Am J Physiol Cell Physiol 311: C663–C672, 2016.
First published August 31, 2016; doi:10.1152/ajpcell.00144.2016.
CALL FOR PAPERS Cellular Mechanisms of Proteostasis
mTOR signaling regulates myotube hypertrophy by modulating protein
synthesis, rDNA transcription, and chromatin remodeling
Ferdinand von Walden,2 Chang Liu,2 Nicole Aurigemma,1 and Gustavo A. Nader1,2
1
Noll Laboratory, Department of Kinesiology and Huck Institutes of the Life Sciences, The Pennsylvania State University,
University Park, Pennsylvania; and 2Department of Physiology and Pharmacology, Karolinska Institute, Stockholm, Sweden.
Submitted 19 May 2016; accepted in final form 30 August 2016
von Walden F, Liu C, Aurigemma N, Nader GA. mTOR sig-
naling regulates myotube hypertrophy by modulating protein synthe-
sis, rDNA transcription, and chromatin remodeling. Am J Physiol Cell
Physiol 311: C663–C672, 2016. First published August 31, 2016;
doi:10.1152/ajpcell.00144.2016.—Ribosome production is an early
event during skeletal muscle hypertrophy and precedes muscle protein
accretion. Signaling via mTOR is crucial for ribosome production and
hypertrophy; however, the mechanisms by which it regulates these
processes remain to be identified. Herein, we investigated the activa-
tion of mTOR signaling in hypertrophying myotubes and determined
that mTOR coordinates various aspects of gene expression important
for ribosome production. First, inhibition of translation with cyclo-
heximide had a more potent effect on protein synthesis than rapamy-
cin indicating that mTOR function during hypertrophy is not on
general, but rather on specific protein synthesis. Second, blocking Pol
II transcription had a similar effect as Rapamycin and, unexpectedly,
revealed the necessity of Pol II transcription for Pol I transcription,
suggesting that mTOR may regulate ribosome production also by
controlling Class II genes at the transcriptional level. Third, Pol I
activity is essential for rDNA transcription and, surprisingly, for
protein synthesis as selective Pol I inhibition blunted rDNA transcrip-
tion, protein synthesis, and the hypertrophic response of myotubes.
Finally, mTOR has nuclear localization in muscle, which is not
sensitive to rapamycin. Inhibition of mTOR signaling by rapamycin
disrupted mTOR-rDNA promoter interaction and resulted in altered
histone marks indicative of repressed transcription and formation of
higher-order chromatin structure. Thus mTOR signaling appears to
regulate muscle hypertrophy by affecting protein synthesis, Class I
and II gene expression, and chromatin remodeling.
mTOR; ribosome biogenesis; RNA Pol I; transcription; epigenetics;
hypertrophy
DE NOVO ribosome production is an early event during skeletal
muscle hypertrophy. The increase in protein synthetic capacity
is needed to sustain muscle protein accretion and is directly
proportional to muscle protein synthesis rates (25). At the onset
of muscle hypertrophy preceding any measureable protein
accretion (20), increased ribosomal DNA (rDNA) transcription
by RNA polymerase I (Pol I) leads to ribosomal RNA (rRNA)
accumulation, and an increase in ribosome content (41). This
involves the activity of all three transcription systems: RNA
Polymerase (Pol) I generates a primary transcript from the 45S
ribosomal (r)DNA genes to produce 18S, 5.8 S, and 28S
rRNA; Pol II transcription is responsible for synthesizing all
Address for reprint requests and other correspondence: G. A. Nader, 101
Noll Laboratory, Dept. of Kinesiology, The Pennsylvania State Univ., Univ.
Park, PA 16802 (e-mail: gan11@psu.edu).
http://www.ajpcell.org 0363-6143/16 Copyright © 2016 the American Physiological Society
Downloaded from http://ajpcell.physiology.org/ by 10.220.32.246 on October 15, 2016
r-proteins mRNAs and accessory factors required for rRNA
processing; and Pol III transcribes 5S and tRNAs. Of these,
transcription of rDNA genes by RNA Pol I is thought to be
rate limiting for ribosome production and cellular growth
(10, 26, 35).
The mechanistic target of rapamycin (mTOR) is central to
growth control (16, 21). In skeletal muscle, mTOR inhibition
by rapamycin impedes hypertrophy in vivo and in vitro (2, 33)
partly by blocking rRNA synthesis (27). In addition to its role
in mRNA translation, mTOR is involved in transcription by all
three Pols (21), and although its importance in skeletal muscle
hypertrophy has recently been challenged (9), early mTOR
activation in hypertrophying muscle is consistent with an
increase in rDNA transcription (41). Signaling to mTOR by
PI3K and downstream to S6K1 is important for various ana-
bolic processes (6, 15), especially Pol I transcription (4, 11,
14). However, the functional divergence exerted by the PI3K/
mTOR/S6K1 signaling cascade requires a detailed investiga-
tion of the relative contribution each factor has in controlling
ribosome production during muscle hypertrophy. For example,
while mTOR-dependent regulation of translation is well estab-
lished (15), its functions in muscle gene transcription are less
clear. Recent studies demonstrated that mTOR can localize to
both cytoplasmic and nuclear compartments (13, 34, 39) indi-
cating that mTOR nuclear localization may play an important
role in gene regulation. Furthermore, nuclear TOR signaling
appears to regulate histone acetylation (32) and rDNA tran-
scription in response to nutrients (18). Thus mTOR signaling
may modulate muscle hypertrophy at the translational and
transcriptional levels by coordinating multiple processes im-
portant for ribosome production.
The main goal of the present study was to determine the
involvement of mTOR signaling in rDNA transcription, and
whether its role in protein synthesis and gene expression
represent two distinct and separable mTOR functions during
myotube hypertrophy. We hypothesized that by having cyto-
plasmic and nuclear localization, mTOR orchestrates ribosome
production by regulating translation and transcription of Class
I and II genes. We approached these aims by first using
rapamycin to block mTOR signaling, and then contrasting the
findings by using specific inhibitors for the downstream pro-
cesses in which mTOR is known to be involved, e.g., protein
synthesis and Pol I or Pol II transcription. These biochemical
dissections would reveal whether inhibition of mTOR signal-
ing by rapamycin has a similar impact on ribosome production
and hypertrophy as the specific inhibition of the downstream
processes (i.e., protein synthesis, transcription). We provide
C663
C664 RIBOSOMAL DNA GENE REGULATION BY mTOR DURING MUSCLE HYPERTROPHY
novel evidence indicating the necessity of protein synthesis and
Pol II transcription for rDNA transcription, ribosome produc-
tion, and hypertrophy. Additionally, we show that in myotubes,
mTOR has nuclear localization and is involved in rDNA
transcription in a rapamycin-sensitive manner by directly in-
teracting with the rDNA gene promoter (rDNAp). We also
provide novel data indicating a reduction in Histone 3 Lysine
56 acetylation (H3K56ac) and enrichment of linker histone H1
(H1) at the rDNAp consistent with transcriptional silencing and
inhibition of mTOR signaling by rapamycin.
MATERIALS AND METHODS
Cell culture and chemical inhibitors. C2C12 myoblasts (ATCC,
Manassas, VA) were grown to 90 –100% confluence in growth me-
dium (DMEM with 10% fetal bovine serum ⫹ 1% Pen-Strep) and
were induced to fuse into myotubes by switching to differentiation
medium (DM ⫽ DMEM with 2% horse serum ⫹ 1% Pen-Strep) for
4 days. To eliminate undifferentiated myoblast from the cultures, 20
␮M AraC was added to the medium for 24 h on the third day of
differentiation. At day 4 postdifferentiation, myotubes were either
maintained in DM or stimulated with high serum medium (GM ⫽
DMEM with 20% FBS ⫹ 1% Pen-Strep) for 1, 3, 6, 12, 24, or 48 h.
All experiments were performed in a humidified environment at 37°C
and 5% CO2. For siRNA transfection experiments, myoblasts were
seeded in 12-well plates and double transfected at day 3 and day 5
postdifferentiation with S6K1 siRNA (50 pM) or scrambled siRNA
(50 pM) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) ac-
cording to the manufacturer’s instructions. Myotubes were stimulated
by addition of GM for 12 h after the second transfection. Chemical
inhibitors were dissolved in dimethyl sulfoxide (DMSO) as follows:
CX-5461 {2-(4-methyl-1,4-diazepan-1-yl)-N-[(5-methylpyrazin-2-yl)
methyl]-5-oxo[1,3]benzothiazolo[3,2a][1,8]naphthyridine-6-carboxa-
mide} (1 ␮M) treatment was initiated by preincubation 2 h before
serum stimulation. Rapamycin (25 ng/␮l) and PF-4708671 (PF) (20 ␮M)
were added 1 h before stimulation with GM. DRB (5– 6-dichloro-1-
beta-D-ribofuranosylbenzimidazole) (75 ␮M), ␣-Amanitin (50 mg/
ml), LY294002 (LY) (20 ␮M), cycloheximide (CHX) (50 ␮M)
incubations started with the addition of GM for the experimental
groups and 0.1% DMSO was used for the DM and GM control
group. All experiments were performed in 12-well plates except
48-h experiments (24-well plates), cytosolic and nuclear fraction-
ation (6-well plates), and chromatin immunoprecipitation (ChIP)
(10-cm plates).
Determination of myotube diameter. Myotube diameter was mea-
sured manually in nine separate fields per treatment at 10 ⫻ using a
Table 1. Primer sequences utilized in this study
Target Forward
45S Pre-rRNA (ETS) CCAAGTGTTCATGCCACGTG
45S Pre-rRNA (ITS) FCCGGCTTGCCCGATTT
GAPDH ATGTTCCAGTATGACTCCACTCACG
c-Myc TGCGACTGACCCAACATCAG
eIF4E CACCCTGCGCCCTTCA
TAF1C CACCCTGCGCCCTTCA
PAF53 TCAGAACAAGACTTTCAGGGACAA
TTF1 AAACGGAAGCATGCCTTCAG
POLR1B TGGGAATCTGCGTTCTAAAACA
UBF CGCGCAGCATACAAAGAATACA
Rrn3 ATTTTGAGCGCATTGTGTTGAGC
tRNA CCTTCGATAGCTCAGCTGGTAGAGCGGAGG
RPS6 CATGGGGGAGTTGGACCATA
RPS7 TGCCTCAATATCTGCGTCGG
RPL11 TGCCTCAATATCTGCGTCGG
45S rDNAp GACCAGTTGTTCCTTTGAGG
AJP-Cell Physiol • doi:10.1152/ajpcell.00144.2016 • www.ajpcell.org
Leitz Fluovert microscope equipped with a digital camera. Myotube
diameter was determined at the point of the widest diameter in all
multinucleated myotubes using ImageJ (NIH, Bethesda, MD).
RNA extraction and quantification, cDNA synthesis, and qRT-PCR.
Total RNA was extracted with TRizol Reagent (Invitrogen, Carlsbad,
CA) and subsequently cleaned using Direct-zol columns (Zymo Re-
search, Irvine, CA). RNA quantification and purity were determined
on a Nanodrop ND-1000 and RNA integrity verified by agarose gel
electrophoresis as previously described (27). RNA was stored at
⫺80°C until further use. cDNA was synthesized from 1 ␮g of total
RNA with the VILO cDNA (Invitrogen) synthesis kit according to the
manufacturer’s recommendations. The cDNA stock was further di-
