.87) was significantly
(P≤0.01) lower in group III (100 ppm TMTD), VIII (100 ppm TMTD + 200 ppm
CuSo4) and XI (60 ppm TMTD + UsCuraTox) and higher (9.72, 10.05 and 11.93) in
group IV (200 ppm CuSo4), VI (UsCuraTox) and IX (60 ppm TMTD+LivOrdain)
during 1st, 3rd and 5th week of experiment. The lower Hb values indicated that the
TMTD at higher level might be interfering with the metabolism and absorption of
Hb synthesizing elements in the body. The results indicated that CuSo4 (200ppm),
US CuraTox-FS (1g/kg) and LivOrdain (1g/kg) alone promoted the Hb synthesis,
but not in combination with TMTD (60 ppm and 100 ppm). On the contrary,
previous reports (Weidong Wu et al., 1990 and Subapriya et al., 2007a) revealed
insignificant increase of Hb concentration in their experiments.
5.4.3 Packed cell volume (PCV)

Significantly (P≤0.01) lower (34.67 and 34.83) means of PCV were
recorded in group III and X during 1st week. The results indicated that not only
TMTD (100 ppm) but also the CuSo4 is influenced the PCV. The role of
ameliorative agents during third week appears to be beneficial. The results of 1st and
5th week were contrary to the previous observations of Weidong Wu et al., (1990)
and Subapriya et al., (2007a) who opined that the hematocrit was insignificant.
However, in this study similar observations were drawn during 3rd week of
experiment.
cxv
5.4.4 ERYTHROCYTE INDICES
Significantly lower means were recorded in group II, IV, V, VIII, IX and
XII, during the entire experimental period. These results are similar to that of TEC,
Hb and PCV as the indices values are derived from the above parameters. Hence, it
can be inferred that the indices are in accordance with other erythrocytes parameters.
5.4.5 Total leukocytes count (TLC) and differential leucocytes count (DLC)
TLC values were significantly (P ≤ 0.01) lower in group XII during 1st week,
in group II during 3rd week and in group XI during 5th week. Among DLC
heterophils were significantly lower in group VIII and IX, lymphocytes were lower
in group I and X and eosinophils were lower in group VIII and III during 1st and 3rd
week of experiment. However, Rao et al., (1996) reported a significant decrease in
lymphocytes and sharp increase in heterophils and normal limits of TLC and other
cells in thiram fed layers.
5.5 BIOCHEMICAL PARAMETERS (Glucose,Cholesterol,TP and A/G ratio)
Significantly (P≤0.01) lower glucose (IV, VII and IX), cholesterol (II, III and
X) and total protein and A/G (III, IV, IX and XI) were recorded during 1st, 3rd and
5th week of experiment and is an indication to biological response towards TD
inducing and ameliorative agents action in relation with healthiness of liver in all
groups. The glucose was lower in CuSo4 control group, 60 ppm TMTD + CuSo4 and
60 ppm+TMTD LivOrdain treated groups indicating the extent of damage to the
liver which resulted in the lower body weight gains (VII and IX) but not in group
IV. Histopathological and ultrastructural changes supported the trends of glucose in
different groups. The lower cholesterol values in TMTD treated groups clearly
indicated the damage to the liver. However, group X also revealed lower value
indicating that LivOrdian did not protect the organ during this period of experiment.
TP and A/G ratio were lower in 100 ppm TMTD and CuSo4 treated groups,
cxvi
indicating the extent of liver damage. Similarly, in 60 ppm TMTD+LivOrdain and
60 ppm TMTD +UsCuraTox fed groups addition of ameliorative agents did not
protect the liver damage. Theses findings are in agreement with the earlier
observations made by Walser et al., (1982), Coles (1986) and Mishra et al., (1998)
who worked only with TMTD but not with the ameliorative agents. Contrary to
these Rath et al., (2004) and Subhapriya et al., (2007) recorded no significant
difference in TMTD treated groups. The lower values in different groups reflected
the compromising in weight gain due to improper protein synthesis, variation in A/G
ratio, cholesterol synthesis and its utilization which played a major role in growth
performance. In the present study, higher values of globulin and glucose in group V
could be due to the hepato stimulant action of LivOrdain fed at the rate of 1g/ kg
diet.
5.6 SERUM ENZYMES (AST, ALT, GGT, ALP and Calcium)
Significantly lower values (17.17 and 18.00) of AST were recorded in group
IV and VI during 1st week, in group II and X it was significantly lower during 3rd
and 5th week of experiment. Lower values (14.50, 15.17 and 15.50) of ALT was
observed in group VII, IX and X respectively during 1st, 3rd and 5th week of
experiment. GGT values were lower in group V, XI, IX and XII during the
experimental period. These results indicated the extent of damage to the liver due to
TMTD toxic action and chemical action of CuSo4 and UsCuraTox. Contrary to this
lower GGT was recorded in group V fed with herbal liver protectant during 1st week
this could be due to age and biochemical response of the birds.
The ALP was significantly low in group V, IV and VIII and the calcium was
low in group II, VIII and XII indicating the toxic action of TMTD and CuSo 4 at
cxvii
cellular and sub cellular level (Tanabe and Wilcox 1960; Rath et al., 1994 and 2004;
Lakshman, 2004b; Subapriya et al., 2007a and Li et al., 2007).
5.7 MORPHOMETRY (weights of Tibail bones, Liver and kidney; length

and diameter of tibial bones)
Significantly lower weights (31.22, 3.91, 16.11 and 16.12) of tibail bones,
liver (2.44, 2.70, 6.35and 12.98) and kidneys (1.22, 1.65, 2.51 and 2.53) were
observed in TMTD treated groups during 1st 3rd and 5th week of experiment.
Similarly, lower values of length (3.63, 4.63, 4.60, 4.57, 5.15, 5.22 and 7.38) and
diameter (0.21, 0.61 and 1.17) were recorded in TMTD fed birds. The results clearly
indicated that the TMTD has toxic effects on the development and growth of the
vital organs, which play a pivotal role in the body weight gains.
5.8 GENE EXPRESSION

