PROTOCOL

Design and cloning of lentiviral vectors expressing

small interfering RNAs
Gustavo Tiscornia, Oded Singer & Inder M Verma

The Salk Institute for Biological Studies, Laboratory of Genetics, 10010 North Torrey Pines Road, La Jolla, California 92037, USA. Correspondence should be addressed to
I.M.V. (verma@salk.edu).

Published online 27 June 2006; doi: 10.1038/nprot.2006.36

RNA interference (RNAi) has emerged as a powerful technique to downregulate gene expression. The use of polIII promoters to
express small hairpin RNAs (shRNAs), combined with the versatility and robustness of lentiviral vector–mediated gene delivery to
© 2006 Nature Publishing Group http://www.nature.com/natureprotocols

a wide range of cell types offers the possibility of long-term downregulation of specific target genes both in vitro and in vivo. The
use of silencing lentivectors allows for a rapid and convenient way of establishing cell lines (or transgenic mice) that stably express
shRNAs for analysis of phenotypes produced by knockdown of a gene product. Here we present two possible protocols describing the
design and cloning of silencing lentiviral vectors. These protocols can be completed in less than 3 weeks.

INTRODUCTION
The procedures described in this protocol will allow the reader
to take full advantage of the combination of two powerful tech-
niques, lentiviral vector technology for gene transfer and gene
silencing by RNAi. While a comprehensive description of the
basic biology underlying these two techniques is beyond the
scope of this protocol, a very brief overview of each will be given,
along with literature references containing more detailed infor-
mation for readers unfamiliar with these technologies. This step-
by-step protocol is designed as a comprehensive set of instruc-
tions for the researcher with basic molecular skills (but not nec-
essarily experience in either lentiviral vectors or RNAi) seeking
to clone a lentiviral vector capable of efficient downregulation of
a particular target; it is intended to be used in conjunction with
the accompanying protocol1 describing production and purifi-
cation of lentiviral vectors. It must be emphasized that because
residual levels of expression (commonly 5–15% of wild-type
expression levels) remain even with the most efficient shRNAs,
the technique produces hypomorphs, not nulls; thus, the suit-
ability of the approach will depend on the particular target gene
in question. For example, effective knockdown of a hypothetical
enzyme for which 5% of wild-type expression levels are enough
to preserve wild-type function will not be expected to result in
a phenotype.
mobilization in the transduced cell6,7. For further description of
the lentiviral vector system, see ref. 1.
Overview of RNAi
RNAi has forcefully emerged as a pathway constituting a whole
new level of control of gene expression8. The pathway has been
under intense study, and details of its basic biological mecha-
nism are described elsewhere8–13. Briefly, short 21–23 nucleotide
double-stranded small interfering RNAs (siRNAs) are incorpo-
rated into a multi-component nuclease complex (RISC: RNA–
induced silencing complex) that selects and degrades mRNAs
that contain a target complementary to the antisense strand of the
siRNA14,15. In mammalian systems, siRNAs can be delivered by
either transient transfection of synthetic siRNAs16,17 or transient
or stable transfection (if viral vectors are used, transduction) of
constructs expressing shRNAs from polIII promoters18–22. More
recently, methods have been developed for using polII promoters
for expression of shRNAs in the context of microRNA precur-
sors23–25. The shRNA is processed by the endogenous microRNA
pathway, resulting in the production of a mature siRNA and
subsequent degradation of the target mRNAs. For further read-
ing on various aspects of shRNA and microRNA biology, see
refs. 12,13,26–31.

Overview of lentiviral vectors
Lentiviral vectors derived from HIV-1 are capable of transduc-
ing a wide variety of dividing and non-dividing cells, and they
integrate stably into the host genome, resulting in long-term
expression of the transgene2. The presence of vesicular stoma-
titis virus glycoprotein (VSVG) in the viral envelope membrane
confers the viral particle with the ability to transduce a broad
range of cell types, including primary cells, stem cells and early
embryos3–5. An important safety feature is provided by a dele-
tion of the promoter-enhancer region in the 3′LTR (SIN vec-
tors). During reverse transcription the proviral 5′LTR is copied
from the 3′LTR, thus transferring the deletion to the 5′LTR; the
deleted 5′LTR of the integrated provirus is therefore transcrip-
tionally inactive, preventing subsequent viral replication or
Design and cloning of lentiviral vectors expressing shRNAs
The two polIII promoters most commonly used for hairpin
expression are H1 and U6 (both human and mouse); both pro-
moters have efficient, ubiquitous expression and are essentially
equivalent for in vitro experiments, although expression effi-
ciency differences in vivo have been reported32. PolIII promoters
are of compact size (less than 400 bp) and (because all sequenc-
es required for promoter function are upstream of the +1 tran-
scriptional start site33) are ideally suited to express shRNAs
consisting of approximately 60 nucleotides that include a 21–23
nucleotide sense sequence that is identical to the target sequence
in the mRNA to be downregulated, followed by a 9-nucleotide
loop and an antisense 21–23 nucleotide sequence. A stretch
of five Ts provides a polIII transcriptional termination signal.

