An International Journal

Aims and scope. Animal Reproduction Science publishes original research and timely reviews on topics relating to reproduction and fertility in
animals. This includes both fundamental research and applied studies, including management practices that increase our understanding of the
biology and manipulation of reproduction. The focus is on animals that are useful to humans including food and fiber producing; companion/
recreational; captive; and endangered species including zoo animals. Animal Reproduction Science has no page charges and only publishes
papers after rigorous peer review.
The journal’s scope includes the study of reproductive physiology and endocrinology, reproductive cycles, natural and artificial control of reproduction,
preservation and use of gametes and embryos, pregnancy and parturition, infertility and sterility, diagnostic and therapeutic techniques but excludes in
vitro studies of oocytes and embryos.

Editors-in-Chief
A.C.O. Evans, Veterinary Sciences Centre, University College Dublin, Belfield, Dublin, Ireland
Phone: (+353) 1 7166271 Fax: (+353) 1 7166253
G.N. Hinch, School of Environmental and Rural Science, University of New England, Armidale, NSW 2351, Australia
Phone: (+61) 2 67732202 Fax: (+61) 2 67733922
J.E. Kinder, Department of Animal Sciences, The Ohio State University, Columbus, OH, 43210-1095, USA
Phone: +1 614 292 3232 Fax: +1 614 292 2929
Reviews Editor:
K.L. Macmillan, University of Melbourne, Veterinary Clinical Centre, 250 Princes Highway, Werribee, VIC 3030, Australia
Book Review Editor
N. Prathalingam, Newcastle Fertility Centre, International Centre for Life, Central Parkway, Newcastle Upon Tyne, NE1 3BZ, United Kingdom

Editorial Advisory Board

B.M. Alexander (Laramie, WY, USA) W. Jöchle (Manahawkin, NJ, USA)
L.L. Anderson (Ames, IA, USA) A.L. Johnson (University Park, PA, USA)
D.T. Armstrong (Adelaide, Australia) R.J. Mapletoft (Saskatoon, SK, Canada)
C. Aurich (Vienna, Austria) W.M.C. Maxwell (Sydney, NSW, Australia)
F.W. Bazer (College Station, TX, USA) J.F. Mee (Fermoy, Co. Cork, Ireland)
P.J. Broadbent (Aberdeen, UK) M. Mihm (Glasgow, UK)
H. Cardenas (Columbus, OH, USA) J.C.F. Moraes (Bage, Brazil)
J. Cavalieri (Townsville, QLD, Australia) T. Nagai (Ibaraki, Japan)
D. Cavestany (Montevideo, Uruguay) R.L. Nebel (Blacksburg, VA, USA)
P. Comizzoli (Washington DC, USA) J.E. Parks (Ithaca, NY, USA)
R.A. Cushman (Clay Center, NE, USA) N. Parvizi (Neustadt, Germany)
R.A. Dailey (Morgantown, WV, USA) R. Pursley (East Lansing, MI, USA)
J.A. Delgadillo (Torren, Coahuila, Mexico) J.P. Ravindra (Bangalore, India)
M.G. Diskin (Athenry, Co. Galway, Ireland) S. Revell (Ruthin, UK)
M.A. Driancourt (Nouzilly, France) R.R. Santos (Utrecht, The Netherlands)
A.D. Ealy (Gainesville, FL, USA) D.C. Sharp (Gainesville, FL, USA)
T. Fair (Dublin, Ireland) J.F. Smith (Hamilton, New Zealand)
W. Flowers (Raleigh, NC, USA) D.L. Thompson (Baton Rouge, LA, USA)
J. Ford (Clay Center, NE, USA) Y. Tsunoda (Nara, Japan)
D.L. Garner (Graeagle, CA, USA) A. Turner (Burwood, Victoria, Australia)
P.J. Hansen (Gainesville, FL, USA) S. Uzbekova (Nouzilly, France)
W.V. Holt (London, UK) J.L. Vallet (Clay Center, NE, USA)
J.S.M. Hutchinson (Aberdeen, UK) P.J. Verma (Clayton, Victoria, Australia)
K. Imakawa (Tokyo, Japan) T. Zhang (Luton, UK)

Publication Information. Animal Reproduction Science (ISSN 0378-4320). For 2010 volumes 117-123 (28 issues) are scheduled for
publication. Subscription prices are available upon request from the Publisher or from the Elsevier Customer Service Department nearest
you or from this journal’s website (http://www.elsevier.com/locate/anirep). Further information is available on this journal and other
Elsevier products through Elsevier’s website: (http://www.elsevier.com). Subscriptions are accepted on a prepaid basis only, and are
entered on a calender year basis. Issues are sent by surface mail (surface within Europe, air delivery outside Europe). Priority rates are
available upon request. Claims for missing issues should be made within six months of our publication (mailing) date.
 Animal Reproduction Science 121 (2010) 189–196

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Review article

Impact of maternal nutrition on ovine foetoplacental development:

A review of the role of insulin-like growth factors
U.M. Igwebuike a,b,∗
a
Department of Veterinary Anatomy, University of Nigeria, Nsukka, Nigeria
b
Abdus Salam International Centre for Theoretical Physics, Trieste, Italy

a r t i c l e i n f o a b s t r a c t

Article history: The intrauterine environment may impact the conceptus (embryo/foetus and associated
Received 15 September 2009 extra-embryonic membranes) during ‘critical periods’ of development, when rapid cell divi-
Received in revised form 29 March 2010
sions occur in various tissues of the body, and may alter expression of the foetal genome,
Accepted 6 April 2010
and this may have lifelong consequences; a phenomenon known as foetal programming.
Available online 13 April 2010
Among intrauterine environmental factors, nutrition appears to play the most critical role
in influencing placental and foetal growth. Changes in maternal nutritional status during
Keywords:
pregnancy often results in permanent structural and functional deficits in foetal, as well as,
Maternal nutrition during pregnancy
Insulin-like growth factors postnatal growth of animals. Maternal undernutrition or overnutrition during pregnancy
Foetal growth can impair foetal growth. Alterations of the insulin-like growth factor cascade are spec-
Placental growth ulated to play a significant role in intrauterine nutrition-associated compromised foetal
Sheep growth and foetal programming. Insulin-like growth factors, IGF-1 and IGF-2 are nutrition-
ally sensitive proteins that are believed to modulate foetal and placental growth. The role
of these growth factors in nutrition-associated deficits in ovine foetal and placental growth
is the subject of this review.
© 2010 Elsevier B.V. All rights reserved.

Contents

1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190
2. Significance of maternal nutrition during gestation for foetoplacental growth . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190
2.1. Impact of maternal nutrition during pregnancy on foetal growth . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190
2.2. Impact of maternal nutrition during pregnancy on placental growth . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
3. Insulin-like growth factors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
3.1. Expression of insulin-like growth factors in ovine foetoplacental tissues . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
3.2. Role of insulin-like growth factors in nutrition-associated foetal growth deficits . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 192
3.3. Role of insulin-like growth factors in placental growth . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 193
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 194

∗ Correspondence address: Department of Veterinary Anatomy, University of Nigeria, Nsukka, Nigeria. Tel.: +234 8038726150.
E-mail addresses: abuchi2002@yahoo.com, udensi.igwebuike@unn.edu.ng.

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.04.007
190 U.M. Igwebuike / Animal Reproduction Science 121 (2010) 189–196
1. Introduction
The intrauterine environment is a major determinant
of foetal growth, since foetal developmental pathways
are dependent on such signaling molecules as hormones,
nutrients and metabolites, which must be present at
the right time and in the right proportions. Whilst the
foetal genome undoubtedly determines growth potential
in utero, there is evidence that its role may be subor-
dinate (Snow, 1989). The intrauterine environment may
impact the conceptus during ‘critical periods’ of develop-
ment, when rapid cell divisions occur in various tissues
of the body, and may alter expression of the foetal
genome, and this may have lifelong consequences (Godfrey
and Robinson, 1998). This phenomenon is referred to as
foetal programming (Lucas, 1991). Experimental studies
have documented many examples of foetal programming,
including long-term effects of alterations in the dam’s diet
during pregnancy on postnatal growth, relative organ size
and lipid metabolism of the offspring (Barker, 1994). The
role of intrauterine environment in foetal development has
been supported by embryo transfer studies, which have
shown that it is the recipient mother rather than the donor
mother that strongly influences foetal growth (Brooks et al.,
1995). Among intrauterine environmental factors, nutri-
tion appears to play the most critical role in influencing
placental and foetal growth (Barker and Clark, 1997). Stud-
ies have shown that the allocation of cells to the inner
and the outer cell masses during early embryonic stage
of development is influenced by nutrition and hormones
(Kleeman et al., 1994; Walker et al., 1996). The inner cell
mass gives rise to the embryo proper, while the extra-
embryonic membranes (placenta) arise from the outer cell
mass. The varying critical periods during which organs and
systems mature indicate that inappropriate foetal nutrition
at different developmental stages may likely have spe-
cific short- and long-term effects (Godfrey and Robinson,
1998).
2. Significance of maternal nutrition during
gestation for foetoplacental growth
The foetus acquires nutrients from the maternal com-
partment either directly as products of digestion following
maternal food ingestion, or as mobilized components of the
maternal body reserves (McCrabb et al., 1992). Changes in
maternal nutritional status during pregnancy often results
in permanent structural and functional deficits in foetal, as
well as postnatal growth of animals (Robinson et al., 1999;
Symonds et al., 2001; Osgerby et al., 2002). The effect of
maternal nutrient intake on foetal development depends
upon the timing, duration, and severity of the nutritional
insult (Robinson et al., 1999). The placenta is pivotal to
foetal development, mediating the supply of substrate and
waste products between the dam and the foetus (Bell et
al., 1999). The significance of placental function to foetal
growth has been demonstrated in sheep, with restrictions
to placental growth or blood supply by pre-mating carun-
clectomy (Robinson et al., 1979), uterine artery ligation
(Emmanouilides et al., 1968) or heat stress (Galan et al.,
1999) resulting in foetal growth retardation.
2.1. Impact of maternal nutrition during pregnancy on
foetal growth
With regard to maternal nutrition influencing birth
weight in the sheep, much information is available,
but occasional discrepancies arise, most likely due to
study–study differences between breed of sheep, sample
size, definition of ‘optimum’ or 100% requirement (Russel,
1971; Russel and Foot, 1973; Robinson, 1977; Mellor and
Matheson, 1979; Wallace et al., 1996; Heasman et al.,
2000). However, there is growing evidence that mater-
nal nutritional status can alter the epigenetic state of
the foetal genome and imprint gene expression. Epige-
netic alterations (stable alterations of gene expression
through covalent modifications of DNA and core histones)
in early embryos may be carried forward to subsequent
developmental stages (Waterland and Jirtle, 2004). Thus,
nutritional insult during a critical period of gestation may
leave a permanent “memory” throughout life. Either mater-
nal undernutrition or overnutrition during pregnancy is
capable of producing impaired foetal growth.
Maternal undernutrition during pregnancy may result
from dietary deficiencies of essential nutrients (e.g., energy,
protein and micronutrients). There is evidence (Wu et al.,
1998) that foetal growth is most vulnerable to maternal
dietary deficiencies of these nutrients. A 30% reduction in
maternal nutrition from at least 45 days before until 7
days after conception resulted in an increase, in late ges-
tation, in arterial blood pressure and in the activation of
the foetal pituitary–adrenal axis in twin but not singleton
ovine foetuses (Edwards and McMillen, 2002a,b). The dif-
ferential effects of preconceptional undernutrition in twin
and singleton pregnancies was attributed to the fact that
foetal growth trajectory in early pregnancy is related to
foetal number, which may be important in determining the
differential impact of periconceptional undernutrition on
singletons and twins.
Overnutrition during pregnancy can result from
increased intake of energy and/or protein by the dam.
It has been demonstrated that maternal overnutrition
retards placental and foetal growth, and increases foetal
and neonatal mortality in some animal species including
sheep (Wallace et al., 2003). In another study (Gardner
et al., 2007), maternal energy intake from early to mid-
gestation had little influence on lamb birth weight, but
late gestation intake was positively associated with weight
at term. It was suggested that the lack of effect of early
to mid-gestation intake is most likely through maternal
‘buffering’; that is, the response is dependent on maternal
pre-pregnancy condition. Therefore, it would appear that
maternal body condition prior to pregnancy and energy
intake during late gestation are important factors in terms
of birth weight in sheep.
Furthermore, maternal nutritional status during preg-
nancy may also affect the growth of specific foetal organs
such as the liver and skeletal muscles (Brameld et al., 2000).
Studies have shown that the foetal ovary is highly sensitive
to maternal nutrition (Da Silva et al., 2003). Maternal over-
nutrition can induce alterations in ovarian development
during late gestation (day 131 of gestation) independent
of changes in foetal weight or indeed in ovary weight
 U.M. Igwebuike / Animal Reproduction Science 121 (2010) 189–196
(Da Silva et al., 2002). Moreover, it has been reported
that in sheep, low maternal nutrition during pregnancy
resulted in delayed ovarian germ cell degeneration at day
42 (Borwick et al., 1997) and delayed onset of meiosis at
day 65 of gestation (Rae et al., 2001), at a stage when
nutrient requirements for foetal body growth are mini-
mal. It is thought that undernutrition-associated restriction
of placental growth, or placenta-mediated changes in the
foetal endocrine environment may induce these detri-
mental effects on ovarian development (Da Silva et al.,
2003).
2.2. Impact of maternal nutrition during pregnancy on
placental growth
Ehrhardt and Bell (1995) observed that placental growth
in terms of mass and net cellular proliferation is maxi-
mal in the first half of gestation in sheep. These authors
demonstrated that a rapid increase in DNA synthesis and
tissue mass per nuclei number occurred between days 40
and 50 followed by proliferative growth to day 70. It was
found that net cellular proliferation ceased by day 80 with
no change in tissue dry matter content observed there-
after. The indication is that placental size and even function
later in gestation may be substantially influenced at this
early stage in sheep. The placenta of sheep is cotyledonary.
It exhibits discrete areas of attachment, the placentomes,
which are interspersed among the interplacentomal areas
(Igwebuike, 2009). The placentomes are formed by inter-
action of patches of the chorioallantois (cotyledons) with
raised aglandular areas of the endometrium called the
caruncles. Intercaruncular areas of the endometrium are
intensely glandular (Bazer, 1975; Gray et al., 2001). Attach-
ment of foetal cotyledons to the maternal caruncles occurs
between days 25 and 30 of gestation, and growth restric-
tion during this period can limit the eventual number of
placentomes that form the placenta (Wathes et al., 1998).
Later in gestation, the size and morphology of the placen-
tomes are affected rather than their number (Vatnick et al.,
1991; Wallace et al., 1996).
The consequences of variable nutrition in the first half
of pregnancy for ruminant placental growth have not been
extensively studied. However, available evidence support
the idea that placental growth, and by implication, foetal
growth is most vulnerable to maternal nutritional status
during the peri-implantation period and the period of rapid
placental development (the first trimester of gestation)
(Wu et al., 2004). High nutrient intakes in early pregnancy
enhanced placental and, hence, foetal growth in ewes that
were poorly nourished around the time of conception; con-
versely, in ewes well nourished around conception, high
intakes in early pregnancy suppressed placental growth,
decreasing placental and foetal size (Robinson et al., 1994).
Similarly, maternal feed restriction during the period from
early to mid-gestation also impacted placental growth
in the ewe. Placental weights were greater in ewes that
received reduced nutrition in early and mid-gestation com-
pared to control animals (Owens et al., 1986). It has been
suggested that the increase in placental weight associated
with undernutrition during pregnancy is an attempt to
compensate for the reduction in nutrient supply from the
191
mother (McCrabb et al., 1987, 1991; Faichney and White,
1987).
3. Insulin-like growth factors
Insulin-like growth factors, IGF-1 and IGF-2 are nutri-
tionally sensitive proteins that are believed to modulate
foetal and placental growth (Baker et al., 1993; Liu et
al., 1993). They act via the type-1 insulin-like growth
factor receptor (IGF-1R) to instigate cellular prolifera-
tion, differentiation and metabolism (Jones and Clemmons,
1995). This IGF-1R is structurally similar to the insulin
receptor, consisting of two ␣ and two ␤ subunits, which
combine to form a heterodimer (LeRoith et al., 1995). A
type-2 insulin-like growth factor receptor (IGF-2R) has
also been identified, but it acts as a degradative path-
way, removing excess IGF-2 from the circulation (Braulke,
1999). This receptor, which is identical to the mannose-6-
phosphate receptor, was originally isolated from placenta
as a molecule that could bind IGF-2, but not IGF-1 (Braulke,
1999). The IGFs act as progression factors in the cell cycle to
increase DNA synthesis and cell differentiation in cultured
embryos and several different foetal cell lines in vitro (Han
and Fowden, 1994; Gardner et al., 1999).
3.1. Expression of insulin-like growth factors in ovine
foetoplacental tissues
Local production of members of the IGF system has been
reported in the uterus and placenta of the ewe (Stevenson
et al., 1994; Reynolds et al., 1997). Polymerase chain reac-
tion techniques have revealed the presence of mRNAs
for both IGF-1 and IGF-2 in sheep embryos throughout
preimplantation development from single-cell stage to the
hatched blastocyst (Watson et al., 1994). Similarly, mRNAs
for these two IGFs were also expressed in both the mucosa
and muscle layers of the oviduct (Stevenson and Wathes,
1996) within which early embryonic development takes
place. The mucosal expression of mRNA for IGF-1 was
maximal, but the concentrations for IGF-2 mRNA were
much lower. Thus, locally produced IGF-1 is more likely
than IGF-2 to influence early stage of embryonic devel-
opment. Following implantation, maternal uterine IGF-1
mRNA expression was low (Reynolds et al., 1997). This
makes it unlikely that locally produced IGF-1 is impor-
tant in placental development. In contrast, IGF-2 mRNA
expression in maternal caruncles, placentome capsule and
endometrial stroma continued throughout the first half of
gestation. Expression of IGF-2 mRNA in foetal mesodermal
tissues increased between days 14 and 35, and remained
high until parturition (Wathes et al., 1998). In addition to
these local productions of the IGFs, the uterus will also
be exposed to maternal circulating IGFs. Plasma levels of
IGF-2 are about 5-fold higher than those of IGF-1 in sheep
(Gallaher et al., 1995). Similarly, plasma concentrations of
IGF-2 in ovine foetal circulation were 3–10-fold higher than
those of IGF-1 during late gestation (Owens et al., 1994). It
has been suggested that the placenta of ruminants is both
the source of foetal plasma IGF-2 and a site for IGF-1 clear-
ance from foetal circulation (Bassett et al., 1990; Holland et
al., 1997). Abundance of IGF mRNA varies widely between
192 U.M. Igwebuike / Animal Reproduction Science 121 (2010) 189–196
foetal tissues and with gestational age. Igf-2 gene expres-
sion was particularly high in the lungs and kidneys while
IGF-1 mRNA abundance was highest in liver and skeletal
muscles (Delhanty and Han, 1993; Kind et al., 1995). Igf-1
gene expression was up- and down-regulated during late
gestation in liver and skeletal muscles respectively (Li et
al., 1996; Forhead et al., 2002). The igf-2 gene expression
was suppressed in liver and skeletal muscles, but not in the
lungs and kidneys towards term in sheep (Li et al., 1993;
Lu et al., 1994).
3.2. Role of insulin-like growth factors in
nutrition-associated foetal growth deficits
Growth factors such as insulin-like growth factors (IGFs)
may play an important role in regulating foetoplacental
growth (Dunk and Ahmed, 2000). Insulin-like growth fac-
tors regulate nutrient partitioning by mediating maternal
and placental metabolism, as well as transplacental nutri-
ent transfer (Vernon et al., 1981; Liu et al., 1994; Kniss et
al., 1994). IGF-I influences amino acid and carbohydrate
metabolism in addition to the transplacental transfer of
amino acids and glucose from the mother to foetus (Kniss
et al., 1994; Harding et al., 1994; Liu et al., 1994). Synthe-
sis of insulin-like growth factors, or that of their receptors
or binding proteins, may be affected by undernutrition.
Indeed, maternal undernutrition during periconceptional
and gestational periods was shown to cause significant
falls in foetal insulin, insulin-like growth factors (IGFs) and
insulin-like growth factor binding protein-3 (IGFBP-3) lev-
els in sheep (Gallaher et al., 1998; Osgerby et al., 2002). In
addition, plasma IGF-1 levels were reduced and elevated,
in nutrition restricted and overfed foetuses respectively
(Dong et al., 2008). Maternal nutrient restriction in early to
mid-gestation with re-feeding thereafter results in alter-
ations in hepatic and skeletal muscle expression of mRNA
for IGF-I, IGF-II and/or growth hormone receptor (GHR)
in the foetus which may subsequently relate to altered
organ and tissue function (Brameld et al., 2000). The foetal
crown-rump length (CRL) was positively correlated with
maternal IGF-I levels (Osgerby et al., 2002), and change
in plasma IGF-1 levels correlates well with the absolute
foetal weights under nutrition restriction (29.9% reduc-
tion) and overfeeding (22.2% increase) (Dong et al., 2008).
Moreover, concentrations of IGFs in the foetus in vivo are
positively correlated to birth weight in a number of species,
including sheep (Kind et al., 1995). Thus, alterations of the
insulin-like growth factor cascade are speculated to play
a significant role in intrauterine nutrition-associated com-
promised foetal growth and foetal programming.
Gene manipulation experiments have shown that IGF-
1 affects foetal growth directly, but suggest that the
growth-promoting actions of IGF-2 on the foetus may
be indirect, being mediated via changes in the growth
and nutrient-transport capacity of the placenta. How-
ever, more detailed comparison of growth rates in various
IGF mutants has shown that foetal growth is determined
by the actions of IGF-1 on the type-1 IGF receptor, and
of IGF-2 on both the type-1 IGF and insulin receptors
(Eggenschwiler et al., 1997; Louvi et al., 1997; Efstratiadis,
1998). It is possible that maternal undernutrition may
impact the foetal IGF system and therefore affect organo-
genesis and foetal development during critical stages of the
gestation period. Early to mid-gestational nutrient restric-
tion significantly reduced foetal crown-rump length (CRL),
changed the expression of IGF-1 and IGF-2 receptors in
foetal myocardium, and played a role in cardiac ventric-
ular enlargement in foetal sheep (Dong et al., 2005). On
the other hand, administration of IGF-1 to foetal sheep
increased the weight of specific foetal organs such as
spleen, lungs, heart, pituitary and adrenal glands (Lok et
al., 1996). Expression of insulin-like growth factor genes
(igf genes) is developmentally regulated in a tissue-specific
manner, and may be altered by nutritional and endocrine
conditions in utero (Ren et al., 1999; Fazio et al., 2000). In
general, the igf-1 gene is more responsive to these stimuli
than the igf-2 gene. Thus, while the igf-1 gene is thought
to regulate foetal growth and development in relation to
the nutrient supply, the igf-2 gene appears to produce the
constitutive drive for intrauterine growth via its placental
and paracrine actions on foetal tissues (Fowden, 2003).
Six IGF binding proteins (IGFBPs) designated IGFBP-
1 to -6 control the biological activities of the IGFs by
modulating the interaction of the IGFs with the IGF recep-
tors (Ferry et al., 1999). This indicates that the effects of
IGFs on foetal growth can be amplified or attenuated by
these IGFBPs, which are themselves regulated by nutri-
tional and endocrine signals (Fowden, 2003). The IGFBPs
may serve not only to transport IGFs in the circulation but
also prolong the half-lives of the IGFs. In addition, it has
been postulated that IGFBPs can modulate IGF action by
intercepting receptor interaction and ligand transduction
(Wetterau et al., 1999) or by influencing the bioavailabil-
ity of the IGFs (Jones and Clemmons, 1995). Studies with
transgenic mice models demonstrated that elevated lev-
els of IGFBP-1 are causal in the pathogenesis of growth
restriction, likely through a decrease in the bioavailabil-
ity of IGFs (Murphy, 2000; Watson et al., 2002). Thus,
decreased foetal growth occurred in mice that have ele-
vated circulating concentrations of IGFBP-1 (Watson et
al., 2002) and in those with a paracrine model of expres-
sion (Murphy, 2000). IGFBP-2, IGFBP-3 and IGFBP-6 mRNAs
were all expressed in ovine placentome capsule, and IGFBP-
3 and IGFBP-6 mRNAs were also present in the stroma
of the maternal villi, while IGFBP-3 and IGFBP-5 were
both expressed in both the luminal and glandular epithe-
lium of intercotyledonary endometrium (Osgerby et al.,
2003). Foetal expression of IGFBPs is tissue specific and
developmentally regulated in most species including sheep
(Delhanty and Han, 1993; Carr et al., 1995). IGFBP expres-
sion in the foetus may be affected by both nutritional and
endocrine conditions in utero. These conditions have more
pronounced effects on IGFBP-1, IGFBP-2 and IGFBP-4 than
IGFBP-3 (Fowden, 2003). Osborn et al. (1992) reported that
tissue expression and plasma levels of IGFBP-1 were ele-
vated by foetal nutrient restriction induced by maternal
dietary restriction in sheep, but increase in foetal glucose
levels lowered hepatic expression and plasma levels of the
IGFBP-1. In summary, IGFBP-1 and IGFBP-2 are increased
during nutrient restriction, but the reverse is true for IGFBP-
3 and IGFBP-4 (Osborn et al., 1992; Gallaher et al., 1995).
These nutrition-induced changes in foetal IGFBP expres-
 U.M. Igwebuike / Animal Reproduction Science 121 (2010) 189–196
Fig. 1. A summary of the role of nutritionally sensitive insulin-like growth factors (IGFs) in ovine foetoplacental development.
sion may be related to the concomitant changes in the
foetal endocrine environment. It has been shown that hep-
atic expression and plasma concentrations of IGFBP-1 are
also reduced by insulin and increased by cathecolamines
(Gallaher et al., 1994; Hooper et al., 1994).
3.3. Role of insulin-like growth factors in placental
growth
Ovine placental growth is maximal during the first half
of pregnancy. Maternal plasma IGF-I was positively cor-
related with the total placentome number, with levels
being higher in high than low condition ewes (Osgerby
et al., 2002). This suggests that high circulating maternal
IGF-I concentrations may stimulate placentome forma-
tion in ewes in good condition. Confirmation that the IGF
system can control placental growth came from gene dele-
tion studies (DeChiara et al., 1991; Baker et al., 1993)
that showed a deficiency in placental growth of mouse
193
embryo carrying null mutations for igf-2 gene. In con-
trast, igf-1 gene deletion did not influence placental weight.
Conversely, placentomegaly occurred when IGF-2 was
over-expressed (Ludwig et al., 1996). The growth stimula-
tory effect of IGF-2 on the placenta may be paracrine and/or
endocrine, but do not appear to be mediated via the type-1
IGF receptor (Fowden, 2003). Placental growth was found
to be normal in double mutant mice lacking both type-1
IGF and insulin receptors, which suggests that IGF-2 may
act through an unknown placenta-specific receptor (Louvi
et al., 1997). The existence of another type of IGF receptor in
the placenta may also explain the unusual characteristics of
IGF-1 binding observed in the ovine trophoblast between
days 45 and 75 of gestation, when no igf-1 receptor gene
expression can be detected in the placentomes (Lacroix et
al., 1995; Wathes et al., 1998).
In addition to their influence on placental growth,
insulin-like growth factors also determine uptake and
utilization of nutrients by placental and foetal tissues.
194 U.M. Igwebuike / Animal Reproduction Science 121 (2010) 189–196
Administration of IGF-1 to either the foetus or dam was
shown to alter the transfer and partitioning of glucose and
amino acids between ovine foetal and uteroplacental tis-
sues (Harding et al., 1994; Liu et al., 1994). A summary of the
role of insulin-like growth factors in ovine foetoplacental
development is given in Fig. 1.
In conclusion, maternal nutritional status during preg-
nancy is an important intrauterine environmental factor
governing placental growth, as well as foetal growth and
programming. This influence of maternal nutrition on
foetoplacental development may be mediated via its regu-
lation of the insulin-like growth factor system axis.
References
Baker, J., Liu, J.-P., Robertson, E.J., Efstratiadis, A., 1993. Role of insulin-like
growth factors in embryonic and post-natal growth. Cell 75, 73–82.
Barker, D.J.P., 1994. Mothers, Babies and Disease in Later Life. BMJ Pub-
lishing Group, London.
Barker, D.J.P., Clark, P.M., 1997. Fetal undernutrition and disease in later
life. Rev. Reprod. 2, 105–112.
Bassett, N.S., Brier, B.H., Hodgkinson, S.C., Dans, S.R., Henderson, H.W.,
Gluckman, P.D., 1990. Plasma clearance of radiolabelled IGF-I in the
late gestation ovine fetus. J. Dev. Physiol. 14, 73–79.
Bazer, F.W., 1975. Uterine protein secretions: relationship to development
of the conceptus. J. Anim. Sci. 41, 1376–1382.
Bell, A.W., Hay, W.W., Ehrhardt, R.A., 1999. Placental transport of nutri-
ents and its implications for fetal growth. J. Reprod. Fertil. Suppl. 54,
401–410.
Borwick, S.C., Rhind, S.M., McMillen, S.R., Racey, P.A., 1997. Effect of
undernutrition of ewes from the time of mating on fetal ovarian devel-
opment in mid gestation. Reprod. Fertil. Dev. 9, 711–715.
Brameld, J.M., Mostyn, A., Dandrea, J., Stephenson, T.J., Dawson, J.M., But-
tery, P.J., Symonds, M.E., 2000. Maternal nutrition alters the expression
of insulin-like growth factors in fetal sheep liver and skeletal muscle.
J. Endocrinol. 167, 429–437.
Braulke, T., 1999. Type-2 IGF receptor: a multi-ligand binding protein.
Horm. Metab. Res. 31, 242–246.
Brooks, A.A., Johnson, M.R., Steer, P.J., Pawson, M.E., Abdalla, H.I., 1995.
Birth weight: nature or nurture? Early Hum. Dev. 42, 29–35.
Carr, J.M., Owens, J.A., Gran, P.A., Walton, P.E., Owens, P.C., Wallace, J.C.,
1995. Circulating insulin-like growth factors (IGFs) IGF binding pro-
teins (IGFBPs) and tissue mRNA levels of IGFBP2 and IGFBP-4 in the
ovine fetus. J. Endocrinol. 145, 545–557.
Da Silva, P., Aitken, R.P., Rhind, S.M., Racey, P.A., Wallace, J.M., 2002. Impact
of maternal nutrition during pregnancy on pituitary gonadotrophin
gene expression and ovarian development in growth-restricted and
normally grown late gestation sheep fetuses. Reproduction 123,
769–777.
Da Silva, P., Aitken, R.P., Rhind, S.M., Racey, P.A., Wallace, J.M.,
2003. Effect of maternal overnutrition during pregnancy on pitu-
itary gonadotrophin gene expression and gonadal morphology in
female and male sheep at day 103 of gestation. Placenta 24, 248–
257.
DeChiara, T.M., Robertson, E.J., Efstratiadis, A., 1991. Parental imprinting
of the mouse insulin-like growth factor II gene. Cell 64, 849–859.
Delhanty, P.J.D., Han, V.K.M., 1993. The expression of insulin-like growth
factor (IGF)-binding 2 and IGF-II genes in the tissues of the developing
ovine fetus. Endocrinology 132, 41–51.
Dong, F., Ford, S.P., Fang, C.X., Nijland, M.J., Nathanielsz, P.W., Ren, J.,
2005. Maternal nutrient restriction during early to mid gestation up-
regulates cardiac insulin-like growth factor (IGF) receptors associated
with enlarged ventricular size in fetal sheep. Growth Horm. IGF Res.
15, 291–299.
Dong, F., Ford, S.P., Nijland, M.J., Nathanielsz, P.W., Ren, J., 2008. Influence
of maternal undernutrition and overfeeding on cardiac ciliary neu-
rotrophic factor receptor and ventricular size in fetal sheep. J. Nutr.
Biochem. 19 (6), 409–414.
Dunk, C., Ahmed, A., 2000. Growth factor regulation of placental angiogen-
esis. In: Baker, P., Kingdom, J. (Eds.), Intrauterine Growth Retardation.
Springer, London, pp. 149–166.
Edwards, L.J., McMillen, I.C., 2002a. Impact of maternal undernutrition
during the periconceptional period, fetal number, and fetal sex on
the development of the hypothalamo–pituitary–adrenal axis in sheep
during late gestation. Biol. Reprod. 66, 1562–1369.
Edwards, L.J., McMillen, I.C., 2002b. Periconceptional nutrition pro-
grams development of the cardiovascular system in the fetal
sheep. Am. J. Physiol. Regul. Integr. Comp. Physiol. 283, R669–
R679.
Efstratiadis, A., 1998. Genetics of mouse growth. Int. J. Dev. Biol. 42,
955–976.
Eggenschwiler, J., Ludwig, T., Fisher, P., Leighton, P.A., Tilghmen, S.M.,
Efstratiadis, A., 1997. Mouse mutant embryos over-expressing IGF-II
exhibit phenotypic features of Beckman-Wiedemann and Simpson-
Golobi-Behmel syndromes. Genes Dev. 11, 3128–3142.
Emmanouilides, G.C., Townsend, D.E., Bauer, R.A., 1968. Effects of sin-
gle umbilical artery ligation in the lamb fetus. Pediatrics 42, 919–
927.
Ehrhardt, R.A., Bell, A.W., 1995. Growth and metabolism of the ovine pla-
centa during mid-gestation. Placenta 16, 727–741.
Faichney, G.J., White, G.A., 1987. Effects of maternal nutritional status on
fetal and placental growth and on fetal urea synthesis in sheep. Aust.
J. Biol. Sci. 40, 365–377.
Fazio, S., Palmieri, E.A., Biondi, B., Cittadini, A., Sacca, L., 2000. The role
of the GH-IGF-I axis in the regulation of myocardial growth: from
experimental models to human evidence. Eur. J. Endocrinol. 142, 211–
216.
Ferry, R.J., Katz, L.E.L., Grimberg, A., Cohen, P., Weinzimer, S.A., 1999. Cel-
lular actions of insulin-like growth factor binding proteins. Horm.
Metab. Res. 31, 192–202.
Forhead, A.J., Li, J., Gilmour, R.S., Dauncey, M.J., Fowden, A.L., 2002. Thy-
roid hormones and the mRNA of the GH receptor and IGFs in skeletal
muscle of fetal sheep. J. Physiol. 282, E80–86.
Fowden, A.L., 2003. The insulin-like growth factors and feto-placental
growth. Placenta 24, 803–812.
Galan, H.L., Hussey, M.J., Barbera, A., Ferrazzi, E., Chung, M., Hobbins, J.C.,
Battaglia, F.C., 1999. Relationship of fetal growth to the duration of
heat stress in an ovine model of placental insufficiency. Am. J. Obstet.
Gynecol. 180, 1278–1282.
Gallaher, B.W., Breier, B.H., Blum, W.F., McCutcheon, S.N., Gluckman, P.D.,
1995. A homologous radioimmunoassay for ovine insulin-like growth
factor-binding protein-2: ontogenesis and the response to growth
hormone, placental lactogen and insulin-like growth factor-1 treat-
ment in sheep. J. Endocrinol. 144, 75–82.
Gallaher, B.W., Breier, B.H., Keven, C.L., Harding, J.E., Gluckman, P.D.,
1998. Fetal programming of insulin-like growth factor (IGF)-I and IGF-
binding protein-3: evidence for an altered response to undernutrition
in late gestation following exposure to periconceptual undernutrition
in the sheep. J. Endocrinol. 159, 501–508.
Gallaher, B.W., Oliver, M.H., Eichorn, K., Kessler, U., Kiess, W., Harding, J.E.,
Gluckman, P.D., Breier, B.H., 1994. Circulating insulin-like growth fac-
tor II/mannose-6-phosphate receptor and insulin-like growth factor
binding proteins in fetal sheep plasma are regulated by glucose and
insulin. Eur. J. Endocrinol. 131, 398–404.
Gardner, D.S., Buttery, P.J., Daniel, Z., Symonds, M.E., 2007. Factors affect-
ing birth weight in sheep: maternal environment. Reproduction 133
(1), 297–307.
Gardner, R.L., Squire, S., Zainan, S., Hills, S., Graham, C.F., 1999. Insulin-
like growth factor-2 regulation of conceptus composition: effects of
the trophectoderm and inner cell mass genotypes in the mouse. Biol.
Reprod. 60, 190–195.
Godfrey, K., Robinson, S., 1998. Maternal nutrition, placental growth and
fetal programming. Proc. Nutr. Soc. 57 (1), 105–111.
Gray, C.A., Bartol, F.F., Tarleton, B.J., Wiley, A.A., Johnson, G.A., Bazer, F.W.,
Spencer, T.E., 2001. Developmental biology of uterine glands. Biol.
Reprod. 62, 1311–1323.
Han, V.K.M., Fowden, A.L., 1994. Paracrine regulation of fetal growth. In:
Ward, R.H.T., Smith, S.K., Donnai, D. (Eds.), Early Fetal Growth and
Development. RCOG Press, London, pp. 275–292.
Harding, J.E., Liu, L., Evans, P.C., Gluckman, P.D., 1994. Insulin-like growth
factor 1 alters feto-placental protein and carbohydrate metabolism in
fetal sheep. Endocrinology 134, 1509–1514.
Heasman, L., Brameld, J., Mostvn, A., Budge, H., Dawson, J., Buttery, P.,
Stephenson, T., Symonds, M.E., 2000. Maternal nutrient restriction
during early to mid gestation alters the relationship between insulin-
like growth factor I and bodyweight at term in fetal sheep. Reprod.
Fertil. Dev. 12, 345–350.
Holland, M.D., Hossner, M.D., Williams, S.E., Wallace, C.R., Niswerder, G.D.,
Odde, K.G., 1997. Serum concentrations of insulin-like growth factors
and placental lactogen during gestation in cattle: fetal profiles. Dom.
Anim. Endocrinol. 14, 231–239.
Hooper, S.A., Bocking, A.D., White, S.E., Fraher, L.J., McDonald, T.J., Han,
V.K.M., 1994. Catecholamines stimulate the synthesis and release of
insulin-like growth factor binding protein-1 (IGFBP1) by fetal sheep
liver in vivo. Endocrinology 134, 1104–1112.
 U.M. Igwebuike / Animal Reproduction Science 121 (2010) 189–196
Igwebuike, U.M., 2009. A review of uterine structural modifications that
influence conceptus implantation and development in sheep and
goats. Anim. Reprod. Sci. 112, 1–7.
Jones, J.I., Clemmons, D.R., 1995. Insulin-like growth factors and their
binding proteins: biological actions. Endocr. Rev. 16, 3–34.
Kind, K.L., Owens, J.A., Robinson, J.S., Quinn, K.J., Grant, P.A., Walton,
P.E., Gilmour, R.S., Owens, P.C., 1995. Effect of restriction of placental
growth on the expression insulin-like growth factors in fetal sheep:
relationship to fetal growth, circulating insulin-like growth factors
and binding proteins. J. Endocrinol. 146, 23–34.
Kleeman, D.O., Walker, S.K., Seamark, R.F., 1994. Enhanced fetal growth
in sheep administered progesterone during the first three days of
pregnancy. J. Reprod. Fertil. 102, 411–417.
Kniss, D.A., Shubert, P.J., Zimmerman, P.D., Landon, M.B., Gabbe, S.G., 1994.
Insulin-like growth factors: their regulation of glucose and amino acid
transport in placental trophoblasts isolated from first trimester chori-
onic villi. J. Reprod. Med. 39, 249–256.
Lacroix, M.C., Servety, J.L., Kann, G., 1995. IGF-I and IGF-II receptors in
the sheep placenta: evolution during the course of pregnancy. J.
Endocrinol. 144, 179–191.
LeRoith, D., Werner, H., Beitner-Johnson, D., Roberts, C.T., 1995. Molecu-
lar and cellular aspects of the insulin-like growth factor 1 receptor.
Endocr. Rev. 16, 143–163.
Li, J., Owens, J.A., Owens, P.C., Saunders, J.C., Fowden, A.L., Gilmour, R.S.,
1996. The ontogeny of hepatic growth hormone receptor and insulin-
like growth factor-I gene expression in the sheep fetus during late
gestation: developmental regulation by cortisol. Endocrinology 137,
1650–1657.
Li, J., Saunders, J.C., Gilmour, R.S., Silver, M., Fowden, A.L., 1993. Insulin-like
growth factor-II messenger ribonucleic acid expression in fetal tissue
of the sheep during late gestation: effects of cortisol. Endocrinology
132, 2083–2089.
Liu, J.-P., Baker, J., Perkins, A.S., Robertson, E.J., Efstratiadis, A., 1993.
Mice carrying null mutations of the genes encoding insulin-like
growth factor I (Igf-1) and type-1 IGF receptor (Igf1r). Cell 75, 59–
72.
Liu, L., Harding, J.E., Evans, P.C., Gluckman, P.D., 1994. Maternal insulin-
like growth factor-I infusion alters feto-placental carbohydrate and
protein metabolism in pregnant sheep. Endocrinology 135, 895–
900.
Lok, F., Owens, J.A., Mundy, L., Robinson, J.S., Owens, P.C., 1996. Insulin-
like growth factor I promotes growth selectivity in fetal sheep in late
gestation. Am. J. Physiol. 270, R1148–1155.
Louvi, A., Accili, D., Efstratiadis, A., 1997. Growth-promoting interaction
of IGF-II with the insulin receptor during mouse embryonic develop-
ment. Dev. Biol. 189, 33–48.
Lu, F., Han, V.K.M., Milne, W.K., Fraser, M., Carter, A.M., Berdusco, E.T.M.,
Challis, J.R.G., 1994. Regulation of insulin-like growth factor-II gene
expression in the ovine fetal adrenal gland by adrenocorticotrophic
hormone and cortisol. Endocrinology 134, 2628–2635.
Lucas, A., 1991. Programming by early nutrition in man. In: Bock, Whelan,
J. (Eds.), The Childhood Environment and Adult Disease. John Wiley
and Sons, Chichester, pp. 38–55.
Ludwig, T., Eggenschwiler, J., Fisher, P., D’Ercole, A.J., Davenport, M.L.,
Efstratiadis, A., 1996. Mouse mutants lacking the type-2 IGF recep-
tor (IGF2R) are rescued from perinatal lethality in Igf2 and Igf1r null
backgrounds. Dev. Biol. 177, 517–535.
McCrabb, G.J., Egan, A.R., Hosking, B.J., 1991. Maternal undernutrition
during mid-pregnancy in sheep: placental size and its relationship
to calcium transfer during late pregnancy. Br. J. Nutr. 65, 157–
168.
McCrabb, G.J., Egan, A.R., Hosking, B.J., 1992. Maternal undernutrition dur-
ing mid-pregnancy in sheep: variable effects on placental growth. J.
Agric. Sci. 118, 127–132.
McCrabb, G.J., Hosking, B.J., Egan, A.R., 1987. Nutrition manipulation of
placental size not the key to higher foetal growth. Proc. Nutr. Soc.
Aust. 12, 87–91.
Mellor, D.J., Matheson, I.C., 1979. Daily changes in the curved crown-rump
length of individual sheep fetuses during the last 60 days of preg-
nancy and effects of different levels of maternal nutrition. Quart. J.
Exp. Physiol. Cogn. Med. Sci. 64, 119–131.
Murphy, L.J., 2000. Overexpression of insulin-like growth factor binding
protein-1 in transgenic mice. Pediatr. Nephrol. 14, 567–571.
Osborn, B.H., Fowlkes, J., Han, V.K.M., Freemark, M., 1992. Nutritional
regulation of insulin-like growth factor-binding protein gene expres-
sion in the ovine fetus and pregnant ewe. Endocrinology 131, 1743–
1750.
Osgerby, J.C., Gadd, T.S., Wathes, D.C., 2003. Effect of maternal body condi-
tion on placental and fetal growth and insulin-like growth factor axis
in Dorset ewes. Reproduction 125, 717–731.
195
Osgerby, J.C., Wathes, D.C., Howard, D., Gadd, T.S., 2002. The effect of
maternal undernutrition on ovine fetal growth. J. Endocrinol. 173,
131–141.
Owens, J.A., Falconer, I., Robinson, J.S., 1986. Effect of restriction of placen-
tal growth on umbilical and uterine blood flows. Am. J. Physiol. 250,
R427–R434.
Owens, J.A., Kind, K.L., Carbone, F., Robinson, J.C., Owens, P.C., 1994. Cir-
culating insulin-like growth factor-I and II and substrate in fetal
sheep following restriction of placental growth. J. Endocrinol. 140,
5–13.
Rae, M.T., Palassio, S., Kyle, C.E., Brooks, A.N., Lea, R.G., Miller, D.W., Rhind,
S.M., 2001. Effect of maternal undernutrition during pregnancy on
early ovarian development and subsequent follicular development in
sheep fetuses. Reproduction 122, 915–922.
Ren, J., Samson, W.K., Sowers, J.R., 1999. Insulin-like growth factor I as a
cardiac hormone: physiological and pathophysiological implications
in heart disease. J. Mol. Cell Cardiol. 31, 2049–2061.
Reynolds, T.S., Stevenson, K.R., Wathes, D.C., 1997. Pregnancy-specific
alterations in the expression of the insulin-like growth factor system
during early placental development in the ewe. Endocrinology 138,
886–897.
Robinson, J.J., 1977. The influence of maternal nutrition on ovine foetal
growth. Proc. Nutr. Soc. 36, 9–16.
Robinson, J.J., Sinclair, K.D., McEvoy, T.G., 1999. Nutritional effects on foetal
growth. Anim. Sci. 68, 315–331.
Robinson, J.S., Kingston, E.J., Jones, C.T., Thorburn, G.D., 1979. Studies on
experimental growth retardation in sheep: the effect of removal of
endometrial caruncles on fetal size and metabolism. J. Dev. Physiol. 1,
379–398.
Robinson, J.S., Owens, J.A., de Barro, T., Lok, F., Chidzanja, S., 1994. Maternal
nutrition and fetal growth. In: Ward, R.H.T., Smith, S.K., Donnai, D.
(Eds.), Early Fetal Growth and Development. RCOG Press, London, pp.
317–334.
Russel, A.J., 1971. Relationships between energy intake and productivity
in hill sheep. Proc. Nutr. Soc. 30, 197–204.
Russel, A.J., Foot, J.Z., 1973. The effect of level of nutrition at two stages of
pregnancy on the performance of primiparous ewes. Proc. Nutr. Soc.
32, 27A–28A.
Snow, M.H.L., 1989. Effects of genome on fetal size at birth. In: Sharp, F.,
Fraser, R.B., Milner, R.D.G. (Eds.), Fetal Growth, Proceedings of the 20th
Study Group. RCOG Press, London, pp. 1–11.
Stevenson, K.R., Gilmour, R.S., Wathes, D.C., 1994. Localization of insulin-
like growth factor-I and -II messenger ribonucleic acid and type 1
IGF receptors in the ovine uterus during the estrous cycle and early
pregnancy. Endocrinology 134, 1655–1664.
Stevenson, K.R., Wathes, D.C., 1996. Insulin-like growth factors and their
binding proteins in the ovine oviduct during the oestrous cycle. J.
Reprod. Fertil. 108, 31–40.
Symonds, M.E., Budge, H., Stephenson, T., McMillen, I.C., 2001. Fetal
endocrinology and development – manipulation and adaptation to
long-term nutritional and environmental challenges. Reproduction
121, 853–862.
Vatnick, I., Schoknecht, P.A., Darrigrand, R., Bell, A.W., 1991. Growth and
metabolism of the placenta after unilateral fetectomy in twin preg-
nant ewes. J. Dev. Physiol. (Oxf.) 15, 351–356.
Vernon, R.G., Clegg, R.A., Flint, D.J., 1981. Metabolism of sheep adi-
pose tissue during pregnancy and lactation. Biochem. J. 200, 307–
314.
Walker, S.K., Hartwich, K.M., Seamark, R.F., 1996. The production of unusu-
ally large offspring following embryo manipulation: concepts and
challenges. Theriogenology 45, 111–120.
Wallace, J.M., Aitken, R.P., Cheyne, M.A., 1996. Nutrient partitioning and
fetal growth in rapidly growing adolescent ewes. J. Reprod. Fertil. 107,
183–190.
Wallace, J.M., Bourke, D.A., Aitken, R.P., Milne, J.S., Hay, W.W.,
2003. Placental glucose transport in growth-restricted pregnancies
induced by overnourished adolescent sheep. J. Physiol. 547, 85–
94.
Waterland, R.A., Jirtle, R.L., 2004. Early nutrition, epigenetic changes at
transposons and imprinted genes, and enhanced susceptibility to
adult chronic diseases. Nutrition 20, 63–68.
Wathes, D.C., Reynolds, T.S., Robinson, R.S., Stevenson, K.R., 1998. Role of
the insulin-like growth factor system in uterine function and placental
development in ruminants. J. Dairy Sci. 81, 1778–1789.
Watson, C.S., Benson, M., Bialek, P., Yee, S.P., Han, V.K.M., 2002. Hep-
atic overexpression of insulin-like growth factor binding protein-1
in fetal mice: a transgenic model of intrauterine growth restriction.
In: 49th Annual Meeting of the Society for Gynecologic Inves-
tigation, Los Angeles, USA, J. Soc Gynecol. Investig. 9 (Suppl),
p. 295A.
196 U.M. Igwebuike / Animal Reproduction Science 121 (2010) 189–196

Watson, A.J., Watson, P.H., Arcellia-Paulilo, M., Warnes, D., Walker, S.K.,
Schultz, G.A., Armstrong, D.T., Seamark, R.F., 1994. A growth factor
phenotype map for ovine preimplantation development. Biol. Reprod.
50, 725–733.
Wetterau, L.A., Moore, M.G., Lee, K.W., Shim, M.L., Cohen, P., 1999. Novel
aspects of the insulin-like growth factor binding proteins. Mol. Genet.
Metab. 68, 161–181.
Wu, G., Pond, W.G., Flynn, S.P., Ott, T.L., Bazer, F.W., 1998. Maternal dietary
protein deficiency decreases nitric oxide synthase and ornithine
decarboxylase activities in placenta and endometrium of pigs during
early gestation. J. Nutr. 128, 2395–2402.
Wu, G., Bazer, F.W., Cudd, T.A., Meininger, C.J., Spencer, T.E., 2004. Maternal
nutrition and fetal development. J. Nutr. 134, 2169–2172.
 Animal Reproduction Science 121 (2010) 197–207

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Review article

Disorders of sex development in the dog—Adoption of a new

nomenclature and reclassification of reported cases
T. Poth a,∗ , W. Breuer a , B. Walter b , W. Hecht c , W. Hermanns a
a
Institute of Veterinary Pathology, Ludwig-Maximilians-University, Veterinaerstrasse 13, D-80539 Munich, Germany
b
Clinic for Veterinary Surgery and Gynaecology for Small Animals, Ludwig-Maximilians-University, Veterinaerstrasse 13, D-80539 Munich, Germany
c
Institute of Veterinary Pathology, Justus-Liebig-University, Frankfurter Strasse 96, D-35392 Giessen, Germany

a r t i c l e i n f o a b s t r a c t

Article history: Intersexuality is a rare congenital abnormality in domestic animals. It is reported in numer-
Received 4 June 2009 ous species including the swine, goat, horse, cat, and dog. The present work provides an
Received in revised form 1 April 2010
overview of the variety of intersexual conditions known in different dog breeds. Each case
Accepted 9 April 2010
was reclassified based on the described gonadal constitution, reproductive tract abnormal-
Available online 24 April 2010
ities and karyogram, and categorised according to the stages normal sex development is
undergoing resulting in three main categories: (1) sex chromosome disorders, (2) disorders
Keywords:
of gonadal sex development, and (3) disorders of phenotypic sex development. Reclassifi-
Disorders of sex development
Sex reversal cation disclosed that the current classification scheme and terminology are inconsistently
Ovotestis used in literature masking the real occurrence and frequency of various intersex conditions
True hermaphroditism in dogs. For establishment of an individual, precise and definite diagnosis, introduction of
Pseudohermaphroditism a new nomenclature is proposed as recently recommended for humans. The new termi-
Dog nology is based on the gonosomal constellation and gonadal constitution, contributes to a
systematic classification of canine intersex cases, and replaces the common but confusing
diagnoses “true hermaphrodite” and “pseudohermaphrodite”.
The literature survey was supplemented by adding the results from own investigations
in a German Pinscher and Berger Picard dog with bilateral ovotestes and ambiguous exter-
nal genitalia. The diagnostic approach and clinical, pathomorphological and cytogenetic
findings were described in detail.
© 2010 Elsevier B.V. All rights reserved.

Contents

1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198
2. Normal sex development . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198
3. Canine intersexuality . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198
3.1. Sex chromosome disorders . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
3.2. Disorders of gonadal sex development . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
3.3. Disorders of phenotypical sex development . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 202

Abbreviations: ADM, androgen-dependent masculinisation; AIS, androgen insensitivity syndrome; C, chimaera; DSD, disorder(s) of sex development; H&E,
haematoxylin & eosin; MIS, Müllerian inhibiting substance; M, mosaic; PMDS, persistent Müllerian duct syndrome; SR, sex reversal; SRY, sex-determining
region of the Y chromosome; TFS, testicular feminisation syndrome; XXSR, XX sex reversal; XYSR, XY sex reversal.
∗ Corresponding author. Tel.: +49 89 21802543; fax: +49 89 21802544.
E-mail address: Poth@patho.vetmed.uni-muenchen.de (T. Poth).

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.04.011
198 T. Poth et al. / Animal Reproduction Science 121 (2010) 197–207

4. Reclassification of canine intersex cases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 202

5. New nomenclature . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203
6. Diagnostic approach in intersex patients—report on two phenotypically female dogs with ovotestes . . . . . . . . . . . . . . . . . . . . . . . . . . 204
Acknowledgement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206

1. Introduction each stage depending upon successful completion of the

previous one: establishment of chromosomal, gonadal, and
With the exception of bovine freemartinism, intersex- phenotypic sex (Meyers-Wallen and Patterson, 1986, 1989;
uality is considered an uncommon congenital disorder in Meyers-Wallen, 2001; Feldman and Nelson, 2004; Schlafer
domestic animals (Schlafer and Miller, 2007). The affected and Miller, 2007).
individuals have parts of or all genital organs of both sexes Chromosomal sex is determined at fertilisation result-
resulting in a variety of phenotypes (Meyers-Wallen and ing in XY and XX zygotes. Initially, early male and
Patterson, 1989; Simpson et al., 1998; Feldman and Nelson, female embryos have similar undifferentiated gonads,
2004; Schlafer and Miller, 2007). mesonephric (Wolffian) as well as paramesonephric (Mül-
Most intersex dogs are actually subcategorised into lerian) ducts, and primitive external genitalia consisting
true hermaphrodites and pseudohermaphrodites, respec- of the urogenital sinus, the genital tubercle, and geni-
tively. True hermaphroditism is defined by the presence tal swellings. The end of the undifferentiated period is
of both ovarian and testicular tissue in any possible com- marked by gonadal differentiation, which is normally
bination: (1) bilateral ovotestes, (2) unilateral ovotestis determined by the genetic sex. In male embryos, the SRY-
with contralateral ovary or testis, and (3) testis with gene representing the sex-determining region of the Y
contralateral ovary. Correspondingly, the three different chromosome initiates the differentiation of the primor-
forms are termed as bilateral, unilateral, and lateral true dial gonads into testes and is supported by the autosomal
hermaphroditism. Pseudohermaphrodites have one type of gene SOX9. The production of two testicular hormones,
gonadal tissue, either ovaries or testes, but the opposite testosterone and antiparamesonephric hormone (Mülle-
phenotype. The affected individuals are classified as a male rian inhibiting substance, MIS), induces the development
or female pseudohermaphrodite according to their gonadal of male genitalia. MIS is secreted by the sustentacular cells
sex. and causes regression of the embryonic paramesonephric
The establishment of an appropriate diagnosis in dogs ducts. Testosterone is secreted by the interstitial cells, and
may be problematical due to the variety of intersexual stimulates the mesonephric ducts to form epididymides
conditions and the presence of ambiguous external gen- and ductus deferentia. Testosterone is converted into dihy-
italia in most cases that initially allow no conclusions drotestosterone within the tissue of the primitive external
about the underlying disorder. Authors of previous stud- genitalia and promotes the formation of the prostate, pro-
ies have already concluded that the determination of both static urethra, penis, and scrotum. These developmental
the gonadal sex and the chromosomal sex are required procedures are mediated via binding of both hormones to
for establishment of a precise diagnosis and classification the cellular androgen receptor, which is located within the
(Hare, 1976; Chaffaux et al., 1980; Meyers-Wallen and target tissue.
Patterson, 1986; Melniczek et al., 1999). The absence of a Y chromosome and therefore a func-
In contrast to human medicine, a standardised and pre- tional SRY-gene results in the development of ovaries
cise nomenclature is missing in veterinary medicine. The and female genitalia. The genetic basis in ovary deter-
existing terminology is inconsistently used, independently mination is only incompletely understood. In contrast to
from the underlying disorder. male embryos, the paramesonephric duct system persists
The objectives of the present work were (1) to review in female embryos, and develops into the uterine tubes,
the literature on canine intersexuality, (2) to categorise uterus, and cranial portion of the vagina, whereas the
and reclassify the reported intersex cases according to a mesonephric ducts regress. The undifferentiated primitive
systematic scheme, (3) to propose a new nomenclature external genitalia being uninfluenced by androgens differ-
for various intersex conditions, which would enable an entiate into the caudal portion of the vagina, labia vulvae,
exact diagnosis and help to avoid the confusing terms “true vestibule, and clitoris.
hermaphrodite” and “pseudohermaphrodite”, and (4) to
illustrate the diagnostic approach and detailed clinical and 3. Canine intersexuality
pathomorphological findings using the case studies of two
dogs with bilateral ovotestes and ambiguous genitalia. To survey the variety of known disorders of sex devel-
opment (DSD) in dogs and establish precise diagnoses
2. Normal sex development in affected patients, categorising of the intersex condi-
tions is useful. DSD can occur at any stage of normal sex
An understanding of normal sex development is a nec- development, and lead to various genital tract abnormal-
essary basis from which to study the variety of intersex ities ranging from conditions with apparently normal to
conditions known in dogs. Generally, normal sex develop- ambiguous genitalia and concomitant sterility or fertility
ment happens in an orderly sequence of three stages, with (Meyers-Wallen and Patterson, 1989; Feldman and Nelson,
 T. Poth et al. / Animal Reproduction Science 121 (2010) 197–207
2004). Therefore, DSD can be categorised according to the
chronological stages normal sex development is undergo-
ing resulting in three main categories: sex chromosome
disorders, disorders of gonadal sex development, and dis-
orders of phenotypic sex development as described in the
following chapters and demonstrated in Table 1.
3.1. Sex chromosome disorders
Reported abnormalities in dogs include congenital
changes of sex chromosome number and XX/XY chi-
maerism/mosaicism resulting from random events. The
three kinds of X chromosomal aneuploidy are based on
mitotic nondisjunction during meiosis and cause underde-
veloped rather than ambiguous genitalia (Meyers-Wallen
and Patterson, 1986). Monosomy X is known as Turner’s
syndrome in women. Affected bitches are infertile and have
afollicular ovaries with partly hypoplastic female genital
organs in combination with normal developed (Löfstedt
et al., 1992) or ambiguous external genitalia (Smith et
al., 1989). Trisomy X results in the development of infer-
tile bitches with infantile genitalia (Johnston, 1989) or a
malformed uterus (Switonski et al., 2000). The XXY chro-
mosomal constitution is termed as Klinefelter’s syndrome
in man. In dogs, the syndrome is associated with the devel-
opment of sterile individuals, either a phenotypical male
with hypoplastic testes (Clough et al., 1970; Marshall et
al., 1982; Nie et al., 1998; Reimann-Berg et al., 2008) and
optionally a uterus (Marshall et al., 1982) or a phenotypical
female with afollicular ovaries, hypoplastic epididymides,
and a malformed female genital tract (Bosu et al., 1978).
In XX/XY chimaera or mosaics, more than one cell line
exists. Chimaerism is caused by fusion of different zygotes
or cells originating from different zygotes, whereas XX/XY
mosaicism results from non-disjunction in a single zygote
or cells deriving from a single zygote, respectively (Meyers-
Wallen and Patterson, 1986; Feldman and Nelson, 2004).
Generally, the phenotype of chimaera and mosaics depends
on the proportion of testicular tissue within the gonads and
its hormonal activity (Feldman and Nelson, 2004). Bitches
with an XX/X0 karyotype are infertile, and have normal
female external genitalia (Mayenco-Aguirre et al., 1999;
Switonski et al., 2003). In the dog, XX/XY and XX/XXY
chimaerism or mosaicism are associated with develop-
ment of ambiguous genitalia and of either testes (Dain
and Walker, 1979; Chaffaux et al., 1980; Allen et al., 1981;
Meyers-Wallen and Patterson, 1986; Genero et al., 1998),
ovaries (Weaver et al., 1979; Chaffaux et al., 1980) or uni-
lateral ovotestis/bilateral ovotestes (Hare, 1976; Bosu et
al., 1978; Dain and Walker, 1979; Johnston, 1989). A fur-
ther case with 78,XX/77,X0/79,XXY mosaicism, ovotestes
and ambiguous genitalia was described by Pullen (1970).
Canine XY/XXY chimaerism or mosaicism is associated
with bilateral cryptorchidism, absence of spermatogenesis,
and ambiguous genitalia (Goldschmidt et al., 2001). There is
one report on a sex-reversed dog tentatively designated as
being a 78,XY/78,XYrcp (X;autosome) mosaic. The authors
speculated, whether this kind of translocation was respon-
sible for the disordered sex development resulting in the
presence of ovotestes and an enlarged clitoris with bone
formation (Schelling et al., 2001).
199
3.2. Disorders of gonadal sex development
Affected dogs have either an XY or an XX chromosome
constitution, but chromosomal and gonadal sex disagree
(Meyers-Wallen and Patterson, 1986). This abnormality
results in two kinds of sex-reversed conditions: either
XX sex reversal (XXSR) or XY sex reversal (XYSR). Both
conditions cause the development of ambiguous external
genitalia in varying degrees, which is positively correlated
with the amount of testicular tissue within the gonads
(Meyers-Wallen and Patterson, 1989; Feldman and Nelson,
2004).
XXSR is subdivided into two categories currently
termed as XX true hermaphroditism and XX male
syndrome (Meyers-Wallen and Patterson, 1986, 1989;
Feldman and Nelson, 2004; Schlafer and Miller, 2007).
XX true hermaphrodites are characterised by having both,
ovarian and testicular tissue occurring in one of three
possible variations: bilateral, unilateral, and lateral, in
which the former combination prevails (Selden et al.,
1984; Meyers-Wallen and Patterson, 1986, 1989; Feldman
and Nelson, 2004). In addition to an often uninfluenced
paramesonephric duct system in affected animals, the
mesonephric ducts may partly be developed. In contrast
to XX true hermaphrodites, XX males have no ovarian
tissue but bilateral non-spermatogenic testes in an ovar-
ian position, and derivates of both, the mesonephric and
paramesonephric duct system resulting in a simultane-
ous formation of both, female and male genital organs
in various degrees of differentiation (Meyers-Wallen and
Patterson, 1986). XX males are sterile, whereas XX true
hermaphrodites can reproduce depending on the grade of
masculinisation (Selden et al., 1978, 1984).
Testis formation in females with a normal XX chromo-
some constitution seems to be contradictory. The aetiology
and pathogenesis of this phenomenon is only partially
understood, but some hypotheses are offered in litera-
ture. In humans, 80% of XX males and 10% of XX true
hermaphrodites show a translocation of the Y-linked SRY-
gene (McElreavey et al., 1992; Sarafoglou and Ostrer,
2000). But all hitherto tested XXSR dogs were SRY-negative
(Melniczek et al., 1999; Meyers-Wallen et al., 1999; Kuiper
and Distl, 2004; Switonski et al., 2004; Nowacka et al.,
2005; De Lorenzi et al., 2008; Buijtels et al., 2009; present
study) indicating an SRY-independent mechanism for testis
induction in dogs with an XX chromosome constitution
(Meyers-Wallen et al., 1995, 1999; De Lorenzi et al., 2008).
Further hypotheses in the dog include the presence of auto-
somal genes with Y-effect as proven for other species as the
SXR gene in female carrier mice (Schlafer and Miller, 2007)
or mutations influencing the transcription of PISRT1 and
FOXL2 in XX goats (polled intersex syndrome, Pailhoux et
al., 2001). In contrast, studies on a multigenerational pedi-
gree of SRY-negative XXSR dogs disclosed no mutations
involving the region of PISRT1 and FOXL2 (Kothapalli et al.,
2005). Further candidate genes (WT1, DMRT1, GATA4, FOG2,
LHX1/LIM1, SF1, SOX9, LHX9, RSPO1) known to play a role in
the sex determination pathway and therefore in the devel-
opment of XXSR or XYSR in humans (Sarafoglou and Ostrer,
2000; Cotinot et al., 2002) or in animal models (Cotinot et
al., 2002) could also be excluded as being causative in the
200 T. Poth et al. / Animal Reproduction Science 121 (2010) 197–207

Table 1
Various disorders of sex development (DSD) known in the dog; the cases were reclassified according to the reported gonadal constitution, genital tract
abnormalities and the karyogram, renamed adopting a new terminology based on gonosomal constellation and gonadal constitution, and categorised
appropriate to the stages of normal sex development.

Gonosomal Currently used Proposed Genital tract Affected dog breeds

constellation nomenclature nomenclature abnormalities

I. Sex chromosome disorders

(a) X aneuploidy
77,X0 Monosomy X, X0 –a O, PD, NG/AG, I Dobermann Pinscher, Miniature
syndrome American Eskimo (Smith et al.,
1989; Löfstedt et al., 1992)
79,XXX Trisomy X, triple-X –a O, PD, NG/AG, I Airedale Terrier, Crossbreed
syndrome (Johnston, 1989; Switonski et al.,
2000)
79,XXY Canine Klinefelter’s Ovarian XXY O, MD, PD, AG, I Great Dane (Bosu et al., 1978)
syndrome, XXY syndrome
syndrome, male PH
Testicular XXY T, (CO), MD, PD, German Shorthaired Pointer,
syndrome NG/AG, I Miniature Schnauzer, Norwich
Terrier, West Highland White
Terrier (Clough et al., 1970;
Marshall et al., 1982; Nie et al.,
1998; Reimann-Berg et al., 2008)

(b) Chimaerism and mosaicism

78,XX/77,X0 XX/X0 C or M 78,XX/77,X0 C O, PD, I Bearded Collie, Munsterlander, Toy
or M Poodle (Mayenco-Aguirre et al.,
1999; Switonski et al., 2003)b
78,XX/78,XY XX/XY C or M, TH, 78,XX/78,XY OT, OT + T, MD, American Eskimo, Pug, Schipperke
THC ovotesticular C (PD), AG (Hare, 1976d ; Bosu et al., 1978;
or M Johnston, 1989)b
XX/XY C or M with 78,XX/78,XY T, (CO), (MD), Belgium Shepherd, German
testes, male PH testicular C or (PD), (H), AG, Shepherd, Old English Sheepdog
M (I) (Chaffaux et al., 1980;
Meyers-Wallen and Patterson,
1986; Genero et al., 1998)b
XX/XY C or M, 78,XX/78,XY O, PD, AG, (I) Dachshund, Toy Spaniel (Weaver et
female PH ovarian C or M al., 1979; Chaffaux et al., 1980)b
XX/XY C or M –c ?; AG Border Terrier, Fila Brasileiro
(Meyers-Wallen et al., 1999;
Kuiper and Distl, 2004)b
78,XX/79,XXY XX/XXY C or M 78,XX/79,XXY OT, PD, AG Irish Red Setter (Dain and Walker,
ovotesticular C 1979)b
or M
XX/XXY C or M, 78,XX/79,XXY T, CO, MD, PD, Labrador-Setter-crossbreed,
male PH testicular C or AG, (I) Cocker Spaniel (Dain and Walker,
M 1979; Allen et al., 1981)b
78,XX/77,X0/79,XXY XX/X0/XXY M, TH 78,XX/77,X0/79, OT, MD, PD, AG Beagle (Pullen, 1970)
XXY
ovotesticular M
78,XY/79,XXY XY/XXY C or M 78,XY/79,XXY T, CO, I Poodle (Goldschmidt et al., 2001)b
testicular C or
M
78,XY/78,XYrcp XY/XYrcp M, TH 78,XY/78,XYrcp OT, MD, PD, AG Yorkshire Terrier (Schelling et al.,
(X;autosome) ovotesticular M 2001)

II. Disorders of gonadal sex development

(a) XX sex reversal
78,XX TH, XX TH 78,XX OT, OT + O, American Cocker Spaniel, Basset,
ovotesticular OT + T, O + T, Beagle, Brussels Griffon, Collie,
DSD (MD), PD, AG, Crossbreed, Doberman Pinscher,
(I) German Pinscher, German
Shorthaired Pointer, Norwegian
Elkhound, Poodle, Pug, Soft Coated
Wheaten Terrier, Kerry Blue
Terriere Vizslae , Weimaraner
(Hare, 1976d ; Selden et al., 1978;
Tangner et al., 1982; Thomas et al.,
1986; Randolph et al., 1987;
Fitzgerald and Murphy, 1990;
Melniczek et al., 1999;
Meyers-Wallen et al., 1999; De
Lorenzi et al., 2008; present study)
 T. Poth et al. / Animal Reproduction Science 121 (2010) 197–207 201

Table 1 (Continued )

Gonosomal Currently used Proposed Genital tract Affected dog breeds

constellation nomenclature nomenclature abnormalities

XX male, male PH 78,XX T, CO, MD, PD, American Cocker Spaniel,

testicular DSD (H), AG, I American Pit Bull Terriere
American Staffordshire Terrier,
Basset Artésien Normand, Beagle,
Border Colliee , Crossbreed, English
Cocker Spaniele , French Bull Dog,
German Shorthaired Pointer, Jack
Russel Terrier, Kerry Blue Terrier,
Norwegian Elkhound, Picard,
Podenco, PON, Pug, Soft Coated
Wheaten Terriere Walker hound,
Weimaranere (Stewart et al., 1972;
Selden et al., 1978; Williamson,
1979; Chaffaux et al., 1990d ;
Williams et al., 1997; Tammer et
al., 1998; Melniczek et al., 1999;
Meyers-Wallen et al., 1999; Kuiper
and Distl, 2004; Nowacka et al.,
2005; De Lorenzi et al., 2008;
Buijtels et al., 2009)
(b) XY sex reversal
78,XY TH 78,XY O + T, MD, PD, Fox Terrier, Yorkshire Terrier
ovotesticular (H), AG (Chaffaux et al., 1986; Jurka et al.,
DSD 2009)

III. Disorders of phenotypic sex development

(a) Male with PMDS
78,YX Male PH, male PH 78,XY T, (CO), MD, PD, American Cocker Spaniel, Basset,
with PMDS DSD/PMDS (H), AG, (I) Bull Terrier, Collie, Crossbreed,
Dachshund, English Cocker Spaniel,
German Shepherd, Labrador
Retriever, Miniature Schnauzer,
Pekinese, Poodle, Standard
Schnauzer, West Highland White
Terrier, Yorkshire Terrier (Hare,
1976d ; Kelly et al., 1976; Chaffaux
et al., 1980d ; Marshall et al., 1982;
Svendsen et al., 1985; Chaffaux et
al., 1990d ; Nickel et al., 1992;
Volpe et al., 2000; Kuiper and Distl,
2004; Alam et al., 2007;
Nowacka-Woszuk et al., 2007;
Whyte et al., 2009)

(b) Male with failure of ADM/incomplete TFS

78,XY Male PH 78,XY DSD T, (CO), MD, Labrador Retriever, Crossbreed
AG, (I) (Hare, 1976d ; Peter et al., 1993;
Wernham and Jerram, 2006)

(c) Virilised female due to exogenous steroid exposure

78,XX Female PH 78,XX DSD O, PD, (H), AG Australian Shepherd crossbreed,
Beagle, Crossbreed, Greyhound
(Hare, 1976d ; Medleau et al., 1983;
Olson et al., 1989)

(d) Virilised female of unknown cause

78,XX Female PH 78,XX DSD O, PD, AG Briard, Cairn Terrier, Cocker
Spaniel, Collie crossbreed, German
Shepherd, Yorkshire Terrier (Hare,
1976d ; Chaffaux et al., 1980d ; Allen
et al., 1981; Van Schouwenburg
and Louw, 1982; Holt et al., 1983)

ADM = androgen-dependent masculinisation; AG = ambiguous genitalia; C = chimaera; CO = cryptorchidism; H = hypospadias; I = infertility;

M = mosaic; MD = mesonephric duct derivates; NG = normal genitalia; O = ovary/ovaries; OT = ovotestis/-es; PD = paramesonephric duct derivates;
PH = pseudohermaphrodite; PMDS = persistent Müllerian duct syndrome; PON = Polski Owczarek Nizinny; SR = sex reversal; T = testis/testes; TH = true
hermaphrodite; THC = true hermaphrodite chimaera; TFS = testicular feminisation syndrome.
a
Renaming is redundant.
b
No differentiation between chimaera or mosaic.
c
Renaming failed due to incomplete information.
d
Review article.
e
SRY-negative, karyotyping not done.
202 T. Poth et al. / Animal Reproduction Science 121 (2010) 197–207
canine model (Kothapalli et al., 2005; Nowacka et al., 2005;
Pujar et al., 2005; De Lorenzi et al., 2008). In the meantime, a
new study indicates that another gene locus, which is likely
located in the linked region of CFA29, may be causative for
sex reversal in dogs (Pujar et al., 2007). It should be consid-
ered that more than one mechanism could be involved in
the development of SRY-negative sex reversal syndrome in
mammals (Meyers-Wallen et al., 1999; Pujar et al., 2007).
Studies on human pedigrees with familiar occurrence of
both XX male syndrome and XX true hermaphroditism in
siblings led to suggest a genetic aetiology (Sarafoglou and
Ostrer, 2000; Cotinot et al., 2002). In the dog, an autoso-
mal recessive trait has been proven in the American Cocker
Spaniel resulting in both, XX true hermaphrodites and XX
males (Selden et al., 1984), and is presumed to be likely in
several other dog breeds including the German Shorthaired
Pointer, Beagle, English Cocker Spaniel, Kerry Blue Terrier,
Norwegian Elkhound, Pug, Weimaraner, and German Shep-
herd (Stewart et al., 1972; Williamson, 1979; Randolph
et al., 1987; Meyers-Wallen and Patterson, 1989; Meyers-
Wallen et al., 1995, 1999; Melniczek et al., 1999; Switonski
et al., 2004).
XYSR results in the presence of ovarian tissue in addi-
tion to testicular tissue, and its occurrence in dogs is rarely
reported. Chaffaux et al. (1986) and Jurka et al. (2009)
described each a case of true hermaphroditism showing an
XY chromosomal constitution, one testis with an attached
epididymis, a contralateral ovary, a uterus and ambiguous
external genitalia and occasional hypospadias. A further
dog with an XY karyotype, ovotestes, epididymides, a
uterus and ambiguous external genitalia was reported, but
due to the presence of a translocation involving the X
chromosome, the animal was finally classified as a mosaic
(Schelling et al., 2001; Table 1).
3.3. Disorders of phenotypical sex development
In affected dogs, chromosomal and gonadal sex match,
but the external genitalia have characteristics of the
opposite gender (Meyers-Wallen and Patterson, 1986).
They are currently classified either as female or male
pseudohermaphrodites depending on their gonadal sex
(Meyers-Wallen and Patterson, 1986; Simpson et al., 1998;
Schlafer and Miller, 2007).
Male pseudohermaphroditism occurs more frequently
than female pseudohermaphroditism (Hare, 1976;
Chaffaux et al., 1980; Simpson et al., 1998; Table 1) and
is based either on the failure of paramesonephric duct
regression (persistent Müllerian duct syndrome, PMDS)
or on the failure of androgen-dependent masculinisation
due to enzyme deficiencies in testosterone biosynthesis
or insensitivity of their receptors in the target tissue
(androgen insensitivity syndrome, AIS) (Meyers-Wallen
and Patterson, 1986; Feldman and Nelson, 2004; Schlafer
and Miller, 2007).
PMDS is the predominant form in the dog (Table 1),
and is autosomal recessive inherited in the Miniature
Schnauzer (Meyers-Wallen and Patterson, 1989; Wu et al.,
2009). In contrast to XX males, dogs suffering from PMDS
have a normal XY chromosome constitution (Meyers-
Wallen and Patterson, 1986). Affected animals commonly
show uni- or bilateral cryptorchidism, and can be fertile
in a case of scrotal testis/testes (Chaffaux et al., 1980).
They usually have ambiguous external genitalia besides
paramesonephric duct derivates and tend to get urinary
tract infections, prostatitis, cystic endometrial hyperpla-
sia, pyometra, and testicular tumours (Hare, 1976; Kelly
et al., 1976; Chaffaux et al., 1980; Marshall et al., 1982;
Svendsen et al., 1985; Meyers-Wallen and Patterson, 1986,
1989; Nickel et al., 1992; Simpson et al., 1998; Volpe et al.,
2000).
In individuals suffering from defects in androgen-
dependent masculinisation, the paramesonephric ducts
regress normally, but masculinisation of the androgen-
responsive tissue happened insufficiently or failed result-
ing amongst others in ambiguous genitalia and hypospa-
dias (Meyers-Wallen and Patterson, 1986, 1989; Simpson
et al., 1998; Wernham and Jerram, 2006; Sonne et al., 2008).
Hypospadias is described in several dog breeds including
the Boston Terrier, in which the condition is suspected to
be inherited. It can occur independently or in combination
with other genital tract abnormalities (Selden et al., 1978;
Chaffaux et al., 1980; Hayes and Wilson, 1986; Jurka et al.,
2009). The X-linked inherited testicular feminisation syn-
drome (TFS) occurring in humans and rodents is based on
a defect of the androgen receptor, and is also assumed to
exist in dogs (Meyers-Wallen and Patterson, 1986, 1989),
but has only been reported once as an incomplete form
in a mixed-breed dog (Peter et al., 1993). Deficiency of
5-alpha-reductase that converts testosterone into dihy-
drotestosterone is autosomal recessive inherited in men
but has not been detected in dogs (Meyers-Wallen and
Patterson, 1986).
Female pseudohermaphrodites have an XX chromo-
some constitution and bilateral ovaries but an androgen-
dependent masculinisation of the genitalia ranging from
mild clitoral enlargement to nearly male external gen-
italia. Beyond a cranial vagina and uterus present in
all cases, a prostate gland could possibly be developed
(Meyers-Wallen and Patterson, 1986). Most cases result
from administration of steroids to pregnant bitches dur-
ing critical stages of development inducing virilisation of
female foetuses (Hare, 1976; Chaffaux et al., 1980; Medleau
et al., 1983; Meyers-Wallen and Patterson, 1989; Olson
et al., 1989; Melniczek et al., 1999; Feldman and Nelson,
2004; Schlafer and Miller, 2007). Other underlying causes
such as the adrenogenital syndrome in women and sev-
eral animal species has not yet been identified in the dog
(Meyers-Wallen and Patterson, 1989; Feldman and Nelson,
2004).
4. Reclassification of canine intersex cases
Reported intersex cases in dogs were reclassified to give
an overview of the diversity of canine DSD, the frequency
of various conditions, and the dog breeds involved. In the
present work, reported canine intersex cases were reclas-
sified based on the described genital tract abnormalities
and cytogenetic findings and categorised according to the
chronological stages of normal sex development (Table 1).
As far as possible, only the earliest report on an affected
dog breed was considered for each kind of DSD. Those cases
 T. Poth et al. / Animal Reproduction Science 121 (2010) 197–207 203

Table 2
Unclassified cases of canine DSD.