luted for downstream Quantitative Real-Time Polymerase chain reac-
tion (qRT-PCR) depending on the target gene. qRT-PCR was per-
formed using a SYBR-chemistry based with GoTaq supermix (Pro-
Downloaded from http://ajpcell.physiology.org/ by 10.220.32.246 on October 15, 2016
mega, Fitchburg, WI) on a Bio-Rad touch CFX-384 system. Reactions
were run in triplicate for each sample on 384 well plates. Primers were
tested on a 64-54°C heat gradient to optimize annealing temperature
and verify a primer efficiency of ⬃100%. A melt-curve analysis was
performed for each primer pair to ensure the amplification of a sole
PCR product and amplicon size was verified by agarose-gel elec-
trophoresis. Relative expression levels were obtained by normal-
ization to GADPH (or 28S for DRB and treated samples) by the
comparative CT (⌬⌬CT) method in the Bio-Rad CFX Manager
(version 3.0) software. Primer sequences utilized in the present
study are described in Table 1.
Cell lysis and cytosol/nuclear protein fractionation. Total protein
was extracted from cells lysed in ice-cold lysis buffer (50 mM
HEPES-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton
X-100, 0.1% sodium deoxycholate, and 0.1% SDS) supplemented
with one tablet of Complete mini protease inhibitor cocktail and
PhoStop phosphatase inhibitors (Roche Diagnostics, Indianapolis,
IN). Cytosol/nuclear protein fractionation was carried out with NE-
PER Nuclear and Cytoplasmic extraction reagent according to the
manufacturer’s recommendations (Thermo Fisher Scientific,
Waltham, MA). All chemicals were purchased from Sigma unless
stated otherwise (Sigma-Aldrich, St. Louis, MO). Crude lysates were
spun down at 12,000 g for 5 min and supernatants transferred to new
tubes. Protein concentration was assessed with the DC protein assay
(Bio-Rad, Hercules, CA) and lysates (if needed) diluted with lysis
buffer before mixing 3:1 with 4X Laemmli buffer (Bio-Rad) contain-
ing 10% ␤-mercaptoethanol. All samples were heated at 95°C for 10
min, cooled on ice, and stored at ⫺20°C until further use.
Western blotting and antibodies. Protein samples were separated by
SDS-page on 4 –12% polyacrylamide Criterion gradient gels and
transferred to PVDF membranes (Bio-Rad) activated in 100% meth-
Reverse
CGAGCGACTGCCACAAAAA
GCCAGCAGGAACGAAACG
GAAGACACCAGTAGACTCCACGACA
CCTGTCCTGGCTCGCAGATT
GGTCAGGGCCATCAGTCATG
GGTCAGGGCCATCAGTCATG
CTGCTTGGTGCTTCCAAAGG
CACGGTAGTACACGAGCTTCCA
TTCAGCTTGTCAGCCACAACA
GTTTGGGCCTCGGAGCTT
GGGAGCATCTGGCGACTGTTC
CGGAATTGAACCAGCGACCTAAGGATGTCC
TGGCCCTCTGTTCACACTA
TTCTCCGGATGCCAAAGGAC
TTCTCCGGATGCCAAAGGAC
ACCTATCTCCAGGTCCAATAG
 RIBOSOMAL DNA GENE REGULATION BY mTOR DURING MUSCLE HYPERTROPHY
anol. Western blotting was performed using standard techniques as
previously described (28). In short, membranes were washed in a
Tris-buffered saline with 0.1% Tween (TBS-T 0.1%) and blocked in
a protein containing buffer TBS-T 0.1%. Primary antibodies were
diluted in a Tris-based buffer containing bovine serum albumin and
sodium azide. Secondary antibodies were diluted in 5% nonfat dry
milk in TBS-T 0.1%. Primary antibodies towards mTOR (no. 2983),
PO4-mTOR Ser2448 (no. 5536), S6K1 (no. 9205), PO4-S6k1 Thr389
(no. 9202) rpS6 (no. 2217), PO4-rpS6 Ser235/236 (no. 2211), and
PDCD4 (no. 9535) were purchased from Cell Signaling (Beverly,
MA) and Nuclear Lamin A/C (no. sc-7293) and GAPDH (no. Sc-
25778) from Santa Cruz Biotechnology (Santa Cruz, CA).
Chromatin immunoprecipitation. Myotubes were grown in 10-cm
plates and treated on day 4 after differentiation. Cells were treated
with DM, GM, or GM ⫹ rapamycin (25 ng/␮l) for 1–12 h. Cells were
fixed for 10 min at room temperature by addition of formaldehyde
(3.7%) directly to the culture medium for a final concentration of 1%,
and the reaction was quenched by the addition of glycine. Cells were
collected in PBS and spun down at 1,400 rpm for 5 min at ⫹4°C.
After removal of PBS, cells were lysed in ice-cold FA lysis buffer and
sonicated on a Branson 150 sonicator. Cross-linked and sonicated
homogenates were stored at ⫺80°C until further use. Sample DNA
concentration was assessed using heat-reversed cross-linking over-
night, proteinase K treatment and subsequent glycogen-assisted pre-
cipitation of DNA following phenol/chloroform separation (Sigma).
The air-dried DNA pellet was diluted in RNase/DNase/nucleotide-
free H2O and rehydrated for 1 h at ⫹65°C. DNA was quantified on a
Nanodrop 1000 at 260 nm. Ten micrograms of DNA was used per
immune-precipitation (IP) reaction, and samples were diluted to a
final volume of 500 ␮l (IP dilution buffer: 16.7 mM Tris-HCl, 167
mM NaCl, 1.2 mM EDTA, 1.1% Triton-X 100, 0.01% SDS). Two to
three micrograms of antibody, mTOR (no. T2949, Sigma), H3K56-ac
(A-4026-050, Epigentek, Farmingdale, NY), H3 (ab1791, Abcam,
Cambridge, UK), H1 (sc-34464, Santa Cruz Biotechnology), and
non-specific IgG (no. I5006, Sigma), was added to each reaction and
samples incubated overnight at ⫹4°C on a rotating wheel. Magnetic
beads were blocked overnight in a blocking buffer (0.2 mg/ml glyco-
gen, 1 mg/ml BSA, and 75 ␮g/ml salmon sperm DNA) and washed
before diluted in IP dilution buffer. Preblocked beads slurry (50 ␮l)
was added to each reaction and samples incubated 60 min at room
temperature. Beads were pulled down using a magnetic stand and
washed several times. Elution buffer (150 ␮l, 1% SDS, 100 mM
NAHCO3) was added to each tube and quickly spun down before
heated at 30°C for 15 min. Eluted antibody-protein-DNA complexes
were reverse crossed-linked, proteinase K digested, and the DNA
extracted as described above for input DNA. Samples were quantified
using qPCR with primers targeting the rDNAp. The corresponding
PCR signal was normalized to a control DNA region (GAPDH
promoter) and expressed as relative to DM treatment.
Determination of protein synthesis. Myotubes grown in 6-well
plates were maintained in DM, or stimulated with GM, GM ⫹ 25
ng/ml rapamycin, or GM ⫹ 1 ␮M CX-5461 for 24 h after which cells
were washed once with PBS and incubated in media containing
35
S-labeled methionine (40 ␮Ci) for 90 min. Thereafter media was
collected from each individual well as reference, and cells were
washed three times in cold PBS and lysed in cell lysis buffer. Lysates
were spun down 5 min at 12,000 g to pellet insoluble debris and
supernatants transferred to new tubes. Lysates (15 ␮l) were used to
determine protein content using the DC protein assay (Bio-Rad).
Protein was then precipitated using TCA to quantify 35S-incorpora-
tion. TCA precipitates were washed in acetone-HCl (10%) and resus-
pended in elution buffer (100 mM NaOH 1% SDS) at ⫹55°C. 35S
incorporation was measured on a Wallac scintillation beta counter.
Counts per minute (CPM) from protein samples were normalized to
protein content (␮g), incubation time, and specific activity of the
media for each well (CPM) using the following formula: protein
AJP-Cell Physiol • doi:10.1152/ajpcell.00144.2016 • www.ajpcell.org
C665
synthesis rate ⫽ {[CPM (protein pellet)/protein in well (␮g)]/incuba-
tion time (h)}/CPM (media).
Statistical analysis. Differences between groups for rRNA, total
protein, myotube diameter, gene expression, and Western blot data
were determined using the Student’s t-test or a one-way analysis of
variance (ANOVA) followed by the Newman-Keuls post hoc test (if
more than 2 groups were involved). Ch-IP data was analyzed inde-
pendently per time point using a one-way ANOVA followed by the
Newman-Keuls post hoc test. Significance was set at P ⬍ 0.05 for all
statistical comparisons. Values are reported as means ⫾ SD unless
stated otherwise.
RESULTS
Activation of mTOR signaling during myotube hypertrophy
Downloaded from http://ajpcell.physiology.org/ by 10.220.32.246 on October 15, 2016
precedes transcription by all three polymerases. Serum stim-
ulation of myotubes increased phosphorylation of mTOR/
S6K1/rpS6 within 3 h of stimulation (Fig. 1A). Following 48 h
of GM, total protein increased by ⫹50% (P ⬍ 0.001) com-
pared with DM with a concomitant increase in myotube width
(⫹28%, P ⬍ 0.001, Fig. 1B). Preceding any quantifiable
hypertrophic response, we observed a transient increase in
rDNA transcriptional activity peaking at 12 h post GM (Fig.
1C). Total rRNA increased significantly by 12 h and continued
to increase throughout the 48-h stimulation period. Protein
synthesis rates were elevated by 3 and 6 h post stimulation, and
increased further concomitant with the increase in rRNA con-
tent. As ribosome biogenesis requires the coordinated function
of all three polymerases, we also investigated the transcrip-
tional response of RNA Pol II and Pol III targets. Peak
transcription of rDNA genes by Pol I paralleled the increase in
Pol II transcription of several factors involved in ribosome
biogenesis (c-Myc, eIF4E, Pol I regulon) and Pol III transcrip-
tion of tRNA (Fig. 1, D and E).
Transcription of rDNA genes during myotube hypertrophy
requires mTOR but not S6k1 signaling. To determine whether
signaling via PI3K/mTOR/S6K1 modulates rDNA transcrip-
tion and muscle hypertrophy, we treated myotubes with PI3K
(LY), mTOR (rapamycin), and S6K1 (PF) inhibitors. PI3K and
mTOR inhibition decreased 45S pre-rRNA to the same degree
(⫺34 – 40% from GM, P ⬍ 0.01) (Fig. 2A) but partial S6K1
inhibition by PF (⫺55%, P ⬍ 0.05, PO4-rpS6Ser235/236) did
not affect rDNA transcription. Furthermore, whereas rapamy-
cin significantly prevented the increase in rRNA and protein
accumulation following serum stimulation, inhibition of S6K1
by PF did not (Fig. 2, B and C). Because PF resulted in
increased S6K1 Thr389 phosphorylation (Fig. 2D), we verified
the functional S6K1 inhibition by determining the phosphory-
lation status of its downstream target rpS6 and the abundance
of PDCD4. Serum-stimulated increase in rpS6 phosphorylation
at Ser235/236 was partially prevented by PF and remained at DM
levels, but rapamycin completely dephosphorylated it. Like-
wise, PDCD4 accumulated to control levels in myotubes
treated with PF although to a lesser extent than with rapamycin
(Fig. 2, E and F). To further validate the observation that
reduced S6K1 activity did not compromise rDNA transcrip-
tion, we knocked down S6K1 using siRNA. Transfection with
S6K1 siRNA successfully decreased S6K1 mRNA levels by
⫺60% (P ⬍ 0.001) and protein levels by ⫺90% (P ⬍ 0.001).
Despite this marked reduction in S6K1 protein content, 45S
pre-rRNA levels were not affected (Fig. 2G). Thus, in agree-
ment with our chemical inhibition data, knockdown of S6K1
C666 RIBOSOMAL DNA GENE REGULATION BY mTOR DURING MUSCLE HYPERTROPHY