234 | VOL.1 NO.1 | 2006 | NATURE PROTOCOLS

 PROTOCOL

BOX 1 VALIDATION OF THE CLONED shRNA CASSETTES

The simplest way to validate the shRNA cassettes is to coexpress a tagged cDNA of the target gene together with the shRNA silencing
cassette in an easily transfected cell line (e.g., 293T HEK cells). This approach will work even with modest transfection efficiencies,
an advantage that is lost if knockdown of the endogenous target is chosen as the validation method. Typically, proceed as described
below:
(i) Seed 105 293T HEK cells in a 24-well plate the day before transfection.
(ii) Mix target cDNA plasmid with the plasmid containing the silencing cassette in 1/5 molar ratio. If comparing different wells,
include a cotransfection control (ideally, a plasmid expressing any cDNA of a size different from the tagged cDNA being knocked
down, but containing the same tag, so as to detect both proteins with the same antibody); aim for a total amount of DNA of
1 µg/well and be sure to equalize the total amount of DNA transfected per well, filling up with nonspecific plasmid DNA if
necessary.
© 2006 Nature Publishing Group http://www.nature.com/natureprotocols

(iii) Transfect the DNA mix into the cells using Fugene or equivalent transfection reagent.
(iv) Perform western blot analysis Harvest protein 48–72 h after transfection. A caveat can arise if you choose to test the silencing
cassette by transfecting the lentiviral silencing vector (as opposed to a plasmid expressing only the shRNA) mixed with a tagged
cDNA driven by a CMV promoter. Since the silencing lentivector plasmid also contains GFP driven by CMV, cotransfecting both
plasmids will result in less expression of the tagged cDNA target simply due to promoter competition. The appropriate control is a
1/5 molar ratio transfection of the target cDNA plasmid and L-CMV-GFP (containing no silencing cassette).

The total length of the silencing cassette is ~350 bp. Expression
results in a short 21–23 bp hairpin; the loop is cleaved by the
endonuclease Dicer and the resulting siRNA triggers degrada-
tion of the target gene mRNA.
Development and validation of an efficient lentiviral silenc-
ing vector involves (i) selection of siRNA target sequences and
design of shRNAs, (ii) cloning and validation of shRNAs and
(iii) cloning the lentiviral silencing vector.
Selection of siRNA target sequences and design of shRNAs
A number of algorithms have been developed to predict effec-
tive siRNA sequences34–38 and many of them are available online
for free or commercial use (e.g., http://www.ambion.com or
http://sfold.wadsworth.org). Typically, 4–6 shRNAs need to be
generated and tested for every target gene. In general, the target
sequence should be 21–23 bases long, but lengths of up to 28
bases have been reported22. Longer targets should be avoided,
as longer dsRNA molecules can trigger a PKR (protein kinase
activated by double stranded RNA) response39. A database
search is recommended to filter out candidate targets that are
present in other genes to avoid silencing of these loci. The G/C
content should be 40–55%. shRNAs driven by the H1 promoter
can begin with any base, but efficiency of expression from a U6
promoter depends on the first base transcribed, with G result-
ing in strong expression and efficiency decreasing with other
bases40. shRNAs can be directed to the 5′UTR, ORF or 3′UTR of
the target mRNA as desired. Strings of identical bases should be
avoided in order to avoid stalling by the RNA polymerase III (in
particular 5 Ts constitute a polIII transcriptional termination
signal). As a loop we generally use the 9 bp sequence (TTC AAG
AGA)18, but a variety of loops have been reported. The design of
an shRNA hairpin for a given target is best explained by example
(see Step 1).
Cloning and validation of shRNAs
The candidate shRNAs are cloned into a plasmid containing
only the silencing cassette (see Steps 1A and 1B) and tested for
efficiency of downregulation (Box 1).
Cloning lentiviral silencing vectors
When an efficient shRNA candidate has been identified, it is
cloned into the lentiviral vector (see Steps 1A and 1B). High-
titer lentiviral suspensions can be prepared and validated for
target downregulation (Box 2)1.