C
The T value in RT-PCR indicates the amount of amplicon for the selected
C
gene. The T value is inversely proportional to amount of amplicon in the reaction.
C
Increased T values indicate decreased expression (down regulation) of a gene,
C
whereas decreased T values indicate increased expression (up regulation) of the
gene (Schmittgen and Livak, 2008).
Out of the 12 groups of birds maintained, only 6 groups (I, III, IV, V, VIII,
X) were selected to study the level of expression of genes associated with the TD.
5.8.1 VEGF
The expression of VEGF gene was up regulated in thiram treated birds (III
group) at 5th day, but down regulated at 10th day and again up regulated at 15th day,
when compared to normal control birds (Group I). These findings are similar to
those of Rath et al., (2007), wherein increased expression of the VEGF gene was
reported up to 166 hours (7 days). In birds treated with both thiram and
cxviii
ameliorating agent copper sulphate (VIII group), the VEGF gene was up regulated at
5th day, 10th day and 15th day, when compared to copper sulphate controls (Group
IV). This up regulation of VEGF gene in group VIII was attributed mainly to the
action of thiram and not due to combined action of thiram and copper sulphate as
copper sulphate alone could not up regulate the VEGF gene expression on 5th and
10th day in copper sulphate controls (Group IV). In birds treated with both thiram
and LivOrdian (Group X) the VEGF gene was down regulated on 5th day and 15th
day, but not on 10th day, when compared to LivOrdian controls (Group V). It may be
surmised that LivOrdian possibly played role in down regulating the VEGF gene in
the group X. Since the objective of the study is to observe the regulation of the
selected genes in thiram induced TD with or without ameliorating agents, controls
for ameliorating agent were maintained for comparing the regulation of selected
genes in thiram + ameliorating agents treated birds. Therefore the level of
expression of TD associated genes in ameliorating agent controls doesn’t have any
technical and practical significance.
5.8.2 VEGFR1
There was no significant change in the regulation of VEGFR1 gene in thiram
treated birds (Group III) at 5th day and 15th day, but it was slightly up regulated at
10day when compared to normal controls. However, Rath et al., (2007) reported that
the VEGFR1 gene expression was down regulated up to 166 hours. But reports are
not available about the regulation of VEGFR1 gene beyond 166 hours in thiram
treated birds. The VEGFR1 gene was up regulated at 5th day and 15th day in birds
treated with both thiram and ameliorating agent copper sulphate (VIII group). No
appreciable effect on VEGFR1 regulation was found at 10th day, when compared to
copper sulphate controls (Group IV). In birds treated with both thiram and
cxix
LivOrdain the VEGFR1 gene was up regulated on 5th day and 10th day, but not on
15th day when compared to LivOrdian controls. Therefore, it may be realized that
LivOrdian exerted its action in arresting the down regulation of VEGFR1 gene.
Although the ameliorative agents could modulate expression of VEGF and VEGFR1
genes in thiram treated birds, their effect varied at different days. Since this is a
preliminary work, further research work with increased sample size is required to
study the effect of ameliorating agents on TD associated genes in thiram induced
TD.
5.8.3 Bcl-2
The Bcl-2 gene expression was consistently up regulated in thiram treated
birds (Group III) on 5th day and 10th day but remain unchanged at 15th day, when
compared to normal controls (Group I). This indicated that the cartilage plate cells in
thiram treated birds (5th and 10 day) were less prone to apoptosis up to 10th day
during thiram treatment, as Bcl-2 gene is regarded an anti-apoptotic gene. These
results are contrary to the findings of Rath et al., (2007) as it was reported that the
expression of VEGFR1 and Bcl-2 genes were down regulated in thiram treated
birds. In the present study, thiram was fed to birds of respective groups throughout
the experiment. Whereas Rath et al., (2007) studied the expression of selected genes
up to 48 hours in birds fed with thiram (in feed). In the present study, expression of
VEGF, VEGFR1 and Bcl-2 genes in tissue samples was studied at 5th day, 10th day
and 15th day, whereas Rath et al., (2007) studied the expression of these genes from
48 hours to 166 hours. As the thiram itself could not down regulate Bcl-2 gene
expression in the present study, action of ameliorating agents on Bcl-2 gene
expression in thiram fed birds has no practical significance.
cxx
5.8.4 MMP 2
MMP-2 plays prominent role in the recovery phase of TD (Dan et al., 2009).
An increased CT value of MMP-2 gene in thiram fed birds (Group III) was observed
at 10th day indicating the decreased expression (down regulation) of MMP-2 gene.
This is in accordance with the findings of Hasky- Negev et al., (2008) and Dan et
al., (2009). However in the present study increased expression (up regulation) of
MMP-2 gene was observed at 5th day and 15th day in thiram fed birds. This may
attributed that at 5th day the TD might have not been fully set and at 15th day the
recovery phase might be in progress. Taking clue from the results it is observed that
the ameliorative agent copper sulphate countered the effect of thiram on MMP-2
gene expression at 10th and 15th day, which is indicated by the increased expression
C
of MMP-2 gene (decreased T values) in birds treated with both thiram and
ameliorating agent copper sulphate (Group VIII), when compared to thiram treated
birds (Group III). However such an effect was not observed in birds treated with
both thiram and LivOrdian (Group X). Therefore, it is opined that copper sulphate
exhibited ameliorating action on expression of MMP-2 gene in thiram induced TD.
5.8.5 MMP 3
The MMP-3 gene expression didn’t vary significantly in different groups at
5th day. However its expression was increased at 10th day in thiram treated birds
(Group III). This is contrary to the findings of Dan et al., (2009). Even both the
ameliorating agents further increased the expression of MMP-3 gene at 10th day, but
the expression levels were not consistent at 15th day. With this preliminary data it’s
is difficult to surmise the probable causes for increased levels of MMP-3 expression
in thiram treated birds.
cxxi
5.9 GROSS PATHOLOGY
Predominant changes were noticed in tibial bones, liver and kidneys of birds
in group II and III after 5th day of feeding of experimental diets. Group VII, VIII,
IX, X, XI, and XII samples also exhibited a mild to moderate changes during first
week of experiment. The birds of group I, group IV, group V and group VI did not
reveal any gross change in the tibial bones. The observations (not the ameliorative
effect) pertaining to tibail bones are in accordance with several authors (Vargas et
al., 1983; Veltmann et al., 1985 and 1986; Rao et al., 1996; Rath et al., 2004 and
2007 and Subapriya et al., 2007c). The above findings in relation with ameliorative
effect of CuSo4 are similar to findings of Weidong Wu et al., (1990 and1993) and
Lakshman et al., (2002).
All the tibial bones were longitudinally sectioned and the lesions of growth
plate cartilage at its widest point was measured and graded as mild (+), moderate
(++), and sever (+++). Out of 108 birds sacrificed during 5th, 10th, and 15th day six
samples have revealed mild, 17 samples have shown moderate and 21 samples
revealed severe lesions. During 1st, 3rd and 5th week of age out of 216 samples, 33
revealed mild, 48 moderate and 135 revealed as severe lesions. The above
mentioned results were in accordance with the observations of Lakshman et al.,
(2002).
5.10 HISTOPATHOLOGY
5.10.1.1 Histopathology of TGPC employed H&E stain
Histopathology of TGPC by H&E stain has shown remarkable changes in the
chondrocytes of hypertrophic zone of group II and III birds comparatively others.
The pathognomonic lesions included pyknotic nuclei, karyorrhexis and
cxxii
disintegration of chromatin material of chondrocytes. Some sections revealed
eosinophilic nuclei and others showed swollen nucleus. Moderate thickening of
proliferating zone was characterized by swollen, oval, misshapen, flattened irregular
columns and reduced vascularity of chondrocytes with abundant matrix. Most of the
chondrocytes were seen as clusters of empty cleft like structures. The transitional
zone was abnormally thickened with oval chondrocytes, more of eosinophilic matrix
in group II and III. Slight variable change was also recorded in other groups VII,
VIII, IX, X, XI, and XII. Whereas the hypertrophic zone was thickened and invaded
by a few blood vessels that appeared empty. The bone trabeculae appeared normal
but irregularly arranged with defective cartilaginous mass of cells. Abrupt
ossification, osteoblastic & osteoclastic activity and transition of cartilage to bone
tissue were seen in group II and III. Other groups (VII, VIII, IX, X, XI, and XII)
revealed mild to moderate changes. Group I and V appeared normal. Sections of
group VI revealed no significant change but the sections of group IV showed an
irregular penetration of numerous emerging capillaries arising from diaphysis to
metaphysis.
The lesions were categorized based on above observations as mild (+),
moderate (++) and severe (+++).
Out of 90 samples, 59 samples revealed different grades of histopathological
changes in different groups (group II-18, group III-18, group VIII-10 and group X-
12. In group IV-1 sample and in group V-2 samples revealed mild lesions during 5th,
10th and 15th day. Severe lesions were observed in group II and III, which were fed
with 60 ppm and 100 ppm of TMTD, where as ameliorative groups (10 samples in
group VIII and 12 samples in group X) revealed mild lesions.
cxxiii
Sections of different groups during the 1st, 3rd, and 5th week were examined
out of which majority of sections revealed different grades of histopathological
changes. Severe lesions were observed in 18 samples each in group II and III, which
were fed with 60 ppm and 100 ppm of TMTD, respectively. Many reports (Leach
and Nesheim, 1965; Siller, 1970; Siller and Duff, 1970; Riddell et al., 1971; Riddell
et al., 1976; Bai and Cook 1994; Rath et al., 1994; Tselepis et al., 1996; Lakshman
et al., 2002; Pines et al., 2005 and Subapriya et al., 2007c) have described the
similar findings among immature chondrocytes and indicated that it could be due to
delayed or deficient penetration of blood vessel, which led to failure of proper
endochondral ossification resulting in enlargement and deformation of entire
epiphyseo-metaphyseal region was in agreement with present observations.
5.10.1.2 Histopathology of TGPC using Koneff’s satin
Histopathology of TGPC using Koneff’s satin was employed only in 10th day
samples of group I, III, IV, VIII, and X based on the pathognomonic lesions
revealed during 5th, 10th, and 15th days of H&E study. However no significant
pathological difference was observed when compared with routine H&E satin. The
lesions observed in group III sections were pyknotic nuclei in few chondrocytes.
While, few cells were empty and few were oval with large disorganized clusters.
Group IV sections revealed proliferating blood vessels and reorganization of
chondrocytes with dark dense centrally placed nucleus with few empty cells, where
as group V sections revealed dilated vessels with blood and chondrocytes in rows
and clusters with most of the cells having centrally placed dense nuclei. Group VIII
sections showed large oval empty chondrocytes, with more of matrix and pyknotic
nuclei. Group X sections showed large oval chondrocytes with nucleus, more of
cxxiv
matrix and cells in the form of clusters than rows. Theses observations are in
accordance with the earlier findings of Lakshman et al., (2002).
5.10.2 Histopathology of Liver
Histopathology of liver sections for all groups (I-XII) on 5th, 10th, and 15th
day, and on 1st, 3rd, and 5th week was carried out. The sections of group III revealed
moderate to severe dilatation of central vein (CV), mild dilation of sinusoids, mild to
moderate fatty change, hydropic degeneration of perivascular area, with shrunken
hepatocytes, thickened vessel walls, karyorrhexic and pyknotic nuclei. Sections of
group IV have shown moderate dilatation of CV, complete distortion of hepatic
cords, focal areas of congestion and dilated sinusoids, varied shape and size of the
nucleus. Where as in group V the sections exhibited mild to moderate congestion of
CV with desquamation of endothelium, moderate to severe dilatation of sinusoids,
moderate to severe fatty change, focal areas of degenerating hepatocytes and in
some sections a dark dense nucleus. The group VIII sections showed dilated vessels
containing homogenous material. Few sections revealed mild sinusoidal congestion,
fatty change and degeneration of hepatocytes with pyknotic nuclei. Group X liver
sections showed moderate congestion of CV, dilated capillaries, marked dilatation of
sinusoids, sinusoidal congestion, mild to moderate fatty change, and focal
aggregates of mononuclear cells (MNC’s).
The literature on hepatic changes in TD affected chicks due to TMTD is very
scanty and the previous observations made by Walser et al., (1982), Rao et al.,
