Antiviral Research 150 (2018) 47–59

Contents lists available at ScienceDirect

Antiviral Research
journal homepage: www.elsevier.com/locate/antiviral

A natural small molecule inhibitor corilagin blocks HCV replication and T

modulates oxidative stress to reduce liver damage
B. Uma Reddya, Ranajoy Mullicka, Anuj Kumara, Geetika Sharmaa, Paromita Baga,
Chaitrali Laha Roya, Govindarajan Sudhab, Himani Tandonb, Pratik Davea, Ashutosh Shuklaa,
Priyanka Srinivasana, Madhusudhan Nandhithaa, Narayanaswamy Srinivasanb, Saumitra Dasa,∗
a
Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore, 560012, India
b
Molecular Biophysics Unit, Indian Institute of Science, Bangalore, 560012, India

A R T I C L E I N F O A B S T R A C T

Keywords: Hepatitis C virus (HCV) infection causes chronic liver disease, which often leads to hepatocellular carcinoma.
Hepatitis C virus Earlier, we have demonstrated anti-HCV property of the methanolic extract of Phyllanthus amarus, an age-old
Antiviral folk-medicine against viral hepatitis. Here, we report identification of a principal bioactive component ‘cor-
Small molecule inhibitor ilagin’, which showed significant inhibition of the HCV key enzymes, NS3 protease and NS5B RNA-dependent-
Oxidative stress
RNA-polymerase. This pure compound could effectively inhibit viral replication in the infectious cell culture
system, displayed strong antioxidant activity by blocking HCV induced generation of reactive oxygen species and
suppressed up-regulation of NOX4 and TGF-β mRNA levels. Oral administration of corilagin in BALB/c mice
demonstrated its better tolerability and systemic bioavailability. More importantly, corilagin could restrict
serum HCV RNA levels, decrease collagen deposition and hepatic cell denaturation in HCV infected chimeric
mice harbouring human hepatocytes. Taken together, results provide a basis towards developing a pure natural
drug as an alternate therapeutic strategy for restricting viral replication and prevent liver damage towards better
management of HCV induced pathogenesis.

1. Introduction
Hepatitis C virus (HCV), a member of Flaviviridae family, has in-
fected over 170 million people worldwide and is the leading cause of
liver fibrosis, cirrhosis and hepatocellular carcinoma [Averhoff et al.,
2012]. There is no vaccine available and the previous standard-of-
care HCV therapy consisting pegylated interferon alpha and ribavirin
provides only 50% sustained virological response (SVR). Recent ad-
dition of direct-acting antivirals (DAAs) has revolutionized hepatitis C
virus (HCV) patient care and offers cure to many patients worldwide
[Pawlotsky et al., 2016]. However, it is impossible to provide DAAs to
170 million chronically infected patients [Bankwitz et al., 2017].
Further, treatment-induced cure does not protect from HCV re-infec-
tion [Bankwitz et al., 2017]. Moreover, HCV prevention in high-risk
groups has seen only limited improvement with DAAs [Liang, 2013].
Thus, use of natural plant products to supplement or circumvent IFN/
DAAs based regimens could be further explored as one of the most
commendable alternate strategy at this moment [Seeff et al., 2008;
Ganta et al., 2017].
Several classes of plant extracts and their derivatives such as puni-
calagin [Reddy et al., 2014], silymarin [Wagoner et al., 2010] and
curcumin [Chen et al., 2012] were reported to exhibit anti-HCV prop-
erties. Earlier, we reported that methanolic extract of Phyllanthus
amarus could inhibit HCV RNA replication by inhibiting the NS3 serine
protease and NS5B-RdRp enzyme activities [Ravikumar et al., 2011].
Different bioactive candidates of P. amarus, particularly polyphenols,
showed wide spectrum of pharmacological activities including anti-
HBV [Ott et al., 1997] and anti-HIV [Notka et al., 2004] properties by
regulating various signalling pathways.
In the present study, we identified corilagin as the principal
bioactive component from P. amarus, which showed significant in-
hibition of HCV enzymes and replication. It also prevented HCV

Abbreviations: HCV, Hepatitis C virus; DAAs, direct-acting antivirals; SVR, Sustained Virological Response; EGFP, enhanced-green-fluorescent-protein; RdRp, RNA dependent RNA
polymerase; JFH1, strain from a patient with fulminant hepatitis; TGFβ, Transforming growth factor beta; Huh 7, human hepatocellular carcinoma cells; ROS, Reactive Oxygen Species;
RIPA buffer, Radioimmunoprecipitation assay buffer; Poly(A), polyadenylation; UMP, Uridine monophosphate; OECD, Organisation for Economic Co-operation and Development; NF-κB,
Nuclear Factor Kappa B; ERK, extracellular signal–regulated kinase
∗
Corresponding author.
E-mail address: sdas@iisc.ac.in (S. Das).

https://doi.org/10.1016/j.antiviral.2017.12.004
Received 24 March 2017; Received in revised form 1 December 2017; Accepted 6 December 2017
Available online 07 December 2017
0166-3542/ © 2017 Elsevier B.V. All rights reserved.
B.U. Reddy et al. Antiviral Research 150 (2018) 47–59

(caption on next page)

mediated generation of reactive oxygen species (ROS) and offered
protection against liver damage by modulating oxidative stress.
Corilagin was found to be non-toxic and systemically bioavailable in-
vivo. An oral administration of corilagin could restrict serum HCV-RNA
levels and reduce the amount of collagen deposition in HCV infected
chimeric PXB-mice harboring human hepatocytes.
2. Materials and methods
2.1. Plasmids
Plasmids pYB-43 encoding single-chain NS3/4A and pYB-44 ex-
pressing fusion protein consisting an enhanced-green-fluorescent-

48
B.U. Reddy et al. Antiviral Research 150 (2018) 47–59

Fig. 1. Effect of different fractions and corilagin from P. amarus on HCV enzymes. (A) NS3 protease assay: The crude leaf methanolic extract and its fractions-1, 2, 3 and residue-3 were
incubated in increasing concentrations (1, 2.5, 5, 7.5 and 10 μg/ml) with recombinant HCV NS3-protease and fusion substrate protein (EGFP-NS5A/B-CBD). Cleavage of this substrate by
NS3 results in emission of fluorescent light that is easily detected and quantitated by fluorimetry. [‘C’ represents vehicle control (0.01% DMSO)], ‘MeOH ext’ represents crude leaf
methanolic extract of Phyllanthus amarus. Fraction-1, 2, 3 and Residue-3 correspond to n-hexane, chloroform, ethyl acetate fractions and left over residue of crude extract, respectively.
The relative NS3 protease activity was normalized with the vehicle control. (B) NS5B polymerase assay: The purified recombinant NS5B protein, poly-A template and oligo dT12 were pre-
incubated with or without fractions (1, 2 and 3) at two concentrations (5 and 30 μg/mL) followed by the addition of α-32P-UTPs. Incorporation of radiolabelled UMPs into RNA products
was quantified using a liquid scintillation counter. Here, ‘C’ represents the relative NS5B RdRp activity normalized with the DMSO vehicle control. (C) Chemical structure of corilagin
(drawn by using ACD/chemsketch freeware). (D) Similar to panel A, NS3 protease assay was also performed with increasing concentrations (0.1, 0.5, 0.75, 1, 2, 5, 15, 30 μM) of purified
corilagin. Telaprevir (Tela, 1 μM) and hypophyllanthin (Hypo, 30 μM) were used as positive and negative controls respectively. (E) Effect of corilagin (at 25, 50 and 100 μM) on cellular
trypsin activity against FITC conjugated casein substrate was determined by fluorimetry. Here, trypsin inhibitor (at 10, 25, 50 μM) from soybean was used as a positive control (F) NS5B
assay was carried out using increasing concentrations (5, 20 and 30 μM) of corilagin. Sofuosbuvir (5 μM) was used as a positive control of inhibition. ‘C’ denotes vehicle control. Results
are expressed as mean percentage of inhibition with error bars of standard deviations from the three independent experiments.