MATERIALS
REAGENTS •NheI restriction enzyme
• Plasmid expressing a tagged cDNA target • SspI restriction enzyme
• Mammalian cells: 293T human embryonic kidney (HEK; Invitrogen cat. no. • Bacterial strains: general cloning-competent E. coli, such as TOP10 (Invitrogen
R700-07) cat. no. 44-0301 or DH5α (Invitrogen cat. no.18265-017).
• Transfection reagent: Fugene (Roche cat. no. 11814443001) FOR STEP 1B ONLY:
• LB-Ampicillin plates and media • Plasmids: pENTR/U6 (Invitrogen cat. no. K4945-00); L-pDest-CMV-GFP
(Verma Lab, Salk Institute for Biological Studies)
FOR STEP 1A ONLY:
• Custom-designed oligonucleotides (O1 and O2, order at 200 µM
• Plasmids: pH1; L-CMV-GFP-NheI (Verma Lab, Salk Institute for Biological
concentration, PAGE purified; for design, see Step 1Bi)
Studies)
• Primers: hU6-F: 5′-GGACTATCATATGCTTACCG-3′, M13-Reverse
• PCR reagents (Advantage GC-2 Polymerase Mix (BD cat. no. 639114)
• BsaI restriction enzyme
• Primers (P1 and P2; for design, see Step 1A)
• NdeI restriction enzyme
• H1-F: 5′-TGGCAGGAAGATGGCTGTGA-3′
• ClaII restriction enzyme
• XbaI restriction enzyme

NATURE PROTOCOLS | VOL.1 NO.1 | 2006 | 235

 PROTOCOL
• AvaII restriction enzyme • LR clonase (Invitrogen cat. no. 11791-020)
• Bacterial strains: transformation-competent E. coli DB3.1 (Invitrogen cat. no. • 10× annealing buffer: 100 mM Tris-HCl pH 8, 10 mM EDTA, 1M NaCl
11782-018) and E. coli STBL3 (Invitrogen cat. no. C7373-03) EQUIPMENT
• LB-Kanamycin plates and media • PCR machine
• Proteinase K (2 µg/µl) • DNA electrophoresis equipment
• SDS-PAGE electrophoresis equipment

PROCEDURE
Lentiviral vector creation and cloning a
A lentiviral vector carrying GFP as a marker and the
silencing cassette positioned in the 3′LTR (Option A) results
in duplication of the silencing cassette upon proviral
integration. While this maximizes the silencing power of the
© 2006 Nature Publishing Group http://www.nature.com/natureprotocols

vector, it can also lead to lower expression of the marker

because the siRNA target sequence is also present in the
mRNA expressing the marker gene (GFP). To avoid this b
problem, use option B, in which the silencing cassette is
cloned upstream of the marker; in this case, only one copy of c
the silencing cassette will be delivered per viral particle.
(A) Clone the silencing cassette into a unique NheI site d
in the 3′LTR of a lentiviral vector expressing GFP as a
marker (this cloning strategy is summarized in Fig. 1).
(i) Select target and design primers to amplify the
silencing cassette. Select a target within the
e
gene to be silenced (e.g., for human p53: 5′-
GACTCCAGTGGTAATCTAC-3′; ref. 41). The forward primer
(P1) must contain a NheI-compatible site such as
XbaI. The reverse primer (P2) includes sequence
complementary to the entire shRNA cassette (in the
5′-to-3′ orientation of the primer: XbaI site + 5As +
target sense sequence + loop anti-sense sequence
+ target anti-sense sequence) followed by 22 bases
complementary to the last 22 bases upstream of the Figure 1 | Cloning scheme for Option A. The most convenient procedure is
+1 transcriptional start site (sense strand) of the to PCR amplify the silencing cassette42 from a template polIII promoter by
using a 5′ forward primer (P1) upstream of the polIII promoter (containing
polIII promoter (Fig. 1a). For the human p53 target
an NheI-compatible site such as XbaI) and a 3′ reverse primer (P2)
suggested above, design the following 3′ reverse that includes sequence complementary to the entire shRNA (in 5′-to-3′
primer: 5′CTGTCTAGACAAAAAGACTCCAGTGGTAATCTACTCT orientation of the primer: XbaI site + 5As + target sense sequence + loop
CTTGAAGTAGATTACCACTGGAGTcGGGGATCTGTGGTCTCATA anti-sense sequence + target anti-sense sequence) followed by 22 bases
CA3′, where sequence in italic bold is complementary complementary to the last 22 bp upstream of the +1 transcriptional start
to the H1 promoter, XbaI is underlined, the loop is bold site (sense strand) of the polIII promoter (Fig. 1a). The resulting shRNA
expression cassette can be cloned into an A/T sequencing vector
underlined and nucleotide +1 is in small caps. (Fig. 1b), sequenced to confirm hairpin integrity (Fig. 1c), tested for target
(ii) Amplify the silencing cassette. Using P1 and P2 knockdown efficiency as described in Box 1 (Fig. 1d) and subsequently
primers (final primer concentration is 10 µM) subcloned into the lentiviral vector (Fig. 1e).
described above, use 10 ng template pH1 to PCR
amplify the silencing cassette. Use the reaction
conditions described below.
▲ CRITICAL STEP It is essential to add DMSO or other similar agents in order to weaken hydrogen bonding and prevent
formation of hairpin structure. We use Advantage GC-2 polymerase mix (BD) with GC melt additive, or add 7% DMSO to a
regular Taq polymerase reaction to prevent hairpin formation.

