Detection of a p35-like anti-apoptosis gene in

Penaeus monodon baculovirus (MBV)

Abeer H. Sahtout 1, Mohamad Azzam F. Sekheta 2,3,

Hassan M. Daud 4 and M. Shariff M. Din 4
1 university Putra Malaysia, Aquatic animal health, Serdang, Selangor
2
University of Belgrade, Faculty of Chemistry, Studenski Trg, 12, 11000 Beograd, Serbia,
3
Sekheta Bros Company, R&D Department, Jdaideh, Aida Str. No. 1, 21000 Aleppo, Syria,
4
Aquatic Animal Health Unit, Faculty of Veterinary Medicine, University Putra Malaysia, 43400
Serdang, Selangor, Malaysia

ABSTRACT
Baculoviruses possess genes such as p35 and iap that have the capability of inhibiting apoptosis or
programmed cell death induced by a variety of stimuli in phylogenetically diverse organisms. This
study was conducted to examine DNA from purified Penaeus monodon baculovirus (MBV) for the
presence of such genes using Autographa californica nuclear polyhedrosis virus (AcMNPV) as a
positive control. Primers designed based on published sequences for p35 produced a 250 bp amplicon
with MBV while primers designed based on iap genes gave no PCR product. Sequencing and
analysis of the 180 bp MBV amplicon revealed 98% identity with the p35 amplicon obtained from
AcMNPV using the same primers. The labeled PCR product gave positive dot blot hybridization
results for both MBV and AcMNPV. This confirmed the presence of a p35 gene in MBV.

Key words: MBV, apoptosis, anti-apoptosis, p35, iap genes

INTRODUCTION
Apoptosis or programmed cell death is an active death process that plays significant roles in the
development and maintenance of animal cells. Cell destruction by apoptosis involves in highly
regulated, multi-step program that often culminates in the degradation of chromosomal DNA into
oligonucleosome size fragments, plasma membrane blebbing, and eventual cytolysis. Both DNA and

1
RNA viruses have the capacity to induce apoptosis in vertebrate and invertebrate cells (Miura and
Yuan, 1996).

Many viruses have as part of their arsenal the ability to initiate or stay the onset of programmed cell
death in host cells through the manipulation of a variety of key apoptosis proteins (Hay and
Kannourakis, 2002). Staying apoptosis might be expected given that viral reproduction and survival
is dependent upon the effective exploitation of functional cellular machinery that would be shut down
by host induced apoptosis (Stark et al. 1998). In response to viral infection, a host may produce an
array of proteins, including cytokines and proteases and utilize macrophages and natural killer cells in
its defense (Roulston et al. 1999). A virus must make its way through this intricate defense network
to establish an infection. On the other hand, a virus might also benefit from the timely promotion of
apoptosis to aid dispersal.

Different cellular responses to viruses can result from differences in viral factors and/or host cell
factors (gene) related to the apoptotic response (Kamita et al. 1993). The p35 gene is known to
prevent at least the initial stages of virus-induced apoptosis. It is also a trans-dominant regulator that
facilitates replication and provides a selective advantage in apoptosis sensitive cells (Hershberger et
al. 1994).

Penaeus monodon baculovirus (MBV) has been associated with high mortalities in cultured shrimp
(Lightner et al. 1983). It is an intranuclear, occluded baculovirus that has been reported from several
shrimp species in the genus Penaeus (Lightner and redman, 1998). In contrast to insect baculoviruses,
little data exists on the physiochemical characteristics of shrimp or crustacean baculoviruses. This
relative paucity of information could be the result of lack of crustacean cell-lines and of problems
associated viral purification from infected tissues. Since no search for anti-apoptosis genes has been
reported in MBV, we examined it for homologues to p35 and iap.

MATERIALS AND METHODS

Sample processing
P. monodon juveniles from a commercial rearing pond (10) were selected because of heavy infections
with MBV. Each shrimp was divided into two halves. One half was fixed with Davidson's fixative for

2
histopathological examination and the other half was used to extract DNA for PCR tests. Other
shrimp specimens (10 shrimp) were collected from the same pond and stunned in ice water before
aseptic removal of the hepatopancreas for isolation of MBV.