True hermaphrodite
(a) Bilateral Afghan Hound, American Staffordshire Terrier, Berger Picard, Boxer,
German Shepherd crossbreed, (Chaffaux et al., 1980a ; Meyers-Wallen et
al., 1999; De Rooster et al., 2006; Redden, 2007; present study)
(b) Lateral Miniature Schnauzer (Stünzi and Stünzi, 1950)

Male pseudohermaphrodite
(a) Persistent Müllerian ducts Afghan Hound, Australian Terrier, Golden Retriever, Pug, Springer Spaniel,
Toy Terrier, Terrierb (Hare, 1976a ; Axelson, 1978; Chaffaux et al., 1980a ;
Röcken, 1988)
(b) Failure of ADM Greenland dog, Pit Bull Terrier, Pug (Stewart et al., 1972; Fischer, 1983;
Sonne et al., 2008)
(c) Unknown Siberian Husky (Nowacka-Woszuk and Switonski, 2009)

Female pseudohermaphrodite
(a) Exogenous steroid exposure Boxer (Hare, 1976a )
(b) Unknown Pekinese-Poodle-crossbreed, Saluki (Hinsch, 1979; Chaffaux et al., 1980a )

Incomplete information impedes reclassification and adoption of a new nomenclature. ADM = androgen-dependent masculinisation.
a
Review article.
b
Not otherwise specified.

that could not be reclassified due to incomplete informa-
tion are summarised in Table 2. The case selection was
limited to those dog breeds that were not affected from
an equivalent intersex DSD already listed in Table 1. There
are further reports on dog breeds such as the Miniature
Pinscher and Shetland Sheepdog with ambiguous geni-
talia (Schneck, 1975; Nowacka et al., 2005), but these are
excluded from both, Tables 1 and 2, due to insufficient
information.
This literature review has revealed that the classifica-
tion and terminology are inconsistently used, leading to
confusion, and masking the occurrence and frequency of
various intersex conditions in dogs. One possible expla-
nation could be the fact that aberrations originating from
different stages of sex development and therefore repre-
senting separate conditions of DSD, can result in similar
alterations on internal and/or external genitalia. Ovotestis
formation, for example, can be caused by both, sex chro-
mosome disorders (chimaerism/mosaicism) and disorders
at the stage of gonadal sex development (sex reversal).
Another example is PMDS representing a disorder of phe-
notypical sex development that can easily be confused
due to anatomical similarities with the XX male syndrome
(disorder of gonadal sex development) or some kinds
of chimaerism/mosaicism (sex chromosome disorder)
(Table 1). Reclassification disclosed that most canine chi-
maera or mosaics were previously termed as female/male
pseudohermaphrodites or true hermaphrodites, respec-
tively (Pullen, 1970; Hare, 1976; Bosu et al., 1978; Weaver
et al., 1979; Chaffaux et al., 1980; Allen et al., 1981;
Johnston, 1989; Genero et al., 1998). Additionally, many
of the intersex cases previously diagnosed as male pseudo-
hermaphrodites (Stewart et al., 1972; Hare, 1976; Chaffaux
et al., 1980; Allen et al., 1981) could be reclassified as XX
males. This finding was consistent with investigations of
Meyers-Wallen and Patterson (1986). Furthermore, a dog
suffering from XXY syndrome was also originally diagnosed
as male pseudohermaphrodite (Marshall et al., 1982).
Male pseudohermaphroditism was previously consid-
ered as being the main intersex condition in dogs (Hare,
1976; Chaffaux et al., 1980; Simpson et al., 1998), but the
present review revealed that at least 27 dog breeds are
involved in XXSR exceeding the group of male pseudo-
hermaphrodites.
In contrast to the frequent occurrence of sex reversal in
purebred dogs, intersexual conditions are less frequently
reported in crossbreed dogs (Hare, 1976; Chaffaux et al.,
1980; Tables 1 and 2). Purebred dogs originate from a
small gene pool, therefore, a recessive mode of inher-
itance results in a frequent expression (Meyers-Wallen
et al., 1999). Furthermore, reclassification disclosed that
numerous dog breeds including amongst others the Cocker
Spaniel, Beagle, German Shepherd, German Shorthaired
Pointer, Poodle, Pug, and Yorkshire Terrier are affected
with various kinds of DSD originating either from differ-
ent stages or from the same stage of sex development
(Table 1). It should be considered that favourite dog breeds
are predominantly involved and some pedigrees, e.g. of the
American Cocker Spaniel are used for research in inher-
ited intersex conditions (Selden et al., 1978, 1984), which
increases the chance to detect rare DSD.
5. New nomenclature
Beside the consequent use of a systematic classifica-
tion scheme in dogs with DSD, the introduction of a new
nomenclature in veterinary medicine as was recently rec-
ommended for humans (Hughes, 2008) would facilitate a
definite and individual diagnosis. The new terminology is
based on the gonosomal constellation and gonadal consti-
tution and replaces the common but confusing and inexact
main categories “true hermaphroditism” and “pseudo-
hermaphroditism”, which are used independently from the
gonosomal constellation (Table 1).
In Table 1, the new terminology was proposed for nearly
all known varieties of canine DSD, apart from the cur-
rently used terms “monosomy X” and “trisomy X”, which
are regarded as being unmistakable diagnoses. In some
conditions, the previous nomenclature was amended by
considering the constitution of the gonadal tissue result-
ing, e.g. in “ovarian” or “testicular XXY syndrome” instead
of “canine Klinefelter’s syndrome” or in “78,XX/78,XY tes-
204 T. Poth et al. / Animal Reproduction Science 121 (2010) 197–207
ticular C or M” instead of “78,XX/78,XY C or M”. In other
conditions, the currently used terms would be replaced,
e.g. “true hermaphroditism” by “78,XX/78,XY ovotesticular
C or M”, “78,XX ovotesticular DSD”, and “78,XY ovotesticu-
lar DSD”, respectively, or “male pseudohermaphrodite” by
“78,XY DSD”. The latter can be completed by adding the
underlying syndrome as, for example, “78,XY DSD/PMDS”.
6. Diagnostic approach in intersex patients—report
on two phenotypically female dogs with ovotestes
Most dogs with DSD are admitted to veterinary prac-
titioners due to the presence of ambiguous external
genitalia, infertility or absence of oestrus signs. If external
genitalia appear normal or show only mild abnormali-
ties, diagnosis of an intersex condition in dogs can be
problematical. A precise and extensive clinical, patho-
morphological, and cytogenetic examination determining
phenotypic sex, gonadal constitution, and gonosomal con-
stellation is essential for a definitive diagnosis as also
recommended by authors of previous studies (Hare, 1976;
Chaffaux et al., 1980; Meyers-Wallen and Patterson, 1986;
Melniczek et al., 1999). The chapters above provide
a structured classification scheme, and propose a new
nomenclature aimed at facilitating individual and exact
diagnoses when confronted with intersex patients. Addi-
tional pedigree analysis should be carried out to disclose a
hereditary disorder (Meyers-Wallen and Patterson, 1986),
and to exclude affected parents and siblings from breeding.
Below, this diagnostic approach is used for two intersex
dogs presented at the Faculty of Veterinary Medicine of the
Ludwig-Maximilians-University.
A five month old German Pinscher (dog 1) and an eight
month old Berger Picard (dog 2) were presented for clini-
cal examination due to concerns about an enlarged clitoris.
Both dogs were phenotypical females, had no signs of
oestrus before presentation and showed normal female-
like urination. Physical examination of external genitalia
revealed a normal sized vulva in physiological position and
confirmed clitoromegaly in both cases. The enlarged clitoris
protruded from the rima vulvae, had a palpable os clitoridis,
and was about 2.5 cm in length (dog 1) and about 4.0 cm
in length (dog 2), respectively. Endoscopy of the vagina
revealed no atypical findings, and the urethral tuber-
cles were positioned ventrally near the vaginovestibular
junction. Both dogs underwent laparotomy under general
anaesthesia. They had a bicornuated uterus in a physiolog-
ical anatomical position and gonads enclosed in the bursa
ovarica at each horn tip. Routine gonadohysterectomy was
performed in both bitches, and the clitoris was additionally
excised in dog 2.
The genital tract of both dogs revealed similar path-
omorphological findings. The gonads measured approx-
imately 1.5 cm × 1.0 cm × 0.5 cm in dog 1 and approx-
imately 2.0 cm × 1.5 cm × 0.7 cm in dog 2. Every gonad
had a testis-like appearance with an attached structure
resembling epididymides. The physiologically developed
uterus had a maximum length of 9.0 cm in dog 1 and
12.0 cm in dog 2, and was composed of two uterine
horns, corpus and cervix. The clitoris removed from dog
2 measured 4.0 cm × 1.0 cm × 1.0 cm. It had a knobbly and
shamrock-formed glans clitoridis with 6.0 mm in diame-
ter, and contained a large central os clitoridis surrounded
by the corpus cavernosum. Subsequent to the macroscopic
examination, removed organs were fixed in 7% buffered
formaldehyde. Representative specimens were embedded
in paraffin (Paraplast® ), cut into 4–6 ␮m-thick sections and
stained with haematoxylin & eosin (H&E) according to stan-
dard protocols.
Histologically, the gonadal parenchyma was distinctly
subdivided in a small peripheral zone of ovarian tis-
sue and a medullar part of non-spermatogenic testicular
tissue by a small band of connective tissue containing
lymphatic and blood vessels (Fig. 1). The ovarian part
showed numerous small follicles that were mostly at stages
of degeneration. They could be identified as being pri-
mordial, primary, secondary, and tertiary follicles (latter
only found in dog 2) consisting of highly vacuolated fol-
licular cells and frequently multiple oocytes (polyovular
follicles, Fig. 2). Several granulosa cell cords and follicu-
lar cysts (latter only found in dog 2) were also present.
The medullar testicular tissue was composed of numerous
normal appearing interstitial cells and hypoplastic seminif-
erous tubules. The tubules were lined with a single layer of
highly vacuolated sustentacular cells, but spermatogenic
cells were absent (Fig. 3). Hypoplastic epididymal tissue
showing the convoluted tubule lined with a flattened cili-
ated epithelium (Fig. 3) as well as a physiologically formed
uterine tube lined with a ciliated columnar epithelium
were attached to each gonad. The endometrium appeared
inactive resembling the stage seen in juvenile bitches. Myo-
and perimetrium revealed no pathological findings.
For chromosomal analysis, whole blood cultures of
dog 1 (1 ml blood/10 ml culture) were set up in RPMI
1640 medium (PAA Laboratories, Pasching, Austria) sup-
plemented with pokeweed mitogen (0.8 ␮g/ml f.c.),
Penicillin/Streptomycin (100 U/ml f.c./0.1 mg/ml f.c.), and
fetal calf serum (15%). Metaphases were arrested using
colcemid (0.1 ␮g/ml f.c.) for two hours and spreads were
prepared according to Barch (1991) after 72 h culture time
at 37 ◦ C (all additives from Biochrom, Berlin, Germany).
Giemsa (5% in Sörensen buffer pH 6.8) stained metaphases
were microphotographed at 1000× microscopic magnifica-
tion. Among 35 metaphases scored, 33 displayed a diploid
chromosome number of 2n = 78. Two metaphases harbour-
ing 75 and 77 chromosomes were classified as artefacts
due to experimental impacts. All metaphases screened pre-
sented an XX gonosomal constellation.
For detection of the sex-determining region of the Y
chromosome (SRY-gene), genomic DNA was extracted from
peripheral blood lymphocytes of dog 1 using the nexttecTM
Genomic DNA Isolation Kit (Bio&Sell e.K., Nuremberg, Ger-
many). SRY-specific PCR was performed using primers
published by Meyers-Wallen et al. (1995). As an ampli-
fication control, a microsatellite (cph 17) (Fredholm and
Winterø, 1995) was simultaneously amplified using a
multiplex master mix (Qiagen® , Hilden, Germany). Total
volume was 25 ␮l. Cycling conditions were 95 ◦ C, 15 min
(1×); 94 ◦ C, 1 min, 55 ◦ C, 1.5 min, 72 ◦ C, 1 min (35×); 72 ◦ C,
5 min (1×). Amplicons were separated in an ethidium
bromide containing agarose gel (2%) in TBE buffer at
4 V/cm. PCR analysis detected no SRY-specific product
 T. Poth et al. / Animal Reproduction Science 121 (2010) 197–207
Fig. 1. Dog 2, DSD, ovotestis, histopathology: parenchyma is distinctly
subdivided in a small peripheral zone of ovarian tissue (1) and a larger
medullar zone of testicular tissue (2); both zones are separated by a small
band of connective tissue (3); bar = 1 mm; haematoxylin & eosin (H&E).
Fig. 2. Dog 1, 78,XX ovotesticular DSD, ovotestis, histopathology:
the ovarian part contains cellular stroma, numerous atretic folli-
cles (1 = primary, 2 = polyovular follicle) and granulosa cell cords (3);
bar = 200 ␮m; H&E.
Fig. 3. Dog 1, 78,XX ovotesticular DSD, ovotestis, histopathology: the testicular part is composed of hypoplastic non-spermatogenic seminiferous tubules,
which are lined with vacuolated sustentacular cells (1) and interstitial cells (2) that are scattered throughout the stroma (left); bar = 100 ␮m; attached
hypoplastic epididymal tissue without spermatozoa (right); bar = 200 ␮m; H&E.
205
within the limit of detection (detection limit was about
one male genome in 10,000 female equivalents, data not
shown).
The clinical and pathomorphological findings includ-
ing bilateral ovotestes, ambiguous external genitalia, and a
markedly enlarged clitoris with bone formation are similar
in both dogs and initially consistent with those described
for true hermaphrodites in literature (Meyers-Wallen
and Patterson, 1986, 1989; Feldman and Nelson, 2004;
Schlafer and Miller, 2007). The clinical history of both cases
matches the literature reports describing clitoromegaly
with bone formation as the most obvious indication for
a disordered sex development in a bitch (Meyers-Wallen
and Patterson, 1986; Meyers-Wallen et al., 1995, 1999;
Simpson et al., 1998). Masculinisation of external geni-
talia in dogs usually occur at about 4 months of age as the
testicular parts of the gonads become endocrinologically
functional, and the degree is likely related to the amount of
testosterone during target organ sensitivity. The extent of
androgen-dependent masculinisation in both bitches can
be explained by the large amount of testicular tissue within
the gonads as described for previous cases (Meyers-Wallen
and Patterson, 1989; Simpson et al., 1998; Feldman and
Nelson, 2004). The findings in the presented dogs agree
with reports describing the presence of bilateral ovotestes
as the most frequent combination (Hare, 1976; Chaffaux et
al., 1980; Selden et al., 1984; Meyers-Wallen and Patterson,
1986, 1989; Feldman and Nelson, 2004) and the centrally
positioned testicular tissue as the most common location
within gonads in true hermaphrodites (Meyers-Wallen and
Patterson, 1989). Furthermore, the presence of an uninflu-
enced developed paramesonephric duct system regardless
of coexisting testicular tissue within the gonads is a known
phenomenon in dogs (Selden et al., 1984; Meyers-Wallen
et al., 1987). The coexistence of epididymic tissue in both
dogs results from stimulation of the mesonephric duct sys-
206 T. Poth et al. / Animal Reproduction Science 121 (2010) 197–207
tem, and was previously reported for true hermaphrodites
(Hare, 1976; Bosu et al., 1978; Allen et al., 1981; Selden
et al., 1984; Meyers-Wallen et al., 1987; Randolph et al.,
1987; De Rooster et al., 2006). The owner’s anamnesis of
absent oestrus cycles in both bitches is attributed to the
prepubertary stage of the ovarian tissue.
Genetic analysis performed in dog 1 demonstrated a
normal female chromosome constitution of 78,XX and
the absence of SRY. Regarding the classification scheme
described earlier and summarised in Table 1, dog 1 was
therefore classified as XXSR animal representing a disorder
at the stage of gonadal sex development. Adopting the new
nomenclature for intersex individuals (Table 1), the defi-
nite diagnosis of 78,XX ovotesticular DSD was established
for dog 1.
Unfortunately, classification and establishment of an
exact diagnosis failed in dog 2 because the owner objected
to further analysis. Including the present study, the devel-
opment of ovotestes was reported for at least 26 dog breeds
(Tables 1 and 2). Most of these cases were categorised as
XX sex-reversed animals and could be redefined as indi-
viduals with 78,XX ovotesticular DSD (Table 1). Although
XXSR is considered as being most likely for dog 2, the
less frequently occurring chimaerism/mosaicism as well as
the rare XYSR can only be excluded by cytogenetic analy-
sis.
In both presented cases, no information was available
about the occurrence of sexual abnormalities in parents or
siblings and exogenous influences like androgen adminis-
tration to canine foetuses as described by De Rooster et al.
(2006). Further studies in pedigrees of the German Pinscher
and Berger Picard breed are necessary to disclose a hered-
itary genetic defect as proven or assumed for other dog
breeds (Stewart et al., 1972; Williamson, 1979; Selden et al.,
1984; Randolph et al., 1987; Meyers-Wallen and Patterson,
1989; Meyers-Wallen et al., 1995, 1999; Melniczek et al.,
1999; Switonski et al., 2004), and to contribute to a bet-
ter understanding of the mode of inheritance of intersex
conditions in the dog.
Acknowledgement
The authors thank Mrs. Irene Zimmer, DVM, for her pro-
fessional language assistance.
References
Alam, M.R., Cho, Y.G., Cho, S.J., Lee, J.I., Lee, H.B., Tae, H.J., Kim, I.S., Kim,
N.S., 2007. Male pseudohermaphroditism in dogs: three case reports.
Vet. Med. (Praha) 52, 74–78.
Allen, W.E., Daker, M.G., Hancock, J.L., 1981. Three intersexual dogs. Vet.
Rec. 109, 468–471.
Axelson, R.D., 1978. Pseudohermaphroditism in a dog. J. Am. Vet. Med.
Assoc. 172, 584–585.
Barch, M.J., 1991. The ACT Cytogenetics Laboratory Manual 2. Raven Press,
New York.
Bosu, W.T.K., Chick, B.F., Basrur, P.K., 1978. Clinical, pathologic and cyto-
genetic observations on two intersex dogs. Cornell Vet. 68, 375–390.
Buijtels, J.J.C.W.M., de Gier, J., van Haeften, T., Kooistra, H.S., Spee, B.,
Veldhuis Kroeze, E.J.B., Zijlstra, C., Okkens, A.C., 2009. Minimal exter-
nal masculinization in a SRY-negative XX male Podenco dog. Reprod.
Dom. Anim. 44, 751–756.
Chaffaux, S., Mailhac, J.M., Cribiu, E.P., Popescu, C.P., Cotard, J.P., 1980.
L’intersexualité chez le chien (canis familiaris). A propos de quatre
cas. Rec. Méd. Vét. 156, 179–192.
Chaffaux, S., Cribiu, E.P., Crespeau, F., 1986. Un cas rare d’hermaphrodisme
vrai latéral chez une chienne 78,XY. Rec. Méd. Vét. 162, 463–
470.
Chaffaux, S., Nudelmann, N., Durand, V., Cribiu, E.P., 1990. Le pseudo-
hermaphrodisme mâle, a propos du cas d’un chien intersexué 78,XX.
Rec. Méd. Vét. 166, 125–132.
Clough, E., Pyle, R.L., Hare, W.C.D., Kelly, D.F., Patterson, D.F., 1970. An XXY
sex-chromosome constitution in a dog with testicular hypoplasia and
congenital heart disease. Cytogenetics 9, 71–77.
Cotinot, C., Pailhoux, E., Jaubert, F., Fellous, M., 2002. Molecular genetics
of sex determination. Sem. Reprod. Med. 20, 157–168.
Dain, A.R., Walker, R.G., 1979. Two intersex dogs with mosaicism. J.
Reprod. Fert. 56, 239–242.
De Lorenzi, L., Gropetti, D., Arrighi, S., Pujar, S., Nicoloso, L., Molteni, L.,
Pecile, A., Cremonesi, F., Parma, P., Meyers-Wallen, V., 2008. Muta-
tions in the RSPO1 coding region are not the main cause of canine
SRY-negative XX sex reversal in several breeds. Sex. Dev. 2, 84–
95.
De Rooster, H., Vercauteren, G., Görtz, K., Saunders, J., Polis, I., Rijsselaere,
T., 2006. True hermaphroditism in six female littermates after admin-
istration of synthetic androgens to a pregnant bitch. Reprod. Dom.
Anim. 41, 22–26.
Feldman, E.C., Nelson, R.W., 2004. Infertility, associated breeding disor-
ders, and disorders of sexual development. In: Feldman, E.C., Nelson,
R.W. (Eds.), Canine and Feline Endocrinology and Reproduction, third
ed. Saunders, pp. 893–898.
Fischer, K., 1983. Pseudohermaphroditism in a dog. Vet. Med. Small. Anim.
Clin. 78, 683–685.
Fitzgerald, A.L., Murphy, D.A., 1990. Bilateral ovotestes in an intersex,
mixed-breed dog. Lab. Anim. Sci. 40, 647–650.
Fredholm, M., Winterø, A.K., 1995. Variation of short tandem repeats
within and between species belonging to the Canidae family. Mamm.
Genome 6, 11–18.
Genero, E.R., Moreno-Millán, M., Ocaña-Quero, J.M., 1998. XX/XY chromo-
some chimaerism in an intersex dog. Vet. Rec. 142, 340.
Goldschmidt, B., El-Jaick, K.B., Souza, L.M., Carvalho, E.C.Q., Moura,
V.L.S., Benevides Filho, I.M., 2001. Cryptorchidism associated with
78,XY/79,XXY mosaicism in dog. Israel J. Vet. Med. 56, 56–58.
Hare, W.C.D., 1976. Intersexuality in the dog. Can. Vet. J. 17, 7–15.
Hayes, H.M., Wilson, G.P., 1986. Hospital incidence of hypospadias in dogs
in North America. Vet. Rec. 118, 605–607.
Hinsch, G.W., 1979. Intersexes in the dog. Teratology 20, 463–468.
Holt, P.E., Long, S.E., Gibbs, C., 1983. Disorders of urination associated with
canine intersexuality. J. Small. Anim. Pract. 24, 475–487.
Hughes, I.A., 2008. Disorders of sex development: a new definition
and classification. Pract. Res. Clin. Endocrinol. Metab. 22, 119–
134.
Johnston, S.D., 1989. Premature gonadal failure in female dogs and cats. J.
Reprod. Fertil. Suppl. 39, 65–72.
Jurka, P., Galanty, M., Zielinska, P., Max, A., Sysa, P., 2009. Hypospadias in
six dogs. Vet. Rec. 164, 331–333.
Kelly, D.F., Long, S.E., Strohmenger, G.D., 1976. Testicular neoplasia in an
intersex dog. J. Small. Anim. Pract. 17, 247–253.
Kothapalli, K., Kirkness, E., Pujar, S., Van Wormer, R., Meyers-Wallen, V.N.,
2005. Exclusion of candidate genes for canine SRY-negative XX sex
reversal. J. Hered. 96, 759–763.
Kuiper, H., Distl, O., 2004. Intersexuality in dogs: causes and genetics.
Dtsch. Tierärztl. Wschr. 111, 251–258.
Löfstedt, R.M., Buoen, L.C., Weber, A.F., Johnston, S.D., Huntington,
A., Concannon, P.W., 1992. Prolonged proestrus in a bitch with
X chromosomal monosomy (77,X0). J. Am. Vet. Med. Assoc. 200,
1104–1106.
Marshall, L.S., Oehlert, M.L., Haskins, M.E., Selden, J.R., Patterson, D.F., 1982.
Persistent Müllerian duct syndrome in miniature schnauzers. J. Am.
Vet. Med. Assoc. 181, 798–801.
Mayenco-Aguirre, A.M., Padilla, J.A., Flores, J.M., Daza, M.A., 1999. Canine
gonadal dysgenesis syndrome: a case of mosaicism (77,X0-78,XX).
Vet. Rec. 145, 582–584.
McElreavey, K., Rappaport, R., Vilain, E., Abbas, N., Richaud, F., Lortat-Jacob,
S., Berger, R., Le Coniat, M., Boucekkine, C., Kucheria, K., Temtamy, S.,
Nihoul-Fekete, C., Brauner, R., Fellous, M., 1992. A minority of 46,XX
true hermaphrodites are positive for the Y-DNA sequence including
SRY. Hum. Genet. 90, 212–215.
Medleau, L., Johnson, C.A., Perry, R.L., Dulisch, M.L., 1983. Female pseu-
dohermaphroditism associated with mibolerone administration in a
dog. J. Am. Anim. Hosp. Assoc. 19, 213–215.
Melniczek, J.R., Dambach, D., Prociuk, U., Jezyk, P.F., Henthorn, P.S., Patter-
son, D.F., Giger, U., 1999. Sry-negative XX sex reversal in a family of
Norwegian Elkhounds. J. Vet. Intern. Med. 13, 564–569.
 T. Poth et al. / Animal Reproduction Science 121 (2010) 197–207
Meyers-Wallen, V.N., Patterson, D.F., 1986. Disorders of sexual devel-
opment in the dog. In: Morrow, D.A. (Ed.), Current Therapy in
Theriogenology: Diagnosis, Treatment and Prevention of Reproduc-
tive Diseases in Animals, second ed. WB Saunders, pp. 567–574.
Meyers-Wallen, V.N., Donahoe, P.K., Manganaro, T., Patterson, D.F., 1987.
Müllerian inhibiting substance in sex-reversed dogs. Biol. Reprod. 37,
1015–1022.
Meyers-Wallen, V.N., Patterson, D.F., 1989. Sexual differentiation and
inherited disorders of sexual development in the dog. J. Reprod. Fertil.
Suppl. 39, 57–64.
Meyers-Wallen, V.N., Bowman, L., Acland, G.M., Palmer, V.L., Schlafer, D.,
Fajt, V., 1995. Sry-negative XX sex reversal in the German Shorthaired
Pointer dog. J. Hered. 86, 369–373.
Meyers-Wallen, V.N., Schlafer, D., Barr, I., Lovell-Badge, R., Keyzner, A.,
1999. Sry-negative XX sex reversal in purebred dogs. Mol. Reprod.
Dev. 53, 266–273.
Meyers-Wallen, V.N., 2001. Inherited abnormalities of sexual develop-
ment in dogs and cats. In: Concannon, P.W., England, G., Verstegen, J.
(Eds.), Recent Advances in Small Animal Reproduction. International
Veterinary Information Service, Ithaca, New York.
Nickel, R.F., Ubbink, G., Van der Gaag, I., Van Sluijs, F.J., 1992. Persistent
Müllerian duct syndrome in the Basset Hound. Tijdschr. Diergeneeskd
117 (Suppl. 1), 31S.
Nie, G.J., Johnston, S.D., Hayden, D.W., Buoen, L.C., Stephens, M., 1998.
Theriogenology question of the month. Azoospermia associated with
79,XXY chromosome complement (canine Klinefelter’s syndrome). J.
Am. Vet. Med. Assoc. 212, 1545–1547.
Nowacka, J., Nizanski, W., Klimowicz, M., Dzimira, S., Switonski, M., 2005.
Lack of the SOX9 gene polymorphism in sex reversal dogs (78,XX; SRY
negative). J. Hered. 96, 797–802.
Nowacka-Woszuk, J., Nizanski, W., Klimowicz, M., Switonski, M., 2007.
Normal male chromosome complement and a lack of the SRY and
SOX9 gene mutations in a male pseudohermaphrodite dog. Anim.
Reprod. Sci. 98, 371–376.
Nowacka-Woszuk, J., Switonski, M., 2009. Variability of CAG tan-
dem repeats in exon 1 of the androgen receptor gene is not
related with dog intersexuality. Anim. Reprod. Sci., doi:10.1016/j.
anireprosci.2009.05.001.
Olson, P.N., Seim, H.B., Park, R.D., Grandy, J.L., Freshman, J.L., Carlson, E.D.,
1989. Female pseudohermaphroditism in three sibling Greyhounds. J.
Am. Vet. Med. Assoc. 194, 1747–1749.
Pailhoux, E., Vigier, B., Chaffaux, S., Servel, N., Taourit, S., Furet, J.-P., Fellous,
M., Grosclaude, F., Cribiu, E.P., Cotinot, C., Vaiman, D., 2001. A 11.7-kb
deletion triggers intersexuality and polledness in goats. Nat. Genet.
29, 453–458.
Peter, A.T., Markwelder, D., Asem, E.K., 1993. Phenotypic feminization
in a genetic male dog caused by nonfunctional androgen receptors.
Theriogenology 40, 1093–1105.
Pujar, S., Kothapalli, K.S., Kirkness, E., Van Wormer, R.H., Meyers-Wallen,
V.N., 2005. Exclusion of Lhx9 as a candidate gene for SRY-negative
XX sex reversal in the American Cocker Spaniel model. J. Hered. 96,
452–454.
Pujar, S., Kothapalli, K.S.D., Göring, H.H.H., Meyers-Wallen, V.N., 2007.
Linkage to CFA29 detected in a genome-wide linkage screen of canine
pedigree segregating SRY-negative XX sex reversal. J. Hered. 98,
438–444.
Pullen, C.M., 1970. True bilateral hermaphroditism in a Beagle: a case
report. Am. J. Vet. Res. 31, 1113–1117.
Randolph, J.F., Center, S.A., McEntee, M., Goldberg, E.H., 1987. H-Y antigen-
positive XX true bilateral hermaphroditism in a German Shorthaired
Pointer. J. Am. Anim. Hosp. Assoc. 24, 417–420.
Redden, B., 2007. Clinical snapshot. A vulvar mass in a dog. True
hermaphrodite. Compend. Contin. Educ. Vet. 29, 240, 245.
Reimann-Berg, N., Murua Escobar, H., Nolte, I., Bullerdiek, J., 2008. Testic-
ular tumor in an XXY dog. Cancer Genet. Cytogenet. 183, 114–116.
Röcken, H., 1988. Über Hermaphroditismus beim Hund. Berl. Münch.
Tierärztl. Wschr. 101, 55–57.
Sarafoglou, K., Ostrer, H., 2000. Familial sex reversal: a review. J. Clin.
Endocrinol. Metab. 85, 483–493.
Schelling, C., Pienkowska, A., Arnold, S., Hauser, B., Switonski, M., 2001.
A male to female sex-reversed dog with a reciprocal translocation. J.
Reprod. Fertil. Suppl. 57, 435–438.
207
Schlafer, D.H., Miller, R.B., 2007. Pathology of the genital system of the non-
gravid female. In: Grant Maxie, M. (Ed.), Jubb, Kennedy, and Palmer’s
Pathology of Domestic Animals, vol. 3, fifth ed. Elsevier Saunders, pp.
431–444.
Schneck, G.W., 1975. Letter: hermaphroditism in a Shetland sheepdog.
Vet. Rec. 96, 323.
Selden, J.R., Wachtel, S.S., Koo, G.C., Haskins, M.E., Patterson, D.F., 1978.
Genetic basis of XX male syndrome and XX true hermaphroditism:
evidence in the dog. Science 201, 644–646.
Selden, J.R., Moorhead, P.S., Koo, G.C., Wachtel, S.S., Haskins, M.E., Patter-
son, D.F., 1984. Inherited XX sex reversal in the cocker spaniel dog.
Hum. Genet. 67, 62–69.
Simpson, G., England, G., Harvey, M., 1998. BSAVA Manual of Small Animal
Reproduction and Neonatology. Iowa State University Press, Ames.
Smith Jr., F.W.K., Buoen, L.C., Weber, A.F., Johnston, S.D., Randolph, J.F.,
Waters, D.J., 1989. X-chromosomal monosomy (77,X0) in a Doberman
Pinscher with gonadal dysgenesis. J. Vet. Intern. Med. 3, 90–95.
Sonne, C., Dietz, R., Born, E.W., Leifsson, P.S., Andersen, S., 2008. Is there
a link between hypospadias and organochlorine exposure in East
Greenland sledge dogs (Canis familiaris)? Ecotoxicol. Environ. Saf. 69,
391–395.
Stewart, R.W., Menges, R.W., Selby, L.A., Rhoades, J.D., Crenshaw, D.B.,
1972. Canine intersexuality in a Pug breeding kennel. Cornell Vet. 62,
464–473.
Stünzi, B., Stünzi, H., 1950. Hermaphroditus verus unilateralis beim Hund
mit blastomatöser Entartung des rudimentären Ovars. Schweiz. Arch.
Tierheilkd. 92, 67–82.
Svendsen, C.K., Thomsen, P.D., Basse, A., 1985. Two cases of male pseu-
dohermaphroditism in the dog. Clinical, macroscopic, karyotypic, and
therapeutic features. Nord. Vet. Med. 37, 358–363.
Switonski, M., Godynicki, S., Jackowiak, H., Pienkowska, A., Turczuk-Bierla,
I., Szymas, J., Golinski, P., Bereszynski, A., 2000. X trisomy in an infer-
tile bitch: cytogenetic, anatomic, and histologic studies. J. Hered. 91,
149–150.
Switonski, M., Szczerbal, I., Grewling, J., Antosik, P., Nizanski, W., Yang,
F., 2003. Two cases of infertile bitches with 78,XX/77,X mosaic kary-
otype: a need for cytogenetic evaluation of dogs with reproductive
disorders. J. Hered. 94, 65–68.
Switonski, M., Nowacka, J., Skorczyk, A., Chmurzynska, A., Nizanski, W.,
2004. Hereditary sex-reversal syndrome (78,XX; SRY-negative) in
German Shepherd puppies. Medycyna weterynaryjna 60, 705–707.
Tammer, I., Herzog, A., Bostedt, H., 1998. Disorders of sexual development
in the dog: two case reports. Tierärztl. Prax. 26 (K), 390–395.
Tangner, C.H., Breider, M.A., Amoss, M.S., 1982. Lateral hermaphroditism
in a dog. J. Am. Vet. Med. Assoc. 181, 70–71.
Thomas, T.N., Olson, P.N., Hoopes, P.J., 1986. Lateral hermaphroditism and
seminoma in a dog. J. Am. Vet. Med. Assoc. 189, 1596–1597.
Van Schouwenburg, S.J., Louw, G.J., 1982. A case of dysuria as a result of
a communication between the urinary bladder and corpus uteri in a
Cairn Terrier. J. S. Afr. Vet. Assoc. 53, 65–66.
Volpe, P., Izzo, B., Pia Di Meo, G., Perucatti, A., Iannuzzi, L., 2000. Male pseu-
dohermaphroditism in a dog: a clinical case. Vet. Rec. 146, 532–533.
Weaver, A.D., Harvey, M.J., Munro, C.D., Rogerson, P., McDonald, M.,
1979. Phenotypic intersex (female pseudohermaphroditism) in a
Dachshund dog. Vet. Rec. 105, 230–232.
Wernham, B.G.J., Jerram, R.M., 2006. Male pseudohermaphroditism in a
Labrador Retriever, and a review of mammalian sexual differentiation.
N. Z. Vet. J. 54, 248–252.
Whyte, A., Monteagudo, L.V., Díaz-Otero, A., Lebrero, M.E., Tejedor, M.T.,
Falceto, M.V., Whyte, J., Gallego, M., 2009. Malformations of the
epididymis, incomplete regression of the mesonephric tubles and
hyperplasia of Leydig cells in canine persistence of Müllerian duct
syndrome. Anim. Reprod. Sci. 115, 328–333.
Williams, J., Partington, B.P., Smith, B., Hedlund, C.S., Law, J.M., 1997.
Pyovagina and stump pyometra in neutered XX sex-reversed beagle:
a case report. J. Anim. Hosp. Assoc. 33, 83–90.
Williamson, J.H., 1979. Intersexuality in a family of Kerry Blue Terriers. J.
Hered. 70, 138–139.
Wu, X., Wan, S., Pujar, S., Haskins, M.E., Schlafer, D.H., Lee, M.M., Meyers-
Wallen, V.N., 2009. A single base pair mutation encoding a premature
stop codon in the MIS type II receptor is responsible for canine Persis-
tent Müllerian Duct Syndrome. J. Androl. 30, 46–56.
 Animal Reproduction Science 121 (2010) 208–217

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Nutrient intake in the bovine during early and mid-gestation causes

sex-specific changes in progeny plasma IGF-I, liveweight, height and
carcass traits
G.C. Micke a , T.M. Sullivan a , K.L. Gatford b , J.A. Owens b , V.E.A. Perry a,∗
a
School of Veterinary Science, The University of Queensland, St. Lucia, QLD 4072, Australia
b
Research Centre for Early Origins of Adult Health and Disease, Robinson Institute and School of Paediatrics and Reproductive Health, University of Adelaide,
SA 5005, Australia

a r t i c l e i n f o a b s t r a c t

Article history: Fetal and postnatal growth are mediated by insulin-like growth factors (IGFs) and their
Received 15 February 2010 binding proteins (IGFBPs). Maternal nutrient intake during gestation can program the post-
Received in revised form 5 May 2010
natal IGF-axis. This may have significant economic implications for beef cattle production.
Accepted 25 May 2010
We investigated the effect of high (H = 240%) and low (L = 70%) levels of recommended daily
Available online 31 May 2010
crude protein (CP) intake for heifers during the first and second trimesters of gestation in a
two-by-two factorial design on progeny (n = 68) plasma IGF-I, IGF-II, total IGFBP (tIGFBP),
Keywords:
postnatal growth and carcass traits. Calves were heavier at birth following high CP diets
Cattle
Fetal programming during the second trimester (P = 0.03) and this persisted to 29 d. Plasma IGF-I concentrations
IGF of males were greater for HL compared to LL (P < 0.01) and HH (P > 0.04) from 29 to 657 d,
Maternal nutrition and for LH compared to LL from 29 until 379 d (P = 0.02). Exposure to low CP diets during
Metabolites the first trimester resulted in heavier males from 191 d onwards (P = 0.04) but a tendency
Postnatal growth for lighter females from 552 d onwards (P = 0.07) that had lighter carcass weights (P = 0.04).
Longissimus dorsi cross-sectional area of all carcasses was greater following exposure to
low CP diets during the second trimester (P = 0.04). Heifer nutrient intake during the first
and second trimesters causes persistent and sex-specific programming of progeny plasma
IGF-I, postnatal liveweight and carcass weight. Refining heifer nutritional programs during
early gestation may optimize production objectives in progeny.
© 2010 Elsevier B.V. All rights reserved.

1. Introduction like growth factors (IGFs) are associated with traits of

Breeder cattle managed under extensive grazing condi-
tions, and consequently their developing fetus, experience
a large variation in nutrient availability throughout the
year. Maternal nutrient intake during gestation affects
progeny postnatal growth and carcass characteristics in
cattle as in other species (Greenwood et al., 2006; Larson et
al., 2009; Martin et al., 2007; Stalker et al., 2006). Insulin-
∗ Corresponding author. Tel.: +61 7 4671 2417; fax: +61 7 4671 2781.
E-mail addresses: ginamicke@hotmail.com (G.C. Micke),
v.perry@uq.edu.au (V.E.A. Perry).
economic importance to cattle production due to their role
in cell growth, proliferation and metabolism (Hyatt et al.,
2004). Specifically, calf plasma IGF-I concentration at birth
is positively associated with calf birth weight (Breier et al.,
1988) as is average postnatal serum IGF concentration with
average daily gain and linear growth (Lund-Larsen et al.,
1977). However, there is a negative association between
average circulating IGF-I concentrations and improved feed
efficiency (Moore et al., 2005). Six IGF-binding proteins reg-
ulate IGF clearance from circulation, IGF access to receptors
(Gallaher et al., 1992) and some also act independently on
cells (Firth and Baxter, 2002). Fetal nutrient supply regu-
lates the fetal IGF axis (Brameld et al., 2000; Oliver et al.,

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.05.017
 G.C. Micke et al. / Animal Reproduction Science 121 (2010) 208–217
1993; Osborn et al., 1992), and can program the IGF axis
after birth in rodents (Olausson et al., 2006) and humans
(Verkauskiene et al., 2005), but few studies have investi-
gated the latter in cattle. Changes in the IGF axis may have
long-term consequences for postnatal growth and perfor-
mance. In sheep, maternal nutrient restriction during early
gestation reduces hepatic expression of type 2 IGF recep-
tor in offspring at 3-years of age (Hyatt et al., 2007b) whilst
restriction during late gestation increases hepatic expres-
sion of IGF-I, but reduces hepatic expression of types 1 and
2 IGF receptor in offspring at 1-month of age (Hyatt et al.,
2007a). Despite changes to hepatic IGF gene expression,
plasma IGF-I concentration was not altered (Hyatt et al.,
2007b). The aims of this study, therefore, were to deter-
mine the effect of varying heifer nutrient intake during the
first and second trimesters of gestation, on plasma IGF-I, -II,
total IGF binding proteins (tIGFBP), growth of progeny from
birth until 657 days (d) and their carcass characteristics at
680 d.
2. Materials and methods
All procedures were performed with the prior approval
of The University of Queensland Animal Ethics Committee,
approval number SVS/716/06/MLA/AACO.
2.1. Animals and treatments
The study was a two-by-two factorial design. The
study animals are the progeny of two-year-old heifers
that have been previously described (Micke et al., 2010).
Heifers (n = 118) were divided into four treatment groups
on the first day of artificial insemination (AI) accord-
ing to stratification by weight within each composite
genotype and individually stall fed until parturition. The
four treatment groups determined the level of crude
protein (CP) fed to each heifer during the first (T1) and
second (T2) trimesters of gestation (HH: T1 = 76.3 MJ ME/d
and 1.4 kg CP/d; T2 = 82.4 MJ ME and 1.4 kg CP/d, HL:
T1 = 76.3 MJ ME/d and 1.4 kg CP/d; T2 = 63.1 MJ ME/d
and 0.4 kg CP/d, LH: T1 = 62.5 MJ ME/d and 0.4 kg CP/d;
T2 = 82.4 MJ ME/d and 1.4 kg CP/d, LL: T1 = 62.5 MJ ME/d
and 0.4 kg CP/d; T2 = 63.1 MJ ME/d and 0.4 kg CP/d). All
heifers were fed 71.45 MJ ME and 1.06 kg CP/d in the third
trimester (T3). Trimester one was defined as 0 to 93 d after
AI, T2 from 94 to 180 d and T3 from 181 d to parturition.
Transition feeding periods from 92 to 97 d and 179 to
184 d enabled heifers to adjust to the ration changes in a
stepwise manner. All heifers consumed their daily feed
allocation each day whilst under supervision. Detailed
composition of the heifer rations is given in Table 1 and the
rationale underlying ration formulation and their feeding
management has been described previously (Micke et al.,
2010).
Pregnancy was positively diagnosed in 77 heifers
(HH = 19; HL = 20; LH = 19; LL = 19) at 39 d via transrec-
tal palpation with the aid of a 5 MHz linear rectal
probe attached to a real time ultrasound scanner (model
Aloka-500® , Aloka Inc., Tokyo, Japan). During the study,
six spontaneous abortions (HH = 3; HL = 1; LH = 2; LL = 0)
(Sullivan et al., 2009a) occurred resulting in a total
209
of 71 heifers (HH = 16; HL = 19; LH = 17; LL = 19) that
completed the study and gave birth (mean gestation
length = 286 ± 0.5 d; range = 278–298 d) (Sullivan et al.,
2009b). Three progeny were removed from the study after
birth: one due to mis-mothering; one pre-weaning from
sudden death of unknown causes; and one post-weaning
from death due to misadventure, leaving 68 progeny dis-
tributed across four treatment groups (HH = 15; HL = 18;
LH = 16; LL = 19). Hereafter, all ages refer to the average age
of progeny on the day of sampling.
Postnatally, progeny remained with their mothers on
improved and native pastures until weaning at 191 d in
accordance with standard beef herd management practice
(Meat and Livestock Australia, 2004). They were supple-
mented daily with whole cotton seed (Gossypium spp.)
allocated at 1 kg/animal whilst grazing native pastures
until 401 d. From 401 d, they were managed as part of
a larger group of yearling cattle at Surat, Queensland
(27◦ 16 S, 149◦ 07 E) due to unforeseen drought conditions
at their property of origin. Each animal was allocated
20 kg/d as fed of a silage-based ration. The ration was 40.7%
dry matter and consisted of 85% corn silage (Zea mays),
12% whole cottonseed (Gossypium spp.) and 3% vitamin and
mineral mix. Progeny commenced an intensive feedlot fin-
ishing program on 541 d at Dalby, Queensland (27◦ 18 S,
151◦ 26 E), where they remained as one group in their own
feedlot pen and were fed commercial feedlot rations prior
to commercial slaughter at 680 d. Male and female progeny
remained together in the same management group at all
times throughout the study.
Males were castrated at 153 d in accordance with stan-
dard beef herd management practice (Newman, 2007). All
progeny were vaccinated against clostridial diseases and
leptospriosis (Ultravac 7 in 1: Pfizer Animal Health, West
Ryde, NSW) on 65 and 123 d with a third clostridial vaccine
given on 544 d (Ultravac 5 in 1: Pfizer Animal Health, West
Ryde, NSW). On 379 and 544 d all progeny were vaccinated
against Bovine herpesvirus 1 (Rhinogard Intranasal Vaccine
(Live): Q-Vax Pty Ltd., Brookfield, QLD) and Mannheimia
haemolytica (Bovilis MH: Intervet Australia Pty Limited,
Bendigo East, Vic.).
2.2. Data and sample collection
Progeny were weighed at birth (Micke et al., 2010), 15 d,
29 d and then approximately monthly until 657 d. Height
was defined as the distance between the ground and the
cranial dorsal iliac spine and was measured on 15, 29, 65,
123, 191, 286, 379, 462, 552 and 657 d. Progeny blood sam-
ples were collected into tubes containing lithium-heparin
(Vacutainer: Becton Dickinson, Franklin Lakes, NJ) within
5 min of birth and then immediately after progeny were
brought in from grazing or their feedlot pen at 8:00 am on
29, 94, 191, 379 and 657 d. Samples were stored for 1–2 h
on ice prior to being centrifuged at room temperature at
3000 × g for 10 min. Plasma was harvested and then stored
at −20 ◦ C until analyses.
At slaughter, each animal was killed by captive bolt
stunning and exsanguination. Standard carcasses (AUS-
MEAT, 1998) were halved and each side weighed prior to
entering the chiller. Carcass weight (HCW) was calculated
210 G.C. Micke et al. / Animal Reproduction Science 121 (2010) 208–217

Table 1
Details of “high” and “low” treatment group daily rations fed to dams during each trimester of gestationa .

Item Trimester 1 (1 to 93 d) Trimester 2 (94 to 180 d) Trimester 3 (181 d to term)

High Low High Low All

Sorghum (kg) 0.65 1.56 1.00 1.20 1.13

Cottonseed meal (kg) 2.45 0.00 2.50 0.00 1.08
Bambatsi hay (kg) 7.88 2.73 5.79 0.00 0.86
Barley straw (kg) 0.00 5.14 2.21 7.58 7.14
Limestone (kg) 0.07 0.02 0.12 0.06 0.08
Premix (kg)b 0.07 0.06 0.10 0.10 0.10
DMI (kg) 9.95 8.64 10.51 8.10 9.39
DMI (g/kg) BWc 27.81 24.67 25.91 20.18 21.23
Energy (MJ) ME 76.29 62.54 82.43 63.14 71.45
Energy (%) NRCd 243 199 229 176 149
CP (kg) 1.37 0.41 1.40 0.38 1.06
CP (%) NRCd 250 75 228 63 135
a
Data are presented on as fed basis per heifer per day.
b
Premix containing 17 g calcium, 9 g phosphorous, 2.91 g magnesium, 5 g sulphur, 27,200 IU vitamin A, 60 mg vitamin E, 70 mg iron, 150 mg zinc, 100 mg
manganese, 55 mg copper, 0.5 mg selenium, 3.4 mg cobalt and 4.2 mg iodine per 100 g.
c
Average BW at start of trimester.
d
Comparison of ration to NRC (1996) recommended nutrient requirements for pregnant Brangus replacement heifers bred at 23 months with a mature
weight of 475 kg and a calf birth weight of 32 kg.

as the sum total of the weight of both halves. Assessments
of the carcasses were obtained after overnight chilling until
the loin temperature was less than 11 ◦ C. Carcass sides
were quartered between the 12th and 13th ribs and no
less than 20 min later, the cross-section area of longissimus
dorsi muscle (LDA), fat depth at the rump (P8) and rib sites,
and marbling score (AUS-MEAT, 1998) were assessed using
the Meat Standards Australia (MSA) grading system (MSA,
1999).
2.3. Metabolite analyses
Plasma urea and NEFA concentrations were measured
in singlicate by enzymatic colorimetric analysis on a
Hitachi autoanalyser, using commercially available kits
(UREA/BUN, Roche Diagnostic Systems, Mannheim, Ger-
many and NEFA-C, Wako Pure Chemical Industries, Osaka,
Japan, respectively). The inter-assay CV for a calf quality
control (QC) plasma sample containing 5.46 mmol/L urea
and 0.10 meq/L NEFA was 3 and 5%, respectively (n = 9 ana-
lytical runs).
2.4. IGF-I, IGF-II and tIGFBP analyses
of neutralized HPLC fraction 3, in an RIA specific for IGF-
I (Francis et al., 1989), using a rabbit polyclonal antibody
to human IGF-I (GroPep, Adelaide, Australia). Total IGFBP
concentrations were measured by analysis of neutralized
fraction 1 in the same assay. Because IGFBP bind to and
sequester 125 I-IGF-I in this assay, they can be measured
due to their effect of reducing the amount of 125 I-IGF-I
in the immunoprecipitated pellet, giving an apparent IGF
concentration that reflects the total amount and binding
affinity of IGFBP present in plasma. The inter-assay CV
for HPLC separation and RIA of IGF-I was 10.9% (n = 18
assays) and the intra-assay CV for extraction and assay
was 22.0% for a calf QC sample containing 31.4 ng/mL of
IGF-I.
Plasma IGF-II concentrations were measured by analysis
of HPLC fraction 3 in a RIA specific for IGF-II (Carr et al.,
1995), using a rabbit polyclonal antibody against human
IGF-II (GroPep). Inter-assay CV was 9.7% (n = 9) and intra-
assay covariance for extraction and assay 21.6% for a calf QC
sample containing 78.0 ng/mL of IGF-II. The antibodies used
for human IGF-I and -II have 100 and 85% cross-reactivity
with bovine IGF-I and–II, respectively (GroPep Novozymes,
product information).

Concentrations of plasma IGF-I, -II and tIGFBP were
measured by RIA after separation of IGF and tIGFBP by
size-exclusion HPLC under acidic conditions (Owens et al.,
1990). Plasma samples were injected onto an HPLC col-
umn, dedicated to bovine plasma samples. Four fractions
of eluate (fraction 1, containing IGFBP; fraction 2, inter-
peak; fraction 3, containing IGF; and fraction 4, post-peak)
were routinely collected for each acidified plasma sample,
using collection times determined for each column based
on elution times of 125 I-IGF-I and IGF immunoreactivity.
Recovery of 125 I-IGF-I was 90.1 ± 0.9% for 11 HPLC runs
of calf plasma. Samples were assayed in triplicate in each
assay, and all samples from the same animal were extracted
in a single HPLC run and run together in the same assay.
Plasma IGF-I concentrations were measured by analysis
2.5. Statistical analyses
The individual animal was considered the experimental
unit for analyses. Measures of liveweight (BW), height and
plasma IGF-I, IGF-II, tIGFBP, NEFA and urea, were analysed
using repeated measures multifactorial ANOVA to deter-
mine the effects of maternal nutritional treatment group
during T1 and T2, progeny sex, time and their interaction
terms whilst including gestation length as a covariate to
account for differences in length of exposure to the T3
diet. Multifactorial ANOVA including maternal nutritional
treatment group during T1 and T2 and progeny sex were
used to analyse carcass measures, with gestation length
included as a covariate to account for differences in length
of exposure to the T3 diet. Oneway ANOVA with Bonferroni
 G.C. Micke et al. / Animal Reproduction Science 121 (2010) 208–217 211

adjustment was used to explore significant interactions

between nutritional treatment group during T1 and T2.
Pairwise correlation analyses using Bonferroni adjustment
were used to explore the relationships between plasma
IGF-I, IGF-II, tIGFBP and progeny BW, height and aver-
age daily gain (ADG) in the periods pre- and post- blood
sampling, and plasma IGF-I, -II and tIGFBP with carcass
parameters.
Student t-tests were used to determine whether the
requirement for veterinary treatment during the feedlot
period had a significant effect on any of the outcomes mea-
sured. Average daily gain of male animals that received
veterinary treatment whilst in the feedlot (n = 4) was
lower between 541 and 657 d than those that did not
(1.340 ± 0.054 kg/d vs. 0.830 ± 0.323 kg/d; P < 0.01). These
animals were excluded from analyses of BW during this
period and later carcass measures. There was no effect Fig. 1. Plasma IGF-I of male progeny from birth until 657 d by mater-
of the requirement for veterinary treatment on ADG of nal nutrition during the first and second trimesters of gestation. Values
are unadjusted mean ±SEM. a = LH > LL (P = 0.02); b = HL > LL (P < 0.01) and
female progeny during the feedlot period, or on measures
HL > HH (P = 0.04).
of metabolites, IGF-I, -II or tIGFBP in male or female progeny
at 657 d. Therefore, 64 progeny remained in the study from
3.2. Plasma IGF-II
541 d onwards.
Data are presented as mean ±SEM. A probability of
Maternal nutrition during T1 and T2 did not affect
5% (P < 0.05) was accepted as the level of significance and
plasma IGF-II from birth to 657 d (P > 0.1). Plasma IGF-II of
trends reported at P < 0.1. Data was analysed using Inter-
all animals was higher at birth compared to all other mea-
cooled Stata 9.0 software (StataCorp, College Station TX
surement times (P < 0.01), increased between 29 and 94 d
77845, Texas, USA).
(P < 0.01), remained stable to 379 d, and then decreased by
657 d (P = 0.01). The effect of sex on plasma IGF-II tended to
change with time (P = 0.08) and females had higher plasma
3. Results IGF-II than males from 191 to 657 d (P = 0.02; Fig. 2). There
was no effect of gestation length on plasma IGF-II (P > 0.1).
3.1. Plasma IGF-I
3.3. Plasma tIGFBP
Plasma IGF-I concentrations from birth to 657 d var-
ied in an interaction between maternal nutrition during Maternal nutrition during T1 and T2 did not affect
T1, maternal nutrition during T2, sex and time (four-way plasma tIGFBP from birth to 657 d (P > 0.1). Plasma tIGFBP
interaction, P = 0.04), and we therefore analysed each sex of all animals increased between birth and 29 d (P < 0.01)
separately. In males, the effect of maternal nutrition during before declining slowly to 379 d to levels greater than at
T1 and T2 tended to vary with time (three-way interaction, birth (P < 0.01), then increasing to 657 d (P < 0.01). The effect
P = 0.09). There was no effect of maternal nutrition during of sex on plasma tIGFBP changed with time (P < 0.01). Males
T1 or T2 on plasma IGF-I of males at birth (each P > 0.1). tended to have higher plasma tIGFBP at birth (P = 0.07) and
From 29 to 379 d, plasma IGF-I of males was altered by had higher plasma tIGFBP from 29 until 657 d (P < 0.01)
maternal nutrition in both trimesters (two-way interac- compared to females (Fig. 2). There was no effect of ges-
tion, P = 0.01) and plasma IGF-I concentrations were higher tation length on plasma tIGFBP (P > 0.1).
in LH compared to LL males (two-way interaction, P = 0.02;
Fig. 1). Similarly, effects of maternal nutrition during each 3.4. Plasma metabolites
trimester on plasma IGF-I concentrations of males from
29 to 657 d interacted (two-way interaction, P = 0.04) and Plasma urea from birth until 657 d did not vary with
HL males had higher plasma IGF-I than LL (P < 0.01) and maternal nutrition during T1 or T2 (each P > 0.1). Plasma
HH (P = 0.04) males. There was no effect of maternal nutri- urea was higher in females than males throughout the
tion during T1 or T2 on plasma IGF-I of females over time study (P < 0.01). There was no effect of gestation length on
(each P > 0.1). Plasma IGF-I of male and female progeny fol- plasma urea (P > 0.1).
lowed a similar pattern. It increased between birth and 29 d Plasma NEFA varied with an interaction between
(P < 0.01) before declining to 379 d to levels higher than at maternal nutrition during T2, sex and time (three-way
birth (P < 0.01) and then increased at 657 d to levels higher interaction P < 0.01), and we therefore analysed NEFAs sep-
than at 379 d (P < 0.01). The effect of sex on plasma IGF- arately within each sex. For males, the effect of maternal
I changed with time (P < 0.01) as males had higher plasma nutrition during T2 changed with time (two-way interac-
IGF-I than females at all ages (P < 0.01) except birth (P > 0.1). tion, P < 0.01). At birth but not thereafter, males exposed to
There was no effect of gestation length on plasma IGF-I of low levels of maternal nutrient intake during T2 (HL + LL;
males or females (P > 0.1). 0.60 ± 0.12 meq/L) had greater plasma NEFA than their
212 G.C. Micke et al. / Animal Reproduction Science 121 (2010) 208–217

Fig. 2. Plasma IGF-II and total IGFBP of male and female progeny from birth until 657 d. Values are unadjusted mean ±SEM.

high group counterparts (LH + HH; 0.258 ± 0.056 meq/L,
P = 0.01). For females, maternal nutrition during T2 did not
affect plasma NEFA (P > 0.1). Plasma NEFA was not affected
by progeny sex, maternal nutrition during T1 or gestation
length (all P > 0.1).
3.5. Progeny growth
Progeny BW and ADG by trimester treatment group
and sex are summarized in Table 2. At birth, progeny
whose mothers were fed high nutrition during T2 were 8.3%
heavier (HH + LH = 33.05 ± 0.81 kg) than their low coun-
terparts (HL + LL = 30.76 ± 0.59 kg; P = 0.03; Micke et al.,
2010). Males (33.37 ± 0.64 kg) were heavier than females
(30.43 ± 0.59 kg; P < 0.01) and longer gestation length
tended (P = 0.05) to be associated with heavier birth weight
calves (Micke et al., 2010). The effect of maternal nutrition
during T2 on progeny BW persisted until 29 d (P = 0.03).
When data from birth until 657 d were considered in
a single analysis, BW varied in an interaction between
maternal nutrition during T1, sex and time (three-way
interaction, P < 0.01), and BW was therefore analysed sep-
arately in each sex. In males, the effect of maternal
nutrition during T1 changed with time (two-way interac-
tion, P < 0.01). From 191 to 657 d, male progeny exposed
to low maternal nutrition during T1 (LH + LL) were heav-
ier than their high counterparts (HH + HL; P = 0.04, Fig. 3).
In females, the effect of maternal nutrition during T1
also changed with time (two-way interaction, P < 0.01).
From 552 to 657 d, female progeny exposed to high
maternal nutrition during T1 (HH + HL) tended to be heav-
ier than their low counterparts (LH + LL; P = 0.07, Fig. 3).
Males were heavier than females throughout the study
(P < 0.01) and there was no effect of gestation length on
BW (P > 0.1).
Progeny height varied in an interaction between
maternal nutrition during T1, sex and time (three-way
interaction, P < 0.01) and data were therefore analysed sep-
arately in each sex. In males, there was no effect of maternal
nutrition during T1 (P > 0.1), and in females, the effect of
maternal nutrition during T1 changed with time (two-way
interaction, P < 0.01). From 286 to 657 d, female progeny
exposed to high maternal nutrition during T1 (HH + HL)
tended to be taller than their low counterparts (LH + LL;
P = 0.08, Fig. 3). Males were taller than females throughout
the study (P < 0.01). There was no effect of gestation length
on height (P > 0.1).
3.6. Progeny carcass measures
Carcass weight varied in an interaction between mater-
nal nutrition during T1 and sex (two-way interaction,
P = 0.02). In males, there was no effect of maternal nutri-
tional treatment group during T1 on HCW (P > 0.1). Females
exposed to high (HH + HL: 334.53 ± 5.54 kg) compared to
low (LL + LH: 312.92 ± 6.82 kg) maternal nutrition during
T1 had heavier HCW (P = 0.04). Males had heavier HCW
(345.38 ± 5.77 kg) than females (323.41 ± 4.73 kg; P = 0.02).

Table 2
Growth of male and female progeny from birth to 657 d by postnatal nutritional period according to maternal nutritional treatment group during the first
two trimesters of gestation. Values are unadjusted means ±SEM.