Downloaded from http://ajpcell.physiology.org/ by 10.220.32.246 on October 15, 2016

Fig. 1. Activation of mTOR signaling during myotube hypertrophy precedes transcription by all three polymerases. A, left: representative Western blots of the
mTOR pathway 1, 3, 6, 12, 24, or 48 h post serum stimulation in DM and GM groups. A, right: quantifications of PO4/total ratio of mTOR, S6K1, and rpS6
DM (n ⫽ 3) and GM (n ⫽ 3) 1 h to 48 h post stimulation. *Significantly different from DM, P ⬍ 0.05. †Significantly different from GM 3 h, P ⬍ 0.05.
**Significantly different from GM 1 h, P ⬍ 0.05. B: comparison of total protein content (left, n ⫽ 3/group) and mean diameter of myotubes (right) following
48 h serum stimulation period in DM (n ⫽ 314) and GM (n ⫽ 254). C: % increase in protein synthesis (o), rDNA transcription (䊐), and RNA content (Œ)
compared with DM control per time point, n ⫽ 3– 4 per group. D: relative gene expression of Pol II targets in DM (n ⫽ 10) and GM (n ⫽ 10) 12 h following
serum stimulation. E: tRNA 12 h following serum stimulation in DM (n ⫽ 3) and GM (n ⫽ 3) 12 h following serum stimulation. GAPDH was used for qRT-PCR
normalization in D and E. Open bars, DM; black bars, GM. *Significantly different from DM, P ⬍ 0.05. *,†,‡Significantly different from DM, P ⬍ 0.05 for
protein synthesis, rDNA transcription, and rRNA content, respectively. DM set as 100% in B, D, and E. Data are shown as means ⫾ SD.