Table 1 2.4. Extraction and bioassay guided fractionation of active constituents

Effect of Phyllanthus amarus and its fractions on HCV enzymes activities.
Dried leaves of P. amarus were refluxed with 90% ethanol. The re-
Phyllanthus amarus HCV NS3/4A protease HCV NS5BCΔ21RdRp assay
(dried leaf) assay (IC50) (IC50)
sultant crude extract was partitioned successively from non-polar to
polar solvents and concentrated by rotary evaporator (IKA, Germany).
MeOH extract (ME) < 1.0 μg/ml 5.00 μg/ml Fractions-1, 2, 3 and residue-3 were evaluated for their inhibitory po-
[Ravikumar et al., 2011] tentials against HCV enzymes (NS3 and NS5B). Major compound from
Fraction-1 of ME 5.0 μg/ml Could not achieve IC50
(n-hexane)
the active fraction-3 was purified by column chromatography and
Fraction-2 of ME 2.5 μg/ml 10.0 μg/ml confirmed for its purity and identity by analytical HPLC
(Chloroform) (Supplementary Fig. S1).
Fraction-3 of ME < 1.0 μg/ml 10.0 μg/ml
(Ethyl acetate)

2.5. HCV NS3 protease based cleavage assay

Table 2
Effect of corilagin on HCV enzyme activities, replication and cell viability. To examine the effect of corilagin on the HCV NS3/4A protease
activity, a high throughput in-vitro fluorimetric assay [Berdichevsky
Compound HCV NS3/ HCV NS5B HCV JFH1 Cell Viability Selectivity et al., 2003] was performed in black 96-well microtiter plate. The single
4A RdRp Replication assay (CC50) Index Ratio
chain NS3/4A protease (scNS3/4A from HCV genotype 1b) and fusion
Protease assay (IC50) (EC50) (SI =
assay CC50/EC50)
protein (EGFP-NS5A/B-CBD) were overexpressed in E. coli BL21 cells
(IC50) and purified. The purified enzyme scNS3/4A (0.1 μM) was pre-in-
cubated with increasing concentrations of test samples followed by the
Corilagin < 1.0 μM 20.0 μM < 50.0 μM > 1.0 mM > 20.0 addition of purified fusion substrate protein (EGFP-NS5A/B-CBD,
0.5 μM) and further incubation for another one hour at 37 °C. The re-
action was terminated by adding the cellulose slurry (40 μM) into the
protein (EGFP), cellulose binding domain and NS3 cleavage site at the
reaction mix followed by rocking the tubes. Then, tubes were cen-
middle [EGFP-NS5A/B-CBD] were received from Dr. Itai Benhar, Tel
trifuged, and the supernatants were separated. Finally, the total fluor-
Aviv University, Israel [Berdichevsky et al., 2003]. Plasmid
escence signal evolved from the cleaved EGFP substrate in the super-
pThNS5BCΔ21 [Kaushik-Basu et al., 2008] was obtained from Dr.
natant was quantified by fluorimeter (Modulus TM Microplate
Neerja Kaushik-Basu, UMDNJ-New Jersey Medical School, USA. The
Multimode Reader) using excitation filter 484 nm and emission filter
HCV JFH-1 plasmid construct [Wakita et al., 2005] and pSGR-Luc/JFHI
538 nm. Telaprevir (MedChem Express) was used as a positive control.
was a generous gift from Dr. Takaji Wakita, National Institute of In-
fectious Diseases, Tokyo [Kato et al., 2005]. Myc-tagged-HCV NS5A
clone was received from Dr. Krishnan H Harshan from Centre for Cel-
2.6. Cellular protease assay
lular and Molecular Biology, India.

A simple high throughput in-vitro cellular serine protease (trypsin)

2.2. Cell lines
HCV replicon harboring hepatoma cell line (Rep2a) was obtained
from Dr. Ralf Bartenschlager, Heidelberg University [Frese et al., 2003].
Huh7.5 cell line was received from Dr. C. M. Rice, Rockefeller Uni-
versity, USA. Cells were cultured in Dulbecco's modified Eagle's
medium (DMEM; Sigma-Aldrich) supplemented with 10% fetal bovine
serum (FBS; Gibco), 100 U/ml of penicillin (HiMedia), and 100 μg/ml
of streptomycin sulphate (HiMedia) at 37 °C in 5% CO2 conditions.
Hygromycin (25 μg/ml) was additionally used to culture replicon
containing cells.
2.3. Collection and identification of plant
Fresh plants of Phyllanthus amarus Schum and Thonn
(Euphorbiaceae) were collected from GKVK campus, Bangalore, and
identified. The herbarium was prepared and deposited with voucher
specimen number 74099 in the Foundation for Revitalisation of Local
Health Traditions, Bangalore.
assay was performed as per the manufacturer's instructions using pro-
tease fluorescent detection kit (PF0100, Sigma-Aldrich). In this assay,
cellular trypsin recognizes and cleaves casein substrate labelled with
fluorescein isothiocyanate (FITC). The intensity of fluorescence signal
evolving from the cleaved FITC conjugated casein substrate was
quantified by fluorometer using excitation filter 485 nm and emission
filter 538 nm in the presence or absence of test compounds. The trypsin
inhibitor from Glycine max (Sigma Aldrich) was used as positive con-
trol.
2.7. Western blotting
Cells were harvested, and cell lysates were prepared using radio-
immunoprecipitation (RIPA) lysis buffer. The proteins from these ly-
sates were resolved in SDS PAGE and transferred onto nitrocellulose
membrane. The protein of interest was detected using respective pri-
mary antibody followed by HRP conjugated secondary antibody and
enhanced chemiluminescence method.

49
B.U. Reddy et al. Antiviral Research 150 (2018) 47–59

(caption on next page)

50
B.U. Reddy et al. Antiviral Research 150 (2018) 47–59

Fig. 2. Effect of corilagin on cell viability and HCV replication (A) Huh7 cells were treated with increasing concentrations of corilagin (0.1–1.0 mM) followed by measurement of cell
viability by measuring the absorbance at 560 nm after treatment with MTT reagent. ‘C’ represents Huh7 cells with no treatment as control. (B) Huh7.5 cells were infected with JFH-1
followed by corilagin treatment (10–200 μM) and cell viability was determined; ‘C’ represents JFH1 infected Huh7.5 cells as control. (C) Schematic representation of pSGR-luc/JFH1
(adapted from Kato et al., 2005). Huh 7 cells were transfected with HCV pSGR-Luc/JFH1 RNA and treated with increasing concentrations (10, 25, 50, 100, 200 μM) of corilagin. No
treatment was used as a control i.e., ‘C’ (representing 100% luciferase activity). Telaprevir (Tela, 20 μM) was used as a positive control. (D) Schematic representation of p-JFH1 (adapted
from Wakita et al., 2005). Huh7.5 cells were infected with JFH-1 for 4 h and treated with increasing concentrations of corilagin (25, 50, and 100 μM). At 72 h, HCV negative strand
synthesis was quantified by qRT-PCR and data was normalized with GAPDH was used as an internal control. Sofosbuvir (10 μM) was used as a positive control. ‘JFH1’ represents control
i.e., Huh7.5 cells infected with JFH-1 in the absence of any inhibitor. Data represent mean ± SD from three independent experiments.