1st trimester treatment group 2nd trimester treatment group

High Low High Low

Males Females Males Females Males Females Males Females

Pre-weaning n = 16 n = 17 n = 17 n = 18 n = 16 n = 15 n= 17 n = 20
ADG (kg/d) 0.96 ± 0.02 0.91 ± 0.01 0.99 ± 0.02 0.89 ± 0.01 0.96 ± 0.02 0.91 ± 0.01 0.98 ± 0.01 0.89 ± 0.01
BW at 191 d (kg) 213.0 ± 3.5 204.6 ± 2.6 220.8 ± 4.1 200.6 ± 2.6 217.0 ± 5.1 204.9 ± 3.1 217.1 ± 2.6 200.8 ± 2.8
Post-weaning 191 to 541 d n = 16 n = 17 n = 17 n = 18 n = 16 n = 15 n= 17 n = 20
ADG (kg/d) 0.63 ± 0.01 0.51 ± 0.07 0.66 ± 0.02 0.56 ± 0.01 0.65 ± 0.01 0.56 ± 0.01 0.64 ± 0.02 0.52 ± 0.06
BW at 541 d (kg) 408.6 ± 3.6* 383.1 ± 7.0 426.9 ± 6.6 370.4 ± 6.8 418.8 ± 4.1 374.1 ± 6.4 418.8 ± 6.4 378.4 ± 7.3
Post-weaning 541 to 657 d n = 14 n = 17 n = 15 n = 18 n = 15 n = 15 n = 14 n = 20
ADG 541 to 657 d (kg/d) 1.34 ± 0.06 1.58 ± 0.2 1.34 ± 0.09 1.25 ± 0.05 1.32 ± 0.09 1.32 ± 0.07 1.36 ± 0.07 1.48 ± 0.17
BW at 657 d (kg) 589.6 ± 9.7 569.8 ± 9.4 608.3 ± 14.8 540.9 ± 9.7 597.1 ± 15.4 555.8 ± 9.9 601.6 ± 9.2 554.3 ± 10.2
*
Denotes P < 0.05 for same sex comparison in the same trimester.
 G.C. Micke et al. / Animal Reproduction Science 121 (2010) 208–217
Fig. 3. Male and female progeny post-weaning liveweight and height by maternal nutrition during the first trimester of gestation. Values are unadjusted
mean ±SEM.
There was no effect of gestation length on HCW of males or
females (P > 0.1).
Carcass LDA of all progeny was greater for those
exposed to low (HL + LL: 79.46 ± 1.27 cm2 ) compared to
high (HH + LH: 76.19 ± 1.12 cm2 ) maternal nutrition during
T2 (P = 0.04). There was no effect of sex on LDA (P > 0.1).
There was no effect of maternal nutrition during T1 or T2
on LDA corrected for HCW. There was no effect of gestation
length on LDA.
Marbling score of all progeny varied with the inter-
action between maternal nutrition during T1 and T2
(two-way interaction, P = 0.04). Progeny in the LL group
(376.8 ± 18.2) tended to have a higher marbling score than
LH (328.8 ± 14.5; P = 0.07). There was no effect of maternal
nutritional treatment group during T1 or T2 on carcass fat
depth at the P8 or rib sites, or on P8 or rib site fat depth
relative to HCW (each P > 0.1). Females had greater mar-
bling score (P < 0.01), P8 fat depth (P < 0.01), P8 fat depth
relative to HCW (P = 0.01), rib fat depth relative to HCW
(P = 0.04) and tended to have greater rib fat depth (P = 0.06)
compared to males. There was no effect of gestation length
on marbling score, fat depth at P8 or rib site, or on fat depth
at P8 or rib site relative to HCW (P > 0.1).
3.7. Relationships between progeny plasma IGF and
tIGFBP and growth
Progeny plasma IGF-I and BW were positively correlated
at 94 d (r = 0.42; P < 0.01) and 379 d (r = 0.46; P < 0.01) but
not at birth (P > 0.1). Plasma IGF-I at 29 d was positively cor-
related with ADG from 29 to 65 d (r = 0.40; P < 0.01). At 94 d,
plasma IGF-I was positively correlated with ADG from 65
to 94 d (r = 0.43; P < 0.01) and 94 to 123 d (r = 0.38; P = 0.03).
Plasma tIGFBP was positively correlated with BW at 29 d
(r = 0.37; P < 0.01). There were no other significant associa-
tions between measures of progeny growth or carcass and
plasma IGF-I, -II or tIGFBP.
213
4. Discussion
This study has shown that male fetuses exposed to
a change from either high to low, or vice versa, level of
maternal nutrient intake at the end of the first trimester,
have higher plasma IGF-I during the postnatal period in
comparison to their counterparts exposed to a constant
plane of maternal nutrient intake during the first two
trimesters of gestation. Although low maternal nutrient
intake during the second trimester of gestation reduced
progeny birth weight, they had caught up in bodyweight
by 65 ± 10 d. Interestingly, subsequent growth was affected
by maternal nutrient intake during the first trimester of
gestation in a sex-specific manner. Specifically, we found
that male progeny born to heifers fed low nutrient diets
during the first trimester of gestation were heavier during
the post-weaning period than their high nutrient exposed
counterparts. Female progeny, however, exposed to a high
level of maternal nutrient intake during the first trimester
of gestation were heavier and taller during the inten-
sive feeding period and had heavier HCW than their low
counterparts. Furthermore, both BW and postnatal growth
rates were associated with plasma IGF-I overall, consis-
tent with the IGF axis mediating part of the long-term
effects of variable maternal nutrition on postnatal perfor-
mance.
4.1. Nutrition
Protein is often the most limiting nutrient to beef pro-
duction in Northern Australian herds (Bortolussi et al.,
2005; Willoughby, 1959), however following unseasonal
winter rainfall forbs that are high in protein become abun-
dant (Perry et al., 2002). The resultant pastures have an
equivalent or higher crude protein content compared to
summer grass pastures. The diets used in the current study,
therefore, were designed to reflect the nutritive value of
pastures in this grazing environment.
214 G.C. Micke et al. / Animal Reproduction Science 121 (2010) 208–217
Exposure of cattle to sudden changes in diet is associ-
ated with acidosis and rumenitis (Huber, 1976). As such, a
stepwise feeding regimen was used to transition heifers to
their new diets at the end of the first and second trimesters.
Clinical signs of digestive and metabolic upsets were not
observed. This minimized the potential for acidosis asso-
ciated inflammatory cytokines (Orsi and Tribe, 2008) and
altered fetal acid–base balance (Gardner et al., 2002) to
impact upon fetal oxygenation status and mitogenic and
apoptotic processes. We propose therefore, that in our
study the observed effects of maternal treatment group to
progeny are due to the dietary treatments imposed rather
than to physiological adaptations associated with dietary
change at the end of the first and second trimesters of ges-
tation.
The high and low planes of maternal nutrition dif-
fered in both CP (3.3–3.6 fold) and energy content (1.2–1.3
fold), with both above the recommended National Research
Council (NRC) energy requirements for heifers in first and
second trimesters. Therefore, the difference in CP between
the high and low diets was much greater than that of
energy. The degradable intake protein balances for the high
and low planes of nutrition during the first trimester were
206 g/d and −345 g/d, respectively, and during the second
trimester, 214 g/d and −464 g/d, respectively. The nega-
tive degradable intake protein balance for the low plane
of nutrition in both the first and second trimesters clearly
demonstrates that protein intake was restricted. Protein
intake, especially arginine, is a determinant of placental
angiogenesis and fetal growth (Kwon et al., 2004). We
therefore consider that effects of maternal nutrition during
the first and second trimesters of gestation upon plasma
IGF-I and NEFA, BW, HCW and carcass LDA in this study
reflect the effects of protein intake rather than energy. The
presence of a small amount of additional energy in high
protein diets was also a feature of the recent study by
Larson et al. (2009).
In beef production, as in other production units in which
dams suckle their young for a defined period, effects of pre-
natal nutrition may include an impact upon lactation. Milk
intake regulates both progeny postnatal BW (Clutter and
Nielsen, 1987) and plasma IGF-I (Chellakooty et al., 2006;
Martin et al., 2005), and it is therefore possible that differ-
ences in milk intake may have partly mediated the effects of
maternal nutrient intake on these outcomes. In the current
study, however, there was no detectable effect of calf milk
intake on their BW, height or plasma IGF-I, IGF-II or tIGFBP,
when the sum total of all milk intake by each animal was
included as a covariate in the analyses (unpublished data).
This was despite low maternal nutrient intake during the
first trimester of gestation being associated with increased
calf milk intake (Sullivan et al., 2009e).
4.2. Response of IGF to maternal nutrient intake during
gestation and ontogeny of IGF
Although maternal nutrition during pregnancy altered
progeny birth weight (Micke et al., 2010), this did not
explain the elevation in plasma IGF-I in male progeny
in response to changing maternal plane of nutrition
between the first and second trimesters, which emerged
only postnatally. This contrasts with previous studies
where the effect of maternal nutrition on size at birth
and progeny IGFs were consistent. In rats, lowered birth
weight following intrauterine growth restriction is asso-
ciated with reduced hepatic expression of IGF-I mRNA
(Woodall et al., 1998) and circulating concentrations of
IGF-I in neonates (Woodall et al., 1996). Similarly, progeny
postnatal plasma IGF-I is inversely associated with birth
weight in sheep following 10 d of maternal nutrient restric-
tion during late gestation (Oliver et al., 2002). The effects
of maternal nutrition on the progeny IGF axis of our
study may have several underlying causes. These poten-
tially include programming via epigenetic modifications
of activity of known regulatory influences, such as the
GH axis or other endocrine axes known to be suscep-
tible to maternal nutrition and the fetal environment
(Gatford et al., 2002; Muhlhausler et al., 2009), appetite
or satiety (De Blasio et al., 2007b; Muhlhausler et al.,
2006) or local cellular IGF-I production (Duffield et al.,
2008).
The rapid rise in plasma IGF-I and concurrent decline
in plasma IGF-II during the immediate postnatal period
seen here is consistent with patterns seen in other
species, including rodents, sheep and humans (Jones and
Clemmons, 1995). Consistent with prior reports (Engström
et al., 2005; Govoni et al., 2003), plasma IGF-I and tIGFBP of
males were greater than females. In humans, plasma IGF-
II increases until the onset of puberty and then remains
stable (Yu et al., 1999). The onset of puberty in Brah-
man × Angus cattle, a similar genotype cross to the cattle
in this study, occurs between 320 and 400 d of age and
262–336 kg liveweight (Stewart et al., 1980). This corre-
sponds to the period of decreasing plasma IGF-II in female
calves in this study. In our study, castration of male calves
at 153 d prevented any pubertal effects on plasma IGF-II
which may explain the earlier decline in plasma IGF-II in
males compared to females, despite no reported immedi-
ate effect of castration on plasma IGF-II in sheep (Gatford
et al., 1996) and pigs (Owens et al., 1999). The similar onto-
genic patterns of tIGFBP and IGF-I were not unexpected
given the roles of IGFBPs in forming stable complexes
with circulating IGF-I slowing clearance (Thissen et al.,
1994).
4.3. Pre-weaning growth and metabolite responses to
maternal nutrient intake during gestation
The majority of neonatal fat mass is present as perirenal
brown adipose tissue (BAT), which provides non-shivering
thermogenesis during the early neonatal period, a pro-
cess regulated by uncoupling protein (UCP) 1 (Clarke et al.,
1997). Maternal nutrient restriction increases exposure of
the fetus to cortisol (Edwards and McMillen, 2001; Hough
et al., 1990). This leads to increased UCP1 abundance in
fetal perirenal adipose tissue (Mostyn et al., 2003) and thus
potential rate of BAT mobilization following birth. This cas-
cade of events could explain the elevated plasma NEFA
at birth observed in the lighter birth weight male calves
in our study. Furthermore, since growth restricted fetuses
have increased amounts of adipose tissue at birth and as
neonates (Bispham et al., 2003; De Blasio et al., 2007a;
 G.C. Micke et al. / Animal Reproduction Science 121 (2010) 208–217
Greenwood et al., 1998), lighter calves may have had a
greater fat mass available for mobilization. It is unlikely that
confounding effects of environmental temperature prior to
birth contributed to the change to plasma NEFA observed.
This is because calves were born over a short period of
time with no appreciable change in temperature due to
season (Bureau-Of-Meterology, 2010); blood samples were
collected within 5 min of birth; and there was no effect of
nutritional treatment group on gestation length (Sullivan
et al., 2009e) or time of day of calving (unpublished data).
A positive effect of increased maternal nutrient intake
on calf BW at weaning has been reported (Cafe et al., 2006;
Freetly et al., 2005; Stalker et al., 2006) but in our study,
increased progeny weight in response to increased mater-
nal feed intake during the second trimester of gestation
only persisted to 29 d. Changes in plasma IGF and IGFBP
have been implicated in the increased rate of neonatal
growth exhibited by low birth weight babies (Cianfarani
et al., 2002) but this association was not present in our
study. Furthermore, differences in milk intake during the
early postnatal period induced by variable maternal nutri-
tion during early gestation (Sullivan et al., 2009e) did not
explain the equalization of BW across treatment groups by
65 d.
4.4. Post-weaning growth and metabolite responses to
maternal nutrient intake during gestation
The effects of maternal nutrient intake during gestation
on post-weaning BW of steers in the present study differs
from previous reports (Greenwood et al., 2006; Larson et
al., 2009; Martin et al., 2007; Stalker et al., 2006). Such
inconsistencies may be caused by timing of maternal nutri-
ent restriction; the nutritional protocol used; age of the
dams; age of progeny at castration; age of the progeny
at slaughter or the absence of repeat administration of
anabolic steroids (Larson et al., 2009; Stalker et al., 2006).
Previously, studies of the effect of maternal nutrition dur-
ing gestation on progeny post-weaning performance have
focused on the final trimester of gestation (Larson et al.,
2009; Martin et al., 2007; Stalker et al., 2006). A single study
commenced between 30 and 90 d of gestation (Greenwood
et al., 2006) but none have begun at conception. Further-
more, the heifers in our study remained in positive ADG
throughout gestation (Sullivan et al., 2009c), a distinct con-
trast to the negative effects on maternal BW of the low
nutrient regimens used by previous studies (Cafe et al.,
2006; Larson et al., 2009; Martin et al., 2007; Stalker et al.,
2006).
Changes to body composition of non-carcass compo-
nents, such as increasing visceral fat mass with ageing,
may explain why males exposed to low levels of mater-
nal nutrient intake during early gestation had heavier BW
but not carcass weights. This proposal is consistent with
increased abdominal obesity of male offspring following
maternal nutrient restriction during early to mid-gestation
as observed in sheep (Ford et al., 2007) and humans (Ravelli
et al., 1976).
Postnatal muscle mass accretion is dependent upon fac-
tors affecting fetal myogenesis as demonstrated in sheep
(Zhu et al., 2004) and pigs (Dwyer et al., 1994). In cat-
215
tle, mid- to late-gestation corresponds to the period of
secondary muscle fiber formation; the largest contrib-
utor to muscle mass (Gagniere et al., 1999; Robelin et
al., 1991). The positive effect of low maternal nutrient
intake during the second trimester on carcass LDA in
our study is consistent with a prior report in cattle of
a non-significant increase in carcass LDA in association
with low birth weight (Greenwood et al., 2006). In fetal
sheep, increased sensitivity of skeletal muscle to IGF fol-
lowing maternal nutrient restriction has been reported
(Brameld et al., 2000) and we are currently investigating
this possibility. Similarly, changes to the fetal environment
during the period of pluripotent stem cell differentiation
(Smas and Sul, 1995) may affect progeny intramuscular
fat deposition. Greenwood et al. (2006) did not find any
appreciable difference in progeny marbling in response to
feeding maternal diets low in nutrients during early and
mid-gestation, despite using a breed predisposed to mar-
bling. The tendency for increased marbling of LL compared
to LH progeny in our study however, supports the recent
suggestion that maternal nutrient intake during gestation
and the periconceptal period may affect progeny intramus-
cular fat deposition (Du et al., 2009; Tong et al., 2009).
Interestingly, progeny phenotype was altered in
response to maternal nutrient intake during the period
of lowest fetal nutrient demand, when the rate of fetal
cellular proliferation and differentiation was high. This
response may have been mediated by concurrent changes
to maternal metabolism (Sullivan et al., 2009d) and pla-
cental function (Perry et al., 1999; Sullivan et al., 2009b),
in addition to possible changes to placental angiogenesis
and vascularity (Vonnahme et al., 2007). Furthermore, dur-
ing the third trimester of gestation there were carry-over
effects of maternal nutrient intake during both the first and
second trimesters on maternal BW, body condition score,
ADG (Sullivan et al., 2009c), as well as to maternal plasma
IGF-I, IGF-II and tIGFBP (Sullivan et al., 2009d). Effects
to progeny attributed to maternal diet during the first
trimester of gestation may, therefore, in part be induced
by altered maternal state during the third trimester.
5. Conclusion
This study, to our knowledge, has demonstrated for the
first time that there is a persistent and sex-specific pro-
gramming of plasma IGF-I in progeny in postnatal life by
heifer nutrient intake during the first and second trimesters
of gestation. This change in abundance of a major growth
factor may partly explain concomitant effects on postnatal
BW and carcass weight, raising the possibility of refining
heifer nutritional programs during early gestation to opti-
mize production objectives of their progeny. Advances in
animal breeding technologies, such as the ability to selec-
tively breed progeny of a preferred sex, may enable the
sex-specific effects of maternal nutrition during early ges-
tation to be utilized. Understanding the origins of these
effects on IGF-I that are not immediately apparent follow-
ing birth, but rather develop later in postnatal life and
are associated with enhanced growth, may reveal novel
approaches to further optimization of production systems.
216 G.C. Micke et al. / Animal Reproduction Science 121 (2010) 208–217
Acknowledgements
This research was funded by Meat and Livestock
Australia, Sydney, Australia; Australian Agricultural Com-
pany, Brisbane, Australia; and Western Australian Cattle
Industry Compensation Fund, Perth, Australia, with the
support of Ridley AgriProducts, Melbourne, Australia;
Milne AgriGroup, Perth, Australia; and Network in Genes
and Environment in Development, Adelaide, Australia. We
are grateful for the untiring statistical advice received from
R.J. Soares Magalhaes of The School of Population Health,
The University of Queensland, Herston Road, Queensland,
Australia.
References
AUS-MEAT, 1998. AUS-MEAT National Accreditation Standards and Aus-
tralian Meat Industry Classification System. AUS-MEAT Ltd., Brisbane,
Australia.
Bispham, J., Gopalakrishnan, G.S., Dandrea, J., Wilson, V., Budge, H.,
Keisler, D.H., Broughton Pipkin, F., Stephenson, T., Symonds, M.E.,
2003. Maternal endocrine adaptation throughout pregnancy to nutri-
tional manipulation: consequences for maternal plasma leptin and
cortisol and the programming of fetal adipose tissue development.
Endocrinology 144, 3575–3585.
Bortolussi, G., McIvor, J.G., Hodgkinson, J.J., Coffey, S.G., Holmes, C.R., 2005.
The northern Australian beef industry, a snapshot 2. Breeding herd
performance and management. Aust. J. Exp. Agric. 45, 1075–1091.
Brameld, J.M., Mostyn, A., Dandrea, J., Stephenson, T.J., Dawson, J.M., But-
tery, P.J., Symonds, M.E., 2000. Maternal nutrition alters the expression
of insulin-like growth factors in fetal sheep liver and skeletal muscle.
J. Endocrinol. 167, 429–437.
Breier, B.H., Gluckman, P.D., Bass, J.J., 1988. Plasma concentrations of
insulin-like growth factor-I and insulin in the infant calf: ontogeny
and influence of altered nutrition. J. Endocrinol. 119, 43–50.
Bureau-Of-Meterology 2010. Climate Statistics for Australian Locations.
Bureau of Meterology, Australian Government (8th February 2010;
http://www.bom.gov.au/jsp/ncc/cdio/weatherData/av?p nccObs
Code=38&p display type=dataFile&p startYear=&p stn num=041521).
Cafe, L.M., Hennessy, D.W., Hearnshaw, H., Morris, S.T., Greenwood, P.L.,
2006. Influences of nutrition during pregnancy and lactation on birth
weights and growth to weaning of calves sired by Piedmontese and
Wagyu bulls. Aust. J. Exp. Agric. 46, 245–255.
Carr, J.M., Owens, J.A., Grant, P., Walton, P.E., Owens, P.C., Wallace, J.C.,
1995. Circulating insulin-like growth factors (IGFs), IGF-binding pro-
teins (IGFBPs) and tissue mRNA levels of IGFBP-2 and IGFBP-4 in the
ovine fetus. J. Endocrinol. 145, 545–557.
Chellakooty, M., Juul, A., Boisen, K.A., Damgaard, I.N., Kai, C.M., Schmidt,
I.M., Petersen, J.H., Skakkebaek, N.E., Main, K.M., 2006. A prospective
study of serum insulin-like growth factor I (IGF-I) and IGF-binding
protein-3 in 942 healthy infants: associations with birth weight, gen-
der, growth velocity, and breastfeeding. J. Clin. Endocrinol. Metab. 91,
820–826.
Cianfarani, S., Geremia, C., Scott, C., Germani, D., 2002. Growth, IGF system,
and cortisol in children with intrauterine growth retardation: Is catch-
up growth affected by reprogramming of the hypothalamic-pituitary-
adrenal axis? Pediatr. Res. 51, 94–99.
Clarke, L., Heasman, L., Firth, K., Symonds, M.E., 1997. Influence of route of
delivery and ambient temperature on thermoregulation in newborn
lambs. Am. J. Physiol. 272, R1931–R1939.
Clutter, A.C., Nielsen, M.K., 1987. Effect of level of beef cow milk production
on pre- and postweaning calf growth. J. Anim. Sci. 64, 1313–1322.
De Blasio, M.J., Gatford, K.L., McMillen, I.C., Robinson, J.S., Owens,
J.A., 2007a. Placental restriction of fetal growth increases insulin
action, growth, and adiposity in the young lamb. Endocrinology 148,
1350–1358.
De Blasio, M.J., Gatford, K.L., Robinson, J.S., Owens, J.A., 2007b. Placental
restriction of fetal growth reduces size at birth and alters postna-
tal growth, feeding activity, and adiposity in the young lamb. Am. J.
Physiol. Regul. Integr. Comp. Physiol. 292, R875–R886.
Du, M., Tong, J., Zhao, J., Underwood, K.R., Zhu, M., Ford, S.P., Nathanielsz,
P.W., 2009. Fetal programming of skeletal muscle development in
ruminant animals. J. Anim. Sci., doi:10.2527/jas.2009-2311.
Duffield, J.A., Vuocolo, T., Tellam, R., Yuen, B.S., Muhlhausler, B.S.,
McMillen, I.C., 2008. Placental restriction of fetal growth decreases
IGF1 and leptin mRNA expression in the perirenal adipose tissue of
late gestation fetal sheep. Am. J. Physiol. 294, R1413–R1419.
Dwyer, C.M., Stickland, N.C., Fletcher, J.M., 1994. The influence of maternal
nutrition on muscle fibre number development in the porcine fetus
and on subsequent postnatal growth. J. Anim. Sci. 72, 911–917.
Edwards, L.J., McMillen, I.C., 2001. Maternal undernutrition increases arte-
rial blood pressure in the sheep fetus during late gestation. J. Physiol.
533, 561–570.
Engström, E., Niklasson, A., Wikland, K.A., Ewald, U., Hellström, A., 2005.
The role of maternal factors, postnatal nutrition, weight gain, and gen-
der in regulation of serum IGF-I among preterm infants. Pediatr. Res.
57, 605–610.
Firth, S., Baxter, R., 2002. Cellular actions of the insulin-like growth factor
binding proteins. Endocr. Rev. 23, 824–854.
Ford, S.P., Hess, B.W., Schwope, M.M., Nijland, M.J., Gilbert, J.S., Vonnahme,
K.A., Means, W.J., Han, H., Nathanielsz, P.W., 2007. Maternal under-
nutrition during early to mid-gestation in the ewe results in altered
growth, adiposity, and glucose tolerance in male offspring. J. Anim.
Sci. 85, 1285–1294.
Freetly, H.C., Ferrell, C.L., Jenkins, T.G., 2005. Nutritionally altering weight
gain patterns of pregnant heifers and young cows changes the time
that feed resources are offered without any differences in production.
J. Anim. Sci. 83, 916–929.
Gagniere, H., Picard, B., Geay, Y., 1999. Contractile differentiation of
foetal cattle muscles: intermuscular variability. Reprod. Nutr. Dev. 39,
637–655.
Gallaher, B.W., Breier, B.H., Oliver, M.H., Harding, J.E., Gluckman, P.D.,
1992. Ontogenic differences in the nutritional regulation of circu-
lating IGF binding proteins in sheep plasma. Acta Endocrinol. 126,
49–54.
Gardner, D.S., Fletcher, A.J.W., Bloomfield, M.R., Fowden, A.L., Giussani,
D.A., 2002. Effects of prevailing hypoxaemia, acidaemia or hypogly-
caemia upon the cardiovascular, endocrine and metabolic responses
to acute hypoxaemia in the ovine fetus. J. Physiol. 540, 351–366.
Gatford, K.L., Clarke, I.J., De Blasio, M.J., McMillen, I.C., Robinson, J.S.,
Owens, J.A., 2002. Perinatal growth and plasma GH profiles in ado-
lescent and adult sheep. J. Endocrinol. 173, 151–159.
Gatford, K.L., Fletcher, T.P., Clarke, I.J., Owens, P.C., Quinn, K.J., Walton,
P.E., Grant, P.A., Hosking, B.J., Egan, A.R., Ponnampalam, E.N., 1996.
Sexual dimorphism of circulating somatotropin, insulin-like growth
factor I and II, insulin-like growth factor binding proteins, and insulin:
relationships to growth rate and carcass characteristics in growing
lambs. J. Anim. Sci. 74, 1314–1325.
Govoni, K.E., Hoagland, T.A., Zinn, S.A., 2003. The ontogeny of the soma-
totropic axis in male and female Hereford calves from birth to one
year of age. J. Anim. Sci. 81, 2811–2817.
Greenwood, P.L., Cafe, L.M., Hearnshaw, H., Hennessy, D.W., Morris, S.T.,
2006. Long-term consequences of birth weight and growth to weaning
on carcass, yield and beef quality characteristics of Peidmontese- and
Wagyu-sired cattle. Aust. J. Exp. Agric. 46, 257–269.
Greenwood, P.L., Hunt, A.S., Hermanson, J.W., Bell, A.W., 1998. Effects of
birth weight and postnatal nutrition on neonatal sheep. I. Body growth
and composition and some aspects of energetic efficiency. J. Anim. Sci.
76, 2354–2367.
Hough, R.L., McCarthy, F.D., Kent, H.D., Eversole, D.E., Wahlberg, M.L., 1990.
Influence of nutritional restriction during late gestation on produc-
tion measures and passive immunity in beef cattle. J. Anim. Sci. 68,
2622–2627.
Huber, T.L., 1976. Physiological effects of acidosis on feedlot cattle. J. Anim.
Sci. 43, 902–909.
Hyatt, M.A., Budge, H., Walker, D., Stephenson, T., Symonds, M.E., 2007a.
Effects of maternal parity and late gestational nutrition on mRNA
abundance for growth factors in the liver of postnatal sheep. Am. J.
Physiol. 292, R1934–R1942.
Hyatt, M.A., Gopalakrishnan, G.S., Bispham, J., Gentili, S., McMillen, I.C.,
Rhind, S.M., Rae, M.T., Kyle, C.E., Brooks, A.N., Jones, C., Budge, H.,
Walker, D., Stephenson, T., Symonds, M.E., 2007b. Maternal nutrient
restriction in early pregnancy programs hepatic mRNA expression of
growth-related genes and liver size in adult male sheep. J. Endocrinol.
192, 87–97.
Hyatt, M.A., Walker, D.A., Stephenson, T., Symonds, M.E., 2004. Ontogeny
and nutritional manipulation of the hepatic prolactin-growth
hormone-insulin-like growth factor axis in the ovine fetus and in
neonate and juvenile sheep. Proc. Nutr. Soc. 63, 127–135.
Jones, J.I., Clemmons, D.R., 1995. Insulin-like growth factors and their
binding proteins: biological actions. Endocr. Rev. 16, 3–34.
Kwon, H., Ford, S.P., Bazer, F.W., Spencer, T.E., Nathanielsz, P.W., Nijland,
M.J., Hess, B.W., Wu, G., 2004. Maternal nutrient restriction reduces
concentrations of amino acids and polyamines in ovine maternal and
fetal plasma and fetal fluids. Biol. Reprod. 71, 901–908.
 G.C. Micke et al. / Animal Reproduction Science 121 (2010) 208–217
Larson, D.M., Martin, J.L., Adams, D.C., Funston, R.N., 2009. Winter grazing
system and supplementation during late gestation influence perfor-
mance of beef cows and steer progeny. J. Anim. Sci. 87, 1147–1155.
Lund-Larsen, T.R., Sundby, A., Kruse, V., Velle, W., 1977. Relation between
growth rate, serum somatomedin and plasma testosterone in young
bulls. J. Anim. Sci. 44, 189–194.
Martin, J.L., Vonnahme, K.A., Adams, D.C., Lardy, G.P., Funston, R.N., 2007.
Effects of dam nutrition on growth and reproductive performance of
heifer calves. J. Anim. Sci. 85, 841–847.
Martin, R.M., Holly, J.M., Davey Smith, G., Ness, A.R., Emmett, P., Rogers,
I., Gunnell, D., 2005. Could associations between breastfeeding and
insulin-like growth factors underlie associations of breastfeeding with
adult chronic disease? The Avon longitudinal study of parents and
children. Clin. Endocrin. (Oxf.) 62, 728–737.
Meat and Livestock Australia, 2004. More Beef from Pastures: the Pro-
ducer’s Manual. Meat and Livestock Australia Ltd., Sydney, Australia.
Micke, G.C., Sullivan, T.M., Magalhaes, R.J.S., Rolls, P.J., Norman, S.T., Perry,
V.E.A., 2010. Heifer nutrition during early- and mid-pregnancy alters
fetal growth trajectory and birth weight. Anim. Reprod. Sci. 117, 1–10.
Moore, K.L., Johnston, D.J., Graser, H.-U., Herd, R., 2005. Genetic and phe-
notypic relationships between insulin-like growth factor-I (IGF-I) and
net feed intake, fat, and growth traits in Angus beef cattle. Aust. J.
Agric. Res. 56, 211–218.
Mostyn, A., Pearce, S., Budge, H., Elmes, M., Forhead, A.J., Fowden, A.L.,
Stephenson, T., Symonds, M.E., 2003. Influence of cortisol on adi-
pose tissue development in the fetal sheep during late gestation. J.
Endocrinol. 176, 23–30.
MSA, 1999. Grading for Eating Quality—Development of the Meat Stan-
dards Australia Grading System, vol. 1. Meat Standards Australia,
Newstead, Australia.
Muhlhausler, B.S., Adam, C.L., Findlay, P.A., Duffield, J.A., McMillen,
I.C., 2006. Increased maternal nutrition alters development of the
appetite-regulating network in the brain. FASEB J. 20, 1257–1259.
Muhlhausler, B.S., Duffield, J.A., Ozanne, S.E., Pilgrim, C., Turner, N., Mor-
rison, J.L., McMillen, I.C., 2009. The transition from fetal growth
restriction to accelerated postnatal growth: a potential role for insulin
signalling in skeletal muscle. J. Physiol. 587, 4199–4211.
Newman, R., 2007. A Guide to Best Practice Husbandry in Beef Cattle:
Branding, Castrating and Dehorning. Meat and Livestock Australia Ltd.,
Sydney, Australia.
Olausson, H., Lewitt, M., Brismar, K., Uvnas-Moberg, K., Sohlstrom, A.I.,
2006. Maternal food restriction during gestation elevates insulin-like
growth factor I and insulin-like growth factor binding protein 1 in
adult male rat offspring. Nutr. Res. 26, 350–355.
Oliver, M.H., Breier, B.H., Gluckman, P.D., Harding, J.E., 2002. Birth weight
rather than maternal nutrition influences glucose tolerance, blood
pressure, and IGF-I levels in sheep. Pediatr. Res. 52, 516–524.
Oliver, M.H., Harding, J.E., Breier, B.H., Evans, P.C., Gluckman, P.D., 1993.
Glucose but not a mixed amino acid infusion regulates plasma insulin-
like growth factor-I concentrations in fetal sheep. Pediatr. Res. 34,
62–65.
Orsi, N.M., Tribe, R.M., 2008. Cytokine networks and the regulation of
uterine function in pregnancy and parturition. J. Neuroendocrinol. 20,
462–469.
Osborn, B.H., Fowlkes, J., Han, V.K., Freemark, M., 1992. Nutritional regu-
lation of insulin-like growth factor-binding protein gene expression
in the ovine fetus and pregnant ewe. Endocrinology 131, 1743–1750.
Owens, P.C., Gatford, K.L., Walton, P.E., Morley, W., Campbell, R.G., 1999.
The relationship between endogenous insulin-like growth factors and
growth in pigs. J. Anim. Sci. 77, 2098–2103.
Owens, P.C., Johnson, R.J., Campbell, R.G., Ballard, F.J., 1990. Growth hor-
mone increases insulin-like growth factor (IGF-I) and decreases IGF-II
in plasma of growing pigs. J. Endocrinol. 124, 269–275.
Perry, V.E., Norman, S.T., Owen, J.A., Daniel, R.C., Phillips, N., 1999. Low
dietary protein during early pregnancy alters bovine placental devel-
opment. Anim. Reprod. Sci. 55, 13–21.
217
Ravelli, G.P., Stein, Z.A., Susser, M.W., 1976. Obesity in young men after
famine exposure in utero and early infancy. New Engl. J. Med. 295,
349–353.
Robelin, J., Loucourt, A., Bechet, D., Ferrara, M., Briand, Y., Geay, Y., 1991.
Muscle differentiation in the bovine fetus: a histological and histo-
chemical approach. Growth Develop. Aging 55, 151–160.
Smas, C.M., Sul, H.S., 1995. Control of adipocyte differentiation. Biochem.
J. 309, 697–710.
Stalker, L.A., Adams, D.C., Klopfenstein, T.J., Feuz, D.M., Funston, R.N., 2006.
Effects of pre- and postpartum nutrition on reproduction in spring
calving cows and calf feedlot performance. J. Anim. Sci. 84, 2582–2589.
Stewart, T.S., Long, C.R., Cartwright, T.C., 1980. Characterization of cattle
of a five-breed Diallel. III. Puberty in bulls and Heifers. J. Anim. Sci. 50,
808–820.
Sullivan, T.M., Micke, G.C., Greer, R.M., Irving-Rodgers, H.F., Rodgers, R.J.,
Perry, V.E.A., 2009a. Dietary manipulation of Bos indicus × heifers dur-
ing gestation affects the reproductive development of their heifer
calves. Reprod. Fertil. Develop. 21, 773–784.
Sullivan, T.M., Micke, G.C., Magalhaes, R.S., Martin, G.B., Wallace, C.R.,
Green, J.A., Perry, V.E.A., 2009b. Dietary protein during gestation
affects circulating indicators of placental function and fetal develop-
ment in heifers. Placenta 30, 348–354.
Sullivan, T.M., Micke, G.C., Magalhaes, R.S., Phillips, N.J., Perry, V.E.A.,
2009c. Dietary protein during gestation affects placental development
in heifers. Theriogenology 72, 427–438.
Sullivan, T.M., Micke, G.C., Perkins, N., Martin, G.B., Wallace, C.R., Gatford,
K.L., Owens, J.A., Perry, V.E.A., 2009d. Dietary protein during gestation
affects maternal IGF, IGFBP, leptin concentrations, and fetal growth in
heifers. J. Anim. Sci. 87, 3304–3316.
Sullivan, T.M., Micke, G.C., Perry, V.E.A., 2009e. Influences of diet
during gestation on potential postpartum reproductive perfor-
mance and milk production of beef heifers. Theriogenology,
doi:10.1016/j.theriogenology.2009.07.016.
Thissen, J.P., Ketelslegers, J.M., Underwood, L.E., 1994. Nutritional regula-
tion of the insulin-like growth factors. Endocr. Rev. 15, 80–101.
Tong, J.F., Yan, X., Zhu, M.J., Ford, S.P., Nathanielsz, P.W., Du, M., 2009.
Maternal obesity downregulates myogenesis and {beta}-catenin sig-
naling in fetal skeletal muscle. Am. J. Physiol. 296, E917–924.
Verkauskiene, R., Jaquet, D., Deghmoun, S., Chevenne, D., Czernichow, P.,
Levy-Marchal, C., 2005. Smallness for gestational age is associated
with persistent change in insulin-like growth factor I (IGF-I) and the
ratio of IGF-I/IGF-binding protein-3 in adulthood. J. Clin. Endocrinol.
Metab. 90, 5672–5676.
Vonnahme, K.A., Zhu, M.J., Borowicz, P.P., Geary, T.W., Hess, B.W.,
Reynolds, L.P., Caton, J.S., Means, W.J., Ford, S.P., 2007. Effect of early
gestational undernutrition on angiogenic factor expression and vas-
cularity in the bovine placentome. J. Anim. Sci. 85, 2464–2472.
Woodall, S.M., Bassett, N.S., Gluckman, P.D., Breier, B.H., 1998. Conse-
quences of maternal undernutrition for fetal and postnatal hepatic
insulin-like growth factor-I, growth hormone receptor and growth
hormone binding protein gene regulation in the rat. J. Mol. Endocrinol.
20, 313–326.
Woodall, S.M., Breier, B.H., Johnston, B.M., Gluckman, P.D., 1996. A model
of intrauterine growth retardation caused by chronic maternal under-
nutrition in the rat: effects on the somatotropic axis and postnatal
growth. J. Endocrinol. 150, 231–242.
Willoughby, W.M., 1959. Limitations to animal production imposed by
seasonal fluctuations in pasture and by management procedures.
Aust. J. Agric. Res. 10, 248–268.
Yu, H., Misrty, J., Nicar, M.J., Khosravi, M.J., Diamandis, A., van Doorn, J.,
Juul, A., 1999. Insulin-like growth factors (IGF-I, free IGF-I, and IGF-
II) and insulin-like growth factor binding proteins (IGFBP-2, IGFBP-3,
IGFBP-6, and ALS) in blood circulation. J. Clin. Lab. Anal. 13, 166–172.
Zhu, M.J., Ford, S.P., Nathanielsz, P.W., Du, M., 2004. Effect of maternal
nutrient restriction in sheep on the development of fetal skeletal mus-
cle. Biol. Reprod. 71, 1968–1973.
 Animal Reproduction Science 121 (2010) 218–224

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

mRNA of luteal genes associated with progesterone synthesis,

maintenance, and apoptosis in dairy heifers and lactating dairy cows
T. Pretheeban, A. Balendran, M.B. Gordon, R. Rajamahendran ∗
Department of Animal Science, University of British Columbia, 229-2357, Main Mall, Vancouver, BC, Canada V6T 1Z4

a r t i c l e i n f o a b s t r a c t

Article history: This study was performed to investigate the role of corpus luteum (CL) in reduced preg-
Received 1 February 2010 nancy rates (PR) observed in high producing lactating dairy cows. Development of CL and
Received in revised form 5 May 2010
secretion of progesterone (P4 ) play a key role in early embryo development, implantation,
Accepted 20 May 2010
and maintenance of pregnancy. Time of ovulation was synchronized in dairy heifers and
Available online 1 June 2010
second/third parity lactating dairy cows and CL enucleated surgically under local anesthe-
sia on day 10 of the estrous cycle. Quality of the CL in dairy heifers (n = 5) and lactating dairy
Keywords:
cows (n = 5) was compared by analyzing the expression of candidate genes by mRNA assess-
Corpus luteum
Dairy heifer ments using quantitative real-time PCR. Amounts of mRNA for factors associated with P4
Lactating dairy cow synthesis: 3␤HSD, anti-apoptotic function: BCL2, angiogenesis: VEGF, IGF1, and FGF2, and
Progesterone synthesis luteal maintenance: IL1A were greater (P < 0.05) in CL obtained from dairy heifers compared
Luteal maintenance to that of lactating dairy cows. Also a greater ratio for BAX:BCL2 mRNA was observed in
Angiogenesis lactating cows. Therefore, genes regulating angiogenic, steroidogenic, and luteotropic fac-
tors are highly expressed in heifers compared to lactating dairy cows, whereas apoptosis
seemed to be more evident in CL of lactating cows. These findings suggest that CL of lac-
tating dairy cows have reduced luteotropic as well as steroidogenic capacities on day 10 of
the estrous cycle and might have played a critical role in reduced PR observed in lactating
dairy cows.
© 2010 Elsevier B.V. All rights reserved.

1. Introduction from 51.5% in the first parity to 19.5% in the third/fourth

Reduced pregnancy rates (PR) in high yielding dairy
cows are a world wide problem and a matter of great con-
cern to dairy producers due to the immense economic
losses (Lucy, 2001). This has led to increased research
efforts to further understand the underlying mechanisms
of reduced PR in lactating dairy cows. Although PR in
lactating dairy cows have declined gradually over the
past 50 years, PR of dairy heifers have remained constant
(Pursley et al., 1997). Balendran et al. (2008) showed that
PR in heifers after first and second artificial insemina-
tions (AI) was 83.4% and it declined in lactating dairy cows
∗ Corresponding author. Tel.: +1 604 822 4784; fax: +1 604 822 4400.
E-mail address: raja@interchange.ubc.ca (R. Rajamahendran).
parity. The causes for the reduced PR in lactating dairy
cows seem to be multifactorial and include disruptions in
the ovarian follicular dynamics, corpus luteum (CL) func-
tion (Opsomer et al., 1998; Wolfenson et al., 2004), poor
estrous behavior and/or detection (Lopez et al., 2004),
reduced oocyte/embryo quality (Lucy, 2007), and com-
promised oviductal and uterine environments (Gustafsson
and Larsson, 1985; Binelli et al., 1999; Spencer et al.,
2007).
Formation of CL and secretion of progesterone (P4 ) are
of paramount importance for the early embryonic devel-
opment, implantation, and maintenance of pregnancy. P4
concentrations during early pregnancy have a marked
effect on PR. Many studies have demonstrated that lower
concentration of P4 in milk (Lamming et al., 1989; Mann
et al., 1995) and in plasma (Butler et al., 1996; Mann and

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.05.016
 T. Pretheeban et al. / Animal Reproduction Science 121 (2010) 218–224
Lamming, 2001) of cows are associated with higher rates
of pregnancy failures.
The formation, function, and maintenance of CL are
regulated by various luteotropic factors before and after
ovulation, as well as by the inhibition of several luteolytic
factors during the period of active CL function (Stocco et
al., 2007). These regulatory mechanisms are mediated by
the cyclic expression of key genes during the lifespan of CL,
and therefore, determine the functional capacities, as well
as the lifespan of CL tissue. Major categories of genes that
participate in the formation, maintenance, secretion, and
regression of CL are those involved in extracellular matrix
and cytoskeleton formation, transcriptional regulation,
angiogenesis, steroidogenesis, oxygen metabolism, apop-
tosis, and inflammation (Casey et al., 2005; Goravanahally
et al., 2009). Therefore, it is expected that any alterations
in the coordinated expression of the above genes could
compromise the optimal development and function of the
CL.
In this study we compared the mRNA of candidate
genes in the CL during mid luteal phase, between dairy
heifers and second/third parity lactating dairy cows. These
genes are involved in steroidogenesis (steroidogenic acute
regulatory protein: StAR, cytochrome P450 family 11
sub-family A polypeptide 1: CYP11A1; formerly known
as P450scc, and 3-beta-hydroxysteroid dehydrogenase:
3␤HSD), angiogenesis (vascular endothelial growth fac-
tor: VEGF, insulin like growth factor: IGF1, and fibroblast
growth factor: FGF2), luteal maintenance (interleukin 1␣:
IL1A and tumor necrotic factor ␣: TNF), and apoptosis or
heat stress (BAX, BCL2, and HSPA1A). We hypothesized
that expression of aforementioned gene transcripts differ
between CL of dairy heifers and lactating dairy cows.
2. Materials and methods
2.1. Animals and treatments
This study was conducted at UBC Dairy Education and
Research Centre in Agassiz, British Columbia, Canada. Dairy
heifers (14 months of age) and second or third parity lac-
tating dairy cows (60 days post-partum, BCS – 2.75) with
regular ovarian activity and no reproductive abnormali-
ties were treated with a protocol to synchronize time of
ovulation (Aali et al., 2004). Briefly, animals were treated
with GnRH (buserelin; 100 ␮g; im) followed by dinoprost
tromethamine (lutalyse; 25 mg; im) 7 days later, and a
second dose of GnRH (buserelin; 100 ␮g; im) was admin-
istered 48 h after dinoprost treatment. All animals were
examined once a day from the day of first GnRH treatment
until enucleation for ovulation (day 0) and development of
CL using ultrasonography and CL were enucleated on day
10 from five animals in each group. Animals were housed in
free stall barns and fed a total mixed ration of corn and grass
silage, hay and concentrates. Lactating dairy cows were fed
twice daily and dairy heifers were fed once daily according
to their dry matter requirements (NRC, 2001). All handling
and management of animals used in this study were in
accordance with the guidelines of the Canadian Council on
Animal Care (1993) and approved by the Animal Care and
Use Committee of the University of British Columbia.
219
2.2. Corpus luteum enucleation and processing
Epidural anesthesia (lidocaine; 2%; 4–5 mL) was admin-
istered to lactating dairy cows and an incision was made in
the ventral wall of the vagina and CL removed as previously
described (Aali et al., 2004). In heifers, CL was removed sur-
gically through a flank incision under paralumbar block and
using lidocaine hydrochloride (lidocaine; 2%; 4–5 mL). In all
animals CL were located and enucleated by applying gen-
tle pressure to the ovarian area surrounding the gland. All
animals were moved and housed in individual free stalls
for recovery and observed continually during the first 12 h
after surgery, and were kept in individual pens for 3–5 days.
Soon after the enucleation, CL was snap frozen in liquid
nitrogen and stored at −80 ◦ C until processing. Blood sam-
ples were taken from the tail vein in all the animals on day
8 post-ovulation and on the day of enucleation (day 10) for
the determination of P4 concentrations. Plasma was sepa-
rated by centrifuging the blood samples at 1000 × g at 4 ◦ C
for 10 min and stored at −20 ◦ C until radioimmunoassay.
2.3. RNA extraction
Total RNA was extracted using a single step RNA iso-
lation method (Chomczynski and Sacchi, 1987), using
a commercially available total RNA isolation solution,
Tri Reagent (Sigma–Aldrich, USA). Briefly, luteal tissues
(100 mg) were pulverized in liquid nitrogen using mor-
tar and pestle, then immediately transferred into sterile
nuclease-free microcentrifuge tubes containing 1000 ␮L of
Tri Reagent. Contents were mixed thoroughly by vortex-
ing and allowed to stand for 5 min at room temperature.
Then 200 ␮L of chloroform was added to each tube, and
agitated vigorously for 30 s. The tubes were allowed to
stand at room temperature for 15 min and were cen-
trifuged at 12,000 × g for 15 min at 4 ◦ C. The top layer
with clear transparent solution was carefully transferred
into a new set of nuclease-free centrifuge tubes and added
750 ␮L of isopropanol to each tube. Contents were mixed
by slightly inverting the tube thrice, and again allowed to
stand at room temperature for 30 min before centrifugation
at 12,000 × g for 10 min at 4◦ C. Supernatant was discarded
and the pellet at the bottom of the tube was washed twice
with 1000 ␮L of ice-cold 75% ethanol by centrifugation
at 7500 × g for 5 min, air dried for 10–15 min thereafter,
and finally dissolved in 100 ␮L of sterile DEPC treated
water. The quantity and quality of RNA were assessed
by measuring the optical densities using Nanodrop ND-
1000 spectrophotometer and by observing clear bands for
28S, and 18S, ribosomal RNA species on ethidium bromide
stained agarose gel (1%). Total RNA was stored at −80◦ C for
copy DNA (cDNA) synthesis.
2.4. Reverse transcription
Reverse transcription (RT) of RNA was performed using
a first-strand cDNA synthesis kit (Cells-to-cDNATM II Kit,
Ambion, Austin, USA). The RT reactions were performed
by following the kit manufacturer’s protocol with slight
modification to match the experimental conditions. RNA
samples were treated with DNase and first-strand cDNA
220 T. Pretheeban et al. / Animal Reproduction Science 121 (2010) 218–224

Table 1
Details of the primers used for PCR amplification of corpus luteum genes.

Gene name Primer sequences (5 –3 ) Ta (◦ C) Gene accession number

GAPDH F – TGTTCCAGTATGATTCCACCC 58 U85042

R – AGGAGGCATTGCTGACAATC
VEGF F – TGTAATGACGAAAGTCTGCAG 60 M32976
R – TCACCGCCTCGGCTTGTCACA
IGF1 F – TCAGTTCGTGTGCGGAGACA 56 NM001077828
R – ACTTCCTTCTGAGCCTTGGG
FGF2 F – TACAACTTCAAGCAGAAGAG 56 NM174056
R – CAGCTCTTAGCAGACATTGG
StAR F – CATGGTGCTCCGCCCCTTGGCT 58 BC110213
R – CATTGCCCACAGACCTCTTGA
3␤HSD F – TGTTGGTGGAGGAGAAGG 58 BC111203
R – GGCCGTCTTGGATGATCT
CYP11A1 F – AACGTCCCTCCAGAACTGTACC 58 BC133389
R – CTTGCTTATTGCTCCCTCTGCC
IL1A F – CTCTCTCAATCAGAAGTCCTTCTATG 58 NM174092
R – CATGTCAAATTTCACTGCCTCCTCC
TNF F – GAAGCTGGAAGACAACCA 60 NM173966
R – TCCCAAAGTAGACCTGCC
BAX F – TGCTTCAGGGTTTCATCCAG 58 U92569
R – AACATTTCAGCCGCCACTC
BCL2 F – TTCGCCGAGATGTCCAGTCAGC 62 U92434
R – GTTGACGCTCTCCACACACA
HSPA1A F – CACTTCGTGGAGGAGTTCA 58 AY149619
R – GGTTGATGCTCTTGTTGAGG

F: forward primer; R: reverse primer; Ta : annealing temperature.

was synthesized by incubating a 20 ␮L reaction mixture
containing 2.5 ␮M of random decamers, 1.25 ␮M of oligo
dT primers, 0.25 mM of deoxyribonucleoside triphosphate
mixture, 2 ␮L of 10× RT buffer (pH 7.4), 0.5 U/␮L of RNase
inhibitor, 0.5 U/␮L of M-MLV reverse transcriptase, 2 ␮g of
total RNA and nuclease-free water at 42 ◦ C for 1 h. Inactiva-
tion of reverse transcriptase was performed by incubating
the reaction mixture at 94 ◦ C for 10 min and the product
was stored at −20◦ C to use in the PCR amplification.
2.5. Quantitative real-time PCR
gel. The gels were photographed under ultraviolet illumi-
nation. At the beginning of the experiment, all the primer
sets were standardized using semi-quantitative RT-PCR
and commercially available JumpStart RED Taq Ready Mix
PCR reaction mix (Jumpstart; Sigma–Aldrich Canada Ltd.,
Oakville, ON) from slaughter house CL samples. Amplifica-
tion of single bands was confirmed and the PCR products
were sequenced to confirm their identity. The primer
sequence, fragment size, annealing temperature, number
of PCR cycles, and gene accession number are provided in
Table 1.

Amount of mRNA was compared for all the genes in
this study using quantitative real-time PCR (Q-RT-PCR)
and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
as the housekeeping gene. PCR was performed using the
iCycler, CFX96 Real-Time PCR Detection System [Bio-Rad
laboratories (Canada) Ltd.], iQ SYBR Green Super Mix [Bio-
Rad laboratories (Canada) Ltd.] and gene specific primers
(Table 1). For each sample PCR reaction consisted of 2.5 ␮L
of cDNA (fractions of 1/20 of original cDNA), 10 ␮M of
each primer in a final volume of 25 ␮L per reaction. Reac-
tion conditions included an initial step of 95 ◦ C (5 min),
followed by 40 cycles of 95 ◦ C (15 s), 60 ◦ C (1 min), and
72 ◦ C (20 s). Melt curve analysis was performed for each
gene to confirm the presence of a single peak. Q-RT-PCR
data (Ct values) were analyzed using the comparative Ct
method (Livak and Schmittgen, 2001). Values (Ct values)
of all genes for each sample were adjusted according to
corresponding housekeeping/control gene (GAPDH) values
(Ct values). Calculations of relative quantitation were per-
formed using the sample with the lowest value in the
group as a control group and using the formula (2−Ct ).
The PCR products were confirmed by gel electrophoresis
using ethidium bromide (0.4 ␮g/mL) stained 1% agarose
2.6. Progesterone RIA
Radioimmunoassay was performed using a Coat-A-
Count progesterone kit (Diagnostic Products, Los Angeles,
USA). Reference standards or serum samples (100 ␮L) were
added to P4 antibody coated tubes. Buffered I125 -labelled P4
(1.0 mL) was added to all tubes and vortexed. After 3 h of
incubation, tubes were decanted and counted for radioac-
tivity on a gamma counter for 1 min and P4 concentrations
were detected. Coefficient of variation (CV) within (intra)
and between (inter) assays were 7% and 9%, respectively.
The sensitivity of the assay was 0.03 ng/mL.
2.7. Statistical analysis
Data analysis for mRNA expression and P4 concentration
were performed by one-way ANOVA. Mean separation pro-
cedure was performed when analysis of variance showed
significant F-values using Fisher’s least significant differ-
ence. The results were reported as the mean values for
each set of data ± SEM and statistical significance declared
at probability level (P) less than 0.05.
 T. Pretheeban et al. / Animal Reproduction Science 121 (2010) 218–224
Fig. 1. Amounts of mRNA of genes associated with (A) apoptosis and heat shock, (B) steroidogenesis, (C) angiogenesis and (D) luteal maintenance, in dairy
heifers and lactating dairy cows. The data are represented as mean ± SEM. *P < 0.05.
3. Results
3.1. mRNA of apoptotic molecules and heat shock protein
The quantitative RT-PCR results of luteal tissue mRNA
for apoptotic molecules (BAX and BCL2) and heat shock
protein (HSPA1A) are shown in Fig. 1A. Analysis of vari-
ance revealed greater mRNA of BCL2 (P < 0.05) in heifers,
compared to that of lactating cows. However, amounts of
BAX and HSPA1A did not differ between the two groups.
The ratio of BAX:BCL2 was greater in lactating dairy cows,
in comparison to that of dairy heifers.
3.2. mRNA of steroidogenic enzymes
The amounts of mRNA for the steroidogenic enzymes
in CL were examined using quantitative real-time PCR. No
differences were observed for the StAR and CYP11A1 mRNA
between dairy heifers and lactating dairy cows. There was
a greater amount of mRNA for 3␤HSD (P < 0.05) in dairy
heifers compared to that of lactating dairy cows (Fig. 1B).
3.3. mRNA of genes associated with angiogenesis
The quantitative real-time PCR results of luteal tissue
mRNA for genes associated with luteal angiogenesis (VEGF,
IGF1, and FGF2) was greater (P < 0.05) in dairy heifers com-
pared to that of lactating dairy cows (Fig. 1C).
221
3.4. mRNA of genes associated with luteal maintenance
When the mRNA of genes associated with luteal mainte-
nance was analyzed, IL1A was highly expressed in the CL of
dairy heifers, compared to that of lactating cows (P < 0.05).
TNF, mRNA was not different between these two groups
(Fig. 1D).
3.5. Progesterone assay
Plasma concentrations of P4 on days 8 and 10 of the
estrous cycle (mid luteal phase) did not show any signifi-
cant differences between dairy heifers and lactating dairy
cows (data not shown).
4. Discussion
Investigation of reduced PR in high producing dairy
cows is a complex procedure and comparing the quality of
CL using gene expression profiles will give an insight into
some of the underlying causes at molecular level. Proper
formation, function, and maintenance of CL are essential
for adequate P4 secretion which is critically important for
the early embryo development, implantation, and mainte-
nance of pregnancy in many animal species including cattle
(Niswender et al., 2000; Spencer et al., 2007).
Apoptosis is an important process that occurs at all
stages of the CL lifespan. The degree of apoptosis differs
between different stages especially between CL develop-
222 T. Pretheeban et al. / Animal Reproduction Science 121 (2010) 218–224
ment and regression. The apoptotic molecules of BCL2
family (activator, BAX and inhibitor, BCL2) are a determi-
nant of apoptotic status and the fate of cells in distinct
tissues including CL (Korsmeyer, 1995; Tilly, 1996). Find-
ings in the present study indicated greater BCL2 mRNA
and a lesser ratio of BAX:BCL2 mRNA in heifers compared
to lactating dairy cows. This indicates a possible occur-
rence of increased rate of apoptosis in CL of lactating
dairy cows compared to that of dairy heifers. It is fur-
ther supported by the studies in human CL, where they
have demonstrated the greatest amounts of BCL2 mRNA in
the midluteal functional CL and greatest amounts of BAX
mRNA in the regressing CL (Rueda et al., 1997; Sugino et
al., 2000).
Heat shock proteins are the molecular chaperones that
help other proteins to undergo folding, transport, and
assembly into multi-protein complexes, or to refold after
heat shock or other stresses (Didelot et al., 2007). It has been
widely recognized that HSPA1A promotes cell survival in a
variety of tissues by preventing apoptosis caused by differ-
ent means such as heat shock, UV radiation, and inadequate
nutrition (Beere, 2004, 2005). There is evidence for possi-
ble protective actions of HSPA1A during induced luteolysis
in sheep (McPherson et al., 1993), as well as a media-
tor in luteal regression in rats (Narayansingh et al., 2004).
When considering the stressors, especially heat shock, even
though both heifers and cows are managed under similar
conditions the effect of milk production causes an increase
in the body temperature in lactating dairy cows (Sartori
et al., 2002). Therefore, it was expected that an induced
expression of HSPA1A mRNA in cows compared to heifers
because of HSPA1A’s inducible nature by which it resists
subsequent apoptotic stimuli (Dimmeler and Zeiher, 1997).
However, in the present study, amount of HSPA1A mRNA
was not different between heifers and lactating dairy cows.
This might reflect the susceptibility of CL in lactating dairy
cows for apoptosis, compared to dairy heifers and also evi-
dent from the expression of apoptotic genes in the present
study. Furthermore, it is shown that nitric oxide mediated
inhibition of apoptosis in rat pre-ovulatory granulosa cells
is associated with an induction of HSPA1A (Yoon et al.,
2002).
Steroid biosynthesis in CL is controlled by the expres-
sion of various factors, mainly by StAR, CYP11A1, and
3␤HSD, which are recognized as luteal markers (Stocco et
al., 2007). In the present study, there were greater amounts
of 3␤HSD mRNA in CL of heifers compared to that of lac-
tating dairy cows, which suggests an enhanced capability
of P4 production by heifer CL. A gradual decline in amounts
of 3␤HSD mRNA will lead to a decrease in P4 production
which in turn could trigger the release of intraluteal PGF2␣
(Stocco and Deis, 1998; Arosh et al., 2004). Casey et al.
(2005) have demonstrated a sharp reduction in the amount
of StAR, CYP11A1, and 3␤HSD mRNA in regressed CL when
compared to non-regressed CL of same stage. Even though,
not significant, the amount of mRNA for StAR and CYP11A1
in the present study tends to be less in lactating dairy cows
(P = 0.15 and 0.20, respectively).
Angiogenesis plays an important role in the formation,
maintenance, and function of CL and several angiogenic fac-
tors are involved in this process including VEGF, FGF2, and
IGF1 (Schams and Berisha, 2002). We compared amounts
of mRNA of the aforementioned genes in CL of heifers and
lactating dairy cows, because inadequate luteal function
is associated with decreased luteal vascularity (Reynolds,
1986). Lesser amounts of mRNA found in the present study
for all three factors in lactating dairy cows may indicate
reduced vascularity in the CL of cows compared to that of
heifers. Furthermore, FGF2 acts as mitogen and induces the
secretion of P4 in CL of cattle during the mid luteal phase
(Miyamoto et al., 1992). The greater amounts of BCL2 mRNA
in the present study could also be due to the anti-apoptotic
effects of FGF2 and VEGF in endothelial cells (Pardo et al.,
2002; Bufalo et al., 2003). It is speculated that stimulation
of steroidogenesis and inhibition of apoptosis in the CL of
lactating dairy cows would be compromised due to the
lesser amounts of IGF1 mRNA compared to that of heifers
(Neuvians et al., 2003; Townson, 2006).
The role of cytokines such as IL1A and TNF in CL survival
and luteolysis is an active area of research. Treatment of
endometrium with IL1A increases the production of PGE2 ,
a luteotrophic factor and thereby the PGE2 :PGF2␣ ratio in
cows (Tanikawa et al., 2005; Okuda and Sakumoto, 2006;
Skarzynski et al., 2008). Also, it increases the production of
P4 and the lifespan of the CL. Greater amounts of IL1A mRNA
in heifers in the present study suggests a greater probabil-
ity of survival and function of their CL compared to that of
lactating dairy cows. Furthermore, endometrial production
of PGE2 increases during early and mid luteal phases in cat-
tle (Miyamoto et al., 2000; Murakami et al., 2001). This is
further supported from recent findings, that the expres-
sion of the IL1A gene is greater in the endometrium of
dairy heifers as indicated by amounts of mRNA and pro-
tein compared to lactating dairy cows (Pretheeban et al.,
2009). Luteal survival and P4 secretion were also enhanced
after treating endometrium with TNF in cattle (Miyamoto
et al., 2000; Skarzynski et al., 2000, 2003) during the mid
lueal phase of the estrous cycle. However, the present study
did not reveal any difference in the expression of luteal
TNF mRNA on day 10 between heifers and lactating dairy
cows.
Timing of post-ovulatory P4 rise, luteal survival and
continuous P4 production are important for the establish-
ment and maintenance of pregnancy rather than the final
concentrations of P4 during pre-implantation development
(Goff, 2004; Inskeep, 2004; Robinson et al., 2005). In the
present study, the P4 concentrations during the mid luteal
phase did not differ between dairy heifers and lactating
dairy cows. Optimal P4 concentration for enhancing PR in
cattle is not well established (Nogueira et al., 2004); not
only sub-optimal concentrations of P4 can cause luteol-
ysis but greater concentrations during early luteal phase
can also trigger premature release of PGF2␣ and luteoly-
sis (Nogueira et al., 2004). Furthermore, P4 concentration
during the previous estrous cycle can affect the embryo
survival of the preceding cycle (Shrestha et al., 2004).
Factors such as feed intake and milk yield can alter the
metabolism of P4 (McCann and Hansel, 1986; Wiltbank et
al., 2000; Rabiee et al., 2001) and thereby the peripheral
P4 concentrations might differ considerably from the local
concentrations needed for the establishment and mainte-
nance of pregnancy.
 T. Pretheeban et al. / Animal Reproduction Science 121 (2010) 218–224
5. Conclusion
From the present study, it is concluded that mRNA
of genes in the mid luteal phase CL differs between
dairy heifers and lactating dairy cows. Genes regulat-
ing angiogenic, steroidogenic, and luteotropic factors are
highly expressed in heifers compared to lactating dairy
cows, whereas apoptosis seemed to be more evident
in CL of lactating cows. Collectively these findings sug-
gest that CL of second/third parity lactating dairy cows
is compromised in luteotropic as well as steroidogenic
capacities on day 10 of the estrous cycle. However, the post-
transcription regulation of aforementioned factors should
be further studied in order to determine whether they have
a role in the reduction of PR observed in lactating dairy
cows.
Acknowledgements
The authors would like to acknowledge the support
provided by Natural Science and Engineering Council of
Canada (NSERC), Western Canada Genetic Centre (WEST-
GEN) and British Columbia Investment Agriculture, Canada
for this study.
References
Aali, M., Small, J.A., Giritharan, G., Ramakrishnappa, N., Cheng, K.M.,
Rajamahendran, R., 2004. In vitro assessment of corpus luteum func-
tions in cattle following Ovsynch and CIDR ovulation synchronization
protocols. Can. J. Anim. Sci. 84, 721–724.
Arosh, J.A., Banu, S.K., Chapdelaine, P., Madore, E., Sirois, J., Fortier, M.A.,
2004. Prostaglandin biosynthesis, transport, and signaling in corpus
luteum: a basis for autoregulation of luteal function. Endocrinology
145, 2551–2560.
Balendran, A., Gordon, M., Pretheeban, T., Singh, R., Perera, R., Rajamahen-
dran, R., 2008. Decreased fertility with increasing parity in lactating
dairy cows. Can. J. Anim. Sci. 88, 425–428.
Beere, H.M., 2004. The stress of dying: the role of heat shock proteins in
the regulation of apoptosis. J. Cell Sci. 117, 2641–2651.
Beere, H.M., 2005. Death versus survival: functional interaction between
the apoptotic and stress-inducible heat shock protein pathways. J.
Clin. Invest. 115, 2633–2639.
Binelli, M., Hampton, J., Buhi, W.C., Thatcher, W.W., 1999. Persistent dom-
inant follicle alters pattern of oviductal secretory proteins from cows
at estrus. Biol. Reprod. 61, 127–134.
Bufalo, D.D., Trisciuoglio, D., Scarsella, M., Zangemeister-Wittke, U., Zupi,
G., 2003. Treatment of melanoma cells with a bcl-2/bcl-xL anti-
sense oligonucleotide induces antiangiogenic activity. Oncogene 22,
8441–8447.
Butler, W.R., Calaman, J.J., Beam, S.W., 1996. Plasma and milk urea nitrogen
in relation to pregnancy rate in lactating dairy cattle. J. Anim. Sci. 74,
858–865.
Canadian Council on Animal Care, 1993. Guide to the Care and Use of
Experimental Animals, vol. 1., 2nd ed. CCAC, Ottawa, ON.
Casey, O.M., Morris, D.G., Powell, R., Sreenan, J.M., Fitzpatrick, R., 2005.
Analysis of gene expression in non-regressed and regressed bovine
corpus luteum tissue using a customized ovarian cDNA array. Theri-
ogenology 64, 1963–1976.
Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by
acid guanidinium thiocyanate–phenol–chloroform extraction. Anal.
Biochem. 162, 156–159.
Didelot, C., Lanneau, D., Brunet, M., Joly, A.L., de Thonel, A., Chiosis, G.,
Garrido, C., 2007. Anti cancer therapeutic approaches based on intra-
cellular and extracellular heat shock proteins. Curr. Med. Chem. 14,
2839–2847.
Dimmeler, S., Zeiher, A.M., 1997. Nitric oxide and apoptosis. Nitric Oxide
1, 275–281.
Goff, K.A., 2004. Steroid hormone modulation of prostaglandin secretion
in the ruminant endometrium during the estrous cycle. Biol. Reprod.
71, 11–16.
223
Goravanahally, M.P., Salem, M., Yao, J., Inskeep, E.K., Flores, J.A., 2009.
Differential gene expression in the bovine corpus luteum during
transition from early phase to midphase and its potential role in acqui-
sition of luteolytic sensitivity to prostaglandin F2 alpha. Biol. Reprod.
80, 980–988.
Gustafsson, H., Larsson, K., 1985. Embryonic mortality in heifers after arti-
ficial insemination and embryo transfer-differences between virgin
and repeat breeding heifers. Res. Vet. Sci. 39, 271–274.
Inskeep, E.K., 2004. Preovulatory, postovulatory, and postmaternal recog-
nition effects of concentrations of progesterone on embryonic survival
in the cow. J. Anim. Sci. 82 (E. Suppl.), E24–E39.
Korsmeyer, S., 1995. Regulators of cell death. Trends Genet. 11, 101–105.
Lamming, G.E., Darwash, A.O., Back, H.L., 1989. Corpus luteum func-
tion in dairy cows and embryo mortality. J. Reprod. Fertil. Suppl. 37,
245–252.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data
using real-time quantitative PCR and the 2-[delta] [delta] CT method.
Methods 25, 402–408.
Lopez, H., Satter, L.D., Wiltbank, M.C., 2004. Relationship between level of
milk production and estrous behavior of lactating dairy cows. Anim.
Reprod. Sci. 81, 209–223.
Lucy, M.C., 2001. Reproductive loss in high-producing dairy cattle: where
will it end? J. Dairy Sci. 84, 1277–1293.
Lucy, M.C., 2007. Fertility in high-producing dairy cows: reasons for
decline and corrective strategies for sustainable improvement. Soc.
Reprod. Fertil. Suppl. 64, 237–254.
Mann, G.E., Lamming, G.E., 2001. Relationship between the maternal
endocrine environment, early embryo development and the inhi-
bition of the luteolytic mechanism in the cow. Reproduction 121,
175–180.
Mann, G.E., Lamming, G.E., Fray, M.D., 1995. Plasma oestradiol during early
pregnancy in the cow and the effects of treatment with buserelin.
Anim. Reprod. Sci. 37, 121–131.
McCann, J.P., Hansel, W., 1986. Relationship between insulin and glucose
metabolism and pituitary ovarian functions in fasted heifers. Biol.
Reprod. 34, 630–641.
McPherson, L.A., Van Kirk, E.A., Murdoch, W.J., 1993. Localization of stress
protein-70 in ovine corpora lutea during prostaglandin-induced lute-
olysis. Prostaglandins 46, 433–440.
Miyamoto, A., Okuda, K., Schweigert, F.J., Schams, D., 1992. Effects of basic
fibroblast growth factor, transforming growth factor-␤ and nerve
growth factor on the secretory function of the bovine corpus luteum
in vitro. J. Endocrinol. 135, 103–114.
Miyamoto, Y., Skarzynski, D.J., Okuda, K., 2000. Is tumor necrosis factor
alpha a trigger for the initiation of endometrial prostaglandin F2 alpha
release at luteolysis in cattle? Biol. Reprod. 62, 1109–1115.
Murakami, S., Miyamoto, Y., Skarzynski, D.J., Okuda, K., 2001. Effects of
tumor necrosis factor-alpha on secretion of prostaglandin E2 and F2
alpha in bovine endometrium throughout the estrous cycle. Theri-
ogenology 55, 1667–1678.
Narayansingh, R.M., Senchyna, M., Vijayan, M.M., Carlson, J.C., 2004.
Expression of prostaglandin G/H synthase (PGHS) and heat shock
protein-70 (HSP-70) in the corpus luteum of prostaglandin F2␣
treated immature superovulated rats. Can. J. Physiol. Pharmacol. 82,
363–371.
National Research Council, 2001. Nutrient Requirements of Dairy Cattle,
7th ed. National Academy of Science, Washington, DC.
Neuvians, T.P., Pfaff, M.W., Berisha, B., Schams, D., 2003. The mRNA expres-
sion of the members of the IGF-system in bovine corpus luteum during
induced luteolysis. Domest. Anim. Endocrinol. 25, 359–372.
Niswender, G.D., Juengel, J.L., Silva, P.J., Rollyso, M.K., McIntush, E.W.,
2000. Mechanisms controlling the function and life span of the corpus
luteum. Physiol. Rev. 80, 1–29.
Nogueira, G.M.F., Melo, S.D., Carvalho, M.L., Fuck, E.J., Trinca, L.A., Barros,
C.M., 2004. Do high progesterone concentrations decrease pregnancy
rates in embryo recipients synchronized with PGF2a and eCG? Theri-
ogenology 61, 1283–1290.
Okuda, K., Sakumoto, R., 2006. Regulation of uterine function by cytokines
in cows: Possible actions of tumor necrosis factor-alpha, interleukin-1
alpha and interferon-tau. Anim. Sci. J. 77, 266–274.
Opsomer, G., Coryn, M., Deluyker, H., de Kruif, A., 1998. An analysis of
ovarian dysfunction in high yielding dairy cows after calving based
on progesterone profiles. Reprod. Domest. Anim. 33, 193–204.
Pardo, O.E., Arcaro, A., Salerno, G., Raguz, S., Downward, J., Seckl, M.J., 2002.
Fibroblast growth factor-2 induces translational regulation of Bcl-XL
and Bcl-2 via a MEK-dependent pathway: correlation with resistance
to etoposide-induced apoptosis. J. Biol. Chem. 277, 12040–12046.
Pretheeban, T., Gordon, M., Singh, R., Rajamahendran, R., 2009. Endome-
trial gene and protein expressions in dairy cows and heifers. Biol.
Reprod. 81 (1 Suppl.), 305.
224 T. Pretheeban et al. / Animal Reproduction Science 121 (2010) 218–224
Pursley, J.R., Wiltbank, M.C., Stevenson, J.S., Ottbre, J.S., Garverick, H.A.,
Anderson, L.L., 1997. Pregnancy rates per artificial insemination for
cows and heifers inseminated at a synchronized ovulation or synchro-
nized estrus. J. Dairy Sci. 80, 295–300.
Rabiee, A.R., Macmillan, K.L., Schwarzenberger, F., 2001. Excretion rate of
progesterone in milk and faeces in lactating dairy cows with two levels
of milk yield. Reprod. Nutr. Dev. 41, 309–319.
Reynolds, L.P., 1986. Utero-ovarian interactions during early pregnancy:
role of conceptus-induced vasodilation. J. Anim. Sci. 62, 47–61.
Robinson, R.S., Hammond, A.J., Hunter, M.G., Mann, G.E., 2005. The induc-
tion of a delayed post-ovulatory progesterone rise in dairy cows: a
novel model. Domest. Anim. Endocrinol. 28, 285–295.
Rueda, B.R., Tilly, K.I., Hansen, T.R., Jolly, P.D., Hoyer, P.B., Tilly, J.L., 1997.
Increased Bax and interleukin-1b-converting enzyme messenger RNA
levels coincide with apoptosis in the corpus luteum during structural
regression. Biol. Reprod. 56, 186–193.
Sartori, R., Sartor-Bergfelt, R., Mertens, S.A., Guenther, J.N., Parrish, J.J.,
Wiltbank, M.C., 2002. Fertilization and early embryonic development
in heifers and lactating cows in summer and lactating and dry cows
in winter. J. Dairy Sci. 85, 2803–2812.
Schams, D., Berisha, B., 2002. Angiogenic factors (VEGF, FGF and IGF) in
the bovine corpus luteum. J. Reprod. Dev. 48, 233–242.
Shrestha, H.K., Nakao, T., Higaki, T., Suzuki, S., Akita, M., 2004. Resump-
tion of postpartum ovarian cyclicity in high-producing Holstein cows.
Theriogenology 61, 637–649.
Skarzynski, D.J., Bah, M.M., Deptula, K.M., Woclawek-Potocka, I.,
Korzekwa, A., Shibaya, M., Pilawski, W., Okuda, K., 2003. Roles of tumor
necrosis factor-␣ of the estrous cycle in cattle: an in vivo study. Biol.
Reprod. 69, 1907–1913.
Skarzynski, D.J., Majewska, M., Bah, M.M., Hapunik, J., Piotrowska, K.K.,
Okuda, K., 2008. Is interleukin 1␣ a luteotropic or luteolytic agent in
cattle? Biol. Reprod. 78, 60.
Skarzynski, D.J., Miyamoto, Y., Okuda, K., 2000. Production of
prostaglandin F2 alpha by cultured bovine endometrial cells in
response to tumor necrosis factor alpha: cell type specificity and
intracellular mechanisms. Biol. Reprod. 62, 1116–1120.
Spencer, T.E., Johnson, G.A., Bazer, F.W., Burghardt, R.C., Palmarini, M.,
2007. Pregnancy recognition and conceptus implantation in domestic
ruminants: roles of progesterone, interferons and endogenous retro-
viruses. Reprod. Fertil. Dev. 19, 65–78.
Stocco, C., Telleria, C., Gibori, G., 2007. The molecular control of cor-
pus luteum formation, function, and regression. Endocr. Rev. 28,
117–149.
Stocco, C.O., Deis, R.P., 1998. Participation of intraluteal progesterone
and prostaglandin F2␣ in LH-induced luteolysis in pregnant rat. J.
Endocrinol. 156, 253–259.
Sugino, N., Suzuki, T., Kashida, S., Karube, A., Takiguchi, S., Kato, H.,
2000. Expression of Bcl-2 and Bax in the human corpus luteum
during the menstrual cycle and in early pregnancy: regulation
by human chorionic gonadotropin. J. Clin. Endocrinol. Metab. 85,
4379–4386.
Tanikawa, M., Acosta, T.J., Fukui, T., Murakami, S., Korzekwa, A., Skarzynski,
D.J., Park, C.K., Okuda, K., 2005. Regulation of prostaglandin synthe-
sis by interleukin-1 alpha in bovine endometrium during the estrous
cycle. Prostaglandins Other Lipid Mediat. 78, 279–290.
Tilly, J.L., 1996. Apoptosis and ovarian function. Rev. Reprod. 1, 162–172.
Townson, H.D., 2006. Immune cell-endothelial cell interactions in the
bovine corpus luteum. Integr. Comp. Biol. 46, 1055–1059.
Wiltbank, M.C., Fricke, P.M., Sangsritavong, S., Sartori, R., Ginther, O.J.,
2000. Mechanisms that prevent and produce double ovulation in dairy
cattle. J. Dairy Sci. 83, 2998–3007.
Wolfenson, D., Inbar, G., Roth, Z., Kaim, M., Bloch, A., Braw-Tal,
R., 2004. Follicular dynamics and concentrations of steroids and
gonadotropins in lactating cows and nulliparous heifers. Theriogenol-
ogy 62, 1042–1055.
Yoon, S.J., Choi, K.H., Lee, K.A., 2002. Nitric oxide-mediated inhibition of
follicular apoptosis is associated with HSP70 Induction and Bax sup-
pression. Mol. Reprod. Dev. 61, 504–510.
 Animal Reproduction Science 121 (2010) 225–235

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Expression analysis of circadian genes in oocytes and preimplantation

embryos of cattle and rabbits
Tomoko Amano a,∗ , Kaori Tokunaga a , Reiko Kakegawa a , Ayaka Yanagisawa a ,
Atsushi Takemoto a , Atsuhiro Tatemizo a , Tatsuya Watanabe a , Yuki Hatanaka a ,
Akinori Matsushita a , Masao Kishi b , Masayuki Anzai b , Hiromi Kato b , Tasuku Mitani b ,
Satoshi Kishigami a , Kazuhiro Saeki a , Yoshihiko Hosoi a ,
Akira Iritani a,b , Kazuya Matsumoto a
a
Department of Genetic Engineering, College of Biology-Oriented Science and Technology, Kinki University, 930 Nishimitani, Kinokawa, Wakayama
649-6493, Japan
b
Institute of Advanced Technology, Kinki University, 14-1 Akasaka, Kainan, Wakayama 642-0017, Japan

a r t i c l e i n f o a b s t r a c t

Article history: We previously showed that circadian genes clock, bmal1, cry1, cry2, per1, and per2
Received 5 January 2010 are expressed and function as maternal mRNA regulating events in the oocytes and
Received in revised form 14 May 2010
preimplantation embryos of mice. Recent evidence indicates however that either or both
Accepted 27 May 2010
expression profiles of circadian genes in some tissues, and transcript sequences of circadian
Available online 4 June 2010
genes, differ to generate the physiological differences between diurnal and nocturnal
species. We therefore investigated the expression profiles of circadian genes in oocytes
Keywords:
and preimplantation embryos of species other than mice, namely cattle and rabbits,
Circadian genes
Oocytes representing diurnal and nocturnal species, respectively, and determined the protein
Preimplantation embryos sequences of circadian genes in these species. Quantitative real-time PCR revealed that all
Rabbits circadian genes considered in this study were present in the oocytes and preimplantation
Cattle embryos of both species, and the transcript amounts of clock, cry1 and per1 contained in
oocytes were significantly higher than in preimplantation embryos of both species. The
transcripts of clock, cry1, and per1 of cattle and rabbits were determined by primer walking,
and functional domains in the estimated amino acid sequences were compared between
cattle and rabbits and with those of humans and mice. The sequences of clock, cry1, and
per1 in cattle and rabbits closely resembled those in mice (85–100% homologies), and no
difference based on diurnality or nocturnality was observed. These findings suggest that
circadian genes in the oocytes and preimplantation embryos of mammals fulfill the same
functions across species as maternal mRNA.
© 2010 Elsevier B.V. All rights reserved.