(1996), Lakshman, (2004) and Subapriya et al., (2007c) are similar to the present
findings except the intense degenerative changes of hepatocytes. Hence the
observations made in this experiment may pavement the intoxication effect of
TMTD on hepatic parenchyma during detoxifying mechanism.
cxxv
5.10.3 Histopathology of Kidney
Histopathology of kidney samples from different groups (I to XII) and at
periods (5th, 10th, and 15th day; 1st, 3rd, and 5th week) were used for histopathological
observations and there were no variable changes in respect to the dose and period. In
group III, sections showed moderate to severe shrunken glomeruli with optimum
size nucleus and intertubular hemorrhage. On 15th day and in subsequent weeks
sections showed hyper cellularity of interstitium, moderate cystic dilatation of
tubules, hyaline casts, shrunken glomeruli and mild dilatation of Bowman’s capsule.
Group IV sections showed cystic dilatation of tubules, shrunken glomeruli, large
quantities of hyaline casts and mild degeneration of tubular epithelium. Mild to
moderate intertubular haemorrhages, focal areas of cystic dilatation, shrunken
glomeruli and degenerating tubular epithelium were observed in group V. Sections
of group VIII revealed moderate cystic dilatation of tubules, degenerating tubular
epithelium, and sections of group X showed focal aggregates of mononuclear cells
and presence of hyaline casts. The changes were mild in early age and pronounced
as the treatment advanced. Present study observations are in agreement with the
findings of Walser et al., (1982), Rao et al., (1996) and Lakshman, (2004), who
reported mild hydropic degeneration of proximal and distal convoluted tubes.
5.11 IMMUNOHISTOCHEMISTRY OF TGPC
5.11.1 Expression of anti apoptotic protein (Bcl-2)
Immunohistochemistry of different groups for detection of apoptotic (Bcl-2)
changes of nucleus of chondrocytes was done by using monoclonal antibodies
against Bcl-2 antigen, which was expressed during the course of early cell death in
which the nucleus is stained dark and dense and with brown color indicating the
presence of antigen. The antigen was detected in the chondrocytes of group III with
cxxvi
intensive reaction, wherein large chondrocytes without nucleus showed empty cleft
like structures. Group IV revealed intensely stained dark dense nucleus in numerous
chondrocytes without antigen reaction. In group V, the samples revealed pyknotic
and chromatolysis of nucleus without staining reaction of antigen and few cells
were empty but chondrocytes were arranged in cords and clusters. In group VIII the
intensity of reaction was increased, the pyknotic nuclei number was more and most
of the cells were empty with cleft like structures. In group X the chondrocytes
appeared, have reorganised with dark dense intensily stained nucleus which was
centrally placed with emerging capillaries. All these changes were prodominently
observed in pre hyper trophic and hypertrophic zones of growth plate
cartilage.These findings appers to be new, the avialble literature peratins to
ACP,AKP and ASP only. Lawler et al. (1988) has observed significant decrease in
the amnitude of ACP. Rath et al.,(1994) observed that the bitinilation enhanced
detectebility of extracted proteins. In the present study, an attempt was made to
focus on Bcl-2 gene expression which palyes a significant role during the early death
death of chondrocytes in TD.
5.11.2 Expression of vascular endothelial growth factor (VEGF)
Vascular endothelial growth factor (VEGF) detection was done in paraffin
embedded section by using monoclonal antibodies against VEGF antigen, which is
expressed during the course of TD pathogenesis. The intensity of reaction was
observed as brown color which indicated the extent of damage during the
development of TD. Group I showed numerous vessels without staining reaction of
endothelium, on the contrary group III showed dilated vessels with increased
staining reaction of endothelium. In group IV, the capillary number increased with
intense staining reaction and in groups V, VIII and X mild staining reaction of lining
cxxvii
endothelium was observed. Gay et al.,(2007) studied the expression of VEGF in
Rachetic cartilage but not in TD cartilage and demonstrated the immuno
localisation of VEGF. Tain et al., (2009) made an attempt to detect the differentailly
expressed genes (Col I and Hsp -90) in growth plate cartilage in relation with
vascularization. Research reports are pertaing to Bcl-2 and VEGF by
immunohistochemistry in TMTD induced TD in broilers is scanty, perhaps the
present study could be the first report as far as the detection of Bcl-2 and VEGF
markers (proteins) in parafin sectioned cartilage tissues. However, many researchers
have indicated the importanace of markers to study the pathogenesis of TMTD
induced TD in broilers.
5.12 ULTRASTRUCTURAL PATHOLOGY
5.12.1 Transmission electron microscopy of TGPC
Ultrastructural changes concerned to nucleus, rough endoplasmic reticulum
and mitochondria were very prominent. The ultrastructural changes of liver and
kidney were sequential and predominant. Perusal of literature revealed that research
reports are not available on sub cellular studies of liver and kidney in TMTD
induced TD in broiler chicks. Hence an attempt was made in the present study to
document the ultrastructural changes in the tibial bone cartilage, liver and kidney of
TMTD treated broilers.
Transmission electron microscopy (TEM) of tibial growth plate cartilage
changes of hypertrophic zone in group III, VIII included the dilatation and
vesiculation of rough endoplasmic reticulum (RER), enlargement of para-nuclear
space, swollen mitochondria with electron-dense flocculent material, loss of matrix
and dilatation of Golgi saccules. Few cells contained crescentric caps of condensed
nuclear chromatin margination, and swollen nucleus which are indicative of
cxxviii
apoptosis. Few cells showed karyorrhexic and pyknotic nuclei with an amorphous
osmiophilic masses which is indicative of necrosis of chondrocytes. In most of the
samples, cytoplasmic vaccuolation was seen. Abundant dilated ER with large
vacuoles, Golgi associated vacuoles and peri-cellular matrix around chondrocytes
was seen. In few cells, mineral aggregates in interstitial septa and lipid vacuoles
were also observed of which the former increased the lucency of cytoplasm of
necrotic chondrocytes.
In group IV and V the changes consisted of a well developed ribbon shaped
RER with dilated regions in the vicinity of Golgi complex and secondary vacuoles.
Some samples had round nucleus with eccentrically placed nucleolus, distorted
RER, shrunken mitochondria, vesicular cytoplasm and loss of other organelle.
Group X revealed round nucleus, faint nucleolus, mild dilated RER with oval
shaped dense mitochondria. Few sections revealed shrunken chondrocytes, pyknotic
nucleus, dark dense nuclear membrane, vesicular nuleolemma, condensed and
vesicular mitochondria, elongated chondrocytes with round nucleus and centrally
placed nucleolus. EM changes in sections of 15th day chondrocytes in
prehypertrophic and hypertrophic zones of treated group contained large lipid
inclusions, vesiculated and disarranged stacks of RER along with apoptotic cells
which have a crescentric cap of condensed chromatin.
In group III and VIII the findings were more related to apoptosis, in which
the nuclear membrane appeared crenated, peripheral chromatin condensation and
margination of chromatin with loose inter cellular junctions, which is indicative of
early cell death. The changes in mitochondria included impaired vascularity of
growth plate in the present experiment. These findings in accordance with the
findings of Lowther et al., (1974) and Brighton et al., (1978) who were focused on
cxxix
mitochondrial changes during early cell death in poultry and rats respectively.
Important role of vascularity of growth plate in the pathogenesis of TD was focused
by Howlet et al., (1984). Hargest et al., (1985) explained the early EM changes in
rapidly growing chickens and other animals affected by TD. The reports of Haynes
and Walser (1986), Ling et al., (1995), Ohyama et al., (1997) and Christopher and
Irving (2002) were focused on micro-environmental regulation of chondrocytes in
apoptosis.
5.12.2 Transmission electron microscopy of liver
Transmission electron microscopy (TEM) of liver samples revealed the
changes like margination of chromatin material of nucleolus, disrupted nucleolus,
swollen mitochondria with loss of matrix. Some sections of 10th and 15th day
showed perinuclear swelling and cytoplasmic vaccuolation. Few cells had
condensed mitochondria and in few cells swollen mitochondria with loss of matrix
were observed. Some sections of 15th day revealed swollen nucleus, with
margination of chromatin, eccentrically placed nucleolus, vacuolated mitochondria
and cytoplasmic vaccuolation as a prominent lesion. The sections of group IV
showed swollen nucleus with margination of chromatin, large nucleolus and loss of
other sub cellular organelle. Electron dense granular material was also noticed
throughout the field. Moderately swollen mitochondria were also evident. The
sections of group V showed swollen nucleus with loss of outer margins and
complete loss of cell organelle and electron dense chromatin blocks in the
nucleoplasma was seen with a faint mitochondria and electron dense granularity
throughout the field. In group VIII samples of different periods (5th, 10th, and 15th
day) shrunken hepatocytes, pyknotic nucleus and scanty chromatin with
margination, complete loss of cellular architecture, cytoplasmic vaccuolation
cxxx
distorted nuclear membrane and loss of other organelle were observed. On 5th day
samples of group VIII revealed moderately enlarged nucleus with eccentrically
placed nucleolus, and margination of chromatin material swollen mitochondria with
scanty and faint matrix. On 15th day sections of group VIII revealed loss of
nucleolus and complete loss of other cytoplasmic organelle. The sections of group X
showed loss of intercellular junctions, condensed nucleus with margination of
chromatin, swollen and condensed mitochondria with scanty and faint matrix and
prominent cytoplasmic vaccuolation.
5.12.3 Transmission electron microscopy of kidney
The TEM of kidney sections of group III have showed the changes like
moderate swelling of nucleus, condensed, vacuolated mitochondria of tubular
epithelial cells, disrupted and marginated chromatin with a narrow tubular lumen. In
group IV dilated interstium filled with blood, shrunken and distorted tubule with
necrotic epithelial cells was found, and the nucleus appeared normal. The sections of
group V revealed necrotic and distorted tubular epithelial cell with electron dense
granular material and condensed mitochondria. The nucleus showed varied shape
and size, and in few samples (10th and 15th day) it revealed the brush boarder of
proximal convoluted tubules (PCT). The cellular junction appeared to be loose. The
epithelial cells of group VIII were shrunken with electron dense numerous fat
bodies, pyknotic nucleus and margination of chromatin, cytoplasmic vacuoles and
vacuolated mitochondria. The lesions in group VIII revealed distorted epithelial cells
with varied shape and size of nucleus, condensed mitochondria, brush boarder of
PCT, loose inter cellular junction and necrotic epithelial cells towards the end of the
experiment. On the contrary in group X, irrespective of age distorted and necrotic
epithelial cells with pyknotic nuclei and condensed nucleolus loose inter cellular
cxxxi
junction, swollen mitochondria and loss of brush boarder and a narrowed tubular
lumen were noticed. In contrast to this the group I (normal controls) samples showed
tight intertubular junction with intact epithelial and properly arranged sub cellular
organelle.
The information on liver and kidney TEM changes was scanty, hence the
present observations may lead to the future research in TMTD induced TD in
broilers.
5.12.4 Scanning electron microscopy of bone and cartilage
Scanning electron microscopy (SEM) of proximal extremity of tibial bone
growth plate cartilage of group III revealed necrotic areas of cartialginous structures
and complete loss of haversion syytem. Group IV sample showed a moderate
alteration of haversion system and also haemorrhges were observed. Group V
cartialge sample showed, only narrowing of the haversion system. The VIII and X
group samples revealed completely altered haversion system with moderate
haemorrhges.
5.12.5 Scanning electron microscopy of liver
Scanning electron microscopy (SEM) of liver sections of group III revealed a
moderate to severe dilation of central vein (CV) with perivesicular space and
necrotic parenchyma. Thin slices of group IV samples showed severe dilatation of
blood vessels and altered hepatic parenchyma Group V samples revealed an
altered parenchyma and congestion.The samples of group VIII exhibited severe
dialataion of blood vessels and necrosis of hepatic parenchyma. Group X slices
revealed a mild dilataion of vessels and altered hepatic architecture.
cxxxii
5.12.6 Scanning electron microscopy of liver
Scanning electron microscopy (SEM) of kidney sections of group III
revealed a moderate swelling of tubules with completely closed lumen and