2.8. HCV NS5B RdRp assay primers used here were as follows:

The RdRp assay was performed as described previously [Kaushik-
Basu et al., 2008]. Briefly, the purified NS5BCΔ21(HCV genotype 1b),
poly (A) template (Amersham) and oligo-dT12 were incubated on ice
with or without test samples. This was followed by addition of α-32P-
UTPs and further incubation for another 1 h at 30 °C. Reactions were
terminated by 5% ice cold trichloroacetic acid in 0.5 mM sodium pyr-
ophosphate. Resulting polymeric RNAs were precipitated at −20 °C for
1 h and transferred to GF/C filters (Sigma-Aldrich). These filters were
washed successively with 5% trichloroacetic acid and distilled water.
Filters were dried at room temperature. The amount of radiolabelled
UMPs incorporated into RNA products present on the filters was
quantified using a liquid scintillation counter.
2.9. MTT assay
Cytotoxic effects of corilagin on Huh7 cells and HCV infected
Huh7.5 cells were assessed 48 h post-treatment by using MTT reagent [3-
(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (Sigma-
Aldrich) as per the standard protocol [Ciofani et al., 2010].
2.10. HCV replication assay in replicon 2a cells
The Huh7 cells harbouring HCV replicon 2a were treated with
corilagin and incubated for additional 24 h. Then total RNA was ex-
tracted using TRIzol reagent (Sigma Aldrich). The HCV RNA levels were
determined using real time RT-PCR as described below. Sofosbuvir
(MyHep™, Gilead Sciences, Ireland) was used as the standard control.
2.11. Luciferase assay
HCV149F:5′ TGCGGAACCGGTGAGTACA3′
HCV342R:5′CTTAAGGTTTAGGATTCGTGCTCAT 3′
GAPDH F:5′ CATGAGAAGTATGACAACAGCCT 3′
GAPDH R: 5′ AGTCCTTCCACGATACCAAAGT 3′
2.14. Measurement of intracellular ROS production
Induction of intracellular ROS production in Huh7.5 cells by JFH-1
infection or Huh7 cells by over expression of HCV proteins (core and
NS5A) in the presence or absence of corilagin was quantified by mea-
suring fluorescent signals obtained from the cleaved DCFDA (2′,7′ –
dichlorofluorescindiacetate) by fluorimeter. Here, H2O2 (0.03%) was
used as positive ROS inducer. Additionally, the intracellular ROS pro-
duction in Huh7.5-core stable cells (4 × 104) with or without corilagin
was analyzed by FACS (BD Biosciences).
2.15. Estimation of NOX4/TGF-β mRNA levels
Hepatic fibrosis is a hallmark of hepatitis C virus infection. Viral
hepatitis results in increased level of NOX4 (a member of the NADPH
oxidase, Nox family), which is a direct contributor of oxidative stress in
a TGF-β mediated pathway [Boudreau et al., 2009]. The levels of HCV
induced NOX4/TGF-β mRNA expressions in JFH-1 infected
Huh7.5 cells and Huh7 cells over expressed with HCV proteins (core
and NSS5A) in the presence or absence of corilagin treatment were
quantified by real time RT-PCR using NOX4 and TGF-β specific primers.
GAPDH expression served as an internal control.
Following primers were used:

Huh7 cells were transfected with pSGR-Luc/JFH1 RNA using lipo- Nox4 F: 5′ TGGCTCTCCATGAATGTCCT 3′
fectamine-2000 (Invitrogen). At 4 h post transfection, cells were treated Nox4R: 5′CTTAGACACAATCCCCCAACA3′
with increasing concentrations of corilagin. After 24 h, cells were lysed, TGF-βF: 5′TGCCCCCTCTGCCACCTGGGGCGGT 3′
and luciferase assay was performed using dual luciferase assay kit TGF-βR: 5′ TCGGCCAGGGCGGAGCGCAGCAGG 3’.
(Promega). The luciferase signals were measured using luminometer
and the TCID50 (50% effective HCV replication inhibitory concentra- 2.16. Analysis of TGF-β pathway by Cignal finder 10 pathway reporter
tion) of corilagin was calculated. array

2.12. HCV replication assay using HCV JFH-1
Huh 7.5 cells were infected with HCV JFH-1 (genotype 2a) virus
(RNA titer 1 × 1010 copies/ml). At 4 h post infection, cells were wa-
shed with PBS, changed to complete medium and treated with in-
creasing concentrations of corilagin. At 72 h post-treatment, cells were
harvested, and total cellular RNA was isolated by Trizol method and
subjected to real time-PCR.
2.13. Real Time-PCR
Total cellular RNA was reverse transcribed using HCV forward
primer (HCV149F) corresponding to IRES region and GAPDH reverse
primer (GAPDH R). cDNA was diluted (1: 2) and added in SYBR Green
PCR Master Mix and subjected to amplification using real-time ABI
PRISM 7900 (Applied Biosystems) PCR machine. GAPDH (a house-
keeping gene) was used as an internal control for normalization. The
The transcription factors/signalling molecules involved in the TGF-
β pathway was investigated using Cignal Finder Immune Signalling 10-
pathway Reporter Luciferase Kit (CCA-008L, SA Biosciences) following
manufacturer's instructions.
2.17. Ethics statement for animal studies
Animal experiments were approved by ‘Institutional Animal Ethics
Committee’. Animals were maintained in accordance with the guide-
lines of the Indian National Law on animal care and use.
2.18. Determination of systemic toxicity in mice
For the safety assessment, the acute and sub-acute toxicity of cor-
ilagin was determined according to OECD guidelines [OECD-423 and
OECD-407].

51
B.U. Reddy et al. Antiviral Research 150 (2018) 47–59

(caption on next page)

52
B.U. Reddy et al. Antiviral Research 150 (2018) 47–59

Fig. 3. Effect of corilagin on HCV induced ROS production. (A) Huh7 cells were either incubated with H2O2 (0.03%) (positive control) or transiently transfected with HCV proteins (core
and NS5A) and then treated cells with increasing concentrations of purified corilagin (25–100 μM). At 48 h post transfection cells were treated with DCFDA stain. The amount of ROS
production was quantified by measuring the amount of fluorescence produced upon oxidation of DCFDA to fluorescent DCF on fluorescent plate reader. Here, ‘C’ represents cells alone,
‘vc’ is cells treated with only DMSO (0.01%) as vehicle control. (B) For the experiment performed in panel A, the level of HCV core was evaluated by Western blotting using anti-core
antibody. (C) In order to reconfirm the ROS inhibitory effects of corilagin, Huh7.5-cells (4 × 104) stably expressing core were treated with corilagin at concentration 50–100 μM and
incubated for 48 h. Cells were then stained with 10 μM of DCFDA and results were analyzed with BD FACS Diva software. The peak ‘a’ represents Huh7.5-core stable cells that are neither
treated with DCFDA stain nor with pure corilagin. The peak ‘b’ represents Huh7.5-core stable cells treated with only DCFDA (10 μM). The peaks ‘c’ and ‘d’ represents Huh7.5-core stable
cells treated with DCFDA (10 μM) and increasing concentrations of pure corilagin (50–100 μM). (D) The quantification of the data from panel ‘C’ is shown here in the form of a bar graph.
(E and F) Experiment similar to panel A, was performed with Huh7.5 cells infected with JFH1 in the presence or absence of corilagin (25–100 μM). Here, fluorescence intensity was
measured at 72 h post infection. Corresponding HCV RNA levels were also measured and plotted as fold change.