AJP-Cell Physiol • doi:10.1152/ajpcell.00144.2016 • www.ajpcell.org

 RIBOSOMAL DNA GENE REGULATION BY mTOR DURING MUSCLE HYPERTROPHY C667

Downloaded from http://ajpcell.physiology.org/ by 10.220.32.246 on October 15, 2016

Fig. 2. Transcription of rDNA genes during myotube hypertrophy requires mTOR but not S6k1 signaling. A: 45S pre-rRNA transcription (ITS) 12 h following
serum stimulation in myotubes treated with DM, GM, GM ⫹ 20 ␮M LY, GM ⫹ 25 ng/ml rapamycin, or GM ⫹ 20 ␮M PF-4708671 (DM set as 100%, n ⫽
3/group). GAPDH was used for qRT-PCR normalization. B and C: changes in rRNA and total protein content in serum stimulated myotubes at 48 h post
stimulation, n ⫽ 3– 4 per group. *Significantly different from DM, P ⬍ 0.01. †Significantly different from GM, P ⬍ 0.05. Legend indicates media and treatments
for A–C. D–F: quantifications of PO4/total ratio of S6K1 and rpS6, and PDCD4/GAPDH ratio in DM, GM, GM ⫹ 25 ng/ml rapamycin and GM ⫹ 20 ␮M
PF-4708671 (n ⫽ 3/group). Insets: representative Western blots of PO4-S6K1, PO4-rpS6, or PDCD4 (top) and total S6K1, rpS6, or GAPDH (bottom).
*Significantly different from DM, P ⬍ 0.05. †Significantly different from GM, P ⬍ 0.01. Legend indicates media and treatment for D–F. G: gene expression
of S6K1 and 45S pre-rRNA (ITS) in GM ⫹ scrambled siRNA and GM ⫹ S6K1 siRNA 12 h following serum stimulation (n ⫽ 3/group). Insets: representative
Western blots of S6K1 (top) and GAPDH (bottom) in siRNA-treated myotubes. Data are shown as means ⫾ SD. GAPDH was used for qRT-PCR normalization.

did not affect Pol I-dependent rDNA transcription in hypertro-
phying myotubes.
Protein synthesis and Pol II transcription modulate rDNA
transcription and hypertrophy. To determine the mTOR-de-
pendent effects on Pol I transcription and myotube hypertro-
phy, we asked whether blocking protein synthesis or Pol II
transcription could equally impact rDNA transcription. Direct
inhibition of translation by CHX resulted in a more pronounced
suppression of protein synthesis and rDNA transcription com-
pared with rapamycin (Fig. 3, A and B). Both CHX and
rapamycin decreased mRNA levels of key proteins involved in
rDNA transcription in a bimodal and time-dependent manner
(Fig. 3C). Inhibiting Pol II transcription directly using either
DRB or ␣-Amanitin caused a suppression of protein synthesis
(Fig. 3D) and a progressive decrease in mRNAs of most genes
investigated with the exception of c-Myc (Fig. 3C). Further-
more, inhibiting transcription by Pol II with either DRB or
␣-Amanitin resulted in an inconsistent expression of the 45S
pre-rRNA transcript (Fig. 3, E and F) and prevented hypertro-
phy with ␣-Amanitin displaying cytotoxic effects by 48 h.
(data not shown).
Selective inhibition of RNA Pol I transcription blocks
protein synthesis and myotube hypertrophy. The observed
effect of rapamycin on rDNA transcription could, in addi-
tion to partially being mediated via its role in translation and
Pol II transcription, be the result of a direct mTOR-mediated
effect on RNA Pol I. To investigate whether increased RNA
Pol I activity is necessary for myotube hypertrophy, we
treated myotubes with the selective RNA Pol I inhibitor
CX-5461. Blocking Pol I transcription prevented 45S pre-
rRNA synthesis (Fig. 4A), and the corresponding increase in
rRNA (Fig. 4B), without negatively affecting the expression
of ribosomal protein genes (Fig. 4C). Surprisingly, it also
suppressed the increase in protein synthesis associated with
myotube hypertrophy (Fig. 4D), and prevented protein ac-
cumulation (Fig. 4E) and the increase in myotube diameter
following serum stimulation without affecting myotube vi-
ability (Fig. 4F).

AJP-Cell Physiol • doi:10.1152/ajpcell.00144.2016 • www.ajpcell.org

C668 RIBOSOMAL DNA GENE REGULATION BY mTOR DURING MUSCLE HYPERTROPHY

Downloaded from http://ajpcell.physiology.org/ by 10.220.32.246 on October 15, 2016