haemorrhages, the group IV showed mild swelling of tubules and narrowed tubular
lumen. Severe intertubular haemorrhages and narrowed tubules were observed in
group V. Group VIII samples showed moderately dilated tubules with complete
closure of tubular lumen, while it was mild in group X.
Though SEM observations may not be useful in studying the pathogenesis of
TD, they have a role in the surface pathomorphological changes of the concerned
organs.
TD is an emerging metabolic disorder of young broilers significantly influencing the
economic status poultry industry. Hence, the present study has been under taken to
evaluate the factors responsible for TD lesion at molecular and ultrastructural level
with ameliorative agents. The present study indicated that Thiram has more
damaging effect on cartilage cells over other organs. VEGF and MMP2 are useful as
biomarker in diagnosis of TD. Ultrastructurally prominent features were noticed in
mitochondria, ER and nucleus in TMTD treated birds. LivOrdian was found to have
moderate ameliorative effect on VEGF and CuSo4 on MMP2. Future research should
be concentrated on eventual metabolic pathways responsible for TD lesion as
biomarkers in diagnosis of TD. Further, it can be emphasized on usage of different
ameliorative agents alone and in combination to over come this metabolic disorder
to minimize the sign
cxxxiii
CHAPTER – VI
SUMMARY
The present study was designed to find out the effect of TMTD in causation of TD
in broilers and amelioration effect of copper sulphate CuSo4, LivOrdian-FS and USCura
Tox-FS.
The experiment was designed with four hundred and twenty (420) day-old male
broilers chicks. All are wing banded, individually weighed and distributed into twelve (I -
XII) groups of 35 chicks each and reared in separate battery brooder pens under identical
managemental conditions throughout the experimental period (35 days) and daily observed
for clinical signs.
Group I served as control, group II and III were fed with 60 ppm and 100 ppm of
TMTD. Group IV, V and VI were fed with 200 ppm CuSo4, LivOrdain-FS and USCura
Tox-FS (1g/kg) Group VII and VIII were fed with 60 ppm and 100 ppm of TMTD and 200
ppm CuSo4 as an ameliorative agent, where as group IX and X were fed with 60 ppm and
100 ppm of TMTD and LivOrdain-FS. Group XI and XII were fed with USCura Tox-FS for
a period of 35 days.
Weekly weight gains were calculated and lowest cumulative mean value (621g) was
recorded in group III, similarly the FCR was analyzed and showed significantly (P≤ 0.01)
higher values in TMTD treated groups.
Six birds from group I, III, IV, V, VIII and X were sacrificed on 5th, 10th and 15th
day and TGPC paired samples were collected for selective gene expression ultrastructural
pathology and immunohistochemistry.
Further, six birds from each group were sacrificed during 1st, 3rd and 5th week of
age, blood samples, tibial bones, liver and kidney were collected from respective groups for
haemato-biochemical, histopathological and ultrastructural studies.
The results of haematological parameters showed significantly (P≤ 0.01) lower
values in TEC, Hb, PCV, TLC and DLC during 1st, 3rd and 5th week of experiment in groups
II, III, IV, VIII, XI, X and XII respectively. The results revealed that the TMTD exhibited
mild to moderate suppressive action on erythrpoiesis, leucopoiesis and Hb synthesis in
addition to causing severe TD lesion. The ameliorative agents have partially counteracted
the TMTD effect on erythrpoiesis, leucopoiesis and Hb synthesis.
Serum biochemical parameters showed significantly (P≤ 0.01) lower values in
glucose (IV, VIII and IX), cholesterol (II, III and X), total protein and A/G ratio (III, IV, IX
and XI) during the experimental period. AST and ALT values were also significantly (P≤
0.01) lower in groups II, IV, VI, VII, IX and X. The lower values of GGT and ALP were
cxxxiv
recorded in groups V, IX, XI, XII and IV, V and XII respectively. Lower values of serum
calcium were recorded in groups II, VIII and XII during the experimental period. The
significance in group IV could be due to toxic action of CuSo4 on liver and in group II and
III it might be due to toxic action of TMTD while in other groups might be due to graded
levels of TMTD and ameliorative agents.
C
The specific selective gene expression was studied and the mean T values of QRT-
C
PCR were statistically analyzed, the increased T values indicated decreased expression and
decreased C
T values indicated increased expression of the selective genes. Significantly (P≤
C
0.01) lower mean T values of VEGF, VEGFR1 and Bcl-2 genes were recorded in III, VIII
C
and X groups. Similarly lower mean T values of MMP2 was observed in X, V and VIII
groups and MMP3 gene lower values were recorded in group IV, VIII and X. These
observations indicated up and down regulation of selective gene expression in causation and
repair of TD lesion by using ameliorative agents.
The morphometry of tibial bone, liver and kidney weights, length and diameter of
tibial bones was done during the weekly sacrifices. Significantly (P≤ 0.01) lower mean
values were observed in group II, III, IV, VII, VIII and IX during 1st, 3rd and 45th week of
experiment. The results indicated that the TMTD has significantly influenced the
morphometry over ameliorative groups and control group. This could be due to age and
graded level of TMTD and the biological behavior of the experimental birds towards
ameliorative agents.
The pronounced gross changes like decrease in length, weight, diameter, slight
bending at proximal extremity of tibial bones were observed in group II and III, where as
group VII, VIII, IX, X, XI, and XII showed mild to moderate changes. The birds of group I,
IV, V and VI did not reveal any changes. All the tibial bones were longitudinally sectioned
and the lesions of TGPC at its widest point was measured and graded as mild (+), moderate
(++) and severe (+++) lesions during respective days and weeks and highest score (++ and
+++) was recorded in TMTD fed groups. The gross changes like shrinkage, mild
enlargement, mild to moderate congestion of liver and kidney were prominent in group II
and III followed by other groups VII, VIII, X and XII.
Histopathological changes in TGPC showed remarkable changes in hypertrophic of
zone of TMTD treated birds like swollen, oval and misshapen, clusters of empty cleft like
chondrocytes. Some sections revealed pyknotic nuclei, karyorrhexis and disintegration of
chromatin material. Some revealed eosinophilic nuclei and some showed swollen nucleus.
All the lesions were as graded mild (+), moderate (++) and severe (+++).
Special stain (Koneff’s’) was employed in samples of group I, III, IV, VIII, and X
to observe the specific changes if any. The sections of group III revealed pyknotic nuclei,
oval and large disorganized clusters of chondrocytes. Group IV sections revealed
cxxxv
proliferating blood vessels, reorganization of chondrocytes where as in group V the
chondrocytes are in rows and clusters. Group VIII sections showed large oval empty
chondrocytes with more of matrix and pyknotic nuclei. The group X sections showed a large
oval chondrocytes with nucleus, more of matrix and cells are in the form of clusters than
rows.
Liver samples of group III showed moderate to severe dilatation of central vein
(CV), mild dilatation of sinusoids, mild to moderate fatty change, hydropic degeneration
karyorrhexic and pyknotic nuclei. Group IV sections revealed moderate dilatation of CV,
complete distortion of hepatic cords and focal dilated sinusoids with focal areas of
congestion. Group V sections showed mild to moderate congestion of CV, desquamation of
endothelium, moderate to severe dilatation of sinusoids, moderate to sever fatty change and
focal areas of degenerating hepatocytes. Group VIII sections revealed dilated vessels, mild
sinusoidal congestion, fatty change and degeneration of hepatocytes. Group X sections
showed moderate congestion of CV, dilatation and congestion of sinusoids, mild to
moderate fatty change, and focal aggregates of MNC’s.
Kidney sections of group III showed moderate to severe intertubular dilatation,
shrunken glomeruli, hyper cellularity of interstitium, moderate cystic dilatation of tubules,
mild to moderate hyaline casts, mild dilation of Bowmen’s capsule were observed. Group
IV and V sections were revealed greater dilatation of tubules, shrunken glomeruli, hyaline
casts, mild degeneration of tubular epithelium, mild to moderate intertubular haemorrhages
and focal areas of cystic dilatation. Group VIII sections revealed moderate cystic dilatation
of tubules and degeneration of epithelium. Group X samples showed large areas focal
aggregates of MNC’s, focal areas of hyaline casts and greater intertubular dilatation.
Immunohistochemistry was employed by using monoclonal antibodies against Bcl-2
and VEGF antigen. The Bcl-2 expression was showed as intensive reaction in group III
intensive reaction over group IV. Group V the samples have revealed the pyknotic and
chromatolysis of nucleus without staining reaction. Stainig intensity was increased in Group
VIII and most of the cells are empty cleft like structures, where as group X sections appears
to be reorganised with emerging capillaries.
The VEGF expression was done to detect the damage of endothelium of TGPC
blood vessels. The brown color reaction is the indication of extent of damage during the
development of TD lesion which was observed in group III and IV, Mild reaction was
observed in group V, VIII and X.
The ultrastructural changes (TEM) of group III and VIII samples revealed dilatation
and vesiculation of rough endoplasmic reticulum (RER), swollen mitochondria with loss of
matrix and dilatation of Golgi saccules and few cells showed apoptotic changes. In most of
the samples cytoplasmic vaccuolation was prominent. Group IV and V samples showed well
cxxxvi
developed ribbon shaped RER with dilated regions in the vicinity of Golgi complex and
secondary vacuoles. Group X revealed round nucleus, mild dilated RER, oval shaped dense
mitochondria, and few sections revealed shrunken chondrocytes with pyknotic nucleus,
condensed and vesicular mitochondria. Group III and VIII revealed crenated nuclear
membrane, condensation and margination of chromatin which is evidence apoptosis.
The liver sections of group II and III revealed margination of chromatin material,
disrupted nucleolus and swollen mitochondria with loss of matrix. Some sections revealed
perinuclear swelling, cytoplasmic vaccuolation and swollen mitochondria with loss of
matrix. Group IV sections showed swollen nucleus with margination of chromatin and loss
of other sub cellular organelle. Sections of group V showed swollen nucleus and complete
loss of cell organelle. Group VIII samples have shown shrunken hepatocytes with pyknotic
nucleus and scanty chromatin margination, complete loss of cellular architecture,
cytoplasmic vaccuolation distorted nuclear membrane and loss of other organelle. The
sections of group X showed loss intercellular junctions, cytoplasmic vaccuolation
condensed nucleus and mitochondria.
The kidney sections of group III revealed moderate swelling of nucleus, condensed
vacuolated mitochondria, disrupted and marginated chromatin with narrow tubular lumen.
Group IV sections showed dilated interstium, shrunken, distorted and necrotic epithelial
cells. Group V revealed necrotic epithelial cells with condensed mitochondria with brush
boarder of PCT. Group VIII sections showed numerous fat bodies, pyknotic nucleus and
margination of chromatin, cytoplasmic vacuoles and vacuolated mitochondria and loose
inter cellular junction. Group X showed distorted and necrotic epithelial cells with pyknotic
nuclei, condensed nucleolus, swollen mitochondria and loss of brush boarder, loose inter-
cellular junction and narrowed tubular lumen.
The SEM lesions of TGPC of group III revealed necrotic areas of cartialginous
structures and complete loss of Haversian system. Group IV sample showed moderate
alteration of Haversion system and haemorrhges. Group V sample showed a narrowed
Haversion system. Group VIII and X samples revealed complete altered Haversian system
with moderate haemorrhges.
The liver samples of group III revealed moderate to severe dilation of CV with
perivesicular space and necrtic parenchyma, group IV showed severe dilation of blood
vessels with altered hepatic parenchyma, group V revealed an altered parenchyma,
congestion and haemorrhages. Group VIII samples exhibited severe dialataion of blood
vessels and necrosis of hepatic parenchyma and group X slices were revealed a mild
dilataion of vessels and altered hepatic architexure.
The kidney samples of group III revealed moderate swelling of tubules with
completely closed lumen and haemorrhages. Group IV showed intertubular dilatation and
cxxxvii
mild swelling of tubules with narrow tubular lumen. Severe haemorrhages and narrowed
tubules were observed in group V. Group VIII samples showed moderately swollen tubules,
group X samples revealed mild intertubular dilatation.
cxxxviii
LITERATURE CITED
Ackerson, C. W. and Mussehl, F. E. 1955. Toxicity of treated seed corn in rations
for chicks. Poultry Science. 34 (3):728-729.
Bai, Y. and Cook, M. C. 1994. Histological study of Tibial dyschondroplasia like