Cycle number Denaturation Annealing Polymerization

1 3 min at 94 °C
2–31 30 s at 94 °C 30 s at 55 °C 40 s at 72 °C
32 10 min at 72 °C

236 | VOL.1 NO.1 | 2006 | NATURE PROTOCOLS

 PROTOCOL
(iii) Clone and sequence the silencing cassette. PCR amplification should result in a ~400 bp fragment. Clone the insert
into an A/T sequencing vector and sequence it, as mutations in the hairpin potentially introduced by PCR can have
considerable impact on silencing efficiency.
(iv) Verify the knockdown efficiency of the silencing cassette as indicated in Box 1.
(v) Transfer the silencing cassette to the lentiviral vector and resequence the hairpin. The insert must be digested with
the XbaI, gel purified, ligated into the lentivector (previously linearized with NheI, dephosphorylated and gel purified)
and transformed. Plasmid DNA from the resulting colonies can be screened by digestion with SspI. The parental vector
should have only one SspI site, whereas the vector containing the insert will acquire an additional SspI site located in
the H1 promoter, resulting in an insert of 1.4 kb or 1.6 kb, depending on orientation (which has no effect on silencing
efficiency). Re-verify the hairpin by sequencing with primer H1-F.
(vi) High titer lentiviral preparations can be prepared as described in ref. 1 and tested for efficiency of target
downregulation (Box 2).
(B) Creation of a lentiviral vector carrying GFP as a marker and cloning the silencing cassette upstream of the GFP
© 2006 Nature Publishing Group http://www.nature.com/natureprotocols

marker. This version of the lentiviral silencing system has been adapted to Gateway cloning technology (Invitrogen),
allowing for a more convenient cloning procedure, as explained in Figure 2.
(i) Select target and design oligonucleotides to generate the hairpin insert. Select a target within the gene to be
silenced (e.g., for human p53: 5′-GACTCCAGTGGTAATCTAC-3′; ref. 41). Cloning of the shRNA will require designing two
complementary oligonucleotides (O1 and O2) and annealing them to generate an insert with BsaI-compatible termini for
subsequent cloning into pENTR/U6, as described below. For example, for the human p53 target sequence given above,
the required oligonucleotides, after annealing, would look as follows, where the sense strand of the hairpin is in italics,
the loop is in bold and the antisense strand of the hairpin is underlined (note the 5′ overhangs present at both ends of
the annealed product).
5′CACCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTGGAGTC 3′
3′CTGAGGTCACCATTAGATGAAGTTCTCTCATCTAATGGTGACCTCAGAAAA5′
(ii) Prepare the hairpin insert. Perform the oligonucleotide annealing procedure by mixing: 5 µl O1 (200 µM), 5 µl O2
(200 µM) and 2 µl 10× annealing buffer, and adjust to 8 µl final volume with H2O. This results in 50 µM final
concentration for each oligonucleotide. Heat the annealing mixture to 94 °C for 5 min and then use a PCR machine to
cool to 25 °C at 0.1 °C/s. Even at 50 µM final concentration, the efficiency of the reaction is only ~50%. Efficiency of
annealing can be ascertained by running an aliquot of the annealed oligonucleotides (5 µωl of a 1/100 dilution of the
annealing mix) on a 4% agarose gel. Single-stranded oligonucleotides will migrate as a hairpin of ~30 bases, whereas
the annealed product will migrate at its predicted size (~60 bp).
? TROUBLESHOOTING
(iii) Ligate the hairpin insert into pENTR/U6. Dilute annealing mix 1:1,000 in H20 and clone into the BsaI linearized pENTR/
U6 vector. A diagram of pENTR/U6 is shown in Figure 2a.
▲ CRITICAL STEP pENTR/U6 has a ccdB toxic gene and must therefore be propagated in tolerant strains such as E. coli
DB3.1. When this plasmid is digested with BsaI (Invitrogen sells it already linearized with BsaI), the vector is left with