2.19. Bioavailability of corilagin in mice and rats verses treated) were done by two-tailed unpaired t-test using GraphPad
Prism 6.0 software and significant differences between the groups are
The bioavailability of corilagin in BALB/c mice and Wistar rats were represented by an asterisk (*p < 0.05, **p < 0.01 and
measured using protocol described previously [Haid et al., 2012]. ***p < 0.001).

2.20. In-vivo tolerability and efficacy of corilagin in HCV chimeric mice
model
In order to demonstrate the safety of corilagin, 1 mM/day of cor-
ilagin was administered orally for 7 days to chimeric mice harboring
human liver (engraftment of primary human hepatocytes is around
70–80% in uPA-SCID mice, carried at Phoenix Bio Inc. Japan). After
confirming its tolerability in chimeric mice, the therapeutic efficacy of
corilagin was explored. To study this, first uPA-SCID mice were en-
grafted with human hepatocytes (> 70% replacement), then these an-
imals were infected with HCV-1b genotype and kept them under ob-
servation for 3 weeks to reach the HCV RNA titre at optimum levels
prior to challenge study. During this course of period, the HCV positive
strand RNA copies in the sera of chimeric mice were determined reg-
ularly every week by qRT-PCR. Those mice in which serum HCV RNA
copy number achieved to ≥107, were selected for efficacy study and
randomly assigned into two groups of 3 mice each. Group-1 mice (ad-
ministered with water) were used as control. Group- 2 mice were
treated with corilagin for 14 days. During this treatment window, body
weight and h-albumin (a direct readout of replacement of human he-
patocytes into chimeric mice liver) levels of mice from both groups
were recorded. HCV serum RNA from infected mice serum was ex-
tracted on 0th, 7th and 14th day of treatment from both the group and
quantified by qRT-PCR. Here, the level of HCV RNA copies on 0th day of
corilagin treatment was approximately ≥107 in chimeric mice sera.
Subsequently the treatment of corilagin was continued for 14 con-
secutive days. The HCV RNA levels in the serum of chimeric mice
treated with corilagin (group 2) were compared with the chimeric mice
treated with water (group 1). This experiment was done through con-
tract research with PhoenixBio, Japan.
2.21. Histochemical analysis of chimeric mice liver
HCV infection in chimeric mice humanized liver leads to up-reg-
ulation of fibrotic genes with consequential liver fibrosis and cirrhosis
[Keng et al., 2016]. To examine the amount of fibrillar collagen de-
position at five weeks post HCV infection in both control and corilagin
treated groups, the histological analysis of NBF fixed chimeric mice
liver tissues was performed. To distinguish the collagen deposition from
the normal hepatocytes into the processed liver sections, collagen
specific stain, sirius red (Sigma-Aldrich) was used. Here, fast green stain
was used to stain the normal hepatocytes [Bility et al., 2014]. Image J
software was used to quantify the percent area of collagen distribution
in HCV infected chimeric mice liver sections.
2.22. Software and statistical analyses
All data are representative of a minimum of three independent ex-
periments. The data are expressed as the mean ± standard deviations
(SD). Statistical comparisons between two independent groups (control
3. Results
3.1. Fractionation and purification of the anti-HCV components of P.
amarus
In order to identify the bioactive constituents of P. amarus, its crude
leaf methanolic (MeOH) extract and fractions 1 to 3 (n-hexane,
chloroform, ethyl acetate, respectively) were assessed for both HCV-
NS3 protease and NS5B-RdRp inhibitory activities. All the fractions
were found to inhibit NS3 protease in a dose dependent manner but
fraction-3 showed highest inhibitory activity (Fig. 1A and Table 1).
Interestingly, fractions 2 and- 3 also showed significant inhibition of
NS5B activity (Fig. 1B) suggesting these could be potent inhibitors of
HCV replication. Since fraction 3 was active against both the viral en-
zymes, the corresponding principal bioactive constituent of fraction 3
was identified as corilagin (Fig. 1C) by high performance liquid chro-
matography and confirmed by LC-ESI-MS (Supplementary Fig. S1 and
S2).
3.2. Corilagin inhibits HCV NS3/4A protease and NS5B RdRp activities in-
vitro
HCV encoded NS3 protease is essential for viral replication [Reed
and Rice, 2000; Kolykhalov et al., 2000] and has long been considered
as an attractive target for the therapeutic intervention [Lamarre et al.,
2003]. Results from both flourimetric and gel based cleavage assays
indicate that corilagin significantly inhibited the NS3 protease activity
in a dose dependent manner (IC50 < 1 μM) (Fig. 1D, Supplementary
Fig S3A, Table 2). However, corilagin did not show inhibitory effect on
the cellular trypsin activity in-vitro even at 100 μM concentration
(Fig. 1E). The specificity of corilagin action was also checked by testing
its effect on cleavage of eIF4GI [Kerekatte et al., 1999] by Coxsackie
virus 2A protease in HeLa cells. No reduction in the cleavage of eIF4GI
by coxsackievirus 2A protease (Supplementary Fig. S3B) suggested that
this small molecule inhibitor could be specific for HCV NS3 protease.
The effect of corilagin on the HCV polymerase activity was also
checked. The purified corilagin also showed significant inhibition of
NS5B RdRp activity in a concentration dependent manner with an IC50
of 20 μM (Fig. 1F and Table 2). Since, corilagin was inhibiting both the
viral enzymes (NS3/4A protease and NS5B polymerase), further we
made an attempt to understand the structural interactions of corilagin
with these HCV enzymes. For this we performed structure guided
docking studies. These studies were performed using the available 3D
structures in PubChem and PDB databases to understand the possible
nature of interactions between corilagin and viral proteins, NS3 and
NS5B (as explained in Supplementary text, Schrodinger). The results of
these docking studies support that corilagin can inhibit both NS3 pro-
tease and NS5B polymerase activities. This can be attributed to its in-
teractions with crucial amino acid residues of viral enzymes, such as
catalytic triad and β-hairpin of NS3 and NS5B enzymes respectively

53
B.U. Reddy et al. Antiviral Research 150 (2018) 47–59

(caption on next page)

54
B.U. Reddy et al. Antiviral Research 150 (2018) 47–59

Fig. 4. Effect of corilagin on HCV mediated induction of NOX4 and TGF-β expressions. (A) Quantification of the cellular NOX4 mRNA levels from HCV infected Huh7.5 cells also HCV
core/NS5A over expressing Huh7 cells by real time qPCR in the presence or absence of corilagin. (B) Similarly, the quantification of the cellular TGF-β mRNA levels from HCV infected
Huh7.5 cells as well as HCV core and NS5A over expressing Huh7 cells in the presence or absence of corilagin by qRT-PCR. C represents control (either JFH1 infection, HCV core, NS5A
over expression) in respective treatment groups. (C–D) Huh7 cells were over expressed with HCV core and NS5A in the presence of corilagin. The levels of these proteins (core and NS5A)
were checked by Western blotting using anti-core and anti-myc antibodies (Here ‘+’ = 25 μM, ‘++’ = 50 μM and ‘+++’ = 100 μM of corilagin). (E) Analysis of the 10-pathway
reporter assay for TGF-β pathway from uninfected and infected Huh7.5 cells treated with or without corilagin. Results were plotted as relative fold change in Fluc/Rluc values (Y axis). X
axis denotes the concentrations of corilagin used in uninfected and infected cells. Results shown as mean ± SD from three biologically independent experiments.