1. Introduction tors that regulate the circadian clock in mammals (Dunlap,

Circadian genes (clock, bmal11, cry1, cry2, per1, and
per2) are known to encode transcription regulation fac-
∗ Corresponding author. Tel.: +81 0736 77 0345.
E-mail addresses: amino@waka.kindai.ac.jp,
amano@waka.kindai.ac.jp (T. Amano).
1999; Reppert and Weaver, 2001). They are expressed
in most organs, tissues, and cells and are classified
into two groups: transcription-promoting factors CLOCK
and BMAL1; and transcription-suppression factors CRY1,
CRY2, PER1, and PER2. Since the transcription activity of
each group alternatively oscillates, peaking nearly every
12 h, numerous genes that have their transcription reg-
ulated by circadian genes are repetitively transcribed

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.05.020
226 T. Amano et al. / Animal Reproduction Science 121 (2010) 225–235
every 24 h, thereby regulating many circadian physiologi-
cal phenomena (Dunlap, 1999; Reppert and Weaver, 2001;
Albrecht, 2007). Moreover, the transcription rhythms of
circadian genes in most parts of the body are synchro-
nized with those in the suprachiasmatic nucleus (SCN),
which converts light/dark information transmitted by
the optic nerve from the environment into transcrip-
tion oscillations of circadian genes, although the factors
involved in this synchronization have not been fully clar-
ified (Dunlap, 1999; Reppert and Weaver, 2001; Albrecht,
2007).
Studies to date have suggested that the transcription
rhythms of circadian genes in diurnal and nocturnal species
are the same in the SCN but differ in peripheral organs,
tissues, and cells. These differing peripheral transcription
patterns are thought to be one of the basic mechanisms
underlying the physiological differences between noctur-
nal and diurnal species (Smale et al., 2003; Mahoney
et al., 2004; Schwartz et al., 2004; Doyle et al., 2008;
Yan et al., 2008; Chappell et al., 2009). For example, the
transcript quantities of bmal1 and per 2 in the skele-
tal muscle of nocturnal and diurnal species peak at
opposite times of the day (Yan et al., 2008). Moreover,
although the transcription patterns of circadian genes in
the SCN in the nocturnal lab-rat species Rattus norvegi-
cus and diurnal grass-rat species Arvicanthis niloticus are
the same, the daily rhythm in activity of their GnRH neu-
rons, which is controlled by circadian genes transcribed
within the GnRH neurons themselves, shows a phase dif-
ference of 12 h (Mahoney et al., 2004; Chappell et al.,
2009).
In mammalian ovaries, when the follicle is recruited
for growth, the oocytes in the follicle undergo a burst of
transcription and translation activity. Some of the tran-
scripts transcribed are long-lived and accumulate in the
oocytes as maternal mRNA. This maternal mRNA is impor-
tant for promoting the subsequent processes of meiosis
and development of preimplantation embryos (Gosden,
2002; Lonergan et al., 2003; Mtango et al., 2008). More-
over, maternal mRNA is abundant in immature oocytes
(GV oocytes), but begins to decrease due to consumption
with the start of oocyte maturation and is almost com-
pletely depleted by the blastocyst stage (Nothias et al.,
1995; Latham, 1999; Gosden, 2002; Hamatani et al., 2004,
2008).
In a previous study, we found transcripts of circadian
genes in the oocytes and preimplantation embryos of mice,
although their quantities did not oscillate every 24 h like
that observed in other cells (Amano et al., 2009). We
also found that the expression patterns of some circadian
genes, such as clock, bmal1, cry1, and per1, in the oocytes
and preimplantation embryos of mice are consistent with
those of maternal mRNA, such as an abundance of these
transcripts in GV oocytes and the subsequent decrease in
transcript amounts with the beginning of oocyte matura-
tion, and involvement of cry1 in oocyte maturation (Amano
et al., 2009).
Although these findings suggest circadian genes play a
role in the oocyte and early preimplantation embryo other
than regulation of the circadian rhythm, the expression
profiles of circadian genes in oocytes and preimplanta-
tion embryos may different between species, especially
between that of diurnal and nocturnal species, and
these genes may be involved in the physiological differ-
ences in oocytes and preimplantation embryos of each
species. These possibilities warrant investigation into the
expression profiles of circadian genes in the oocytes and
preimplantation embryos of other nocturnal and diurnal
species.
In fact, the species differences in the oocyte maturation
time and the development of preimplantation embryos
from the 1-cell to blastocyst stage are well known (Hosoi
et al., 1981; Dominko and First, 1997; Polanski et al., 1998;
Latham et al., 1999). These differences explain the inter-
est in identifying maternal mRNAs that are differently
expressed between the oocytes and blastocysts of each
species and able to modulate the speed of cell-cycle pro-
gression, which is an important factor in regulating the
speed of oocyte maturation and preimplantation embryos
development. Since the circadian genes are reported to be
differently expressed between the peripheral organs, tis-
sues, and cells of diurnal and nocturnal species (Smale et
al., 2003; Mahoney et al., 2004; Schwartz et al., 2004; Doyle
et al., 2008; Yan et al., 2008; Chappell et al., 2009) and
to play a role in the modulation of cell cycle progression,
including meiosis (Matsuo et al., 2003; Nagoshi et al., 2004;
Amano et al., 2009), mRNAs of circadian genes appear to
be good candidates for maternal mRNAs that are differ-
ently expressed between the oocytes and blastocysts of
each species and able to modulate the speed of cell-cycle
progression.
Further, it has been shown that a point mutation in the
CSNK1E-binding domain of per2 brings forward the timing
of the sleep phase in humans, suggesting that inter-species
differences in the timing of daily active and inactive phases
may be explained by differences in the functional domain
sequences of proteins derived from circadian genes (Toh
et al., 2001; Ebisawa, 2007). Although this also suggests
the importance of considering differences between diurnal
and nocturnal species in protein sequences derived from
circadian genes when assessing for universal functionality
of these genes in the oocytes and preimplantation embryos
of mammals, the source animals used to obtain the protein
sequences derived from circadian genes are often limited
to common experimental animals, which are commonly
nocturnal species such as mice and rats. Sequence infor-
mation of circadian genes provided by on-line databases is
therefore limited.
In this study, to compare differences between diurnal
and nocturnal species in expression profiles of circa-
dian genes in oocytes and preimplantation embryos, we
investigated the expression profiles of circadian genes
in the oocytes and preimplantation embryos of cattle
and rabbits, representing diurnal and nocturnal mam-
mals, respectively (Gonyou and Stricklin, 1984; Linnane et
al., 2001). Results were compared with those previously
analyzed for mice. We also determined the amino acid
sequences of the functional domains of proteins derived
from circadian genes in cattle and rabbits, which have
not been available in on-line databases, using transcript
sequences, and compared them to those of humans and
mice.
 T. Amano et al. / Animal Reproduction Science 121 (2010) 225–235
2. Materials and methods
2.1. Media
For cattle, 25 mM Hepes-buffered TCM199 medium
with Hanks’ salts (H199-H; Gibco, Invitrogen Life Tech-
nologies, Tokyo, Japan) supplemented with 5% (v/v) FBS
was used to handle the cumulus-oocyte complexes (COCs),
oocytes, and preimplantation embryos in air (handling
medium). Twenty-five millimolar Hepes-buffered TCM199
medium to which 5% (v/v) FBS, 0.5 mM sodium pyru-
vate, 25 mg/ml gentamicin, 0.02 Armour unit (AU)/ml FSH
(Antrin; Kawasaki Seiyaku, Tokyo, Japan), and 1 mg/ml
estradiol-17b were added was used for the maturation
of oocytes (maturation medium). Brackett and Oliphant
medium (Brackett and Oliphant, 1975) excluding glu-
cose and supplemented with 10 mg/ml heparin was used
for in vitro fertilization (fertilization medium). SOFaa
medium from which potassium phosphate monobasic was
removed was used for the development of the preim-
plantation embryos (development medium) (Tervit et
al., 1972; Takahashi and First, 1992; Saeki et al., 1998).
The handling medium was warmed before use to 39 ◦ C,
while the maturation and fertilization media were incu-
bated before use in CO2 (humidified atmosphere of 5%
CO2 in air at 37 ◦ C) and CO2 /O2 (humidified atmosphere
of 5% CO2 , 5% O2 and 90% N2 set at 38 ◦ C) incubators,
respectively.
For rabbits, M2 medium (Quinn et al., 1982) was
used to handle the COCs, oocytes, and preimplanta-
tion embryos in air (handling medium). Brackett and
Oliphant medium to which 3 mg/ml bovine serum albu-
min (BSA; A-7638; Sigma-Aldrich, St. Louis, MO) was added
was used for in vitro fertilization (fertilization medium).
Three milligrams per milliliter BSA-supplemented TCM
199 medium (680557; Nissui Pharmaceutical, Tokyo,
Japan) was used for the development of the preimplan-
tation embryos (development medium). The handling
medium was warmed before use to 38 ◦ C, while the fer-
tilization developmental media were incubated before
use in CO2 (humidified atmosphere of 5% CO2 in air
at 37 ◦ C) and CO2 /O2 (humidified atmosphere of 5%
CO2 , 5% O2 and 90% N2 set at 39 ◦ C) incubators,
respectively.
2.2. Collection of oocytes and preimplantation embryos
from cattle and rabbits
2.2.1. Animals and their care
Sexually mature male and female New Zealand White
and Japanese White rabbits (1–2 years old) were individ-
ually housed under a lighting schedule with 14 h of light
(08:00–22:00) followed by 10 h of darkness. All proce-
dures involving animals conformed to the Kinki University
Guidelines for the Care and Use of Laboratory Animals.
2.2.2. Collection of immature oocytes from cattle and in
vitro maturation
Collection of immature oocytes from cattle and in vitro
production of mature oocytes was performed according
to a previously described method (Saeki et al., 1998).
227
Briefly, cattle ovaries were collected at a local abattoir
and transported to the laboratory within 1 h after col-
lection in a sterile saline solution (0.85% NaCl) kept at
20–25 ◦ C. COCs were aspirated from antral follicles 2–8 mm
in diameter using a 21-gauge needle attached to a 10-
ml disposable syringe and then pooled in a 15-ml test
tube placed in a water bath at 37 ◦ C. The sediment in
the test tube was collected and put into a 35-mm dis-
posable dish containing handling medium, and the COCs
were collected by a capillary tube attached to a rubber
tube operated by mouth suction. For the collection of
immature oocytes, 60 COCs were collected and the oocytes
were detached from the cumulus cells by vigorous pipet-
ting. The immature oocytes were then separated into 3
groups of 20 each, and each group was collected into a
1.5-ml disposable tube. The tubes were then frozen with
liquid nitrogen immediately after collection and stored at
−80 ◦ C until mRNA extraction. For production of mature
oocytes, COCs collected from ovaries were separated into
groups of 10 each and put into a 50-␮l drop of matu-
ration medium covered with mineral oil. The maturation
media containing COCs were then cultured for 21 h in
an incubator (humidified atmosphere of 5% CO2 in air at
39 ◦ C), and the cumulus cells of COCs were subsequently
detached from the oocytes by vigorous pipetting and
hyaluronidase treatment. For mRNA extraction, 60 oocytes
that had first polar bodies were collected as matured
oocytes, and the matured oocytes were separated into 3
groups of 20 each and collected into 1.5-ml disposable
tubes. The tubes were then frozen in liquid nitrogen imme-
diately after collection and stored at −80 ◦ C until mRNA
extraction.
2.2.3. Production of cattle preimplantation embryos
In vitro fertilization and culturing of preimplanta-
tion embryos was performed according to a previously
described method with slight modifications (Saeki et al.,
1998). Briefly, approximately 200 mature oocytes obtained
by the above methods were separated into groups of 20–25
each, and each group was put into a 50 ␮l drop of fer-
tilization medium covered with mineral oil. The drops
of fertilization medium containing matured oocytes were
placed in a CO2 incubator (humidified atmosphere of 5%
CO2 in air at 37 ◦ C) until insemination. Cattle spermatozoa
stored in a storage straw in liquid nitrogen were thawed in
a water bath set at 37 ◦ C, put on a discontinuous gradient
percoll solution (Amersham Biosciences, Uppsala, Sweden;
Pousette et al., 1986) in a 15-ml conical tube, and cen-
trifuged at 1900 rpm for 30 min. After centrifugation, the
supernatant containing percoll solution and spermatozoa
of low fertilization ability was removed, and the remaining
spermatozoa sediment was suspended into 10 ml of fer-
tilization medium. The spermatozoa concentration in the
suspension was adjusted by addition of an adequate vol-
ume of fertilization medium, and the final concentration of
spermatozoa in the drops of fertilization medium contain-
ing COCs was adjusted to 2.0 × 106 /ml by addition of 50 ␮l
of suspension. The time of spermatozoa addition to the fer-
tilization medium was set as 0 h post-insemination (hpi).
The co-culture of COCs and spermatozoa was continued for
9 h, the time required for 60% of oocytes to be fertilized.
228 T. Amano et al. / Animal Reproduction Science 121 (2010) 225–235
After co-culture, the spermatozoa and cumulus cells were
put into 10 ml of developmental medium in a 15-ml coni-
cal tube. The tube was vortexed to remove the spermatozoa
and cumulus cells from the oocytes, and the oocytes, now
defined as 1-cell embryos, were subsequently collected.
The 1-cell embryos were then separated into groups of 20
each, 3 of which were separately put into 1.5-ml disposable
tubes immediately after collection, frozen in liquid nitro-
gen, and stored at −80 ◦ C until mRNA extraction. Each of
the remaining groups was transferred to 100 ␮l of devel-
opmental medium covered with mineral oil and incubated
for a determined time in an incubator (humidified atmo-
sphere of 5% CO2 , 5% O2 and 90% N2 at 39 ◦ C). Incubation of
1-cell embryos was continued until 30, 36, 60, 84, 144, and
168 hpi, at which time respective 2-cell embryos, 4-cell
embryos, early 8-cell embryos, late 8-cell embryos, com-
pacted morulae (CM), and blastocysts (BL) were collected
and accordingly named.
Embryos of a certain developmental stage at each time-
point were collected from 2 or 3 drops of developmental
medium, and the drops that had been used for the collec-
tion of the embryos were discarded. The embryos collected
at each time-point were put into 1.5-ml disposable tubes,
frozen with liquid nitrogen immediately after collection,
and the tubes were then stored at −80 ◦ C until mRNA
extraction. The in vitro fertilization and culture procedure
was repeated until 60 embryos were collected from each
post-insemination time-point.
2.2.4. Collection of immature and matured oocytes from
rabbits
Collection of immature and matured oocytes from rab-
bits was performed according to a previously described
method with slight modifications (Hosoi et al., 1981;
Kanaya et al., 2007). Briefly, for the collection of immature
oocytes, 5 female rabbits were injected with 80 IU of preg-
nant mare serum gonadotrophin (PMSG; Sankyo Lifetech)
at 19:00 and sacrificed by intravenous injection of pen-
tobarbital 72 h later. Ovaries were collected immediately
after sacrifice and the COCs were aspirated from antral fol-
licles 1-5 mm in diameter using a 24-gauge needle attached
to a 5-ml disposable syringe. Collected COCs were trans-
ferred to a 35-mm disposable dish containing handling
medium, and the cumulus cells were detached from the
oocytes by vigorous pipetting. Sixty oocytes with germinal
vesicles were collected as immature oocytes. Groups of 20
each were then put into 1.5-ml tubes, frozen in liquid nitro-
gen, and the tubes were then stored at −80 ◦ C until mRNA
extraction.
For the collection of mature oocytes, 7 female rab-
bits were injected with 80 IU PMSG at 19:00, and 60 IU
of human chorionic gonadotropin (hCG; Sankyo Lifetech)
was injected 72 h later. The rabbits were then sacrificed
14 h thereafter, and COCs were obtained from the fal-
lopian tubes. Cumulus cells were detached from oocytes
by hyaluronidase treatment and vigorous pipetting, and
80 oocytes with extruded polar bodies were collected as
matured oocytes. Groups of 20 mature oocytes each were
put into 1.5-ml disposable tubes, immediately frozen in liq-
uid nitrogen, and the tubes were then stored at −80 ◦ C until
mRNA collection.
2.2.5. Production of rabbit preimplantation embryos
Production of rabbit preimplantation embryos was per-
formed according to previously described methods with
slight modifications (Hosoi et al., 1981). Briefly, 9 female
rabbits were injected with 80 IU PMSG at 19:00 and 60 IU of
hCG was injected 72 h later. The rabbits were sacrificed 14 h
thereafter, and 107 COCs were obtained from the fallopian
tubes. The COCs were separated into groups of 20–22 each
and put into 50-␮l drops of fertilization medium covered
with mineral oil. The fertilization medium drops contain-
ing COCs were incubated in a CO2 incubator (humidified
atmosphere of 5% CO2 in air at 37 ◦ C) until insemination.
Approximately 300 ␮l of sperm was collected from the
epididymis of a male rabbit and suspended in 5 ml of fertil-
ization medium in a 15-ml disposal tube. The suspension
was then centrifuged to remove the supernatant contain-
ing seminal plasma, and after removal of the supernatant,
5 ml of fertilization medium was added to the remaining
sediment to suspend the spermatozoa. The spermatozoa
in suspension were incubated in a CO2 incubator (humid-
ified atmosphere of 5% CO2 in air at 37 ◦ C) for 10 h to
induce spermatozoa capacitation. The spermatozoa con-
centration in the suspension was adjusted by addition of
an adequate volume of fertilization medium, and the final
concentration of spermatozoa in the drops of fertilization
medium containing COCs was adjusted to 1.5 × 106 /ml by
addition of 50 ␮l of suspension. The drops containing both
COCs and spermatozoa were incubated in an incubator
(humidified atmosphere of 5% CO2 at 37 ◦ C) for 6 h, and
then the oocyte-attached cumulus cells and spermatozoa
were removed by hyaluronidase treatment and vigorous
pipetting. Eighty oocytes having two pronuclei were then
collected as 1-cell embryos. Groups of 20 were put into 1.5-
ml disposable tubes, immediately frozen in liquid nitrogen,
and the tubes were then stored at −80 ◦ C until mRNA
collection.
2.3. mRNA extraction and cDNA synthesis
mRNA extraction and cDNA synthesis were performed
according to previously described methods with slight
modifications (Amano et al., 2009). Briefly, the mRNA of
oocytes and preimplantation embryos was extracted using
a QuickPrep micro mRNA purification kit (GE Healthcare,
CT). Four hundred microliters of extraction buffer produced
by the manufacturer was added to each tube contain-
ing oocytes and preimplantation embryos, and the tubes
were vortexed to extract the total RNA. For the tubes used
in the collection of cattle embryos, 20 ␮l of extraction
buffer was added per embryo. The total volume of RNA
extract obtained at each post-insemination time-point was
1200 ␮l, and the total volume was divided into 3 sets of
400 ␮l, each containing the total RNA of 20 embryos, and
put into 1.5-ml disposable tubes. The total RNA extract in
each tube was applied to the column attached to the kit
to extract the mRNA. The extracted mRNA in each tube
was incubated with DNase at 37 ◦ C for 30 min to remove
genomic DNA, and cDNA was then synthesized from the
purified mRNA using a SuperScriptTM III First Strand Syn-
thesis Kit with random hexamer (Invitrogen). The total
volume of each cDNA sample solution was adjusted to 10 ␮l
 T. Amano et al. / Animal Reproduction Science 121 (2010) 225–235 229

Table 1
Primers used for real-time quantitative PCR analysis of circadian gene transcripts of cattle and the amplicon characteristics.

Gene NCBI accession number (mouse) Forward or reverse Primer sequence 5 to 3 Amplicon length (bp)

Clock NM 007715 F GCCATGCAGCATCTCAAAGA 83

R CTTAGTTCTTCTTGCCGATCA

Bmal1 NM 007489 F CACTACGGAGTCGGTGGTTCA 74

R GGTGTTCGTGGAGACAATGTATTC

Cry1 NM 007771 F ACCATCCGCTGCGTCTAC 78

R CAAAAATCGCCACCTGTTGA

Cry2 NM 009963 F GCGATACCTGCCTAAACTGAAAG 86

R TGGCTGCCTTCTGAATGGA

Per1 NM 011065 F CCACACTGCAATACGCGCT 101

R TGTCCATGGCACACGGTTC

Per2 NM 011066 F TGCACGAGATTGAGGGCAT 84

R TACAGGGTCTTCCCGGTCAC

using TE, and the obtained cDNA samples were stored at
−20 ◦ C until use in real-time quantitative polymerase chain
reaction (real-time PCR).
2.4. Quantification of circadian gene transcripts in
oocytes and preimplantation embryos
Real-time PCR was performed using SYBR® Premix Ex
TaqTM II (Perfect Real Time; TaKaRa) and an ABI 7300 instru-
ment. Primers amplifying 71–127 bp DNA fragments of the
open reading frame (ORF) of each transcript of cattle and
rabbit clock, bmal1, cry1, and per1 and cattle cry2 and per2
were designed based on transcript sequences from the
primer walking method described below (Tables 1 and 2).
A 0.5 ␮l cDNA sample, which corresponded to one oocyte
or embryo, was added to each reaction tube. The amplifi-
cation profiles of the target DNA sequences in each tube
were checked by measuring the fluorescence intensity of
the dye, which emits fluorescence when intercalated to
double-stranded DNA and therefore increases with ampli-
fication of target DNA. To quantify the target DNA sequence
in each tube, Ct (threshold cycle), defined as the cycle
number at which the increase in fluorescence starts, was
determined for each tube. Transcript quantities were then
calculated by first measuring the Cts of solutions containing
107 , 106 , 105 , 104 , 103 and 102 copies/␮l of DNA fragment
for each gene. Then, for each gene, the Cts were plotted
against a log2 scale of each cDNA fragment concentration
to obtain a standard curve. To quantify the transcript con-
centration of each circadian gene, the Ct of each circadian
gene in each cDNA sample from a oocyte or preim-
plantation embryo was measured by real-time PCR and
then applied to the corresponding standard curve for that
gene.
After each run, the reaction tubes were gradually heated
above the amplicons’ melting temperatures, confirming
the specificity of the amplified products. The real-time
PCR reaction described above was also performed using
the series of cDNA samples obtained from one insemina-
tion, and the reaction used to plot the standard curve for
each target gene was performed at every run. To check the
amplification efficiency and reproducibility of each run of
real-time PCR, slopes and correlation coefficients (R2) were
calculated for the obtained standard curves. We confirmed
that the slopes of the standard curves were between −3.4
and −3.6 and the R2 for all standard curves were >0.95. In
addition, to check the reproducibility of the real-time PCR
quantification, quantification reactions of each target gene
transcript were performed twice for each cDNA sample in
each run, and we confirmed that the ratio of duplicated
data obtained from each target gene in the same cDNA
sample did not exceed the range of 1:1.7–1:1. To express
the data concisely, the duplicated data were averaged and
these data for each gene from each of the three samples
of GV oocytes, MII oocytes, and preimplantation embryos
obtained at each collection time-point were further aver-
aged and used as the representative amount of transcripts
for each gene (Figs. 1 and 2).
2.5. Protein sequence determination for CLOCK, CRY1,
and PER1 in cattle and rabbits
In this study, the amino acid sequences of CLOCK, CRY1,
and PER1 for cattle and rabbits were estimated from the

Table 2
Primers used for real-time quantitative PCR analysis of circadian gene transcripts of rabbits and the amplicon characteristics.

Gene NCBI accession number (mouse) Forward or reverse Primer sequence 5 to 3 Amplicon length (bp)

Clock NM 007715 F CCTGCAAATTTACCGATTCCA 71

R TGCTGCATGGCTCCTAATTG

Bmal1 NM 007489 F AGGAGGCAAGAAGATTTTAAATGGA 76

R CTCCTGAGCCTGTCCTGGTAATA

Cry1 NM 007771 F ACCAAGATCCGGGTTTCAGA 82

R AACTGAAGCACTTACACGTTTGGA

Per1 NM 011065 F ACCAAGATCCGGGTTTCAGA 127

R TGTGCCGCGTGGTGAAG
230 T. Amano et al. / Animal Reproduction Science 121 (2010) 225–235

Fig. 1. Expression profiles of circadian genes in the oocytes and preimplantation embryos of cattle. Mean (±SEM) quantity of transcripts of circadian
genes per 1 oocyte or preimplantation embryo of cattle. Abbreviations: GV, GV oocytes; MII, MII oocytes; E8-cell, early 8-cell embryos; L8-cell, late 8-cell
embryos; CM, compacted morulae; BL, blastocysts. Statistical significant differences between each developmental stage are denoted by differing letters
(all differences with P < 0.05).

mRNA sequences by primer walking using a DNASIS sys-
tem (Hitachi Lifescience Solutions, Tokyo, Japan). Briefly,
forward and reverse primers were designed to amplify
approximately 500 bp at the 5 end of the ORF of each tran-
script of clock, cry1 and per1 for cattle and rabbits by PCR
based on known mouse clock, cry1, and per1 sequences
(NCBI accession numbers NM 007715, NM 007771, and
NM 011065, respectively). cDNA synthesized from total
RNA extracted from cattle liver and rabbit kidney were
used as the PCR templates. Ex Taq (TaKaRa, Shiga, Japan)
was used as the DNA polymerase and conditions were
set in accordance with the manufacturer’s instructions.
The amplified DNA fragments were cloned by the blue-
white screening method. Competent cells (E-coli JM109
competent cells; TaKaRa) were transformed by plasmid
vectors (pGEM T-easy Vector; Promega, WI), into which the
DNA fragments were inserted. The cells were inoculated
on an LB plate containing carbenicilln with X-gal and iso-
propyl ␤-D-1-thiogalactopyranoside, and DNA fragments
were selected from the white colonies. The sequences of
these DNA fragments were determined by the dye ter-
minator method using a Big dye terminator (ABI) and
DNA sequencer (3730 DNA Analyzer, ABI), and the consis-
tency of the DNA-fragments derived from three different
white colonies on the same LB plate was confirmed. A
forward primer was then designed approximately 500 bp

Fig. 2. Expression profiles of circadian genes in the oocytes and preimplantation embryos of rabbits. Mean (±SEM) quantity of transcripts of circadian
genes per 1 oocytes or preimplantation embryo of rabbits. Abbreviations: GV, GV oocytes; MII, MII oocytes; E8-cell, early 8-cell embryos; L8-cell, late 8-cell
embryos; CM, compacted morulae; BL, blastocysts. Statistical significant differences between each developmental stage are denoted by differing letters
(all differences with P < 0.05).
 T. Amano et al. / Animal Reproduction Science 121 (2010) 225–235 231

from the 5 end of each gene transcript ORF. The cor-
responding reverse primer was designed approximately
500 bp from the 3 end based on the known mouse
sequences. The sequence determination for clock, cry1,
and per1 genes in cattle and rabbits was stopped when
it reached the base corresponding to the 3 end of each
ORF sequence for that of mice. The functional domains of
CLOCK, PER1, and CRY1 of cattle and rabbits were esti-
mated according to that of mice, which are available at
Uniprot (http://www.uniprot.org/) and have the accession
numbers O08785, O35973, and P97784, respectively. No
suitable primers could be designed for rabbit per1 and so
the last 200–300 bp of the transcript was not identified
(Fig. 3C).
2.6. Statistical analysis
Overall differences between groups were determined
by one-way ANOVA, and Fisher’s protected LSD multiple
comparison test was applied when the results of one-way
ANOVA were significant (P < 0.05). All statistical analyses
were performed using STATVIEW (Abacus Concepts, Pis-
cataway, NJ).
3. Results
3.1. Expression profiles of circadian genes in oocytes and
preimplantation embryos of cattle
Transcripts of clock, bmal1, cry1, cry2, per1, and per2
were detected in the oocytes and all stages of preimplanta-
tion embryos of cattle (Fig. 1). Transcripts of per1 were most
abundant in GV and MII oocytes (approximately 20,000
copies/oocyte) with the level 10- to 100-fold that of other
circadian genes detected in oocytes (Fig. 1). The next most
abundant transcripts in GV and MII oocytes were cry1
and clock, with 3000–4000 and 1000–2000 copies/oocyte,
respectively (Fig. 1). In contrast, the levels of cry2 and per2
transcripts in oocytes were less than 1000 copies/oocyte
and that of bmal1 was less than 100 copies/oocyte (Fig. 1).
Although the levels of clock, cry1, and per1 significantly
declined after fertilization (Fig. 1, P < 0.05), no significant
declines were observed in the levels of bmal1, cry2 and per2
transcripts in cattle (Fig. 1).
3.2. Expression profiles of circadian genes in oocytes and
preimplantation embryos of rabbits
Transcripts of clock, bmal1, cry1, and per1 were detected
in the oocytes and 1-cell embryos of rabbits (Fig. 2). Tran-
scripts of cry1 were abundant in GV and MII oocytes
(approximately 60,000 and 30,000 copies/oocyte) with
the levels 2- to 300-fold that of other circadian genes
(Fig. 2). The transcripts of per1 and clock were also abun-
dant in GV and MII oocytes, with 10,000–30,000 and
4000–6000 copies/oocyte, respectively (Fig. 2). In contrast,
the level of bmal1 transcripts was low (approximately 200
copies/oocytes) in GV and MII oocytes (Fig. 2). Although the
transcripts of bmal1, cry1 and per1 declined with matura-
tion (P < 0.05, Fig. 2), only the transcripts of cry1 declined
after fertilization (Fig. 2, P < 0.05).
3.3. Comparison between human, cattle, rabbit, and
mouse major functional domains of circadian gene
proteins
The transcripts of clock, cry1, and per1 were abundant
in the oocytes and preimplantation embryos of both cattle
and rabbits (Figs. 1 and 2) and so we focused on analyzing
the respective amino acid sequences of these genes.
The functional domains sequences were well conserved
between species, and the sequence homology of cattle
and of rabbits to that of mice was 85–100% (Table 3)
with no sequences specific to diurnal or nocturnal species
(Fig. 3A–C). As point mutations at the amino acid residues
656, 658, 659, 669, 670, and 672 in the Q-rich domain
of mouse CLOCK attenuate its transcription-promoting
activity by inducing failure of histone acetyltransferase

Table 3
Homologies of functional domains in CLOCK, CRY1 and PER1 of human, cattle and rabbit to those of mice.

a. CLOCK

HLH PAS1 PAS2 PAC Q-rich domain

Human 97.4% 100% 100% 100% 97.0%

Cattle 97.4% 100% 100% 100% 97.6%
Rabbit 97.4% 100% 100% 100% 85.5%

b. CRY1

DNA photolyase superfamily FAD-binding superfamily Region required for inhibition of

CLOCK-BMAL1-mediated transcription

Human 96.6% 100% 100%

Cattle 99.4% 100% 100%
Rabbit 96.0% 98.9% 99.0%

c. PER1

PAS1 PAS2 PAC Nuclear export signal 1 CSNK1E-binding domain Nuclear-localization signal

Human 97.0% 100% 100% 100% 91.4% 83.2%

Cattle 95.6% 100% 100% 100% ND ND
Rabbit 94.1% 97.0% 100% 92.3% 89.5% 88.2%
232 T. Amano et al. / Animal Reproduction Science 121 (2010) 225–235
 T. Amano et al. / Animal Reproduction Science 121 (2010) 225–235
recruitment (Doi et al., 2006), we compared these amino
acid residues between species. We found that the 656
amino acid residue in humans, cattle, and mice, shown as
amino acid residue 664 in Fig. 3A, was proline while in that
of rabbits was alanine.
4. Discussion
Here, we provided evidence that circadian genes
function universally across species as maternal mRNA
orchestrating events in the oocytes and preimplantation
embryos of mammals. This indicates that circadian genes
may have unique although as-yet unknown roles in the
physiological mechanisms of oocytes and preimplantation
embryos in mammals.
It has been previously shown that transcripts of all cir-
cadian genes are present in the oocytes of mice, and that
clock, bmal1, cry1, and per1 transcripts are more abun-
dant in oocytes and preimplantation embryos up until
the 2-cell stage than at subsequent developmental stages.
These findings are consistent with those observed in the
oocytes and preimplantation embryos of cattle and rabbits
in this study (Figs. 1 and 2). Considering these simi-
lar expression profiles of circadian genes in the oocytes
and preimplantation embryos of cattle, rabbits, and mice,
which between them represent both diurnal and nocturnal
mammalian species, it is reasonable to assume that circa-
dian gene transcripts play a regulatory role universal to
all mammals in the development of oocytes and preim-
plantation embryos (Amano et al., 2009). Moreover, it has
been shown that maternal mRNA important to the devel-
opment of oocytes and preimplantation embryos, such as
spindlin, zar1 and gdf9 is abundant in oocytes and then
decreases immediately after fertilization due to rapid con-
sumption (Oh et al., 1997; Gosden, 2002; Xumei et al.,
2003; Hanrahan et al., 2004). Our results therefore sug-
gest that the transcripts of all circadian genes are present
as maternal mRNA and that those of clock, cry1, and per1,
which are abundant in oocytes and decrease immedi-
ately after fertilization, are important for the development
of oocytes and preimplantation embryos in cattle and
rabbits.
In several mammal species, including mice and cat-
tle, it has been shown that oocytes and preimplantation
embryos must reach each developmental stage at a cer-
tain time-point, and those that reach each stage either
before or after this time will not develop further properly.
(Dominko and First, 1997; Polanski et al., 1998; Lonergan
et al., 2003). For this reason, although quantification of
transcripts within intervals of at least 6 h is required to
precisely detect oscillatory transcription that repeats every
24 h, we collected oocytes and preimplantation embryos in
a stage-specific manner that required intervals longer than
Fig. 3. Comparison of the amino acid sequences of proteins derived from circadian genes of humans, cattle, rabbits, and mice. (A) CLOCK amino acid
sequence. Numbered underlined sequences indicate functional domains: 1, HLH domain; 2, PAS domain 1; 3, PAS domain 2; 4, PAC domain; 5, Q-rich
domain. (B) CRY1 amino acid sequence. Numbered underlined sequences indicate functional domains: 1, DNA photolyase superfamily; 2, FAD-binding
superfamily; 3, Region required for inhibition of CLOCK-BMAL1-mediated transcription. (C) PER1 amino acid sequence. Numbered underlined sequences
indicate functional domains: 1, PAS domain1; 2, PAS domain 2; 3, PAC domain; 4, nuclear export signal; 5, CSNK1E-binding domain; 6, nuclear-localization
signal.
233
6 h (Figs. 1 and 2). Many studies have however shown that
until zygotic gene activation (ZGA), which occurs at the 4-
to -8 cell stage in cattle and the 8 to 16 cell stage in rab-
bits, transcription activity is almost totally suppressed. This
suggests transcripts of circadian genes detected in oocytes
and preimplantation embryos of cattle and rabbits up to
ZGA are present as maternal mRNA and not transcribed
during either or both meiosis and the developmental pro-
cess after fertilization (Nothias et al., 1995; Latham, 1999;
Memli and First, 2000; Parcheco-Trigon et al., 2002). More-
over, our data showed that transcripts of all circadian genes
considered in this study were almost totally depleted after
the 8-cell stage in cattle (Fig. 1) and the 2-cell stage in
mice preimplantation embryos, which are the respective
stages that ZGA starts in these species. This suggests circa-
dian genes are not transcribed in preimplantation embryos
of mammals after ZGA and are not involved in circadian
clock regulation in the preimplantation embryos after ZGA
(Amano et al., 2009).
It has previously been shown that bmal1 transcript
levels are abundant in mouse oocytes and preimplan-
tation embryos up until the 2-cell stage (approximately
20,000 copies/oocyte or embryo) (Amano et al., 2009).
Here, however, we found levels of these to be very low
in the oocytes and preimplantation embryos of all stages
in cattle and rabbits (50–200 copies/oocyte or embryo,
Figs. 1 and 2). Further, the relative transcript amounts
for each circadian gene were different in oocytes and
preimplantation embryos for cattle, rabbits, and mice, with
per1 > cry1 > clock in cattle, cry1 > per1 > clock in rabbits, and
clock > bmal1 > cry1 > per1 in mice (Figs. 1 and 2). Although
the mechanisms underlying and physiological meaning
of these differences are not known, several physiological
characteristics of oocytes and preimplantation embryos are
known to differ between species. For example, the timing
of ZGA during preimplantation embryo development varies
among species and is thought to depend on differences in
the oocyte and preimplantation embryo maternal mRNA of
each species. This suggests that differing expression pro-
files of circadian genes in oocytes and preimplantation
embryos between different species may play a role in deter-
mining their different physiological characteristics, such as
the timing of ZGA (Nothias, 1995; Latham, 1999).
Amino acid sequences of each functional domain in
CLOCK, CRY1, and PER1 were largely the same for humans,
cattle, rabbits, and mice and there were no sequences par-
ticularly unique to diurnal or nocturnal species, suggesting
that the functions of circadian genes in the oocytes and
preimplantation embryos of mammals are virtually univer-
sal (Fig. 3 and Table 3). The Q-rich domain in rabbit CLOCK
and the CSNK1E-binding domain and nuclear-localization
signal in PER1 of humans and cattle, however, showed
low homologies to those of mice (less than 90%) (Fig. 3
234 T. Amano et al. / Animal Reproduction Science 121 (2010) 225–235
and Table 3). These domains are known to regulate the
transcription activity of circadian gene-regulated genes;
for example, the Q-rich domain in CLOCK recruits his-
tone acetyltransferase to promote transcription activity
(Doi et al., 2006), and the CSNK1E-binding domain in
PER1 includes sites regulating the speed of its own degra-
dation depending on its phosphorylation state (Akashi
et al., 2002). Further, the nuclear-localization signal in
mouse PER1 transfers it to the nucleus, with CRY1 and
2 suppressing transcription activity (Loop et al., 2005).
In addition, as a mutation at amino acid residue 656 in
mouse CLOCK from proline to alanine has been shown to
degrade histone acetyltransferase activity and attenuate
the transcription-activation ability of mouse CLOCK (Doi et
al., 2006), our results showing alanine was the 656 amino
acid residue in rabbit CLOCK may indicate that mouse
CLOCK has a stronger transcription-promoting ability than
that of rabbit. Whether circadian genes are involved in
transcription suppression in oocytes and preimplantation
embryos remains unclear, and the possibility exists that the
observed functional domain sequence differences of cir-
cadian gene proteins between species might only reflect
differences between individual animals used for that anal-
ysis. Nonetheless, variations in these domains may reflect
differences in physiological characteristics of oocytes and
preimplantation embryos between species, such as the
time required for preimplantation embryos to reach a cer-
tain developmental stage (Amano et al., 2009).
In summary, our results suggest that, rather than act-
ing as regulators of the circadian clock, circadian genes
function universally across species as maternal mRNA
in mammals. This finding indicates that circadian genes
may have unique although as-yet unknown roles in the
physiological mechanisms of oocytes and preimplantation
embryos. Our results not only provide new information on
the functions of maternal mRNA in general, but also shed
light on the specific functions of circadian genes as mater-
nal mRNA.
Acknowledgements
We thank Ms. Madoka Ozawa, Ms. Yukihi Mera, Mr. Keiji
Masukura, and Mr. Hajime Takahashi for their excellent
technical support in rabbit oocyte collection and in vitro
fertilization. This study was supported by a grant from the
Wakayama Prefecture Collaboration of Regional Entities for
the Advancement of Technology Excellence Project (CRE-
ATE Project) of the Japan Science and Technology Agency
and a Grant-In-Aid for Young Scientists (19780210) from
the Japanese Ministry of Education, Culture, Sports, and
Technology.
Contributions. Conceived and designed the experiments:
Amano T, Kishi M, Anzai M, Kato H, Mitani T, Kishigami
S, Saeki K, Hosoi Y, Iritani A, Matsumoto K; quantified
the transcripts: Matsushita A, Kakegawa R, Yanagisawa A,
Watanabe T, Hatanaka Y; sequenced the DNA and analyzed
the data: Tokunaga K and Takemoto A; produced the cat-
tle samples: Tatemizo A and Saeki K; produced the rabbit
samples: Anzai M, Kishi M, Kato H, Mitani T, Kishigami S,
Hosoi Y; wrote the paper: Amano T.
References
Akashi, M., Tsuchiya, Y., Yoshino, T., Nishida, E., 2002. Control of intra-
cellular dynamics of mammalian period proteins by casein kinase I
epsilon (CKIepsilon) and CKIdelta in cultured cells. Mol. Cell. Biol. 22,
1693–1703.
Albrecht, U., 2007. Orchestration of gene expression and physiology by
the circadian clock. J. Physiol. Paris. 100, 243–251.
Amano, T., Matsushita, A., Hatanaka, Y., Watanabe, T., Oishi, K., Ishida,
N., Anzai, M., Mitani, T., Kato, H., Kishigami, S., Saeki, K., Hosoi, Y.,
Iritani, A., Matsumoto, K., 2009. Expression and functional analyses
of circadian genes in mouse oocytes and preimplantation embryos:
Cry1 is involved in the meiotic process independently of circadian
clock regulation. Biol. Reprod. 80, 473–483.
Brackett, B.G., Oliphant, G., 1975. Capacitation of rabbit spermatozoa in
vitro. Biol. Reprod. 12, 260–274.
Chappell, P.E., White, R.S., Mellon, P.L., 2009. Circadian gene expression
regulates pulsatile gonadotropin-releasing hormone (GnRH) secre-
tory patterns in the hypothalamic GnRH-secreting GT1-7cell line. J.
Neuroendocrinol. 21, 339–345.
Doi, M., Hirayama, J., Sassone-Corsi, P., 2006. Circadian regulator CLOCK
is a histone acetyltransferase. Cell 125, 497–508.
Dominko, T., First, N.L., 1997. Timing of meiotic progression in bovine
oocytes and its effect on early embryo development. Mol. Reprod. Dev.
47, 456–467.
Doyle, S.E., Yoshikawa, T., Hillson, H., Menaker, M., 2008. Retinal path-
ways influence temporal niche. Proc. Natl. Acad. Sci. U.S.A. 105,
12645–12646.
Dunlap, J.C., 1999. Molecular bases for circadian clocks. Cell 96, 271–290.
Ebisawa, T., 2007. Circadian rhythms in the CNS and peripheral clock dis-
orders: human sleep disorders and clock genes. J. Pharmacol. Sci. 103,
150–154.
Gonyou, H.W., Stricklin, W.R., 1984. Diurnal behavior patterns of feedlot
bulls during winter and spring in northern latitudes. J. Anim. Sci. 58,
1075–1083.
Gosden, R.G., 2002. Oogenesis as a foundation for embryogenesis. Mol.
Cell. Endocrinol. 186, 149–153.
Hamatani, T., Carter, M.G., Sharov, A.A., Ko, M.S., 2004. Dynamics of global
gene expression changes during mouse preimplantation develop-
ment. Dev. Cell. 6, 117–131.
Hamatani, T., Yamada, M., Akutsu, H., Kuji, N., Mochimaru, Y., Takano, M.,
Toyoda, M., Miyado, K., Umezawa, A., Yoshimura, Y., 2008. What can
we learn from gene expression profiling of mouse oocytes? Reproduc-
tion 135, 581–592.
Hanrahan, J., Gregan, S.M., Mulsant, P., Mullen, M., Davis, G.H., Powell,
R., Galloway, S.M., 2004. Mutations in the genes for oocyte-derived
growth factors GDF9 and BMP15 are associated with both increased
ovulation rate and sterility in Cambridge and Belclare sheep (Ovis
aries). Biol. Reprod. 70, 900–909.
Hosoi, Y., Niwa, K., Hatanaka, S., Iritani, A., 1981. Fertilization in vitro of
rabbit eggs by epididymal spermatozoa capacitated in a chemically
defined medium. Biol. Reprod. 24, 637–642.
Kanaya, H., Hashimoto, S., Teramura, T., Morimoto, Y., Matsumoto, K.,
Saeki, K., Iritani, A., Hosoi, Y., 2007. Mitochondrial dysfunction of in
vitro grown rabbit oocytes results in preimplantation embryo arrest
after activation. J. Reprod. Fertil. 53, 631–637.
Latham, K.E., 1999. Mechanism and control of embryonic genome activa-
tion in mammalian embryos. Int. Rev. Cytol. 193, 71–124.
Linnane, M.I., Brereton, A.J., Giller, P.S., 2001. Seasonal changes in circadian
grazing patterns of Kerry cows (Bos Taurus) in semi-feral conditions
in Killarney National Park, Co. Kerry, Ireland. Appl. Anim. Behav. Sci.
71, 277–292.
Loop, S., Katzer, M., Pieler, T., 2005. mPER1-mediated nuclear export of
mCRY1/2 is an important element in establishing circadian rhythm.
EMBO Rep. 6, 341–347.
Lonergan, P., Rizos, D., Gutierrey-Adan, A., Fair, T., Boland, M.P., 2003.
Oocyte and embryo quality: effect of origin, culture conditions and
gene expression patterns. Reprod. Dom. Anim. 38, 259–267.
Mahoney, M.M., Sisk, C., Ross, H.E., Smale, L., 2004. Circadian regulation
of gonadotropin-releasing hormone neurons and the preovulatory
surge in luteinizing hormone in the diurnal rodent, Arvicanthis nilog-
icus, and in a nocturnal rodunt, Rattus norvegicus. Biol. Reprod. 70,
1049–1054.
Matsuo, T., Yamaguchi, S., Mitsui, S., Emi, A., Shimoda, F., Okamura, H.,
2003. Control mechanism of the circadian clock for timing of cell
division in vivo. Science 10, 255–259.
Memli, E., First, N.L., 2000. Zygotic and embryonic gene expression in
cow: a review of timing and mechanisms of early gene expression
as compared with other species. Zygote 8, 87–96.
 T. Amano et al. / Animal Reproduction Science 121 (2010) 225–235
Mtango, N.R., Potireddy, S., Latham, K.E., 2008. Oocyte quality and mater-
nal control of development. Int. Rev. Cell. Mol. Biol. 268, 223–290.
Nagoshi, E., Saini, C., Bauer, C., Laroche, T., Naef, F., Schibler, U., 2004.
Circadian gene expression in individual fibroblasts: cell-autonomous
and self-sustained oscillators pass time to daughter cells. Cell 119,
693–705.
Nothias, J.Y., Majumder, S., Kaneko, K.J., DePamphilis, M.L., 1995. Regula-
tion of gene expression at the beginning of mammalian development.
J. Biol. Chem. 270, 22077–22080.
Oh, B., Hwang, S.Y., Solter, D., Knowles, B., 1997. Spindlin, a major maternal
transcript expressed in the mouse during the transition from oocyte
to embryo. Development 124, 493–503.
Parcheco-Trigon, S., Hennequet-Antier, C., Oudin, J.F., Piumi, F., Renard, J.P.,
Duranthon, V., 2002. Molecular characterization of genomic activities
at the onset of zygotic transcription in mammals. Biol. Reprod. 67,
1907–1918.
Polanski, Z., Ledan, E., Brunet, S., Louvet, S., Verlhac, M.H., Kublak, J.Z.,
Maro, B., 1998. Cyclin synthesis controls the progression of meiotic
maturation in mouse oocytes. Development 125, 4989–4997.
Pousette, A., Akerlöf, E., Rosenborg, L., Fredricsson, B., 1986. Increase in
progressive motility and improved morphology of human spermato-
zoa following their migration through Percoll gradients. Int. J. Androl.
9, 1–13.
Quinn, P., Barros, C., Whittingham, D.G., 1982. Preservation of hamster
oocytes to assay the fertilizing capacity of human spermatozoa. J.
Reprod. Fertil. 66, 161–168.
235
Reppert, S.M., Weaver, D.R., 2001. Molecular analysis of mammalian cir-
cadian rhythms. Annu. Rev. Physiol. 63, 647–676.
Saeki, K., Nagao, Y., Kishi, M., Nagai, M., Iritani, A., 1998. Timing of comple-
tion of the first meiotic division in bovine oocytes after maintenance
of meiotic arrest with cycloheximide and their subsequent develop-
ment. J. Vet. Med. Sci. 60, 523–526.
Schwartz, M.D., Nunez, A.A., Smale, L., 2004. Differences in the suprachi-
asmatic nucleus and lower subparaventricular zone of diurnal and
nocturnal rodents. Neuroscience 127, 13–23.
Smale, L., Lee, T., Nunez, A., 2003. Mammalian diurnality: some facts and
gaps. J. Biol. Rhythms 18, 356–366.
Takahashi, Y., First, N.L., 1992. In vitro development of bovine one-cell
embryos: Influence of glucose, lactate, pyruvate, amino acids and vita-
mins. Theriogenology 37, 963–978.
Tervit, H.R., Whittingham, D.G., Rowson, L.E., 1972. Successful culture in
vitro of sheep and cattle ova. J. Reprod. Fertil. 30, 493–497.
Toh, K.L., Jones, C.R., He, Y., Eide, E.J., Hinz, W.A., Virshup, D.M.,
Ptácek, L.J., Fu, Y.H., 2001. An hPer2 phosphorylation site muta-
tion in familial advanced sleep phase syndrome. Science 291,
1040–1043.
Xumei, W., Viveiros, M.M., Eppig, J.J., Bai, Y., Fitzpatrick, S.L., Matzuk, M.M.,
2003. Zygote arrest1 (Zar1) is a novel maternal-effect gene critical for
the oocyte-to-embryo transition. Nat. Genet. 33, 187–191.
Yan, J., Wang, H., Liu, Y., Shao, C., 2008. Analysis of gene regulatory net-
works in the mammalian circadian rhythm. PLoS. Comput. Biol. 10,
e1000193.
 Animal Reproduction Science 121 (2010) 236–241

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Resumption of ovarian cyclicity and fertility response in bull-exposed

postpartum buffaloes
P.P. Gokuldas a,∗ , M.C. Yadav a , H. Kumar a , G. Singh b , S. Mahmood a , A.K.S. Tomar c
a
Division of Animal Reproduction, Indian Veterinary Research Institute, Izatnagar, Bareilly 243 122, Uttar Pradesh, India
b
Division of Physiology & Climatology, Indian Veterinary Research Institute, Izatnagar, Bareilly 243 122, Uttar Pradesh, India
c
LPM Section, Indian Veterinary Research Institute, Izatnagar, Bareilly 243 122, Uttar Pradesh, India

a r t i c l e i n f o a b s t r a c t

Article history: A study was undertaken to evaluate the effect of bull exposure on resumption of ovar-
Received 22 January 2010 ian cyclicity and fertility response in postpartum buffaloes raised under standard farm
Received in revised form 9 June 2010
conditions. A total of 24 Murrah buffaloes was randomly grouped to receive one of the
Accepted 16 June 2010
following treatments: (1) exposure to a vasectomised bull from 40th to 90th day postpar-
Available online 1 July 2010
tum (bull-exposed, BE, n = 11) and (2) isolated from bull (non-exposed, NE, n = 13). Changes
in the progesterone concentration were used to assess the resumption of ovarian cyclic-
Keywords:
ity. Postpartum interval to resumption of ovarian cyclicity (47 ± 2.58 days vs. 56 ± 2.37
Biostimulation
Buffalo days, p < 0.05) as well as behavioral estrus (57 ± 3.61 days vs. 71 ± 5.13 days, p < 0.05) was
Bull exposure shorter in bull-exposed animals than control animals. Similarly, animals in the BE group
Ovarian cyclicity had significantly shorter interval to postpartum ovulation (48 ± 2.69 days vs. 57 ± 2.37 days,
Fertility p < 0.05). Reduced incidence of silent ovulation was observed in BE group compared to NE
Postpartum group (18.18% vs. 50%). More than half proportion of animals in BE group conceived by 60
Progesterone days postpartum compared to a very low proportion of animals in NE group (54% vs. 15%,
p < 0.05). Furthermore, first service conception rate in BE animals was significantly greater
than NE animals (100% vs. 37.50%, p < 0.05). In conclusion, continuous bull exposure to buf-
faloes during later postpartum period accelerates resumption of ovarian cyclicity, reduces
incidence of silent ovulation and enhances first service conception rate. These results indi-
cate that introduction of bulls to buffalo herd could be a rational management strategy for
reducing the postpartum anestrus by enhancing reproductive function in buffaloes.
© 2010 Elsevier B.V. All rights reserved.

1. Introduction anestrus and repeat breeding, besides delayed age at

In tropical countries like India, the domestic buffalo pro-
duction is an indispensable livestock resource to millions
of smallholder farmers. Indian buffalo constitute less than
40% of the bovine population, but accounts for more than
half (34.5 million tonnes) of the total milk production in the
country (Ingawale and Dhoble, 2004). However, buffaloes
are considered difficult breeder because of their inher-
ent susceptibility to environmental stress which cause
∗ Corresponding author. Tel.: +91 9927305130; fax: +91 581 2303284.
E-mail address: dasgokul2001@gmail.com (P.P. Gokuldas).
first calving and higher incidence of silent ovulations.
Delayed postpartum estrus and conception affect produc-
tivity and cause economic losses to buffalo producers.
Various attempts to regulate postpartum reproduction
through use of hormones and biological agents have so
far failed to be consistently effective and besides, some
of these biologicals are not easily available, unsustainable
or too expensive for smallholder farmers. For harnessing
the reproductive potential of buffaloes, there is a need to
develop rational management strategies that will curtail
postpartum reproductive problems, without reducing milk
yield or calf growth rate, and without significant increases
in production costs.

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.06.005
 P.P. Gokuldas et al. / Animal Reproduction Science 121 (2010) 236–241 237

Table 1
Characteristics (mean ± SEM) of buffaloes exposed or non-exposed to vasectomised bull.

Groups Body weight (kg) Age (years) Parity Calf body weight (kg) Calf sex ratio

Bull-exposed (BE) (n = 11) 586 ± 25a 8.64 ± 0.93b 3.0 ± 0.33c 30.82 ± 0.81a 1.2:1
Non-exposed (NE) (n = 13) 570 ± 20a 6.69 ± 0.76b 2.77 ± 0.31c 31.31 ± 1.26a 1.17:1
Overall (n = 24) 578 ± 22 7.66 ± 0.85 2.88 ± 0.32 31.07 ± 1.02 1.18:1

Values bearing common superscripts within a column did not differ significantly (p > 0.05) by Student’s t-test.

Biostimulation by bull exposure represents a relatively
inexpensive management tool. It has been reported that
the exposure of bulls to postpartum cows can be used
to reduce the interval from calving to the resumption of
luteal activity in primiparous (Gifford et al., 1989; Custer
et al., 1990; Fernandez et al., 1993) as well as multiparous
cows (Zalesky et al., 1984; Alberio et al., 1987; Naasz and
Miller, 1990; Burns and Spitzer, 1992). Presence of male
before the breeding season stimulated onset of estrus in
seasonally anestrus ewes (Knight and Peterson, 1978) in
goats (Shelton, 1960) and in suckled sows (Rowlinson et
al., 1975). While there is overwhelming evidence to support
the effect of bull exposure in inducing earlier return to post-
partum estrus in cattle, there exists a paucity of information
concerning this application in postpartum buffaloes. The
objective of the present study was to study the effect of
direct bull exposure on resumption of ovarian cyclicity and
fertility response in postpartum buffaloes.
2. Materials and methods
2.1. Experimental materials and procedures
This study was conducted during the winter season with
24 postpartum Murrah buffaloes maintained at the Cat-
tle and Buffalo Farm, Indian Veterinary Research Institute,
Bareilly, Uttar Pradesh. The farm is situated at 28◦ 22 (N)
latitude and 79◦ 24 (E) longitude, at an altitude of 169.2 m
above mean sea level. Agro-ecologically, the experimen-
tal site is situated in the upper Gangetic plain region with
extreme conditions where temperature varies from 37.5 ◦ C
to 39.5 ◦ C in the month of May to June (summer) and 5 ◦ C to
10 ◦ C in December to February (winter). All buffaloes were
between the second and the fourth parity and were free
from reproductive disorders. They were maintained under
similar managemental conditions and stall feeding with
free access to water. The animals were hand-milked twice
daily and limited suckling by a calf preceded each milking.
The elapsed time period within which reproductive
performance was monitored in this study included from
40 to 90 days postpartum. Twenty-four Murrah buffaloes
with similar body weight, age, parity, calf body weight
and calf sex ratio were selected for the study. There were
no significant differences between the groups in terms of
these parameters (Table 1). The buffaloes were grouped
at random to receive one of the following treatments: (1)
exposure to a vasectomised bull (bull-exposed, BE) and (2)
isolated from bull (non-exposed, NE). The animals of the
BE group (n = 11) were continuously exposed to a vasec-
tomised bull which was tethered in a semi-open shed from
40th to 90th day postpartum whereas, the buffaloes in the
NE group (n = 13) were kept in another semi-open shed at
a distance of approximately 0.13 km without bull exposure
for the similar period. Buffaloes in this group had no visual
or tactile contact with mature bulls or their excretory prod-
ucts during the same period. Onset of estrus in all animals
was checked twice daily (8:30 h and 17:00 h) by teaser bull
parading and confirmed by examination of genitalia per
rectum. Animals in estrus were inseminated using 0.5 ml
of frozen–thawed semen of fertile buffalo bulls. Pregnancy
was checked by per rectal examination after 60 days.
2.2. Progesterone analysis
Changes in the plasma progesterone concentration
were used to assess the resumption of ovarian cyclic-
ity. Blood samples were collected by jugular venipuncture
in heparinised glass tubes. Samples were collected at
4 days interval beginning from 40th day after calving
until 90th day. After collection, plasma from each blood
sample was separated through centrifugation (600 × g
for 10 min) and stored in 1.5 ml aliquots at −20 ◦ C until
assayed. The progesterone levels in the plasma samples
were estimated using solid phase 125 I Radioimmunoas-
say kits (Immunotech, Beckman Coulter Company, France).
The assay sensitivity was 0.05 ng/ml and had an intra-

Table 2
Effect of bull exposure on some reproductive criteria (mean ± SEM) in postpartum buffaloes.

Reproductive criteria BE group (n = 11) NE group (n = 13) p value

Postpartum interval (days) to:

(1) resumption of ovarian activity 47.4 ± 2.58a 56.0 ± 2.37b <0.05
(2) first ovulation 48.1 ± 2.69a 57.0 ± 2.37b <0.05
(3) first behavioral estrus 54.5 ± 1.79 59.6 ± 4.74 0.29
(4) first behavioral estrus(adjusted) 57.7 ± 3.61a 71.3 ± 5.13b <0.05

Proportion of animals resuming cyclicity*

by days 60 postpartum 81.82%a 38.46%b <0.05
by days 90 postpartum 90.91% 61.54% 0.11

Incidence of silent ovulations* 18.18% 50.00% 0.12

Values bearing different superscripts within a row differ significantly (p < 0.05) by Student’s t-test. BE-Bull-exposed; NE-Non-exposed.
*
Percentages within rows that lack a common superscript differ significantly (p < 0.05) by normal deviate test.
238 P.P. Gokuldas et al. / Animal Reproduction Science 121 (2010) 236–241
and inter-assay coefficient of variation of <10%. A total of
760 plasma samples was thawed at room temperature and
assayed for progesterone.
An increase in baseline progesterone concentration in
at least two consecutive samples that exceeded 1 ng/ml
was used as the criterion for resumption of ovarian
cyclicity (Stumpf et al., 1992; Berardinelli and Joshi, 2005).
Postpartum intervals to estrus or conception for buffaloes
that had not exhibited estrus or conceived by the end of
experimental period (90 days postpartum) were calculated
by assuming that estrus or conception in these animals had
occurred on the last day of the experimental period and
subtracting this date from their calving date (Fernandez et
al., 1996). These intervals were then included in the data
set of buffaloes that actually showed estrus or conceived by
the end of the experiment (adjusted interval) for statistical
analysis.
2.3. Statistical analysis
Data were analyzed as per Snedecor and Cochran (1989).
Student’s t-test was used to compare the means of post-
partum interval to ovulation, first behavioral estrus, and
conception between the groups and a p value of <0.05 was
used to define statistical significance. The proportional data
were analyzed by Normal Deviate test. Student’s t-test and
Duncan’s multiple range tests were used to compare the
means of progesterone between the groups.
3. Results and discussion
In the present study, the postpartum interval to resump-
tion of ovarian cyclicity (47.4 ± 2.58 days vs. 56.0 ± 2.37
days, p < 0.05) as well as adjusted interval to behav-
ioral estrus (57.7 ± 3.61 days vs. 71.3 ± 5.13 days, p < 0.05,
Table 2) was significantly shorter for buffaloes exposed
to bull than non-exposed buffaloes. These results are
consistent with the reports of Burns and Spitzer (1992)
and Rekwot et al. (2000) in cattle and Abdalla (2003) in
buffaloes. The finding that early resumption of ovarian
cyclicity in BE animals possibly indicates a rapid response
of these animals to male stimuli.
However, in contrast to these results, some work-
ers recorded no significant difference in the interval to
resumption of ovarian activity and estrus between bull-
exposed and non-exposed suckling beef cows (Alberio et
al., 1987) and buffaloes (Barman, 2008). In these stud-
ies, animals were exposed to bull in the early postpartum
period (10 days and 3 days postpartum, respectively).
Tauck (2005) opined that postpartum cows would not
respond to the bull pheromone when bulls were intro-
duced to cows shortly after parturition. The initiation of
bull exposure post-calving appears to be a decisive factor
in the biostimulatory effect as neuro-endocrine restora-
tion of cyclicity takes place gradually over 20–30 days after
parturition (Alberio et al., 1987). In the present study, bull
exposure at progressively later stage (40 days postpartum)
would have strengthened the biostimulatory effect and
consequently exposed animals responded more rapidly to
the male stimuli.
Fig. 1. Cumulative percentages of cyclic buffaloes in bull-exposed and
non-exposed group. Bars that lack common letter between groups differ
significantly (p < 0.05) by normal deviate test.
Inspection of cumulative proportions of buffaloes that
resumed estrous activity at weekly intervals during the
experiment indicated that maximum response in terms of
resumption of cyclicity occurred during 60–70 days post-
calving (20–30 days of bull exposure, Fig. 1). By 60 days
postpartum, a significantly higher proportion (81.82% vs.
38.46%) of BE animals resumed cyclicity as compared to
animals in NE group. In accordance with the findings of
Abdalla (2003), animals in the BE group had significantly
shorter interval to postpartum ovulation (48.1 ± 2.69 days
vs. 57.0 ± 2.37 days, Table 2). Ruminant animals are spon-
taneous ovulators but may experience seasonal cyclicity.
However, the influence of male and mating stimuli in
hastening ovulation through nervous and hormonal mech-
anisms associated with it has been proven even in these
species (Randel et al., 1975; Kutty, 2004). Interestingly,
in the present study, bull exposure stimulated a major-
ity of animals to ovulate before 50 days postpartum. This
is important as it allows them to experience one or two
estrous cycles for successful breeding before 70–90 days
postpartum, by which the buffaloes must be pregnant to
maintain a calving interval of 13–14 months (El-Wishy,
2007).
Presence of males has been found to enhance the estrous
expression in sows (Langendijk et al., 2000) and goats
(Kunowska and Ryniewicz, 2001). Various workers have
reported significantly reduced proportion of silent ovula-
tion in bull-exposed cattle (22% vs. 89%, Alberio et al., 1987)
as well as buffaloes (57.14% vs. 85.71%, Barman, 2008).
This is further confirmed by a lower incidence of silent
ovulation in bull-exposed buffaloes (18.18%) compared
to non-exposed animals (50.00%) in this study (Table 2).
Remarkably, the presence of bulls increased overall inci-
dence of overt estrus, while decreasing the incidence of
silent estrus. As has been seen in this study, lack of appro-
priate male stimuli seems to be a contributory factor for
weak expression of estrus and higher incidence of silent
ovulation in non-exposed buffaloes.
Table 3 depicts various parameters in relation to fertil-
ity response in experimental animals. Animals in BE group
conceived earlier with an insignificant difference of 6 days
compared to NE group (55.4 ± 1.8 vs. 61.5 ± 5.4, p > 0.05).
However, difference of adjusted interval from calving
to conception between the two groups (13.2 days) was
found to be statistically significant (68.0 ± 5.3 vs. 81.2 ± 4.1,
 P.P. Gokuldas et al. / Animal Reproduction Science 121 (2010) 236–241 239

Table 3
Effect of bull exposure on certain fertility parameters in postpartum Murrah buffaloes.

Parameter BE group (n = 11) NE group (n = 13) p value

(1) Proportion of animals conceiving by

days 60 postpartum 54.55%a 15.39%b <0.05
days 90 postpartum 63.63% 30.77% 0.09

(2) First service conception rate 100%a 37.50%b <0.05

(3) Calving to conception* 55.4 ± 1.8 61.5 ± 5.4 0.22
(4) Calving to conception (adjusted)* 68.0 ± 5.3a 81.2 ± 4.0b <0.05

Percentages bearing different superscripts within a row differ significantly (p < 0.05) by normal deviate test. BE-Bull-exposed; NE-Non-exposed.
*
Means (±SEM) bearing different superscripts within a row differ significantly (p < 0.05) by Student’s t-test.

p < 0.05). More than half proportion of animals in BE group
conceived by 60 days postpartum compared to a very low
proportion of animals in NE group (54.55% vs. 15.39%).
Other noteworthy finding in the present study was signif-
icantly higher first service conception rate in bull-exposed
buffaloes compared to non-exposed buffaloes (100% vs.
37.50%, Table 3). Conception data indicate that not only bull
exposure significantly reduced calving to conception inter-
val but that a significant proportion of buffaloes conceived
at bull induced estrus associated with the first postpar-
tum estrous cycle. In support of this contention, Ebert et
al. (1972) reported higher conception rate after first ser-
vice (68%) in the bull-exposed group than the control group
(48%). This is further supported by the findings of Abdalla
(2003), who reported significantly higher proportion of
conception in buffaloes (84% vs. 63%) exposed continu-
ously (from day 7 to 150 days postpartum) to bull than
those exposed twice daily (30 min per session for same
period) to bull. Considering the fertility response of bull
induced estrous cycles, the results of this study further reaf-
firm that bull exposure can enhance the conception rates
and reduce calving to conception interval in postpartum
buffaloes. These findings and the observation that, higher
proportion of animals became cyclic within 20 days of bull
exposure, thus indicated bull-mediated stimulatory effect
on reproductive function in postpartum buffaloes.
Apparently higher progesterone levels, even though sta-
tistically non-significant, were observed in bull-exposed
animals throughout the experiment (Fig. 2). This is in agree-
ment with the results reported by Hornbuckle et al. (1995)
in cattle. The finding that mean progesterone rises above
1 ng/ml was observed as early as on 44th day postpartum
in biostimulated buffaloes indicates early resumption of
cyclicity in these animals. Similarly, higher progesterone
levels (above 2.5 ng/ml) observed in BE animals during
later postpartum period (after 60 days) probably indicates
enhanced conception rate as well as higher proportion of
cyclic animals in BE group.
Exposure of postpartum animals with bull may be
affecting time of ovulation, fertilization rates, corpus
luteum development, progesterone secretion and embry-
onic survival. In the present study, higher levels of
progesterone were observed during the critical period of
conception in BE buffaloes. Higher plasma progesterone
concentration during the estrous cycle preceding insem-
ination is closely related to the occurrence of conception in
postpartum dairy cows (Folman et al., 1973). Secretion of
endogenous LH also may improve potential development
of the corpus luteum and increase progesterone secretion
(Kawate et al., 2000). Maurer and Echternkamp (1982)
found higher embryo survival in cows with higher pre-
ovulatory surges of LH and earlier postovulatory rises of
luteal progesterone. Interestingly, introduction of a male
to females has been shown to induce a rapid release of
LH, mating behavior and ovulation in mice (Bronson and
Desjardins, 1974) and goats (Claus et al., 1990). There-
fore, the possibility that added increment of LH secretion
might have become beneficial to the events associated with
conception in bull-exposed buffaloes cannot be ignored.
Further work needs to be done to elucidate the bull bios-
timulatory effect on hormone secretion and its mechanism
for improving conception.

Fig. 2. Mean (±SEM) plasma progesterone concentration in bull-exposed and non-exposed group of buffaloes.
240 P.P. Gokuldas et al. / Animal Reproduction Science 121 (2010) 236–241
It is known that resumption of ovarian cycling activity
is characterized by the release of GnRH by the hypotha-
lamus in low amplitude high frequency temporal release
pattern (Wright et al., 1992). As a result, the anterior pitu-
itary releases low amplitude, high frequency pulses of LH
which in turn stimulates ovulation and resumption ovar-
ian cycling activity. Unlike in mice (Singh, 2001) and goats
(Iwata et al., 2000) aspects of biostimulation such as the
behavioral and pheromonal signal and its translation into
a hormonal response remain unclear in cattle and buf-
faloes. Fernandez et al. (1996) observed that bull exposure
caused an increase in the pulse frequency of luteinizing
hormone from the anterior pituitary. These data support
the hypothesis that bull exposure stimulates the percep-
tion of pheromones which cause a relatively immediate
stimulation of the HPO axis and the release of LH which in
turn stimulates ovulation and resumption ovarian cycling
activity. The findings of the present study such as, bull
exposure rapidly induced estrus in higher proportion of
animals, reduced incidence of silent estrus and enhanced
conception rate, further corroborate the fact that biostimu-
latory effect of bull did influence postpartum reproduction
in buffaloes. The bull-effect observed in the present study
might have occurred through olfactory cues (pheromones)
transmitted from the bull to the female as they were in con-
tinuous and close proximity to the pheromonal source for a
sufficient period during which the stimuli could influence
the HPO axis to initiate resumption of ovarian activity.
4. Conclusions
Continuous bull exposure of buffaloes during later
postpartum period (40 days post-calving) accelerates post-
partum resumption of ovarian cyclic activity, reduces
incidence of silent ovulation and enhances first service
conception rate. Biostimulation through bull stimuli offers
an efficient strategy to increase the number of pregnant
animals during the earlier days of mating period after
calving. Incorporation of bull biostimulation into buffalo
production system may help to optimize overall repro-
ductive performance and fertility response in postpartum
buffaloes.
Acknowledgements
The authors thank the Director, IVRI, Bareilly, India for
providing necessary facilities and logistics support to con-
duct the study. Thanks are also due to the Indian Council of
Agricultural Research, Government of India for the financial
support provided in the form of Institutional Fellowship to
the first author.
References
Abdalla, E.B., 2003. Improving the reproductive performance of Egyptian
buffalo cows by changing the management system. Anim. Reprod. Sci.
75, 1–8.
Alberio, R.H., Schiersmann, G., Carou, N., Mestre, J., 1987. Effect of a teaser
bull on ovarian and behavioral activity of suckling beef cows. Anim.
Reprod. Sci. 14, 263–271.
Barman, P., 2008. Identification of urinary compounds, response of estrual
and diestrual urine on male libido and effect of bull exposure on ovar-
ian cyclicity in postpartum buffaloes. Ph.D. Thesis submitted to Indian
Veterinary Research Institute, Izatnagar, U.P., pp. 68–70.
Berardinelli, J.G., Joshi, P.S., 2005. Introduction of bulls at different days
postpartum on resumption of ovarian cycling activity in primiparous
beef cows. J. Anim. Sci. 83, 2106–2110.
Bronson, F.H., Desjardins, C., 1974. Circulating concentrations of FSH,
LH, estradiol and progesterone associated with acute, male-induced
puberty in female mice. Endocrinology 94, 1658–1664.
Burns, P.D., Spitzer, J.C., 1992. Influence of biostimulation on reproduction
in postpartum beef cows. J. Anim. Sci. 70, 358–362.
Claus, R., Over, R., Dehnhard, M., 1990. Effect of male odour on LH secretion
and the induction of ovulation in seasonally anestrous goats. Anim.
Reprod. Sci. 22, 27–31.
Custer, E.E., Berardinelli, J.G., Short, R.E., Wehman, M., Adair, R., 1990.
Postpartum interval to estrus and patterns of LH and progesterone
in first-calf suckled beef cows exposed to mature bulls. J. Anim. Sci.
68, 1370–1377.
Ebert, J.J., Conteras, P., Saelzer, P., 1972. Influence of a teaser bull on
puerperium and fertility in dairy cows. In: Proceedings of the 8th
International Congress on Animal Reproduction and Artificial Insem-
ination, vol. 3, Munich, pp. 1743–1748.
El-Wishy, A.B., 2007. The postpartum buffalo II. Acyclicity and anestrus.
Anim. Reprod. Sci. 97, 216–236.
Fernandez, D., Berardinelli, J.G., Short, R.E., Adair, R., 1996. Acute and
chronic changes in luteinizing hormone secretion and postpartum
interval to estrus in first-calf suckled beef cows exposed continuously
or intermittently to mature bulls. J. Anim. Sci. 74, 1098–1103.
Fernandez, D., Berardinelli, J.G., Short, R.E., Adair, R., 1993. The time
required for the presence of bulls to alter the interval from parturi-
tion to resumption of ovarian activity and reproductive performance
in first calf-suckled beef cows. Theriogenology 39, 411–419.
Folman, Y., Rosenberg, M., Herz, Z., Davidson, M., 1973. The relationship
between plasma progesterone concentration and conception in post-
partum dairy cows maintained on two levels of nutrition. J. Reprod.
Fertil. 34, 267–278.
Gifford, D.R., D’Occhio, M.J., Sharpe, P.H., Weatherly, T., Pittar, R.Y., Reeve,
D.V., 1989. Return to cyclic ovarian activity following parturition in
mature cows and first-calf beef heifers exposed to bulls. Anim. Reprod.
Sci. 19, 209–214.
Hornbuckle, T., Weston, P.G., Hixon, J.E., 1995. Effects of bull exposure on
the cyclic activity of beef cows. Theriogenology 61, 1521–1532.
Ingawale, M.V., Dhoble, R.L., 2004. Buffalo reproduction in India: an
overview. Buffalo Bull. 23 (1), 4–7.
Iwata, E., Wakabayashi, Y., Kakuma, Y., Kikusui, T., Takeuchi, Y., Mori, Y.,
2000. Testosterone dependent primer pheromone production in the
sebaceous gland of male goat. Biol. Reprod. 62, 806–810.
Kawate, N., Morita, N., Tsuji, M., Tamada, H., Inaba, T., Sawada, T., 2000.
Roles of pulsatile release of LH in the development and mainte-
nance of corpus luteum function in the goat. Theriogenology 54 (7),
1133–1143.
Knight, T.W., Peterson, A.J., 1978. The ovarian and hormonal response
of ewe to the stimulation by the ram early in the breeding season.
Theriogenology 10, 343–353.
Kunowska, M., Ryniewicz, Z., 2001. The preliminary investigations on
estrus period in goats. J. Anim. Sci. 38, 47–56.
Kutty, I.C., 2004. Emerging fertility problems in cattle and buffaloes bred
through artificial insemination. Intas Polivet 5 (11), 269–274.
Langendijk, P., Soede, N.M., Bouwman, E.G., Kemp, B., 2000. Responsive-
ness to boar stimuli and change in vulvar reddening in relation to
ovulation in weaned sows. J. Anim. Sci. 78, 3019–3026.
Maurer, R.R., Echternkamp, S.E., 1982. Hormonal asynchrony and embry-
onic development. Theriogenology 17, 11–16.
Naasz, C.D., Miller, H.L., 1990. Effects of bull exposure on postpartum inter-
val and reproductive performance in beef cows. Can. J. Anim. Sci. 70,
537–543.
Randel, R.D., Short, R.E., Christensen, D.S., Bellows, R.A., 1975. Effect of cli-
toral massage after artificial insemination on conception in the bovine.
J. Anim. Sci. 40, 1119–1123.
Rekwot, P.I., Ogwu, D., Oyedipe, E.O., 2000. Influence of bull biostim-
ulation, season and parity on resumption of ovarian activity of
zebu (Bos indicus) cattle following parturition. Anim. Reprod. Sci. 63,
1–11.
Rowlinson, P., Boughton, H.G., Bryant, M.J., 1975. Studies on reproductive
performance of buffaloes. Anim. Prod. 21, 233–241.
Shelton, M., 1960. Influence of the presence of a male goat on the initia-
tion of estrous cycling and ovulation of Angora does. J. Anim. Sci. 19,
368–379.
Singh, P.B., 2001. Chemosensation and genetic individuality. Reproduction
121, 529–539.
Snedecor, G.W., Cochran, W.G., 1989. Statistical Methods, 6th ed. The Iowa
State University Press, USA.
 P.P. Gokuldas et al. / Animal Reproduction Science 121 (2010) 236–241 241

Stumpf, T.T., Wolfe, M.W., Day, M.L., Kittok, R.J., Kinder, J.E., 1992. Weight
changes prepartum and presence of bulls postpartum interact to
affect duration of postpartum anestrus in cows. J. Anim. Sci. 70,
3133–3137.
Tauck, S.A., 2005. Factors associated with the biostimulatory effect of bulls
on resumption of ovarian cycling activity and breeding performance
of first-calf suckled beef cows. M.S. Thesis submitted to Montana State
University, Bozeman, Montana, pp. 3–75.
Wright, I.A., Rhind, S.M., Whyte, T.K., Smith, A.J., 1992. A note on the effects
of pattern intake and body condition on the duration of the post-
partum anoestrous period and LH profiles in beef cows. Anim. Prod.
54, 143–146.
Zalesky, D.D., Day, M.L., Garcia-Winder, M., Imakawa, K., Kittok, R.J.,
D’Occhio, M.J., Kinder, J.E., 1984. Influence of exposure to bulls on
resumption of estrous cycles following parturition in beef cows. J.
Anim. Sci. 59, 1135–1139.
 Animal Reproduction Science 121 (2010) 242–248

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Short-term grazing of lucerne and chicory increases ovulation rate in

synchronised Merino ewes
B.J. King a,b,∗ , S.M. Robertson a,b , J.F. Wilkins a , M.A. Friend a,b
a
EH Graham Centre for Agricultural Innovation (Industry & Investment NSW and Charles Sturt University), Locked Bag 588,
Wagga Wagga, NSW 2678, Australia
b
Co-operative Research Centre for Future Farm Industries, Nedlands, WA, Australia

a r t i c l e i n f o a b s t r a c t

Article history: This study evaluated the ability of short-term grazing of live = green pasture to increase
Received 18 November 2009 ovulation rate during late summer when annual pasture is generally dead and of low qual-
Received in revised form 17 June 2010
ity. Ovulation rates, measured by the number of corpora lutea, were compared between
Accepted 28 June 2010
4 nutritional treatments: senesced phalaris (Phalaris aquatica), phalaris plus 500 g lupin
Available online 3 August 2010
grain per day, lucerne (Medicago sativa) or chicory (Chicorum intybus) pastures. The study
used 100 Merino ewes per treatment, divided between 2 replicates. The experiment was
Keywords:
repeated in 3 years; February 2006, and January 2007 and 2008. Oestrus was synchronised
Sheep
Ovulation rate and the ewes grazed the pastures for 9 days prior to ovulation at times corresponding to
Nutrition days 8–17 of the cycle in 2006, and days 6–14 in 2007 and 2008. The proportion of ewes
Flushing producing multiple ovulations was higher (P < 0.05) in the lucerne and chicory (0.36, 0.38)
Lupins than the phalaris (0.27), and intermediate in the lupin (0.33) treatment. Regression analysis
Lucerne showed that the proportion of ewes with multiple ovulations increased with the quantity
Chicory of live herbage (P < 0.04). Responses were achieved even at low levels of live herbage with
90% of the maximum proportion of multiples occurring at 350 kg DM/ha. It is concluded
that providing short-term grazing of live chicory or lucerne to ewes can increase ovulation
rates relative to ewes grazing senesced phalaris and to levels similar to those achieved by
lupin grain supplementation.
Crown Copyright © 2010 Published by Elsevier B.V. All rights reserved.