Fig. 3. Protein synthesis and Pol II transcription modulate rDNA transcription and hypertrophy. A: protein synthesis rates at 24 h post serum stimulation. DM
(n ⫽ 4), GM (n ⫽ 4), GM ⫹ 25 ng/ml rapamycin (n ⫽ 4), and GM ⫹ 50 ␮M CHX (n ⫽ 3). *Significantly different from DM, P ⬍ 0.01. †Significantly different
from GM, P ⬍ 0.01. ‡Significantly different from all groups, P ⬍ 0.001. B: 45S pre-rRNA (ITS) expression 12 h post serum stimulation supplemented with
50 ␮M CHX for 1 or 12 h. *Significantly different from DM, P ⬍ 0.001. †Significantly different from all other groups, P ⬍ 0.01. C: graphical illustration of
changes in mRNA levels in the following groups: DM, GM, GM ⫹ 25 ng/ml rapamycin (12 h), GM ⫹ CHX, GM ⫹ DRB, GM ⫹ ␣-Amanitin. CHX, DRB,
and ␣-Amanitin treatments were performed for 1 or 12 h. qPCR data were used for hierarchical clustering using the R script hetmap.2 from R/gplots and
ColorBrewer package. The color legend displays the transformed signal intensity range in the dataset. D: protein synthesis rates at 24 h post serum stimulation
as described in A. DM, GM, GM ⫹ 75 ␮M DRB and GM ⫹ 50 mg/ml ␣-Amanitin (n ⫽ 4/group). *Significantly different from DM, P ⬍ 0.01. †Significantly
different from GM, P ⬍ 0.01. E: 45S pre-rRNA expression (ETS and ITS) following 1 and 12 h 75 ␮M DRB. F: 45S pre-rRNA expression (ETS and ITS)
following 1 and 12 h 50 mg/ml ␣-Amanitin. *Significantly different from DM. †Significantly different from GM, P ⬍ 0.05. ‡Significantly different from all
groups, P ⬍ 0.05. Data are shown as means ⫾ SD. GAPDH or 28S was used for qRT-PCR normalization.

Rapamycin inhibits mTOR enrichment at the rDNA pro-
moter and represses active chromatin marks. While the cyto-
plasmic function of mTOR is well defined, its nuclear function
remains elusive. During hypertrophy, rapamycin did not
alter mTOR compartmentalization as evidenced by its con-
tinuous nuclear localization despite interrupted rDNA tran-
scription. Rapamycin treatment reduced mTOR enrichment
at the rDNAp to control levels (Fig. 5, A and B) and was
sufficient to significantly reduce H3K56ac and increase H1 at
the rDNAp (Fig. 5, C and D).
DISCUSSION
Muscle ribosome content is a major determinant of protein
synthesis rates (25). In the present study we investigated the
involvement of mTOR signaling in rDNA transcription and
ribosome production during myotube hypertrophy. As we have
previously shown in vivo, rDNA transcription is an early event
during skeletal muscle hypertrophy (41). This precedes the
accumulation of rRNA to support the need to increase muscle
translational capacity during hypertrophy (8, 17, 27). In this
study, we show that mTOR signaling also precedes rRNA
accumulation and myotube hypertrophy and is consistent with
transcription by all three polymerases (21). We have previ-
ously demonstrated that inhibition of mTOR with rapamycin
prevents rRNA accumulation (8) and skeletal muscle hyper-
trophy (2, 27, 33). Thus the involvement of mTOR signaling in
rDNA gene transcription appears to be necessary for ribosome
production and muscle hypertrophy. To further dissect the
hierarchical role of mTOR in muscle rDNA transcription, we
employed a biochemical approach by targeting PI3K/mTOR/
S6K1 signaling. Blocking PI3K or mTOR signaling resulted in
a similar level of inhibition of rDNA transcription, but pre-
venting an increase in S6K1 activity did not. We interpret this
as both PI3K and mTOR being involved in regulating signaling
leading to elevated rDNA transcription (4, 11, 14) and there-
fore the negative effect of rapamycin on Pol I transcription,
ribosome production, and myotube hypertrophy is mediated by
mTOR and not S6K1 activity. Even though rapamycin mark-
edly suppressed rDNA transcription, our present results do not
allow us to distinguish between mTORC1 and mTORC2, and
because both complexes can be localized to the nucleus, further
studies should elucidate whether mTORC1 and/or mTORC2

AJP-Cell Physiol • doi:10.1152/ajpcell.00144.2016 • www.ajpcell.org

 RIBOSOMAL DNA GENE REGULATION BY mTOR DURING MUSCLE HYPERTROPHY C669

Downloaded from http://ajpcell.physiology.org/ by 10.220.32.246 on October 15, 2016

Fig. 4. Selective inhibition of RNA Pol I transcription blocks protein synthesis and myotube hypertrophy. A: CX-5461 decreases 45S pre-rRNA abundance in
serum-stimulated myotubes. DM, GM, GM ⫹ 1 ␮M CX-5461 (n ⫽ 3/group). *Significantly different from DM, P ⬍ 0.05. †Significantly different from GM,
P ⬍ 0.05. B: rRNA content in myotubes serum stimulated for 48 h. DM, GM, and GM ⫹ 1 ␮M CX-5461 (n ⫽ 4/group). *Significantly different from DM, P ⬍
0.001. †Significantly different from GM, P ⬍ 0.001. C: mRNA abundance of rpS6, rpS7, and rpL11 12 h post serum stimulation in response to CX-5461
treatment. DM, GM, and GM ⫹ 1 ␮M CX-5461 (n ⫽ 3/group). *Significantly different from all groups, P ⬍ 0.05. D: effect of CX-5461 on protein synthesis
at 24 h post serum stimulation. DM, GM, and GM ⫹ 1 ␮M CX-5461 (n ⫽ 4/group). *Significantly different from DM, P ⬍ 0.01. †Significantly different from
GM, P ⬍ 0.01. E: total protein content in myotubes serum stimulated for 48 h. DM, GM, and GM ⫹ 1 ␮M CX-5461 (n ⫽ 4/group). *Significantly different
from DM, P ⬍ 0.01. †Significantly different from GM, P ⬍ 0.01. F: mean diameter of myotubes following 48 h serum stimulation. Left: comparison between
DM (n ⫽ 314), GM (n ⫽ 254), and GM ⫹ 1 ␮M CX-5461 (n ⫽ 416). ***Significantly different from DM and GM ⫹ 1 ␮M CX-5461, P ⬍ 0.001. Right:
representative light microscopic images of myotubes treated with DM, GM, or GM ⫹ 1 ␮M CX-5461. Image inset: scale bar ⫽ 100 ␮m. Data are shown as
means ⫾ SD. A and C: GAPDH was used for qRT-PCR normalization.

can regulate rDNA transcription. However, although not tested
in the present study, it is likely that mTORC1 and not
mTORC2 is involved in rDNA transcription as RAPTOR has
been previously shown to associate with the rDNA transcrip-
tion machinery, i.e., colocalizes with fibrillarin and Pol I at
nucleoli (40). Surprisingly, S6K1 inhibition did not affect
rDNA transcription. It is possible that the lack of effect seen
with partial biochemical S6K1 inhibition was due to the re-
mainder activity of this kinase, which may have sufficed to
support hypertrophy. For this reason we targeted S6K1 with
siRNA and found that S6K1 silencing also failed to prevent
rDNA transcription. One possible explanation is that S6K2
may have compensated for the absence of S6K1. In S6K1⫺/⫺
mice, muscle mass is smaller in the presence of intact S6K2 but
yet they are viable, which suggests that S6K2 can compensate
for some S6K1 functions (29, 37). In cardiomyocytes, rRNA
accumulation and hypertrophic growth in vitro have been
suggested to depend on S6K1 via UBF1 phosphorylation (11).
But because both S6K1⫺/⫺ and S6K1⫺/⫺/S6K2⫺/⫺ mice are
able to respond to physiological, pathological, and IGF-1-
induced cardiac hypertrophy (23), it becomes apparent that the
S6Ks are dispensable for cardiac growth in vivo. In our study,
despite evidence of a decreased S6K1 function, no effect on
45S pre-rRNA levels or myotube hypertrophy was observed.
Thus, we interpret our findings as indicating that the repressive
effect of mTOR inhibition by rapamycin on rDNA transcrip-
tion does not involve S6K1 activity. Clearly the precise roles
and interactions between the S6Ks signaling in muscle hyper-
trophy require further investigation (24).
We have previously demonstrated that mTOR inhibition by
rapamycin prevented the increase in rRNA content and blocked
myotube hypertrophy (27). To distinguish between the protein
synthesis inhibitory effects of blocking mTOR (i.e., cap-de-
pendent translation) and its transcriptional functions, we first
used CHX to block global protein synthesis. CHX had a more
dramatic effect on suppressing protein synthesis and rDNA
transcription than rapamycin. This is likely due to the depletion
of essential factors required for Pol I transcription (7), and
suggests that mTOR may regulate rDNA transcription by a
separate mechanism other than global protein synthesis. It also
indicates that Pol I transcription requires protein synthesis to
maintain basal ribosome production as CHX decreased rDNA