lesion from light type chicks fed with cysteine supplemented diets. Avian
Diseases. 38: 557- 562.
Balasubramaniam, A. and Sukumar, S. 2008. A report on Thiram poisoning in

commercial layers. Tamilnadu Journal of Veterinary and Animal Sciences.
3(4): 219.
Bancraft, J. D., Cook, H. C., Stirling, R.W. and Turner, D. R. 1994. Manual of
histological and their diagnostic application. Churchill Livingstone
Edinburgh London, Madrid, Melbourne, New York and Tokyo.263-288.
Beisel, W. R. 1996. Nutrition and Immune function: an overview. Journal of

Nutrition. 126:2611-2613.
Boone, L., Meyer, D., Cusick, P., Ennulat, D., Provencher, B.A., Everds, N.
Meador, V., Elliot, G., Honor, D., Bounous, D. and Jordan, H. 2005.
Selection and Interpretation of Clinical Pathology indicators of hepatic injury
in pre clinical studies. Veterinary Clinical Pathology. 34:182-216.
Bozzala, J. J. and Russel, L. D. 1998. In: Electron Microscopy Principles and

Techniques for Biologists. 2nd Edn. Jones and Barlett Publishers, Sudbury,
Massachusetts pp. 19-45 and 72-144.
Brighton, C. T. and Hunt, R. M. 1978. The role of mitochondria in growth plate

calcification as demonstrated in a rachitic model. Journal of Bone Joint
Surgery. 60: 630-639.
Christopher, S. A. and Irving, M. S. 2002. The fate of the terminally differentiated

chondrocyte: Evidence for Micro environmental regulation of chondrocyte
apoptosis. Critical review of Oral Biology and Medicine. 13 (6): 465-473.
Coles, E. 1986. Veterinary Clinical Pathology, 4th Edition, W B Saunders Company,

West Washington Square, Philadelphia, P A 19105, 279-301.
Cynthia Rider, V. and Gerald Le Blanc, A. 2005. An Integrated Addition and

Interaction Model for Assessing Toxicity of Chemical Mixtures.
Toxicological Science. 87:520-523.
Dan, H., Simsa, S., Hisdai, A., Sela-Donenfeld, D. and Monsonego-Ornan, E. 2009.
Expression of matrix metalloproteinases during impairment and recovery of
the avian growth plate. Journal of Animal Science. 87 (11): 3544-3555.
cxxxix
Dennis, A. L., Robinson, H. C., Dolman, J. W. and Thomas, K. W. 1974. Cartilage
matrix components in chickens with tibial dyschondroplasia. Journal of
Nutrition. 104: 922-929.
Dumas, B. T., Watson, W. A. and Biggs, H. G. 1971. Albumin standards and the
measurement of serum albumin with bromocresol green. Clinical Chemistry
Acta. 31:87-96.
Edwards, H. M. Jr. 1985. Observations on several factors influencing the incidence

of tibial dyschondroplasia in Broiler Chickens. Poultry science. 64: 2325-
2334.
Edwards, H. M. Jr. 1987. Effect of Thiuram, Disulfiram and a trace element mixture
on the incidence of tibial dyschondroplasia in chickens. Journal of Nutrition.
117: 964-969.
Edwards, H. M. Jr. 1988. Effect of dietary calcium, phosphorus, chloride, and

zeolite on the development of tibial dyschondroplasia. Poultry Science.
67:1436-1446.
Edwards, J. 2004. Animal Health: A break point in economic development. In: 11th
International Conference of Association of International Tropical Veterinary
Medicine and the 16th Veterinary Association of Malaysia Congress, pp 23-
25.
Eisaku, H., Susumu, O., Tomota, N., Yukaro, K., Yuji, O., Tacko, H., Yuzo, K.,
Dongchon, K., Yuchiro, C., Kiyiko, G. and Kenji, S. 2009. Development of
new measurement method for serum calcium with chlorophosphonazo-III.
Annual Clinical Biochemistry. 46: 296- 301.
FairBrother, A., Smits, J., and Grasman,K. 2004. Avian Immunotoxicology. Journal
of Toxicology and Environment Health (part B). 7:105-137.
Fallavena, L. L. B., Salle, L. T., Moraes, H. L. S., Krahl, M., Reali, E. H., Santos,
G. P., Countinho, A. and Franco, J. L. K. 1991. Locomotor problems in
broiler chickens of three commercial strains: I. Clinical aspects, occurrence
of tibial dyschondroplasia and bowing of tibiotarso : Arquivo-Brasilerio-de-
Medicina- Veterinaria-e-zooteua : 43 (4) : (Poultry Abstracts (1982) 018 –
02968).
Gan, Z. R. 1987. Purification, Characterization, Primary structure and Catalytic