1. Introduction may be inexpensive and avoids the use of chemicals and

Increasing ewe reproductive capacity provides poten-
tial for increasing profitability in sheep meat production
systems (Warn et al., 2006). This increase in reproductive
rate needs to be achieved cost effectively and in a way that
satisfies an increasing consumer demand for a “clean, green
and ethical” product (Martin et al., 2004). Using nutrition
to manipulate ovulation rate provides a useful strategy that
∗ Corresponding author at: School of Animal and Veterinary Sciences,
Charles Sturt University, Locked Bag 588, Wagga Wagga, NSW, Australia.
Tel.: +61 02 6933 2427; fax: +61 02 6933 2911.
E-mail address: bking@csu.edu.au (B.J. King).
hormones.
Increased nutrition or flushing prior to mating has long
been known to increase ovulation rates or the number
of lambs born. This operates through either or both a
‘dynamic’ effect – a rising plane of nutrition and gaining
weight at and for some weeks prior to mating (Gunn et
al., 1984), or a ‘static’ effect – that of the resultant higher
liveweight or condition at the time of mating (Coop, 1962;
Edey, 1968). An ‘acute’ effect of nutrition has also been
shown, whereby ‘short-term’ or ‘spike’ feeding with lupin
grain for 4–6 days increases ovulation rates without affect-
ing liveweight or body condition (Knight et al., 1975; Smith
and Stewart, 1990). This short-term feeding targets a criti-
cal period in the luteal phase of the oestrous cycle around

0378-4320/$ – see front matter. Crown Copyright © 2010 Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.06.007
 B.J. King et al. / Animal Reproduction Science 121 (2010) 242–248
days 10–14 of the oestrous cycle (Stewart and Oldham,
1986), or during the period 6 days before luteolysis (Nottle
et al., 1990). The benefit of this strategy is that limited feed
resources can be used more efficiently than if a longer feed-
ing period is required.
It is clear that the ovulatory response to short-term
feeding with lupins is generally repeatable (Scaramuzzi et
al., 2006) although responses are variable, and can pro-
vide increases in ovulation rate of up to 60% (Stewart and
Oldham, 1986; Teleni et al., 1989; Nottle et al., 1990, 1997;
Wilkins, 1997). Lupin grain has been the most common feed
supplement used in previous studies, but is expensive and
not readily available in all localities. However, the use of
supplements is an additional cost which may be unneces-
sary if similar responses could be obtained using existing
pasture resources. Since research has provided increasing
evidence that the effect of short-term feeding on ovulation
rate is driven by dietary energy (e.g. Teleni et al., 1989;
Vinoles et al., 2005), other feed alternatives that provide
similar nutrition, but are less risky to metabolic health
and are more cost effective than lupin supplementation,
become possible. Indeed, the value of short-term grazing
(up to 18 days) of high quality leguminous pastures such
as the perennial shrub tagasaste (Chamaecytisus palmen-
sis) (Wilkins, 1997) and Lotus spp. (Ramirez-Restrepo et al.,
2005; Vinoles et al., 2009) have already been shown to have
positive effects on prolificacy. If similar responses to those
obtained with lupin grain could be achieved with com-
monly grown summer-active pasture species, short-term
grazing to increase ovulation rates in summer/autumn
joined ewes could be adopted by a substantial number of
sheep producers.
Lucerne (Medicago sativa) and chicory (Chicorum inty-
bus) are perennial pastures that provide good quality
nutrition during the summer and autumn (Holst et al.,
1998) when traditional annual pastures senesce and
become low in nutritive value (Thomas et al., 2010).
Phalaris (Phalaris aquatic) is widely sown as pasture in
the higher rainfall temperate regions of Australia, but it
is summer-dormant and less able to provide quality sum-
mer feed for finishing lambs and improved ewe nutrition
at joining. Lucerne is suited to medium and high rainfall
areas and in addition to extending the supply of quality
pasture, can be sown as a pasture phase in crop rotations
to provide a disease break and fix nitrogen. Chicory is more
tolerant of acid soils than lucerne, thereby providing an
alternative where lucerne cannot be grown (Upjohn et al.,
2005). Lucerne and chicory are also desirable because, as
perennials, they show potential to reduce ground water
recharge and thus contribute to the control of dryland
salinity (Dear and Ewing, 2008). Although these improved
pastures have proven effective in producing high growth
rates in lambs over the summer period (Holst et al., 1998)
in central N.S.W., the potential of these forages to increase
ovulation rate in a fashion similar to supplementation with
of lupin grain and the leguminous species reported by oth-
ers, is not known.
The field study described in this paper was conducted
over 3 years. It aimed to investigate the effects of short-
term grazing of lucerne and chicory on ovulation rate in
Merino ewes compared to the existing perennial pasture,
243
phalaris with and without short-term lupin grain supple-
mentation.
2. Materials and methods
This experiment was conducted with the approval of
the Charles Sturt University Animal Ethics committee. The
experiment was conducted on a property south-east of
Wagga Wagga NSW (latitude 147.5; longitude −35.2). The
climate is typical Mediterranean with hot dry summers and
moderately cold winters. Rainfall is an average 600 mm per
annum falling evenly throughout the year, although sum-
mer rainfall is typically less reliable.
2.1. Animals and experimental procedures
A schematic representation of the experimental design
is presented in Fig. 1. The experimental design com-
prised 4 nutritional treatments (senesced phalaris pasture,
senesced phalaris pasture plus 500 g/ewe/day lupin grain
(Lupinus angustifolius), chicory and lucerne), in a ran-
domised block design with 2 replicates of each treatment
combination. The experiment was repeated in each of 3
years (2006, 2007 and 2008). In each year, 400 medium to
large-framed 5-year-old Merino ewes of CentrePlus blood-
line (a dual-purpose bloodline selected for both meat and
wool characteristics) were stratified and randomly allo-
cated to treatment groups (n = 100) according to body
condition (scale 0 (emaciated) to 5 (obese) (Jefferies, 1961))
and liveweight. In 2007 and 2008, when some older ewes
were replaced with younger ewes, animals were also allo-
cated according to age group.
Ewes were weighed and condition scored (without
fasting) at the beginning and end of the nutritional treat-
ment periods. Oestrous cycles were synchronised using
an intravaginal CIDR® (Controlled Internal Release Device;
0.3 g progesterone, EZI-breed® NZ) inserted for 11–13 days.
In 2006, CIDRs were inserted on day −11 and removed
on day 0. It was expected that the mean time of ovula-
tion would occur approximately 3 days after CIDRs were
removed. That is, the mean time of onset of oestrus in the
flock would occur around 36 h after CIDR removal (Kohno
et al., 2005) and ovulation would occur approximately 24 h
after that. All treatment groups grazed senesced pastures
off plots until day −6 when they were introduced to pas-
ture plots and remained there until day 3. Lupin grain was
fed daily to the relevant group while grazing the phalaris
pasture. After 2006, the protocol was modified to remove
the possibility that high levels of feeding, late in the luteal
phase of the oestrous cycle, may inhibit ovulatory response
(Stewart and Oldham, 1986). Therefore, in 2007 and 2008,
CIDRs were inserted at day −13 and removed on day 0. In
these years, due to drought conditions, the ewes were sup-
plementary fed a maintenance ration (SCA, 1990) of wheat
grain until day −8 when they were placed on the pasture
plots and were removed from plots at the end of the CIDR
treatment. In all years, the ewes grazed plots for a period
of 9 days, corresponding to days 8–17 (2006) or days 6–14
(2007 and 2008) of the 17-day oestrous cycle. On removal
from pasture treatment plots, ewes were returned as one
flock to annual pasture or low quality hay until the day
244 B.J. King et al. / Animal Reproduction Science 121 (2010) 242–248

Fig. 1. Schematic representation of experimental design in 2006 and 2007/2008. Ewes were synchronised with CIDRs for either 11 (2006) or 13 days
(2007/2008). Where day 0 is the day of CIDR removal, ewes grazed nutritional treatments for 9 days in all years from day −6 to day 3 (2006) and day −8 to
day 0 (2007/2008). At the end of this period, all the ewes were united into one flock and grazed senesced annual pasture until ovulation rate was measured
via laparoscopy at day 5–6 after expected ovulation (2006) or via trans-rectal ultrasound at day 8–11 after expected time of ovulation.

of ovulation, after which grain feeding re-commenced if 2.2.1. Pasture biomass

required.
Ovulation rate, as determined by the number of cor-
pora lutea per ewe ovulating, was measured on 6 March
2006 via laparoscopy (Oldham and Lindsay, 1980) at day
5–6 after the estimated average time of ovulation in the
flock. On 29–31 January 2007 and 2008 ovulation rate was
measured using transrectal ultrasonography (Vinoles et al.,
2004) with the ewe in a standing position at day 8–11 after
the estimated average time of ovulation. Transrectal ultra-
sound provides a less invasive technique that has a high
predictive value and sensitivity for the diagnosis of func-
tional corpora lutea (Dickie et al., 1999; Vinoles et al., 2004).
2.2. Pastures
The pastures used as the nutritional treatments com-
promised senesced phalaris pasture (P. aquatica cv.
Australian), senesced phalaris pasture, chicory (C. intybus
cv. Punall), and lucerne (M. sativa cv. Aurora) all with a
subclover (Trifolium subterranean) component. The phalaris
pasture was an existing 5-year-old stand that had been
sown with subclover (cv. Coolamon). The lucerne and
chicory pastures were sown in spring 2005 at sowing rates
of 4 and 3.5 kg seed/ha, respectively, along with 2 kg/ha
subclover. The phalaris plots were 2.5 ha, and the lucerne
and chicory plots 2.2 ha.
Pastures were measured 2–4 days before ewes were put
on plots, and again 3 or 9 days after ewes were removed
from plots. Live and dead pasture biomass was visually
estimated using the method of Haydock and Shaw (1975)
as described by Cayley and Bird (1996), using an elec-
tric handpiece to cut calibration quadrats to ground level.
The quantity of live pasture pre-grazing in the chicory and
lucerne treatments was higher (P < 0.05) than in the lupin
and phalaris treatments (Table 1). Higher levels of herbage
were estimated in 2008 than in other years, but in the
lupin and phalaris treatments all except about 100 kg was
clammy goosefoot (Chenopodium pumilio) which is gener-
ally considered relatively unpalatable. Over the 9 days of
grazing the quantity of pasture decreased, with most live
leaf material consumed 3 days before ewes were removed
from plots. The larger quantities of live lucerne and chicory
remaining post-grazing were stem, with no or little leaf;
the live material in lupin and phalaris in 2008 was clammy
goosefoot. The quantity of dead pasture was usually above
levels that would limit pasture intake by sheep (SCA, 1990),
both pre and post-grazing.
2.2.2. Pasture/feed quality
In 2007 and 2008 samples for herbage quality were
taken using the ‘toe-cut’ method (Cayley and Bird, 1996)
and these and lupin grain samples were tested for crude

Table 1
Mean quantity of live and dead pasture (kg DM/ha) pre- and post-grazing for the different treatment groups averaged over 2006–2008.

Live pasture (kg DM/ha) Dead pasture (kg DM/ha)

Treatment Pre-grazing Post-grazing Pre-grazing Post-grazing

Phalaris 86a 39a 2220d 1869d

Phalaris + lupin 167a 156bc 1737c 1634c
Lucerne 761b 208cd 974a 928a
Chicory 884c 260d 1508b 1416b

Values with different superscript letters (a, b, c, d) within columns indicate means differ at P < 0.05.
 B.J. King et al. / Animal Reproduction Science 121 (2010) 242–248 245

Table 2 Table 3
Mean crude protein (CP %), dry organic matter digestibility (DOMD %) Mean daily maximum, minimum and mean temperature and total rainfall
and metabolisable energy (ME, MJ/kg DM) of live pasture post-grazing for during each experimental period 2006–2008.
different treatments, combining data for 2007–2008.
2006 2007 2008
Treatment CP (%) DOMD (%) ME (MJ/kg DM)
Mean (◦ C) 24.3 25.4 24.6
Phalaris 21.0d 66b 10.5c Mean minimum (◦ C) 16.3 17.2 18.1
Phalaris + lupin 19.6c 63b 9.8b Mean maximum (◦ C) 32.4 33.3 31.4
Lucerne 13.0b 47a 6.5a Rainfall (mm) 1 25 85
Chicory 10.5a 50a 7.0a

Values with different superscript letters (a, b, c, d) within columns indicate

means differ at P < 0.05.
protein (CP), neutral detergent fibre (NDF), dry matter
digestibility (DMD), and digestibility of organic matter
(DOMD) (Department of Primary Industries, Hamilton,
Victoria). Values were estimated using near infrared spec-
troscopy (NIR) and metabolisable energy (ME) calculated.
The quality of the live component of pastures was simi-
lar (P > 0.05) between all treatments pre-grazing: mean CP
17.2%; DOMD 62% and ME 9.8 MJ ME/kg DM. The quality
of live pasture declined with grazing in the chicory and
lucerne, but not in the phalaris or phalaris plus lupin treat-
ments. This was partially due to a higher presence of the
unpalatable goosefoot in the phalaris plots. However, the
ewes also consumed most of the leaf, leaving mainly stem
in the lucerne and chicory paddocks. Post-grazing quality
of live pasture is shown in Table 2.
The dead component of chicory pastures was higher
(P < 0.05) than other pastures for crude protein, digestibil-
ity, ME and lower in NDF pre-grazing and generally
post-grazing. Mean values for all pastures pre- and post-
grazing, respectively were CP 12.0, 9.62%; DOMD 52, 42%;
and ME 7.56, 5.62 MJ ME/kg DM. Quality between years was
generally similar (P > 0.05).
The lupin grain contained a mean 29.5% CP, 80% DOMD
and 13.3 MJ ME/kg DM.
2.3. Weather
of ewes ovulating, the proportion of ewes recording mul-
tiple ovulations (2+ ovulations) were analysed by logistic
regression. Condition score, measured at the start of the
nutritional treatments, was used as a co-variate for the
proportion of multiple ovulations. Liveweight, body condi-
tion and pasture biomass data were analysed using residual
maximum likelihood (REML). Non-linear regression was
used to predict the relationship between pasture biomass
and the mean percentage of ewes with multiple ovulations
in each group (treatment/replicate/year). Quality parame-
ters for dead pasture for 2007 and 2008 were analysed by
ANOVA; while live pasture parameters were analysed by
REML because there was insufficient live to test in 2007.
3. Results
3.1. Liveweight and condition score
Ewe liveweight pre-grazing averaged 54.5 kg and did
not differ between treatments, but increased with each
successive year (P < 0.001) being 51 ± 7 s.e., 52 ± 6 and
61 ± 7 kg respectively, in 2006, 2007 and 2008. Mean
liveweight increased (P < 0.05) by 2 kg during grazing, with
ewes grazing phalaris only increasing by 1 kg compared
with 2–3 kg in others. Mean condition score pre-grazing
in 2006 at 3.2 was higher (P < 0.001) than in later years
(3.0) but was similar (P > 0.05) between treatments. Post-
grazing the condition score of ewes which grazed phalaris
was lower (P < 0.05) than for other treatments.

Temperature and rainfall data were recorded for the
period of grazing and up to measurement of ovulation rate
at a meteorological station 10 km from the experimen-
tal site. Mean temperatures were similar between years
(Table 3).
2.4. Statistical analyses
Data were analysed using Genstat® 9th edition (Payne
et al., 2006). The proportions of ewes failing to ovulate and,
3.2. Ovulation rate
On average, 8% of ewes did not ovulate, and this was sim-
ilar (P > 0.05) between treatments and years. The majority
of multiple ovulations were twins; only 1.8% of ovulating
ewes had triplet ovulations. In ovulating ewes, both lucerne
and chicory increased (P < 0.05) the proportion of ewes with
multiple ovulations compared with phalaris pasture (0.36
vs. 0.38 vs. 0.27 respectively; Table 4). Feeding lupins pro-
duced an intermediate response (0.33). The proportion of

Table 4
The mean ovulation rate and proportion of ewes with multiple ovulations for ewes grazing 4 pastures averaged over 2006–2008, excluding non-ovulating
ewes.

Treatment Number of ewes Mean Proportion of ewes with

ovulations/ewea 2+ ovulations

Phalaris 266 1.28 0.27a

Phalaris + lupin 270 1.35 0.33ab
Lucerne 278 1.41 0.36b
Chicory 274 1.39 0.38b

Values with different superscript letters (a, b) indicate means differ at P < 0.05.
a
Mean ovulations per ewe and the percentage of ewes with multiple ovulations are not the same due to the occurrence of some triple ovulating ewes.
246 B.J. King et al. / Animal Reproduction Science 121 (2010) 242–248
Fig. 2. Predicted lines of regression between proportion of ovulating ewes
with multiple ovulations and live pasture on offer pre- () and post-
grazing (), combining data for 2007 and 2008.
ewes with multiple ovulations over all treatments differed
between years (P < 0.05): in 2006, 0.41; in 2007, 0.27; and
in 2008, 0.33. However, there was an interaction (P < 0.05)
between treatment and year largely due to a change in
ranking between chicory and lucerne between years. Data
is not shown because it was the quantity of pasture, rather
than the treatment, influencing this response, as presented
below.
3.3. Relationship between quantity of pasture and
ovulation rate
Logistic regression showed no difference (P > 0.05)
between treatments in the relationship between the quan-
tity of live pasture on offer and the proportion of ewes with
multiple ovulations. This indicates that it was the quan-
tity of live pasture, rather than the species, that resulted in
different ovulatory responses in this study.
Excluding the lupin treatments, where the response
may not reflect the quantity of pasture, and 2006 data
where ovulation rate was measured in March rather than
January, the proportion of ewes with multiple ovulations
was significantly increased with increasing quantities of
live herbage both pre- and post-grazing (Fig. 2). The regres-
sion equations, where y is proportion of ewes with multiple
ovulations, were:
Pre-flushing live biomass:
y = 0.3492 − 0.276 × 0.99410biomass (P = 0.04)
Post-flushing live biomass:
y = 0.3483 − 0.2203 × 0.9736biomass (P = 0.04)
The proportion of ewes with multiple ovulations at 90%
of the maximum predicted by the regression was achieved
with a pre-grazing live pasture on offer of 350 kg DM/ha,
and post-grazing 70 kg DM/ha. There was a poor relation-
ship (P > 0.05) between the quantity of dead pasture and
ovulation rate.
4. Discussion
This study indicates that short-term grazing of live pas-
tures can increase ovulation rate in oestrus synchronised
ewes by increasing the proportion of ewes with multiple
ovulations compared with those grazing senesced pasture.
Grazing both chicory and lucerne increased ovulation rates
to the same or higher extent when compared to ewes given
supplements of 500 g/h/day of lupin grain per ewe. The
ovulatory response is closely related to the quantity of live
pasture available and the pattern of feeding may also be
important.
The increases in ovulation rate of up to 10% in plots
where sufficient live pasture was available were within the
range achieved with lupin feeding in previous flushing tri-
als of either short-term (14–29%) (Stewart and Oldham,
1986; Teleni et al., 1989) or longer-term (−14 to 21%)
(Croker et al., 1985) flushing trials, indicating the suitability
of short-term grazing as an alternative. Although there are
reports of grazing lucerne reducing ovulation rate, this was
due to ingestion of coumestans when lucerne is infected
with fungus (Smith et al., 1979), and this situation can be
avoided.
There are few reports of short-term flushing using
live pasture. Wilkins (1997) investigated the potential of
grazing for 18 days prior to mating using the perennial
leguminous shrub tagasaste (C. palmensis). This plant pro-
vides fodder typically testing as 15–18% crude protein and
around 70% in vitro digestibility (Oldham et al., 1994). He
found that the ovulation rates of ewes grazing tagasaste
in both of 2 experiments (1.34 and 1.22) were higher than
that of control ewes grazing dead standing pasture (1.14
and 1.06), but not as high as that measured in ewes supple-
mented with lupins for 9 or 18 days prior to mating (1.80
and 1.72). Similarly, the number of lambs born per ewe
has been increased by grazing Lotus corniculatus either for
12 days (Vinoles et al., 2009) or several weeks (Ramirez-
Restrepo et al., 2005). Thus previous evidence supports
the current study which indicated that both legume and
non-legume live pastures can increase ovulation rate. It
is likely that the quantity of live pasture will be the most
limiting factor determining ovulatory response, due to the
improvement in feed quality when compared with senes-
cent pasture.
The proportion of ewes with multiple ovulations being
higher in 2006 than in later years was probably due to
several factors: measurement via laparoscopy rather than
ultrasound providing a more accurate estimate (Dickie et
al., 1999), ewes being in higher condition, and because ovu-
lation rate was measured well into, rather than at the start
of the breeding season. From this study it is not possible to
determine whether the ovulatory response to short-term
grazing varies with time of year.
The variation in ovulatory responses in different treat-
ments between years was largely explained by the
quantities of live pasture available. This is similar to previ-
ous studies that show that increases in ovulation rate due
to lupin supplementation are rate responsive (Lightfoot et
al., 1976). The data here suggest that significant responses
in ovulation rate can be achieved when as low as 350 kg
DM/ha live pasture is available pre-grazing to synchronised
ewes.
In this study the pattern of nutrition would also have
varied between years. Much or all of the live pasture leaf
was eaten before the end of the grazing period, at times sev-
eral days before, such that both the quantity and quality of
live pasture after about day 10 of the oestrous cycle would
 B.J. King et al. / Animal Reproduction Science 121 (2010) 242–248
have been rapidly declining with mainly stem remaining.
A varying pattern between different paddocks probably
contributed to the varying response in ovulation rate, but
the regressions demonstrate that even small quantities
of live pasture pre-grazing are associated with significant
increases in ovulation rate (Fig. 2). Although large quanti-
ties of live stem of low quality were available post-grazing
in both lucerne and chicory in 2008, we can only specu-
late that ovulation rates could have been further increased
if the quality of remaining pasture was higher. It is likely
because the ovulation rates achieved are considered below
the ewe’s genetic potential. In practice, producers need to
adjust stocking rates so that sufficient live pasture remains
at the end of the critical grazing period.
If a higher response is obtainable with better quality
and quantity of pasture, then short-term flushing is more
likely to have commercial value. In our case, while the 10%
increase in ovulation rate was statistically significant, only
approximately 10.5 more lambs would be born per 100
ewes joined, once embryo mortality has been accounted
for. In this case, the economic benefit of the short-term
feeding, after allowing for the additional costs of synchro-
nisation (synchronisation materials, additional labour and
increased ram percentage) would depend on lamb values.
From a practical viewpoint, synchronisation is a sub-
stantial cost and effort and is unlikely to be adopted unless
the ovulatory response is large. However, the advantage
of synchronisation is that it allows exposure of all ewes
to live pasture at the “critical” stage of the oestrous cycle
in a short grazing period. This is particularly beneficial
in drought years such as those in this study, where the
quantity of feed was limited. It also allows the reallocation
of limited feed resources to other livestock classes, such
as finishing lambs. Furthermore, the short joining period
associated with synchronisation facilitates the “focussed”
feeding of pregnant ewes such as “colostrum feeding”
(Martin et al., 2004). However, producers in extensive
sheep production systems are more likely to use short-
term feeding if synchronisation is not required. Although
this study has shown the principle that short-term feeding
of live pasture increases ovulation rates in synchronised
ewes, its effectiveness in unsynchronised ewes is not
known.
5. Conclusion
Short-term feeding of synchronised ewes on live pas-
ture is a method of increasing ovulation rate in ewes
without risking triplet pregnancies. It may be a more cost-
effective alternative to both longer-term grazing or lupin
supplementation, which has been shown to give highly
variable responses, where suitable pastures already exist
in the grazing system. However, it is also important to cal-
culate whether the extra lambs born will lead to increased
profit margins after considering the cost of synchronisa-
tion. On the other hand, these costs may be out-weighed
by the benefits that growing perennial rather than annual
pastures have to the local environment in their ability to
reduce groundwater discharge. Further studies are needed
to define optimum quantities of live pasture pre- and post-
grazing, to determine whether the response varies with
247
time of year and, to evaluate whether short-term feeding
is effective in unsynchronised ewes.
Acknowledgements
This work was funded by EverGraze® - More livestock
from perennials. EverGraze is a Future Farm Industries CRC,
Meat and Livestock Australia and Australian Wool Innova-
tion research and delivery partnership. The studies were
conducted under the CRC for Plant-based Management
of Dryland Salinity. The authors wish to thank Profes-
sor Graeme Martin for his advice on experimental design,
Mr John Broster for his technical assistance and Dr Car-
olina Vinoles for conducting rectal ultrasounds in 2007. Dr
Raquel Waller and Mr Matthew Lieschke assisted with field
work in 2006.
References
Cayley, J.W.D., Bird, P.R., 1996. Techniques for Measuring Pastures. Agri-
culture Victoria, Hamilton.
Coop, I.E., 1962. Liveweight-productivity relationships in sheep I.
Liveweight and reproduction. NZ J. Agric. Res. 5, 249–264.
Croker, K.P., Johns, M.A., Johnson, T.J., 1985. Reproductive performance
of Merino ewes supplemented with sweet lupin seed in southern
Western Australia. Aust. J. Exp. Agric. 25, 21–26.
Dear, B.S., Ewing, M.A., 2008. The search for new pasture plants to achieve
more sustainable production systems in southern Australia. Aust. J.
Exp. Agric. 48, 387–396.
Dickie, A.M., Paterson, C., Anderson, J.L.M., Boyd, J.S., 1999. Determination
of corpora lutea numbers in Booroola-Texel ewes using transrectal
ultrasound. Theriogenology 51, 1209–1224.
Edey, T.N., 1968. Bodyweight and ovulation rate in sheep. Proc. Aust. Soc.
Anim. Prod. 24, 190.
Gunn, R.G., Doney, J.M., Smith, W.F., 1984. The effect of level of pre-mating
nutrition on ovulation rate in Scottish Blackface ewes in different body
conditions at mating. Anim. Prod. 39, 235–239.
Haydock, K.P., Shaw, N.H., 1975. The comparative yield method for esti-
mating dry matter yield of pasture. Aust. J. Exp. Agric. Anim. Husb. 15,
663–670.
Holst, P.J., Kemp, D.R., Goodacre, M., Hall, D.G., 1998. Summer lamb pro-
duction from puna chicory (Cichorium intybus) and lucerne (Medicago
sativa). Proc. Aust. Soc. Anim. Prod. 22, 145–148.
Jefferies, B.C., 1961. Body condition scoring and its use in management.
Tas. J. Agric. 32, 19–21.
Kohno, H., Okamoto, C., Iida, K., Takeda, T., Kaneko, E., Kawashima, C.,
Miyamoto, A., Fukui, Y., 2005. Comparison of estrus induction and
subsequent fertility with two different intravaginal devices in ewes
during the non-breeding season. J. Reprod. Dev. 51, 805–812.
Knight, T.W., Oldham, C.M., Lindsay, D.R., 1975. Studies in ovine infertility
in agricultural regions of Western Australia: The influence of a sup-
plement of lupins (Lupinus angustifolius cv. Uniwhite) at joining on the
reproductive performance of ewes. Aust. J. Agric. Res. 26, 567–575.
Lightfoot, R.J., Marshall, T., Croker, K.P., 1976. Effects of rate and duration
of lupin grain supplementation on ovulation and fertility of Merino
ewes. Proc. Aust. Soc. Anim. Prod. 11, 5.
Martin, G.B., Milton, J.T.B., Davidson, R.H., Banchero Hunzicker, G.E., Lind-
say, D.R., Blache, D., 2004. Natural methods for increasing reproductive
efficiency in small ruminants. Anim. Reprod. Sci. 82/83, 231–245.
Nottle, M.B., Kleeman, D.O., Seamark, R.F., 1997. Effect of previous under-
nutrition on the ovulation rate of merino ewes supplemented with
lupin grain. Anim. Reprod. Sci. 49, 29–36.
Nottle, M.B., Seamark, R.F., Setchell, B.P., 1990. Feeding lupin grain for six
days prior to a cloprostenol-induced luteolysis can increase ovulation
rate in sheep irrespective of when in the oestrous cycle supplemen-
tation commences. Reprod. Fertil. Dev. 2, 189–192.
Oldham, C.M., Lindsay, D.R., 1980. Laparoscopy in the ewe: a photographic
record of the ovarian activity of ewes experiencing normal or abnor-
mal oestrous cycles. Anim. Reprod. Sci. 3, 119–124.
Oldham, C.M., Allen, G.M., Fortune, J.A., 1994. Production from cows and
calves set-stocked on tagasaste, a perennial leguminous fodder shrub.
Proc. Aust. Soc. Anim. Prod. 20, 85–88.
Payne, R.W., Harding, S.A., Murray, D.A., Soutar, D.M., Baird, D.B., Welham,
S.J., Kane, A.F., Gilmour, A.R., Thompson, R., Webster, R., Tunnicliffe
248 B.J. King et al. / Animal Reproduction Science 121 (2010) 242–248
Wilson, G., 2006. Genstat Release 9 Lawes Agricultural Trust, Rotham-
stead.
Ramirez-Restrepo, C.A., Barry, T.N., Lopez-Villalobos, N., Kemp, P.D., Har-
vey, T.G., 2005. Use of Lotus corniculatus containing condensed tannins
to increase reproductive efficiency in ewes under commercial dryland
farming conditions. Anim. Feed Sci. Technol. 121, 23–43.
SCA (Ed.), 1990. Feeding standards for Australian livestock: Ruminants.
CSIRO, Melbourne.
Scaramuzzi, R.J., Campbell, B.K., Downing, J.A., Kendall, N.R., Khalid, M.,
Munoz-Gutierrez, M., Somchit, A., 2006. A review of the effects of
supplementary nutrition in the ewe on the concentrations of repro-
ductive and metabolic hormones and the mechanisms that regulate
folliculogenesis and ovulation rate. Reprod. Nutr. Dev. 46, 339–354.
Smith, J.F., Jagusch, K.T., Brunswick, L.F.C., Kelly, R.W., 1979. Coumestans
in lucerne and ovulation in ewes. NZ J. Agric. Res. 22, 411–416.
Smith, J.F., Stewart, J.F., 1990. Effects of nutrition on the ovulation rate
of ewes. In: Oldham, C.M., Martin, G.B., Purvis, I.W. (Eds.), Reproduc-
tive Physiology of Merino Sheep – Concepts and Consequences, School
of Agriculture (Animal Science). The University of Western Australia,
Perth, pp. 85–101.
Stewart, R., Oldham, C.M., 1986. Feeding lupins to ewes for four days dur-
ing the luteal phase can increase ovulation rate. Proc. Aust. Soc. Anim.
Prod. 16, 367–370.
Teleni, E., Rowe, J.B., Croker, K.P., Murray, P.J., King, W.R., 1989. Lupins
and energy-yielding nutrients in ewes. II. Responses in ovulation rate
in ewes to increased availability of glucose, acetate and amino acids.
Reprod. Fertil. Dev. 1, 117–125.
Thomas, D.T., Milton, J.T.B., Revell, C.K., Ewing, M.A., Dynes, R.A., Murray,
K., Lindsay, D.R., 2010. Preference of sheep among annual legumes is
more closely related to plant nutritive value as plants mature. Anim.
Prod. Sci. 50, 114–123.
Upjohn, B., Parker, M., Kemp, D., 2005. Chicory (Chicorium intybus), Agnote
DPI-398, 3rd ed. NSW Department of Primary Industries.
Vinoles, C., Forsberg, M., Martin, G.B., Cajarville, C., Repetto, J., Meikle, A.,
2005. Short-term nutritional supplementation of ewes in low body
condition affects follicle development due to an increase in glucose
and metabolic hormones. Reproduction 129, 299–309.
Vinoles, C., Meikle, A., Forsberg, M., 2004. Accuracy of evaluation of ovarian
structures by transrectal ultrasonography in ewes. Anim. Reprod. Sci.
80, 69–79.
Vinoles, C., Meikle, A., Martin, G.B., 2009. Short-term nutritional treat-
ments grazing legumes or feeding concentrates increase prolificacy
in Corriedale ewes. Anim. Reprod. Sci. 113, 82–92.
Warn, L., Webb Ware, J., Salmon, L., Donnelly, J., Alcock, D., 2006. Analysis
of the profitability of sheep wool and meat enterprises in southern
Australia. Final Report for Project 1.2.6., Sheep Co-operative Research
Centre.
Wilkins, J.F., 1997. Method of stimulating ovulation rate in Merino ewes
may affect conception but not embryo survival. Anim. Reprod. Sci. 47,
31–42.
 Animal Reproduction Science 121 (2010) 249–258

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Comparative studies on bull and stallion seminal DNase activity

and interaction with semen extender and spermatozoa
Abdorrahman S. Alghamdi a,∗ , Bethany J. Funnell b , Scott L. Bird b , G. Cliff Lamb c ,
Aaron K. Rendahl d , Patrick C. Taube e , Douglas N. Foster f
a
100 E. Normal St., Department of Agricultural Sciences, Truman State University, Kirksville, MO 63501, United States
b
North Central Research and Outreach Center, University of Minnesota, Grand Rapid, MN, United States
c
North Florida Research and Education Center, University of Florida, Marianna, FL, United States
d
School of Statistics, University of Minnesota, St. Paul, MN, United States
e
Pfizer Animal Health Inc., Kalamazoo, MI, United States
f
Department of Animal Science, University of Minnesota, St. Paul, MN, United States

a r t i c l e i n f o a b s t r a c t

Article history: We performed a series of comparative studies of bull and stallion seminal plasma (SP) and its
Received 17 August 2009 role on sperm–neutrophil binding as well as the interaction between semen extender and
Received in revised form 8 June 2010
seminal DNase. Because of contrasting roles of SP on sperm–neutrophil binding between
Accepted 14 June 2010
horses and cattle, it was suspected there were some species-specific differences on sperm
Available online 30 June 2010
interaction with SP proteins due to the variations in the natural location of semen deposition
(uterus compared to vagina). Bull frozen-thawed sperm removed from egg yolk extender
Keywords:
showed similar results to fresh sperm, but this also caused extensive sperm agglutination
Bull
Stallion unless SP or egg yolk was included. If similar agglutination occurs after AI with frozen bull
Seminal plasma semen, it could interfere with sperm transport or sperm functions. Commonly used bull
Sperm semen extenders were poor media for seminal DNase activity on plasmid DNA degradation,
Neutrophil raising the prospect that the same may be true with other SP factors important to fertility.
DNase DNase activity per mg SP protein of bulls was less than that of horses (P < 0.05), but DNase
Semen extender activity associated with bull sperm was greater (P < 0.05) indicating a different affinity of
Binding DNase to spermatozoa. This could be related to the fact that bull sperm naturally migrate
from the vagina to the uterus leaving the bulk of SP behind. In such migration, sperm
cells needed to carry DNase and other SP factors along. Incorporation of egg yolk in bull
semen and introducing SP into the uterus of cattle with current AI protocols may contribute
to reduced fertility. Modifications of semen extender and/or semen processing should be
examined to allow sperm cells a maximum potential for fertilization.
© 2010 Elsevier B.V. All rights reserved.

1. Introduction
Seminal plasma contains many cytokines, hormones,
enzymes, and growth factors that modify various physi-
ological and immunological functions in different species
(Alghamdi and Foster, 2005; Alghamdi et al., 2004; Aljabari
∗ Corresponding author. Tel.: +1 660 785 4548.
E-mail address: abdo@Truman.edu (A.S. Alghamdi).
et al., 2007; Calvete et al., 1996; Lazarevic et al., 1995; Nauc
and Manjunath, 2000; Penna et al., 2007; Robertson, 2007;
Sharkey et al., 2007; Therien et al., 1995, 1997). While bull
epididymal sperm fertilize the egg, fertilization rate was
10% greater for ejaculated sperm (Amman and Griel, 1974),
and non-return rate was 69% and 75% for epididymal and
ejaculated sperm, respectively, but was not statically sig-
nificant (Igboeli and Foote, 1968). In human and horses,
ejaculation and SP improved fertility rate compared to epi-
didymal sperm (Masaya et al., 1996; Morris et al., 2002;

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.06.003
250 A.S. Alghamdi et al. / Animal Reproduction Science 121 (2010) 249–258
Heise et al., 2010). Bull semen is naturally deposited into
the vagina and sperm migrate into the uterus leaving
the bulk of the SP behind, but stallion sperm and SP are
deposited directly into the uterus. The site of semen depo-
sition results in different barriers for sperm transport to
the site of fertilization including neutrophil influx into
the female reproductive tract (FRT; Alghamdi et al., 2001,
2004; Mattner, 1968; Rozeboom et al., 1998; Taylor, 1982;
Tremellen et al., 1998). While neutrophils combat micro-
bial contamination and eliminate excess/dead sperm, their
presence at the time of semen deposition reduces fertil-
ity including in horses and cattle (Alghamdi et al., 2004;
Kasimanickam et al., 2005, 2004; Matilsky et al., 1993; Ou
and Su, 2000; Rozeboom et al., 2000). SP improves the fer-
tility of stallion sperm deposited in the neutrophil-laden
uteri by reducing sperm–neutrophil binding (Alghamdi et
al., 2004; Alghamdi and Foster, 2005).
In contrast to horses, bull sperm binding to neutrophils
and neutrophil extracellular traps (NETs) formation were
lesser in the absence than in the presence of SP or SP pro-
tein (SP-P; Alghamdi et al., 2009). Bull sperm selectively
bind certain SP factors, including seminal DNase, and carry
them into the uterus and oviduct to help accomplish their
presumed roles (Kawano and Yoshida, 2007; McCauley
et al., 1999; Miller et al., 1990). Extension of bull semen
always targets sperm number resulting in different pro-
portions of SP in the final insemination dose (Bergeron et
al., 2004), and semen extenders commonly contain pro-
tein and lipoprotein not naturally found in semen (e.g.
egg yolk, milk). This is especially true for preserved semen
to help sperm withstand cold shock and preserve mem-
brane integrity. Egg yolk replaces/reduces sperm binding
to some SP factors, interferes with assays performed on
sperm (Alghamdi et al., 2009; Amirat et al., 2005; Bergeron
et al., 2004; Wall and Foote, 1999), and stimulates antibody
production in the FRT, which was associated with reduced
fertility in cows (Griffin et al., 1971, 1974; Coulter et al.,
1976).
The different locations of natural semen deposition
between bulls and stallions may explain the contrasting
role of SP on sperm–neutrophil binding between these two
species. The ability of egg yolk to negate the role of SP
on sperm–neutrophil binding (Alghamdi et al., 2009) and
to reduce sperm binding to some SP factors necessary for
upstream function (Bergeron et al., 2004) indicates a role
for semen extenders on sperm interactions with SP factors
important for fertility. We hypothesized semen extenders
would influence seminal DNase activity in vitro and this
enzyme would have greater binding to bull than stallion
sperm. We used different experiments to investigate the
interactions between frozen bull sperm with neutrophils
and the DNase activity and binding to sperm incubated in
different media.
2. Materials and methods
All sample collection was conducted in accordance to
the guidelines of the Institutional Animal Care and Use
Committee, Research Subjects’ Protection Program at the
University of Minnesota.
2.1. Frozen semen
Frozen bull semen from young beef sires was purchased
from Select Sires (Plain City, OH; DeJarnette et al., 2000)
and only samples with a post-thaw motility of ≥40% were
used. Semen from stallions of known fertility was frozen as
previously described (Alghamdi et al., 2002) and all sam-
ples had a minimum of 35% post-thaw motility. The data
reported here on frozen semen included only sperm sam-
ples that were first removed from freezing extender by a
ninefold dilution followed by centrifugation to remove the
freezing extender that included egg yolk, glycerol and SP.
2.2. Seminal plasma preparation
Semen (Bos taurus) was collected by electro ejacula-
tion from five Angus bulls (18–24 months old) that passed
a breeding soundness examination (BSE) and were used
for breeding and in vitro fertilization at the University of
Minnesota North Central Research and Outreach Center.
The collection method of semen for SP preparation did not
influence these data because identical results were found
from SP collected with artificial vagina (data not shown).
All bull semen samples had excellent motility (raw semen
examined immediately after collection) and had a mini-
mum of 80% motility after centrifugation. All bulls were
housed in a small lot without access to pasture with an
open-faced barn for shelter. Semen (Equus caballus) was
collected by artificial vagina from three Arabian stallions
(5–30 years old) of normal fertility, which were housed in
box stalls. The SP was isolated by centrifugation of undi-
luted semen at 400 × g for 10 min to remove the bulk of the
sperm then at 3000 × g for 20 min to remove the remaining
sperm.
2.3. Seminal plasma protein isolation
Pooled SP from each of three males (bulls or stallion)
was prepared as above, treated with proteinase inhibitor
cocktail (Calbiochem, Cat #539131) and frozen at −20 ◦ C
until all samples had been collected. The samples were
thawed on ice, buffered with 2× Dulbecco phosphate
buffered saline without Ca and Mg (PBS, pH 7), and total
SP proteins were precipitated by ammonium sulfate (33%
(w/v)). Precipitated SP protein (SP-P) was collected by cen-
trifugation at 3000 × g for 20 min, re-suspended in PBS, and
dialyzed (3500 MWCO; Slide-A-Lyzer; Pierce) against two
changes of 4 l PBS for 2 h each followed by a third change
over night. Protein concentration was determined (Protein
Assay, BioRad) and the samples were divided to aliquots
and frozen at −80 ◦ C until needed.
2.4. Semen extenders
Bull semen was diluted with different extenders
depending on the experiment: (1) Tris–citrate (Tris); (2)
Tris–citrate–egg yolk (EY; similar to 1 except that it
included 20% egg yolk by volume); (3) skim milk (milk;
heated at 95 ◦ C for 10 min and cleared by centrifugation at
10,000 × g for 5 min with lipids floating on top removed by
aspiration using a wide mouth pasture pipette); and (4)
 A.S. Alghamdi et al. / Animal Reproduction Science 121 (2010) 249–258
AndroMed (Minitube of America, Verona, WI, Reference
# 13503-1250), which substitutes egg yolk with soybean
extracts (for semen extender composition see: Kommisrud
et al., 1996; Amirat et al., 2005; Bergeron et al., 2004). All
extenders were glycerol-free except those used for semen
freezing, but the thawed sperm were removed from the
freezing extender and suspended in glycerol-free exten-
ders (see Section 2.1 above).
2.5. Neutrophil isolation from peripheral blood
Heparinized blood from healthy Angus cows (3½–5½
years old) or heifers (12–18 months old) was subjected to
centrifugation at 600 × g for 10 min and the blood plasma
was removed keeping the buffy coat and RBC layers. The
red blood cells were lysed with four volumes of sterile
water for 40 s and the isotonicity was restored by dilu-
tion with an equal volume of 2× PBS. The WBC pellet was
re-suspended in PBS and layered over lymphocyte sepa-
ration media (LSM; Mediatech Inc., Herndon, VA). After
centrifugation at 500 × g for 30 min, the LSM and buffy
coat (peripheral blood mononuclear cells; PBMCs) were
removed and pelleted neutrophils were then washed, re-
suspended in PBS, counted, adjusted to 1 × 108 cell ml−1 ,
and used within 1.5 h after collection.
2.6. Experiments
2.6.1. Experiment 1: sperm–neutrophil binding
We have previously shown a profound influence of
SP, SP-P, and EY on fresh bull sperm–neutrophil binding
(Alghamdi et al., 2009) and because egg yolk is almost
exclusively used with frozen bull semen, the binding
between neutrophils and frozen-thawed bull sperm was
investigated. Frozen-thawed semen was diluted at a ratio
of 1:9 with Tris, EY, milk or AndroMed extenders and sperm
were recovered by centrifugation and used for the bind-
ing assay. Frozen-thawed sperm cells (3 × 107 ml−1 ) were
incubated with either 0% or 40% SP (v/v) using the four
semen extenders for 30 min at room temperature. Neu-
trophils (5 × 106 ml−1 ) were added to sperm preparations
and incubated for 3 h. Sperm binding was evaluated at 30
and 180 min after mixing the two cell types as the percent-
age of neutrophils that bound to at least one sperm cell
counted under light microscope at a magnification of 400×
(Alghamdi et al., 2009).
2.6.2. Experiment 2: DNase activity in SP and SP-P
In horses, SP digests neutrophil extracellular traps
(NETs) and frees entangled sperm resulting in reduced
binding (Alghamdi and Foster, 2005). However, bull SP
increased neutrophil binding to fresh (Alghamdi et al.,
2009) and frozen bull sperm (Experiment 1) suggesting
seminal DNase was either absent from bull samples or was
inhibited by unknown factors. Because a large proportion
of sperm binding was due to NETs, bull SP DNase activ-
ity in comparison to SP from stallions was investigated as
previously described (Alghamdi and Foster, 2005). Briefly,
crude SP-P from bulls and stallions (2, 1, and 0.5 mg ml−1 )
were used with 2 ␮g plasmid DNA substrate (5 kb) in
a DNase digestion buffer (Tris–HCl 50 mM; NaCl 5 mM;
251
MgCl2 10 mM; CaCl2 mM; pH 7.2; Hashida et al., 1982). The
reaction was performed at room temperature for 15 min
followed by inactivation of DNase with 50 ␮M EGTA. To
determine the role of semen extender on DNase activity,
stallion and bull SP (10% (v/v)) and SP-P (2 mg ml−1 ) were
examined with plasmid DNA. The buffer was replaced by
the corresponding extenders and the reaction was con-
ducted as previously described. Similar experiments were
performed to examine the effects of divalent cations (Mg2+
and Ca2+ ) on DNase activity using these extenders. In other
experiments, SP and SP-P were replaced by purified cat-
tle pancreatic DNase I (Roche) to determine whether the
results obtained with the different extenders were due to
their composition or potential interactions between exten-
ders and SP/SP-P. In all the experiments above, treated DNA
was then separated on a 1.2% agarose gel. Plasmid DNA
samples treated with 2 mg ml−1 BSA served as a negative
control.
2.6.3. Experiment 3: DNase binding to sperm cells
To examine sperm binding to seminal DNase, frozen-
thawed bull and stallion sperm were washed from the
freezing extender by a 1:9 dilution followed by centrifu-
gation with PBS containing 20% milk extender (v/v). Sperm
cells (3 × 106 ) from each species were set aside to be tested
for DNase activity without further treatment. The remain-
ing sperm cells were divided (within species) to include
the same sperm number in 100 ␮l reaction for the fol-
lowing treatments: (1) sperm alone; (2) sperm with 20%
SP (v/v); and (3) 20% SP without sperm (washing con-
trol). After incubation at 37 ◦ C for 30 min, 900 ␮l of DNase
buffer was added, the samples were subjected to cen-
trifugation at 2000 × g for 5 min, and the supernatant was
removed leaving 20 ␮l in the bottom of the tube. In the first
group, 10 ␮l of DNase buffer containing 2 ␮g of plasmid
was added and incubated at room temperature for 15 min
before stopping DNase activity by the addition of EGTA. In
the second group, 980 ␮l DNase buffer was added to the
20 ␮l left from the first wash and subjected to a second
centrifugation and treated as described for the first group.
The third group was washed a third time before adding
the plasmid DNA. After EGTA addition, samples were sub-
jected to centrifugation at 10,000 × g for 2 min and 20 ␮l
of the supernatant was separated on an agarose gel as
above.
2.7. Time lapse analysis
To show the effect of extender and SP on NETs forma-
tion, we used the same method described for binding. At
the 180-min time point, samples were treated with Sytox
Green and 25 ␮l was placed on a glass slide and covered
with a cover slip. Time lapse analysis was performed with
fluorescent microscopy at 1 s intervals. To show that puri-
fied DNase could digest the formed NETs, an extensively
formed sperm–neutrophil cluster was placed on a Petri
dish and covered with 20 ␮l DNase buffer containing 30
units of purified DNase and Sytox Green. The sample was
then covered with mineral oil and time lapse analysis was
performed at 5 min intervals. Un-stimulated neutrophils
were used as a negative control to demonstrate the absence
252 A.S. Alghamdi et al. / Animal Reproduction Science 121 (2010) 249–258
of NETs formation and time lapse was performed every
15 min.
2.8. Statistical analysis
Data were analyzed using the R 2.5.1 program (R
Development Core Team, 2007) with Repeated Measure
ANOVA. The model included the extender, SP, the day of
sample collection, and time points of data collection as
independent variables. The day of sample collection rep-
resents different frozen semen and neutrophil samples
for each independent experiment. Means were compared
with Tukey HSD method to find simultaneous 95% con-
fidence intervals. All data are presented as means ± SE.
Sperm–neutrophil binding experiment was performed in
three independent replicates in which semen from a dif-
ferent bull and neutrophils from a different cow were
collected for the experiment in three different days. The
number of replications was chosen based on power anal-
ysis using variations gleaned previously (Alghamdi et al.,
2009). All other experiments were replicated in at least five
different days and the figures are representative of these
replications.
3. Results
3.1. Experiment 1
Similar to the results obtained with fresh spermatozoa
(Alghamdi et al., 2009), EY extender invariably prevented
frozen-thawed spermatozoa from binding to neutrophils
with either SP concentration and at either time point (Fig. 1,
and supplemental video 1). The absence of SP resulted in
a lesser (P < 0.05) sperm–neutrophil binding in all exten-
ders except for AndroMed at 180 min. Interestingly, when
sperm cells were removed from the freezing extender and
re-suspended in any extender other than EY, more than 50%
(mean ± SE; 66.2 ± 2.2) of sperm cells bound to each other
(Fig. 2a) unless SP was added, a phenomenon not observed
in any experiment performed with fresh sperm.
3.2. Experiment 2
DNase activity can be examined with plasmid DNA (or
any DNA with a defined unit size) by the appearance of
a DNA smear after treatment with DNase (Fig. 2b; if the
reaction time is allowed to proceed long enough, DNA can
be degraded completely). Bull and horses SP-P was com-
pared using a plasmid DNA substrate and it was found
that SP from both species contained DNase, but the enzy-
matic activity per mg crude preparation was greater in SP-P
from stallions than from bulls (Fig. 2c; P < 0.05). Because
we previously showed that stallion seminal DNase reduced
sperm–neutrophil binding (Alghamdi and Foster, 2005),
it was paradoxical to find that bull SP increased bind-
ing despite the fact that it contained DNase activity. It
was suspected the lesser DNase activity in bull SP may be
due to other SP molecules that inhibit DNase, interactions
between semen extender and SP/SP-P, or that the removal
of bull sperm cells from SP resulted in the removal of DNase
bound to sperm cells. Seminal DNase activity was first eval-
uated in the four semen extenders commonly used with
bull semen as well as a DNase buffer using a plasmid DNA
substrate with SP and SP-P from both stallions and bulls.
Fig. 2d shows that all four extenders served as poor media
for bull seminal DNase activity compared to the DNase
buffer. Although AndroMed showed some degraded DNA,
the DNA smear did not increase even when the incubation
time was extended for 45 min. Milk had a lesser rate of
DNase activity as shown by the presence of a DNA smear
at 45 min (data not shown), although not at 15 min. Stal-
lion seminal DNase, however, was not inhibited by milk
extender (the most commonly used semen extender in this
species), had reduced activity in egg yolk extender, and
was completely inhibited in AndroMed and Tris extenders
(Fig. 2d).
The poor performance of the four extenders examined
indicated the need for modification for DNase to function.
Because bull seminal DNase is Mg2+ - and Ca2+ -dependent
(Hashida et al., 1982), a simple modification would be the
addition of these cations to the extenders. Because DNase
buffer included 10 mM Mg2+ and 2 mM Ca2+ for optimal
activity, this concentration was used as a standard, but
samples at 2× and 0.5× concentrations were also included.
Bull seminal DNase activity can be improved in milk exten-
der by these cations, but no improvement was seen for the
other extenders (Fig. 3a). Because SP and SP-P contains a
complex mixture of proteins, we examined purified DNase
I activity (0.1 U) on plasmid DNA suspended in the four
extenders above as well as DNase buffer. Similar to stal-
lion seminal DNase (see Fig. 2d), purified DNase I activity
in milk extender was less than DNase buffer, but became
similar when supplemented with Ca2+ and Mg2+ (Fig. 3b).
However, Tris, EY, and AndroMed all showed essentially no
DNase activity.
3.3. Experiment 3
To examine the hypothesis that bull sperm cells bind
and carry seminal DNase into the cervix and uterus, we
used frozen semen that had been washed from freezing
extender and that was treated with either buffer alone or
buffer and 20% (v/v) SP for 30 min at 37 ◦ C. Frozen-thawed
stallion and bull sperm cells that were removed from
the freezing extender and examined directly showed less
(P < 0.05) DNase activity (Fig. 3c; lanes 4 and 5). A second
wash was enough to eliminate DNase activity from these
frozen-thawed spermatozoa. However, washed sperm cells
incubated with SP had DNase activity after a single wash;
although stallion sperm cells incubated with SP did not
appear to retain DNase activity being similar in samples
without sperm cells (washing control). When those sperm
cells were washed twice before incubation with plasmid
DNA, stallion sperm retained less DNase activity than that
of bulls. After three washes, stallion sperm showed no DNA
degradation, but bull sperm still contained DNase activity
indicating bull sperm bind to DNase with greater affinity
than stallion sperm (Fig. 3c).
Based on the previous studies with stallions, it was
expected bull seminal DNase would reduce sperm bind-
ing to neutrophils. Because the bull SP results were the
opposite of those expectations, the influence of purified
 A.S. Alghamdi et al. / Animal Reproduction Science 121 (2010) 249–258 253

Fig. 1. The role of semen extenders and SP on the binding of frozen bovine sperm to peripheral neutrophils in vitro. (a) Frozen-thawed sperm were washed
from freezing extender and re-suspended in the four extenders with either 0% or 40% SP (v/v) and the binding was evaluated at 30 and 180 min. Different
letters indicates a difference (P < 0.05; n = 3). (b) Frozen-thawed sperm re-suspended in EY (left panels) or Tris (right panels) with 0% SP (top panels) or 40%
SP (bottom panels) treated with Sytox Green, incubated for 2 h at room temperature and photographed at one frame/s using fluorescent microscopy. Note
the greater NETs formation with Tris extender and 40% SP (green streaks; bottom right panel). Results with AndroMed and milk are similar to those with
Tris. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

DNase I on bull sperm–neutrophil clustering was exam-
ined. The rationale was based on the ability of bull sperm
to bind and carry DNase (Miller et al., 1990) into the uterus,
which was supported by the observation that incubation
of bull sperm with SP appears to restore DNase activity
(Fig. 3b). It is possible that some factors in whole SP may
interfere with DNase activity in addition to the effects due
to the media. Purified DNase I digested the formed NETs
and freed entangled bull sperm when DNase buffer was
used in a manner similar to that observed for stallions
(Fig. 4a and supplementary video 2). To ascertain that neu-
trophils will not form NETs without being activated with SP,
time lapse analysis was also performed with neutrophils
alone and NET formation was virtually absent (Fig. 4b and
254 A.S. Alghamdi et al. / Animal Reproduction Science 121 (2010) 249–258

Fig. 2. (a) Agglutination of bull spermatozoa removed from freezing extender. (b) DNase activity causes a DNA smear indicating degradation. Plasmid DNA
was treated with 1, 0.1, 0.01 and 0 U of DNase I (lanes 1–4, respectively) for 15 min at room temperature. (c) DNase activity per mg crude SP-P from bull and
stallion. Different concentrations of SP-P (2, 1, and 0.5 mg) were incubated with plasmid DNA substrate for 15 min. (d) The four different extenders were
compared to DNase buffer using bull and stallion SP (10% (v/v); first lane within each extender) and SP-P (2 mg ml−1 ; second lane within each extender).
Note how milk inhibited DNase activity from the bull but not the stallion.

supplementary video 3). Unlike stallion sperm, bull sperm
cells without SP did not stimulate NETs formation (Fig. 1b
and supplementary video 1).
4. Discussion
The surprising finding that seminal DNase from bull SP
and SP-P did not digest NETs and that bull SP/SP-P gener-
ally promoted sperm–neutrophil binding was contrary to
previous findings in horses (Alghamdi and Foster, 2005).
A plausible explanation may be provided by Lusignan et
al. (2007) who demonstrated that whole boar SP failed
to induce sperm capacitation, but purified bull seminal
plasma protein (BSP) and a homologous protein (pB1) from
boar SP did. It is possible that some factor(s) in the whole
bull SP and SP-P masked the DNase activity. This is sup-
ported by the fact that purified DNase was able to digest
NETs and release entrapped bull sperm cells, and that the
 A.S. Alghamdi et al. / Animal Reproduction Science 121 (2010) 249–258 255

Fig. 3. (a) Supplementation of milk extender (but not Tris, EY or AndroMed) improved the DNase activity of bull SP. (b) Purified DNase I (0.1 U) was
incubated with plasmid DNA suspended in the following extenders: DNase buffer, Tris, EY, milk, AndroMed, and milk supplemented with Mg and Ca (lanes
1–6, respectively; control BSA in lane 7). (c) Bull but not stallion spermatozoa bind DNase from SP; (1) sperm alone; (2) sperm with SP; and (3) SP alone
(washing control). Sperm removed from freezing extender and used without further washing are shown in lanes 4 and 5. Control BSA was used in all
experiments.

DNase activity in bull SP-P was less than that of stallions.
It should be noted that SP from all species is sequestered
in different organs, is mixed during ejaculation, and the
contents of accessory sex glands are not released at the
same time. All these phenomena may have evolved due
to the presence of certain factors that mask others until
needed, or alternatively activate others at a specific time
or location. With the complex composition of SP we need
to decipher the interactions of SP, sperm cells, and the FRT.
The specificity of such interactions can be appreciated by
the absence of NETs formation when cattle and horse neu-
trophils are incubated alone. However, when neutrophils
are incubated with sperm cells, stallion SP prevents, while
bull SP exacerbates binding and NETs formation.
Semen extender had a clear influence on the binding of
frozen-thawed sperm to neutrophils similar to that seen
with fresh semen (Alghamdi et al., 2009) and EY exten-
der negated the effects of SP. Frozen spermatozoa removed
256 A.S. Alghamdi et al. / Animal Reproduction Science 121 (2010) 249–258

Fig. 4. (a) Purified DNase digested NETs and freed entangled bull sperm, but this required the use of DNase digestion buffer and covered with mineral
oil. Time lapse analysis was performed under fluorescent microscopy with frames acquired every 5 min (see supplementary video 3; left and right panels
represent first and last frames, respectively). (b) Neutrophils alone do not form NETs. First frame was acquired by light microscopy (left panel) then frames
were acquired every 15 min by fluorescent microscopy (right panel; see supplementary video 3).

from the freezing extender (including egg yolk and variable
amounts of SP) resulted in low sperm–neutrophil binding,
but the addition of SP increased the binding significantly.
Surprisingly, the removal of frozen-thawed spermatozoa
from freezing extender resulted in extensive sperm agglu-
tination unless SP was included in the extender or EY
was re-used to suspend those spermatozoa. The ability of
egg yolk molecules to replace some SP proteins or reduce
their binding to sperm cells (Bergeron et al., 2004) may be
responsible for this agglutination. It is possible that egg yolk
replaced some SP factors and when egg yolk was removed,
some adhesion molecules were exposed, leading to sperm
agglutination. This possibility is supported by the fact that
incubation of these sperm cells in any extender containing
SP (or EY extender) prevented sperm agglutination pre-
sumably by replacing those SP factors that masked the
adhesion molecules. More attention needs to be focused
on this possibility due to the potential implication of such
agglutination on sperm transport and fertilization. For
example, if uterine secretions resulted in the removal of EY
from inseminated bull sperm, similar agglutination in the
uterus may lead to hindered sperm transport or increased
sperm elimination. Mounting evidence suggests that egg
yolk may be counter productive to fertility and a thorough
examination of this component is overdue (Griffin et al.,
1971, 1974; Coulter et al., 1976; Hanzen et al., 1994; Amirat
 A.S. Alghamdi et al. / Animal Reproduction Science 121 (2010) 249–258
et al., 2004; Roasa et al., 2007; Leroy et al., 2005; Alghamdi
et al., 2009).
Stallion SP-P had greater DNase activity per mg crude
protein than that of bulls, but bull sperm cells incubated
with SP retained greater DNase activity after repeated
washing. It is possible that sperm cells from stallions have
evolved to rely on soluble seminal DNase for degradation
of NETs because both sperm and SP are deposited into
the uterus. However, bull sperm cells that must migrate
through the cervix leave SP behind and therefore need to
carry this enzyme along to assist sperm navigation through
the NETs in the uterus. The ability of bull sperm cells to
bind DNase may have resulted in the removal of DNase
from prepared SP samples and may have contributed to the
lesser DNase activity per mg SP-P compared to horses. Nev-
ertheless, with the exception of milk extender, the other
three semen extenders commonly used with bovine semen
appear to serve as poor media for bull seminal DNase activ-
ity (at least for up to the 45 min incubation time tested).
Surprisingly, purified bovine pancreatic DNase I and equine
seminal DNase function well in milk extender showing
clear DNA degradation within 15 min and the latter even
showed activity in EY extender with increased incuba-
tion time. Bull seminal DNase activity improved in milk
extender supplemented with Ca2+ and Mg2+ , but this sup-
plementation did not improve activity in the other three
extenders.
The results with frozen bull semen in the present
study were similar to those with fresh semen (Alghamdi
et al., 2009) in that the absence of SP resulted in
low sperm–neutrophil binding, while the presence of SP
increased the binding substantially and EY extender was
capable of interfering with this binding. Furthermore, the
composition of the most commonly used bull semen exten-
ders are not capable of supporting bull seminal DNase
activity and maybe similar for other SP factors important to
fertility mandating a re-examination of these extenders as
more SP factors (other than DNase) are identified and their
functions are characterized. It is possible that bull semen
deposition into the vagina has resulted in altered sperm
interactions with SP factors such that spermatozoa can
carry these factors into the uterus and oviduct while SP left
in the vagina promotes neutrophil activities for the elimi-
nation of spermatozoa that failed to migrate into the uterus.
The ability of stallion SP to reduce sperm–neutrophil bind-
ing may reflect the fact that semen in this species is
deposited into the uterus with an altered composition of
SP to allow sperm cells sufficient time to reach the oviduct
by reducing and/or delaying the neutrophil elimination
of spermatozoa. In addition, the estrous period of cattle
is much shorter than that of horses, so the potential for
repeated inseminations under natural conditions in the for-
mer is less than for the latter. If the deposition of bull SP
into the uterus (as is performed with current AI) results
in an increased or faster neutrophil influx, the increased
binding may indicate that a significant number of sperm
cells is eliminated before reaching the site of fertilization.
Future research need to include testing the influence of
bull SP deposited in the uterus on sperm transport to the
oviduct, influx of neutrophils to the uterine lumen, and
ultimately the fertility rate in both cows with pre-existing
257
uterine neutrophils and those with clear uteri at the time
of insemination.
Acknowledgements
This project was supported by a grant from Pfizer
Animal Health Inc., Kalamazoo MI; Grant Number 1743-
410-6320. We thank Linda Foster and Robyn Gangl for
laboratory assistance, and Dr. Scott Madill for assistance
with sample collection.
Appendix A. Supplementary data
Supplementary data associated with this arti-
cle can be found, in the online version, at
doi:10.1016/j.anireprosci.2010.06.003.
References
Alghamdi, A.S., Foster, D.N., 2005. Seminal DNase frees spermato-
zoa entangled in neutrophil extracellular traps. Biol. Reprod. 73,
1174–1181.
Alghamdi, A., Troedsson, M.H., Laschkewitsch, T., Xue, J.L., 2001. Uterine
secretion from mares with post-breeding endometritis alters sperm
motion characteristics in vitro. Theriogenology 55, 1019–1028.
Alghamdi, A.S., Troedsson, M.H., Xue, J.L., Crabo, B.G., 2002. Effect of semi-
nal plasma concentration and various extenders on postthaw motility
and glass wool–Sephadex filtration of cryopreserved stallion semen.
Am. J. Vet. Res. 63, 880–885.
Alghamdi, A.S., Foster, D.N., Troedsson, M.H., 2004. Equine seminal plasma
reduces sperm binding to polymorphonuclear neutrophils (PMNs)
and improves the fertility of fresh semen inseminated into inflamed
uteri. Reproduction 127, 593–600.
Alghamdi, A.S., Lovaas, B.J., Bird, S.L., Lamb, G.C., Rendahl, A.K., Taube, P.C.,
Foster, D.N., 2009. Species-specific interaction of seminal plasma on
sperm–neutrophil binding. Anim. Reprod. Sci. 114, 331–344.
Aljabari, B., Calogero, A.E., Perdichizzi, A., Vicari, E., Karaki, R., Lahloub, T.,
Zatari, R., El-Abed, K., Nicoletti, F., Miller, E.J., Pavlov, V.A., Al-Abed, Y.,
2007. Imbalance in seminal fluid MIF indicates male infertility. Mol.
Med. 13, 199–202.
Amirat, L., Tainturier, D., Jeanneau, L., Thorin, C., Gerard, O., Courtens, J.L.,
Anton, M., 2004. Bull semen in vitro fertility after cryopreservation
using egg yolk LDL: a comparison with Optidyl, a commercial egg yolk
extender. Theriogenology 61, 895–907.
Amirat, L., Anton, M., Tainturier, D., Chatagnon, G., Battut, I., Courtens, J.L.,
2005. Modifications of bull spermatozoa induced by three extenders:
Biociphos, low density lipoprotein and Triladyl, before, during and
after freezing and thawing. Reproduction 129, 535–543.
Amman, R.P., Griel, L.C., 1974. Fertility of bovine spermatozoa from rete
testis, cauda epididymids, and ejaculated semen. J. Dairy Sci. 57,
212–219.
Bergeron, A., Crete, M.H., Brindle, Y., Manjunath, P., 2004. Low-density
lipoprotein fraction from hen’s egg yolk decreases the binding of the
major proteins of bovine seminal plasma to sperm and prevents lipid
efflux from the sperm membrane. Biol. Reprod. 70, 708–717.
Calvete, J.J., Varela, P.F., Sanz, L., Romero, A., Mann, K., Topfer-Petersen, E.,
1996. A procedure for the large-scale isolation of major bovine seminal
plasma proteins. Protein Expr. Purif. 8, 48–56.
Coulter, G.H., Foote, R.H., Schiavo, J.J., Braun, R.K., 1976. Antibodies to egg
yolk in blood serum of rabbits and cattle and cervical mucus of cattle
inseminated artificially. Theriogenology 6, 585–589.
DeJarnette, J.F., Barnes, D.A., Marshall, C.E., 2000. Effects of pre- and post-
thaw thermal insults on viability characteristics of cryopreserved
bovine semen. Theriogenology 53, 1225–1238.
Griffin, J.F., Nunn, W.R., Hartigan, P.J., 1971. An immune response to egg-
yolk semen diluent in dairy cows. J. Reprod. Fertil. 25, 193–199.
Griffin, J.F., Hartigan, P.J., McGilligan, C.A., Nunn, W.R., 1974. Antibodies to
semen diluent and infertility in rabbits. Theriogenology 1, 55–61.
Hanzen, C., Laurent, Y., Ward, W.R., 1994. Comparison of reproductive
performance in Belgian dairy and beef cattle. Theriogenology 41,
1099–1114.
Hashida, T., Tanaka, Y., Matsunami, N., Yoshihara, K., Kamiya, T., Tanigawa,
Y., Koide, S.S., 1982. Purification and properties of bull seminal plasma
Ca2+ , Mg2+ -dependent endonuclease. J. Biol. Chem. 257, 13114–13119.
258 A.S. Alghamdi et al. / Animal Reproduction Science 121 (2010) 249–258
Heise, A., Hahn, W., Volkmann, D.H., Thompson, P.N., Gerber, D., 2010.
Influence of seminal plasma on fertility of fresh and frozen-thawed
stallion epididymal spermatozoa. Anim. Reprod. Sci. 118, 48–53.
Igboeli, G., Foote, R.H., 1968. Maturation changes in bull epididymal sper-
matozoa. J. Dairy Sci. 51, 1703–1705.
Kasimanickam, R., Duffield, T.F., Foster, R.A., Gartley, C.J., Leslie,
K.E., Walton, J.S., Johnson, W.H., 2004. Endometrial cytology and
ultrasonography for the detection of subclinical endometritis in post-
partum dairy cows. Theriogenology 62, 9–23.
Kasimanickam, R., Duffield, T.F., Foster, R.A., Gartley, C.J., Leslie, K.E., Wal-
ton, J.S., Johnson, W.H., 2005. A comparison of the cytobrush and
uterine lavage techniques to evaluate endometrial cytology in clin-
ically normal postpartum dairy cows. Can. Vet. J. 46, 255–259.
Kawano, N., Yoshida, M., 2007. Semen-coagulating protein, SVS2, in
mouse seminal plasma controls sperm fertility. Biol. Reprod. 76,
353–361.
Kommisrud, E., Steine, T., Graffer, T., 1996. Comparison of fertility rates
following insemination with different numbers of spermatozoa per
insemination dose of frozen bovine semen. Reprod. Domes. Anim. 31,
359–362.
Lazarevic, M., Skibinski, G., Kelly, R.W., James, K., 1995. Immunomodu-
latory effects of extracellular secretory vesicles isolated from bovine
semen. Vet. Immunol. Immunopathol. 44, 237–250.
Leroy, J.L., Opsomer, G., De Vliegher, S., Vanholder, T., Goossens, L., Geldhof,
A., Bols, P.E., de Kruif, A., Van Soom, A., 2005. Comparison of embryo
quality in high-yielding dairy cows, in dairy heifers and in beef cows.
Theriogenology 64, 2022–2036.
Lusignan, M.F., Bergeron, A., Crete, M.H., Lazure, C., Manjunath, P., 2007.
Induction of epididymal boar sperm capacitation by pB1 and BSP-
A1/-A2 proteins, members of the BSP protein family. Biol. Reprod. 76,
424–432.
Masaya, K., Kiyomi, M., Mikio, N., Tomoko, H., Tsukasa, S., Akihiko, O., 1996.
The fertilizing ability of human epididymal sperm. J. Assist. Reprod.
Genet. 13, 652–656.
Matilsky, M., Ben-Ami, M., Geslevich, Y., Eyali, V., Shalev, E., 1993. Cervical
leukocytosis and abnormal post-coital test: a diagnostic and thera-
peutic approach. Hum. Reprod. 8, 244–246.
Mattner, P.E., 1968. The distribution of spermatozoa and leucocytes in
the female genital tract in goats and cattle. J. Reprod. Fertil. 17, 253–
261.
McCauley, T.C., Zhang, H., Bellin, M.E., Ax, R.L., 1999. Purification and char-
acterization of fertility-associated antigen (FAA) in bovine seminal
fluid. Mol. Reprod. Dev. 54, 145–153.
Miller, D.J., Winer, M.A., Ax, R.L., 1990. Heparin-binding proteins from
seminal plasma bind to bovine spermatozoa and modulate capaci-
tation by heparin. Biol. Reprod. 42, 899–915.
Morris, L., Tiplady, C., Allen, W.R., 2002. The in vivo fertility of cauda epi-
didymal spermatozoa in the horse. Theriogenology 58, 643–646.
Nauc, V., Manjunath, P., 2000. Radioimmunoassays for bull seminal
plasma proteins (BSP-A1/-A2, BSP-A3, and BSP-30-kilodaltons), and
their quantification in seminal plasma and sperm. Biol. Reprod. 63,
1058–6610.
Ou, M.C., Su, C.S., 2000. Implications of asymptomatic endocervical leuko-
cytosis in infertility. Gynecol. Obstet. Invest. 49, 124–126.
Penna, N., Mondaini, S., Amuchastegui, S., Degli Innocenti, M., Carini,
G., Giubilei, B., Fibbi, E., Colli, M., Maggi, M., Adorini, L., 2007. Sem-
inal plasma cytokines and chemokines in prostate inflammation:
interleukin 8 as a predictive biomarker in chronic prostatitis/chronic
pelvic pain syndrome and benign prostatic hyperplasia. Eur. Urol. 51,
524–533.
Roasa, L.M., Choi, Y.H., Love, C.C., Romo, S., Varner, D.D., Hinrichs, K., 2007.
Ejaculate and type of freezing extender affect rates of fertilization of
horse oocytes in vitro. Theriogenology 68, 560–566.
Robertson, S.A., 2007. Seminal fluid signaling in the female reproductive
tract: lessons from rodents and pigs. J. Anim. Sci. 85, E36–44.
Rozeboom, K.J., Troedsson, M.H., Crabo, B.G., 1998. Characterization of
uterine leukocyte infiltration in gilts after artificial insemination. J.
Reprod. Fertil. 114, 195–199.
Rozeboom, K.J., Troedsson, M.H., Hodson, H.H., Shurson, G.C., Crabo, B.G.,
2000. The importance of seminal plasma on the fertility of subsequent
artificial inseminations in swine. J. Anim. Sci. 78, 443–448.
R Development Core Team, 2007. R: A Language and Environment for Sta-
tistical Computing. R Foundation for Statistical Computing, Vienna,
Austria, ISNB 3-900051007-0 http://www.R-project.org.
Sharkey, D.J., Macpherson, A.M., Tremellen, K.P., Robertson, S.A., 2007.
Seminal plasma differentially regulates inflammatory cytokine gene
expression in human cervical and vaginal epithelial cells. Mol. Hum.
Reprod. 13, 491–501.
Taylor, N.J., 1982. Investigation of sperm-induced cervical leucocytosis by
a double mating study in rabbits. J. Reprod. Fertil. 66, 157–160.
Therien, I., Bleau, G., Manjunath, P., 1995. Phosphatidylcholine-binding
proteins of bovine seminal plasma modulate capacitation of sperma-
tozoa by heparin. Biol. Reprod. 52, 1372–1379.
Therien, I., Soubeyrand, S., Manjunath, P., 1997. Major proteins of
bovine seminal plasma modulate sperm capacitation by high-density
lipoprotein. Biol. Reprod. 57, 1080–1088.
Tremellen, K.P., Seamark, R.F., Robertson, S.A., 1998. Seminal transforming
growth factor beta1 stimulates granulocyte-macrophage colony-
stimulating factor production and inflammatory cell recruitment in
the murine uterus. Biol. Reprod. 58, 1217–1225.
Wall, R.J., Foote, R.H., 1999. Fertility of bull sperm frozen and stored in
clarified egg yolk–Tris–glycerol extender. J. Dairy Sci. 82, 817–821.
 Animal Reproduction Science 121 (2010) 259–266

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Effect of number of motile, frozen-thawed boar sperm and number of

fixed-time inseminations on fertility in estrous-synchronized gilts夽
Karl W. Spencer a , Phil H. Purdy b , Harvey D. Blackburn b , Scott F. Spiller b , Terry S. Stewart c ,
Robert V. Knox a,∗
a
Department of Animal Sciences, University of Illinois, 1207 W Gregory Dr. BLD. 165, Urbana, IL 61801, United States
b
USDA-ARS National Center for Genetic Resources Preservation, National Animal Germplasm Program, 1111 S. Mason St., Fort Collins, CO 80521-4500,
United States
c
Purdue University, 915 W State St., 3-234 Lilly Hall, West Lafayette, IN 47907, United States

a r t i c l e i n f o a b s t r a c t

Article history: There are advantages for use of frozen-thawed boar sperm (FTS) as a tool for preser-
Received 6 November 2009 vation and transfer of valuable genetic material, despite its practical limitations. It was
Received in revised form 11 June 2010
hypothesized that increasing the number of motile FTS and number of fixed-time artificial
Accepted 5 July 2010
inseminations (AI) would improve pregnancy rate and litter size. Semen from six boars
Available online 13 July 2010
was frozen in 0.5 mL straws at 500 × 106 cells/mL. Gilts ∼170 days of age, were induced
into estrus with PG600® and synchronized using MATRIXTM (synthetic progestagen). Fol-
Keywords:
lowing last feeding of MATRIX (LFM), gilts were checked twice daily for estrus. At onset of
Frozen sperm
Boar estrus, gilts were randomly assigned in a 3 × 2 factorial treatment design to receive 1 × 109
Pregnancy motile FTS (n = 19), 2 × 109 motile FTS (n = 19), 4 × 109 motile FTS (n = 19) in a single AI
Litter size at 32 h after onset of estrus, or 1 × 109 motile FTS (n = 18), 2 × 109 motile FTS (n = 17), or
Ovulation 4 × 109 motile FTS (n = 19) in each of the two AI at 24 and 32 h following onset of estrus.
AI Ultrasonography was performed at 12 h intervals after estrus to estimate time of ovulation.
Reproductive tracts were collected 28–34 days following AI. Estrus occurred at 139 ± 2 h
(mean ± SE) after LFM and ovulation at 33 ± 1 h following onset of estrus. Dose and num-
ber of inseminations did not interact or individually influence pregnancy rate at slaughter
(73 ± 4.2%) or numbers of normal fetuses (10.8 ± 0.5). However, number of fetuses tended
(P = 0.14) to increase with double AI but not with dose. Boar did not affect pregnancy rate
but did affect number of normal fetuses and embryonic survival (P < 0.01). Longer intervals
from insemination to ovulation reduced pregnancy rate (P < 0.05), number of normal fetuses
(P < 0.001), and embryonic survival (P < 0.01). Ovarian abnormalities at slaughter were asso-
ciated with reduced pregnancy rate (P < 0.001). The results of this experiment indicate that
a double insemination using 2 × 109 motile sperm would produce the greatest number of
piglets with fewest numbers of frozen sperm used, while double AI with 1 × 109 motile
sperm would be most practical for pig production with limited genetic resources. Fertil-
ity was also influenced by boar, interval from insemination to ovulation, and gilt ovarian
abnormalities.
© 2010 Elsevier B.V. All rights reserved.