BOX 2 VALIDATION OF LENTIVIRAL SILENCING VECTOR SUSPENSIONS

The final validation of high titer viral preparations by transduction of a cell line expressing the target protein, followed by
measuring target expression by RT-PCR, northern or western blot) is crucial. Overexpression of any siRNA can cause some nonspecific
downregulation of gene expression; therefore, inclusion of adequate controls is critical. Appropriate controls are lentiviral vectors
carrying a silencing cassette expressing an shRNA against no known target, a different (nonrelated) target, or lacking a silencing
cassette altogether. Furthermore, any knockdown experiment should show similar knockdown phenotypes using a minimum of two
different shRNAs in order to rule out the possibility that the observed phenotype is due to nonspecific effects. Transduction at
several MOIs should be tested. Precise determination of efficiency of downregulation of the target will require testing homogeneously
transduced cell populations, which can be obtained by transducing at high MOIs or by FACS sorting for GFP-positive cells. The MOI
required to silence a given target will depend on the levels of expression of the target mRNA, siRNA efficiency and the transducibility
of the cell type involved. Typically, proceed as described below:
(i) Seed 105 293T HEK cells in a 24-well plate the day before transduction.
(ii) Add an aliquot of lentiviral silencing vector to the well and mix gently. Return plates to the incubator. GFP fluorescence should
start appearing after 24 h and be very clear by 48 h. Lack of GFP fluorescence indicates a problem during lentiviral production or
that the promoter driving GFP is not efficient in the cell type transduced. The cells may by expanded, passaged and FACS sorted as
required.
(iii) Determine knockdown efficiency by RT-PCR, northern or western blot analysis.

NATURE PROTOCOLS | VOL.1 NO.1 | 2006 | 237

 PROTOCOL
the following termini, which are compatible with the a Cut pENTR/U6 with BsaI
termini of the insert: BsaI BsaI
XXXXX 3′ 5′ TTTTTXXXXXXX attL1 hU6 ccdB T5 attL2

XXXXXGTGG 5′ 3′ AXXXXXXX BsaI BsaI

T5 attL2
Typically, 50 ng of vector are ligated to 2–3 µl of a attL1 hU6

1/1,000 dilution of the annealed product. Transform

competent bacteria and select on LB-kanamycin plates. b Anneal O1/O2
shRNA
? TROUBLESHOOTING
(iv) Analyze transformants. Resulting plasmids will have
the structure shown in Figure 2c; plasmid DNA from c Clone shRNA into pENTR/U6

colonies can be digested with NdeI-XbaI and run on a attL1 hU6 shRNA T5 attL2

4% agarose gel. Clones containing inserts will show a

band of 127 bp compared to a 76 bp band for clones
© 2006 Nature Publishing Group http://www.nature.com/natureprotocols

d Sequence
lacking an insert. The nucleotide sequence of the
shRNA insert should be determined with hU6-F and e Verify KD efficiency (Box 1)
M13-R primers to check hairpin integrity.
(v) Test the silencing cassettes for silencing efficiency as
f Perform LR clonase reaction
explained in Box 1.
(vi) Perform the LR recombination reaction. The L-CMV-GFP attL1 hU6 shRNA T5 attL2

destination vector is shown in Figure 3e. Initially

set up the LR recombination reaction by mixing RSV attR1 ccdB attR2 cPPT CMV GFP WPRE 3' LTR