Histopathological preparation
After 72 hr fixation in Davidson's fixative, samples were transferred to 50% ethyl alcohol for storage.
Tissue was processed form routine histopathological methods as described by Bell and Lightner
(1988). Sections were stained with haematoxylin and eosin (H&E) and examined by light microscopy
for typical MBV histopathology and signs of other viral infection.

MBV purification
Hepatopancreatic tissue from was pooled and homogenised in cold TE buffer (Tris EDTA, pH 7.6)
using an electric homogenizer. The suspension was filtered through a 40-mm filter paper and the
filtrate centrifuged at 1,700 g for 1 hr. The pellet was re-suspended in 2 ml TE buffer and layered into
the top of a continuous sucrose gradient (35 to 65 % w/v dddw) in a 10 ml tube and ultracentrifuged
for 2 hrs at 70,000 rpm using an AH629 Sorvall rotor. The viral band at 45 % sucrose was collected,
mixed with TE buffer and ultracentrifuged again for 1 hr at 50,000 rpm using an SS34 Sorvall rotor.
The viral pellet was collected and stored with TE buffer at –80OC.

Cell culture
AcMNPV was propagated in an Sf9 cell line in SF 900-growth medium (GIBCO laboratories)
supplemented with 10% fetal bovine serum (Gibco BRL®). Wild type AcMNPV (obtained from
Riken Cell Bank, Japan) was inoculated and incubated at 27OC. Cells were harvested after 4 days
inoculation and purified as described above for MBV.

Detection of anti-apoptotic genes using PCR products

Specific primers (10 pairs, Tables 1 & 2) were designed using the computer software programme
Primer Premier 4.0 programs® (Premier Biosoft International) and based on the sequence of the insect
anti apoptosis baculovirus gene p35 (Kamita et al. 1993) and iap gene (Birnbaum et al. 1994). These
were predicted to produce PCR products of specific sizes and were utilised for PCR analysis of DNA
samples of MBV, AcMNPV and BmNPV.

3
Table 1: Primer pairs designed to detect p35 gene.
Forward and Reversed primers Predicted amplicon
size (bp)
P1 5` GAGCTTTACCGAACGGTTAT 3` 400
3` GAATAATATTAGGCAATAAA 5`
P2 5` CATTTGAGCTTTACCATTGC 3` 320
3` CATTTTTGTTGAGTGTACTA 5`
P3 5` GGTGGACAAACAAACCAGAGAGTT 3` 240
3` GTTAATTTCGTGAGCAAACGGC 5`
P4 5` TTCCGGTTCTCGCGCATCACGAGCA 3` 460
3` AAGCAATTCGCTATCTTGATAATTT 5`
P5 5` CCCGTCCAGTTTTTGGAGCCGAGC 3` 300
3` GTCATCACCCGCTGCACAAAGTCGC 5`
P6 5` GATCGTGTGTGTGTTATCTCTGGC 3` 270
3`TGTCCACCTGACAATCTCGAAT 5`

Table 2: The four primers designed for detection of iap gene.

Forward and Reversed primer Predicted amplicon

size (bp)
IP1 5` GTTCCGGTTCTCGCGCATCA 3` 500
3` GTGACGCTATTAAACACCTT 5`
IP2 5` CAAGGCCAAGAGCGCGTAGT 3` 110
3` CACTGCGATAATTTGTGGAA 5`
IP3 5`TTCCGGTTCTCGCGCATCACGAGCA 3` 250
3` AAGCAATTCGCTATCTTGATAATTT 5`
IP4 5` CCCGTCCAGTTTTTGGAGCCGAGC 3 300
3` GTCATCACCCGCTGCACAAAGTCGC 5`

PCR Amplification
PCR was performed using DNA samples obtained from purified MBV; AcMNPV and BmNPV.
MBV free shrimp genome was also purified for use as a negative control in the same run. A
DNAzol® kit (Molecular Research Center, Inc.) was used to extract the DNA of normal shrimp and
of the viruses MBV, AcMNPV and BmNPV. The reaction mixture yielded a total volume of 50µl
containing 28µl H2O, 5.5µl PCR buffer, 3µl MgCl, 1µl dNTPs, 2.5µl of each primer, 0.5µl hot start
Taq (PERKEIN ELMER™) and 6µl DNA. Thin layer of mineral oil was layed onto each tube. The
PCR protocol comprised a start at 96OC for 6 min, followed by 40 cycles of 3 min at 94OC, 1 min at
40OC and 2 min at 63OC with a final extension at 63OC for 6 min. Negative control reactions

4
containing no template DNA and healthy shrimp DNA were run for all tests, whilst AcMNPV and
BmNPV DNA were used as positive controls.