夽 Mention of a trade name or proprietary product does not constitute a guaranty or warranty by the USDA and does not imply approval to the
exclusion of other products that may be suitable. USDA, Agricultural Research Service, Northern Plains Area, is an equal opportunity/affirmative action
employer. All agency services are available without discrimination.
∗ Corresponding author at: University of Illinois, 360 ASL, 1207 W Gregory Dr., MC-630, Urbana, IL 61801 Tel.: +1 217 244 5177; fax: +1 217 333 8286.
E-mail address: rknox@illinois.edu (R.V. Knox).

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.07.002
260 K.W. Spencer et al. / Animal Reproduction Science 121 (2010) 259–266
1. Introduction
Due to reduced fertility in comparison to liquid
extended semen, frozen-thawed boar sperm is used in
less than 1% of all inseminations (Johnson et al., 2000).
Despite its limited use in commercial production, frozen
boar sperm has potential for application if improvements
can be achieved in post-thaw sperm quality and AI fertility.
Frozen boar semen is valued for maintaining swine genet-
ics in the cryopreserved state to allow for preservation and
regeneration of valued genetic lines, for providing for an
emergency sperm supply, and for facilitating opportuni-
ties for global gene distribution (Almlid and Hofmo, 1996;
Johnson et al., 2000; Eriksson et al., 2002; Roca et al., 2006;
Bailey et al., 2008).
Extensive research has been conducted on methods
to improve post-thaw fertility of frozen boar sperm. One
major limitation is that fertility following freezing is influ-
enced by boar and ejaculate and involves variability in
plasma membrane integrity (Waterhouse et al., 2006). To
preserve membrane integrity and sperm viability, several
freezing methods have proven successful (Larsson, 1978;
Bwanga, 1991; Johnson et al., 2000; Grobfeld et al., 2008).
Of these, computerized, controlled-rate freezing machines
(Johnson et al., 2000; Thurston et al., 2003) allow for opti-
mal freezing rate control for maintaining sperm membrane
integrity (Fiser et al., 1993; Hernandez et al., 2007b). In
addition, sperm freezing in straws and bags allows for more
uniform freezing and thawing with the increased surface
area when compared to pellets (Pursel and Johnson, 1976;
Bwanga et al., 1990; Eriksson and Rodriguez-Martinez,
2000a,b). Improvements in freezing media, such as addi-
tion of cholesterol (Bailey et al., 2008), seminal plasma
(Hernandez et al., 2007a; Okazaki et al., 2009b) or antiox-
idants (Grobfeld et al., 2008) have been reported to have
potential for improving post-thaw sperm motility and
acrosome integrity.
Many early studies with frozen boar sperm resulted in
reduced post-thaw quality, and fertility following insem-
ination. The decreased sperm fertility may have resulted
as a consequence of method of freezing while reduced
AI fertility could be attributed to variation in number of
inseminations, number of sperm used, and less than opti-
mal AI timing. In studies, the insemination doses tested
were based on the number of motile or total sperm cells per
dose with estimates for motility averaging ∼30% (Einarsson
et al., 1973; Larsson and Einarsson, 1976). In a review of ear-
lier research, farrowing rates remained at ∼55% and litter
sizes at ∼8 pigs/litter (Johnson, 1985). More recent studies
have used single or double inseminations with 5 to 6 × 109
total sperm with post-thaw motility reported at ∼40–60%
(Roca et al., 2003; Okazaki et al., 2009a). Fertility following
AI in more recent trials has yielded pregnancy rates >60%
with litter sizes >9 pigs per litter (Hofmo and Grevel, 2000;
Eriksson et al., 2002). New technologies, such as intrauter-
ine and deep uterine AI, may allow for increased fertility
when using reduced numbers of sperm (Roca et al., 2003;
Rozeboom et al., 2004). Improved AI timing is also essential
because frozen boar sperm has a reduced fertile lifespan
(Einarsson and Viring, 1973; Waberski et al., 1994) and
must be deposited within 4 h before ovulation to result
in fertilization rates similar to those using liquid semen
(Waberski et al., 1994).
We hypothesized that improved pregnancy rates and
litter sizes would result from use of increased numbers of
motile, frozen-thawed sperm when using multiple instead
of single timed inseminations in order to compensate for
variation in the time of ovulation and reduced fertile lifes-
pan of frozen sperm. The objectives of this study were to
test the impact of numbers of motile, frozen-thawed boar
sperm in either a single or double AI, in relation to interval
from last estrous synchronization treatment to estrus, time
of ovulation, and other sources of variation that included
boar, ovulation rate, quality of insemination, and other
uncontrolled causes of variation.
2. Materials and methods
2.1. Animals, induction and estrous synchrony, ovulation
and insemination determination
The experiment was performed at the University of
Illinois swine research farm in six sequential replicates
from December 2007 to June 2008. All procedures uti-
lized in this experiment were approved by the University
of Illinois Institutional Animal Care and Use Committee.
Terminal line gilts (n = 123, 337 × C22, PIC North Amer-
ica, Hendersonville, TN) were moved from a finishing barn
into crates in a gestation building. All gilts were given
PG600 (400 IU eCG and 200 IU hCG, Intervet/Schering-
Plough, Kenilworth, NJ) for initial induction of estrus. The
gilts selected for this experiment ranged from 165 to
198 days of age and weighed between 95 and 139 kg at
the time of induction. Estrus detection was performed
daily using the back-pressure test while providing fence-
line contact with a mature boar. Ten days following
treatment with PG600, regardless of estrus expression,
stage of estrous cycle in gilts was synchronized using a
synthetic progestagen, MATRIX (Altrenogest 2.2 mg/mL,
Intervet/Schering-Plough, Kenilworth, NJ, USA) for 14 days
as a top-dress on a standard sow gestation diet. After
14 days of MATRIX feeding, in replicates 1–3, gilts were
checked for estrus once daily. In replicates 4–6, PG600
was given to all gilts 24 h following LMF to reduce vari-
ation in timing of estrus and to aid in labor scheduling
and timing for AI. Beginning on the third day following
LMF, estrus detection was performed at 12 h intervals.
Transrectal real-time ultrasonography (Aloka 500 V, Tokyo,
Japan) was initiated 12 h following onset of estrus and con-
tinued at 12 h intervals to observe ovaries and estimate
time of ovulation (Knox et al., 2002). The total number of
large antral follicles >5.0 mm was counted and the images
recorded in electronic format on DVD for playback confir-
mation of follicle size and number. Overall, 111 animals
expressed estrus after LMF and were assigned to treat-
ment. At onset of estrus, gilts were randomly assigned in
a 3 × 2 factorial treatment design to receive 1 × 109 motile
FTS (n = 19), 2 × 109 motile FTS (n = 19), 4 × 109 motile FTS
(n = 19) in a single AI at 32 h after onset of estrus, or 1 × 109
motile FTS (n = 18), 2 × 109 motile FTS (n = 17), or 4 × 109
motile FTS (n = 19) in each of the two AI at 24 and 32 h
following onset of estrus. Gilts were randomly assigned to
 K.W. Spencer et al. / Animal Reproduction Science 121 (2010) 259–266
each treatment in order of estrus detection so that all treat-
ments would receive sperm from the same boar. The order
for boar use was random, but we selected each boar to be
represented across each treatment before the process was
repeated for next boar. The daily experimental procedures
involved semen thawing and dose preparation (0500 and
1700 h), ultrasonography (0800 and 2000 h), followed by
estrous detection (0900 and 2100 h).
2.2. Semen collection, evaluation, and freezing
Terminal line (L220), excellent health, crossbred boars
(PIC, n = 6) with a previous history of offspring production
were selected for use in this study. A total of 3 to 7 ejaculates
were collected for each boar and processed for freezing.
Semen was collected at a commercial PIC stud, diluted
1:4 (v/v) with 37 ◦ C Androhep Plus (Minitube of Amer-
ica, Verona, WI), cooled to 15 ◦ C and shipped overnight
to the USDA-ARS National Center for Genetic Resources
Preservation, National Animal Germplasm Program in Fort
Collins, CO, USA. The samples were then centrifuged for
10 min at 800 × g and the supernatant aspirated and the
resulting pellet evaluated for sperm concentration using
a spectrophotometer (Purdy, 2008). Motility of the ejacu-
late was determined by Computer Assisted Sperm Analysis
(CASA, Hamilton Thorne Research, Beverly MA, USA) as pre-
viously described (Purdy, 2008).
The ejaculates used in this experiment were frozen
using the method of Pursel and Johnson (1975) as
modified by Purdy (2008). Briefly, following centrifuga-
tion, sperm pellets were re-suspended in BF5 cooling
extender (CE, 52 mM TES, 16.5 mM Tris[hydroxymethyl]
aminomethane, 178 mM glucose, 20% egg yolk; 325 mOsm)
to 750 × 106 sperm/mL. The sperm were then equilibrated
at 5 ◦ C for 2.5 h and diluted to 500 × 106 sperm/mL by
drop-wise addition of the BF5 freezing extender (91.5%
CE, 6% glycerol, 2.5% Equex Paste, Minitube of America;
1450 mOsm (Pursel and Johnson, 1975). The sperm was
placed into 0.5 mL CBS straws (IMV Corporation, Min-
neapolis, MN, USA) and frozen using a programmable
freezer (Minidigicool UJ400, IMV USA) with the follow-
ing freeze curve: 5 to −8 ◦ C at 20◦ /min; −8 to −120 ◦ C at
69 ◦ C/min; −120 to −140 ◦ C at 20 ◦ C/min (Purdy, 2008). Fol-
lowing the freezing cycle the straws were placed directly
into liquid nitrogen for storage.
Following ejaculate freezing, the numbers of motile
sperm/straw were estimated by thawing a random straw
and evaluating motility using CASA. Thawed sperm were
diluted 1:5 (v/v) in BTS and warmed to 37 ◦ C and evaluated
after 10 min. The CASA used the following variables which
were preset by the manufacturer: 30 frames acquired,
frame rate of 60 Hz, minimum contrast of 55, minimum
cell size of 5 pixels, VAP cutoff of 20 ␮m, progressive min-
imum VAP cutoff of 45 ␮m/s, VSL cutoff of 5 ␮m/s, static
head size of 0.53–4.45, and magnification of 1.89. A min-
imum of seven fields and 1000 sperm were observed for
motility analysis. The percentage of motile sperm within
each straw was used to determine the number of straws
needed to create doses with the proper number of motile
sperm. Each dose of FTS was comprised of each of 3–7 ejac-
ulations from a single boar. Frozen sperm to be used for
261
insemination was sent to the University of Illinois in liquid
nitrogen dry vapor containers.
2.3. Sperm thawing and insemination
To prepare each insemination dose, straws of frozen
boar sperm were placed in a 50 ◦ C waterbath and agitated
for 20 s for thawing. The thawed sperm were diluted with
80 mL of Androhep CryoGuard Thaw extender (Minitube of
America, Verona, WI) in a 26 ◦ C waterbath. Within 30 min of
thawing, intra-cervical insemination was performed using
standard spirette or foam tipped AI catheters (Minitube of
America, Verona, WI) in the presence of a boar. Because
all animals in this experiment received an insemination at
32 h following first expression of estrus, this AI was scored
for fluid loss during AI. Insemination scoring was based on
categorical 1–3 scale, with a score of 1 having excessive vol-
ume loss during AI, 2 having moderate loss, and 3 having
no volume loss during insemination.
2.4. Pregnancy classification and reproductive tract
processing
Gilts were sacrificed between days 28 and 34 of ges-
tation and reproductive tracts collected. The tracts were
identified and processed for pregnancy status (0 fetus = not
pregnant, or 1 or more fetus = pregnant), number of nor-
mal fetuses, number of degenerative fetuses (those with
abnormal appearance), number of corpora lutea (CL), and
presence of any abnormal structures associated with the
ovaries or oviducts. Abnormalities were identified as fol-
licular or luteal cysts (>12.9 mm) or fluid-filled oviducts.
2.5. Statistical evaluation
Data were evaluated in SAS (SAS Institute, Inc., Cary,
NC) using a mixed model ANOVA (PROC MIXED) for all
continuous response variables and PROC GENMOD for
binary response variables. The continuous response vari-
ables included age and weight of gilts, number of normal
fetuses, quality of insemination, number of degenerative
fetuses, and embryonic survival (total number of fetuses
divided by number of CL at slaughter). The binary response
variables included: pregnancy at slaughter. The MIXED and
GENMOD models included the main effects of dose, num-
ber of inseminations, the interaction of dose × number of
inseminations, boar, AI score, and replicate. Additional con-
tinuous variables such as number of large follicles at estrus
and number of CL at slaughter were included as covari-
ates to test for linear, quadratic and cubic effects. To test
for the effects of interval from insemination to ovulation
and an abnormal ovary at slaughter on pregnancy rate and
number of normal fetuses, one-way ANOVA procedures
were performed using the MIXED and GENMOD proce-
dures, respectively.
To examine the effects of the procedures used for induc-
tion and synchronization and use of PG600 following LMF,
one-way ANOVA was performed using PROC MIXED with
replicate group (1–3 or 4–6) and expression of estrus (Yes
or No) following initial PG600 treatment as class variables
in the model. The response variables included the interval
262 K.W. Spencer et al. / Animal Reproduction Science 121 (2010) 259–266

from LMF to estrus, duration of estrus, interval from insem-
ination to ovulation, numbers of follicles and CL, pregnancy
rate and number of fetuses. All means comparisons were
performed using the LSMEANS statement in SAS and dif-
ferences determined using the PDIFF option. In addition,
Pearson product moment–correlation analyses were per-
formed using the PROC CORR function in SAS to determine
the simple correlation relationship between the number of
follicles >5.0 mm counted using ultrasound with the final
number of CL counted at slaughter.
3. Results
3.1. Post-thaw sperm motility
A total of 26 ejaculates were frozen from the six boars
for use in this experiment with post-thaw motility aver-
aging 38%. Each insemination dose included all ejaculates
from the same boar. The post-thaw motility for each boar
averaged 38 ± 2.9% for boar A (three ejaculates), 36 ± 4.0%
for boar B (five ejaculates), 46 ± 3.5% for boar C (four ejac-
ulates), 32 ± 2.8% for boar D (seven ejaculates), 33 ± 6.4%
for boar E (four ejaculates), and 37 ± 3.8% for boar F (three
ejaculates). Each 0.5 mL straw contained ∼94 × 106 motile
sperm cells.
3.2. Response to estrous induction and synchronization
The initial pubertal response to the estrus induction
treatment with PG600 was 66% with an interval of 100 ± 2 h
(mean ± SE) from PG600 to estrus, with estrus lasting
42 ± 2 h. Expression of estrus following the pubertal induc-
tion with PG600 had no effect (P > 0.20) on expression of
estrus following LMF, or on final pregnancy rate. Use of
PG600 following LMF reduced the interval from LMF to
estrus (P < 0.0001) in replicates 4–6 (130 ± 3 h) compared
to replicates 1–3 (148 ± 3 h). Use of PG600 following LMF
also reduced the duration of estrus (P < 0.0005) in repli-
cates 4–6 (42 ± 3 h) compared to replicates 1–3 (52 ± 3 h).
However, the interval from onset of estrus to ovulation
was not influenced by use of PG600 (P > 0.20), and aver-
aged 33 ± 1 h in replicates 1–3, and 34 ± 1 h replicates 4–6.
PG600 increased (P < 0.0001) the numbers of large follicles
at estrus in replicates 4–6 compared to replicates 1–3 (22
compared to 16), but there was no effect of replicate on
number of CL at slaughter (17). There were no effects of
use of PG600 following LMF on pregnancy at slaughter or
on number of fetuses.
The number of large follicles (>5 mm) counted during
ultrasound and then validated by counting from playback
of the digital recording on a digital imaging system was
correlated (r = 0.90, P < 0.0001) and averaged 19.0 ± 0.7 fol-
licles, but were unrelated to the number of CL at slaughter
(17.0 ± 0.3). The AI score at 32 h following estrus did not
differ among doses or number of inseminations (P > 0.20)
and averaged 2.7 ± 0.1 (3.0 = no volume loss), with 73% of
inseminations having an AI score = 3, while 24% had an AI
score = 2, and 3% had an AI score = 1. Across all replicates
at the time of slaughter, 7.2% of gilts had ovaries that were
classified as abnormal, with six gilts having cystic struc-
tures and two gilts showing fluid-filled oviducts.
3.3. Impact of dose and AI number on pregnancy rate
and litter size
The average age (168.8 ± 1.2 days) and weight
(114.5 ± 1.0 kg) of gilts assigned to each treatment
based on estrus were not different among treatments
(>0.20).
3.3.1. Pregnancy
Pregnancy rate at slaughter averaged 73.0 ± 4.2%. There
was no interaction of dose and number of AI and no effect
of dose or number of inseminations (Table 1). There was
no effect of boar (Table 2), but interval from insemination
to ovulation influenced pregnancy rate (P < 0.05, Table 3).
Increased pregnancy rates were observed when insemi-
nation occurred at 4 h before ovulation or up to 8 h after
ovulation, compared to earlier or later intervals. While
most additional sources of variation had no effect on preg-
nancy, the presence of an abnormal ovary was associated
with only a 12.5% pregnancy rate (P < 0.0001).
3.3.2. Litter size
There was no significant interaction of dose and number
of inseminations and no effect of dose on numbers of nor-
mal fetuses (Table 1). However, number of inseminations
tended to influence numbers of normal fetuses (P = 0.14)
with double inseminations resulting in greater numbers
of normal fetuses (11.5 ± 0.6) compared to single insem-
inations (10.2 ± 0.6). Boar influenced numbers of normal
fetuses (P < 0.01) with boar A having the smallest and
boar D the largest litter size (Table 2). Number of normal
fetuses increased as insemination occurred closer to ovula-
tion (P < 0.001, Table 3). Additional sources of variation had
no effect on normal fetus numbers. Number of degenerat-

Table 1
Least squares means for pregnancy and litter data in response to treatment with dose of motile, frozen-thawed sperm (1 to 4 × 109 ) and number of
inseminations (single or double). Data were collected from mature gilts between 28 and 34 days of gestation.

Motile sperm (×109 ) Number of AIa Pregnancy at slaughter (%)b Normal fetuses Degenerative fetuses Embryonic survival (%)

1 1 76.4 (14/19) 9.5 ± 1.1 0.2 ± 0.4 61.5 ± 5.8

1 2 70.4 (13/19) 11.3 ± 1.2 0.0 ± 0.4 65.6 ± 6.1
2 1 71.1 (13/19) 10.4 ± 1.2 0.4 ± 0.4 67.3 ± 6.0
2 2 79.2 (14/18) 12.6 ± 1.1 0.1 ± 0.4 71.0 ± 5.7
4 1 66.1 (12/17) 10.6 ± 1.2 0.7 ± 0.4 59.2 ± 6.5
4 2 87.3 (15/19) 10.7 ± 1.1 1.0 ± 0.4 69.5 ± 5.8
a
AI occurring at 32 h after detection of estrus for single AI and at 24 and 32 h for double AI.
b
Numbers in parentheses are proportions of gilts.
 K.W. Spencer et al. / Animal Reproduction Science 121 (2010) 259–266 263

Table 2
Least squares means for pregnancy and litter data in response to the main effect of boar in GENMOD and MIXED models following insemination with 1 to
4 × 109 motile, frozen boar sperm in a single or double AI. Data were collected from mature gilts between 28 and 34 days of gestation.

Boar Pregnancy at slaughter (%) Normal fetuses Degenerative fetuses Embryonic survival (%)

A 78.6 (15/20) 7.2 ± 1.1z 0.4 ± 0.4 42.9 ± 6.1z

B 77.7 (14/18) 9.8 ± 1.1x 0.1 ± 0.4 74.1 ± 6.1xy
C 73.1 (13/19) 10.8 ± 1.1xy 0.1 ± 0.4 65.1 ± 6.2xy
D 71.4 (13/18) 13.8 ± 1.2y 0.5 ± 0.4 75.8 ± 6.6y
E 83.9 (15/18) 12.6 ± 1.1y 0.4 ± 0.4 74.9 ± 6.0xy
F 65.7 (11/18) 10.9 ± 1.3xy 1.1 ± 0.4 61.3 ± 6.8x
xyz
Different superscripts within a column indicate differences (P < 0.05). Numbers in parentheses are proportions of gilts.

Table 3
Least squares means resulting from GENMOD and MIXED models for pregnancy and litter data in response to estrus to ovulation interval following
insemination with 1 to 4 × 109 frozen boar sperm in a single or double AI. Data were collected from mature gilts between 28 and 34 days of gestation.

Estrus to ovulation (h)a Interval from last AI at 32 h Pregnancy at Normal fetuses Degenerative Embryonic survival (%)
to ovulationb slaughter (%) fetuses

12 +20 50.0 (2/4)xz 15.0 ± 3.0y 0.0 ± 1.0 75.5 ± 16.8y

24 +8 80.0 (27/35)y 12.1 ± 0.8xy 0.4 ± 0.4 76.0 ± 4.7y
36 −4 88.1 (37/43)y 11.1 ± 0.7xy 0.2 ± 0.3 64.0 ± 4.1y
48 −16 57.8 (11/19)x 6.0 ± 1.3z 0.1 ± 0.5 44.3 ± 7.2x
60 −28 0.0 (0/1)z – – –

Numbers within parentheses are proportions of gilts.

x,y,z
Different superscripts within column indicate differences (P < 0.05).
– No estimate.
a
Estrous detection and transrectal ultrasonography were conducted at 12 h intervals.
b
Use of ultrasonography allowed for observation of ovulation in 101 of 111 gilts.

ing fetuses/litter averaged 0.4 ± 0.2 and was not influenced
by dose and number of inseminations. Embryonic survival
(65.5 ± 3.0%) was not influenced by dose and number of
inseminations or other variables but was affected by boar
(P < 0.005, Table 2) and interval from insemination to ovu-
lation (P < 0.005, Table 3).
4. Discussion
The overall pregnancy rates (73%) and number of normal
fetuses (10.8) observed in the present study were some-
what higher than expected. It is not clear whether the gilts
in this study would have actually maintained pregnancy to
term and whether the normal fetus numbers would survive
to be liveborn pigs, but assessments for fetal and ovarian
measures for normality indicated there would be few lim-
itations. The aim of this study was to demonstrate that
increasing the dose of motile, frozen-thawed sperm with
double AI would result in acceptable pregnancy rates and
litter sizes by compensating for reduced sperm quality and
variation in time of ovulation. There was no indication that
dose of frozen sperm interacted with numbers of insemina-
tions to compensate for poor sperm fertility or variation in
time of ovulation. However, double insemination tended to
improve litter size compared to single insemination and as
expected, interval from insemination to ovulation affected
both pregnancy rate and litter size.
Collectively it would appear that the technology for
frozen boar sperm use can be reliable for producing preg-
nancy rates at ∼70% and litter sizes of ∼10 pigs. Most
studies testing fertility of frozen-thawed boar sperm uti-
lize frozen sperm numbers equivalent to 2.5 to 3.0 × 109
motile cells or 5 to 6 × 109 total sperm with similar fer-
tility outcomes shown in the present trial (Johnson, 1985;
Roca et al., 2006). In the present study, dose had no effect
on pregnancy or litter size. From a practical standpoint,
using the least amount of sperm would have the greatest
advantages. Our test with 1 × 109 motile sperm in single
or double AI resulted in pregnancy rates ≥70% and num-
bers of normal fetuses between 9.5 and 11.3. Most of the
treatments resulted in acceptable fertility for use of frozen
boar sperm. Results in the present study are similar to
others where greater numbers of sperm were used and
with comparable numbers of gilts (Eriksson and Rodriguez-
Martinez, 2000a), and also where greater numbers of sperm
and even larger numbers of sows were used (Eriksson et
al., 2002). The effect of sperm dose has been tested for both
liquid and frozen boar sperm. In some frozen boar sperm
studies, altering dose had variable effects for pregnancy
and litter size responses (Einarsson et al., 1973; Larsson
et al., 1977; Johnson, 1985). Yet in certain studies with liq-
uid semen (Watson and Behan, 2002) or with small dose,
or deep uterine insemination (DUI) of frozen sperm, the
effects of dose were quite clear (Bolarín et al., 2006). The
reasons for the discrepancies among studies may reflect
differences in any of the following variables: actual sperm
dose (motile or total sperm used), number of insemina-
tions, use of single sire or pooled semen, boar fertility, AI
timing, and the reproductive maturity and management of
the animal used.
Number of inseminations did not affect final pregnancy
rate, but did tend to influence number of normal fetuses. It
was surprising that there were limited effects of number of
inseminations, since a double AI system of frozen-thawed
boar sperm had previously shown greater non-return rates
and increased litter sizes in studies with fewer (Einarsson
et al., 1973) and even more animals tested (Reed, 1985).
In contrast to the present study, it is possible that the ear-
264 K.W. Spencer et al. / Animal Reproduction Science 121 (2010) 259–266
lier methods of cryopreservation allowed for compensable
fertility in response to number of inseminations. How-
ever, although not significant in the present study, at the
greater doses, pregnancy rates were greater, and this is
similar to farrowing rate increases that have been noted
with double AI compared to single AI in sows (Almlid et
al., 1987). Yet only a few studies have been conducted that
have tested dose of frozen sperm with number of insem-
inations (Einarsson et al., 1973; Bathgate et al., 2008). In
these studies, regardless of the AI method used (cervical or
DUI), results indicate that more inseminations at greater
doses yield greater fertility.
In the present experiment there was no clear choice
for optimizing final pregnancy establishment or litter size.
The greatest pregnancy rates were observed with 2 and
4 × 109 motile sperm with double AI, while the largest
litter sizes occurred with 1 and 2 × 109 motile sperm
in a double AI. To examine the fertility and sperm use
efficiency, fertility indices were created for total number
of normal pigs produced/treatment (final pregnancy rate
(×100) × number of normal fetuses) and numbers of motile
sperm/piglet produced (total number of motile sperm used
per treatment/total number of normal pigs produced per
treatment). The fertility index revealed that double AI of 1,
2, and 4 × 109 sperm produced more pigs (796, 998, and 934
pigs) than single AI (726, 739, and 701 pigs, respectively).
The index for number of sperm used per pig produced indi-
cated that single insemination with 1 × 109 motile sperm
was most efficient (0.14 × 109 sperm/pig). However, the
greatest number of pigs was produced when using 2 × 109
motile sperm in a double insemination. If equal weight is
given to both numbers of pigs produced and the numbers
of sperm used for each pig produced, the double insemi-
nation at 1 and 2 × 109 motile cells allowed for the most
pigs produced with least amount of sperm used per pig
(0.25 and 0.40 × 109 sperm/pig, respectively). For produc-
tion purposes a double insemination using 2 × 109 motile
sperm would produce the greatest number of pigs consis-
tently when using the least amount of frozen sperm. When
access to valuable genetics is limited by increased demand,
a double insemination using 1 × 109 motile sperm would
allow for acceptable pig production with minimal sperm
use.
Compensating for variation in the time of ovulation was
a major objective of the present study and the reason why
double insemination was included. Double insemination is
standard practice for commercial pig production when uti-
lizing liquid semen (Flowers and Esbenshade, 1993; Kemp
et al., 1996). The timing system in the present study for the
single and double AI following detection of estrus has been
used in experiments with frozen sperm in gilts and sows
with single (Johnson et al., 1982; Aalbers et al., 1985) and
double inseminations (Rodriguez-Martinez et al., 1996;
Eriksson and Rodriguez-Martinez, 2000a; Eriksson et al.,
2002). These published trials with gilts showed pregnancy
rates of ∼60% (Rodriguez-Martinez et al., 1996; Eriksson
and Rodriguez-Martinez, 2000a), while the farrowing rates
for the sow trials averaged ≥70% (Eriksson et al., 2002). The
AI timing system in the present study was designed with
a predicted estrus to ovulation average of 36 h (Almeida
et al., 2000; Bortolozzo et al., 2005; Horsley et al., 2005).
In the present study, time of ovulation averaged 33 h. We
observed that 34% of gilts had ovulations by 24 h, 42% by
36 h, and 19% by 48 h. As a result, the majority of insemina-
tions occurred close to ovulation, which is important since
frozen swine sperm has a shortened fertile lifespan in utero
(Waberski et al., 1994). In the present study, interval from
estrus to ovulation affected pregnancy rate, litter size, and
embryonic survival similar to frozen sperm experiments
using DUI (Bolarín et al., 2006). These fertility measures
were greatest when gilts ovulated by 24 and 36 h. For gilts
that ovulated by 48 h, pregnancy rate dropped to ∼58% and
litter size declined to 6.0 fetuses. Collectively, all studies
show the importance of frozen sperm AI occurring close to
the time of ovulation (Waberski et al., 1994; Wongtawan et
al., 2006). Perhaps in the future, synchronization of ovula-
tion could be used to prevent delayed ovulation when using
frozen sperm (Okazaki et al., 2009a).
Although not novel, it is still important to account for the
fact that in this and other studies, boar affects the number
of normal fetuses, and embryonic survival (Almlid et al.,
1987; Eriksson and Rodriguez-Martinez, 2000a). Because
gilts in the present study were inseminated based on total
numbers of motile sperm, boar differences in this mea-
sure were not a factor in gilt fertility. However, variance
in post-thaw motility was evident among boars and ejacu-
lates. Post-thaw motility averaged 38% and was lower than
the 50% motility reported by (Eriksson et al., 2002; Roca et
al., 2003) while farrowing rates and litter sizes were sim-
ilar. However, poor motility does not always translate to
reduced fertility for liquid or frozen boar sperm (Flowers,
1997; Eriksson et al., 2002). It should be noted that in some
experiments, boars are selected based on post-thaw sperm
survival for use in frozen sperm fertility tests (Hernandez
et al., 2007a; Okazaki et al., 2009b). However, in the present
study, boars were selected on previous history for commer-
cial litter production with liquid semen. As a result, we did
observe boar fertility differences similar to that reported
by (Flowers, 2002).
While the present experiment focused on the primary
fertility measures of pregnancy rate and number of nor-
mal fetuses in early gestation, the timing of animal sacrifice
allowed us to obtain data on numbers of degenerative
fetuses and embryonic survival. Both factors provided us
with an indication of the overall health of the litter. Addi-
tional variables were also examined for their effects on
fertility when using frozen boar sperm. Insemination tech-
nique had no effect on fertility since the AI score was very
good. This was important to test since the volume of the
inseminate has been reported to affect sperm transport,
the sperm reservoir, and fertilization (Baker et al., 1968).
Number of follicles at estrus and number of CL also did
not influence litter size or measures of litter health. How-
ever, previous studies have suggested that ovulation rate
could influence embryonic survival, pregnancy, and litter
size during early gestation (Town et al., 2005; Foxcroft et
al., 2007). Because follicle numbers and ovulation rate were
within normal limits, it is not surprising that we did not
observe any effect on fertility.
In the present experiment prepubertal gilts induced
with PG600 were used, with subsequent progestagen syn-
chronization to measure fertility from use of frozen boar
 K.W. Spencer et al. / Animal Reproduction Science 121 (2010) 259–266
sperm. Gilt weight, age and initial estrus had no effect
on estrus synchronization or fertility outcomes. Despite
an initial estrus induction response <70%, subsequent syn-
chronization with Matrix resulted in an estrous synchrony
response of >90% similar to other reports (Estienne et al.,
2001). As a result, it is possible that insemination may have
occurred at pubertal estrus for ∼30% of gilts. Assessment
of our synchronized gilt model for fertility indicated nor-
mal measures for duration of estrus, interval from estrus
to ovulation, numbers of large follicles at estrus, and num-
bers of CL (Bracken et al., 2003; Horsley et al., 2005; Breen
et al., 2006). The effect of PG600 on reducing the interval
to estrus without influencing interval from estrus to ovula-
tion has been observed in weaned sows (Knox et al., 2002)
and suggests that the use of PG600 changes the time of ovu-
lation from 63% of the way through estrus (replicates 1–3)
to 78% (replicates 4–6). Numbers of CL can be an important
component to consider when accounting for differences in
fertility responses. To account for possible fertility effects,
we counted large follicles at estrus and correlated these to
digital recordings. Others have also examined this and cor-
related ultrasonographic measures with use of laparoscopy
(Bolarin et al., 2009). However, it is of interest to note
that follicle counts were not correlated with the number
of CL at slaughter as has been reported previously (Soede
et al., 1992). It is possible that this discrepancy might be
explained by use of PG600 on follicle development or by
the occurrence of follicle heterogeneity and the differen-
tial response to the LH surge for ovulation (Hunter and
Wiesak, 1990; Knox, 2005). Finally, in the present study,
it was noted that 7% of gilts had cystic ovaries or fluid-
filled oviducts. In either case, this had a negative impact on
pregnancy rate and number of normal fetuses. These occur-
rences were unrelated to use of PG600 and these problems
have been observed in mature gilts and sows (Heinonen et
al., 1998) with associated reduction in fertility (Waberski
et al., 2000; Castagna et al., 2004).
5. Conclusion
There was no interaction of dose and number of insem-
inations when using frozen boar sperm on fertility. The
results of this study indicate that double insemination with
1 to 2 × 109 motile, frozen-thawed boar sperm could be
used to achieve acceptable pregnancy rates and litter sizes
with the most efficient use of sperm. Use of single AI was
less efficient for pig production while use of 4 × 109 motile
sperm in a double AI was less efficient for use of sperm.
Variation in interval from AI to ovulation and boar fertility
accounted for significant fertility effects. Methods to con-
trol ovulation time and maximize boar fertility would aid
this technology. The induction and estrous synchronization
procedure for prepubertal gilts proved to be an effective
method for testing frozen sperm fertility.
Acknowledgements
We would like to thank the USDA for funding sup-
port, and PIC North America for providing boar semen and
Intervet/Schering-Plough for providing PG600 and MATRIX
for use in this study. We are also grateful to Dr. S. Breen, J.
265
Taibl, B. Yantis, and D. Canaday for their excellent technical
assistance. We also extend our appreciation to the Univer-
sity of Illinois farm staff; R. Wischover, R. Alan, S. Hughes,
and D. Bidner for management of the animals used in this
study.
References
Aalbers, J.G., Johnson, L.A., Aalbers-Smit, E.A., Rademaker, J.H.M., 1985.
Motility acrosome morphology and fertilizing capacity of boar sper-
matozoa frozen in pellets and straws. In: Johnson, L.A., Larsson, K.
(Eds.), Deep Freezing Boar Semen. Proc. First Int. Conf. Deep Freezing
of Boar Semen. Swedish University of Agricultural Sciences, Uppsala,
Sweden, pp. 277–281.
Almeida, F.R., Novak, S., Foxcroft, G.R., 2000. The time of ovulation in
relation to estrus duration in gilts. Theriogenology 53, 1389–1396.
Almlid, T., Hofmo, P.O., 1996. A brief review of frozen semen applica-
tion under Norwegian AI service conditions. Reprod. Dom. Anim. 31,
169–173.
Almlid, T., Stavne, S.E., Johnson, L.A., 1987. Fertility evaluation of the straw
freezing technique for boar semen under practical artificial insemina-
tion conditions. Reprod. Dom. Anim. 22, 193–202.
Bailey, J.L., Lessard, C., Jacques, J., Breque, C., Dobrinski, I., Zeng, W.,
Galantino-Homer, H.L., 2008. Cryopreservation of boar semen and its
future importance to the industry. Theriogenology 70, 1251–1259.
Baker, R.D., Dziuk, P.J., Norton, H.W., 1968. Effect of volume of semen,
number of sperm and drugs on transport of sperm in artificially insem-
inated gilts. J. Anim. Sci. 27, 88–93.
Bathgate, R., Eriksson, B.M., Thomson, P.C., Maxwell, W.M., Evans, G., 2008.
Field fertility of frozen-thawed boar sperm at low doses using non-
surgical, deep uterine insemination. Anim. Reprod. Sci. 103, 323–335.
Bolarín, A., Roca, J., Rodríguez-Martínez, H., Hernández, M., Vázquez, J.M.,
Martínez, E.A., 2006. Dissimilarities in sows’ ovarian status at the
insemination time could explain differences in fertility between farms
when frozen-thawed semen is used. Theriogenology 65, 669–680.
Bolarin, A., Vazquez, J.M., Parrilla, I., Vazquez, J.L., Martinez, E.A., Roca, J.,
2009. Validation of trans-rectal ultrasonography for counting preovu-
latory follicles in weaned sows. Anim. Reprod. Sci. 113, 137–142.
Bortolozzo, F.P., Uemoto, D.A., Bennemann, P.E., Pozzobon, M.C., Castagna,
C.D., Peixoto, C.H., Barioni Jr., W., Wentz, I., 2005. Influence of time of
insemination relative to ovulation and frequency of insemination on
gilt fertility. Theriogenology 64, 1956–1962.
Bracken, C.J., Safranski, T.J., Cantley, T.C., Lucy, M.C., Lamberson, W.R.,
2003. Effect of time of ovulation and sperm concentration on fertil-
ization rate in gilts. Theriogenology 60, 669–676.
Breen, S.M., Rodriguez-Zas, S.L., Knox, R.V., 2006. Effect of altering dose of
P.G. 600 on reproductive performance responses in prepubertal gilts
and weaned sows. Anim. Reprod. Sci. 95, 316–323.
Bwanga, C.O., 1991. Cryopreservation of boar semen i: a literature review.
Acta Vet. Scand. 32, 431–453.
Bwanga, C.O., De Braganca, M.M., Einarsson, S., Rodriguez-Martinez, H.,
1990. Cryopreservation of boar semen in mini- and maxi-straws. Zen-
tralbaltt fur veterinarmedizin reihe a 37, 651–658.
Castagna, C.D., Peixoto, C.H., Bortolozzo, F.P., Wentz, I., Neto, G.B., Ruschel,
F., 2004. Ovarian cysts and their consequences on the reproductive
performance of swine herds. Anim. Reprod. Sci. 81, 115–123.
Einarsson, S., Swensson, T., Viring, S., 1973. A field trial on the fertility of
deep-frozen boar spermatozoa. Nord. Vet. Med. 25, 372–376.
Einarsson, S., Viring, S., 1973. Distribution of frozen-thawed spermato-
zoa in the reproductive tract of gilts at different time intervals after
insemination. J. Reprod. Fertil. 32, 117–120.
Eriksson, B.M., Petersson, H., Rodriguez-Martinez, H., 2002. Field fertil-
ity with exported boar semen frozen in the new flatpack container.
Theriogenology 58, 1065–1079.
Eriksson, B.M., Rodriguez-Martinez, H., 2000a. Deep-freezing of boar
semen in plastic film ‘cochettes’. J. Vet. Med. 47, 89–97.
Eriksson, B.M., Rodriguez-Martinez, H., 2000b. Effect of freezing and thaw-
ing rates on the post-thaw viability of boar spermatozoa frozen in
FlatPacks and Maxi-straws. Anim. Reprod. Sci. 63, 205–220.
Estienne, M.J., Harper, A.F., Horsley, B.R., Estienne, C.E., Knight, J.W., 2001.
Effects of P.G. 600 on the onset of estrus and ovulation rate in gilts
treated with Regu-mate. J. Anim. Sci. 79, 2757–2761.
Fiser, P.S., Fairfull, R.W., Hansen, C., Painch, P.L., Shrestha, J.N.B., Underhill,
L., 1993. The effect of warming velocity on motility and acrosomal
integrity of boar sperm as influenced by the rate of freezing and glyc-
erol level. Mol. Reprod. Devel. 34, 190–195.
266 K.W. Spencer et al. / Animal Reproduction Science 121 (2010) 259–266
Flowers, W.L., 1997. Management of boars for efficient sperm production.
J. Reprod. Fertil. Suppl. 52, 67–78.
Flowers, W.L., 2002. Increasing fertilization rate of boars: Influence of
number and quality of spermatozoa inseminated. J. Anim. Sci. 80,
E47–53.
Flowers, W.L., Esbenshade, K.L., 1993. Optimizing management of natural
and artificial matings in swine. J. Reprod. Fertil. Suppl. 48, 217–228.
Foxcroft, G.R., Vinsky, M.D., Paradis, F., Tse, W.Y., Town, S.C., Putman, C.T.,
Dyck, M.K., Dixon, W.T., 2007. Macroenvironment effects on oocytes
and embryos in swine. Theriogenology 68 (Suppl. 1), S30–39.
Grobfeld, R., Sieg, B., Struckmann, C., Frenzel, A., Maxwell, W.M.C., Rath, D.,
2008. New aspects of boar semen freezing strategies. Theriogenology
70, 1225–1233.
Heinonen, M., Leppävuori, A., Pyörälä, S., 1998. Evaluation of reproduc-
tive failure of female pigs based on slaughterhouse material and herd
record survey. Anim. Reprod. Sci. 52, 235–244.
Hernandez, M., Roca, J., Calvete, J.J., Sanz, L., Muino-Blanco, T., Cebrian-
Perez, J.A., Vazquez, J.M., Martinez, E.A., 2007a. Cryosurvival and in
vitro fertilizing capacity postthaw is improved when boar spermato-
zoa are frozen in the presence of seminal plasma from good freezer
boars. J. Androl. 28, 689–697.
Hernandez, M., Roca, J., Gil, M.A., Vázquez, J.M., Martínez, E.A., 2007b.
Adjustments on the cryopreservation conditions reduce the incidence
of boar ejaculates with poor sperm freezability. Theriogenology 67,
1436–1445.
Hofmo, P.O., Grevel, I.S., 2000. Development and commercial use of frozen
boar semen in Norway. In: Johnson, L.A., Gutherie, H.D. (Eds.), Boar
Semen Preservation IV. Allen Press Inc., Lawrence, KS, pp. 71–77.
Horsley, B.R., Estienne, M.J., Harper, A.F., Purcell, S.H., Baitis, H.K., Beal,
W.E., Knight, J.W., 2005. Effect of P.G. 600 on the timing of ovulation
in gilts treated with altrenogest. J. Anim. Sci. 83, 1690–1695.
Hunter, M.G., Wiesak, T., 1990. Evidence for and implications of follicular
heterogeneity in pigs. J. Reprod. Fertil. Suppl. 40, 163–177.
Johnson, L.A., 1985. Fertility results when using frozen boar spermatozoa:
1970 to 1985. In: Johnson, L.A., Larsson, K. (Eds.), Deep Freezing Boar
Semen. Proc. First Int. Conf. Deep Freezing of Boar Semen. Swedish
University of Agricultural Sciences, Uppsala, Sweden, pp. 192–222.
Johnson, L.A., Aalbers, J.G., Arts, J.A.M., 1982. Use of boar spermatozoa
for artificial insemination II. Fertilizing Capacity of fresh and frozen
spermatozoa in gilts inseminated either at a fixed time or according
to Walsmeta readings. J. Anim. Sci. 54, 126–131.
Johnson, L.A., Weitze, K.F., Fiser, P., Maxwell, W.M.C., 2000. Storage of boar
semen. Anim. Reprod. Sci. 62, 143–172.
Kemp, B., Soede, N.M., Hazeleger, W., Wetzels, C.C.H., 1996. The effects
of a second insemination after ovulation—as determined with
ultrasonography—on fertilization rate and accessory sperm count in
sows. Reprod. Dom. Anim. 31, 297–298.
Knox, R.V., 2005. Recruitment and selection of ovarian follicles for deter-
mination of ovulation rate in the pig. Dom. Anim. Endocrinol. 29,
385–397.
Knox, R.V., Miller, G.M., Willenburg, K.L., Rodriguez-Zas, S.L., 2002. Effect of
frequency of boar exposure and adjusted mating times on measures of
reproductive performance in weaned sows. J. Anim. Sci. 80, 892–899.
Larsson, K., 1978. Deep-freezing of boar semen. Cryobiology 15, 352–354.
Larsson, K., Einarsson, S., 1976. Influence of boars on the relationship
between fertility and post thawing sperm quality of deep frozen boar
spermatozoa. Acta Vet. Scand. 17, 74–82.
Larsson, K., Einarsson, S., Swenson, T., 1977. The development of a practi-
cable method for deepfreezing of boar spermatozoa. Nord. Vet. Med.
29, 113–118.
Okazaki, T., Abe, S., Shimada, M., 2009a. Improved conception rates in sows
inseminated with cryopreserved boar spermatozoa prepared with a
more optimal combination of osmolality and glycerol in the freezing
extender. Anim. Sci. J. 80, 121–129.
Okazaki, T., Abe, S., Yoshida, S., Shimada, M., 2009b. Seminal plasma dam-
ages sperm during cryopreservation, but its presence during thawing
improves semen quality and conception rates in boars with poor post-
thaw semen quality. Theriogenology 71, 491–498.
Purdy, P.H., 2008. Ubiquitination and its influence in boar sperm physiol-
ogy and cryopreservation. Theriogenology 70, 818–826.
Pursel, V.G., Johnson, L.A., 1975. Freezing of boar spermatozoa: fertilizing
capacity with concentrated semen and a new thawing procedure. J.
Anim. Sci. 40, 99–102.
Pursel, V.G., Johnson, L.A., 1976. Frozen boar spermatozoa: methods of
thawing pellets. J. Anim. Sci. 42, 927–931.
Reed, C.B., 1985. Current use of frozen boar semen—future need of frozen
boar semen. In: Johnson, L., Larsson, K. (Eds.), Deep Freezing Boar
Semen. Proc. First Int. Conf. Deep Freezing of Boar Semen. Swedish
University of Agricultural Sciences, Uppsala, Sweden, pp. 225–237.
Roca, J., Carvajal, G., Lucas, X., Vazquez, J.M., Martinez, E.A., 2003. Fertility
of weaned sows after deep intrauterine insemination with a reduced
number of frozen-thawed spermatozoa. Theriogenology 60, 77–87.
Roca, J., Vázquez, J.M., Gil, M.A., Cuello, C., Parrilla, I., Martínez, E.A.,
2006. Challenges in pig artificial insemination. Reprod. Dom. Anim.
41, 43–53.
Rodriguez-Martinez, H., Eriksson, B., Lundeheim, N., 1996. Freezing boar
semen in flat plastic bags membrane integrity and fertility. Reprod.
Dom. Anim. 31, 161–168.
Rozeboom, K.J., Reicks, D.L., Wilson, M.E., 2004. The reproductive per-
formance and factors affecting on-farm application of low-dose
intrauterine deposit of semen in sows. J. Anim. Sci. 82, 2164–2168.
Soede, N.M., Noordhuizen, J.P.T.M., Kemp, B., 1992. The duration of ovula-
tion in pigs, studied by transrectal ultrasonography, is not related to
early embryonic diversity. Theriogenology 38, 653–666.
Thurston, L.M., Holt, W.V., Watson, P.F., 2003. Post-thaw functional sta-
tus of boar spermatozoa cryopreserved using three controlled rate
freezers: a comparison. Theriogenology 60, 101–113.
Town, S.C., Patterson, J.L., Pereira, C.Z., Gourley, G., Foxcroft, G.R., 2005.
Embryonic and fetal development in a commercial dam-line genotype.
Anim. Reprod. Sci. 85, 301–316.
Waberski, D., Kunz-Schmidt, A., Borchardt Neto, G., Richter, L., Weitze, K.F.,
2000. Real-time ultrasound diagnosis of ovulation and ovarian cysts
in sows and its impact on artificial insemination efficiency. J. Anim.
Sci. 77, 1-aj-8.
Waberski, D., Weitze, K.F., Gleumes, T., Schwarz, M., Willmen, T., Petzoldt,
R., 1994. Effect of time of insemination relative to ovulation on fertility
with liquid and frozen boar semen. Theriogenology 42, 831–840.
Waterhouse, K.E., Hofmo, P.O., Tverdal, A., Miller Jr., R.R., 2006. Within
and between breed differences in freezing tolerance and plasma
membrane fatty acid composition of boar sperm. Reproduction 131,
887–894.
Watson, P.F., Behan, J.R., 2002. Intrauterine insemination of sows with
reduced sperm numbers: results of a commercially based field trial.
Theriogenology 57, 1683–1693.
Wongtawan, T., Saravia, F., Wallgren, M., Caballero, I., Rodríguez-Martínez,
H., 2006. Fertility after deep intra-uterine artificial insemination
of concentrated low-volume boar semen doses. Theriogenology 65,
773–787.
 Animal Reproduction Science 121 (2010) 267–272

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

The role of sexual steroid hormones in the direct stimulation by

Kisspeptin-10 of the secretion of luteinizing hormone,
follicle-stimulating hormone and prolactin from bovine anterior
pituitary cells
A. Ahmed Ezzat a,b , H. Saito a , T. Sawada a , T. Yaegashi a , Y. Goto a , Y. Nakajima a ,
J. Jin a , T. Yamashita a , K.Sawai a , T. Hashizume a,∗
a
Faculty of Agriculture, Iwate University, 3-18-8 Ueda, Morioka 020-8550, Japan
b
Faculty of Veterinary Medicine, South Valley University, Qena 83523, Egypt

a r t i c l e i n f o a b s t r a c t

Article history: The aims of the present study were to clarify the effect of Kisspeptin-10 (Kp10) on the
Received 24 February 2010 secretion of luteinizing hormone (LH), follicle-stimulating hormone (FSH) and prolactin
Received in revised form 30 April 2010
(PRL) from bovine anterior pituitary (AP) cells and evaluate the ability of sex steroids to
Accepted 2 June 2010
enhance the sensitivity of gonadotropic and lactotropic cells to Kp10. AP cells prepared
Available online 11 June 2010
from 7-week-old male calves were incubated for 12 h with estradiol (E2 ; 10−8 M), proges-
terone (P4 ; 10−8 M), testosterone (T; 10−8 M), or vehicle only (control), and then for 2 h with
Keywords:
Kp10 (10−6 M). The amounts of LH, FSH and PRL released into the culture medium after the
Kisspeptin-10
Sex steroids 2-h incubation period were examined. Kp10 significantly stimulated the secretion of LH
LH from the AP cells treated with E2 and T (P < 0.05), but not from the P4 -treated cells. In con-
FSH trast, Kp10 had no effect on the secretion of FSH regardless of the steroid treatment. Kp10
PRL significantly stimulated the secretion of PRL (P < 0.05), the sexual steroid hormones having
Bovine no effect. The LH- or FSH-releasing response to gonadotropin-releasing hormone (GnRH;
10−8 M) and PRL-releasing response to thyrotropin-releasing hormone (TRH; 10−8 M) were
significantly greater than those to Kp10 (P < 0.05).
The present results suggest that E2 and T, but not P4 , enhance the sensitivity of
gonadotropic cells to the secretion of LH in response to Kp10. However, Kp10 had no stim-
ulatory effect on the secretion of FSH regardless of the effect of sex steroids. Kp10 directly
stimulates the secretion of PRL from the pituitary cells, and sex steroids do not enhance the
sensitivity of lactotropic cells to Kp10. Furthermore, the LH- and FSH-releasing effect and
the PRL-releasing effect of Kp10 are less potent than that of GnRH and TRH, respectively.
© 2010 Elsevier B.V. All rights reserved.

1. Introduction coupled receptor (GPR54) (Kotani et al., 2001; Ohtaki et al.,

Kisspeptin is a neuropeptide hormone encoded by KiSS-
1 (Gottsch et al., 2009) in the hypothalamus. Studies have
found that kisspeptin and its functional ligand, G-protein-
∗ Corresponding author. Tel.: +81 19 621 6161; fax: +81 19 621 6161.
E-mail address: hashi@iwate-u.ac.jp (T. Hashizume).
2001), play a significant role in the anterior pituitary (AP)
gland as evidenced by (a) the secretion of kisspeptin in the
hypophyseal portal circulation (Smith et al., 2008), (b) the
expression of GPR54 in human (Kotani et al., 2001; Ohtaki
et al., 2001), rat (Gutierrez-Pascual et al., 2007) and ovine
(Smith et al., 2008) pituitary cells, and (c) the presence
of kisspeptin-secreting cells in the AP gland of monkeys
(Ramaswamy et al., 2009). Furthermore, recent studies in

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.06.002
268 A.A. Ezzat et al. / Animal Reproduction Science 121 (2010) 267–272
vitro reported a direct effect of kisspeptin on gonadotropic,
i.e. luteinizing hormone (LH) (Suzuki et al., 2008), and non-
gonadotropic, i.e. prolactin (PRL) (Kadokawa et al., 2008),
pituitary hormone release. Although hormone secretion by
the AP is controlled by hypothalamic peptides (Vankelecom
and Denef, 1997), sexual steroid hormones are also impli-
cated in AP cell function. Estradiol (E2 ) is a key regulator
for the synthesis and secretion of pituitary reproduc-
tive hormones: LH, follicle-stimulating hormone (FSH) and
PRL (Sánchez-Criado et al., 2004). E2 has a direct effect
on pituitary gonadotropes and lactotropes (Scully et al.,
1997). Progesterone (P4 ) (Fox et al., 1990) and testos-
terone (T) (Okada et al., 2003) receptors are expressed by
gonadotropes. P4 exerts a direct modulatory effect on LH
secretion (Krey and Kamel, 1990) and T regulates the syn-
thesis of the LH␤ subunit in the AP (Burger et al., 2004;
Thackray et al., 2006). However, the role of sexual steroid
hormones and kisspeptin in the secretion of LH, FSH and
PRL has not been evaluated yet.
The present study aimed to clarify the direct effect of
Kisspeptin-10 (Kp10: a shorter variant of kisspeptin retain-
ing full biological activity) on the secretion of LH, FSH, and
PRL from cultured bovine AP cells and evaluate the abil-
ity of E2 , P4 , and T to enhance the sensitivity of pituitary
cells to Kp10. In the present study, the direct effects of
Kp10 on the secretion of the AP hormones were compared
to those of gonadotropin-releasing hormone (GnRH) and
thyrotropin-releasing hormone (TRH).
2. Materials and methods
2.1. Peptides
Human Kp10 amide (amino acid sequence:
YNWNSFGLRF-NH2 ) was synthesized in our labora-
tory (Ezzat et al., 2009; Hashizume et al., 2010). The
peptide has been confirmed to stimulate the release of
gonadotropins in goats (Hashizume et al., 2010) and cattle
(Ezzat et al., 2009). GnRH and TRH were purchased from
Peptide Institute Inc., Osaka, Japan.
2.2. Adenohypophyseal cells and culture
The pituitary glands were obtained from four male Hol-
stein calves (age: 7-week old). AP cells were enzymatically
dispersed by a method described previously (Hashizume
and Kasuya, 2009). Cell viability as determined by trypan
blue exclusion was greater than 90%. The dispersed cells
were suspended in Dulbecco’s modified Eagle’s medium
(DMEM; Gibco, Grand Island, NY, USA) containing 10%
horse serum (Gibco), 100 I.U./ml penicillin and 50 mg/ml
streptomycin. The cells (2.5 × 105 /ml) were then plated in
Costar 24-well dishes and cultured at 37 ◦ C in a humidified
atmosphere of 5% CO2 .
2.3. Sexual steroid hormones and Kp10 treatments
The plated cells were cultured for 24 h, and then E2
(10−8 M), P4 (10−8 M), T (10−8 M), or the respective vehi-
cle only (controls) was added to the wells. Sexual steroid
hormones were dissolved in ethanol first, and then diluted
with phosphate-buffered saline (PBS). The volumes of PBS
added to the wells in control and treated groups were 27 ␮l
for E2 , 31 ␮l for P4 and 29 ␮l for T, respectively. Other wells
were left without steroid treatments and designed to be
treated with Kp10 without the effect of steroids. There
were exactly four wells dedicated for each treatment and
each treatment has its separate control which is equal in
number. Twelve hours later, the cells were washed twice
with PBS, and the medium was replaced with DMEM alone
(control), or DMEM containing 10−6 M of Kp10. The exper-
imental protocol for steroid treatments (Hashizume et al.,
2002) and the concentration of Kp10 (Kadokawa et al.,
2008) was performed according to our previous study. After
a 2-h incubation period, the medium was removed from
cells and stored at −30 ◦ C until the assays for hormones.
2.4. GnRH and TRH treatments
In the present study, the non-steroid-treated AP cells
were also treated with GnRH or TRH. The plated cells were
cultured for 36 h, and then the cells were washed twice
with PBS. The medium was replaced with DMEM alone,
DMEM containing 10−8 M of GnRH or TRH. After a 2-h incu-
bation period, the medium was removed from cells and
stored at −30 ◦ C until the assays for hormones.
2.5. Hormone assay
Concentrations of bovine LH in media were measured
by a time-resolved fluoroimmunoassay procedure with
slight modifications to the system described previously
(Kaneko et al., 2002). The standard LH preparation and
the hormone for labeling europium were USDA-bLH-B-
6. Concentrations of bovine FSH and PRL in media were
measured by a double-antibody radioimmunoassay with
slight modifications (Hashizume et al., 1999). For FSH, the
standard preparation and the hormone for iodination were
AFP5346D and AFP5318C, respectively. For PRL, the stan-
dard preparation and the hormone for iodination were
NIDDK oPRL-I-3. Assay sensitivities for LH, FSH and PRL
were 1.6, 0.2, and 1.0 ng/ml, respectively. All samples were
assayed in a single run. The intraassay coefficient of vari-
ation was 11.8% for LH, 7.5% for FSH and 5.8% for PRL. The
displacement curve for increasing volumes of the culture
medium pool paralleled the standard curve of the LH, FSH
and PRL assays.
2.6. Statistical analysis
There were four wells per treatment and each exper-
iment was repeated three to four times with different
pituitary glands. Hormone concentrations in the controls
were averaged and the mean value was set at 100% to trans-
form the data. Each hormone concentration was expressed
as a percentage of the control value. All data from the exper-
iments were presented as the mean ± S.E.M. The statistical
significance of differences in the LH, FSH or PRL concen-
tration in response to 0 or 10−6 M of Kp10 between the
steroid-treated and un-treated groups was evaluated by
two-way ANOVA, and the Bonferroni test was used as a
post hoc test. Comparisons between the un-treated control
 A.A. Ezzat et al. / Animal Reproduction Science 121 (2010) 267–272
Fig. 1. Effect of estradiol (E2 ; 10−8 M), progesterone (P4 ; 10−8 M) and
testosterone (T; 10−8 M) on Kisspeptin-10 (Kp10; 10−6 M)-stimulated
release of luteinizing hormone (LH) (a), follicle-stimulating hormone
(FSH) (b) and prolactin (PRL) (c) from cultured bovine anterior pituitary
(AP) cells. There were four treatments; Kp10 only without steroids, Kp10
proceeded by E2 , Kp10 proceeded by P4 and Kp10 proceeded by T. There
were four wells per treatment and the experiment was repeated three
to four times with cells obtained from different male calves. Each value
represents the mean for 12 (LH) to 16 (FSH, PRL) wells ± S.E.M. *P < 0.05
vs. control (CTL).
group and group treated with 10−8 M of GnRH or TRH were
evaluated with Student’s t-test. The statistical significance
of differences in all data was analyzed using GraphPad
Prism (GraphPad Software, San Diego, CA, USA). Results
were considered significant at the P < 0.05 level.
3. Results
3.1. Effects of sexual steroid hormones on the secretion of
LH, FSH and PRL in response to Kp10
Fig. 1a shows the effect of Kp10 on the secretion of LH
from cultured bovine AP cells, treated with steroids or not.
In the group not treated with a steroid, 10−6 M of Kp10
269
failed to increase the concentration of LH in the culture
medium compared to the control (17.2 ± 2.6 ng/ml). In the
E2 -treated group, it significantly increased the concentra-
tion by 17.0% compared to the control (20.2 ± 2.6 ng/ml)
(P < 0.05). In the P4 -treated group, it did not increase the
concentration of LH in the culture medium compared to
the control (14.9 ± 2.4 ng/ml). In the T-treated group, it sig-
nificantly increased the concentration by 11.4% compared
to the control (12.2 ± 1.6 ng/ml) (P < 0.05). The percent
increase in the concentration of LH in T-treated group was
not significantly different from that in the E2 -treated group.
Fig. 1b shows the effect of Kp10 on the secretion of
FSH from cultured bovine AP cells, treated with steroids
or not. In the group not treated with a steroid, 10−6 M of
Kp10 failed to increase the concentration of FSH in the cul-
ture medium compared to the control (1.2 ± 0.1 ng/ml). In
the E2 -treated group, it significantly decreased the concen-
tration by 2.60% compared to the control (1.2 ± 0.1 ng/ml)
(P < 0.05). In the P4 -and T-treated groups, it did not increase
the FSH-concentration in the medium compared to each
respective control (1.2 ± 0.1 and 1.1 ± 0.1 ng/ml, respec-
tively).
Fig. 1c shows the effect of Kp10 on the secretion of
PRL from cultured bovine AP cells, treated with steroids
or not. In the group not treated with a steroid, 10−6 M
of Kp10 significantly increased the concentration of PRL
in the culture medium by 23.0% compared to the con-
trol (40.3 ± 4.5 ng/ml) (P < 0.05). In the E2 -treated group,
it significantly increased the concentration by 23.2% com-
pared to the control (39.3 ± 4.1 ng/ml) (P < 0.05). In the
P4 -treated group, Kp10 significantly increased the con-
centration of PRL by 20.2% compared to the control
(42.1 ± 5.5 ng/ml) (P < 0.05). In the T-treated group, it sig-
nificantly increased the concentration by 19.7% compared
to the control (42.7 ± 5.1 ng/ml) (P < 0.05). There were no
significant differences in the percent increase of PRL among
the non-steroid-treated group and each steroid-treated
group.
3.2. Secretion of LH, FSH and PRL in response to GnRH or
TRH
Fig. 2 shows the secretion of LH, FSH and PRL in response
to GnRH or TRH from cultured bovine AP cells. GnRH
significantly increased the LH (Fig. 2a) concentration by
104.1% compared to the control (22.7 ± 3.2 ng/ml) and this
response was significantly greater than that of E2 plus
Kp10- or T plus Kp10-treated group (P < 0.05). GnRH sig-
nificantly increased the FSH (Fig. 2b) concentration by
178.0% compared to the control (2.1 ± 0.3 ng/ml) (P < 0.05).
TRH significantly increased the PRL (Fig. 2c) concentration
by 117.0% compared to the control (41.1 ± 4.7 ng/ml) and
this response was significantly greater than that to Kp10-
treated group (P < 0.05).
4. Discussion
Recent studies have examined the direct effect of Kp10
on the pituitary release of LH (Suzuki et al., 2008) and PRL
(Kadokawa et al., 2008). The present study is the first to
examine the direct effect of Kp10 on the release of FSH
270 A.A. Ezzat et al. / Animal Reproduction Science 121 (2010) 267–272
Fig. 2. Effect of gonadotropin-releasing hormone (GnRH; 10−8 M) or
thyrotropin-releasing hormone (TRH; 10−8 M) on the release of LH (a),
FSH (b) and PRL (c) from cultured bovine AP cells. There were four wells
per treatment and the experiment was repeated three times with cells
obtained from different male calves. Each value represents the mean for
12 wells ± S.E.M. *P < 0.05 vs. CTL.
in addition to LH and PRL from cultured bovine AP cells
and compare the characteristics of the secretion to those
of responses to GnRH and TRH. Furthermore, the present
study is the first to examine the role of sexual steroid hor-
mones in enhancing the sensitivity of gonadotropes and
lactotropes to Kp10.
Although gonadotropes were suggested to express
GPR54 receptors (Smith et al., 2008), Kp10 alone failed to
stimulate the secretion of LH directly from the AP cells.
However, treatment with E2 or T but not P4 enhanced the
sensitivity of LH-releasing gonadotropes to Kp10. The E2
receptor is expressed by 60–70% of pituitary cells (Keefer
et al., 1976) and mostly by gonadotropes (Smith and
Keefer, 1985). It increases LH-subunit gene expression via
modulation of regulatory transcription factors (Kowase
et al., 2007). Furthermore, a recent study found that rat
gonadotropes express both the GPR54 and KiSS-1 genes,
and the latter expression is up-regulated by E2 (Richard et
al., 2008). Therefore, our results suggest that E2 regulates
an autocrine action of kisspeptin through the secretion of
LH from the pituitary gonadotropes.
Work by a number of investigators using AP cell cul-
tures has shown that P4 exerts a direct modulatory effect
on LH secretion (Drouin and Labrie, 1981; Ortmann et al.,
1989; Krey and Kamel, 1990). P4 receptors were detected
on pituitary gonadotropes (Fox et al., 1990). P4 adminis-
tered for periods beyond 12 h inhibited the gonadotropin
release from cultured pituitary cells (Lesoon and Mahesh,
1992). Furthermore, luteal P4 was found to suppress the
secretion of LH in monkeys (O’Byrne et al., 1991). There-
fore, it was considered that Kp10 had no stimulatory effect
on LH secretion from the AP cells treated with P4 .
Androgen acts directly in the pituitary cell via its own
receptor rather than through prior conversion into estro-
gen (Belanger et al., 1980). Androgen receptors have been
detected in the pituitary gonadotropes (Okada et al., 2003).
T and dihydrotestosterone were reported to regulate LH-␤
mRNA levels in the AP gland (Burger et al., 2004; Thackray
et al., 2006). Androgens have a dual effect, inhibitory and
stimulatory, on the secretion of LH from the pituitary
gonadotropes in vitro (Turgeon and Waring, 1999). The
stimulatory action of T on the LH-secreting gonadotropes is
due to stimulation of LH-␤ mRNA expression (Yasin et al.,
1996) or modulation of Ca2+ signals (Ortmann et al., 1998).
Therefore, it was suggested that T enhanced the sensitiv-
ity of LH-secreting gonadotropes to Kp10 through these
pathways.
Regulation of FSH secretion is less clearly understood
(Lesoon and Mahesh, 1992). The secretion of FSH, like that
of LH, did not respond to Kp10 in the AP cells not treated
with steroids, and the sexual steroid hormones did not
enhance the FSH-secretory response to Kp10. In contrast to
LH, E2 significantly suppressed FSH secretion, but neither
P4 nor T had any effect on the FSH-secreting cells. A pre-
vious study in vivo found an inverse relationship between
FSH and E2 (Robertson et al., 2009). E2 ’s inhibitory effect on
the secretion of FSH is mediated through its ability to sup-
press the expression of the gene encoding activin (Nett et
al., 2002). Our results support that E2 primarily acts on the
pituitary gonadotropes to inhibit FSH production (Ghosh
et al., 1996) and subsequently showed no response to the
Kp10-releasing effect. It seems that the effect of P4 on the
pituitary gonadotropes is the same for both LH and FSH,
and T regulates the secretion of LH and FSH independently
from its direct action on the pituitary cells.
GnRH stimulated both the synthesis and release of the
pituitary gonadotropins LH and FSH (Naor, 2009). This sup-
ports that LH and FSH secretion was greater in response to
GnRH than to Kp10 in the present study. Our results show
Kp10 to be a less potent LH-releaser.
Our findings revealed a direct effect of Kp10 on the
secretion of PRL from cultured bovine AP cells regardless of
steroid treatments. The results were similar to those for GH
(Ezzat et al., 2010); that is, GH was secreted by Kp10 regard-
less of steroid treatments. E2 and T receptors have been
demonstrated in the pituitary tissue; however, there was
no evidence for a direct effect of sex steroids on lactotropes
(Shi et al., 1986). Sprangers et al. (1989) found that P4 recep-
tors are not expressed in pituitary lactotropes and P4 had
no direct effect on PRL secretion in monkey pituitary cell
cultures. These findings support our results since we found
no effect of sexual steroid hormones on the PRL-secreting
 A.A. Ezzat et al. / Animal Reproduction Science 121 (2010) 267–272
lactotropes in response to Kp10. However, our results sug-
gest that kisspeptin plays an autocrine or paracrine role in
the pituitary tissue to regulate the function of lactotropes in
cattle. In the present study, we examined the characteris-
tics of PRL secretion in response to Kp10 and TRH. However,
less PRL was secreted in response to Kp10 than to TRH.
In summary, the present results suggest that E2 and T,
but not P4 , enhance the sensitivity of gonadotropic cells
to Kp10-stimulated release of LH. However, Kp10 had no
stimulatory effect on FSH secretion regardless of the effect
of sex steroids. Kp10 directly stimulates the release of PRL
from lactotropic cells and sex steroids do not enhance the
sensitivity of lactotropic cells to Kp10. Furthermore, LH-
and PRL-releasing effect of Kp10 was less potent than that
of GnRH and TRH, respectively.
Acknowledgements
The authors thank Dr. E Kasuya (National Institute
of Agrobiological Science, Tsukuba, Japan) for providing
bovine pituitary and Dr. A F Parlow (National Hormone and
Peptide Program, Harbor-UCLA Medical Center, Torrance,
CA, USA) for providing the bovine FSH and ovine RIA kits.
This research was partly supported by a Grant-in-aid for
Scientific Research (no. 21380169) from the Japan Society
for the Promotion of Science to T. Hashizume.
References
Belanger, A., Lundell, L., Eneroth, P., Gustafsson, J.A., 1980. Andro-
gen metabolism in rat anterior pituitary cells in culture. Mol. Cell.
Endocrinol. 19, 175–181.
Burger, L.L., Haisenleder, D.J., Dalkin, A.C., Marshall, J.C., 2004. Regula-
tion of gonadotropin subunit gene transcription. J. Mol. Endocrinol.
33, 559–584.
Drouin, J., Labrie, F., 1981. Interaction between 17␤-estradiol and proges-
terone in the control of LH and FSH release in rat anterior pituitary
cell culture. Endocrinology 108, 52–57.
Ezzat, A.A., Saito, H., Sawada, T., Yaegashi, T., Jin J, Sawai, K., Yamashita, T.,
Hashizume, T., 2010. Sex steroid hormones do not enhance the direct
stimulatory effect of kisspetin-10 on the secretion of growth hormone
from bovine anterior pituitary cells. Anim. Sci. J. (in press).
Ezzat, A.A., Saito, H., Sawada, T., Yaegashi, T., Yamashita, T., Hirata, T.-I.,
Sawai, K., Hashizume, T., 2009. Characteristics of the stimulatory effect
of Kisspeptin-10 on the secretion of luteinizing hormone, follicle-
stimulating hormone and growth hormone in prepubertal male and
female cattle. J. Reprod. Dev. 55, 650–654.
Fox, S., Harlan, R.E., Shivers, B., Pfaff, D.W., 1990. Chemical characterization
of neuroendocrine targets for progesterone in the female rat brain and
pituitary. Neuroendocrinology 51, 276–283.
Ghosh, B.R., Wu, J.C., Strahl, B.D., Childs, G.V., Miller, W.L., 1996. Inhibin
and estradiol alter gonadotropes differentially in ovine pituitary cul-
tures: changing gonadotrope numbers and calcium responses to
gonadotropin-releasing hormone. Endocrinology 137, 5144–5154.
Gottsch, M.L., Clifton, D.K., Steiner, R.A., 2009. From KISS1 to kisspeptins:
an historical perspective and suggested nomenclature. Peptides 30,
4–9.
Gutierrez-Pascual, E., Martinez-Fuentes, A.J., Pinilla, L., Tena-Sempere,
M., Malagon, M.M., Castano, J.P., 2007. Direct pituitary effects of
kisspeptin: activation of gonadotrophs and somatotrophs and stim-
ulation of luteinizing hormone and growth hormone secretion. J.
Neuroendocrinol. 19, 521–530.
Hashizume, T., Kasuya, E., 2009. Methodology for the study of the
hypothalamic-pituitary hormone secretion in cattle. Anim. Sci. J. 80,
1–11.
Hashizume, T., Kumahara, A., Fujino, M., Okada, K., 2002. Insulin-
like growth factor I enhances gonadotropin-releasing hormone-
stimulated luteinizing hormone release from bovine anterior pituitary
cells. Anim. Reprod. Sci. 70, 13–21.
Hashizume, T., Saito, H., Sawada, T., Yaegashi, T., Ezzat, A.A., Sawai, K.,
Yamashita, T., 2010. Characteristics of stimulation of gonadotropin
271
secretion by kisspeptin-10 in female goats. Anim. Reprod. Sci. 118,
37–41.
Hashizume, T., Takahashi, Y., Numata, M., Sasaki, K., Ueno, K., Ohtsuki,
K., Kawai, M., Ishi, A., 1999. Plasma profiles of growth hormone, pro-
lactin and insulin-like growth factor-I during gestation, lactation and
neonatal period in goats. J. Reprod. Dev. 45, 273–281.
Kadokawa, H., Suzuki, S., Hashizume, T., 2008. Kisspeptin-10 stimulates
the secretion of growth hormone and prolactin directly from cultured
bovine anterior pituitary cells. Anim. Reprod. Sci. 105, 404–408.
Kaneko, H., Noguchi, J., Kikuchi, K., Todoroki, J., Hasegawa, Y., 2002. Alter-
ations in peripheral concentrations of inhibin A in cattle studied
using a time-resolved immunofluorometric assay: relationship with
estradiol and follicle-stimulating hormone in various reproductive
conditions. Biol. Reprod. 67, 38–45.
Keefer, D.A., Stumpf, W.E., Petrusz, P., 1976. Quantitative autoradiographic
assessment of 3H-estradiol uptake in immunocytochemically charac-
terized pituitary cells. Cell Tissue Res. 166, 25–35.
Kotani, M., Detheux, M., Vandenbogaerde, A., Communi, D., Vander-
winden, J.M., Le Poul, E., Brezillion, S., Tyldesley, R., Suarez-Huerta,
N., Vandeput, F., Detheux, M., Blanpain, C., Schiffmann, S.N., Vas-
sart, G., Parmentier, M., 2001. The metastasis suppressor gene KiSS-1
encodes kisspeptins, the natural ligands of the orphan G protein-
coupled receptor GPR54. J. Biol. Chem. 276, 34631–34636.
Kowase, T., Walsh, H.E., Darling, D.S., Shupnik, M.A., 2007. Estrogen
enhances gonadotropin-releasing hormone-stimulated transcription
of the luteinizing hormone subunit promoters via altered expression
of stimulatory and suppressive transcription factors. Endocrinology
148, 6083–6091.
Krey, L.C., Kamel, F., 1990. Progesterone modulation of gonadotropin
secretion by dispersed rat pituitary cells in culture. I. Basal and
gonadotropin-releasing hormone stimulated luteinizing hormone
release. Mol. Cell. Endocrinol. 68, 85–94.
Lesoon, L.A., Mahesh, V.B., 1992. Stimulatory and inhibitory effects of
progesterone on FSH secretion by the anterior pituitary. J. Steroid
Biochem. Mol. Biol. 42, 479–491.
Naor, Z., 2009. Signaling by G-protein-coupled receptor (GPCR): studies
on the GnRH receptor. Front. Neuroendocrinol. 30, 10–29.
Nett, T.M., Turzillo, A.M., Baratta, M., Rispoli, L.A., 2002. Pituitary effects
of steroid hormones on secretion of follicle-stimulating hormone and
luteinizing hormone. Domest. Anim. Endocrinol. 23, 33–42.
O’Byrne, K.T., Thalabard, J.C., Grosser, P.M., Wilson, R.C., Williams, C.L.,
Chen, M.D., Ladendorf, D., Hotchkiss, J., Knobil, E., 1991. Radiotele-
metric monitoring of hypothalamic gonadotropin-releasing hormone
pulse generator activity throughout the menstrual cycle of the rhesus
monkey. Endocrinology 129, 1207–1214.
Ohtaki, T., Shintani, Y., Honda, S., Matsumoto, H., Hori, A., Kanihashi, K.,
Terao, Y., Kumano, S., Takatsu, Y., Masuda, Y., Ishibashi, Y., Watanabe,
T., Asada, M., Yamada, T., Suenaga, M., Kitada, C., Usuki, S., Kurokawa,
T., Onda, H., Nishimura, O., Fujino, M., 2001. Metastatsis suppressor
gene kiss-1 encodes peptide ligand of a G-protein coupled receptor.
Nature 411, 613–617.
Okada, Y., Fujii, Y., Moore Jr., J.P., Winters, S.J., 2003. Androgen receptors
in gonadotrophs in pituitary cultures from adult male monkeys and
rats. Endocrinology 144, 267–273.
Ortmann, O., Tomic, M., Weiss, J.M., Diedrich, K., Stojilkovic, S.S., 1998.
Dual action of androgen on calcium signaling and luteinizing hormone
secretion in pituitary gonadotrophs. Cell Calcium 24, 223–231.
Ortmann, O., Weise, H., Knuppen, R., Emons, G., 1989. Acute facilitory
action of progesterone on gonadotropin secretion of perifused rat
pituitary cells. Acta Endocr. (Copenh.) 121, 426–434.
Ramaswamy, S., Gibbs, R.B., Plant, T.M., 2009. Studies of the locali-
sation of Kisspeptin within the pituitary of the Rhesus Monkey
(Macaca mulatta) and the effect of Kisspeptin on the release of non-
gonadotropic pituitary hormones. J. Neuroendocrinol. 21, 795–804.
Richard, N., Galmiche, G., Corvaisier, S., Caraty, A., Kottler, M.L., 2008.
KiSS-1 and GPR54 genes are co-expressed in rat gonadotrophs and
differentially regulated in vivo by oestradiol and gonadotrophin-
releasing hormone. J. Neuroendocrinol. 20, 381–393.
Robertson, D.M., Hale, G.E., Jolley, D., Fraser, I.S., Hughes, C.L., Burger, H.G.,
2009. Interrelationships between ovarian and pituitary hormones in
ovulatory menstrual cycles across reproductive age. J. Clin. Endocrinol.
Metab. 94, 138–144.
Scully, K.M., Gleiberman, A.S., Lindzey, J., Lubahn, D.B., Korach, K.S., Rosen-
feld, M.G., 1997. Role of estrogen receptor-a in the anterior pituitary
gland. Mol. Endocrinol. 11, 674–681.
Shi, Y., Patterson, A.P., Sherins, R.J., 1986. Increased plasma and pituitary
prolactin concentrations in adult male rats with selective elevation of
FSH levels may be explained by reduced testosterone and increased
estradiol production. J. Androl. 7, 105–111.
272 A.A. Ezzat et al. / Animal Reproduction Science 121 (2010) 267–272
Smith, J.T., Rao, A., Pereira, A., Caraty, A., Millar, R.P., Clarke, I.J., 2008.
Kisspeptin is present in ovine hypophyseal portal blood but does
not increase during the preovulatory luteinizing hormone surge: evi-
dence that gonadotropes are not direct targets of kisspeptin in vivo.
Endocrinology 149, 1951–1959.
Smith, P.F., Keefer, D.A., 1985. Estrogen uptake capacity of individual pitu-
itary cell types from male and female rats one fourteen and fifty days
after castration. Horm. Metab. Res. 17, 583–587.
Sprangers, S.A., Brenner, R.M., Bethea, C.L., 1989. Estrogen and progestin
receptor immunocytochemistry in lactotropes versus gonadotropes
of monkey pituitary cell cultures. Endocrinology 124, 1462–1470.
Suzuki, S., Kadokawa, H., Hashizume, T., 2008. Direct Kisspeptin-10 stim-
ulation on luteinizing hormone secretion from bovine and porcine
anterior pituitary cells. Anim. Reprod. Sci. 103, 360–365.
Sánchez-Criado, J.E., Martín De Las Mulas, J., Bellido, C., Tena-Sempere,
M., Aguilar, R., Blanco, A., 2004. Biological role of pituitary estrogen
receptors ERalpha and ERbeta on progesterone receptor expression
and action and on gonadotropin and prolactin secretion in the rat.
Neuroendocrinology 79, 247–258.
Thackray, V.G., McGillivray, S.M., Mellon, P.L., 2006. Androgens, progestins
and glucocorticoids induce follicle-stimulating hormone ␤-subunit
gene expression at the level of the gonadotrope. Mol. Endocrinol. 20,
2062–2079.
Turgeon, J.L., Waring, D.W., 1999. Androgen modulation of luteinizing
hormone secretion by female rat gonadotropes. Endocrinology 140,
1767–1774.
Vankelecom, H., Denef, C., 1997. Paracrine communication in the anterior
pituitary as studied in reaggregate cell cultures. Microsc. Res. Tech.
39, 150–156.
Yasin, M., Dalkin, A.C., Haisenleder, D.J., Marshall, J.C., 1996. Testosterone is
required for gonadotropin-releasing hormone stimulation of luteiniz-
ing hormone-beta messenger ribonucleic acid expression in female
rats. Endocrinology 137, 1265–1271.
 Animal Reproduction Science 121 (2010) 273–278