100–300 ng of entry vector, 150 ng of destination

vector and 4 µl of 5× LR buffer, and making up to 20 µl RSV attB1 hU6 shRNA T5 attB2 cPPT CMV GFP WPRE 3' LTR

final volume with H2O. Incubate at room temperature

(22 – 26°C) overnight. Add 2 µl of Proteinase K (2
Figure 2 | Cloning scheme for Option B. The pENTR/U6 vector is linearized
µg/µl) mg/ml) and incubate 10 min at 37 °C. Transform with BsaI (Fig. 3a). An shRNA hairpin is created by annealing (Fig. 3b)
STBL3 (or equivalent recombination deficient strain) and cloned into pENTR/U6 (Fig. 3c). This procedure results in a pENTR/u6
competent bacteria with 2 µl of LR reaction mix. plasmid containing a hU6 driven silencing cassette flanked by recombination
▲ CRITICAL STEP Use of nonrecombination-deficient sites from phage lambda (attL1 and attL2). The silencing cassette should
bacteria can result in unwanted recombination events be sequenced to confirm hairpin integrity (Fig. 3d), tested for target
knockdown efficiency as described in Box 1 (Fig. 3e) and subsequently
within the plasmid). Plate on LB-ampicillin plates. transferred to the lentiviral destination vector (L-Dest-CMV-GFP, a lentiviral
? TROUBLESHOOTING vector with a Gateway destination cassette (phage lambda attR1 and attR2
(vii) Analyze resulting clones. The resulting constructs will recombination sites flanking a ccdB toxic gene) cloned upstream of the GFP
have the structure depicted in Figure 2f, and plasmid marker) by performing an LR clonase reaction (Fig. 3f). Further information
DNA can be digested with ClaI-AvaI. Clones containing on the Gateway Cloning system can be found at http://www.invitrogen.com.
the silencing cassette should have a ~700 bp insert,
whereas the unrecombined parental destination vector
will show a 1.9 kb insert. Sequence positive clones with hU6-F primer to check hairpin integrity.
? TROUBLESHOOTING
(viii) High-titer lentiviral preparations can be prepared as described in ref. 1 and tested for silencing efficiency (Box 2).

● TIMING
Option A:
Day 1: select target and design primers
Day 2: amplify silencing cassette
Days 3–9: clone and sequence the silencing cassettes
Days 10–13: verify knockdown efficiency
Days 14–19: transfer silencing cassette to the lentiviral vector and sequence

Option B:
Day 1: select target and design oligonucleotides
Day 2: prepare hairpin insert
Days 3–8: clone and sequence silencing cassettes
Days 9–12: verify knockdown efficiency
Days 13–18: transfer silencing cassette to lentivector and sequence

238 | VOL.1 NO.1 | 2006 | NATURE PROTOCOLS

 PROTOCOL
? TROUBLESHOOTING
See Table 1.

TABLE 1 | Troubleshooting table.

STEP PROBLEM
1Bii Low oligonucleotide annealing efficiency may be caused
by excess salt in the oligonucleotide stock solution
1Biii Absence of kanamycin-1 resistant colonies may be due to
low ligation efficiency caused by low annealing efficiency
1Bvi Absence of colonies may be due to excess volume of
ligation reaction, especially if the PEG-based ligation
buffer provided with the LR clonase kit is used
© 2006 Nature Publishing Group http://www.nature.com/natureprotocols
SOLUTION
Purify the oligonucleotides by ethanol precipitation
Analyze annealing efficiency in Step 1Bii by agarose gel
electrophoresis
Adhere to the recommended ligation volume (2 µl of ligation
reaction in 100 µl competent cell suspension) added to the
transformation

1Bvii Unexpected restriction digest patterns in the ampicillin-

resistant colonies may have two causes:
a) Erroneous use of kanamycin instead of ampicillin,
resulting in growth of colonies harboring pENTR/U6
instead of L-Dest-CMV-GFP
b) Use of bacterial strains that are not recombination
deficient
a) Use the correct antibiotic selection (ampicillin)
b) Adhere to the recommended STBL3 (or equivalent recombination-
deficient) E. coli competent bacteria; if recombination problems
persist, grow the transformation plates and the individual colony DNA
minipreparations at 30 °C, avoiding growth into stationary phase