AJP-Cell Physiol • doi:10.1152/ajpcell.00144.2016 • www.ajpcell.org

C670 RIBOSOMAL DNA GENE REGULATION BY mTOR DURING MUSCLE HYPERTROPHY

Fig. 5. Rapamycin inhibits mTOR enrich-

ment at the rDNA promoter and represses
active chromatin. A: representative Western
blot of mTOR, GAPDH, and nuclear lamina
A/C in whole (W), cytoplasmic (C), and
nuclear (N) lysates from myotubes treated
with DM, GM, or GM ⫹ 25 ng/ml rapamy-
cin for 3 h. Bottom band in the mTOR blot
is nonspecific. B: chromatin immunoprecipi-
tation of mTOR at 1, 3, 6, and 12 h post
serum stimulation in DM, GM, and GM ⫹
25 ng/ml rapamycin (n ⫽ 3/group). qPCR
data from rDNA region normalized to
GAPDH promoter region. *Significantly dif-
ferent from DM, P ⬍ 0.05. †Significantly
different from GM, P ⬍ 0.001. C: chromatin
immunoprecipitation of H3K56ac relative to

Downloaded from http://ajpcell.physiology.org/ by 10.220.32.246 on October 15, 2016

H3 at the rDNA promoter 1 and 12 h post
serum stimulation in DM, GM, and GM ⫹
25 ng/ml rapamycin. *Significantly different
from GM, P ⬍ 0.05. D: chromatin immuno-
precipitation of H1 at 1 and 12 h in DM,
GM, and GM ⫹ 25 ng/ml rapamycin. qPCR
data from rDNA region normalized to
GAPDH promoter region. **Significantly
different from GM, P ⬍ 0.01. Data are
shown as means ⫾ SD. For B–D, data are
expressed as fold change relative to DM.

transcription below control (DM) levels. Because mTOR can
also control Pol II transcription (12, 30), we determined
whether specific Pol II inhibition affected rDNA gene expres-
sion by Pol I in a manner similar to rapamycin. When directly
arresting Pol II with either DRB or ␣-Amanitin, it became
evident that Pol II transcription is necessary for ribosome
production and hypertrophy, as ␣-Amanitin was sufficient to
block Pol I transcription. Because DRB, which inhibits Pol II
and to a lower extent Pol I (36), had a similar effect on 45S
pre-rRNA, we consider the inhibition of Class II genes by
␣-Amanitin a Pol II specific effect, and an indication that Pol
II transcription is necessary for rDNA transcription. This
highlights the dependency of Pol I on Class II genes to initiate
rDNA transcription during hypertrophy and suggests that
mTOR signaling may indirectly control Pol I by modulating
Class II gene expression. Intriguingly, arresting Pol II tran-
scription resulted in bidirectional changes in some mRNAs
important for ribosome biogenesis and other growth genes,
again, demonstrating that blocking protein synthesis has a very
different effect than Pol II transcription on Pol I-dependent
rDNA transcription. These findings provide indirect evidence
that mTOR signaling to protein synthesis may be distinct from
that to Pol II transcription. Furthermore, blocking Pol II tran-
scription with either DRB or ␣-Amanitin produced an imbal-
ance between 45S pre-rRNA ETS and ITS which suggests an
important role of Pol II transcription on Pol I elongation more
than initiation. Altogether, these data surface an emerging role
of mTOR signaling in transcriptional regulation of ribosome
synthesis by partially controlling mRNA translation and Class
II gene expression. This conclusion is also supported by the
fact that ␣-Amanitin is specific for Pol II transcription and does
not interfere with Pol I (19).
To establish whether mTOR-dependent ribosome produc-
tion is directly mediated by Pol I, we specifically inhibited Pol
I transcription with CX-5461 (5). Compared with rapamycin,
CX-5461 prevented the increase in rDNA transcription to a
similar extent. However, specific Pol I inhibition blunted
rDNA transcription and rRNA production without decreasing
the expression of ribosomal proteins (i.e., Class II genes).
Surprisingly, arresting Pol I, in addition to preventing the
increase in protein content and myotube size, also blunted the
increase in protein synthesis. This was an unexpected finding
as the existing ribosomes should have sufficed for at least an
increase in protein synthesis (translational efficiency) before
any increase in ribosome production (translational capacity).
These findings indicate that transcription of rDNA genes by
RNA Pol I is necessary for myotube hypertrophy, not only to
increase ribosome production but also to regulate protein
synthesis. These data also suggest the presence of a “coupling”
mechanism, either direct or indirect, that links rDNA transcrip-
tion to the translational machinery independently of ribosome
content.
Based on the above, and in line with our previous results
(27), it is clear that mTOR signaling is directly involved in
ribosome production and myotube hypertrophy. While mTOR
operates at the cytoplasmic level to regulate mRNA translation
(42), we demonstrate here that in skeletal muscle mTOR is also
nuclear and binds to the rDNAp. Blocking mTOR signaling
with rapamycin did not result in its nuclear exclusion, but
significantly reduced mTOR-rDNAp interaction. This suggests
that there is a fraction of the mTOR pool that is nuclear
regardless of its DNA binding activity at the rDNAp. Similarly,
the p110 subunit of PI3K has been reported to have nuclear
functions as a kinase for the Pol I factor UBF1 (4). Thus a
likely function of nuclear PI3K/mTOR signaling appears to be
the phosphorylation and activation PIC factors such as UBF
and Rrn3 to modulate rDNA transcription (11, 22) and pro-
cessing (13). Another possible involvement of nuclear mTOR
in ribosome biogenesis appears to be the regulation of chro-
matin. Inhibition of mTOR by rapamycin decreased H3K56ac
levels at the rDNAp, a chromatin mark consistent with tran-
scriptional silencing. Although the exact mechanism by which