PCR product detection (agarose gels)

Ten microliters of each completed PCR reaction mix was mixed with 1 μl loading buffer. The
mixtures were then subjected to electrophoresis (130V for 1 hr) in 2% agarose gel using TBE buffer.
The gels were stained with ethidium bromide and visualised and photographed by UV
transillumination. A 100bp DNA ladder was included. The bands were then cut and extracted from
the gel using a QIAquick Gel Extraction Kit (QIAGEN). One PCR product (270 bp) derived from the
primer pair (P6): 5` GAT CGT GTG TGT GTT ATC TCT GGC 3` and 5`TGT CCA CCT GAC AAT
CTC GAA T 3` was chosen for sequencing.

DNA sequencing and computer analysis

Sequencing was done on both strands of the fragment using an ABI 373 automatic DNA sequencer
(PERKEIN ELMER™, Applied biosystems). The DNA sequences were compared with
GenBank/NCBI databases using BLAST 2.2.1 (Gapped BLAST and PSI-BLAST: a new generation
of protein database search programs).

Dot-blot hybridisation
A total volume of 5μl of genomic DNA isolated from each of MBV and AcMNPV was mixed with
5μl 6 x SSC buffer (1 x SSC = 150 mM sodium chloride, 15 mM sodium citrate, pH 7.0) and 18μl
DDW. The mixture in each tube was denaturated at 100OC for 10 min and chilled directly on ice.
Denatured DNA was dotted directly onto a positively charged nylon membrane (Boehringer
Mannheim, Germany) that had been pre-soaked with 2 x SSC for 5 minutes and air dried. A quantity
of 2μl of the DNA was blotted every few minutes. The DNA was then cross-linked by exposing the
membrane to UV for 10 min. Then, the membrane was washed with 2 x SSC and air dried.

The 270 bp PCR-amplified product from AcMNPV was used as a probe for p35. It was cut from an
electrophoresis gel and purified using a QIAquick Gel Extraction Kit® (QIAGEN) and was non-
radioactively labelled by incorporation of digoxigenin using a (DIG)-dUTP DNA Labelling and

5
Detection Kit (Boehringer Mannheim). The DNA probe concentration was determined by using High
MassTM Ladder DNA estimation.

The membrane was placed in a hybridisation bag containing 20-ml prehybridisation solution (5 x
SSC, 0.1% (w/v) N-lauroylsarcosine, 0.02% (w/v) SDS and 1-% blocking reagent). The bag was then
kept at 64OC for 2 hrs. Meanwhile, the DNA probe was denaturated for 10 min, at 100 OC, chilled on
ice and diluted in hybridisation solution. The blot was then hybridised at 64 OC for 20 hrs with the
DIG-labelled probe. After overnight hybridisation at 64OC, blots were washed and prepared
following the procedure recommended by the supplier. Detection was accomplished using anti-
digoxigenin antibody conjugated to alkaline phosphatase (DIG-AP) and CSPD (Boehringer
Mannheim™, Germany) as a chemiluminescent substrate for alkaline phosphatase. Finally,
membrane was exposed to Kodak X-ray film for 2 and 5 min.

Internucleosomal DNA fragmentation

In order to detect the presence of apoptosis in MBV infected shrimp. DNA extracts from the host
were used. The shrimp DNA was run in a 2% agarose gel (type 1:low EEO Sigma) using a 10 µl
volume with 1 x TBE running buffer (54 g/l TRIS base, 27.5 g/l Boric acid and 20 ml EDTA, pH
8.0). Electrophoresis was carried out at 135V for one hour together with 100 bp markers. The gel was
then stained in ethidium bromide and visualized using UV light.