ANTICIPATED RESULTS a UT L318 L339 b UT L318 L339

The protocols described here are very MOI 0 10 10 MOI 0 10 100 10 100
robust; adherence to the recommended htt
procedures should result in relatively
GFP
problem-free cloning. Lentiviral 28S
silencing vectors described in this
protocol routinely result in a high c
degree of knockdown (>90%) both in
htt
vitro and in vivo. An example of in vitro htt

results is given in Figure 3. p300

Figure 3 | An example of an efficient lentiviral silencing vector. A lentiviral silencing vector was
developed (Option B) to express an shRNA against primate huntingtin (L339) or an shRNA against no
known target (L318). A primate cell line was transduced with MOI of 0 (untransduced control), 10 or 100.
Cells were expanded during six consecutive passages and FACS-sorted for GFP+ cells. Levels of endogenous
huntingtin in all three lines were assessed by (a) imunohistochemistry, (b) northern blot and (c) western
blot. The 28S ribosomal band and p300 are shown as loading controls in b and c, respectively.

ACKNOWLEDGMENTS The authors wish to thank Kenneth Fringpong and Knut
Madden of Invitrogen Corporation for their assistance in development of the L-
pDest-cmv-gfp vector.
COMPETING INTERESTS STATEMENT The authors declare that they have no
competing interests.
Published online at http://www.natureprotocols.com/
Reprints and permissions information is available online at http://npg.nature.
com/reprintsandpermissions/
1. Tiscornia, G., Singer, O. and Verma, I.M. Production and purification of
lentiviral vectors. Nat. Protocols 1, 241–245 (2006).
2. Trono, D. Lentiviral Vectors (Berlin-Heidelberg, Springer-Verlag, 2002).
3. Naldini, L. et al. In vivo gene delivery and stable transduction of nondividing
cells by a lentiviral vector. Science 272, 263–267 (1996).
4. Pfeifer, A., Ikawa, M., Dayn, Y. & Verma, I.M. Transgenesis by lentiviral
vectors: lack of gene silencing in mammalian embryonic stem cells and
preimplantation embryos. Proc. Natl. Acad. Sci. USA 99, 2140–2145 (2002).
5. Lois, C., Hong, E.J., Pease, S., Brown, E.J. & Baltimore, D. Germline
transmission and tissue-specific expression of transgenes delivered by
lentiviral vectors. Science 295, 868–872 (2002).
6. Miyoshi, H., Blomer, U., Takahashi, M., Gage, F.H. & Verma, I.M. Development
of a self-inactivating lentivirus vector. J. Virol. 72, 8150–8157 (1998).
7. Zufferey, R. et al. Self-inactivating lentivirus vector for safe and efficient in
vivo gene delivery. J. Virol. 72, 9873–9880 (1998).
8. Denli, A.M. & Hannon, G.J. RNAi: an ever-growing puzzle. Trends Biochem.
Sci. 28, 196–201 (2003).

