DNA AND CELL BIOLOGY

Volume 36, Number 1, 2017

ª Mary Ann Liebert, Inc.
Pp. 58–66
DOI: 10.1089/dna.2016.3418

Wnt5a Deficiency Regulates Inflammatory Cytokine

Secretion, Polarization, and Apoptosis
in Mycobacterium tuberculosis-Infected Macrophages

Deming Chen,1 Guobao Li,2 Xiangdong Fu,2 Pei Li,2 Jie Zhang,2 and Lan Luo2

Tuberculosis, an infectious disease caused by Mycobacterium tuberculosis (MTB), is one of the global public health
catastrophes. Wnt signaling has recently been identified to exert immunoregulatory functions in a variety of
inflammatory and infectious diseases, including tuberculosis. The opposite expression of Wnt5a in human and mice
during MTB infection drives us to explore the roles and biological significances of reduced Wnt5a for MTB-treated
mice. In our study, the reduction of WNT5A in MTB-treated mice lung tissues or MTB-infected mice bone marrow-
derived macrophages (BM-Mø) was in a dose- and time-dependent manner. Then, WNT5A-silenced mice, secreted
frizzled-related protein 1 (SFRP1)-overexpressed or -silenced mice BM-Mø, were constructed to regulate Wnt5a
levels. When Wnt5a is deficient, MTB-induced increases of pro-inflammatory cytokines (TNF-a, IL-1b, IL-12, and
IL-6) can be markedly attenuated in mice lung tissues or BM-Mø. Besides, external disturbance triggered that Wnt5a
lower expression can induce Mø to be M2 phenotype and enhance cell apoptosis of MTB-infected mice BM-Mø.
Hence, the reduction of Wnt5a is a tactful strategy adopted by Mø to resistant MTB-induced immune responses and
to enhance MTB-induced Mø apoptosis in mice. Our study revealed a new style for Mø to manipulate themselves
against MTB infection. Our research identifies that Wnt5a deficiency can regulate inflammatory cytokine secretion,
polarization, and apoptosis in MTB-infected Mø.

Keywords: Sfrp1, Wnt5a, polarization, inflammatory cytokine, Mycobacterium tuberculosis, macrophage

Introduction survival strategy for virulent MTB (Kremer et al., 1997). The
immune response of Mø to MTB infections has been suffi-

T uberculosis is one of the global public health catas-

trophes leading to more than 8 million cases of illness
and 2 million deaths annually (Dheda et al., 2005). The
pathogenesis of tuberculosis is characterized by the granu-
lomatous lesion formation in the lung due to Mycobacterium
tuberculosis (MTB) infection (Russell et al., 2009). The first
cell type encountered by invaded MTB is the alveolar
macrophages (Mø) (Ernst, 1998; Heldwein and Fenton,
2002), which are the primary host cells for MTB, and fre-
quently aggregate to form the early granuloma core medi-
ated by the binding of hyaluronic acid to CD44 on Mø
surface (Love et al., 1979; Green et al., 1988).
It is well demonstrated that Mø play a pivotal role in in-
flammation by releasing of and responding to numerous in-
flammatory cytokines and chemokines (Pereira et al., 2008).
Within Mø, MTB is able to stably multiply and can efficiently
induce Mø apoptosis, which is associated with killing of intra-
cellular MTB (Molloy et al., 1994; Oddo et al., 1998). Hence, it
seems that inhibiting apoptosis of Mø might be an effective
ciently studied in great detail. On the contrary, still little is
known about how Mø manipulate themselves to resistant MTB-
induced immune responses and apoptosis.
Wnt signaling pathways are well known as a group of
highly conserved principles among metazoan species, which
are responsible for essential biological processes in em-
bryogenesis and tissue homeostasis (Angers and Moon,
2009; van Amerongen and Nusse, 2009). Wnt family pro-
teins regulate multiple cellular functions, including prolif-
eration, apoptosis, migration, survival, differentiation, and
polarity, by activating various intracellular signaling cas-
cades (Kikuchi et al., 2009). In essence, Wnts have also
been identified to exert immunoregulatory functions in a
variety of inflammatory and infectious disease, including
tuberculosis (Schaale et al., 2013).
Currently, there are at least 19 Wnt members that have been
revealed to be present in human and mice (Kikuchi et al.,
2009). Among which, Wnt5a, negatively regulated by secreted
frizzled-related protein 1 (Sfrp1) (Surinkaew et al., 2015), was