(Supplementary Figure S4).
3.3. Corilagin is non-toxic in cell culture
Results based on cell viability assay showed that treatment of cor-
ilagin up to 1000 μM to Huh7 cells did not induce any toxicity (Fig. 2A)
(CC50 > 1 mM). Further, treatment of corilagin in increasing con-
centrations (10–200 μM) rescued HCV-JFH1induced cell death in in-
fectious cell culture system (Fig. 2B).
(Fig. 3C and D). Further, we have also confirmed the reduction of ROS
production in HCV-JFH1 infected Huh7.5 cells (Fig. 3E). The corre-
sponding decrease in the level of HCV RNA in these cells were found to
be consistent (Fig. 3F) with the reduction in ROS production. In par-
allel, we have checked the levels of HCV core protein in JFH1 infection,
however, in contrast to core protein over expression experiment
(Fig. 3B), the level of HCV core protein in the context of HCV-JFH1
virus (Supplementary Fig S6B) infection didn't decrease upon corilagin
treatment.

3.4. Corilagin inhibits HCV replication in cell culture
To investigate the effect of corilagin on HCV replication, HCV
genotype 2a sub genomic reporter replicon (pSGR-Luc/JFH1) was used
for transient transfection. Results showed a considerable decrease in
luciferase activity upon treatment with corilagin (TCID50 = 29.5 μM)
(Fig. 2C). Similarly, HCV RNA levels reduced upon corilagin treatment
on non-reporter replicon 2a harboring Huh7 cells (Supplementary Fig
S5A-C). Sofosbuvir was used as a positive control.
Next, we studied the effect of corilagin on HCV replication using
JFHI infectious virus. Huh7.5 cells were infected with HCV genotype 2a
virus JFH1 (Fig. 2D) for 72 h in absence and presence of increasing
concentrations of corilagin (post incubation). Sofosbuvir was used as
positive control in this study. The inhibitory effect of corilagin was
observed against negative strand synthesis in the infectious cell culture
system (EC50 = ∼50 μM). Even though the replication levels are very
low (Fig. 2D, Table 2 and Supplementary Fig. S5D-E, Supplementary
Table S1). Here, as expected, levels of NS5B decreased in a dose de-
pendent manner with increasing concentrations of corilagin
(Supplementary Fig. S6B).
3.5. Corilagin suppressed HCV induced ROS production
Generation of ROS plays an important role in the development and
progression of inflammatory liver disease mediated by HCV. The in-
hibitory activity of corilagin (if any) against ROS production was also
investigated. Several folds increase in the ROS production was observed
due to over expression of HCV proteins (core and NS5A) in Huh7 cells
(Fig. 3A). This increase was significantly decreased upon treatment of
corilagin, proving its potent antioxidant and hepatoprotective proper-
ties. Interestingly, immunoblot analysis showed that corilagin (25, 50
and 100 μM) treatment leads to specific decrease of HCV core protein
dose dependently in Huh7 cells over expressed with HCV core protein
(Fig. 3B). The levels of core protein were rescued by MG132 (data not
shown) suggesting that corilagin might degrade the HCV-core protein
via proteosomal pathway. Further, corilagin also suppressed the NS5A
(over expressed) induced ROS (Fig. 3A). However, the levels of NS5A
did not show any change upon treatment of corilagin (Supplementary
Fig. S6A). We have also ruled out the possibility that decrease in the
fluorescence intensity (observed in Fig. 3A) is not due to effect of cor-
ilagin in quenching the fluorescence of GFP. For this, we have ad-
ditionally performed an experiment where Huh7 cells were co-trans-
fected with pCDNA vector expressions of HCV-core/NS5A followed by
pCD-GFP and treated with or without corilagin. However, no change in
GFP fluorescence suggested that corilagin indeed causes ROS suppres-
sion without affecting the fluorescence (Supplementary Fig. S7A-C).
Similar inhibitory effect of corilagin against generation of ROS by
Huh 7.5 stable cell line expressing core protein in FACS analyses
3.6. Corilagin suppressed the HCV induced ROS production via NOX4 in a
TGF-β dependent pathway
Our results showed that, either JFH-1 infected Huh7.5 cells or over
expression of HCV proteins, particularly HCV core and NS5A proteins in
Huh7 cells, significantly upregulated the expression of both NOX4 and
TGF-β mRNA levels. The treatment of corilagin could dramatically re-
duce the expression of TGF-β and NOX4 mRNA levels under these
conditions (Fig. 4A and B; also see Supplementary Tables S2 and S3).
The levels of core and NS5A in overexpressed cells were checked by
Western blotting (Fig. 4C and D).
In addition, we also confirmed the effect of corilagin on the TGF-β
levels from uninfected and JFH1 infected Huh7.5 cells by the immune
signalling. Result showed down regulation of the transcription factors
SMAD2/3/4 (involved in the TGF-β pathway) upon treatment with
corilagin (Fig. 4E).
3.7. Corilagin is well tolerable in mice
Next, we have checked the in-vivo tolerability of corilagin in BALB/c
mice. It was observed that an acute dose of corilagin up to 3500 mg/kg
b. wt. showed maximum tolerance (LD50 lies between 3500 and
5000 mg/kg b.wt.). Suggesting corilagin can be considerably non-toxic
even at higher dosage (Fig. 5A). In sub-acute toxicity studies, the re-
peated oral administrations of corilagin (1000 mg/kg/day b.wt.) for 28
days to mice did not exhibit any undesirable changes in behavior and
body weight of the mice (Fig. 5B). Importantly, corilagin treatment did
not affect the histology of mice liver in both acute and sub-acute toxi-
city studies (Fig. 5C).
3.8. Orally administered corilagin is systemically transported to mice and
rat blood plasma
As orally administered corilagin did not show any toxicity in acute
and sub-acute toxicity studies, it was important to check if this com-
pound is systemically available in blood or not. For this, 1500 mg/kg
corilagin was orally fed in mice and rats followed by HPLC-ESI-MS
analyses of plasma samples collected at different time points. Results
showed systemic maximum bioavailability at 2hr (Tmax = 2 h) with half
life time of the compound (t1/2) = ∼6 h and maximum concentration
absorbed (Cmax) = 57.0 and 52.37 μg/ml of blood in mice and rats
respectively (Fig. 5D).
3.9. Corilagin restricts HCV-RNA levels in chimeric mouse model
To investigate the tolerability and in-vivo efficacy of the corilagin,
the HCV challenge chimeric mice model (as described in materials and
methods) was used. Tolerability result showed that treatment of

55
B.U. Reddy et al. Antiviral Research 150 (2018) 47–59

Fig. 5. In-vivo toxicity and bioavailability of purified corilagin. (A) Acute toxicity study. Body weights of BALB/c mice (n = 3) were recorded for 14 consecutive days after oral
administration of an acute maximum tolerance dose of corilagin (3500 mg/kg b.wt. p.o.) (B) Sub-acute toxicity study. Repeated oral doses of corilagin (1000 mg/kg b.wt./day p.o.) into
BALB/c mice (n = 3) for 28 consecutive days were administered and body weight was measured. Results from corilagin treated mice in both acute (A) and sub-acute toxicity (B) studies
were compared with mice from their respective control groups treated only sterile water (vehicle control for corilagin). (C) Histopathological examination of mice liver. A representative
picture of the liver sections of mice from different treatment groups in acute toxicity studies {(i) Water control, (ii) corilagin 3500 mg/kg b.wt.}. Similarly, representative pictures of liver
sections of mice from different groups in subacute toxicity studies, {(iii) Water control, (iv) corilagin (1000 mg/kg b.wt./day)}. (D) Pharmacokinetics of corilagin in BALB/c mice and
Wistar rats. An acute dose of corilagin (1500 mg/kg b. wt.) was administered orally to animals. Concentrations of corilagin in plasma at different time points (0–24 h) post treatment was
measured by LC-ESI-MS. Values used to plot AUC are mean ± SD from the three mice or rats (pre-administered with corilagin) at each time point.