NATURE PROTOCOLS | VOL.1 NO.1 | 2006 | 239

 PROTOCOL
9. Du, T. & Zamore, P.D. microPrimer: the biogenesis and function of microRNA.
Development 132, 4645–4652 (2005).
10. Chen, P.Y. & Meister, G. microRNA-guided posttranscriptional gene
regulation. Biol. Chem. 386, 1205–1218 (2005).
11. Lund, E., Guttinger, S., Calado, A., Dahlberg, J.E. & Kutay, U. Nuclear export
of microRNA precursors. Science 303, 95–98 (2004).
12. Kim, V.N. MicroRNA precursors in motion: exportin-5 mediates their nuclear
export. Trends Cell Biol. 14, 156–159 (2004).
13. Lee, Y. et al. The nuclear RNase III Drosha initiates microRNA processing.
Nature 425, 415–419 (2003).
14. Fjose, A., Ellingsen, S., Wargelius, A. & Seo, H.C. RNA interference:
mechanisms and applications. Biotechnol. Annu. Rev. 7, 31–57 (2001).
15. Hannon, G.J. RNA interference. Nature 418, 244–251 (2002).
16. Elbashir, S.M. et al. Duplexes of 21-nucleotide RNAs mediate RNA
interference in cultured mammalian cells. Nature 411, 494–498 (2001).
17. Oliveira, D.M. & Goodell, M.A. Transient RNA interference in hematopoietic
© 2006 Nature Publishing Group http://www.nature.com/natureprotocols
progenitors with functional consequences. Genesis 36, 203–208 (2003).
18. Brummelkamp, T.R., Bernards, R. & Agami, R. A system for stable expression
of short interfering RNAs in mammalian cells. Science 296, 550–553 (2002).
19. Miyagishi, M. & Taira, K. U6 promoter-driven siRNAs with four uridine 3�
overhangs efficiently suppress targeted gene expression in mammalian cells.
Nat. Biotechnol. 20, 497–500 (2002).
20. Rubinson, D.A. et al. A lentivirus-based system to functionally silence
genes in primary mammalian cells, stem cells and transgenic mice by RNA
interference. Nat. Genet. 33, 401–406 (2003).
21. Tiscornia, G., Singer, O., Ikawa, M. & Verma, I.M. A general method for gene
knockdown in mice by using lentiviral vectors expressing small interfering
RNA. Proc. Natl. Acad. Sci. USA 100, 1844–1848 (2003).
22. Paddison, P.J., Caudy, A.A., Bernstein, E., Hannon, G.J. & Conklin, D.S. Short
hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian
cells. Genes Dev. 16, 948–958 (2002).
23. Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J. & Elledge, S.J. A lentiviral
microRNA-based system for single-copy polymerase II–regulated RNA
interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102, 13212–
13217 (2005).
24. Vaucheret, H. MicroRNA-dependent trans-acting siRNA production. Sci. STKE
300, pe43 (2005).
25. McManus, M.T., Petersen, C.P., Haines, B.B., Chen, J. & Sharp, P.A. Gene
240 | VOL.1 NO.1 | 2006 | NATURE PROTOCOLS
silencing using micro-RNA designed hairpins. Rna 8, 842–850 (2002).
26. Dudley, N.R. & Goldstein, B. RNA interference: silencing in the cytoplasm and
nucleus. Curr. Opin. Mol. Ther. 5, 113–117 (2003).
27. Pe’ery, T., Mathews, M.B. & Baulcombe, D. RNA interference. Methods 30,
287–288 (2003).
28. Cullen, B.R. Transcription and processing of human microRNA precursors. Mol.
Cell 16, 861–865 (2004).
29. Gregory, R.I., Chendrimada, T.P., Cooch, N. & Shiekhattar, R. Human RISC
couples microRNA biogenesis and posttranscriptional gene silencing. Cell
123, 631–640 (2005).
30. Zeng, Y. & Cullen, B.R. Sequence requirements for micro RNA processing and
function in human cells. Rna 9, 112–123 (2003).
31. Zeng, Y. & Cullen, B.R. Structural requirements for pre-microRNA binding and
nuclear export by Exportin 5. Nucleic Acids Res. 32, 4776–4785 (2004).
32. Makinen, P.I. et al. Stable RNA interference: comparison of U6 and H1
promoters in endothelial cells and in mouse brain. J. Gene Med. (2006).
33. Myslinski, E., Ame, J.C., Krol, A. & Carbon, P. An unusually compact external
promoter for RNA polymerase III transcription of the human H1RNA gene.
Nucleic Acids Res. 29, 2502–2509 (2001).
34. Amarzguioui, M. & Prydz, H. An algorithm for selection of functional siRNA
sequences. Biochem. Biophys. Res. Commun. 316, 1050–1058 (2004).
35. Jagla, B. et al. Sequence characteristics of functional siRNAs. Rna 11, 864–
872 (2005).
36. Reynolds, A. et al. Rational siRNA design for RNA interference. Nat.
Biotechnol. 22, 326–330 (2004).
37. Santoyo, J., Vaquerizas, J.M. & Dopazo, J. Highly specific and accurate
selection of siRNAs for high-throughput functional assays. Bioinformatics 21,
1376–1382 (2005).
38. Ui-Tei, K. et al. Guidelines for the selection of highly effective siRNA
sequences for mammalian and chick RNA interference. Nucleic Acids Res 32,
936–948 (2004).
39. Clemens, M.J. & Elia, A. The double-stranded RNA-dependent protein kinase
PKR: structure and function. J. Interferon Cytokine Res. 17, 503–524 (1997).
40. Boden, D. et al. Promoter choice affects the potency of HIV-1-specific RNA
interference. Nucleic Acids Res. 31, 5033–5038 (2003).
41. Brummelkamp, T.R., Bernards, R. & Agami, R. A system for stable expression
of short interfering RNAs in mammalian cells. Science 296, 550–553 (2002).
42. Castanotto, D., Li, H. & Rossi, J.J. Functional siRNA expression from
transfected PCR products. Rna 8, 1454–1460 (2002).