1
ICU, Shenzhen Third People’s Hospital, Shenzhen, China.
2
Department of Pulmonary Diseases, Shenzhen Third People’s Hospital, Shenzhen, China.

58
WNT5A DEFICIENCY REGULATES MTB-INFECTED MØ
reported to be the first member of Wnt family (Schaale et al.,
2013). Generally, Wnt5a was induced in multiple inflamma-
tory diseases, such as sepsis (Pereira et al., 2008), atheroscle-
rosis (Christman et al., 2008), and tuberculosis (Blumenthal
et al., 2006), and commonly exert pro-inflammatory effects on
MTB-infected human Mø (Blumenthal et al., 2006; Schaale
et al., 2011). While in mice, Reiling and colleagues discovered
that Wnt5a was markedly reduced in the lung tissue of MTB-
treated mice, as well as in MTB-infected mice bone marrow-
derived macrophages (BM-Mø) (Schaale et al., 2013), which
aroused our interest in the roles and biological significances of
reduced Wnt5a in MTB-infected mice BM-Mø.
In the present study, the reducing of WNT5A in MTB-
treated mice or MTB-infected mice BM-Mø was verified
first. Through silencing or inhibiting of WNT5A gene facti-
tiously, we found that MTB infection, which induced in-
creases of inflammatory cytokine secretion, can be attenuated
in Wnt5a lacked mice or mice BM-Mø and enhanced in
Wnt5a overexpressed mice BM-Mø. Besides, when Wnt5a
was insufficient, Mø phenotype trended to be M2 and cell
apoptosis was significantly enhanced in MTB-infected BM-
Mø. These findings hinted us that, in mice, Wnt5a deficiency
can lead to a resistance of Mø to MTB-induced immune
responses and reinforcement of MTB-induced Mø apoptosis.
Materials and Methods
Mycobacteria preparation
M.tuberculosis H37Rv was purchased from American
Type Culture Collection (ATCC, Manassas, VA). Experi-
ments were performed under biosafety level 3 (BSL3)
conditions. H37Rv was cultured in Middlebrook 7H9 broth
(Difco, Detroit, MI) containing 10% oleic acid albumin-
dextrose-catalase (OADC; Difco), 0.05% Tween 80 (Sigma-
Aldrich, St. Louis, MO), and 0.2% glycerol (Sigma) at 37C
in a shaking incubator until log phase (OD600*0.6) (Ven-
ketaraman et al., 2005; Chandolia et al., 2014). Before use,
H37Rv was dispersed by aspiration through a 29-gauge
needle (BD Biosciences, Franklin Lakes, NJ), vortexed, and
then sonicated for 15 s in a bath sonicator (100 Watt, KQ-
100DB; Kunshan Ultrasound Co., Ltd., China). After soni-
cation, suspensions were allowed to settle for 10 min, and the
upper 500 mL were removed and stored for use in following
experiments (Schaale et al., 2013). For the determination of
the number of colony-forming units (CFUs), 10-fold serial
dilutions of the prepared H37Rv strain were plated in tripli-
cate onto Middlebrook 7H11 agar plates (Difco) containing
10% OADC and incubated at 37C. After incubating for
21 days, CFU was calculated (Rahman et al., 2014).
Treatment of mice with H37Rv by aerosol infection
C57BL/6 mice (8 weeks, 24 – 0.7 g) were purchased from
Shanghai Laboratory Animal Center, Chinese Academy of
Sciences (Shanghai, China) and housed under specific
pathogen-free conditions in accordance with institutional
guidelines. All animal experiments were approved by the
Animal Care and Use Committee of Shenzhen Third Peo-
ple’s Hospital. For MTB infection, mice were infected with
different doses of H37Rv (CFU: 0, 100, 500, and 1000; n = 3