Mechanism Studies of Pig Liver Thioltransferase. Ph. D. thesis, Michigan
State University.
Gan, Z. R. and William, W.W. 1988. Immunological Characterization of

Thioltransferase from Pig Liver. The Journal of Biological Chemistry. 263
(18) 9050-9054.
cxl
Gay, C.V., Anderson, R. E. and Leach, R. M. 1985 Activities and distribution of
alkaline phosphatase and carbonic anhydrase in the tibial
dyschondroplastic lesion and associated growth plate of chicks. Avian
Diseases. 29: 812-882.
Gay, C. V., Gilman, V. R., and Leach, R. M. 2007. Immunolocalization of

vascularization factors in normal, tibial dyschondroplasia and rachitic
cartilage. Avian Pathology. 36 (6): 445-451.
Germeloc, D. R., Nyska, A., Kashon, M., Kuper, C. F., Portier, C., Kommineni,
C., Johnson, K. A. and Luster, M. I. 2004. Extended Histopathology in
Immunotoxicity testing: International laboratory validation studies.
Toxicological Science. 78:107-110.
Hargest, T. E., Leach, R. M. and Gay, C. V. 1985. Avian tibial dyschondroplasia-I.

Ultra structure. American Journal of Pathology.119: 175 – 190.
Hasky-Negev, M., Simsa, S., Tong, A., Genina, O. and Monsonego-Ornan, E. 2008.
Expression of matrix metalloproteinases during vascularization and
ossification of normal and impaired avian growth plate. Journal of Animal
Science. 86:1306-1315.
Hassig, A., Wen-Xil and Stampflik. 1996. Stress induced suppression of the CMI
on the neuro endocrine control of the immune system. Medical Hypothesis.
46:551-553.
Hayes, W.J. and E.R. Laws (ed.). 1990. Handbook of Pesticide Toxicology, Vol. 3,
Classes of Pesticides. Academic Press, Inc., NY.
Haynes, J. S. and Walser, M. M. 1986. Ultrastructure of Fusarium-induced tibial

dyschondroplasia in chickens: A sequential study. Veterinary Pathology.
23:499-505.
Hemsley, L. A. 1970. A cartilage abnormality of broiler chickens. Veterinary

Record. 86: 385.
Howlett, C. R., Dickson, M. and Sheridant, A. K. 1984. The fine structure of the
proximal growth plate of the avian tibia: vascular supply. Journal of
Anatomy. 139(1): 115-132.
Jyoti Palod. 2005. Scope and Challenges of Poultry Production in 21st Century.
Poultry Line. 5:25-31.
Kacmar, P., Pistl, J. and Mikula, I. 1999. Immuno Toxicology and Veterinary
Medicine. Acta Veterinary Brno. 68: 57-59.
Kalita, D. 2004. Pollution by Agricultural Chemicals and their management.

Chemical weekly. 9:185-190.
cxli
Kenneth, J. L. and Schmittgen, T. D. 2001. Analysis of relative gene expression data
using Real-Time Quantitative PCR and 2-∆∆CT method. Methods. 25: 402-
408.
Knopov, V. R., Leach, M., Barak-Shalom, T., Hurwitz, S. and Pines, M. 1995.
Osteopontin gene expression and alkaline phosphatase activity in avian tibial
dyschondroplasia. Bone. 16:329-334.
Krishna Kumar, C.V.R. 2011. Green Chemistry for Animal Health, e-proceedings of
National Seminar on Pharmaceutical Chemistry: Held at Krishna University,
Machilipatnam, A.P. 30th -31st January.
Krishna Kumar, C.V.R. and Rajendar, K. 2010. Agro chemical pollution in poultry
industry-status evaluation, e-proceedings of International Conference on
Climate Change: Held at Osmania University, Hyderabad, A.P. 9th -11th
December.
Lakshman, M., Ahmed, S. R. and Sarma, B. J. R. 2002. Effect of tetramethyl

thiuram disulfide (TMTD) on the development of experimental tibial
dyschondroplasia (TD) in chicks. Indian Journal of Veterinary Pathology. 26
(1&2): 43-45.
Lakshman, M. 2004 a. Effect of tetramethyl thiuram disulfide on the growth rate and
leg weakness in broilers. Indian Veterinary Journal. 81: 1093-1096.
Lakshman, M. 2004b. Natural occurrence tetramethyl thiuram disulfide (TMTD)

contaminated tibial dyschondroplasia (TD) in broilers in A.P. National
Symposium on Advances in Pathological techniques in Diagnosis of Animal,
Bird and Fish Diseases, 21st Annual conference of IAVP 23rd – 25th Nov:
Held at Kolkatta, pp - 9 and 10.
Laursen-Jones, A. P. 1970. A cartilage abnormality of broiler chicks. Veterinary

Record. 86: 445.
Lawler, M. E., Shivers, J. L., Walser, M. M. 1988. Acid phosphatase activity of

chondrocytes from Fusarium - induced tibial dyschondroplastic cartilage.
Avian Diseases. 32: 240-245.
Leach, R. M. Jr. and Nesheim, M. C. 1965. Nutritional, genetic and morphological

studies of an abnormal cartilage formation in young chicks. Journal of
Nutrition. 86: 236- 244.
Leach, R. M. Jr. and Nesheim, M. C. 1972. Further studies on tibial

dyschondroplasia (cartilage abnormality) in young chicks. Journal of
Nutrition. 102: 1673-1680.
Leach, R. M. Jr. and Gay, C. V. 1987. Role of epiphyseal cartilage in Endochondral

Bone Formation. Journal of Nutrition. 111: 784 - 790.
cxlii
Leach, R. M. Jr. and Monsonego-Orman, E. 2007. Invited reviews tibial
dyschondroplasia 40 years later. Poultry Science. 86: 2053-2058.
Li, J., Bi, D., Pan, S. and Zhang, Y. 2007. Effect of diet with thiram on liver
antioxidant capacity on dyschondroplasia in broilers. British Poultry Science.
48 (6): 724-728.
Ling, J., Kinkad, S. A., Daniel, M. C. and Barteis, J. E. 1995. Ultrastructural

changes of chondrocytes of growth plates of young broiler chickens
predisposed to tibial dyschondroplasia. Poultry Science. 74 (5):788-794.
Lowther, A. D., Clem, R.H., Dolman, W. J. and Thomas, W. K. 1974. Cartilage

matrix components in chickens with tibial dyschondroplasia. Journal of
Nutrition. 104: 922-929.
Luna, G. L. H. T. (ASCP). 1968. Manual of Histologic and special staining

techniques. 2nd edn., The Blakistone Division, McGraw-Hill Book Company,
Inc. New York, Toronto London: 1-5 and 93-94.
McCapes, R. H. 1967. Lameness in turkeys due to faulty bone formation. Animal

Nutrition Health. 22: 17-18.
Meister, R.T. 1992. Farm Chemicals Handbook '92. Meister Publishing Company,
Willoughby, OH.
Michael, L., Barry, H., Thorp, C. Colin, C. W. 1992. Avian tibial dyschondroplasia
as a cause of bone deformity. Avian Pathology. 21: 275-285.
Mishra, V. K., Srivastava, M. K. and Raizada, R. B. 1998. Testicular toxicity in rats

to repeated oral administration of tetramethyl thiuram disulfide (Thiram).
Indian Journal of Experimental Biology. 36: 390-394.
Nene, Y. L. and Thapliyal, P. N. 1982. Fugicides in plant disease control. 2nd edn.,
IBH Publishing Company, New Delhi: 70-89.
Neufeld, G., Cohen, T., Gengrinovitch, S. and Poltorak, Z. 1999. Vascular

endothelial growth factor (VEGF) and its receptors. The Journal of the
Federation of American Societies for Experimental Biology (FASEB). 13: 9-
22.
Ohyama, K., Farquharson, C., Whitehead, C. C. and Shapiro, I. M. 1997. Further

observations on programmed cell death in the epiphyseal growth plate:
comparison of normal and dyschondroplastic epiphysis. Journal of Bone and
Mineral Research. 12 (10): 1647-1656.
Orth, M. W. and Cook, M. E. 1994. Avian Tibial Dyschondroplasia: A