RESULTS
Histopathological examination
The presence of MBV in samples was confirmed by detection of MBV-type occlusion bodies
Lightner 1996) in the hepatopancreas and anterior midgut of histlogical preparations (Figure 1). The
examination also confirmed the absence of other shrimp viral infections.

PCR Products
Four out of six p35 gene primers screened by PCR amplification gave strong products after gel
electrophoresis (Figure 2) and bands of 357 bp were closest to the predicted amplicon size of 270 bp.
By contrast, no PCR products were obtained with any of the primers designed to detect the iap gene.
One p35 PCR products from primer pair P6 gave a strong signal at approximately 250 bp (Figure 2)

6
and was selected for sequencing (Figure 3). After sequencing, the actual length was 180 bp.
Comparison with the database of known sequences revealed 98% homology with Autographa
california nuclear polyhedrosis virus (AcMNPV). It is shows that 173 of the bases in the sequenced
fragment aligned to give 98% homology with the AcMNPV sequence. Table 3 and Figure 4 showing
the homology between this sequence and the p35 gene from other baculoviruses.

Table 3: Homology between the MBV sequence and sequences of other baculovirus p35 genes.

Virus Name Homology

Autographa californica nucleopolyhedrovirus (173bp) 98%
Bombyx mori nuclear polyhedrosis virus (171bp) 96%
Silkmoth apoptosis preventing protein (p35) gene sequence (171bp) 96%
Spodoptera litura nuclear polyhedrosis virus p35 gene (173 bp) 94%
Leucania separate nuclear polyhedrosis virus p35 protein (173bp) 85%
Heliothis armigera nucleopolyhedrovirus (171 bp) 93%

Dot blot hybridization

The Dig-labelled PCR-amplified products from AcMNPV gave a strong hybridization reaction with
MBV DNA (Figure 5).

Internucleosomal DNA fragmentation

Agarose gel electrophoresis to detect apoptotic degradation of DNA into oligonucleosome-sized
fragments revealed DNA fragmentation in MBV infected shrimp tissue (Figure 6). The DNA, which
migrated as discrete bands, by comparison to DNA markers, gave a ladder of approximately 200 bp

DISCUSSION
MBV is obtained from many crustacean species, but limited sequence analysis seems to suggest that
the isolates are very similar if not identical (Lo et al. 1999). This is the first report indicating the
presence of p35 in MBV or any shrimp virus. The sequence of p35 reveals few clues as to its function
and it has no detectable homology to any other known gene except closely-related homologues in
baculoviruses (Clem et al. 1996). For example, p35 of BmNPV has 90% amino acid identity to

7
AcMNPV p35 that also plays a role in preventing apoptosis (Kamita et al. 1993). Vickers et al.
(1994) reported homology between polyhedrin genes of Penaeus monodon type baculovirus (MBV)
of shrimp and AcNPV of insects. A degree of homology between shrimp and insect genes is expected
due to their ancient evolutionary relationship in the arthropod line and sequence similarities amongst
arthropod viruses might also be expected.

The p35 protein can inhibit developmental cell death in nematodes and insects, suggesting that p35
targets a conserved component of the cell death machinery (Clem et al. 1996). p35 has recently been
shown to inhibit apoptosis by inhibiting caspase activity induced by virus infection in insect host cells
(Bertin et al. 1996).

Fegan et al. (1991) reported that post larvae (PL) of P. monodon with large numbers of MBV
polyhedral occlusion bodies in the hepatopancreas did not appear to affect production when used to
stock commercial shrimp ponds. This and similar phenomena with other viruses led Flegel and
Pasharawipas (1998) to propose that shrimp had a specific "recognition mechanism" by which they
could acquire tolerance to viral pathogens. Our findings, suggest that it might be the presence of p35
gene that works to block viral triggered apoptosis, which may be the main cause of death during viral
infection (Flegel and Pasharawipas 1998, Flegel 2001, Sahtout et al. 2001, Khanobdee et al. 2002,
Wongprasert et al. 2003). For the host organism, a cellular apoptotic response during viral infection
would probably have a significant effect on viral pathogenesis. The presence of apoptosis in viral
infection may have evolved as a primitive viral defence response in animals lacking humoral immune
systems (Clem et al. 1991).