for each group) through the aerosol route as described pre-
viously (Reiling et al., 2002). After infection for 7 days,
59
lung tissues of these mice were removed to prove the suc-
cess of infection by colony enumeration assay (Hölscher
et al., 2001). After infection for indicated days (0, 7, 14, or
21 days, n = 3 for each group), lung tissues of these mice
were removed for use in following experiments. Experi-
ments were performed under BSL3 conditions.
Construction of Wnt5a siRNA recombinant adenovirus
Wnt5a special and nonspecial (normal-control, NC) siR-
NA sequences were designed and synthesized by Gene-
Pharma Co., Ltd. (Shanghai, China). Sequences were listed
as follows: Special: 5¢-GAA GCC CAU UGG AAU AUU
ATT-3¢ (sense) and 5¢-UAA UAU UCC AAU GGG CUU
CTT-3¢ (antisense); Nonspecial: 5¢-UUC UCC GAA
CGU GUC ACG UUU-3¢ (sense) and 5¢-ACG UGA CAC
GUU CGG AGA AUU-3¢ (antisense). The Wnt5a siRNA
recombinant adenovirus (Ad-Wnt5a-siRNA) was con-
structed as previously described (Yang et al., 2014). Briefly,
the synthesized siRNA sequences were amplified and sub-
cloned into pAdTrack-cytomegalovirus (CMV) plasmids
(Stratagene-Agilent Technologies, Waldbronn, Germany).
The obtained pAdTrack-CMV-Wnt5a-siRNA or pAdTrack-
CMV-NC plasmids were homologously recombined with
pAdEasy-1 (Stratagene) in Escherichia coli strain BJ5183
(Stratagene). Then, the secondarily obtained recombinant
plasmids were transfected into HEK-293 cells (ATCC). After
amplification and purification, virus titers were measured by
the p24 ELISA Kit (Cell Biolabs, Inc., San Diego, CA).
Treatment of mice with recombinant Ad-Wnt5a-siRNA
Through caudal vein injection, mice received 200 mL phos-
phate buffer saline (PBS), which were used as Mock group
(n = 3), 200 mL recombinant Ad-NC (1 · 1010 plaque-forming
units, PFUs) as rAd-NC group (n = 3), and 200 mL recombinant
Ad-Wnt5a-siRNA (1 · 1010 PFUs) as rAd-Wnt5a-siRNA group
(n = 9). Mice without any treatment were used as Control group
(n = 3). After 14 days, a secondary injection (200 mL PBS to
mice in Mock group, 200 mL recombinant Ad-NC to mice in
rAd-NC group, and 200 mL recombinant Ad-Wnt5a-siRNA to
mice in rAd-Wnt5a-siRNA group) was performed. After an-
other 14 days, three mice in each group were sacrificed to
analyze Wnt5a levels in lung tissues. The rest mice in rAd-
Wnt5a-siRNA group (n = 9–3) continuously received H37Rv
infection or not (1000 CFU for 21 days) as described above.
Meanwhile, normal mice treated with or without H37Rv (1000
CFU for 21 days) were used as appropriate controls, respectively.
Preparation of murine BM-Mø
Murine BM-Mø were generated as previously described
(Reiling et al., 2001). First, the femurs of three mice were
separated and flushed with HBSS (Sigma). To remove fi-
broblasts, the obtained cells were cultured at 37C overnight
in DMEM (Sigma) containing 10% heat-inactivated FBS
(Sigma), 10 mM HEPES (Sigma), 10 mM glutamine (Sigma),
1 mM sodium pyruvate (Sigma), and 50 ng/mL macrophage
colony stimulating factor (M-CSF; Sigma). Then, the adherent
cells were collected and cultured in DMEM containing M-CSF
(50 ng/mL) for 9 days. Cells were collected to identify the
markers (F4/80 and CD11b) of Mø by Flow cytometry.
Fluorescein isothiocyanate (FITC)-labeled rat monoclonal
60 CHEN ET AL.