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Relationships between ovarian cysts and morphological

and hormonal state of ovarian cortex in sows
˛
K. Szulańczyk-Mencel, A. Rzasa, W. Bielas ∗
Department and Clinic of Reproduction, Faculty of Veterinary Medicine, University of Environmental and Life Sciences, Wrocław, Poland

a r t i c l e i n f o a b s t r a c t

Article history: The aim of this study was to evaluate the relationship between ovarian cysts and concen-
Received 25 November 2009 trations of ovarian steroid hormones: 17␤-estradiol (E2 ), progesterone (P4) , testosterone
Received in revised form 27 May 2010
(T), and androstendione (A4 ) both in blood plasma and in cysts and morphological state
Accepted 1 June 2010
of the ovarian cortex in sows. Females were divided into three groups: PCO (sows with
Available online 8 June 2010
polycystical ovaries), OO (sows with oligocystic ovaries) and control (sows without ovarian
cysts). The ovaries for evaluations were collected after slaughtering of 18 multiparous sows.
Keywords:
Between the PCO and OO animals, statistically significant differences in numbers of the fol-
Ovarian cyst
Steroid hormones licular cysts (FC) (8.6 vs. 1.5), follicular theca-lutein cysts (FTLC) (8.0 vs. 2.0), follicular lutein
Ovarian cortex cysts (FLC) (4.5 vs. 2.0) and corpus luteum cysts (CLC) (1.7 vs. 0.4) (P ≤ 0.01) were noted. In
Sow the PCO sows the most common kinds of cysts were FC and FTLC (8.6 and 8.0) whilst in OO
sows the cysts occurred on their ovaries on a similar level (FC – 1.6, FTLC – 2.0, FLC – 2.0).
Existence of more than 10 ovarian cysts in the sows significantly decreases the frequency of
physiological ovarian follicles (primary, growing and maturing) and significantly increases
the pathological process of atresia on all stages of ovarian follicles development (P ≤ 0.01).
The study did not reveal any effect of growing or decreasing number of ovarian cyst on con-
centrations of E2 and P4 in blood plasma of sows. Polycystical ovaries significantly decreased
concentrations of A4 but increased the concentration of T in blood plasma (P ≤ 0.01). The
general presence of ovarian cysts considerably positively correlated with concentrations of
E2 , T and A4 from cysts’ fluid, of all kinds of ovarian cysts and atresia of primary follicles (a
correlation coefficient r from 0.72 up to 0.97, P ≤ 0.05). The phenomenon of ovarian cysts
significantly negatively correlated with all generations of ovarian follicles (P ≤ 0.05).
© 2010 Elsevier B.V. All rights reserved.

1. Introduction infertility, lesser conception rate, and behavioral changes

The occurrence of ovarian cysts may have detrimental
effect on sows health and reduce their reproductive per-
formance. Some studies confirm the connections between
reproductive disorders and the presence of ovarian cysts
found at slaughter (Castagna et al., 2004). COD (Cystic
Ovarian Disease) in pigs appears frequently in multiparous
sows and offers no pathognomic symptoms except for an
irregular or prolonged estrous cycle, permanent anoestrus,
∗ Corresponding author. Tel.: +48 692 697 616; fax: +48 71 320 1006.
E-mail addresses: wbie@interia.pl, wbielas@up.wroc.pl (W. Bielas).
(Fitko et al., 1998b). Cysts appear to be an important risk
factor in returning to estrus. These ovarian structures are
present in approximately 10% of sows culled for fertility
problems (Ebbert and Bostedt, 1993; Castagna et al., 2004).
However, little is known about the incidence of ovar-
ian cysts in pig herds because they may also occur without
leading to culling for reproductive problems. The presence
of cysts before insemination and conception might not
interfere with ovulation from other follicles but it could
decrease the number of normal viable eggs (Castagna et al.,
2004).
Social stress may influence the delicate hormonal pat-
tern around the time of ovulation and fertilization. It is

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.06.001
274 K. Szulańczyk-Mencel et al. / Animal Reproduction Science 121 (2010) 273–278
well known that stress can have a negative effect on the
reproductive performance in animals. There is a cascade
of hormonal events following the immediate endocrine
response to a stressor (Castagna et al., 2004; Prunier and
Quesnel, 2000; Razdan et al., 2002). Stress is known to
be accompanied by elevated levels of ACTH (Close and
Liptrap, 1975). ACTH is released by the anterior pituitary
gland in response to a stressful stimulus. ACTH acts on the
adrenal cortex causing it to produce and release cortisol
which affects reproductive organs and several hormonal
pathways (Brandt et al., 2007; Tsuma et al., 1996). A lack
of luteinizing hormone (LH) that is necessary to induce
ovulation has been suggested as the main cause of cystic
ovaries in the sow. Sows with weaning to estrus inter-
vals shorter than 3 days and a lactation length shorter
than 14 days have a greater probability of developing
ovarian cysts. It’s suggested that the cause of this state
is insufficient LH surge system so follicles fail to ovu-
late and become cystic (Castagna et al., 2004; Knox et al.,
2003).
It was also shown that hypothyroidism promotes ovar-
ian cysts formation. The role of thyroid hormones in ovarian
function was evidenced by many authors (Fitko et al.,
1996). Progesterone of adrenal origin may serve, at least
in part, as a component in the etiology of this kind of infer-
tility (Brandt et al., 2007; Close and Liptrap, 1975; Madej et
al., 2005; Scholten and Liptrap, 1978). Injections of proges-
terone during the follicular phase of the cycle also caused
development of ovarian cysts. Administration of proges-
tational compounds in order to synchronize estrus cycles
in pigs is known as reason resulting in a high incidence of
cystic ovaries (Scholten and Liptrap, 1978). Moreover some
authors suggest that the presence of ovarian cysts in sows
is related to the seasons of the year (Castagna et al., 2004).
The hormonal interactions of the hypothalamic–
pituitary–ovarian axis are accountable for a normal repro-
duction in female pigs. Activation of the hypothalamic–
pituitary–adrenal axis may hamper the normal
gonadotropin secretion and in consequence the ovar-
ian activity (Madej et al., 2005). Steroid hormones are
best-known and best-characterized secretory products
of the ovary. The ovarian steroids fulfill a number of
important functions related to reproduction by endocrine
mechanisms of action. The steroids are produced by luteal
or follicular cells of the ovary. They may act as hormones
on structures remote from the ovary and as local regu-
lators of ovarian activity. These hormones play roles of
paracrine/autocrine agents acting on or within the cells
in which they are produced (Schams and Berisha, 2002).
These hormones exert important effects on the correct
functions of the ovary. The disturbances of endocrino-
logical mechanisms which regulate the physiology of
reproductive organs may lead to infertility. Cystic ovarian
disease is connected with various hormonal interrelations
between sex steroids (Fitko et al., 1998a). Because COD
is an endocrine disorder we can suspect that there are
some correlations between the concentrations of steroid
hormones and the structural changes in structure of the
ovaries.
It is very difficult to diagnose the cystic ovarian dis-
ease in pigs on the basis of the hormonal profile. But
it is well known that this pathology is connected with
hormonal disturbances. It is complex to diagnose cysts
trough serological methods because plasma concentrations
of progesterone, estradiol and luteinizing hormone in this
disturbance are similar in sows during diestrus (Castagna
et al., 2004).
The aim of this study was to evaluate the relation-
ship between ovarian cysts and concentrations of ovarian
steroid hormones: 17␤-estradiol (E2 ), progesterone (P4) ,
testosterone (T), and androstendione (A4 ) both in blood
plasma and in cysts and morphological state of the ovarian
cortex in sows.
2. Material and methods
2.1. Animals
The experiment was performed with 18 purebred, 2–5
years old multiparous Rodone sows from a commercial pig-
breeding farm located in the Region of Leszno, Poland. Sows
were fed with a commercial diet twice daily on the farm
and had ad libitum access to water. Experimental females
derived from animals which were culled from the farm
mainly due to fertility disturbances. Every culled sow was
routinely checked for the presence of ovarian cysts before
slaughtering, using transcutaneous ultrasound examina-
tion, according to Kauffold and Althouse (2007). Ovaries
with ovarian cysts from the particular sow were taken into
laboratory from slaughterhouse. After macroscopic, his-
tological and histometrical examination we distinguished
several different types of ovarian cysts: follicular cysts (FC),
follicular theca-lutein cysts (FTLC), follicular lutein cysts
(FLC) and cysts of corpus luteum (CCL). Reduced granu-
losa and theca layer are characteristic for thin-walled FC
in these structures. In FC cysts membrana granulosa is vis-
ibly thinner than in mature follicles. FTLC have an enlarged
internal zone of theca. The cells of tunica interna undergo
luteinization. In FLC the wall of follicle was luteinized. The
CLC derived from corpora lutea that result from exces-
sive central hemorrhage. Corpus luteum becomes over
distended with blood. They contain clear fluid or altered
blood. At the beginning cystic corpora lutea display the
same features as their non-cystic counterparts, but if the
hemorrhage is excessive their involution is delayed and
they reach pathological size often exceeding 3–4 cm in
diameter. 19 sows (7.98%) out of 238 females culled during
15 months had ovarian cysts. 7 sows (2.94%) had poly-
cystical ovaries whilst 12 females (5.04%) had oligocystic
ovaries. Allotment of a sow to the polycystical or to the
oligocystic ovaries group depended on the number of cysts
which had been discovered on its ovaries; to the oligocys-
tic ovaries group, up to 10 cysts, to the polycystic ovaries
group, when more than 10 cysts were present. The dis-
criminating number between polycystical and oligocystic
ovaries was 10 cysts on ovaries as was chosen according
to what described by Ebbert and Bostedt (1993). Females
were randomly divided into three groups: PCO group – 6
sows with polycystical ovaries, OO group – 6 sows with
oligocystic ovaries and – control group (6 sows with-
out ovarian cysts). OO sows with oligocystic ovaries were
selected from out of 12 sows with oligocystic ovaries whilst
 K. Szulańczyk-Mencel et al. / Animal Reproduction Science 121 (2010) 273–278 275

Table 1
Effect of polycystical and oligocystic ovaries on structural components of ovarian cortex in sows (mean ± SD).

Sows with Sows with Sows without

polycystical oligocystic ovarian cysts
ovaries (n = 6) ovaries (n = 6) (n = 6) (control)

Primary ovarian follicles 46.16 ± 2.8C 71.66 ± 6.25B 96.50 ± 4.12A

Growing ovarian follicles 27.83 ± 2.7C 33.66 ± 2.60B 43.08 ± 2.93A
Maturing ovarian follicles 4.33 ± 1.15B 6.75 ± 0.96A 6.25 ± 0.96A
Corpora lutea 4.50 ± 1.08A 5.25 ± 0.96A 3.41 ± 0.79B
Corpora albicans 4.16 ± 1.11B 4.33 ± 1.43B 8.83 ± 1.11A
Atresia of primary ovarian Follicles 112.75 ± 3.19A 92.91 ± 4.14B 40.50 ± 5.0C
Atresia of growing ovarian Follicles 55.41 ± 2.35A 54.00 ± 2.92A 13.75 ± 2.41B
Atresia of maturing ovarian Follicles 16.16 ± 1.52A 14.08 ± 2.77A 3.83 ± 1.02B
Follicular cysts 8.66 ± 1.61A 1.58 ± 1.62A 0.50 ± 0.90B
Follicular theca-lutein cysts 8.00 ± 1.12A 2.00 ± 1.12B 0.16 ± 0.3C
Follicular lutein cysts 4.50 ± 1.62A 2.00 ± 0.95B 0.00 ± 0.0C
Corpus luteum cysts 1.75 ± 0.75A 0.41 ± 0.66B 0.00 ± 0.0C

Mean values marked with different capital letters, different at P ≤ 0.01.

control sows were selected from out of 219 animals with-
out ovarian cysts which were culled from the farm mainly
due to low fecundity, overweight, hoofs diseases and other
ailments.
2.2. Blood sampling
Peripheral blood was collected by a puncture of anterior
vena cava directly after the diagnosis of ovarian cysts in
culled sows. The blood samples were centrifuged at 1500 g
for 10 min. Plasma samples were stored at −20 ◦ C until con-
centrations of 17␤-estradiol, progesterone, testosterone,
and androstendione were determined.
2.3. Ovarian cysts fluid
The samples of cysts fluid were collected post-mortem,
frozen and stored at −20 ◦ C until the concentrations
of hormones were determined. Cyst fluid was collected
from random cysts from either polycystical or oligocystic
ovaries.
2.4. Hormone assays
The concentration of 17␤-estradiol, progesterone,
testosterone, and androstendione in the blood plasma
was determined by radioimmunoassay (Coat-A-Count,
Diagnostic Products Corporation, Los Angeles, CA, USA)
according to the manufacturer’s instructions.
2.5. Histology and histometry
The ovaries collected at the slaughterhouse were fixed
in 4% formalin for 48 h and embedded in paraffin. Then the
organs were cut at 6–7 ␮m, fixed on slides, dyed, deparaf-
finized and rehydrated in ethanol solutions. The slides were
stained with hematoxylin/eosin. The amount of ovarian fol-
licles of all generations, corpora lutea, and corpora albicans,
atretic follicles and different kind of cysts were counted on
five sections from each ovary.
2.6. Statistics
Treatment comparisons were made by analysis of vari-
ance procedures for a completely randomised design using
STATISTICA 8 statistical package. All the values were
presented as mean ± SEM. Differences were considered sig-
nificant if the P value was less than 0.05 or 0.01. Differences
between means were compared by the Duncan test when
the analysis was done for three groups and by Tukey test
when the analysis was done for two groups. The Pearson’s
correlations between analysed factors were calculated.
The experimental protocol had previously been
reviewed and approved by the II Local Ethical Committee
for Experimentation with Animals, Wroclaw, Poland.
3. Results
Table 1 presents the effect of polycystical and oligocys-
tic ovaries on structural components of the ovarian cortex
in sows. There were statistically significant differences in
numbers of FC (8.6 vs. 1.5), FTLC (8.0 vs. 2.0), FLC (4.5 vs.

Table 2
Effect of polycystical and oligocystic ovaries on concentrations of steroid hormones in blood plasma of sows (mean ± SD).

Sows with Sows with Sows without ovarian

polycystical oligocystic ovaries cysts (control) (n = 6)
ovaries (n = 6) (n = 6) (control)

17␤-estradiol pg/ml 5.19 ± 0.69 8.24 ± 5.29 6.47 ± 1.43

Progesterone ng/ml 22.05 ± 13.83 16.23 ± 14.05 12.34 ± 12.76
Testosterone ng/ml 0.04 ± 0.02 0.05 ± 0.02a 0.03 ± 0.02b
Androstendione ng/ml 0.06 ± 0.06b 0.14 ± 0.12 0.22 ± 0.08a

Mean values marked with different small letters, different at P ≤ 0.05.

276 K. Szulańczyk-Mencel et al. / Animal Reproduction Science 121 (2010) 273–278

Table 3
Concentrations of steroid hormones between polycystical and oligocystic ovaries in liquids derived from cysts of cystical sows (mean ± SD).

Steroid hormones Sows with polycystical ovaries (n = 6) Sows with oligocystic ovaries (n = 6)

17␤-estradiol pg/ml 1,195,839 ± 884,095A 10,714 ± 28,791B

Progesterone ng/ml 615,770 ± 801,750 926,508 ± 379,163
Testosterone ng/ml 3820 ± 3592A 448 ± 237B
Androstendione ng/ml 7272 ± 5072A 035 ± 1395B

Mean values marked with different capital letters, different at P ≤ 0.01.

2.0) and CLC (1.7 vs. 0.4) between the PCO and OO sows, centrations of steroid hormones in blood of the studied
respectively (P ≤ 0.01). An increasing number of ovarian sows (P > 0.05). The general presence of ovarian cysts sig-
cysts significantly decreases the frequency of physiologi- nificantly positively correlated both with concentrations of
cal ovarian follicles (primary, growing and maturing) and E2 , T and A 4 , derived from all kinds of cysts’ fluid, and with
significantly increases the pathological process of atresia all kinds of ovarian cysts and atresia of primary follicles (a
on all stages of ovarian follicles development (P ≤ 0.01). correlation coefficient r from 0.72 up to 0.97, P ≤ 0.05).
Table 2 presents the effect of polycystical and oligocys-
tic ovaries on concentrations of steroid hormones in blood 4. Discussion
plasma of sows. No effect of growing or decreasing num-
ber of ovarian cyst on concentrations of E2 and P4 in blood The ovarian cysts are an important reproductive disor-
plasma of sows was found (P > 0.01). Polycystical ovaries der in pigs (Ribadu et al., 2000). The formation of ovarian
significantly decreased concentrations of A4 but increased cysts is multifactorial. Many factors such as stress, nutri-
concentration of T in blood plasma (P ≤ 0.01). tion, and season are associated with the development
Table 3 compares concentrations of steroid hormones of ovarian cysts, although their exact relationship is not
between polycystical and oligocystic ovaries in liquids fully understood. Additionally, there are several limita-
derived from cysts of cystical sows. Cysts from polycys- tions in scientific studies on the spontaneous occurrences
tical ovaries produced significantly larger quantities of E2 , of ovarian cysts. The immediate reason of this condition
T and A4 than oligocystic ovaries, whilst P4 concentration is believed to be an alteration in gonadotropin secretion
was almost the same. (Peter and Liptrap, 1985); however the pathogenesis of
Table 4 presents correlations between the general ovarian cysts development is still unknown not only in
occurrence of ovarian cysts and the morphological and hor- the case of animals but also in women to. Perhaps, this is,
monal state of the cortex of ovary in sows. The phenomenon at least partially, a reason for ineffective therapy of this
of ovarian cysts significantly negatively correlated with all ailment.
generations of ovaries follicles (P ≤ 0.05). There were not We noted that the increase of the number of ovar-
any correlations between cysts phenomenon and the con- ian cysts was accompanied by elevated number of atretic
follicles, and on the other hand, this increase negatively
correlates with normal non-atretic ones. The atresia pro-
Table 4
cess was especially observed within primary follicles both
Correlations between general occurrence of ovarian cysts and morpho-
logical and hormonal state of cortex of ovary in sows (n = 12). in PCO and OO group of females. In the case of polycys-
tical ovaries we noted an advanced stage of degenerative
Studied factors of General occurrence of
changes in ovarian cortex which would have been a reason
sow ovaries ovarian cysts
functionality of persistent infertility. Our observations have demon-
Correlation strated that 7 females (7 out of 238) had 10 and more
coefficient (r) ovarian cysts on the ovaries. It appeared that this ail-
17␤-estradiol in blood −0.37 ment (polycystical ovaries) always caused reproductive
Progesterone in blood 0.26 disorders and reduced reproductive performance in these
Testosterone in blood −0.28 sows leading to culling them from herd. In the case of
Androstendione in blood −0.16
polycystical ovaries the corpora lutea or normal follicles
17␤-estradiol in cysts 0.80a
Progesterone in cysts −0.43 are often invisible in macroscopic investigation due to
Testosterone in cysts 0.73a a high number of large cysts present on the examined
Androstendione in cysts 0.75a ovary. Therefore, only precise histological and histomet-
Primary ovarian follicles −0.94a
rical investigations would allow evaluating the state of
Growing ovarian follicles −0.83a
Maturing ovarian follicles −0.72a
ovarian cortex in case of cystic ovarian degeneration. On
Corpora lutea −0.50 the contrary, the oligocystic ovaries are not accompanied
Corpora albicans −0.27 by intense unfavorable changes in ovarian cortex, and we
Atresia of primary ovarian follicles −0. 89a cannot exclude the possibility of ovulation and pregnancy
Atresia of growing ovarian follicles 0.27
in sows with this kind of cysts. 12 sows (12 out of 238
Atresia of maturing ovarian follicles 0.38
Follicular cysts 0.99a culled) exhibited only up to 10 cysts on ovaries. It was
Follicular theca-lutein cysts 0. 97a found in these and in the earlier studies that females
Follicular lutein cysts 0.76a with oligocystic ovaries were never culled from herd
Corpus luteum cysts 0.88a
by reproductive failures (Szulańczyk-Mencel and Bielas,
a
Correlation coefficient is highly significant, P ≤ 0.01. 2008).
 K. Szulańczyk-Mencel et al. / Animal Reproduction Science 121 (2010) 273–278
We have to underline that the cystic ovary disorder
(COD) is a dynamic process, some of the cysts can disappear
spontaneously or undergo the process of degeneration, so
we could suspect that the hormonal profile which accom-
panies this state is instable. It is very difficult to define
for how long the cysts may have existed before diagno-
sis. 25–30% of the ascertained cysts disappeared when they
were evaluated by ultrasound examination until the 15th
day of evaluation (Castagna et al., 2004). Lucy et al. (1999)
reported that approximately 1 week after the regression
of all the cysts on investigated ovaries the new cohort of
follicles was formed on them.
From the analysis of the hormonal profile in sows with
ovarian cysts in comparison to sows without cysts it may
be concluded that it is very difficult to ascertain the ovarian
cysts presence on the basis of endocrinological investiga-
tions. The estimation of hormone levels in the blood of
sows with naturally occurring cystic ovarian disease (COD)
is rare and the results are very diverse. The concentration
of estimated hormones in blood plasma showed a limited
and incomplete parallelism (Ribadu et al., 2000). Moreover,
many results of ovarian steroid hormones were obtained
experimentally from sows with artificially induced ovarian
cysts.
In our studies the concentration of hormones in blood
plasma of sows varied among groups as well as between
individual animals. The differences between sows may
be due to individual, physiological variations to stres-
sors (Scholten and Liptrap, 1978). These differences may
result from the fact that the hormones produced by the
ovaries undergo various transformations (binding to spe-
cific proteins or receptors, conversion to other hormones,
elimination etc.) after their release into general blood circu-
lation. This is probably the reason why the data on hormone
concentration in blood plasma usually does not reflect hor-
mone content in cystical fluid (Fitko et al., 1998a).
Results of this work do not confirm some details in the
findings of other authors investigating hormone levels in
COD in pigs. It is probably possible that this fact may be
connected with the differences in degree of ovarian degen-
eration in females in our studies. The changes in steroids
profile indicated that in sows with the presence of ovarian
cysts some disturbances in hormonal metabolism exist. The
disturbances in ovarian steroid genesis in sows may also
have resulted from a defect in aromatase complex which
caused an increased conversion of A4 to E1 and T to E2 in
peripheral fat tissue (Ribadu et al., 2000).
The data obtained in our studies revealed the distur-
bances in hormone production or secretion in examined
sows. We found some correlations between the hormone
concentrations and the state of ovarian cortex in cystic
ovaries in sows. The data evidenced different interrela-
tions between concentrations of hormones in the blood
plasma and cystical fluid and a number of various ovarian
structures. These abnormalities were probably the conse-
quences of a disturbed ovarian function connected with
structural and functional changes in the ovaries.
We also noted some differences in the concentration of
testosterone and androstendione – hormones in which lev-
els are not commonly measured in blood plasma of female
pigs. Polycystical ovaries significantly decreased concen-
277
trations of A4 , increased the concentration of T in blood
plasma and significantly negatively correlated with all gen-
erations of ovarian follicles. Therefore we should give more
attention to these hormones in future researches. Elevated
levels of circulating androgens (hyperandrogenemia) and
clinical manifestation of androgen excess (hyperandro-
genism) are the symptoms of polycystic ovarian syndrome
(PCOS) in women. Thus, experimental pigs may be a suit-
able and useful model for the study of some aspects of
pathophysiology of PCOS in women and COD in female
animals (Ribadu et al., 2000).
Correlations between various hormones or between
hormones and the morphological state of ovaries have been
very rarely investigated up to this time. Therefore this work
may provide valuable data concerning endocrine regula-
tions, abnormalities in hormone secretion and dysfunction
of ovarian cortex in the case of ovarian cysts presence in
sows. Disturbed ovarian function caused serious deregu-
lations in the hormonal pattern of these animals. These
disturbances changed the hormonal profiles and elimi-
nated the characteristic hormone fluctuations and peaks of
secretion around the estrus period. Therefore, these facts
should be taken into consideration when the hormonal
treatment of animals is undertaken (Fitko et al., 1998b).
In conclusion some correlations between hormonal pro-
file, state of ovarian cortex and cysts presence are now
documented and may stimulate further research in this
field.
Acknowledgements
This study was supported by grant KBN 7/14-W/2008/G.
References
Brandt, Y., Lundeheim, N., Madej, A., Rodriguez-Martinez, H., Einarsson,
S., 2007. Effects of ACTH injections during estrus on concentrations
and patterns of progesterone, estradiol, LH, and inhibin ␣ and time of
ovulation in the sow. Dom. Anim. Endocrinol. 32, 122–137.
Castagna, C.D., Peixoto, C.H., Bortolozzo, F.P., Wentz, I., Neto, G.B., Ruschel,
F., 2004. Ovarian cysts and their consequences on the reproductive
performance in swine herds. Anim. Reprod. Sci. 81, 115–123.
Close, R.W., Liptrap, R.M., 1975. Plasma progesterone levels in sows with
induced cystic ovarian follicles. Res. Vet. Sci. 19, 28–34.
Ebbert, W., Bostedt, H., 1993. Cystic degeneration in porcine ovaries –
first communication: morphology of cystic ovaries, interpretation of
the results. Reprod. Dom. Anim. 28, 441–450.
Fitko, R., Jana, B., Kucharski, J., 1998a. Correlations of hormone concen-
trations in blood plasma and their relations to ovarian structures in
hypo- and hyperthyroid cyst-bearing gilts. Pol J. Vet. Sci. 1, 11–15.
Fitko, R., Jana, B., Kucharski, J., Sobczak, J., 1998b. Changes in periestrous
hormonal profile in blood of gilts with different thyroid function and
ovary cysts. Pol J. Vet. Sci. 1, 3–9.
Fitko, R., Kucharski, J., Szlezyngier, B., Jana, B., 1996. The concentration
of GnRH in hypothalamus, LH and FSH in pituitary, LH PRL and sex
steroids in peripheral and ovarian venous plasma of hypo- and hyper-
thyroid, cysts-bearing gilts. Anim. Reprod. Sci. 45, 123–138.
Kauffold, J., Althouse, G.C., 2007. An update on the use of B-mode ultra-
sonography in female pig reproduction. Theriogenology 67, 901–911.
Knox, R.V., Vatzias, G., Naber, C.H., Zimmerman, D.R., 2003. Plasma
gonadotropins and ovarian hormones during the estrous cycle in high
compared to low ovulation rate gilts. J. Anim. Sci. 81, 249–260.
Lucy, M.C., Liu, J., Koenigsfeld, A.T., Cantley, T.C., Keisler, D.H., 1999.
Ultrasonically-measured ovarian follicular development in weaned
sows. Biol. Reprod. 60 (Suppl. 1), 166–172.
Madej, A., Lang, A., Brandt, Y., Kindahl, H., Madsen, M.T., Einarsson, S., 2005.
Factors regulating ovarian function in pigs. Dom. Anim. Endocrinol. 29,
347–361.
278 K. Szulańczyk-Mencel et al. / Animal Reproduction Science 121 (2010) 273–278
Peter, A.T., Liptrap, R.M., 1985. Plasma gonadotrophin levels in sows with
experimental cystic ovarian follicles. Br. Vet. J. 141, 288–296.
Prunier, A., Quesnel, H., 2000. Nutritional influences on the hormonal
control of reproduction in female pigs. Livestock Prod. Sci. 63, 1–16.
Razdan, P., Mwanza, A.M., Kindahl, H., Rodriguez-Martinez, H., Hul-
ten, F., Einarsson, S., 2002. Effect of repeated ACTH-stimulation on
early embryonic development and hormonal profiles in sows. Anim.
Reprod. Sci. 70, 127–137.
Ribadu, A.Y., Nakada, K., Moriyoshi, M., Zhang, W.C., Tanaka, Y., Nakao, T.,
2000. The role of Pulse frequency in ACTH-induced ovarian follicular
cysts in heifers. Anim. Reprod. Sci. 64, 21–31.
Schams, D., Berisha, B., 2002. Steroids as a local regulators of ovarian
activity in domestic animals. Dom. Anim. Endocrinol. 23, 53–65.
Scholten, J.A., Liptrap, R.M., 1978. A role of the adrenal cortex in the onset
of cystic ovarian follicles in the sow. Can. J. Comp. Med. 42, 525–533.
Szulańczyk-Mencel, K., Bielas, W., 2008. Relationships between ovarian
cysts and changes in mucosa of the oviduct and uterus in sows. Bull.
Vet. Inst. Pulawy 52, 235–238.
Tsuma, V.T., Einarsson, S., Madej, A., Kindahl, H., Lundeheim, N., Rojkit-
tikhum, T., 1996. Endocrine changes during group housing of
primiparous sows in early pregnancy. Acta. Vet. Scand. 37, 481–490.
 Animal Reproduction Science 121 (2010) 279–285

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Embryo transfer technique: Factors affecting the viability of the corpus

luteum in llamas
Virginia Trasorras a,∗ , María Graciela Chaves a , Deborah Neild a , Mariana Gambarotta b ,
Marcelo Aba c , Alicia Agüero a
a
Área de Teriogenología, Instituto de Investigación y Tecnología en Reproducción Animal (INITRA), Facultad de Ciencias Veterinarias, Universidad de Buenos
Aires (UBA), Av. Chorroarín 280 (1427), Ciudad Autónoma de Buenos Aires, Buenos Aires, Argentina
b
Área de Bioestadística, Facultad de Ciencias Veterinarias, UBA, Argentina
c
Área de Endocrinología, Facultad de Ciencias Veterinarias, Universidad Nacional del Centro de la Provincia de Buenos Aires (U.N.C.P.B.A.), Campus
Universitario, Paraje Arroyo Seco s/n, Tandil, 7000 Buenos Aires, Argentina

a r t i c l e i n f o a b s t r a c t

Article history: The aim of the present study was to evaluate the effect of the embryo transfer (ET) maneu-
Received 24 November 2009 vers on plasma progesterone concentrations in recipient Lama glama females and the
Received in revised form 9 June 2010
relationship between the site the embryo was transferred to and corpus luteum (CL) local-
Accepted 14 June 2010
ization. Experiment I (effect of transcervical threading): adult non-pregnant, non-lactating
Available online 19 June 2010
llama females were randomly assigned into two groups: control group (without cervical
threading, n = 10) and group A (with cervical threading, n = 10). In both groups, CL activity
Keywords:
was evaluated through measurement of progesterone plasma concentrations. In group A,
Llama
Corpus luteum on Day 6 after inducing ovulation with buserelin, the cervix was threaded to evaluate the
Progesterone effect of the maneuver on CL viability. No significant differences were observed in mean
Embryo transfer progesterone concentrations between groups (P > 0.05). Experiment II (effect of depositing
Maternal recognition of pregnancy PBS): females (n = 66) were randomly assigned into six groups (n = 10 per group and con-
trol group: n = 6) to evaluate the effect of depositing PBS in different sites in the uterus in
relation to the localization of the CL: group ‘Left-Ipsilateral’: transcervical placing of PBS
in the left uterine horn (CL in left ovary); group ‘Left-Contralateral’: transcervical placing
of PBS in the left uterine horn (CL in right ovary); group ‘Right-Ipsilateral’: transcervical
placing of PBS in the right uterine horn (CL in right ovary); group ‘Body-Left’: transcervi-
cal placing of PBS in the uterine body (CL in left ovary); group ‘Body-Right’: transcervical
placing of PBS in the uterine body (CL in right ovary) and control group. Corpus luteum
activity was evaluated in all groups by measuring plasma progesterone concentrations.
On Day 6 post-buserelin, the corresponding maneuver was carried out according to the
group. No significant differences were found for the mean plasma progesterone concen-
trations between groups (P > 0.05). Experiment III (effect of ET on CL viability): females
(n = 22) were used as embryo donors and 50 females as recipients, in order to evaluate if
placing the embryo in different areas of the uterus influences CL viability. Recipients were
randomly divided into five groups, according to the place in the uterus where the ET was
conducted with respect to the ovary where ovulation occurred: group ‘Left-Ipsilateral’:

∗ Corresponding author. Tel.: +54 011 4524 8425; fax: +54 011 4524 8425.
E-mail addresses: vtrasorras@fvet.uba.ar, vickytrasorras@hotmail.com (V. Trasorras).

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.06.004
280 V. Trasorras et al. / Animal Reproduction Science 121 (2010) 279–285

ET in the left uterine horn (CL in left ovary); group ‘Left-Contralateral’: ET in the left uter-
ine horn (CL in right ovary); group ‘Right-Ipsilateral’: ET in the right uterine horn (CL in
right ovary); group ‘Body-Left’: ET in the uterine body (CL in left ovary) and group ‘Body-
Right’: ET in the uterine body (CL in right ovary). Corpus luteum activity was evaluated in
all groups by measuring plasma progesterone concentrations. Embryos were recovered by
flushing the uterus on Day 8 after the first mating of the donor and transcervical ET was
carried out in recipients 6 days after buserelin administration. Pregnancy rates were: group
‘Left-Ipsilateral’: 50%; group ‘Left-Contralateral’: 20%; group ‘Right-Ipsilateral’: 30%; group
‘Body-Left’ and ‘Body-Right’: 10%. No significant differences (P = 0.4728) were detected
between the pregnancy rates in the five groups. Threading the cervix and transcervical
placing of PBS either in the uterine horns or the body did not affect plasma progesterone
concentrations in the llama, indicating that the different embryo transfer maneuvers do
not interfere with CL viability. To improve pregnancy rates it could be suggested that ET in
the left uterine horn with an ipsilateral CL, is the most desirable option.
© 2010 Elsevier B.V. All rights reserved.

1. Introduction
There have been minimal amounts of reproduction-
focused research with South American Camelids (SAC).
Complex reproductive characteristics of these species con-
tribute to the lack of research: induced ovulation, short
half-life of the CL, different luteolytic activity between
the two uterine horns, maternal recognition of pregnancy
(MRP) beginning before Day 10 after mating, pregnan-
cies only in left uterine horn, highly viscous semen with
low sperm concentration, etc. Nevertheless, some assisted
reproductive techniques (such as synchronization of time
of ovarian follicular development, superstimulation and
embryo transfer) indicate a greater increase in knowledge
while others show less advances (artificial insemination,
in vitro fertilization and intracytoplasmic sperm injection)
(Miragaya et al., 2006; Tibary et al., 2005) and certain basic
reproductive physiology remains unclear such as MRP sig-
naling.
In their natural habitat (Andean regions) SAC demon-
strate a seasonal reproductive behavior, with mating and
parturitions occurring predominantly in the rainy season
when more food is available (November–March). In areas
at sea level (Buenos Aires, Entre Ríos, etc.) characterized
by a higher quality food supply, llamas are considered
non-seasonal because of follicular growth throughout the
year. Nevertheless in these areas during the same months,
with greater ambient temperatures, fertilizing capacity
in males is less (Giuliano et al., 2000, 2008). This short
reproductive period added to the long gestation of approx-
imately 11 months (Johnson, 1989; Leon et al., 1990),
are partly responsible for the poor reproductive efficiency
observed in camelids. Application of reproductive biotech-
nologies such as embryo transfer (ET) would allow an
increase in the number of offspring from selected males
and females and consequently increase the proportion of
genetically superior animals. This technique has spread
widely as a practical production method in domestic ani-
mals (horses: Allen, 2005; cattle: Hasler, 2003). In llamas
there has been little success (Aller et al., 2002; Bourke
et al., 1992; Taylor et al., 2000). The luteolytic release
of PGF2␣ starting on Day 7 or 8 post-mating and com-
pleted by Day 9 or 10 after mating, shortens the half-life
of the CL to 8 or 9 days (Aba et al., 1995, 2000) lim-
iting the period necessary for transferring embryos to
the uterus and for MRP to maintain the CL viable in lla-
mas.
Del Campo et al. (1996) found luteolytic action of the
right uterine horn is solely local, while the luteolytic action
of the left uterine horn is on the CL located on the left
and right ovaries. This difference in luteolytic activity
between uterine horns can be explained by the differ-
ent oviduct, ovarian and uterine vascular anatomy in the
camelid female. The main vein originating from the left
uterine horn crosses the midline and ends as a branch of the
right uterine horn vein. Therefore, vascular anatomy indi-
cates that much of the blood-flow of the left uterine horn
vein crosses over to the right side, thus being able to exert a
luteolytic control of the CL in the right ovary (Del Campo et
al., 1996). Although ovulations occur with equal frequency
from both ovaries, the majority of pregnancies are localized
in the left uterine horn (alpaca: 97.5 and 99.3% with a CL
in the right and left ovaries respectively, Fernández-Baca
et al., 1973, 1979; llama: 100%, Sumar, 1988). When ovu-
lation occurs in the right ovary, the embryo must probably
migrate from the right uterine horn to the left to be able to
conduct MRP (Sumar and Leyva, 1979). These observations
allow us to hypothesize that the success of ET could depend
on the site where the embryo is deposited in the uterus.
To date, the poor pregnancy rates obtained using tran-
scervical ET are attributed to a high release of prostaglandin
because of cervix manipulation, a weak signal from the
embryo or a deficient embryo migration. In mares, the
cervical threading involved in ET produces an increase in
endometrial PGF2␣ release, thus compromising CL viability
(Kask et al., 1997) but this has not yet been studied in SAC.
Therefore, the aim of the present study was to evaluate
the effect of uterine handling during ET on plasma proges-
terone concentrations in recipient Lama glama females and
the relationship between the place the embryo is deposited
and CL localization, to improve the pregnancy rates using
ET.
2. Materials and methods
2.1. Animals
Non-pregnant, non-lactating female llamas (n = 70)
ranging between 4 and 8 years of age and with an average
 V. Trasorras et al. / Animal Reproduction Science 121 (2010) 279–285
body weight of 120 ± 22 kg were used in this study. Females
were kept separated from males during the experiment
and fed bales of hay and water ad libitum. The study was
conducted at the Faculty of Veterinary Sciences of the Uni-
versity of Buenos Aires, Buenos Aires, Argentina, situated
34◦ 36 S and 58◦ 26 W, at sea level.
2.2. Ultrasonographic evaluation of ovarian dynamics
and induction of ovulation
Ovarian dynamics was monitored by transrectal pal-
pation and ultrasonography (Berger LC 2010 plus with
a 5 MHz linear-array electronic transducer, Buenos Aires,
Argentina). When a dominant follicle (≥7 mm in diam-
eter) was detected, a single dose of 8 ␮g of buserelin
(GnRH synthetic analogue, Receptal® , Intervet, Buenos
Aires, Argentina) was administered IV (day 0) for inducing
ovulation. Ovulation was confirmed on Day 2 using tran-
srectal ultrasonography based on the disappearance of the
dominant follicle and observation of a CL on Day 5.
2.3. Hormone assay
Corpus luteum activity was evaluated in all groups
by measuring plasma progesterone concentrations using
radioimmunoassay (RIA). Blood samples were obtained by
jugular venipuncture using heparin as the anticoagulant.
The moment of extraction varied according to the exper-
iment. Blood samples were immediately centrifuged at
3000 rpm for 20 min and the plasma separated and kept
at −20 ◦ C in plastic 5 ml tubes (Polistor® , Buenos Aires,
Argentina) until analysis.
Progesterone was measured using a RIA kit (Diagnostic
Products Corporation, Los Angeles, CA, USA) validated for
use in llama plasma (Bianchi et al., 2007). The sensitivity of
the assay was 0.3 nmol l−1 and the intra-assay coefficient
of variation was below 9% for concentrations between 0.4
and 128 nmol l−1 . All samples were measured in duplicates
and in one single assay for each experiment.
2.4. Experimental procedure
2.4.1. Experiment I
The objective of this experiment was to evaluate the
effect of transcervical threading on the viability of the CL.
Females were randomly separated into two groups: control
group (n = 10) and group A (n = 10). In both groups, CL activ-
ity after induction of ovulation was evaluated by measuring
plasma progesterone concentrations. In the control group,
females were not subject to any procedure. In group A, the
maneuver of threading the cervix was conducted on Day
6 after inducing ovulation to determine if plasma proges-
terone concentrations decrease because of PGF2␣ release
during the process. The maneuvers were conducted with
the female either standing or in sternal recumbency. The
animal was restrained in stocks, the tail was wrapped and
the rectum was emptied of feces. The perineum was then
scrubbed using an iodine solution, rinsed carefully with
clean water and then dried. A lubricated gloved hand was
inserted in the rectum to hold the cervix while an assistant
separated the vulva labia and an artificial insemination (AI)
281
pipette, covered with a sterile sheath, was inserted into the
vagina. Cervical threading was performed through tran-
srectal manipulation. Blood samples were obtained once
daily from both groups between Day −2 and 10 (Day 0:
induction of ovulation using buserelin).
2.4.2. Experiment II
The objective of experiment II was to evaluate the effect
of depositing PBS in different sites in the uterus in rela-
tion to CL localization and its relationship to CL lifespan.
Females were randomly divided into five treatment groups
(n = 10) and one control group (n = 6). Treatment groups
were assigned as follows: group ‘Left-Ipsilateral’: transcer-
vical placing of PBS in the left uterine horn (CL in left
ovary); group ‘Left-Contralateral’: transcervical placing of
PBS in the left uterine horn (CL in right ovary); group
‘Right-Ipsilateral’: transcervical placing of PBS in the right
uterine horn (CL in right ovary); group ‘Body-Left’: tran-
scervical placing of PBS in the uterine body (CL in left
ovary); group ‘Body-Right’: transcervical placing of PBS in
the uterine body (CL in right ovary). Ovulation was induced
in all groups (treatment and control). On Day 6 after induc-
ing ovulation in treatment groups 0.25 ml of sterile D-PBS
(Gibco® , Grand Island, NY, USA) was deposited in the cor-
responding uterine site using an ET pipette. Control group
females were not subject to any ET procedure. Blood sam-
ples were obtained once daily in all groups from Day 5 to
12 after induction of ovulation with buserelin.
2.4.3. Experiment III
The objective of this experiment was to evaluate
whether embryo transfer to different sites in the uterus
affects CL viability.
2.4.3.1. Treatment of donor llamas. The ovarian dynamics
of all donor females (n = 22) was examined by transrec-
tal ultrasonography and the absence of follicles bigger
than 5 mm was confirmed before beginning the treatment.
A single IM dose (1000 IU) of eCG (Novormon® , Syntex,
Buenos Aires, Argentina) was administered (Trasorras et
al., 2009) to stimulate multiple follicle growth. Daily ultra-
sonographic examinations of the ovaries were continued
until two or more dominant follicles were found and at
that moment, donor females were mated twice, 24 h apart
to increase the number of available spermatozoa, using dif-
ferent fertile L. glama males to minimize the male effect. In
addition, ovulation was assured in all donor llamas with a
single IV dose of 8 ␮g of buserelin after the first mating.
2.4.3.2. Treatment of recipient llamas. Synchronization of
recipient–donor females using a single dose of buserelin
in the presence of a dominant follicle was conducted 2
days after inducing ovulation in the donor female. Recip-
ient females (n = 50) were divided into five groups (n = 10
per group) according to the place in the uterus where the ET
was carried out and the ovary where ovulation occurred:
group ‘Left-Ipsilateral’: ET in the left uterine horn (CL in
left ovary); group ‘Left-Contralateral’: ET in the left uter-
ine horn (CL in right ovary); group ‘Right-Ipsilateral’: ET
in the right uterine horn (CL in right ovary); group ‘Body-
Left’: ET in the uterine body (CL in left ovary) and group
282 V. Trasorras et al. / Animal Reproduction Science 121 (2010) 279–285

‘Body-Right’: ET in the uterine body (CL in right ovary).

Transcervical ET was performed on Day 6 after buserelin
administration (coinciding with the day of uterine flushing
of the donor female).
Blood samples were obtained once daily in all groups
from Day 5 to 12 after inducing ovulation with buserelin.
A progesterone profile, belonging to non-pregnant, non-
embryo transferred females (n = 6) was used (reference
profile) for comparison to the other groups.

2.4.3.3. Embryo recovery and transfer. The uterus of the

22 mated donor llamas were transcervically flushed for Fig. 1. Mean plasma progesterone concentrations in control group and
embryo recovery 8 days after the first mating. Aggressive group A (cervical threading). Arrows represent treatment days: Day
females received 0.2 mg/kg xylazine IV (Rompun® , Bayer, 0: buserelin; Day 6: cervical threading maneuver. Values represent
Buenos Aires, Argentina) before flushing. Collection was means ± SE.

conducted using a Foley catheter (12 or 16 Fr, according

to female size) and a stylet was inserted into the catheter
to keep it from bending during recto-vaginal manipulation.
Uterine flushing was done by placing the catheter cuff 1 cm
cranial to the internal cervical os and inflating it with 5
or 10 ml of air (according to catheter gauge). The uterus
was flushed 4–5 times with D-PBS supplemented with 1%
fetal calf serum (FCS), using a total volume of 500 ml. After
the flushing was finished, donor females received a single
IM dose of 250 ␮g of cloprostenol (Estrumate® , Schering-
Plough, Germany) to cause the lysis of all CLs in both
ovaries.
Embryos recovered were graded according to Tibary and
Anouassi (1997) and only grades I and II were used, consid-
ering grade I: excellent quality embryo, size corresponds
to the stage of collection in relation to ovulation; before
Day 8 should be perfectly spherical with smooth surface;
and grade II: good embryo, same as grade I with some
irregularities of the contour and very few protruded cells.
These embryos were aspirated individually into 0.25 ml
straws (IMV® ET Straws, France), which were loaded into a
sheathed bovine/equine embryo transfer pipette (IMV® ET
Sheath, 21 , France). Then, embryos were transcervically
transferred into the uterus of the recipient llamas belong-
ing to each group.
2.4.3.4. Pregnancy diagnosis. Pregnancy diagnosis was
performed 13 days after the transfer by transrectal ultra-
sonographical visualization of the embryo vesicle and 3
days later viability was confirmed by observing the heart-
beat.
3. Results
3.1. Experiment I
Plasma progesterone concentrations in group A (with
cervical threading) and in control group (without cervical
threading) were similar throughout the evaluation period
(Day −2 to 10 after buserelin), showing no significant dif-
ferences between groups (P > 0.05) (Fig. 1).
3.2. Experiment II
When evaluating the effect of depositing PBS in dif-
ferent sites of the uterus and its relationship to the
localization of the CL, no significant differences were found
between the mean plasma progesterone concentrations
from groups ‘Left-Ipsilateral’, ‘Left-Contralateral’, ‘Right-
Ipsilateral’, ‘Body-Left’, ‘Body-Right’ and the control group
(P > 0.05) (Fig. 2).
3.3. Experiment III
After administration of 1000 IU of eCG, multiple folli-
cle growth required 5–7 days to reach dominant size. A
total of 67 embryos were recovered from the 22 llamas that
were flushed (recovery from each female was 3.04 ± 0.11
embryos, mean ± SE). Embryo size ranged from 0.3 to
1.2 mm in diameter and all of them were in the hatched

2.5. Data analysis

In experiment I, plasma progesterone concentrations

from group A (with cervical threading) and control
group (without cervical threading) were analyzed using
a Student’s t test for comparing the means of each
group. In experiment II, ANOVA was used to evaluate
the means of groups ‘Left-Ipsilateral’, ‘Left-Contralateral’,
‘Right-Ipsitlateral’, ‘Body-Left’, ‘Body-Right’ and control
group. In experiment III, a chi-square test was performed Fig. 2. Mean plasma progesterone concentrations in group ‘Left-
Ipsilateral’, group ‘Left-Contralateral’, group ‘Right-Ipsilateral’, group
to compare pregnancy results. Statistical significance was
‘Body-Left’, group ‘Body-Right’ and control group. Day 6 after buserelin
set at P ≤ 0.05 and the statistical package used to analyze administration: PBS was deposited in the uterine site according to each
the data was InfoStat. group. Values correspond to means ± SE.
 V. Trasorras et al. / Animal Reproduction Science 121 (2010) 279–285 283

Fig. 3. Mean plasma progesterone concentration in non-pregnant and pregnant females from each ET group and non-transferred females (reference profile).
Values are means ± SE.

blastocyst stage (some embryos could be visualized with-
out optical instruments). This difference in embryo size is
probably due to the wide variability in occurrence of ovu-
lations in superstimulated animals.
When comparing the pregnancy rates in the dif-
ferent groups no significant differences were detected
(P = 0.4728). Nevertheless, the ‘Left-Ipsilateral’ group
showed the highest pregnancy rate. The mean plasma pro-
gesterone concentrations in non-pregnant and pregnant
females of each ET group and those of the reference pro-
file are presented in Fig. 3. Data for pregnancy rates are
shown in Table 1. In non-pregnant females, a decrease
in plasma progesterone concentrations was observed by
the time MRP was expected to occur in pregnant animals
(between days 8 and 10) (Fig. 4).
4. Discussion
To our knowledge this is the first comprehensive study
addressing the issue of the ET technique with regard to CL
viability in this species. The results hereby presented indi-
cate that stimulation of the cervix during threading did not
produce a decrease in plasma progesterone concentrations,
as reflected by the lack of significant differences between

Table 1
Pregnancy rates in different groups according to ET in relationship to CL location.

Groups Left-Ipsilateral Left-Contralateral Right-Ipsilateral Body-Left Body-Right

Pregnancy rate % (pregnant females/n) 50 (5/10) 20 (2/10) 30 (3/10) 10 (1/10) 10 (1/10)

284 V. Trasorras et al. / Animal Reproduction Science 121 (2010) 279–285
Fig. 4. Mean plasma progesterone concentrations in non-pregnant
and pregnant females from all ET groups (group ‘Left-Ipsilateral’,
‘Left-Contralateral’, ‘Right-Ipsilateral’, ‘Body-Left’ and ‘Body-Right’) and
non-transferred females (reference profile). Values are means ± SE.
the control group (without cervix manipulation) and group
A (cervical threading). This observation is consistent with
results obtained in dromedaries (Skidmore et al., 2002).
Although these authors observed a short-lived increase in
PGF2␣ produced during the passage of the ET pipette, this
was not enough to harm the CL function or the pregnancy.
They suggest that the PGF2␣ release is either too short or
the amount is insufficient.
Likewise, it was observed in the present study
that cervical threading together with transfer of ster-
ile PBS to simulate the complete ET maneuver, did
not alter plasma progesterone concentrations in any of
the groups (‘Left-Ipsilateral’, ‘Left-Contralateral’, ‘Right-
Ipsilateral’, ‘Body-Left’ and ‘Body-Right’) when compared
to the control. Contrary to what occurs in the mare, where
inflammatory changes in the endometrium produce early
PG release (Koblischke et al., 2008), none of the females
in this experiment showed signs of inflammatory early
release of PG after depositing PBS in the uterus, as the
decrease in progesterone concentrations were similar to
the control group (see Fig. 2). Therefore, it can be concluded
that the ET technique as a whole (cervix manipulation and
deposit of fluid in the uterus) is not responsible for the
embryo loss occurring after transfer.
Estimates are that more than 50% of embryo loss occurs
during the first month of gestation (Fernández-Baca et al.,
1970) and this loss increases to 60–80% in the first 90 days
(Alarcón et al., 1990) but the origin of these losses remains
unknown. A possible cause for these losses is the failure of
the right uterine horn to maintain pregnancy. In our study,
the highest ET results were obtained when the embryo was
deposited in the left uterine horn in the presence of a CL in
the ipsilateral ovary (50%). Depositing the embryo in the
left horn is the only case where the embryo does not need
to migrate to carry out MRP. Nevertheless, despite deposit-
ing the embryo in the supposedly ideal uterine location,
pregnancy rate is not as great as expected, therefore, there
would seem to be some other factor/s responsible for low
embryo viability (for example, embryo defects, chromo-
some abnormalities, gamete ageing, etc.). Pregnancy rate
decreases even more in the rest of the groups, where the
embryo had to somehow get a signal to the other horn to
maintain CL viability.
In group ‘Left-Contralateral’ 20% of the females were
pregnant. This case never happens physiologically, perhaps
embryos carried out MRP in the left uterine horn where
they were deposited and then probably had to get a sig-
nal to the right horn. One possibility is migrating to the
right uterine horn to inhibit endometrial PGF2␣ release
locally and then return to the left uterine horn or elongat-
ing to establish pregnancy. In the dromedary it has been
suggested that migration is facilitated by the shortness of
the uterine body, the smallness of the right horn and the
increased number of mucosal folds in the endometrium of
the right horn (Musa, 1979). The time frame for this migra-
tion is short because camelid embryos have a rapid rate of
growth and rapidly start elongating (after day 9) and the
uterus has a decreased tone and no contractions (Tibary
and Anouassi, 1997). If migration is the way MRP is per-
formed, perhaps the lesser pregnancy rate in this group is
due to the fact that this double migration is not possible
because the morphological changes of the embryo hinder
it.
In group ‘Right-Ipsilateral’ 30% of the females were
pregnant. In this case, embryos had to migrate from the
right uterine horn to the left one to establish pregnancy.
This is physiologically normal because around 50.4% of
pregnancies are supported by a right CL (Fernández-Baca
et al., 1973, 1979). Tibary and Anouassi (1997) reported
results from embryo transfer experiments showing that
pregnancy is maintained with equal frequency whether
the recipient has a CL in the left or right ovary. They
also observed that when embryos were deposited in the
right uterine horn, they migrated to the left one after a
few days and at ultrasound visualization on Days 15–18
post-breeding, all embryos were located in the left uter-
ine horn. In the present study the ‘Right-Ipsilateral’ group
was expected to have similar results to the ‘Left-Ipsilateral’
(50% pregnancy rate) but this was not the case, although
the number of animals in the study does not allow further
conclusions.
The 10% pregnancy obtained in both groups where
ET was performed in the uterine body was unex-
pected. Considering all the previous discussion, the
percentage should have been higher in the “Body-Left”
group than the in the “Body-Right” group. Perhaps
proximity to the recently dilated cervix when the
embryos were deposited in the very short uterine body
favors embryo loss through the cervix before MRP can
occur.
Plasma progesterone concentrations in non-pregnant
females after ET were similar to that observed in females
belonging to the reference profile group, decreasing
between Days 8 and 10 after inducing ovulation; a similar
decrease was observed in some of the groups of pregnant
females (see Figs. 3 and 4). This coincides with the results
obtained by Aba et al. (1995), where pregnant females show
a slight decrease in plasma progesterone concentrations
between Days 8 and 18 but then recover and maintain sta-
ble levels. This transitory fall in progesterone, which starts
at the same time as that observed in non-pregnant females,
would seem to indicate the presence of some factor that
inhibits luteolysis. Therefore MRP is a critical period that
determines the continuity or not of gestation. It is neces-
sary to further investigate the factor/s that allows embryos
to continue their development.
 V. Trasorras et al. / Animal Reproduction Science 121 (2010) 279–285
5. Conclusions
To our knowledge this is the first study to demonstrate
that threading the cervix and transcervical placing of PBS
in either the uterine horns or uterine body did not decrease
plasma progesterone concentrations in llamas. Therefore,
the different ET maneuvers do not interfere with CL via-
bility. To improve pregnancy rates it would seem that ET
in the left uterine horn with an ipsilateral CL, is the most
desirable option.
Acknowledgements
This research was supported by grants from the Uni-
versity of Buenos Aires (UBACyT V018) and the Agencia
Nacional de Promoción Científica y Tecnológica (PICT 2003-
08-14231). The authors thank Ignacio Videla Dorna from
Syntex Laboratories for donating the Novormon® for this
study.
References
Aba, M.A., Forsberg, M., Kindhal, H., Sumar, J., Edqvist, L.E., 1995. Endocrine
changes after mating in pregnant and non-pregnant llamas and
alpacas. Acta Vet. Scand. 36, 489–498.
Aba, M.A., Kindhal, H., Forsberg, M., Quiroga, M., Auza, N., 2000. Levels of
progesterone and changes in prostaglandin F2␣ release during luteol-
ysis and early pregnancy in llamas and the effect of treatment with
flunixin meglumine. Anim. Reprod. Sci. 59 (1–2), 87–97.
Alarcón, V., Sumar, J., Riera, G.S., Foote, W.C., 1990. Comparison of three
methods of pregnancy diagnosis in alpacas and llamas. Theriogenol-
ogy 34, 1119–1127.
Allen, W.R., 2005. The development and application of the modern repro-
ductive technologies to horse breeding. Reprod. Domest. Anim. 40,
310–329.
Aller, J.F., Rebuffi, G.E., Cancino, A.K., Alberio, R.H., 2002. Successful transfer
of vitrified llama (Lama glama) embryos. Anim. Reprod. Sci. 73 (1–2),
121–127.
Bianchi, C.P., Meikle, A., Sartore, I., González, F., Aba, M.A., 2007. Uter-
ine estrogen receptor alpha and progesterone receptor during the
follicular and luteal phase in llamas. Anim. Reprod. Sci. 99, 117–126.
Bourke, D.A., Adam, C.L., Kyle, C.E., Young, P., McEvoy, T.G., 1992. Super-
ovulation and embryo transfer in the llama. In: Allen, W.R., Higgins,
A.J., Maythew, I.G., Snow, D., Wade, J.F. (Eds.), Proceedings of the First
International Camel Conference on R&W. Publications Newmarket
Ltd, pp. 183–185.
Del Campo, M.R., Del Campo, C.H., Ginther, O.J., 1996. Vascular provisions
for a local utero-ovarian cross-over pathway in New World Camelids.
Theriogenology 46, 983–991.
Fernández-Baca, S., Hansel, W., Novoa, C., 1970. Embryonic mortality in
the alpaca. Biol. Reprod. 3, 243–251.
Fernández-Baca, S., Hansel, W., Saatman, R., Sumar, J., Novoa, C., 1979. Dif-
ferential luteolytic effects of right and left uterine horns in the alpaca.
Biol. Reprod. 20, 586–595.
285
Fernández-Baca, S., Sumar, J., Novoa, C., Leyva, V., 1973. Relación
entre la ubicación del cuerpo lúteo y la localización del
embrión en la alpaca. Revista de Investigaciones Pecuarias 2,
131–135.
Giuliano, S., Agüero, A., Spirito, S., Chaves, G., Boquet, M., Rutter, B., Fer-
rari, M., 2000. Heat stress effect on sperm morphology in Lama glama.
Biocell 24, 265.
Giuliano, S., Director, A., Gambarotta, M., Trasorras, V., Miragaya, M.,
2008. Collection method, season and individual variation on semi-
nal characteristics in the llama (Lama glama). Anim. Reprod. Sci. 104,
359–369.
Hasler, J.F., 2003. The current status and future of commercial embryo
transfer in cattle. Anim. Reprod. Sci. 79, 245–264.
Johnson, L.W., 1989. Llama reproduction. In: Johnson, L.W. (Ed.), The Vet-
erinary Clinics of North America, Llama Medicine. WB Saunders Co.,
Philadelphia, pp. 159–182.
Kask, K., Odensvik, K., Kindahl, H., 1997. Prostaglandin F2 alpha release
associated with an embryo transfer procedure in the mare. Equine
Vet. J. 29, 286–289.
Koblischke, P., Kindahl, H., Budik, S., Aurich, J., Palm, F., Walter, I.,
Kolodziejek, J., Nowotny, N., Hoppen, H.O., Aurich, C., 2008. Embryo
transfer induces a subclinical endometritis in recipient mares which
can be prevented by treatment with non-steroid anti-inflammatory
drugs. Theriogenology 70, 1147–1158.
Leon, J.B., Smith, B.B., Timm, K.I., LeCren, G., 1990. Endocrine changes dur-
ing pregnancy, parturition and the early post-partum period in the
llama (Lama glama). J. Reprod. Fertil. 88, 503–511.
Miragaya, M.H., Chaves, M.G., Agüero, A., 2006. Reproductive biotehnol-
ogy in South American camelids. Small Ruminant Res. 61,
299–310.
Musa, B.E., 1979. Reproductive patterns in the female camel (Camelus
dromedarius). In: Workshop in Camels, Karthoum, Sudan. Intl. Fnd.
For. Sci., pp. 279–284.
Skidmore, J.A., Billah, M., Allen, W.R., 2002. Investigation of factors
affecting pregnancy rate after embryo transfer in dromedary camels.
Reprod. Fertil. Dev. 14, 109–116.
Sumar, J., 1988. Removal of the ovaries or ablation of the corpus luteum
and its effect on the maintenance of gestation in the alpaca and llama.
Acta Vet. Scand. Suppl. 83, 133–141.
Sumar, J., Leyva, V., 1979. Relación entre la ubicación del cuerpo lúteo y
la localización del embrión en la llama (Lama glama). Res. Proyec-
tos Investigación, Univ. Nacional Mayor de San Marcos, Período
1975–1979, Lima, p. 124.
Taylor, S., Taylor, P.J., James, A.N., Godke, R.A., 2000. Successful commer-
cial embryo transfer in the llama (Lama glama). Theriogenology 53,
344.
Tibary, A., Anouassi, A., 1997. Theriogenology in camelidae. Anatomy,
physiology, pathology and artificial breeding. In: Actes Éditions, Insti-
tut Agronomique et Vetérinaire Hassan II (Maroc) (Eds.), Reproductive
Physiology in Female Camelidae. Abu Dhabi Printing and Publish-
ing Company Institut Agronomique et Vetérinaire Hassan II (Maroc),
United Arab Emirates, p. 438.
Tibary, A., Anouassi, A., Khatir, H., 2005. Update on reproductive
biotechnologies in small ruminants and camelids. Theriogenology 64,
618–638.
Trasorras, V.L., Chaves, M.G., Miragaya, M.H., Pinto, M., Rutter, B., Flores,
M., Agüero, A., 2009. Effect of eCG superstimulation and buserelin on
cumulus-oocyte complexes recovery and maturation in llamas (Lama
glama). Reprod. Domest. Anim. 44 (3), 359–364.
 Animal Reproduction Science 121 (2010) 286–293

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Differential expression of estrogen receptor alpha gene in the ampullae

and isthmus regions of the rabbit oviduct during early pregnancy
Noemi Baranda-Avila a , M. Enrique Cardoso-Rangel b , Marco Cerbón a,∗ ,
Ignacio Camacho-Arroyo a , C. Adriana Mendoza-Rodríguez a ,
Héctor Villaseñor-Gaona b , Santiago R. Anzaldúa-Arce b
a
Facultad de Química, Departamento de Biología, Universidad Nacional Autónoma de México, D.F., Mexico
b
Facultad de Medicina Veterinaria y Zootecnia, Departamento de Morfología, Universidad Nacional Autónoma de México, D.F., Mexico

a r t i c l e i n f o a b s t r a c t

Article history: We characterized the expression pattern of estrogen receptor ␣ (ER␣) gene in two regions
Received 26 March 2010 of the oviduct, ampullae and isthmus, of the rabbit (Oryctolagus cuniculus) during early
Received in revised form 11 June 2010
pregnancy (1–4 days) by RT-PCR and immunohistochemistry. In both regions of the oviduct,
Accepted 5 July 2010
ER␣ mRNA was increased (P < 0.01) in pregnant rabbits as compared with non-pregnant
Available online 13 July 2010
animals (NG). In the ampullae, the greatest amount of ER␣ mRNA was detected on the
third day of pregnancy (1.01 ± 0.02 relative amount), followed by a decrease on Day 4. In the
Keywords:
isthmus, an increase in ER␣ mRNA was observed during the first 4 days of pregnancy, with
Oviduct
Estrogen receptor ␣ the greatest amount on Day 3 (1.49 ± 0.3 relative amount). A marked ER␣ immunostaining
Rabbit was detected in epithelial, stromal and smooth muscle cells of the ampullae on the second
Early pregnancy and third days of pregnancy as compared with the NG group. In contrast, a significant
increase in ER␣ immunostaining was observed on the first and second days of pregnancy
with a reduction on the third and fourth days in the epithelial, stromal and smooth muscle
cells of the isthmus. The overall results suggest there is differential expression pattern for
the ER␣ gene in the ampullae and isthmus during early pregnancy of the rabbit, and that
these variations are related to specific functions of ER␣ in the reproductive tract during
early pregnancy.
© 2010 Elsevier B.V. All rights reserved.