corilagin up to 1 mM/day p.o. for 7 consecutive days is well tolerated in Further, to check the therapeutic efficacy of corilagin, HCV (gt-1b)
chimeric mice with no signs of toxicity (behavioural changes and infected chimeric mice were treated with corilagin (1 mM/day p.o.) for
mortality). Body weights of mice were also found to be normal 14 days. No alterations in the body weight ratio (Fig. 6B) or h-albumin
(Fig. 6A). levels (Fig. 6C) were observed. With respect to virus titre, a steady

56
B.U. Reddy et al. Antiviral Research 150 (2018) 47–59

(caption on next page)

57
B.U. Reddy et al. Antiviral Research 150 (2018) 47–59

Fig. 6. The tolerability and efficacy of corilagin in HCV infected chimeric mice. (A) Tolerability study of corilagin in chimeric/non PXB mice, n = 3 (with < 70% replacement index of
primary human hepatocytes). Body weights of these mice were recorded from 0 to 7 days during for repeated administrations of corilagin at a dose of 1 mM/day. (B–C) Efficacy study of
corilagin in HCV infected chimeric/PXB-mice, n = 3 (> 70% replacement index of primary human hepatocytes). To study this, uPA/SCID chimeric mice were infected with HCV
genotype 1b three weeks prior to challenge with corilagin. The body weights and levels of serum h-albumin of post infected PXB mice were monitored daily for 14 days during corilagin (1
mM/day) treatment period (i.e., on 4th and 5th weeks of infected PXB mice). Similar observations were also recorded in the same time for those post infected PXB mice from control
group. (D) Levels of serum HCV RNA titre in control (no treatment) and corilagin treated chimeric/PXB-mice (n = 3). (E) Histochemistry of HCV infected chimeric mice liver: On 15th
day post treatment, post infected chimeric/PXB-mice from control and treated groups were sacrificed, dissected the liver. Then liver sections were examined for collagen deposition using
sirius red and fast green stains (collagen stained with red-coloured by Sirius red stain and normal hepatocytes stained with blueish green-colour by fast green stain). (E i, iii, v)
Representative pictures from the liver sections of three different HCV infected chimeric mice from control group. (E ii, iv, vi) Representative pictures from the liver sections of three
different HCV infected chimeric/PXB-mice from corilagin treated group, (F) Results from the panel E was represented in bar graph format. Here, approximately 10 representative fields
were selected from each HCV infected chimeric mice liver sections of both water control and corilagin treated groups. The image J software was used to quantify the positive area of
collagen distribution from the liver sections. (Fi) Bar graph of control mouse-1 verses corilagin treated mouse-1, (Fii) represents control mouse-2 verses corilagin treated mouse-2, (Fiii)
represents control mouse-3 verses corilagin treated mouse-3. Here, C represents HCV infected control mice (administered only with water). (For interpretation of the references to colour
in this figure legend, the reader is referred to the Web version of this article.)

increase in the control group (treated with water) was observed.
However, in the corilagin treated mice group, the virus titer was re-
stricted to a considerable extent (Fig. 6D; Supplementary Table S4).
This study acts a proof of concept for the potential of plant-derived
compounds, such as corilagin, to act as antivirals against HCV.
3.10. Corilagin treatment alleviates the HCV induced liver fibrosis in
chimeric mice
To investigate whether corilagin can offer protection against HCV
induced liver damage, we performed liver histochemical analyses of
HCV infected PXB chimeric mice liver sections using two stains, sirius
red and fast green specifically to stain fibrillar collagen and normal
hepatocytes, respectively (Fig. 6E i-vi). Results from the quantification
of percent area of collagen distribution in corilagin treated group
showed approximately 4 folds reduction in fibrillar collagen deposition
in between/around portal tracts as compared to liver sections from the
control group (Fig. 6F i-iii). Thus, it appears corilagin could suppress
HCV mediated liver fibrosis and hepatic cell denaturation.
4. Discussion
There are increasing evidences that viral cure does not eliminate the
risk for developing progressive liver disease once fibrosis is established
[El-Serag et al., 2016]. Infact, the DAAs might not be effective once
chronic HCV infection reaches liver fibrosis, cirrhosis and HCC stages.
Here, we have demonstrated possible use of corilagin (derived from a
plant P.amarus) in inhibiting HCV replication; oxidative stress as well as
reducing the HCV induced liver damage.
Corilagin could inhibit HCV NS3 protease enzyme activity at sub-
micromolar concentrations; it also inhibited NS5B-RdRp activity but at
slightly higher concentrations.
HCV infection creates oxidative stress that impairs the basic cellular
functions by DNA damage, modifying lipids and proteins and altering
mitochondrial membrane potential [Pal et al., 2010; Ivanov et al.,
2013]. Our study has demonstrated that corilagin could effectively re-
duce HCV induced oxidative stress by suppressing the HCV protein
induced enhanced expressions of NOX4 mRNA levels via TGF-β medi-
ated signalling pathway implicated in profibrotic processes [Carmona-
Cuenca et al., 2008]. In fact, our result obtained with core over-
expressed cells is consistent with earlier study which showed that
blocking TGF-β signalling with neutralizing antibodies could drastically
abrogate HCV core protein mediated induction of Nox4 and subsequent
ROS production [Boudreau et al., 2009]. However, the increased core
level in JFH1 cell culture upon corilagin treatment (Supplementary Fig
S6B) suggests that corilagin might first stabilize core in this system
which may lead to reduced HCV replication (as observed in replication
assays) by inhibiting HCV IRES activity in subsequent HCV life cycles
[Shimoike T et al., 1999; Shimoike T et al., 2006]. Alternatively, Core
protein is stabilized (protected) from corilagin when probed in the
context of JFH1 infection (Supplementary Fig S6B). But found to be
decreased upon Corilagin treatment when Core protein is over
expressed alone (Fig. 3B).
These contrasting but interesting observations may reveal that al-
though corilagin decrease ROS production and NOX4/TGF-β mRNA
levels, however mechanisms for these are different in core over-
expressed cells versus HCV infected cells which need to be further ex-
plored in near future. Previous studies showed that corilagin isolated
from Phyllanthus niruri L. has a potential antitumor effect against
ovarian cancer cells via the targeted action on the TGF-β/ERK/AKT/
Smad signalling pathways [Jia et al., 2013]. Corilagin was also shown
to be considerably effective in reducing the in-vivo growth of xeno-
grafted Hep3B hepatocellular carcinoma cells [Hau et al., 2010]. Reg-
ulation of notch signalling pathway by corilagin helps suppressing the
development of cholangiocarcinoma [Gu et al., 2016]. Corilagin at-
tenuates bleomycin-induced epithelial injury and fibrosis via blocking
the oxidative stress, release of proinflammatory cytokines and TGF-β1
and NF-κB signalling [Wang et al., 2014]. Corilagin isolated from P.
amarus showed a high degree of antiviral activity against HIV infection
[Notka et al., 2004], Human enterovirus 71 and Coxsackie-virus A16
[Yeo et al., 2015]. Another study showed that, corilagin exhibit anti-
inflammatory effects in HSV 1 infected microglia [Guo et al., 2010].
Corilagin reduces the cytotoxicity induced by EV71 or Coxsackie virus
A16 on Vero cells [Yeo et al., 2015]. All these observations indicate that
corilagin might be potentiated in the clinical setting after testing in
(pre) clinical trials.
The in-vivo HCV challenge study in PXB chimeric mice showed re-
striction of HCV RNA levels in the serum at a steady state level upon
oral administration of corilagin. Interestingly, administration of cor-
ilagin to chimeric mice, significantly reduced HCV induced liver fi-
brosis, suggesting that corilagin might possess a direct antifibrotic role.
Thus, our findings open up a new strategy offering the use of the an-
tifibrotic property of corilagin in HCV induced liver fibrosis for better
management of disease progression.
Taken together, it appears, corilagin might have multifaceted role
for better management of HCV infected liver. Also, the remarkable
tolerance and stability of this compound in blood circulation might
offer greater advantage in reducing the risk of HCV induced patho-
genesis. More importantly, the study unfolds the ultimate mysteries of
the ‘folk medicinal use’ of the wonder plant ‘Phyllanthus amarus’ against
viral hepatitis in ancient time.
Conflicts of interest
The authors declare no conflict of interest.
Acknowledgements
We are thankful to Itai Benhar, Takaji Wakita, Neerja Kaushik-Basu,
Ralf Bartenschlager, Charles M. Rice and Krishnan H Harshan for
sharing useful plasmid constructs and cell lines. We are also grateful to
Central animal facility, Microtome, NMR, FACS, Analytical spectro-
scopy and other central facilities of our Institute (funded by DST-FIST
and DBT-partnership programme).