anti-mouse F4/80 antibody (Abcam, Cambridge, MA) and logical Engineering Technology and Service Corporation Ltd.
allophycocyanin (APC)-labeled rat monoclonal anti-mouse (Shanghai, China) and listed in Table 1. All reactions were
CD11b antibody (Abcam) were used for Mø identification. performed in triplicate. Data were calculated using 2-DDCt
method and normalized to b-actin.
Treatment of BM-Mø with H37Rv
Western blot analysis
In vitro experiments, BM-Mø in 24-well plates were in-
fected with DMEM containing different doses of H37Rv Proteins from mice lung tissues or BM-Mø were isolated
(multiplicities of infection, MOI: 0:1, 3:1, 6:1, or 9:1) for using RIPA lysis buffer (Sigma). Protein concentrations were
indicated times (0, 4, 8, or 12 h). Then, the plates were measured by BCA (Sigma). Then, 40 mg total proteins were
gently washed with HBSS (Sigma). After washing, cells separated by 10% SDS-PAGE gel and transferred to PVDF
were collected, and Wnt5a levels were measured by real- membranes (Sigma). After incubated with 0.5% skimmed milk
time quantitative polymerase chain reaction (RT-qPCR) and power at room temperature for 1 h, target proteins in the
Western blots. For inflammatory cytokine (TNF-a, IL-1b, membranes were probed with primary antibodies overnight at
IL-12, IL-6, Arg-1, MRC-1, and TGF-b) level detection by 4C. After washing, the membranes were incubated with cor-
RT-qPCR, cells were collected at 12 h postinfection with responding horseradish peroxidase (HRP)-conjugated second-
heat-inactivated H37Rv or H37Rv at a MOI of 6:1. ary antibodies at room temperature for 1.5 h. The bands were
visualized using enhanced chemiluminescence (Pierce, Rock-
Construction and transfection of Sfrp1 ford, IL). The levels of b-actin were used as internal reference.
overexpression vector All antibodies (Abs) were purchased from Abcam. Primary
Abs: rabbit polyclonal anti-Wnt5a Ab (ab72583; 1:2000), anti-
The cDNA of Sfrp1 was subcloned from total RNA of
b-actin Ab (ab8227; 1:3000); Secondary Abs: HRP-conjugated
mice BM-Mø with Pyrobest DNA polymerase (Takara,
goat polyclonal anti-rabbit IgG Ab (ab6721; 1:4000).
Kyoto, Japan) and inserted into a pcDNA3.1/V5-HisA vector
(Invitrogen, Carlsbad, CA). The obtained pcDNA3.1/V5-
Cell apoptosis assay
HisA-Sfrp1-vectors or pcDNA3.1/V5-HisA-empty-vectors
were transfected into BM-Mø in 6-well plates using Lipo- Mice BM-Mø prepared above were allowed to receive
fectamine 2000 (Sigma). After transfection for 48 h, cells heat-inactivated H37Rv or H37Rv infection at a MOI of 6: 1
were collected to analyze and verify Wnt5a levels. Mean- for 12 h. Then, cell apoptosis was analyzed by flow cy-
while, pcDNA3.1/V5-HisA-Sfrp1-vector transfected cells were tometry. Cells were stained by reagents in Annexin V-FITC
arranged to receive heat-inactivated H37Rv or H37Rv infection Apoptosis Detection Kits (Sigma) as per the manufacturer’s