AJP-Cell Physiol • doi:10.1152/ajpcell.00144.2016 • www.ajpcell.org

 RIBOSOMAL DNA GENE REGULATION BY mTOR DURING MUSCLE HYPERTROPHY
mTOR signaling modulates H3K56ac in mammalian cells
remains unknown, this observation validates recent data from
yeast implicating TORC1 signaling in the regulation of
H3K56ac and rDNA transcription. Chen et al. (3) have recently
shown that genetic disruption of the TORC1 subunit tco89
(tco89⌬), nutrient-dependent TORC1 activators (ego3⌬), or
pharmacological inhibition of TORC1 with rapamycin, nega-
tively regulates global H3K56ac. This indicates that mTOR
signaling may be necessary for the control of this specific
chromatin mark. While this connection is likely indirect, it may
occur via Sirtuin deacetylases as deletions of yeast Hst3 or
Hst4, which play a critical role in maintaining H3K56 hy-
poacetylation, can restore H3K56ac levels (43). Specifically,
H3K56ac can regulate rDNA chromatin by controlling Hmo1
(a functional homolog of UBF1) (1) binding to rDNAp, as
Hmo1 binding to rDNAp is reduced in H3K56(A) mutants.
These data, although from a different model system, are similar
to our findings where inhibition of mTOR signaling results in
decreased H3K56ac levels and likely reduces chromatin acces-
sibility to the rDNAp. Although we appreciate the limitations
of the present study in that we do not provide a mechanistic
link between the inhibition of mTOR signaling by rapamycin
and the decrease in H3K56ac, it is safe to speculate that these
two events may be linked and both contribute to the suppres-
sion of rDNA transcription (3, 18). This points towards a
conserved link between mTOR signaling, H3K56ac, and rDNA
transcription and is supported by the enrichment of histone H1
at the rDNAp, which reinforces the notion of increased silent
chromatin formation at the rDNAp upon mTOR inhibition. H1
linker histones repress transcription by stabilizing higher-order
chromatin structure (38), and preventing access of transcription
factors to DNA binding sites (31). To our knowledge, this is
the first observation linking mTOR signaling to H1 enrichment
at rDNA genes, which suggests that mTOR signaling could
regulate rDNA transcription by remodeling chromatin archi-
tecture. Collectively, a decrease in H3K56ac and increased H1
at the rDNAp supports the interpretation that, similar to yeast,
rapamycin-mediated mTOR inhibition negatively affects chro-
matin remodeling, and consequently rDNA gene silencing, in
postmitotic myotubes.
In summary, we provide evidence indicating a necessary and
coordinating role of mTOR signaling in protein synthesis, both
Pol I and Pol II transcription, and ribosome production during
myotube hypertrophy. Our data indicate that in this setting, an
increase in Pol I-dependent rDNA transcription is necessary for
protein synthesis and enhanced ribosome production. We also
demonstrate the necessity of Pol II transcription and proteins
synthesis for Pol I transcription of rDNA genes. The present
study also provides novel findings suggesting that during
myotube hypertrophy, mTOR associates with the rDNAp and
may modulate chromatin remodeling in a rapamycin-sensitive
manner. Although the precise mechanism(s) by which mTOR
regulates chromatin structure to control transcription remains
to be elucidated, it is clear that mTOR signaling is required for
the maintenance of transcriptionally competent chromatin at
the rDNAp as reflected by changes in H3K56ac and histone
H1. Thus nuclear mTOR signaling may be responsible for
priming and/or maintaining the transcriptionally competent
state of the rDNA genes, and provides a novel possible mech-
anism for the regulation of gene expression during hypertrophy
in postmitotic skeletal muscle.
AJP-Cell Physiol • doi:10.1152/ajpcell.00144.2016 • www.ajpcell.org
C671
ACKNOWLEDGMENTS
We are thankful to Dr. R. N. Laribee for sharing insight about the work
presented in Chen et al. (3).
GRANTS
This work was supported by grants from the Swedish Research Council
(Vetenskapsradet VRK2008-67X-20797-01-04), Centrum för Idrottsforskning
(P2011-01-0133), Kung Gustaf V:s 80 Årsfond (FAI2009-0065), and Reuma-
tikerförbundet (R-21211), Diabetesfonden (DIA2012-071), the Karolinska
Institute Strategic Diabetes Program, and the Department of Kinesiology at
The Pennsylvania State University to G. A. Nader.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the author(s).
AUTHOR CONTRIBUTIONS
Downloaded from http://ajpcell.physiology.org/ by 10.220.32.246 on October 15, 2016
F.v.W., C.L., and N.A. performed experiments; F.v.W., C.L., N.A., and
G.A.N. analyzed data; F.v.W., C.L., and G.A.N. interpreted results of exper-
iments; F.v.W., C.L., and N.A. prepared figures; F.v.W., N.A., and G.A.N.
edited and revised manuscript; F.v.W., C.L., N.A., and G.A.N. approved final
version of manuscript; G.A.N. conception and design of research; G.A.N.
drafted manuscript.
REFERENCES
1. Albert B, Colleran C, Leger-Silvestre I, Berger AB, Dez C, Normand
C, Perez-Fernandez J, McStay B, Gadal O. Structure-function analysis
of Hmo1 unveils an ancestral organization of HMG-Box factors involved
in ribosomal DNA transcription from yeast to human. Nucleic Acids Res
41: 10135–10149, 2013.
2. Bodine SC, Stitt TN, Gonzalez M, Kline WO, Stover GL, Bauerlein R,
Zlotchenko E, Scrimgeour A, Lawrence JC, Glass DJ, Yancopoulos
GD. Akt/mTOR pathway is a crucial regulator of skeletal muscle hyper-
trophy and can prevent muscle atrophy in vivo. Nat Cell Biol 3: 1014 –
1019, 2001.
3. Chen H, Fan M, Pfeffer LM, Laribee RN. The histone H3 lysine 56
acetylation pathway is regulated by target of rapamycin (TOR) signaling
and functions directly in ribosomal RNA biogenesis. Nucleic Acids Res
40: 6534 –6546, 2012.
4. Drakas R, Tu X, Baserga R. Control of cell size through phosphorylation
of upstream binding factor 1 by nuclear phosphatidylinositol 3-kinase.
Proc Natl Acad Sci USA 101: 9272–9276, 2004.
5. Drygin D, Lin A, Bliesath J, Ho CB, O’Brien SE, Proffitt C, Omori M,
Haddach M, Schwaebe MK, Siddiqui-Jain A, Streiner N, Quin JE,
Sanij E, Bywater MJ, Hannan RD, Ryckman D, Anderes K, Rice WG.
Targeting RNA polymerase I with an oral small molecule CX-5461
inhibits ribosomal RNA synthesis and solid tumor growth. Cancer Res 71:
1418 –1430, 2011.
6. Glass DJ. PI3 kinase regulation of skeletal muscle hypertrophy and
atrophy. Curr Topics Microbiol Immunol 346: 267–278, 2010.
7. Gokal PK, Cavanaugh AH, Thompson EA Jr. The effects of cyclohex-
imide upon transcription of rRNA, 5 S RNA, and tRNA genes. J Biol
Chem 261: 2536 –2541, 1986.
8. Goldspink DF. The influence of activity on muscle size and protein
turnover. J Physiol 264: 283–296, 1977.
9. Goodman CA, Frey JW, Mabrey DM, Jacobs BL, Lincoln HC, You
JS, Hornberger TA. The role of skeletal muscle mTOR in the regulation
of mechanical load-induced growth. J Physiol 589: 5485–5501, 2011.
10. Grummt I. Regulation of mammalian ribosomal gene transcription by