Whilst the presence of p35 is clearly shown in this study, the iap gene was not detected using the
techniques utilised. There are three baculovirus homologues of iap known to date, two of which, Cp-
iap and Op-aip have been shown to block apoptosis in insect cell lines. The third, Ac-aip, does not
block apoptosis (Clem et al. 1994). Although expression of Ac-aip does not appear to block apoptosis
in insect cell lines, it is possible that it could have anti apoptosis function in cells from different
tissues of the insect or in different species of insect (Clem et al. 1994). Thus, we must leave open the
possibility that perhaps MBV does have related genes differing sufficiently in sequence not to be
detectable by the probe or primers tested.

8
In contrast to MBV, white spot syndrome virus (WSSV) causes massive mortality in many cultivated
penaeid shrimp species including P. monodon (Lightner 1996). Several publications indicate that
mortality from WSSV is associated with high levels of apoptosis (Sahtout et al. 2001, Wongprasert et
al. 2003). Our search of the whole WSSV genomes listed at GenBank ( AF 332093, AF 369029.2 and
NC_0032251) did not reveal any sequences homologous to either p35 or known iap sequences. One
might speculate as to whether the absence of these or related genes may partially explain the
difference in the shrimp response to these two DNA viruses. For the host organism, a cellular
apoptotic response during viral infection could have a significant affect on viral pathogenesis.
Apoptosis may have evolved as a primitive viral defence response in animals lacking humoral
immune systems (Clem et al., 1991) and the p35 gene may have evolved to block that response.
More work is needed on the expression and function of this gene homologue in MBV-infected
shrimp.

Figure 1: Histopathological examination from hepatopancreas sample showing MBV occlusion

bodies in different stage of development (1,700X).

9
Figure 2: The PCR product using specific primers for AcMNPV. (1) is insect AcMNPV genome
(arrow head), (2,) is shrimp MBV genome (arrow head, in duplicated), (3) is shrimp genome. A 50 bp
marker have been used.

10 20 30 40 50
ATAGGCGTAG TGGTCGCGAA AATTACACGC GCGTCGTAAC GTGAACGTTT
TATCGCCGGA CGTCGATTTC TACCGGAGCG CGTACACACA TTTTGCAATGG

60 70 80 90 100
ATATTATAAA TATATCAACG TTGCTTGTAT TAAGTGAGCA TTTGAGCTTT
TAAAGCTCAA ATGCTCACTT AATACAAGCA ACGTTGAATA TTTATAATAT

110 120 130 140 150

ACCATTGCAA AATGTGTGTA ATTTTTCCGG TAGAAAATCG ACGTGTCCCA
AAACGTTCAC GTTACGACGC GCGTGTAATT TTCGCGACCA CTATCGCGCT

160 170 180

GACGATTATT CGAGATTGTC AGGCGGGACA A
GCCAGAGATA ACACACACAC GATCATT

Figure 3: DNA sequencing of the 250 bp PCR amplicon.

10
Figure 4: Dot blot result using the AcMNPV p35 DIG-labeled probe with DNA from (a) AcMNPV
(b) MBV. Note the high signal from the MBV blot.

Referances

Bell, T. A., Lightner, D. V. (1988). A handbook of normal Penaeid shrimp histology. The world
aquaculture society, Baton Rouge, Louisiana 1988.

Bertin, J., Mendrysa, S. m., La count, D. J., Gaur, S., Krebs, J. F., Armstrong, R. C., Tomaselli, K. J.
and Friesen, P. D. (1996). Apoptotic suppression by baculovirus p35 involves cleavage by and
inhibition of virus induced CED-3/ICE-like protease. Journal of virology, 70 : 6251-6259.

Birnbaum, M. J., Clem, R. J. and Miller, L. K. (1994). An apoptosis-ihibiting gene from a nuclear
polyhedrosis virus encoding a polypeptide with cys/His sequence motifs. Journal of virology,
68 : 2521-2528.

Clem, R. J., Fecheimer, M. and Miller, L. K. (1991). Prevention of apoptosis by a baculovirs gene
during infection of insect cell. Science, 254 : 1388-1390.

Clem, R. J., Robson, M. and Miller, L. K. (1994). Influence of infection route on the infectivity of
baculovirus mutants lacking the apoptosis-inhibiting gene p35 and the adjacent gene p94.
Journal of virology, 68 : 6759-6762.