58
B.U. Reddy et al.
We thank Dr. Upasana Ray and Dr. Partho Sarothi Ray for critical
comments on the manuscript and our other laboratory members for the
helpful discussion. This work was supported by grant from Department
of Biotechnology (DBT) (BT/01/COE/06/02/10-IISc), Government of
India to SD. BUR is supported by the research fellowship from Science
and Engineering Research Board, DST. AK, GS and PD were supported
by the research fellowship from CSIR. SD and NS also acknowledge JC
Bose fellowship from DST for research support.
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://dx.
doi.org/10.1016/j.antiviral.2017.12.004.
References
Averhoff, F.M., Glass, N., Holtzman, D., 2012. Global burden of hepatitis C: considera-
tions for healthcare providers in the United States. Clin. Infect. Dis. 55, S10–S15.
Bankwitz, D., Doepke, M., Hueging, K., Weller, R., Bruening, J., Behrendt, P., Lee, J.Y.,
Vondran, F.W.R., Manns, M.P., Bartenschlager, R., Pietschmann, T., 2017.
Maturation of secreted HCV particles by incorporation of secreted ApoE protects from
antibodies by enhancing infectivity. J. Hepatol. 30251–30259 S0168–8278.
Berdichevsky, Y., Zemel, R., Bachmatov, L., Abramovich, A., Koren, R., Sathiyamoorthy,
P., Golan-Goldhirsh, A., Tur-Kaspa, R., Benhar, I., 2003. A novel high throughput
screening assay for HCV NS3 serine protease inhibitors. J. Virol. Methods 107,
245–255.
Bility, M.T., Cheng, L., Zhang, Z., Luan, Y., Li, F., Chi, L., Zhang, L., Tu, Z., Gao, Y., Fu, Y.,
Niu, J., Wang, F., Su, L., 2014. Hepatitis B virus infection and immunopathogenesis in
a humanized mouse model: induction of human-specific liver fibrosis and M2-like
macrophages. PLoS Pathog. 10, e1004032.
Boudreau, H.E., Emerson, S.U., Korzeniowska, A., Jendrysik, M.A., Leto, T.L., 2009.
Hepatitis C virus (HCV) proteins induce NADPH oxidase 4 expression in a trans-
forming growth factor beta-dependent manner: a new contributor to HCV-induced
oxidative stress. J. Virol. 83, 12934–12946.
Carmona-Cuenca, I., Roncero, C., Sancho, P., Caja, L., Fausto, N., Fernandez, M.,
Fabregat, I., 2008. Upregulation of the NADPH oxidase NOX4 by TGF-beta in hepa-
tocytes is required for its pro-apoptotic activity. J. Hepatol. 49, 965–976.
Chen, M.H., Lee, M.Y., Chuang, J.J., Li, Y.Z., Ning, S.T., Chen, J.C., Liu, Y.W., 2012.
Curcumin inhibits HCV replication by induction of heme oxygenase-1 and suppres-
sion of AKT. Int. J. Mol. Med. 30, 1021–1028.
Ciofani, G., Danti, S., D'Alessandro, D., Moscato, S., Menciassi, A., 2010. Assessing cy-
totoxicity of boron nitride nanotubes: interference with the MTT assay. Biochem.
Biophys. Res. Commun. 394, 405–411.
El-Serag, H.B., Kanwal, F., Richardson, P., Kramer, J., 2016. Risk of hepatocellular car-
cinoma after sustained virological response in veterans with hepatitis C virus infec-
tion. Hepatology 64, 130–137.
Frese, M., Barth, K., Kaul, A., Lohmann, V., Schwarzle, V., Bartenschlager, R., 2003.
Hepatitis C virus RNA replication is resistant to tumour necrosis factor-alpha. J. Gen.
Virol. 84, 1253–1259.
Ganta, K.K., Mandal, A., Debnath, S., Hazra, B., Chaubey, B., 2017. Anti-HCV activity
from semi-purified methanolic root extracts of Valeriana wallichii. Phytother Res. 31,
433–440.
Gu, Y., Xiao, L., Ming, Y., Zheng, Z., Li, W., 2016. Corilagin suppresses cholangiocarci-
noma progression through Notch signalling pathway in vitro and in-vivo. Int. J.
Oncol. 48, 1868–1876.
Guo, Y.J., Zhao, L., Li, X.F., Mei, Y.W., Zhang, S.L., Tao, J.Y., Zhou, Y., Dong, J.H., 2010.
Effect of corilagin on anti-inflammation in HSV-1 encephalitis and HSV-1 infected
microglias. Eur. J. Pharmacol. 635, 79–86.
Haid, S., Novodomska, A., Gentzsch, J., Grethe, C., Geuenich, S., Bankwitz, D., Chhatwal,
P., Jannack, B., Hennebelle, T., Bailleul, F., Keppler, O.T., Poenisch, M.,
Bartenschlager, R., Hernandez, C., Lemasson, M., Rosenberg, A.R., Wong-Staal, F.,
Davioud-Charvet, E., Pietschmann, T., 2012. A plant-derived flavonoid inhibits entry
of all HCV genotypes into human hepatocytes. Gastroenterology 143, 213–222.
Hau, D.K., Zhu, G.Y., Leung, A.K., Wong, R.S., Cheng, G.Y., Lai, P.B., Tong, S.W., Lau,
F.Y., Chan, K.W., Wong, W.Y., Lam, K.H., Cheng, C.H., Cheung, F., Chui, C.H.,
Gambari, R., Fong, D.W., 2010. In vivo anti-tumour activity of corilagin on Hep3B
hepatocellular carcinoma. Phytomedicine 18, 11–15.
Ivanov, A.V., Bartosch, B., Smirnova, O.A., Isaguliants, M.G., Kochetkov, S.N., 2013. HCV
and oxidative stress in the liver. Viruses 5, 439–469.
Jia, L., Jin, H., Zhou, J., Chen, L., Lu, Y., Ming, Y., Yu, Y., 2013. A potential anti-tumor
herbal medicine, Corilagin, inhibits ovarian cancer cell growth through blocking the
TGF-β signaling pathways. BMC Compl. Alternative Med. 13, 33.
Kato, T., Date, T., Miyamoto, M., Sugiyama, M., Tanaka, Y., Orito, E., Ohno, T., Sugihara,
59
Antiviral Research 150 (2018) 47–59
K., Hasegawa, I., Fujiwara, K., Ito, K., Ozasa, A., Mizokami, M., Wakita, T., 2005.
Detection of anti-hepatitis C virus effects of interferon and ribavirin by a sensitive
replicon system. J. Clin. Microbiol. 43, 5679–5684.
Keng, C.T., Sza, C.W., Zheng, D., Zheng, Z., Young, K.S.M., Tan, S.Q., Ong, J.J.Y., Tan,
S.Y., Loh, E., Upadya, M.H., Kuick, C.H., Hotta, H., Lim, S.G., Tan, T.C., Chang,