RNA polymerase I. Progr Nucleic Acid Res Mol Biol 62: 109 –154, 1999.
11. Hannan KM, Brandenburger Y, Jenkins A, Sharkey K, Cavanaugh A,
Rothblum L, Moss T, Poortinga G, McArthur GA, Pearson RB,
Hannan RD. mTOR-dependent regulation of ribosomal gene transcription
requires S6K1 and is mediated by phosphorylation of the carboxy-terminal
activation domain of the nucleolar transcription factor UBF. Mol Cell Biol
23: 8862–8877, 2003.
12. Hardwick JS, Kuruvilla FG, Tong JK, Shamji AF, Schreiber SL.
Rapamycin-modulated transcription defines the subset of nutrient-sensi-
tive signaling pathways directly controlled by the Tor proteins. Proc Natl
Acad Sci USA 96: 14866 –14870, 1999.
13. Iadevaia V, Zhang Z, Jan E, Proud CG. mTOR signaling regulates the
processing of pre-rRNA in human cells. Nucleic Acids Res 40: 2527–2539,
2012.
C672 RIBOSOMAL DNA GENE REGULATION BY mTOR DURING MUSCLE HYPERTROPHY
14. James MJ, Zomerdijk JC. Phosphatidylinositol 3-kinase and mTOR
signaling pathways regulate RNA polymerase I transcription in response
to IGF-1 and nutrients. J Biol Chem 279: 8911–8918, 2004.
15. Kubica N, Bolster DR, Farrell PA, Kimball SR, Jefferson LS. Resis-
tance exercise increases muscle protein synthesis and translation of eu-
karyotic initiation factor 2Bepsilon mRNA in a mammalian target of
rapamycin-dependent manner. J Biol Chem 280: 7570 –7580, 2005.
16. Laplante M, Sabatini DM. mTOR signaling in growth control and
disease. Cell 149: 274 –293, 2012.
17. Laurent GJ, Sparrow MP, Millward DJ. Turnover of muscle protein in
the fowl. Changes in rates of protein synthesis and breakdown during
hypertrophy of the anterior and posterior latissimus dorsi muscles.
Biochem J 176: 407–417, 1978.
18. Li H, Tsang CK, Watkins M, Bertram PG, Zheng XF. Nutrient
regulates Tor1 nuclear localization and association with rDNA promoter.
Nature 442: 1058 –1061, 2006.
19. Lindell TJ, Weinberg F, Morris PW, Roeder RG, Rutter WJ. Specific
inhibition of nuclear RNA polymerase II by alpha-amanitin. Science 170:
447–449, 1970.
20. Marino JS, Tausch BJ, Dearth CL, Manacci MV, McLoughlin TJ,
Rakyta SJ, Linsenmayer MP, Pizza FX. Beta2-integrins contribute to
skeletal muscle hypertrophy in mice. Am J Physiol Cell Physiol 295:
C1026 –C1036, 2008.
21. Mayer C, Grummt I. Ribosome biogenesis and cell growth: mTOR
coordinates transcription by all three classes of nuclear RNA polymerases.
Oncogene 25: 6384 –6391, 2006.
22. Mayer C, Zhao J, Yuan X, Grummt I. mTOR-dependent activation of
the transcription factor TIF-IA links rRNA synthesis to nutrient availabil-
ity. Genes Dev 18: 423–434, 2004.
23. McMullen JR, Shioi T, Zhang L, Tarnavski O, Sherwood MC, Dor-
fman AL, Longnus S, Pende M, Martin KA, Blenis J, Thomas G,
Izumo S. Deletion of ribosomal S6 kinases does not attenuate patholog-
ical, physiological, or insulin-like growth factor 1 receptor-phosphoinosi-
tide 3-kinase-induced cardiac hypertrophy. Mol Cell Biol 24: 6231–6240,
2004.
24. Mieulet V, Roceri M, Espeillac C, Sotiropoulos A, Ohanna M, Oors-
chot V, Klumperman J, Sandri M, Pende M. S6 kinase inactivation
impairs growth and translational target phosphorylation in muscle cells
maintaining proper regulation of protein turnover. Am J Physiol Cell
Physiol 293: C712–C722, 2007.
25. Millward DJ, Garlick PJ, James WP, Nnanyelugo DO, Ryatt JS.
Relationship between protein synthesis and RNA content in skeletal
muscle. Nature 241: 204 –205, 1973.
26. Moss T, Langlois F, Gagnon-Kugler T, Stefanovsky V. A housekeeper
with power of attorney: the rRNA genes in ribosome biogenesis. Cell Mol
Life Sci CMLS 64: 29 –49, 2007.
27. Nader GA, McLoughlin TJ, Esser KA. mTOR function in skeletal
muscle hypertrophy: increased ribosomal RNA via cell cycle regulators.
Am J Physiol Cell Physiol 289: C1457–C1465, 2005.
28. Nader GA, von Walden F, Liu C, Lindvall J, Gutmann L, Pistilli EE,
Gordon PM. Resistance exercise training modulates acute gene expres-
AJP-Cell Physiol • doi:10.1152/ajpcell.00144.2016 • www.ajpcell.org
sion during human skeletal muscle hypertrophy. J Appl Physiol 116:
693–702, 2014.
29. Ohanna M, Sobering AK, Lapointe T, Lorenzo L, Praud C, Petrou-
lakis E, Sonenberg N, Kelly PA, Sotiropoulos A, Pende M. Atrophy of
S6K1(⫺/⫺) skeletal muscle cells reveals distinct mTOR effectors for cell
cycle and size control. Nat Cell Biol 7: 286 –294, 2005.
30. Preiss T, Baron-Benhamou J, Ansorge W, Hentze MW. Homodirec-
tional changes in transcriptome composition and mRNA translation in-
duced by rapamycin and heat shock. Nat Struct Biol 10: 1039 –1047, 2003.
31. Ramakrishnan V. Histone H1 and chromatin higher-order structure. Crit
Rev Eukaryot Gene Express 7: 215–230, 1997.
32. Rohde JR, Cardenas ME. The tor pathway regulates gene expression by
linking nutrient sensing to histone acetylation. Mol Cell Biol 23: 629 –635,
2003.
33. Rommel C, Bodine SC, Clarke BA, Rossman R, Nunez L, Stitt TN,
Yancopoulos GD, Glass DJ. Mediation of IGF-1-induced skeletal myo-
tube hypertrophy by PI(3)K/Akt/mTOR and PI(3)K/Akt/GSK3 pathways.
Downloaded from http://ajpcell.physiology.org/ by 10.220.32.246 on October 15, 2016
Nat Cell Biol 3: 1009 –1013, 2001.
34. Rosner M, Hengstschlager M. Cytoplasmic and nuclear distribution of
the protein complexes mTORC1 and mTORC2: rapamycin triggers de-
phosphorylation and delocalization of the mTORC2 components rictor and
sin1. Hum Mol Genet 17: 2934 –2948, 2008.
35. Russell J, Zomerdijk JC. RNA-polymerase-I-directed rDNA transcrip-
tion, life and works. Trends Biochem Sci 30: 87–96, 2005.
36. Scheer U, Hugle B, Hazan R, Rose KM. Drug-induced dispersal of
transcribed rRNA genes and transcriptional products: immunolocalization
and silver staining of different nucleolar components in rat cells treated
with 5,6-dichloro-beta-D-ribofuranosylbenzimidazole. J Cell Biol 99: 672–
679, 1984.
37. Shima H, Pende M, Chen Y, Fumagalli S, Thomas G, Kozma SC.
Disruption of the p70(s6k)/p85(s6k) gene reveals a small mouse pheno-
type and a new functional S6 kinase. EMBO J 17: 6649 –6659, 1998.
38. Thoma F, Koller T. Influence of histone H1 on chromatin structure. Cell
12: 101–107, 1977.
39. Tsang CK, Liu H, Zheng XF. mTOR binds to the promoters of RNA
polymerase I- and III-transcribed genes. Cell Cycle 9: 953–957, 2010.
40. Vazquez-Martin A, Cufi S, Oliveras-Ferraros C, Menendez JA. Rap-
tor, a positive regulatory subunit of mTOR complex 1, is a novel phos-
phoprotein of the rDNA transcription machinery in nucleoli and chromo-
somal nucleolus organizer regions (NORs). Cell Cycle 10: 3140 –3152,
2011.
41. von Walden F, Casagrande V, Ostlund Farrants AK, Nader GA.
Mechanical loading induces the expression of a Pol I regulon at the onset
of skeletal muscle hypertrophy. Am J Physiol Cell Physiol 302: C1523–
C1530, 2012.
42. Wang X, Proud CG. The mTOR pathway in the control of protein
synthesis. Physiology 21: 362–369, 2006.
43. Yang B, Miller A, Kirchmaier AL. HST3/HST4-dependent deacetyla-
tion of lysine 56 of histone H3 in silent chromatin. Mol Biol Cell 19:
4993–5005, 2008.