Morphological and Biochemical Review of the Growth Plate Lesion and its
Causes. Veterinary Pathology. 31: 403-414.
cxliii
Pines, M., Hasadi, A. and Monsonego-Oman, E. 2005. Tibial dyschondroplasia?
Tools, new insights and future prospects. World’s Poultry Science
Journal.61: 285- 297.
Ramljak, D., Bidjin, Z., Culjak, K., Hrlel, G., Shhic, M. and Cizel, J. A. 1988.
Toxicity of Tetramethyl thiuram disulfide as a possible cause of leg
weakness in broiler chickens. Poultry Abstract. 14 (4): 137.
Rao, N. A., Ramsubba Reddy, V., Rajashekara, R. and Srilatha, Ch. 1996. Thiram
poisoning in poultry-its alleviation. Poultry Punch.12 (12): 37-42.
Rath, N. C., Bayyari, G. R., Balog, J. M. and Huff, W. E. 1994. Physiological

studies of Turkey tibial dyschondroplasia. Poultry Science. 73:416-424.
Rath, N. C., Bayyari, G. R., Beasley, J. N., Huff, W. E. and Balog, J. M. 1994. Age
related changes in the incidence of tibial dyschondroplasia in Turkeys.
Poultry Science. 73:1254-1259.
Rath, N. C., Huff, W. E. J. M.., Balog, G. R. B. and Reddy, R. P. 1997. Matrix

Metalloproteinase activities in Avian tibial dyschondroplasia. Poultry
Science. 76: 501- 505.
Rath, N. C., Huff, W. E., Bayyari, G. R. and Balog, J. M. 1998. Cell death in Avian
tibial dyschondroplasia. Avian Diseases. 42: 72-79.
Rath, N. C., Huff, W. E., Balog, J. M. and Huff, G. R. 2004. Comparative efficacy
of different dithiocarbamates to induce tibial dyschondroplasia in poultry.
Poultry Science. 83: 266-274.
Rath, N. C., Richards, M. P., Huff, W. E., Huff, G .R. and Balog, J. M. 2005.
Changes in the tibial growth plates of chickens with thiram-induced
dyschondroplasia. Journal of Comparative Pathology. 133: 41-52.
Rath, N. C., Huff, G. R. and Huff, W. E. 2006. Thiram - induced tibial

dyschondroplasia: a model to study its pathogenesis and prevention
presented at 12th European poultry conference, Sept, 10th -14th, pp 1-6 held at
Verona Italy.
Rath, N. C., Huff, W. E. and Huff, G. R. 2007. Thiram- induced changes in the
expression of genes relating to vascularization. Poultry Science. 86 (11):
2390-2395.
Rath, N. C., Kannan, L.. Pillai, P. B., Huff , W. E., Huff, G. R., Horst, R. L. and
Emmert, J. L. 2007. Evaluation of the efficacy of vitamin D3 or its
metabolites on thiram-induced tibial dyschondroplasia in chickens. Research
in Veterinary Science. 83: 244 - 250.
cxliv
Reich, A., Jaffe, N., Tong, A., Lavelin, I,. Genina, O., Pines, M. Sklan, D,
Nussinovitch A. and Monsonego-Ornan, E. 2008. Weight loading young
chicks inhibits bone elongation and promotes growth plate ossification and
vascularization. Journal of Applied Physiology. 98: 2381-2389.
Riddell, C., Howell, J. and Kaye, M. M. 1971. tibial dyschondroplasia in broiler

chickens in Western Canada. Avian Diseases. 15: 557-565.
Riddel, C. 1976. Studies on the pathogenesis of Tibial Dyschondroplasis in

Chickens IV, Some Features of the vascular supply to the growth plates of
the Tibiotarsus. Avian Diseases. 21 (1): 9 -15.
Ross, H. V. and William, M.A. 2003. Invertebrate Biomarkers: Links to toxicosis

that predict population decline. Ecology Toxicology Environmental
Safety.54:366-369.
Sakamoto, M. 1997. Nutrition and Host Defence. Biotherapy (Japan). 11: 492-511.
Schmittgen, T. D. and Livak, K.J. 2008.Analyzing real-time PCR data by the

comparative CT method: Nature Protocols (3): 1101 – 1108.
Shaw, L. M., Stromme, J. A., Lodon, J. L. and Theodorsen, L. 1983. International
Federation of Clinical Chemistry, Scientific Committee, Analytical Section.
IFCC methods for the measurement of catalytic conc. of enzymes. Part 4.
IFCC method for {(Gamma-glutamyl)-peptide:aminoacid gamma-glutamyl
transferase, EC 2.3.2.2}In: Journal of Clinical Chemistry, Biochemistry. 2
(10): 633- 646.
Siller, W. G. 1970. Tibial dyschondroplasia in the fowl. Journal of Pathology. 101:

19- 46.
Siller, W. G. and Duff, R. H. 1970. Cartilage abnormality in broiler fowls.

Veterinary Record. 86: 757.
Simsa, S., Hasdai, A. and Dan, H. 2007. Induction of tibial dyschondroplasia in

turkeys by tetramethyl thiuram disulfide (thiram). Poultry Science. 86: 1766-
1771.
Snedecor, G.W. and Cochran. W. G.1994. In: Statistical methods 8th Edn. Iowa state
University press, Ames, Iowa, USA.
Spurr, A. R. 1969. A low viscosity epoxy resin embedding medium for electron
microscopy. Journal of Ultrastructural Research. 26: 31- 43.
Stav, S., Hasdai, A., Dan, H. and Monsonego Ornan, E. 2007. Differential regulation
of MMPs and matrix assembly in chicken and turkey growth-plate
chondrocytes. American Journal of Physiology Regulatory, Integrative and
Comparative Physiology. 292: 2216 - 2224.
cxlv
Subhapriya, S., Vairamuthu, S., Muralimanohar, B. and Balachandran, C. 2007a.
Clinicopathological Investigation on Thiram toxicosis in broiler chicken.
International Journal of Poultry Science. 6 (4): 242- 244.
Subhapriya, S., Vairamuthu, S., Muralimanohar, B. and Balachandran, C. 2007b.

Growth Performance Studies in Thiram toxicosis in broiler chicken.
Subhapriya, S., Vairamuthu, S., Muralimanohar, B. and Balachandran, C. 2007c.

Pathomorphalogical changes in Thiram toxicosis in broiler chicken.
Tanabe, Y. and Wilcox, F. H. 1960. Effect of age, sex, and line on serum alkaline
phosphatase of the chicken. Proceedings of Society of Experimental
Medicine. 103: 68-70.
Thorp, B. H., Whitehead, C. C. and Rinnle, J. S. 1991. Avian tibial

dyschondroplasia: a comparison of the incidence and severity assessed by
gross examination and histopathology. Research in Veterinary Science.
51(1): 48-54.
Tian, W. X., Zhang, W. P., Li, J. K., Bi, D. R., Guo, D. Z ., Pan, S. Y., Zhang, Y. H.
and Qin, P. 2009. Identification of differentially expressed genes in the
growth plate of broiler chickens with thiram-induced tibial dyschondroplasia.
Avian Pathology. 38 (2) 161-166.
Tomlin, C. 1994. The Pesticide Manual, 10th Edn. Crop Protection Publication, pp
989-990.
Trinder, P. 1969. Determination of glucose in blood using by glucose oxidase with

an alternative oxygen acceptor Ann. Clinical Biochemistry. 6: 24-25.
Tselepis, C. J. A., Hoyland, R. E. B., Thorp B. H. and Kwan, A.P.L. 1996.

Expression and distribution of cartilage matrix macromolecules in avian
tibial dyschondroplasia. Avian Pathology. 25:305-324.
Vargas, M. I., Lamas, J. M. and Alverenga, V. 1983. Tibial dyschondroplasia in

growing chickens experimentally intoxicated with Tetramethyl thiuram
disulfide. Poultry Science. 62: 1195 - 1200.
Veltmann, J. R. Jr., Rowland, G. N. and Linton, S. S. 1985. Tibial dyschondroplasia

in single comb white leghorn chicks fed tetramethyl thiuram disulfide (A
fungicide). Avian Diseases. 29 (4): 1269-1272.
Veltmann, J. R. Jr. and Linton, S. S. 1986. Influence of dietary tetramethyl thiuram

disulfide (A fungicide) on growth and incidence of tibial dyschondroplasia in
single comb white leghorn chicks. Poultry Science. 65: 1205-1207.
Waible, P. E., Pomeroy, B. S. and Elton, J. L. 1955. Effect of Arasan - treated corn
on laying hens. Poultry Science. 121: 40-42.
cxlvi
Waibel, P. E., Elton, J. L., Pomeroy, B. S. and Howard, L .B. 1957. Toxicity of
Tetramethyl thiuram disulfide for chicks, poults and goslings. Poultry
Science. 36 (1): 697- 703.
Walser, M. M., Allen, N. K., Mirocha, C. J., Hanlon, G. F. and Newman, J. A. 1982.
Fusarium induced osteochondrosis (tibial dyschondroplasia) in chickens.
Veterinary Pathology. 19: 544 - 550.
Weidong Wu, M. S., Cook, M. E. and Smalley, E. B. 1990. Prevention of thiram-

induced dyschondroplasia by copper. Nutritional Research. 10: 555-566.
Weidong Wu, M. S., Cook, M. E., Chu, Q. and Smalley, E.B. 1993. Tibial
dyschondroplasia of chickens induced by fusarochromanone, mycotoxins.
Avian Diseases. 37: 302-309.
Wise, D. R. and Jennings, A. R. 1972. Dyschondroplasia in domestic poultry.