11
Clem, R. J., Hardwick, J. M. and Miller, L. K. (1996). Anti-apoptosis gene baculoviruses. Cell death
and differentiation, 3 : 9-16.

Fegan DF, Flegel TW, Sriurairatana S, Waiakrutra M (1991) The occurrence, development and
histopathology of monodon baculovirus in Penaeus monodon in Southern Thailand.
Aquaculture 96:205-217

Flegel TW (2001) The shrimp response to viral pathogens. In: Browdy CL, Jory DE (eds) The new
wave. Proceedings of the special session on sustainable shrimp aquaculture, World
Aquaculture 2001 , Orlando. World Aquaculture Society, Boca Raton, p 190-214

Flegel, T. W. and Pasharawipas, T. (1998). Viral accommodation : a new concept for crustacean
response to viral pathogens. In : Flegel, T. W. (ed.) Advance in shrimp biotechnology.
National center for genetic engneering and biotechnology, Bangkok.

Hay, S. and Kannourakis, G. (2002). A time to kill : viral manipulation of the cell death program.
Journal of General Virology, 83 : 1547-1564.

Hershberger, P. A., Lacount, D. J. and Friesen, P. D. (1994). The apoptotic suppressor p35 is required
early during baculovirus replication and is targeted to the cytosol of infected cells. Journal of
Virology, 68 : 3467-3477.

Kamita, S. G., Majima, K. and Maeda, K. (1993). Identification and characterization of the p35
Bombyx mori Nuclear Polyhedrosis virus that prevents virus-induced apoptosis. Journal of
Virology, 67 :455-463.
Khanobdee K, Soowannayan C, Flegel TW, Ubol S, Withyachumnarnkul B (2002) Evidence for
apoptosis correlated with mortality in the giant black tiger shrimp Penaeus monodon infected
with yellow head virus. Dis Aquat Org 48:79-90
Lightner DV (1996) A handbook of pathology and diagnostic procedures for diseases of penaeid
shrimp, Vol. World Aquaculture Society, Baton Rouge, LA

12
Lightner, D. V., Redman, R. M. and Bell, T. A. (1983). Infectious and hematopiotic necrosis a newly
recognized virus disease of Penaeid shrimp. Journal of Invertebrate Pathology, 42 : 6270.

Lightner, D. V. and Redman, R. M. (1998). Shrimp disease and current diagnostic methods.
Aquaculture, 164 : 201-220.

Lo, C.F., Hsu, H.C., Tsai, M.F., Ho, C.H., Peng, S.E., Kou, G.H. and Lightner, D.V. (1999). Specific
genomic DNA fragment analysis of different geographical clinical samples of shrimp white
spot syndrome virus. Diseases of Aquatic Organisms, 35, 175-185.

Miura, M. and Yuang, J. (1996). Mechanisms of programmed cell death in Caenorhabditis Elegans
and vertebrates. Current Topics in Development Biology, 32 : 139-172.

Roulston, A., Marcellus, R. C. and Branton, P. E. (1999). Viruses and apoptosis. Annual Review of
Microbiology, 53 : 577-628.

Sahtout AH, Hassan MD, Shariff M (2001) DNA fragmentation, an indicator of apoptosis, in cultured
black tiger shrimp Penaeus monodon infected with white spot syndrome virus (WSSV). Dis
Aquat Org 44:155-159

Stark, G. R., Kerr, I. M., Williams, B. R., Silverman, R. H. and Schreiber, R. D. (1998). How cells
respond to infections. Annual Review of Biochemistry, 67 : 227-264.

Wongprasert K, Khanobdee K, Glunukarn S, Meeratana P, Withyachumnarnkul B (2003) Time-

course and levels of apoptosis in various tissues of black tiger shrimp Penaeus monodon
infected with white spot syndrome virus. Dis Aquat Org 55:3-10

Vickers, J. E., Lestek, R. J. G., Spradbro, P. B. and Pembert, J. M. (1994). Evidence for homology
between polyhedrine genes of baculoviruses of a prawn and an insects. Journal of Invertebrate
Pathology, 63 : 207-208.

13