1. Introduction
The mammalian oviduct is a key tissue in rabbit repro-
duction because it is involved in the transport and stability
of sperm, fertilization and early embryo development
(Hamner, 1973; Pauerstein and Eddy, 1979; Roblero and
Garavagno, 1979; Killian, 2004). The rabbit oviduct is a
coiled structure composed of four different regions, each
with different functions: infundibulum (INF), ampullae
∗ Corresponding author at: Facultad de Química, Universidad Nacional
Autónoma de México, Ciudad Universitaria, Coyoacán 04510, México, D.F.,
Mexico. Tel.: +52 55 5622 3820; fax: +52 55 5622 3820.
E-mail address: mcerbon85@yahoo.com.mx (M. Cerbón).
(AMP), isthmus (IST) and uterotubal junction (UTJ). The UTJ
provides a barrier to infectious microbes that might enter
the oviduct from the uterus. It also regulates sperm entry to
the oviduct. The IST serves as a sperm storage organ and the
AMP provides an environment conducive to fertilization
and early embryonic development. The INF is responsible
for picking up the oocyte cumulus complex following ovu-
lation and moving it into the AMP where the fertilization
occurs (Harper, 1994; Talbot et al., 1999; Suarez, 2008). The
oviduct has at least three types of cells: epithelial, stromal
and smooth muscle cells. Selective modifications in the his-
tomorphology of the rabbit oviduct during early pregnancy
have been reported (Anzaldúa et al., 2002).
Estrogens participate in the regulation of the struc-
ture and function of the oviduct. Estrogen actions in target

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.07.003
 N. Baranda-Avila et al. / Animal Reproduction Science 121 (2010) 286–293
tissues are mainly mediated by its interaction with the two
intracellular estrogen receptor (ER) subtypes, denoted ER␣
and ER␤ (Nilsson et al., 2001; Diel, 2002; Edwards, 2005).
Both ERs are widely distributed throughout different tis-
sues with a distinct gene expression pattern in a variety
of tissues. In the oviduct of rats, mice and rabbits, ER␣ is
the predominant subtype (Saunders et al., 1997; Mowa and
Iwanaga, 2000a,b; Couse et al., 1997; Sar and Welsch, 1999;
Jefferson et al., 2000). Evaluation of the gene expression
and localization of ER␣ is fundamental for understanding
estrogen functions in reproductive tissues. In the uterus
and vagina, ER␣ gene expression during pregnancy has
been well documented (Iwai et al., 1991; Hegele-Hartung
et al., 1992; Spencer and Bazer, 1995; Murata et al., 2003;
Asakawa et al., 2008). However, the expression and regula-
tion of this receptor gene in the oviduct of mammals have
been scarcely studied.
ER␣ gene regulation is under tissue-specific hormonal
control, e.g., in most mammals, cyclical estradiol (E2 ) con-
centrations regulate ER␣ gene expression in the uterus
and oviduct (Nephew et al., 2000; Slayden and Brenner,
2004; Bläuer et al., 2005). Previous studies have reported
the nuclear expression of ER␣ gene in epithelial, stromal
and smooth muscle cells of the rat oviduct (Pelletier et al.,
2000). During pregnancy, ER␣ immunostaining increases
in all cell types of all the rat oviduct regions (Okada
et al., 2003) and the administration of E2 increases the
immunoreactivity of ER␣ in the AMP and the IST of preg-
nant rats (Orihuela et al., 2009).
In the rabbit, interactions of E2 with different segments
of the oviduct during early pregnancy have been analyzed
by hormonal binding assays. The amount of nuclear binding
in the IST reaches its maximum at 48 h post-coitum (p.c.),
whereas in the AMP it is detected at 72 h p.c. (El-Banna
and Sacher, 1977; Puri and Roy, 1981). ER␣ gene expres-
sion has been described in both the AMP and the IST of the
oviduct and in the uterus of pseudopregnant rabbits. ER␣
gene expression was increased in the AMP and myosalpinx
of the IST with a decrease in the uterus (Karbowski et al.,
1992). However, the expression and anatomical distribu-
tion of ER␣ gene expression during early pregnancy before
implantation (1–4 days) in the oviduct of the rabbit has not
been described. To contribute to the understanding of the
molecular mechanisms involved in E2 actions during the
pre-implantation period in the oviduct, we investigated the
expression pattern of the ER␣ gene in the AMP and the IST
of the oviduct of rabbits during the first 4 days of pregnancy.
2. Materials and methods
2.1. Animals
Fifteen adult virgin female New Zealand white rabbits
(Oryctolagus cuniculus) (Harlan, Mexico) (3.5–4.5 kg) were
used throughout the study. Animals were housed in indi-
vidual cages with controlled temperature (23 ± 2◦ C) under
a 12:12 h light:dark cycle with food and water available ad
libitum. A group of animals (n = 12) was mated twice on the
same day with two experienced bucks. The day of mating
was designated as Day 0. Non-pregnant animals (NG) (n = 3)
were used as controls. Animals were euthanized by i.v. pen-
287
tobarbital injection (90 mg/kg) after deep anesthesia with
ketamine (Rhóne, Mérieux, Qro. México) on Days 1–4 of
pregnancy. Pregnancy was confirmed by the observation
of zygotes and morula under a stereoscopic microscope
after washing the oviduct with PBS. The experiments were
conducted following the Mexican Law for the Protection of
Animals (México), and NOM-062-200-1999 (Aluja, 2002).
2.2. Total RNA extraction and RT-PCR
Total RNA was isolated from two regions of the oviduct,
AMP and IST, with the single-step method based on guani-
dine isothiocyanate/phenol/chloroform extraction using
TRIzol reagent (Gibco-BRL, Inc.) (Chomczynski and Sacchi,
1987). RNA concentration was determined by absorbance
at 260 nm and its integrity was verified by electrophore-
sis on 1.1% denaturing agarose gels in the presence of
2.2 M formaldehyde. Total RNA was reverse transcribed to
synthesize single strand cDNA. Briefly, 4 ␮g of total RNA
were incubated at 37 ◦ C for 1 h with 800 units of M-ML
reverse transcriptase (Gibco-BRL, Inc.) in 20 ␮L reaction
volume containing 50 mM Tris–HCl (pH 8.3), 75 mM KCl,
3 mM MgCl2 , 10 mM DTT, 0.5 mM for each dNP and 2.5 ␮M
oligo d-T (Gibco-BRL, Inc.) (Camacho-Arroyo et al., 1996).
Ten microliters of reverse transcriptase (RT) reaction were
subjected to PCR to simultaneously amplify ER␣ and glyc-
eraldehyde 3-phosphate dehydrogenase (GAPDH) gene
which was used as an internal control. The sequences of the
specific primers for ER␣ amplification segment (from +151
to +304 relative to the start site of transcription of exon 1)
(Kaluz et al., 1997) were 5 -[GCGTATGAGTTCAACGCCG]-3
in the sense primer and 5 -[GGCTCGGAGACACGCTGTT]-3
in the antisense. The PCR reaction (50 ␮L) included 10 ␮L
of previously synthesized cDNA, 20 mM Tris–HCl (pH 8.3),
50 mM KCl, 1 mM MgCl2 , 0.2 mM of each dNTP, 0.5 ␮M of
each primer, and 2.5 units of Taq DNA polymerase. Negative
controls without RNA and with non-retrotranscribed RNA
were included in all experiments. After an initial denatu-
ration step at 95 ◦ C for 5 min, PCR reaction was performed
for 25 cycles. The cycle profile for ER␣ and GAPDH genes
amplification was: 95 ◦ C, 1 min; 60 ◦ C, 1 min; 72 ◦ C, 1 min.
A final extension cycle was performed at 72 ◦ C for 5 min.
The number of cycles, was within the exponential phase of
the amplification process. All PCR products were studied
and analyzed together throughout the experiments. PCR
products (25 ␮L) were separated on 2% agarose gel and
stained with ethidium bromide. The image was captured
under a UV transilluminator with Type 665 negative films
(Polaroid Co., Cambridge, MA, USA). The intensity of ER␣
or GAPDH bands was quantified by densitometry using a
Scanjet 3C apparatus (Hewlett Packard). Amount of ER␣
gene expression was normalized to that of GAPDH.
2.3. Immunohistochemistry
The endometrium, AMP and the IST of the rabbit were
immediately dissected and fixed in 15% picric acid and
4% paraformaldehyde in phosphate buffer saline (PBS) for
8 h. Tissues were dehydrated through a series of increasing
ethanol concentrations and finally cleared with xylene. Tis-
sues were then embedded in paraplast (OxfordLabware, St.
288 N. Baranda-Avila et al. / Animal Reproduction Science 121 (2010) 286–293

Louis, MO). Serial tissue sections were cut at 5 ␮M thickness

and mounted on poly-l-lysine (Sigma) coated slides. Slides
were deparaffinized, rehydrated through graded concen-
trations of alcohol to distilled water, transferred to sodium
citrate buffer (pH 6.0), and heated two times for 10 min
in a microwave oven set at 800 W. Slides were cooled
between microwave irradiation for 5 min. After this pro-
cedure, slides were washed twice with 10 mM PBS, pH
7.4. Endogenous peroxidase was blocked by incubation
with 3% hydrogen peroxide in PBS for 30 min. After rins-
ing in PBS, slides were incubated in 0.5% Triton X-100,
and non-specific immunoglobulin binding was blocked by
incubating sections in 5% BSA for 30 min. Sections were
incubated overnight with monoclonal primary antibody
against ER␣ at a 1:100 dilution (6F11; Novocastra Labo-
ratories Ltd, Newcastle upon Tyne, UK) in a humidified
chamber at 4 ◦ C. For negative control, primary antibody was
omitted. After washing with PBS, sections were incubated
for 2 h at room temperature with biotin-conjugated goat
anti-rabbit IgG antibody (Santa Cruz Biotechnology, Inc.,
Santa Cruz, CA) at a 1:100 dilution and then washed with
PBS to remove unbound secondary antibody, and incubated
for 1 h at room temperature in peroxidase-conjugated
avidin–biotin reagent (Santa Cruz Biotechnology, Inc.,
Santa Cruz, CA). The slides were washed with PBS, devel-
oped with DAB substrate, and counterstained with Mayer’s
hematoxylin.
The number of immunopositive nuclei and staining
intensity in the epithelium and stroma were determined
using Metamorph Imaging System (Westchester, PA, USA).
All the nuclei from the epithelium, stoma and smooth mus- Fig. 1. Densitometric analysis of ER␣ mRNA gene expression in the
cle were analyzed in each section. Three sections by animal ampullae and isthmus of the rabbit oviduct during early pregnancy. RT-
(n = 3 animals per day of pregnancy) were analyzed. The PCR was performed using total RNA isolated from (A) ampullae and (B)
staining intensity of the cell nuclei was assigned the follow- isthmus of non-pregnant rabbits (NG) and the first 4 days of the preg-
nancy (D-1 to D-4). ER␣ gene expression was corrected for that of GAPDH.
ing scores: 0, absent; 1, weak; 2, moderate and 3, intense.
Results are expressed as the mean ± SEM (n = 3). In (A) *P < 0.01 compared
The histologic score (HSCORE) was calculated as follows: to all other groups, **P < 0.05 compared to all other groups, ***P < 0.05
HSCORE = ˙Pi (i + 1), where i = 1, 2 or 3, and Pi is the per- compared with D-1 and D-2. In (B) *P < 0.01 compared to all other groups.
centage of each intensity, from 0 to 100% (Lessey et al.,
1988). of pregnancy with a reduction in ER␣ gene expression on
the fourth day (0.75 ± 0.04 relative amount) (Fig. 1A). In the
2.4. Statistical analysis IST, relative amount of ER␣ mRNA was increased (P < 0.01)
during the first 4 days of pregnancy as compared with NG
RT-PCR and immunohistochemistry data were analyzed rabbits. The greatest amounts of ER␣ gene expression were
using one-way analysis of variance (ANOVA) followed by detected on the third day (1.49 ± 0.3 relative expression)
Student–Newman–Keuls or Tukey’s multiple comparison and were maintained until the fourth day of pregnancy
test, respectively. The Prism 2.01 program (Graph Pad, San (1.2 ± 0.4 relative expression) (Fig. 1B).
Diego, CA) was used for calculating probability values. ER␣ protein was detected by immunohistochem-
istry in the rabbit oviduct of pregnant rabbits. ER␣
3. Results immunopositive cells were observed in secretory and
ciliated cells in both regions (AMP and IST) of rab-
In all RT-PCR amplifications, single bands of 154 and bit oviduct. ER␣ immunopositive nuclei in epithelial,
454 bp, corresponding to the expected size fragments of stromal and smooth muscle cells of rabbit AMP were
ER␣ and GAPDH genes, respectively, were obtained. No undectectable in NG rabbits and on the first day of preg-
bands were observed in the negative controls. The identity nancy (Figs. 2A and B, 3A and B, and 6A, C, and E).
of each PCR product was confirmed by nucleotide sequenc- An increase in ER␣ immunoreactivity was observed in
ing (data not shown). all cell types in AMP on the second day of pregnancy
Relative amount of ER␣ mRNA in the AMP was detected (Figs. 2C, 3C, and 6A, C, and E), the highest ER␣ HSCORE
by RT-PCR. An increase (P < 0.01) of ER␣ gene expression in all cell types studied was observed on the third day of
was observed during the first 4 days of pregnancy as com- pregnancy (Figs. 2D, 3D, and 6A, C, and E), with a decrease
pared with NG rabbits. The greatest content of ER␣ mRNA on the fourth day (Figs. 2E, 3E, and 6A, C, and E). In the
(1.01 ± 0.02 relative amount) was observed on the third day rabbit uterus, used as a positive control tissue, ER␣ was
 N. Baranda-Avila et al. / Animal Reproduction Science 121 (2010) 286–293
Fig. 2. Nuclear localization of ER␣ in epithelial and stromal cells of the rab-
bit ampullae during early pregnancy. Ampullae from an NG animal (A), on
Days 1 (B), 2 (C), 3 (D) and 4 of pregnancy (E). Positive (F) and negative (G)
controls from rabbit endometrium. Arrows indicate ER␣ immunopositive
cells. Epithelium (E) and stroma (S). Bar = 100 ␮m.
detected in the nuclei of epithelia, stroma and muscle layers
(Figs. 2F and 3F). No staining was observed in the negative
controls of rabbit uterus, where the primary antibody was
omitted (Figs. 2G and 3G).
In the IST, a significant increase in the ER␣
HSCORE of epithelial, stromal and smooth muscle
cells was observed on the first 2 days of pregnancy
(Figs. 4B, C, 5B, C and 6B, D, and F) as compared with
NG rabbits (Figs. 4A, 5A and 6B, D, and F), but a decrease
(P < 0.05) in the ER␣ HSCORE was observed on the third
and fourth days of pregnancy in all cell types of the IST
(Figs. 4D, E, 5D, E, and 6B, D, and F). Positive and negative
immunostaining controls were similar to those found in
AMP (Figs. 4F, G, and 5F and G).
289
Fig. 3. Immunohistochemical localization of ER␣ protein in smooth mus-
cle cells of the rabbit ampullae during early pregnancy. Ampullae from an
NG animal (A), on Days 1 (B), 2 (C), 3 (D) and 4 of pregnancy (E). Positive (F)
and negative (G) controls from rabbit endometrium. Arrows indicate ER␣
immunopositive cells. Smooth muscle (M) and stroma (S). Bar = 100 ␮m.
4. Discussion
Although ER␣ gene expression in female reproductive
tissues has been extensively studied, the expression and
localization of this receptor in the rabbit oviduct dur-
ing early pregnancy remained unclear. The present study
demonstrates that ER␣ gene is expressed in the rabbit
oviduct during early pregnancy in a tissue-dependent man-
ner. Differences in the time of induction of ER␣ gene
expression were observed between AMP and IST. In addi-
tion, this receptor was found in ciliated and secretory cells
of the rabbit oviduct.
In the present study, a progressive increase in relative
amounts of ER␣ mRNA during the 4 days of pregnancy was
observed in the AMP and IST of the rabbit oviduct (Fig. 1).
290 N. Baranda-Avila et al. / Animal Reproduction Science 121 (2010) 286–293
Fig. 4. Nuclear localization of ER␣ in epithelial and stromal cells of the
rabbit isthmus during early pregnancy. Isthmus from an NG animal (A), on
Days 1 (B), 2 (C), 3 (D) and 4 of pregnancy (E). Positive (F) and negative (G)
controls from rabbit endometrium. Arrows indicate ER␣ immunopositive
cells. Epithelium (E) and stroma (S). Bar = 100 ␮m.
In many mammals, E2 concentrations regulate ER␣ gene
expression in the uterus and oviduct. Both up and down
regulation of ER␣ mRNA by E2 have been demonstrated. Up
regulation of ER␣ mRNA in the rat oviduct and uterus was
observed from day 1 to day 3 of pregnancy when E2 concen-
trations were greater (Wu et al., 1996; Ing and Ott, 1999;
Okada et al., 2003). In line with this observation, the great-
est relative amount of ER␣ mRNA occurred in both regions
(AMP and IST) on the third day of pregnancy when a signif-
icant increase of E2 concentrations is observed (Browning
et al., 1980; Hegele-Hartung et al., 1992).
The cilia of the oviduct are believed to play a critical
role in ovum transport to the uterus in pregnant animals
(Halbert et al., 1989). Importantly, in the present study
ER␣ immunopositive cells in secretory and ciliated cells
in the AMP and IST of the rabbit oviduct were detected.
Fig. 5. Immunohistochemical localization of ER␣ protein in smooth mus-
cle cells of the rabbit isthmus during early pregnancy. Isthmus from an NG
animal (A), on Days 1 (B), 2 (C), 3 (D) and 4 of pregnancy (E). Positive (F)
and negative (G) controls from rabbit endometrium. Arrows indicate ER␣
immunopositive cells. Smooth muscle (M) and stroma (S). Bar = 100 ␮m.
Results of the present study are consistent with previous
studies that showed the presence of ER␣ in secretory and
ciliated cells of endosalpinx and myosalpinx of pseudo-
pregnant rabbits (Karbowski et al., 1992). E2 administration
induces ciliogenesis in the oviduct of ovariectomized rats
and rabbits and accelerates ovum transport in pregnant
animals (Banik and Pincus, 1964; Fuentealba et al., 1988).
In addition, in pregnant rats, ovariectomy or hypophy-
sectomy, and treatment with the aromatase inhibitor
4-hydroxyandrostenedione, caused delayed ovum trans-
port due to a reduction of estrogen production (Wu et al.,
1971; Forcelledo and Croxatto, 1986, 1988). Our group pre-
viously reported the presence of PR immunopositive cells
in secretory and ciliated cells in the AMP and IST of the
rabbit oviduct (Anzaldúa et al., 2007). Thus, both E2 and P4
 N. Baranda-Avila et al. / Animal Reproduction Science 121 (2010) 286–293 291

Fig. 6. ER␣ protein in the ampullae and isthmus of the rabbit during early pregnancy. Immunohistochemistry was performed in the ampullae and isthmus
of NG and pregnant rabbits during the first 4 days of pregnancy. The histologic score (HSCORE), was calculated as described in Material and Methods. Results
are expressed as the mean ± SEM. In (A–F) *P < 0.05 compared with all other groups without *. In (C and E) **P < 0.005 compared with all other groups.

may participate in ovum transport by regulating oviductal
ciliogenesis in rabbits.
Interestingly, some differences were observed between
the AMP and IST in ER␣ gene expression during early preg-
nancy. In the IST, the highest relative amounts of ER␣
protein (HSCORE) were observed on the first and second
days of pregnancy (Fig. 6B, D and F). In contrast, in the
AMP, ER␣ gene expression was detected several hours
later, beginning on the second day and reaching a max-
imum on the third day of pregnancy (Fig. 6A, C and E).
These differences in the time of induction of nuclear ER␣
gene expression between AMP and IST could reflect a spe-
cific contribution of these regions to signals provided by
E2 to regulate egg transport. Morphological changes in the
oviduct during early pregnancy, such as height and pro-
portion of PAS+ and PAS− cells in different regions of the
292 N. Baranda-Avila et al. / Animal Reproduction Science 121 (2010) 286–293
rabbit oviduct, could be related to the changes observed in
ER␣ expression in the AMP and IST (Anzaldúa et al., 2002).
In the rabbit reproductive tract, the content and
immunolocalization of ER␣ have been studied using
hormonal binding assays and during induced pseudopreg-
nancy by human chorionic gonadotropin (hCG). According
to results of the present study, in the AMP and IST, E2 bind-
ing reaches a peak at 72 and 48 h p.c., respectively (Puri and
Roy, 1981). In addition, and in agreement with our results,
Karbowski’s group (1992) reported there was a significant
increase in ER␣ immunoreactive score 24 h after hCG treat-
ment in the IST and 48 h post-hCG treatment in the AMP
(Karbowski et al., 1992).
In contrast with results from the present study,
Karbowski et al. (1992) observed an increase of ER␣
immunoreactive score in the IST 72 h post-hCG injection
when we observed a significant decrease in ER␣ HSCORE
(Fig. 6B, D and F). Although E2 and P4 plasma concentra-
tions are similar during pregnancy and pseudopregnancy
(Challis et al., 1973; Browning et al., 1980; Hegele-Hartung
et al., 1992), a different ER␣ gene expression pattern was
observed in the IST and AMP between the pseudopreg-
nant and pregnant animals. This suggests that ER␣ gene
expression not only depends on P4 and E2 concentra-
tions, but also on other local or paracrine factors such
as gonadotropin-releasing hormone (GnRH) or androgens
and their receptors (GnRHR and AR, respectively). Recently,
a direct inhibitory effect of the ER␣/AR heterodimer on
both ER␣ and AR transactivational properties has been
reported (Panet-Raymond et al., 2000). Also, expression of
GnRHR gene in the oviduct during pregnancy was reported
(Casan et al., 2000; Sengupta and Sridaran, 2008). Oviduc-
tal GnRH is predicted to be involved in autocrine/paracrine
regulation of functions like fertilization, early embryonic
development, and implantation in human (Casan et al.,
2000). The role of these oviductal receptors during early
pregnancy requires further investigations.
In the present study, the greatest relative amount of
ER␣ protein was detected in the AMP (on day 3) (Fig. 6A,
C and E) and the IST (on days 1 and 2) (Fig. 6B, D and
F) of rabbit oviduct during early pregnancy, when the
least PR gene expression was previously observed in these
oviduct regions (Anzaldúa et al., 2007). This differential
gene expression patterns between ER␣ and PR may be
related to the hormonal mileu observed in rabbits during
early pregnancy (Challis et al., 1973).
The differences observed in the distribution and expres-
sion of the ER␣ gene in the AMP and IST during early
pregnancy and before implantation in the rabbit, suggest
that there are different regulatory mechanisms for the
expression of steroid receptor genes in distinct regions of
the rabbit reproductive tract that could reflect specific con-
tributions of these regions to the signals provided by E2 to
regulate egg transport.
Acknowledgements
This research was supported in part by grant from
PAPIIT-IN207207 and CONACyT (AC-89544 and 80338).
References
Aluja, A.S., 2002. Animales de Laboratorio y la Norma Oficial Mexicana
(NOM-062-ZOO-1999). Gac. Méd. Méx. 138, 295–298.
Asakawa, M.G., Goldschmidt, M.H., Une, Y., Nomura, Y., 2008. The
immunohistochemical evaluation of estrogen receptor-␣ and
progesterone receptors of normal. Hyperplastic, and neoplastic
endometrium in 88 pet rabbits. Vet. Pathol. 45, 217–225.
Anzaldúa, S.R., Camacho-Arroyo, I., Cerbón, M.A., 2002. Histomorpho-
logical changes in the oviduct epithelium of the rabbit during early
pregnancy. Anat. Histol. Embryol. 31, 308–312.
Anzaldúa, S.R., Camacho-Arroyo, I., Reyna-Neyra, A., Pérez-Martínez, M.,
Cerbón, M., 2007. Regional differences in expression of progesterone
receptor in oviduct and uterus of rabbit during early pregnancy. Comp.
Biochem. Physiol. A Mol. Integr. Physiol. 147, 685–690.
Banik, U.K., Pincus, G., 1964. Estrogens and transport of ova in the rat. Proc.
Soc. Exp. Biol. Med. 116, 1032–1034.
Bläuer, M., Heinonen, P.K., Martikainen, P.M., Tomás, E., Ylikomi, T., 2005.
A novel organotypic culture model for normal human endometrium:
regulation of epithelial cell proliferation by estradiol and medroxypro-
gesterone acetate. Hum. Reprod. 20, 864–871.
Browning, J.Y., Keyes, P.L., Wolf, R.C., 1980. Comparison of serum pro-
gesterone, 20 alpha-dihydroprogesterone, and estradiol-17 beta in
pregnant and pseudopregnant rabbits: evidence for postimplantation
recognition of pregnancy. Biol. Reprod. 23, 1014–1019.
Camacho-Arroyo, I., Pasapera, A.M., Cerbón, M.A., 1996. Regulation of pro-
gesterone receptor gene expression by sex steroid hormones in the
hypothalamus and cerebral cortex of the rabbit. Neurosci. Lett. 214,
25–28.
Casan, E.M., Raga, F., Bonilla-Musoles, F., Polan, M.L., 2000. Human
oviductal gonadotropin-releasing hormone: possible implications in
fertilization, early embryonic development, and implantation. J. Clin.
Endocrinol. Metab. 85, 1377–1381.
Challis, J.R., Davies, J., Ryan, K.J., 1973. The concentrations of progesterone,
estrone and estradiol-17 beta in the plasma of pregnant rabbits.
Endocrinology 93, 971–976.
Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation
by acid guanidinium thyocyanate–phenol–chlorophorm extraction.
Anal. Biochem. 162, 156–159.
Couse, J.F., Lindzey, J., Grandien, K., Gustafsson, J.Å., Korach, K.S., 1997.
Tissue distribution and quantitative analysis of estrogen receptor-
␣ (ER␣) and estrogen receptor-␤ (ER␤) messenger ribonucleic acid
in the wild-type and ER␣-knockout mouse. Endocrinology 138,
4613–4621.
Diel, P., 2002. Tissue-specific estrogenic response and molecular mecha-
nisms. Toxicol. Lett. 127, 217–224.
Edwards, D.P., 2005. Regulation of signal transduction pathways by estro-
gen and progesterone. Annu. Rev. Physiol. 67, 335–376.
El-Banna, A.A., Sacher, B., 1977. A study on steroid hormone receptors in
the rabbit oviduct and uterus during first few days after coitus and
during egg transport. Biol. Reprod. 17, 1–8.
Forcelledo, M.L., Croxatto, H.B., 1986. Ovum transport in cyclic
rats rendered hypo-oestrogenic by treatment with 4-hydroxy-4-
androstene-3,17-dione. J. Reprod. Fertil. 76, 325–330.
Forcelledo, M.L., Croxatto, H.B., 1988. Effects of 4-
hydroxyandrostenedione and exogenous testosterone on blood
concentrations of oestradiol and oviductal embryo transport in the
rat. J. Endocrinol. 118, 93–100.
Fuentealba, B., Nieto, M., Croxatto, H.B., 1988. Progesterone abbreviates
the nuclear retention of estrogen receptor in the rat oviduct and coun-
teracts estrogen action on egg transport. Biol. Reprod. 38, 63–69.
Halbert, S.A., Becker, D.R., Szal, S.E., 1989. Ovum transport in the rat
oviductal ampulla in the absence of muscle contractility. Biol. Reprod.
40, 1131–1136.
Hamner, C.E., 1973. Oviductal fluid—composition and physiology. In:
Greep, R., Astwood, E.B. (Eds.), Handbook of Physiology, vol. 2.
Female Reproductive Physiology. Waverly, Baltimore, MD, pp. 141–
151.
Harper, M.J.K., 1994. In: Knobil, E., Niel, J.D. (Eds.), The Physiology of Repro-
duction, 2nd ed. Raven Press, New York.
Hegele-Hartung, C., Chwalisz, K., Beier, H.M., 1992. Distribution of
estrogen and progesterone receptors in the uterus: an immunohis-
tochemical study in the immature and adult pseudopregnant rabbit.
Histochemistry 97, 39–50.
Ing, N.H., Ott, T.L., 1999. Estradiol up-regulates estrogen receptor-alpha
messenger ribonucleic acid in sheep endometrium by increasing its
stability. Biol. Reprod. 60, 134–139.
Iwai, T., Fujii, S., Nanbu, Y., Nonogaki, H., Konishi, I., Mori, T., Okamura,
H., 1991. Effect of human chorionic gonadotropin on the expression
 N. Baranda-Avila et al. / Animal Reproduction Science 121 (2010) 286–293
of progesterone receptors and estrogen receptors in rabbit ovarian
granulosa cells and the uterus. Endocrinology 129, 1840–1848.
Jefferson, W.N., Couse, J.F., Banks, E.P., Korach, K.S., Newbold, R.R., 2000.
Expression of estrogen receptor ␤ is developmentally regulated in
reproductive tissues of male and female mice. Biol. Reprod. 62,
310–317.
Kaluz, S., Kaluzova, M., Flint, A.P.F., 1997. Sequencing variability in the A/B
region of the estrogen receptor. Anim. Biotechnol. 8, 221–226.
Karbowski, B., Vollmer, E., Schneider, P.G., 1992. Steroid receptors in the
fallopian tube—morphological and functional investigation in rabbits.
Prog. Histochem. Cytochem. 26, 140–144.
Killian, G.J., 2004. Evidence for the role of oviduct secretions in sperm
function, fertilization and embryo development. Anim. Reprod. Sci.
82–83, 141–153.
Lessey, B.A., Killam, A.P., Metzger, D.A., Haney, A.F., Greene, G.L., McCarty
Jr., K.S., 1988. Immunohistochemical analysis of human uterine estro-
gen and progesterone receptors throughout the menstrual cycle. J.
Clin. Endocrinol. Metab. 67, 334–340.
Mowa, C.N., Iwanaga, T., 2000a. Differential distribution of oestrogen
receptor-␣ and -␤ mRNAs in the female reproductive organ of rats
as revealed by in situ hybridization. J. Endocrinol. 165, 59–66.
Mowa, C.N., Iwanaga, T., 2000b. Developmental changes of the oestrogen
receptor-␣ and -␤ mRNAs in the female reproductive organ of the
rat—an analysis by in situ hybridization. J. Endocrinol. 167, 363–369.
Murata, T., Narita, K., Honda, K., Matsukawa, S., Higuchi, T., 2003. Differen-
tial regulation of estrogen receptor alpha and beta mRNAs in the rat
uterus during pregnancy and labor: possible involvement of estrogen
receptors in oxytocin receptor regulation. Endocr. J. 50, 579–587.
Nephew, K.P., Long, X., Osborne, E., Burke, K.E., Ahluwalia, A., Bigbsby, R.M.,
2000. Effect of estradiol on estrogen receptor expression in rat uterine
cell types. Biol. Reprod. 62, 168–177.
Nilsson, S., Mäkelä, S., Treuter, E., Tujague, M., Thomsen, J., Andersson, G.,
Enmark, E., Pettersson, K., Warner, M., Gustafsson, J.A., 2001. Mecha-
nisms of estrogen action. Physiol. Rev. 81, 1535–1565.
Okada, A., Ohta, Y., Inoue, S., Hiroi, H., Muramatsu, M., Iguchi, T., 2003.
Expression of estrogen, progesterone and androgen receptors in the
oviduct of developing, cycling and pre-implantation rats. J. Mol.
Endocrinol. 30, 301–315.
Orihuela, A.P., Zuñiga, M.L., Rios, M., Parada-Bustamante, A., Sierralta,
D.W., Velásquez, A.L., Croxatto, B.H., 2009. Mating changes the sub-
cellular distribution and the functionality of estrogen receptors in the
rat oviduct. Reprod. Biol. Endocrinol. 7, 139.
293
Panet-Raymond, V., Gottlieb, B., Beitel, L.K., Pinsky, L., Trifiro, M.A.,
2000. Interactions between androgen and estrogen receptors and the
effects on their transactivational properties. Mol. Cell. Endocrinol. 167,
139–150.
Pauerstein, C.J., Eddy, C.A., 1979. The role of the oviduct in reproduction;
our knowledge and our ignorance. J. Reprod. Fertil. 55, 223–229.
Pelletier, G., Labrie, C., Labrie, F., 2000. Localization of oestrogen receptor
␣, oestrogen receptor ␤ and androgen receptors in the rat reproduc-
tive organs. J. Endocrinol. 165, 359–370.
Puri, R.K., Roy, S.K., 1981. Estradiol binding in different parts of the rabbit
oviduct during egg transport. Endokrinologie 78, 12–20.
Roblero, L.S., Garavagno, A.C., 1979. Effect of oestradiol-17␤ and pro-
gesterone on oviductal transport and early development of mouse
embryos. J. Reprod. Fertil. 57, 91–95.
Sar, M., Welsch, F., 1999. Differential expression of estrogen receptor-␣
and estrogen receptor-␤ in the rat ovary. Endocrinology 140, 963–971.
Saunders, P.T., Maguire, S.M., Gaughan, J., Millar, M.R., 1997. Expression
of oestrogen receptor beta (ER␤) in multiple rat tissues visualised by
immunohistochemistry. J. Endocrinol. 154, R13–R16.
Sengupta, A., Sridaran, R., 2008. Expression and localization of
gonadotropin-releasing hormone receptor in the rat oviduct during
pregnancy. J. Histochem. Cytochem. 56, 25–31.
Slayden, O.D., Brenner, R.M., 2004. Hormonal regulation and localization
of estrogen, progestin and androgen receptors in the endometrium
of nonhuman primates: effects of progesterone receptor antagonists.
Arch. Histol. Cytol. 67, 393–409.
Spencer, T.E., Bazer, F.W., 1995. Temporal and spatial alterations in uterine
estrogen receptor and progesterone receptor gene expression during
the estrous cycle and early pregnancy in the ewe. Biol. Reprod. 53,
1527–1543.
Suarez, S.S., 2008. Regulation of sperm storage and movement in the mam-
malian oviduct. Int. J. Dev. Biol. 52, 455–462.
Talbot, P., Geiske, C., Knoll, M., 1999. Oocyte pick-up by the mammalian
oviduct. Mol. Biol. Cell 10, 5–8.
Wu, J.T., Dickmann, Z., Johnson, D.C., 1971. Effects of ovariectomy or
hypophysectomy on day one of pregnancy on development and trans-
port of fertilized rat eggs. J. Endocrinol. 49, 507–513.
Wu, W.X., Owiny, J., Zhang, Q., Ma, X.H., Nathanielsz, P.W., 1996. Regu-
lation of the estrogen receptor and its messenger ribonucleic acid in
the ovariectomized sheep myometrium and endometrium: the role
of estradiol and progesterone. Biol. Reprod. 55, 762–768.
 Animal Reproduction Science 121 (2010) 294–300

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Body reserves and ovarian performance in primiparous lactating rabbit

does submitted to early weaning as a strategy to decrease
energy deficit
O.G. Sakr a,b , R.M. García-García c , M. Arias-Álvarez c , P. Millán c ,
P.L. Lorenzo c , P.G. Rebollar a,∗
a
Department of Animal Production, Polytechnic University of Madrid, Ciudad Universitaria s/n, 28040 Madrid, Spain
b
Department of Animal Production, Faculty of Agriculture, Cairo University,12613 Giza, Egypt
c
Department of Physiology (Animal Physiology), Complutense University of Madrid, Ciudad Universitaria s/n, 28040 Madrid, Spain

a r t i c l e i n f o a b s t r a c t

Article history: The aim of this work was to study the effect on body composition, serum metabolic
Received 26 April 2010 parameters and ovarian status of early weaning at 25 Days post-partum (dpp) as a
Received in revised form 22 June 2010
strategy to decrease energy deficit of primiparous lactating rabbit does prior to insem-
Accepted 28 June 2010
ination at 32 dpp following an extensive rhythm. A total of 34 primiparous lactating
Available online 6 August 2010
rabbit does were used and distributed in three groups: 10 lactating does euthanized
at 25 dpp (group L25), 13 does weaned at 25 dpp and euthanized at 32 dpp (group
Keywords:
NL32), and 11 non weaned lactating does euthanized at 32 dpp (group L32). No sig-
Body composition
Weaning nificant differences were observed in live body weight, ovary weight, serum NEFA
Oocyte and total protein concentration among groups. Although NL32 does had a low feed
Follicle intake (122 ± 23.5 g/Day; P < 0.001), their estimated lipids (16.9 ± 1.09%, P < 0.008), pro-
PRL-R tein (19.7 ± 0.07%, P < 0.0001), and energy (1147 ± 42.7 MJ/kg, P < 0.006) body contents were
Rabbit higher and their serum glucose concentrations (158 ± 24.5 mg/dl, P < 0.04) were lower com-
pared to L25 does (11.9 ± 1.3%, 18.5 ± 0.08%, 942 ± 51.3 MJ/kg and 212 ± 27.9 mg/dl) and L32
does (13.4 ± 1.03%, 18.5 ± 0.1%, 993 ± 40.4 MJ/kg and 259 ± 29.5 mg/dl), respectively. In the
ovarian surface of L25 does a lower number of follicles ≥1 mm was observed compared to
NL32 and L32 groups (12.7 ± 1.5 vs. 18.0 ± 1.45 and 17.6 ±1.67; P < 0.05). Follicular pop-
ulation in the histological ovarian sections and immunolocalization of prolactin receptor
were similar between groups. In group L25, both nuclear maturation of oocytes in terms of
Metaphase II rate (67.0 vs. 79.7 and 78.3%; P < 0.05) and cytoplasmic maturation measured
by percentage of cortical granules (CG) totally or partially migrated in oocytes were signifi-
cantly lower than in groups NL32 and L32 (16.0 vs. 38.3 and 60.0%; P < 0.05). Consequently,
a higher rate of oocytes with non-migrated CGs was found in group L25 than in groups
NL32 and L32 (76.0 vs. 46.8 and 33.3%; P < 0.05). In conclusion, even though early weaning
at 25 dpp seemed to improve body energy stores of primiparous does, this fact was not well
reflected on the ovarian status at 32 dpp, which was similar regardless of weaning time and
it could be performed later.
© 2010 Elsevier B.V. All rights reserved.

∗ Corresponding author. Tel.: +34 914 524 868; fax: +34 915 499 763.
E-mail address: pilar.grebollar@upm.es (P.G. Rebollar).

0378-4320/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.anireprosci.2010.06.008
 O.G. Sakr et al. / Animal Reproduction Science 121 (2010) 294–300
1. Introduction
In commercial rabbit farms, litter weaning usually
occurs from Days 28 to 35 of age. However, primi-
parous does cannot completely meet the high nutritional
demands of lactation and usually show an energy deficit
(Cervera et al., 1993; Fortun-Lamothe, 1998; Parigi Bini
and Xiccato, 1998; Xiccato et al., 2004) which reduces
their body fat depots and is partly responsible for their
low reproductive performance (Castellini et al., 2006). It
has been reported that an extensive reproductive rhythm
can be adopted in these animals to improve their nutri-
tional status, fertility, length of reproductive activity and
welfare (Castellini et al., 2003; Dal Bosco et al., 2003;
Feugier and Fortun-Lamothe, 2006). In a recent work, it
has been shown that insemination of primiparous does at
32 Days post-partum (dpp), only 4 Days after weaning,
improved estimated body composition and energy con-
tent, serum leptin and protein concentrations, health of
follicular populations in the ovary, oocyte quality and, as
a consequence, conception rate and prolificacy compared
to lactating does inseminated at 11 dpp (Arias-Álvarez et
al., 2007).
Also, in primiparous does, early weaning between 21
and 25 dpp seems to be a feasible practice to improve their
poor body condition before artificial insemination time.
Thus, Feugier and Fortun-Lamothe (2006) observed that
early weaning at 23 dpp significantly reduced dissectible
fat mobilisation of does compared to weaning at 35 dpp.
Nevertheless, in both cases, reproductive performance is
not affected when females are inseminated at 25 dpp. In
turn, Xiccato et al. (2005) have shown that early-weaned
does (at 21 or 25 dpp) display a substantial decrease in
food intake in the post-weaning period, reducing the daily
energy surplus and delaying the complete restoration of
their reserves. In these previous studies, corpora lutea and
foetuses were counted, and, when does were inseminated
at 25 dpp, the number of corpora lutea and embryonic or
fetal mortality were not affected by the age of weaning.
To our knowledge, no studies have been done to assess
the consequences of early weaning on ovarian follicle and
oocyte features in extensively-reared primiparous rabbit
does. In this sense, it is well known that a good ovarian
status leads to reproductive success.
Additionally, in previous works, high prolactin (PRL)
concentrations were observed during lactation in rabbit
does (Ubilla et al., 2000). This hormone is the main respon-
sible for the negative effect of lactation on reproductive
function (McNeilly et al., 1982). Kermabon et al. (1994)
indicated that receptive behavior is correlated with signif-
icantly more follicles higher than 1 mm of diameter and
an increase in the concentration of PRL receptors on the
rabbit ovary. Early weaning could decrease the possible
inhibitory action of this hormone in follicular development
and oocyte quality as described in several species (rabbit:
Yoshimura et al., 1989; bovine: Torner et al., 2001).
On the basis of the findings stated above, this study was
conducted to assess the influence of early weaning at 25
dpp on estimated body composition, serum metabolic and
ovarian parameters of primiparous lactating does when
they are reared in an extensive reproductive rhythm.
295
2. Materials and methods
2.1. Animals
A total of 34 primiparous lactating Californian × New
Zealand White rabbit does were used for this study. Ani-
mals were housed at the experimental farm in the Animal
Production Department, Polytechnic University of Madrid
(Spain), in individual metal cages (50 cm × 70 cm × 32 cm)
with a closeable nest box, under a constant photoperiod of
16 h light per Day, a temperature of 18–22 ◦ C, and a rela-
tive humidity of 60–75% maintained by a forced ventilation
system. All females were fed ad libitum a commercial diet
(NANTA S.A., Tres Cantos, Madrid, Spain) containing 16%
crude protein, 15.7% crude fiber and 2.5% fat; digestible
energy of the diet was 2700 kcal/kg. Animals had free access
to water. All experimental procedures used in this research
were approved by the Animal Ethics Committee of the
Polytechnic University of Madrid and were in compliance
with the Spanish guidelines for care and use of animals in
research (BOE, 2005).
2.2. Experimental design
Primiparous lactating does were equalized at eight
pups one day after parturition, keeping this number con-
stant throughout lactation and dead pups being replaced
with others of a similar weight and age provided from
nurse does. Thirty-four lactating does were randomly
distributed in three experimental groups: 10 lactating
does were euthanized on Day 25 pp (group L25), 13
non-lactating does were weaned on Day 25 pp and
euthanized on Day 32 pp (group NL32), and 11 lactat-
ing does were euthanized on Day 32 pp (group L32).
Live body weight (LBW), estimated body composition
and serum metabolic parameters (glucose, non-esterified
fatty acids (NEFA) and total protein) were measured
before euthanasia in all groups. Also, solid feed intake
of does from parturition until 25 dpp, as well as solid
feed intake of does and their litters between 25 and
32 dpp were determined. The solid feed intake of
young rabbits from parturition to Day 25 was consid-
ered null. Nevertheless, feed intake of L32 does from
Day 25 pp to 32 pp was calculated considering that
kits, apart from milk, fed a mean of 30 g of solid feed
from Day 25 to 32 of age according to Gidenne and
Lebas (2006). Euthanasia was performed with 30 mg/kg
of intravenous pentobarbital sodium (Dolethal, Veto-
quinol, Alcobendas, Spain). To further determine ovarian
features, both ovaries were recovered by laparotomy
after euthanasia. One of them was preserved for his-
tological and immunohistochemical studies (follicular
categorization and immunolocalization of prolactin recep-
tor), and the other one was used for in vitro maturation
assessment.
2.3. Analytical methods
Unless otherwise stated, all chemicals were purchased
from Sigma Chemical Company (St. Louis, MO, USA).
296 O.G. Sakr et al. / Animal Reproduction Science 121 (2010) 294–300
2.3.1. Body composition
Body composition was estimated by means of bioelec-
trical impedance analysis (BIA) using a four-terminal body
composition analyser (Model Quantum II, RJL Systems,
Detroit, MI, USA) which reports reactance and resistance
between two sets of two electrodes. In our case, we used
standard 21-gauge needles (Terumo Europe N.V. 3001 Leu-
ven, Belgium) as electrodes inserted into the skin of the
animal. One pair of needles was held 1 cm apart in the
neck and the other one in the rump. These components
have been correlated to BIA measurements through regres-
sion equations built on multiple measurements of rabbit
does in different physiological status (pregnant, lactating,
non pregnant, non lactating) and validated according to
Nicodemus et al. (2009) and Pereda (2010).
2.3.2. Serum parameters
Blood samples were collected from the margin ear vein
into non-heparinized tubes at 9:00 h a.m. to avoid circa-
dian variations and considering that over 60% of the solid
feed is consumed by the rabbit in the dark period (Gidenne
and Lebas, 2006). Serum was obtained after centrifugation
at 1200 × g for 10 min at 4 ◦ C and stored at −32 ◦ C until
analysed.
Serum non-esterified fatty acids (NEFA) determinations
were performed in duplicate samples using a two-reaction
enzymatic-based colorimetric assay from Wako Chemi-
cals GmbH Specialty Chemicals (Neuss, Germany). The
method is linear over the range from 0.01 to 4.0 mEq/l.
Serum glucose was determined in duplicate samples using
the GOD-PAP method from RANDOX Laboratories Ltd.
(Crumlin, United Kingdom), according to Tietz (1995). This
method is linear up to a glucose concentration of 400 mg/dl.
Serum total protein was determined by the Biuret method
from RANDOX Laboratories Ltd. (Crumlin, United King-
dom), according to Tietz (1995). This method is linear up
to 13 g/dl.
2.3.3. Ovarian parameters
Ovary weight, number of follicles ≥1 mm on the ovar-
ian surface and hemorrhagic follicles were first recorded.
Then, one ovary from each animal was placed into a 4%-
buffered neutral paraformaldehyde solution (pH 7.2–7.4).
All samples were gradually dehydrated with increasing
concentrations of ethyl alcohol, embedded in paraffin,
prepared by sectioning at 5 ␮m, and stained with hema-
toxylin/eosin. In order to study follicle population, a pair
of histological sections of each half ovary was examined
at light microscope (Olympus BX40, Hamburg, Germany).
Rabbit ovarian follicles were categorized into three spe-
cific development stages related to the number of layers of
granulosa cells according to Rebollar et al. (2008), namely,
primary, preantral and antral follicles.
The remaining ovaries were placed in PBS at 37 ◦ C.
Cumulus-oocyte complexes (COCs) were obtained from
ovarian follicles more than 1 mm diameter by aspiration
with a 25-gauge needle under a stereoscopic microscope.
A total of 317 cumulus-oocyte complexes (group L25,
n = 116; group NL32, n = 126; group L32, n = 75) with com-
pact cumulus cells were washed and placed in 500 ␮l of
maturation medium and cultured for 16 h at 38 ◦ C under an
atmosphere of 5% CO2 in air with maximum humidity. The
maturation medium was prepared according to Lorenzo
et al. (1997). After the maturation period, COCs were
processed for the confocal study as previously reported
by Arias-Álvarez et al. (2007). Nuclear maturation was
measured in terms of metaphase II rate. Cortical granule
distribution was classified as follows: migrated (CGs were
adjacent to the plasma membrane, showing they were
cytoplasmically matured) or partially migrated (CGs were
spread throughout the cortical area showing they had ini-
tiated their cytoplasmic maturation), non-migrated (CGs
were distributed throughout the cytoplasm, as they did not
show cytoplasmic maturation) and abnormally migrated
(anomalous distribution of CGs compatible with poor qual-
ity or degenerated oocytes).
To determine PRL receptor on ovarian surface a proto-
col was used according to that described by Arias-Álvarez
et al. (2009). The primary antibody against prolactin
receptor (1:75, Affinity Bioreagents, Golden, CO, USA)
used in this study specifically recognized long and short
forms of rabbit prolactin receptor (PRL-R). After detec-
tion with diaminobenzidine, sections were counterstained
with hematoxylin and photographed under the light micro-
scope (Olympus BX40). A subjective image analysis was
performed to estimate the immunoreactivity of PRL-R in
different cell types by an observer unaware of which group
of animals was examining. At least five fields of each ovary
sample were examined at 400× magnification to evalu-
ate PRL-R immunostaining. Each cell compartment was
given an immunohistochemical score, based on the stain-
ing intensity (0–3: 0 = negative, 1 = weak, 2 = intermediate,
3 = strong) according to Picazo et al. (2004) and García-
Palencia et al. (2007).
2.4. Statistical analysis
Trial data were analysed using the Statistical Analysis
Systems (SAS/STAT, 1999–2001). Mean differences of LBW,
estimated body composition, serum metabolic parame-
ters, feed intake, ovary weight, number of haemorrhagic
follicles, follicles more than 1 mm diameter, follicular cat-
egorization and staining intensity of PRL-R were analyzed
with a GLM procedure by a one-way analysis of variance
(three differentiated groups L25, NL32 and L32, represent-
ing two post-partum times: 25 and 32 dpp). Means were
compared using a protected Student’s t-test. In order to
compare nuclear maturation and CG migration index of in
vitro-matured oocytes among experimental groups a Chi-
square test (proc CATMOD) was carried out. All the results
are expressed as mean ± S.E.M., and statistical significance
was accepted for P < 0.05.
3. Results
3.1. Live body weight, estimated body composition, feed
intake and serum metabolic parameters
Early weaning did not affect LBW of does, which was
in average 3.82 ± 1.15 kg. In group NL32, the estimated
water content was lower (P < 0.001), and estimated lipids
(P < 0.01), protein (P < 0.001), and energy (P < 0.01) body
 O.G. Sakr et al. / Animal Reproduction Science 121 (2010) 294–300 297

Table 1
Live body weight, estimated body composition, feed intake and serum parameters in primiparous lactating does on Day 25 pp (L25), on Day 32
pp (L32) and in early-weaned, non-lactating does on Day 32 pp (NL32).

Day 25 pp Day 32 pp

L25 NL32 L32

No. of does 10 13 11
LBW (kg) 3.86 ± 0.14 3.91 ± 0.94 3.68 ± 1.13
Water (%) 65.9 ± 1.06A 61.5 ± 0.89B 66.9 ± 1.07A
Ash (%) 3.09 ± 0.05 3.04 ± 0.04 3.14 ± 0.04
Lipids (%) 13.4 ± 1.03b 16.9± 0.09a 11.9 ± 1.31b
Proteins (%) 18.5 ± 0.10B 19.7 ± 0.07A 18.5 ± 0.08B
Energy (MJ/kg) 993 ± 40.4b 1147 ± 2.7a 942 ± 51.3b

Feed intake (g/Day)

Parturition to 25 Days pp 345 ± 19.6 357 ± 17.2 359 ± 17.9
25 to 32 Days pp* – 122 ± 23.5B 402 ± 26.7A

Serum concentrations
NEFA (mmol/L) 0.26 ± 0.04 0.23± 0.03 0.19 ± 0.04
Glucose (mg/dl) 212 ± 27.9ab 158 ± 24.5b 259 ± 29.5a
Total protein (g/dl) 7.60 ± 1.26 7.40 ± 1.10 6.50 ± 1.33

pp: post-partum. LBW: live body weight. NEFA: non-esterified fatty acids.
A, B: P < 0.001; a, b: P < 0.01 in the same row.
*
Calculated considering litter size of each doe (8 kits) and a mean dry feed intake of kits of 30 g/d.

contents were higher than in the two other experimental
groups (Table 1). Feed intake from parturition to 25 dpp
was similar in all groups, but just as we expected, group
L32 had a higher feed intake from 25 to 32 dpp compared
to group NL32 (P < 0.0001).
Serum NEFA and total protein concentrations did not
show significant differences between experimental groups,
but serum glucose concentration was lower in group NL32
than in group L32 (P < 0.04), being intermediate in group
L25.
3.2. Features of ovarian follicular population
As shown in Table 2, no significant differences
were found in average ovary weight in the number of
haemorrhagic follicles between experimental groups. Nev-
ertheless, L25 does showed a lower number of follicles
≥1 mm in the ovarian surface per ovary than groups NL32
and L32 (P < 0.05).
Follicular population observed in the histological sec-
tions was not affected by early weaning, and similar means
of primary, preantral and antral follicles in the ovarian sec-
tions were found (11.4 ± 1.71, 13.7 ± 1.84, and 13.3 ± 1.12
follicles per ovary, respectively; P > 0.05).
PRL-R cytoplasmic staining was observed in all ovarian
compartments studied (granulose cells of all categorized
follicles and also in corpora lutea (CL) and stromal cells),
but not in theca cells, as shown in Fig. 1. No staining was
detected in the negative controls. No statistical differences
were found in the staining intensity of PRL-R in different

Table 2
Ovarian status in primiparous lactating does and in vitro oocyte maturation from primiparous lactating does on Day 25 pp (L25), on Day 32 pp (L32), and
in early-weaned, non-lactating does on Day 32 pp (NL32). Nuclear and cytoplasmic maturation were measured in terms of metaphase II rate (MII) and
cortical granule (CG) migration.

Day 25 pp Day 32 pp

L25 NL32 L32

No. of does 10 13 11
Ovary Weight (mg)
Right 347 ± 37.4 329 ± 34.1 295 ± 39.4
Left 331 ± 32.9 323 ± 30.1 286 ± 34.7

Follicles (n)
>1mm 12.7 ± 1.58b 18.0 ± 1.45a 17.6 ± 1.67a
Haemorrhagic 1.30 ± 0.85 1.00 ± 0.77 0.90 ± 0.89

Mean of follicular population/ovary (n)

Antral 9.88 ± 2.17 15.7 ± 2.05 13.3 ± 1.70
Preantral 12.9 ± 3.6 19.3 ± 3.36 10.4 ± 2.80
Primary 10.8 ± 3.32 13.4 ± 3.13 10.4 ± 2.61

In vitro oocyte maturation

MII rate (%) 67.0b 79.7a 78.3ab
Migrated or partially migrated CGs (%) 16.0b 38.3a 60.0a
Non-migrated CGs (%) 76.0a 46.8b 33.3b
Abnormally migrated CGs (%) 8.0 14.9 3.3

pp: post-partum. a,b P < 0.05 in the same row.

298 O.G. Sakr et al. / Animal Reproduction Science 121 (2010) 294–300

Fig. 1. Immunohistochemical localization of PRL-R in ovaries of does early weaned at 25 days post-partum (group L25 and group NL 32) or non weaned
(group L32) in the different sized follicles and corpus luteum. (A) Negative control (20×); (B) primary follicles (PF) (40×) with positive (brown) granulose
cells and oocytes, surrounded by positive stromal cells (SC); (C) antral follicle (AF) showing strong immunoreactivity to PRL-R in granulosa cells, and negative
theca cells (20×); (D) Corpus luteum (CL) (20×) showing positive immunostaining in all luteal cells. Given that the pattern and intensity of localizations
did not change between ovaries of the three experimental groups, only representative images of follicles and corpus luteum are shown (A–D). Scale bar:
100 ␮m.

size follicles and CL in group L25 compared to groups L32
and NL32.
3.3. In vitro oocyte maturation
As shown in Table 2, Metaphase II rate observed in
oocytes from non-lactating does was significantly higher
(P < 0.05) than in oocytes from lactating does at 25 dpp
(L25), but similar to lactating rabbits at 32 dpp. Percent-
age of cytoplasmic maturation was significantly different
between groups (P < 0.05). In group NL32, a significantly
higher rate of oocytes with migrated or partially migrated
CGs was found with respect to L25 (P < 0.05), but similar to
L32 (P = 0.06). Oocytes with no migrated CGs were higher
for group L25 than for the two other groups (P < 0.05). No
significant differences were found among groups regarding
abnormal migration of CGs.
4. Discussion
Early weaning is one factor to settle an extensive repro-
ductive rhythm. From the ovarian and energy points of
view, the present study will clarify some aspects of this
critical reproductive period.
4.1. Live body weight, estimated body composition, feed
intake and serum metabolic parameters
LBW of does on Day 25 pp was similar to that observed
in primiparous does in previous studies (Rebollar et al.,
2009). The greatest interest in early weaning techniques
lies in the possibility of reducing doe body energy deficit.
In this sense, estimated body composition and energy
changes observed in this work have confirmed previous
results found on primiparous lactating rabbit does (Xiccato
et al., 2005; Fortun-Lamothe and Prunier, 1999; Feugier
and Fortun-Lamothe, 2006; Castellini et al., 2006). A high
energy supply is required during the final lactation period,
since milk dry matter and lipid concentrations increase
from Day 20 onwards when production begins falling
(Lebas, 1971, 1972; Pascual et al., 1999). Using ultrasounds,
Pascual et al. (2002) observed a decrease of around 0.2 mm
in peri-renal fat thickness during the first three weeks of
lactation, rising to a loss of 0.9 mm in the last week. Simi-
lar results were obtained by Fortun-Lamothe et al. (2002),
who found a decrease of 5 MJ in the total energy content
of primiparous does during lactation, or Fortun-Lamothe
and Prunier (1999), who reported a weight loss (−97 g
per week) after the first two weeks post-partum. In our
study, focused on the last week of lactation, primiparous
lactating does at 32 dpp maintained similar body energy
reserves than lactating does at 25 dpp. Nevertheless, wean-
ing at 25 dpp increased energy reserves; non-lactating
animals had 154 and 205 MJ/kg more body energy con-
tent than lactating does at 25 and 32 dpp, respectively.
Although feed intake was lower in weaned does, decreased
milk production for seven days was enough to improve
slightly their energy reserves. Consequently, body lipids
and protein content were also improved in non-lactating
does.
 O.G. Sakr et al. / Animal Reproduction Science 121 (2010) 294–300
Previous studies observed that weaning age of litters
strongly influence the evolution of the body condition of
females during their reproductive cycles. Early weaning (23
Days of age, Feugier and Fortun-Lamothe, 2006; 21 Days
of age, Xiccato et al., 2005) reduces fat loss and energy
deficit with respect to weaning performed later (33 Days
of age, Feugier and Fortun-Lamothe, 2006, or 25 Days of
age, Xiccato et al., 2005, respectively). This improvement
on body condition is observed even though the feed intake
of does is voluntarily reduced, according to our results.
This is due to the chemostatic mechanism of appetite
regulation according to which, after litter weaning, does
quickly decrease their feed intake by 35–45% of the lacta-
tion level in just a week (Xiccato et al., 2005). The lower
serum glucose concentrations observed in non-lactating
does on Day 32 pp compared to lactating ones could be
explained by the substantial decrease in feed intake dur-
ing the dry period after weaning, reducing the daily energy
intake as Xiccato et al. (2004) demonstrated. When serum
glucose concentrations fall, NEFA must be released into
the blood stream (Brecchia et al., 2006). In fact, around
parturition, elevated concentrations of NEFA have been
previously described due to mobilization of body reserves
and reduced feed intake at the end of pregnancy (Arias-
Álvarez et al., 2009). Nevertheless, neither lactating does
at 25 dpp nor weaned ones at 32 dpp showed differences
in NEFA concentrations. In that sense, Arias-Álvarez et al.
(2009) did not observe differences among does on Day 11
pp and on Day 32 pp. As regards both serum parameters,
low concentrations of glucose are not enough to evoke
any meaningful effect on the evolution of NEFA concentra-
tions in lactating rabbit does. In fact, Xiccato et al. (2005)
observed a high individual variability in NEFA concentra-
tions of does under different reproductive rhythms and
weaning ages.
4.2. Features of ovarian follicular population
Ovarian features were similar in lactating and non-
lactating does at 32 dpp. Only the post-partum times
considered (25 or 32 dpp) had a significant effect in
mean preovulatory follicles, since they were lower on
Day 25 pp than on Day 32 pp. The reduction in the
number of preovulatory follicles observed in group L25
is consistent to their lower estimated body composition,
which corresponds to the negative energy balance and
the endocrine changes expected in these animals, changes
affecting in turn follicular growth (Diskin et al., 2003).
The distribution or evolution of follicular waves in the
rabbit ovary is not well described. These animals con-
tinuously produce mature follicles which become atretic
if ovulation is not stimulated by coitus (Kranzfelder et
al., 1984). Ubilla and Rebollar (1995) suggested the pres-
ence of a follicular growth wave between Days 23 and
30 of the post-partum period in non-pregnant lactating
rabbits. This wave coincided with an increase in plasma
oestradiol levels found on Days 23–30 after parturition
and with a rise of sexual receptivity. Current results
show the existence of this physiological follicular wave
irrespective of whether rabbit does were lactating or
not.
299
Glucose, insulin and leptin are the most likely signals
informing the hypothalamus of the animal metabolic sta-
tus (Diskin et al., 2003). In our work, follicular growth
took place irrespective of glucose concentrations availabil-
ity because lactating and non-lactating does at 32 dpp had
different serum glucose concentrations.
4.3. In vitro oocyte maturation
Oocyte maturation implies both nuclear and cytoplas-
mic maturation including CG migration (Edwards, 1965;
Yanagimachi, 1994). A recent report in rabbit (Arias-
Álvarez et al., 2009) clearly shows that conditions related
to early lactation and negative energy balance adversely
affect oocyte quality and endocrine parameters, effects
which are especially pronounced after the first parturi-
tion. In the current study, on Day 32 pp oocytes matured
in vitro from ovaries of lactating or non-lactating females
showed higher nuclear and cytoplasmic maturation rates
than oocytes of lactating does on Day 25 pp. Addition-
ally, the percentage of cytoplasmic immature oocytes, with
non-migrated CGs, was also higher in does on Day 25 of
lactation. These results confirm the previously described
progressive improvement of reproductive performance
during lactation (Ubilla and Rebollar, 1995; Feugier and
Fortun-Lamothe, 2006).
Prolactin effects are related to the presence of its
receptor. Prolactin concentration fluctuates according
to lactation stage (Durand and Djiane, 1977), and it acts
directly on rabbit follicles, modulating follicular health
and development (Ben-Jonathan et al., 1996). In this study,
PRL-R appeared in different ovarian localizations, includ-
ing granulosa cells and antral follicle oocytes, matching
previous results (Kermabon et al., 1994; García-García et
al., 2007). However, we found no significant differences
in the cellular localization of prolactin receptor among
groups. Matching our results, previous studies showed
no differences between lactating and non-lactating rab-
bit does (Kermabon et al., 1994; Arias-Álvarez et al.,
2009). Some works have shown that localization of PRL-R
exhibits remarkable changes throughout the oestrus cycle
in ewe (Picazo et al., 2004), which is closely regulated by
hormones and/or local factors. In our work, rabbits are
probably having the physiological follicular wave on Days
23–30, pp, as is suggested by Ubilla and Rebollar (1995), so
time of oestrus cycle and endocrine environment, including
distribution of PRL receptor could be similar for all groups.
5. Conclusions
Early weaning at 25 dpp seems to improve body energy
stores of primiparous does, but this fact is not well reflected
on their ovarian status, which is better on Day 32 pp than
on Day 25 pp, regardless of weaning time and it could be
performed later.
Acknowledgements
This research was supported by the CICYT project
(AGL08-022283) and the Community of Madrid
(S2009/AGR1704).
300 O.G. Sakr et al. / Animal Reproduction Science 121 (2010) 294–300
References
Arias-Álvarez, M., López-Béjar, M., Rebollar, P.G., García-García, R.M.,
Lorenzo, P.L., 2007. Nuclear and cytoplasmic patterns of rabbit IVM
oocytes. Investigación Técnica Económica Agraria 28, 42–44.
Arias-Álvarez, M., García-García, R.M., Rebollar, P.G., Revuelta, L., Millán,
P., Lorenzo, P.L., 2009. Influence of metabolic status on oocyte qual-
ity and follicular characteristics at different post-partum periods in
primiparous rabbit does. Theriogenology 72, 612–623.
Ben-Jonathan, N., Mershon, J.L., Allen, D.L., Steinmetz, R.W., 1996. Extra-
pituitary prolactin: distribution, regulation, functions, clinical aspects.
Endocr. Rev. 17, 639–669.
BOE. Boletín Oficial del Estado, 2005. Real Decreto 1201/2005. Sobre pro-
tección de los animales utilizados para experimentación y otros fines
científicos. BOE 252, 34367–34391.
Brecchia, G., Bonanno, A., Galeati, G., Federici, G., Maranesi, M., Gobbetti,
A., Zerani, M., Boiti, C., 2006. Hormonal and metabolic adaptation to
fasting: effects on the hipotalamic–pituitary–ovarian axis and repro-
ductive performance of rabbit does. Domest. Anim. Endocrin. 31,
105–122.
Castellini, C., Dal Bosco, A., Mugnai, C., 2003. Comparison of different
reproductive protocols for rabbit doe: effect of litter size and re-
mating interval. Livest. Prod. Sci. 83, 131–139.
Castellini, C., Dal Bosco, A., Cardinali, C., 2006. Long term effect of post-
weaning rhythm on the body fat and performance of rabbit doe.
Reprod. Nutr. Dev. 46, 195–204.
Cervera, C.J., Fernández-Carmona, J., Viudes, P., Blas, E., 1993. Effect of
remating interval and diet on the performance of female rabbits and
their litters. Anim. Prod. 56, 399–405.
Dal Bosco, A., Castellini, C., Cardinali, R., 2003. Evaluation of body condi-
tion score in pregnant rabbit does by ultrasound scanner. In: Atti XV
Congresso. ASPA, Parma, pp. 480–482.
Diskin, M.G., Mackey, D.R., Roche, J.F., Sreenan, J.M., 2003. Effects of nutri-
tion and metabolic status on circulating hormones and ovarian follicle
development in cattle. Anim. Reprod. Sci. 78, 345–370.
Durand, P., Djiane, J., 1977. Lactogenic activity in the serum of rabbits
during pregnancy and lactation. Endocrinology 75, 33–42.
Edwards, R.G., 1965. Maturation in vitro of mouse, sheep, cow, pig, rhesus
monkey and human ovarian oocytes. Nature 208, 349–351.
Feugier, A., Fortun-Lamothe, L., 2006. Extensive reproductive rhythm and
early weaning improve body condition and fertility of rabbit does.
Anim. Res. 55, 459–470.
Fortun-Lamothe, L., 1998. Effects of pre-mating energy intake on repro-
ductive performance of rabbit does. Anim. Sci. 66, 263–269.
Fortun-Lamothe, L., Prunier, A., 1999. Effects of lactation, energetic deficit
and remating interval or reproductive performance of primiparous
rabbit does. Anim. Rep. Sci. 55, 289–298.
Fortun-Lamothe, L., Lamboley-Gaüzère, B., Bannelier, C., 2002. Prediction
of body composition in rabbit female using total body electrical con-
ductivity (TOBEC). Livest. Prod. Sci. 78, 132–142.
García-García, R.M., Arias-Álvarez, M., García-Palencia, P., Revuelta, L.,
Sánchez-Maldonado, B., Rebollar, P.G., Lorenzo, P.L., 2007. Local-
ización del receptor de prolactina en el ovario de conejas en diferentes
estados fisiológicos. II Congreso Ibérico de Cunicultura, IV Jornadas
Internacionales de Cunicultura y XXXII Symposium de Cunicultura.
5,6 junio. Ed. Asociación Española de Cunicultura, 41–46. Vila Real
(Portugal).
García-Palencia, P., Sánchez, M.A., Nieto, A., Vilar, M.P., González, M.,
Veiga-López, A., González-Bulnes, A., Flores, J.M., 2007. Sex steroid
receptor expression in the oviduct and uterus of sheep with estrus
synchronized with progestagen or prostaglandin analogues. Anim.
Reprod. Sci. 97, 25–35.
Gidenne, T., Lebas, F., 2006. Feeding behaviour in rabbits. In: Bels, V. (Ed.),
Feeding in Domestic Vertebrates. From Structure to Behaviour. CABI
Publishing, Wallingford, UK, pp. 179–209 (Chapter 11).
Kermabon, A.Y., Belair, L., Theau-Clement, M., Salesse, R., Djiane, J., 1994.
Effects of anoestrus and bromocryptine treatment on the expression
of prolactin and LH receptors in the rabbit ovary during lactation. J.
Reprod. Fertil. 102, 131–138.
Kranzfelder, D., Korr, H., Mestwerdt, W., Maurer-Schultze, B., 1984. Follicle
growth in the ovary of the rabbit after ovulation-inducing application
of human gonadotrophin. Cell Tissue Res. 238, 611–620.
Lebas, F., 1971. Composition chimique du lait de lapine, évolution au cours
de la traite et en fonction du stade de lactation. Annales de Zootechnie
20, 185–191.
Lebas, F., 1972. Effet de la simultanéité de la lactation et de la gestation sur
les performances latières chez la lapine. Ann. Zootech. 21, 129–191.
Lorenzo, P.L., Illera, J.C., Silván, G., Munro, C.J., Illera, M.J., Illera, M.,
1997. Steroid-level response to insulin-like growth factor-1 in oocytes
matured in vitro. J. Reprod. Immunol. 35, 11–29.
McNeilly, A.S., Glasier, A., Jonassen, J., Howie, P.W., 1982. Evidence for
direct inhibition of ovarian function by prolactin. J. Reprod. Fertil. 65,
559–569.
Nicodemus, N., Pereda, N., Romero, C., Rebollar, P.G., 2009. Évaluation de
la technique d’impedance bioélectrique (IBE) pour estimer la compo-
sition corporelle de lapines reproductrices. In: Bolet, G. (Ed.), 13 èmes
Journées de la Recherche Cunicole. 17–18 novembre 2009, LeMans,
France, pp. 109–112.
Pascual, J.J., Cervera, C., Blas, E., Fernández-Carmona, J., 1999. Effect of
high fat diets on the performance, milk yield and milk composition of
multiparous rabbit does. Anim. Sci. 68, 151–162.
Pascual, J.J., Motta, W., Cervera, C., Quevedo, F., Blas, E., Fernández-
Carmona, J., 2002. Effect of dietary energy source on the performance
and peri-renal fat thickness evolution of primiparous rabbit does.
Anim. Sci. 75, 267–279.
Parigi Bini, R., Xiccato, G., 1998. Energy metabolism and requirements.
In: De Blas, J.C., Wiseman, J. (Eds.), The Nutrition of the Rabbit. CABI
Publishing, Wallingford, UK, pp. 103–131.
Pereda, N., 2010. Evaluación de la técnica del Análisis de Impedancia
Bioeléctrica para predecir la composición corporal: aplicación en
conejas sometidas a diferentes sistemas de alimentación durante la
recría. In: Tesis Doctoral. Universidad Politécnica de Madrid, Madrid,
Spain, pp. 194.
Picazo, R.A., García Ruiz, J.P., Santiago Moreno, J., González de Bulnes,
A., Muñoz, J., Silván, G., Lorenzo, P.L., Illera, J.C., 2004. Cellular local-
ization and changes in expression of prolactin receptor isoforms in
sheep ovary throughout the estrous cycle. Reproduction 128, 545–
553.
Rebollar, P.G., Bonanno, A., Di Grigoli, A., Tornambè, G., Lorenzo, P.L., 2008.
Endocrine and ovarian response after a 2-Day controlled suckling
and eCG treatment in lactating rabbit does. Anim. Reprod. Sci. 104,
316–328.
Rebollar, P.G., Pérez-Cabal, M.A., Pereda, M.A., Lorenzo, P.L., Arias-Álvarez,
M., García-Rebollar, P., 2009. Effects of parity order and reproductive
management on the efficiency of rabbit productive systems. Livest.
Sci. 123, 107–115.
SAS/STAT, 1999–2001. SAS 7. In: STAT User’s Guide (Release 8.2). SAS Inst.
Inc., Cary, NC.
Tietz, N.W., 1995. Clinical Guide to Laboratory Tests, 3rd Ed. W.B. Saunders
Co., Philadelphia, pp. 518–519.
Torner, H., Kubelka, M., Heleil, B., Tomek, W., Aim, H., Kuzmina, T., Guiard,
V., 2001. Dynamics of meiosis and protein kinase activities in bovine
oocytes correlated to prolactin treatment and follicle size. Theri-
ogenology 55, 885–899.
Ubilla, E., Rebollar, P.G., 1995. Influence of the postpartum day on
plasma oestradiol-17␤ levels, sexual behavior and fertility rate
in artificially inseminated lactating rabbits. Anim. Reprod. Sci. 38,
337–344.
Ubilla, E., Rebollar, P.G., Pazo, D., Esquifino, A., Alvariño, J.M., 2000. Effects
of doe litter separation on endocrinological and productivity variables
in lactating rabbits. Livest. Sci. 67, 67–74.
Xiccato, G., Trocino, A., Sartori, A., Queaque, P.I., 2004. Effect of parity order
and litter weaning age on the performance and body energy balance
of rabbit does. Livest. Prod. Sci. 16, 239–251.
Xiccato, G., Trocino, A., Boiti, C., Brecchia, G., 2005. Reproductive rhythm
and litter weaning age as they affect rabbit doe performance and body
energy balance. Anim. Sci. 81, 289–296.
Yanagimachi, R., 1994. Mammalian fertilization. In: Knobil, E.,
Neill, J.D. (Eds.), The Physiology of Reproduction. Raven Press,
pp. 189–279.
Yoshimura, Y., Hosoi, Y., Irritan, A., Nakamura, Y., Atlas, S.J., Wal-
lach, E.E., 1989. Developmental potential of rabbit oocyte matured
in vitro: the possible contribution of prolactin. Biol. Reprod. 41,
26–33.