K.T.E., Hong, W., Chen, J., Tan, Y.-J., Chen, Q., 2016. Characterization of liver pa-
thogenesis, human immune responses and drug testing in a humanised mouse model
of HCV infection. Gut 65, 1744–1753.
Kerekatte, V., Keiper, B.D., Badorff, C., Cai, A., Knowlton, K.U., Rhoads, R.E., 1999.
Cleavage of Poly(A)-binding protein by coxsakievirus 2A protease in vitro and in
vivo: another mechanism for host protein synthesis shutoff? J. Virol. 73, 709–717.
Kaushik-Basu, N., Bopda-Waffo, A., Talele, T.T., Basu, A., Costa, P.R., da Silva, A.J.,
Sarafianos, S.G., Noel, F., 2008. Identification and characterization of coumestans as
novel HCV NS5B polymerase inhibitors. Nucleic Acids Res. 36, 1482–1496.
Kolykhalov, A.A., Mihalik, K., Feinstone, S.M., Rice, C.M., 2000. Hepatitis C virus-en-
coded enzymatic activities and conserved RNA elements in the 3’ nontranslated re-
gion are essential for virus replication in vivo. J. Virol. 74, 2046–2051.
Lamarre, D., Anderson, P.C., Bailey, M., Beaulieu, P., Bolger, G., Bonneau, P., Bös, M.,
Cameron, D.R., Cartier, M., Cordingley, M.G., Faucher, A.M., Goudreau, N., Kawai,
S.H., Kukolj, G., Lagacé, L., LaPlante, S.R., Narjes, H., Poupart, M.A., Rancourt, J.,
Sentjens, R.E., St George, R., Simoneau, B., Steinmann, G., Thibeault, D., Tsantrizos,
Y.S., Weldon, S.M., Yong, C.L., Llinàs-Brunet, M., 2003. An NS3 protease inhibitor
with antiviral effects in humans infected with hepatitis C virus. Nature 426, 186–189.
Liang, T.J., 2013. Current progress in development of hepatitis C virus vaccines. Nat.
Med. 19, 869–878.
Notka, F., Meier, G., Wagner, R., 2004. Concerted inhibitory activities of Phyllanthus
amarus on HIV replication in vitro and ex vivo. Antivir. Res. 64, 93–102.
Organization for Economic Cooperation and Development, 2001. OECD Guidelines for the
Testing of Chemicals. OECD 423. Acute Oral Toxicity-acute Toxic Class Method.
Paris. .
Organization for Economic Cooperation and Development, 2006. OECD Report of the
Validation of the Updated Test Guideline 407: Repeat Dose 28-day Oral Toxicity
Study in Laboratory Rats. Series on Testing and Assessment No 59, ENV/JM/MONO.
pp. 26.
Ott, M., Thyagarajan, S.P., Gupta, S., 1997. Phyllanthus amarus suppresses hepatitis B
virus by interrupting interactions between HBV enhancer I and cellular transcription
factors. Eur. J. Clin. Invest. 27, 908–915.
Pal, S., Polyak, S.J., Bano, N., Qiu, W.C., Carithers, R.L., Shuhart, M., Gretch, D.R., Das,
A., 2010. Hepatitis C virus induces oxidative stress, DNA damage and modulates the
DNA repair enzyme NEIL1. J. Gastroenterol. Hepatol. 25, 627–634.
Pawlotsky, J.M., 2016. Hepatitis C virus resistance to direct-acting antiviral drugs in
interferon-free regimens. Gastroenterology 151, 70–86.
Ravikumar, Y.S., Ray, U., Nandhitha, M., Perween, A., Raja Naika, H., Khanna, N., Das, S.,
2011. Inhibition of hepatitis C virus replication by herbal extract: phyllanhus amarus
as potent natural source. Virus Res. 158, 89–97.
Reddy, B.U., Mullick, R., Kumar, A., Sudha, G., Srinivasan, N., Das, S., 2014. Small mo-
lecule inhibitors of HCV replication from pomegranate. Sci. Rep. 4, 5411.
Reed, K.E., Rice, C.M., 2000. Overview of hepatitis C virus genome structure, polyprotein
processing and protein properties. Curr. Top. Microbiol. Immunol. 242, 55–84.
Schrodinger.The PyMOL molecular Graphics System Version 1.5.0.4 Schrodinger, LLC.
Seeff, L.B., Curto, T.M., Szabo, G., Everson, G.T., Bonkovsky, H.L., Dienstag, J.L.,
Shiffman, M.L., Lindsay, K.L., Lok, A.S., Di Bisceglie, A.M., Lee, W.M., Ghany, M.G.,
HALT-C-Trial Group, 2008. Herbal product use by persons enrolled in the hepatitis C
antiviral long-term treatment against cirrhosis (HALT-C) Trial. Hepatology 47,
605–612.
Shimoike, T., Mimori, S., Tani, H., Matsuura, Y., Miyamura, T., 1999. Interaction of he-
patitis C virus core protein with viral sense RNA and suppression of its translation. J.
Virol. 73, 9718–9725.
Shimoike, T., Koyama, C., Murakami, K., Suzuki, R., Matsuura, Y., Miyamura, T., Suzuki,
T., 2006. Downregulation of the internal ribosome entry site (IRES)-mediated
translation of the hepatitis C virus: critical role of binding of the stem-loop IIId do-
main of IRES and the viral core protein. Virology 345, 434–445.
Wagoner, J., Negash, A., Kane, O.J., Martinez, L.E., Nahmias, Y., Bourne, N., Owen, D.M.,
Grove, J., Brimacombe, C., McKeating, J.A., Pecheur, E.I., Graf, T.N., Oberlies, N.H.,
Lohmann, V., Cao, F., Tavis, J.E., Polyak, S.J., 2010. Multiple effects of silymarin on
the hepatitis C virus life cycle. Hepatology 51, 1912–1921.
Wang, Z., Guo, Q.Y., Zhang, X.J., Li, X., Li, W.T., Ma, X.T., Ma, L.J., 2014. Corilagin
attenuates aerosol bleomycin-induced experimental lung injury. Int. J. Mol. Sci. 15,
9762–9779.
Wakita, T., Pietschmann, T., Kato, T., Date, T., Miyamoto, M., Zhao, Z., Murthy, K.,
Habermann, A., Krausslich, H.G., Mizokami, M., Bartenschlager, R., Liang, T.J., 2005.
Production of infectious hepatitis C virus in tissue culture from a cloned viral
genome. Nat. Med. 11, 791–796.
Yeo, S.G., Song, J.H., Hong, E.H., Lee, B.R., Kwon, Y.S., Chang, S.Y., Kim, S.H., Lee, S.W.,
Park, J.H., Ko, H.J., 2015. Antiviral effects of Phyllanthus urinaria containing cor-
ilagin against human enterovirus 71 and Coxsackievirus A16 in vitro. Arch Pharm.
Res. (Seoul) 38, 193–202.