Veterinary Record.91: 285-286.
Wrathall, A. E., Simmons, H. A., Bowles, D. J., and Jones, S. 2004. Biosecurity
strategies for conserving valuable live stock genetic resources. Journal of
Reproduction, Fertility and Development. 16:103-112.
Yutaka, E., Donald, L. E. and Yoshihide, T. 1992. Isolation and characterization of

the chicken Bcl-2 gene: expression in a variety of tissues including lymphoid
and neural organs in adult and embryo. Nucleic Acids Research. 20 (16):
418-419.
cxlvii
ABBREVIATIONS
< - Less than

> - Greater than
µ - microns
µl - micro liter
% - percentage
2 -∆∆cT - 2 delta delta threshold cycles
@ - at the rate
o
C - Degrees centigrade
A - Albumin
ACP - Acid Phosphatase
AKP Alkaline phosphatase
Al - Aluminium
ALP - Alkaline phosphatase
ALT - Alanine amino transferase
AP - Andhra Pradesh
ASP - Aryl sulfate
AST - Aspartate amino transferase
Ba - Barium
BD - Basal diet
Bcl-2 - Antiapaptotic protein (marker)
bp - Base pairs
Br - Bromide
Bwt - Body weight
Ca - Calcium
CAS - Chemical abstract service
cDNA - complementary deoxyribo nucleic acid
CHOD/POD - Cholesterol dehyrogenase/peroxidase
cm - centimeter
Col I - Collagen type I
CP - Chemical product
cxlviii
CPD - Critical point drier
Cr - Chromium
Cu - Copper
CuSo4 - Copper sulphate
CV - Central vein
DLC - Differential leukocyte count
DMTC - DiMethyldithiocarbomate
DNA - Deoxyribo nucleic acid
dNTP - Deoxy nucleoside triphos phate
DPX - Distyrene plasticizer xylines
EBDCs - ethylene bisdithiocarbamates
ECM - Extra cellular matrix
EDTA - Ethylene diamine tetra acetic acid
EM - Electron microscopy
EPA - Environmental protection agency
ER - Endoplasmic reticulum
F - Feledioum
FCR - Feed conversion ratio
Fe - Iron
FS - Feed supplement
G - Globulin
g - Grams
GDP - Gross domestic product
GGT - Gamma-glutamyl transferase
Glu - Glucose
GOD - Glucose oxidase
GP - Growth plates
GSH - Glutathione
GSH-Px - Glutathione peroxidase
guHCL - guanidine Hydrochloric acid
h - hour
H&E - Haemotoxylin and eosin
Hb - Haemoglobin concentration
cxlix
HP - Herbal product
H2O2 - Hydrogen peroxide
HRP - Horse-radish peroxidase
Hsp - Heat shock proteins
Hsp90 - Heat shock protein 90
I - Iodine
IB - Infectious bronchitis
IBD - Infectious bursal disease
IFCC - International federation of clinical chemistry
IUPAC - International union of pure and applied chemistry
JEOL - Japan electronics optical limited
Kg - Kilo gram
LC - Lead citrate
LD50 - Leathal dose -50
Li - Lithium
MCH Mean corpuscular haemoglobin
MCHC - Mean corpuscular haemoglobin concentration
MCV - Mean corpuscular cell volume
MD - Marek’s disease
MDA - Malondialdehyde
ml - Milli liter
MMP - Matrix metalloproteinases
mm - Milli meter
Mn - Manganese
MNC’s - Mono nuclear cells
Mo - Molybdenum
mRNA - messenger Ribonucleic acid
NBF - Neutral buffer formalin
ND - Newcastle disease
Ni - Nickel
NIOSH - National institute of safety and health
NOEC - No Observable Effect of Chemical
NRC - National research council
cl
oCPC - o-Creso phthalein complexone
OPN - Osteopontin
OsO4 - Osmium tetraoxide
P - Phosphorus
PBS - Phosphate buffered saline
PCT - Proximal convoluted tubules
PCV - Packed cell volume
PDTC - Pyrrolidine Dithiocarbomate
PES - Poultry experimental station
pH - Negative log of hydrogen ion concentration
PMA - Phorbol 12-myristate 13-acetate
ppm - parts per million
QRT-PCR Quantitative real time polymerase chain reaction
RA Retinoic acid
RER - Rough endoplasmic reticulum
RGD - arg-gly-asp (peptide sequence)
RT - Reverse transcriptase
RT- PCR - real time polymerase chain reaction
RTECS - Registry of toxic effects of chemical substances
SAP - Serum alkaline phosphatase
SCWLH - Single comb white leg horn
SEM - Scanning electron microscope
Si - Silica
Sn - Tin
SOD - Super oxide dismutase
SPI - Structure probe inc
Sr - Strontium
TBS - Tris buffer saline
TCA - Tri chloroacetic acid
TD - Tibial dyschondroplasia
TEC - Total erythrocyte count
TEM - Transmission electron microscope
TGPC - Tibial bones growth plate cartilage
cli
TLC - Total leukocyte count
TMTD - Tetramethyl thiuram disulfide
TP - Total proteins
tris - Hydroxymethyl aminomethane (T.B.S) buffer saline
UA - Urenyl acetate
V - Vanadium
VEGF - Vascular endothelial growth factor
VEGFR1 - Vascular endothelial growth factor receptor
WP - Wettable powder
Zn - Zinc
clii

Lakshman - Thesis PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Lakshman - Thesis PDF

Uploaded by

Copyright:

Available Formats

MOLECULAR AND ULTRASTRUCTURAL

PATHOLOGY OF THIRAM (TMTD - TETRA METHYL THIURAM

THESIS SUBMITTED TO THE

DEPARTMENT OF VETERINARY PATHOLOGY

Mr. M.LAKSHMAN has satisfactorily prosecuted the course of research

and that the thesis entitled “MOLECULAR AND ULTRASTRUCTURAL

PATHOLOGY OF THIRAM (TMTD - TETRA METHYL THIURAM

DISULFIDE) INDUCED TIBIAL DYSCHONDROPLASIA (TD) IN

BROILERS” submitted is the result of original research work and is of sufficiently

This is to certify that the thesis entitled “MOLECULAR AND

Thesis approved by the Student’s Advisory Committee

CHAIRMAN: Dr. Y. ANJANEYULU __________________

MEMBER: Dr. Ch. SRILATHA __________________

MEMBER: Dr. T. S. CHANDRA SEKHARA RAO __________________

MEMBER: Dr. D. SRINIVASULU __________________

I M. Lakshman here by declare that the thesis entitled “MOLECULAR

AND ULTRASTRUCTURAL PATHOLOGY OF THIRAM (TMTD- TETRA

METHYL THIURAM DISULFIDE) INDUCED TIBIAL

DYSCHONDROPLASIA (TD) IN BROILERS” submitted to Sri Venkateswara

Veterinary University Tirupati, for the degree of DOCTOR OF PHILOSOPHY is

materials contained in this thesis have not been published earlier.

Date: (M. LAKSHMAN)

II REVIEW OF LITERATURE 5-36

2.1 Thiram (tetramethyl thiuram disulfide - TMTD) 5

2. 4 Tibial dyschondroplasia( TD) 10-12

2.5 Pathogenesis of tibial dyschondroplasia (TD) 12-15

2.6 Clinical signs of tibial dyschondroplasia (TD) 15-17

2.7 Hematological parameters in TMTD induced TD 17-18

2.8 Serum biochemical parameters in TMTD induced TD 18

2.8.1 Serum protein , glucose and cholesterol 18

2.8.2 Serum enzymes (ALP,ALT,AST and GGT) 19-20

2.8.3 Serum calcium and phosphorus in TMTD induced TD 20-21

2.9 Gross pathology of tibial dyschondroplasia (TD) 21-22

2.10 Histopathology in TMTD induced TD 22

2.10.1 Tibial bone growth plate cartilage (TGPC) 22-25

2.10.2 Liver and Kidney 25-26

2.11 Immunohistochemistry of tibial dyschondroplasia (TD) 26

2.11.1 Tibial bone growth plate cartilage (TGPC) 26-28

2.12 Ultrastructural pathology tibial dyschondroplasia (TD) 28

2.12.1 Tibial bone growth plate cartilage (TGPC) 28-32

2.13 Molecular pathology tibial dyschondroplasia (TD) 32-35

3.1 Growth rate 38

3.2 Feed consumption and conversion ratio 38

3.3.1 Collection of blood for haematological parameters 39

3.4 Serum biochemistry 39

3.4.1 Collection of blood for serum separation 39-40

3.4.2 Serum biochemistry 40

3.4.3 Serum enzymes and calcium 40

3.5 Morphometry of tibia, liver and kidneys 40

3.5.1 Weights of tibial bones , liver and kidneys 41

3.5.2 Length and diameter of tibial bones 41

3.6 Necropsy observations 41

3.7 Gross pathology of tibial bones, liver and kidneys 41

3.8 Histopathological studies 42

3.10 Molecular pathology of tibial dyschondroplasia (TD) 45

Material collection for quantitative real time polymerase

3.10.2 RNA isolation and reverse transcription ( RT) 46

3.10.4 Real-Time PCR 47

3.11 Ultrastructural pathology of tibial dyschondroplasia (TD) 47

4.1 General observation and clinical signs 50

4.2 Mortality pattern 53

4.3 Body weight gains 53

4.4 Feed consumption and Feed conversion ratio (FCR) 53