with a MOI of 6:1 for 12 h. Then, mRNA levels of inflamma- proposal. In brief, cells were collected postinfection and
tory cytokine (TNF-a, IL-1b, IL-12, IL-6, Arg-1, MRC-1, and washed twice with PBS and then resuspended in 1· binding
TGF-b) in the above cells were analyzed by RT-qPCR. buffer (1 · 106 cells/mL) in a test tube. Next, 5 mL Annexin
V-FITC conjugate and 10 mL propidium iodide solution
Silencing of Sfrp1 expression with siRNA interference were added into the tube sequentially. After being incubated
in the dark for 10 min, cells were analyzed using a FACS
For Sfrp1 gene silence, siRNA transfection was per-
analyzer (BD Biosciences, San Jose, CA).
formed as per the manufacturer’s protocol. In brief, 0.2 nmol
mouse Sfrp1 siRNA (Thermo Fisher Scientific, Waltham,
MA) or corresponding Silencer Select Negative Control Table 1. List of Primers
No. 1 siRNA and 20 mL Lipofectamine 2000 were incubated
in 2 mL DMEM at room temperature for 1.5 h. The above Gene name Sequence from 5¢ to 3¢
mixtures were added to BM-Mø in six-well plates and cultured
at 37C for 48 h. Then, cells were collected to verify Wnt5a Wnt5a F GAATCCCATTTGCAACCCCTCACC
R GCTCCTCGTGTACATTTTCTGCCC
levels. Besides, Sfrp1-silenced cells were continuously in- TNF-a F GTGACAAGCCTGTAGCCCA
fected with heat-inactivated H37Rv or H37Rv with a MOI of R AAAGTAGACCTGCCCGGAC
6:1 for 12 h. Then, cells were collected to analyze inflamma- IL-1b F ATGGCAATCGTTCCTGAACTCAAC
tory cytokine secretion (TNF-a, IL-1b, IL-12, and IL-6). R CAGGACAGGTATAGATTCTTTCCTTT
IL-12p40 F ATCGTTTTGCTGGTGTCTCC
Real-time quantitative PCR R CTTTGTGGCAGGTGTACTGG
IL-6 F AGTAAGTTCCTCTCTGCAAGAGACT
Total RNA of mice lung tissues or BM-Mø was extracted R CACTAGGTTTGCCGAGTAGATCTC
using the High Pure RNA Kit (Roche, Mannheim, Germany). Sfrp1 F TCCTCCATGCGACAACGA
The purity and integrity of the obtained RNA were controlled R TGATTTTCATCCTCAGTGCAAACT
by absorbance at A 260/280. For each sample, 4 mg total RNA Arg-1 F TGACATCAACACTCCCCTGACAAC
was reverse transcribed using a High Capacity cDNA Archive R GCCTTTTCTTCCTTCCCAGCAG
Kit (Applied Biosystems, Foster City, CA) in a reaction vol- MRC-1 F TCTTTTACGAGAAGTTGGGGTCAG
ume of 30 mL. The acquired cDNA was used for amplification R ATCATTCCGTTCACCAGAGGG
using SYBR Green PCR Amplification Reagent Kit (Qiagen, TGF-b F AGACGGAATACAGGGCTTTCGATTCA
R CTTGGGCTTGCGACCCACGTAGTA
Hilden, Germany) as per the manufacturer’s instructions. b-actin F ATCGTGGGGCGCCCCAGGCACC
RT-qPCR was performed on an Applied Biosystems PRISM R CTCCTTAATGTCACGCACGATTTC
7500 Fast Sequence Detection System (Thermo Fisher Sci-
entific). Primers were synthesized by Shanghai Sangon Bio- F, forward; R, reverse.
WNT5A DEFICIENCY REGULATES MTB-INFECTED MØ 61

Statistical analyses suggests that Wnt5a mRNA level is significantly reduced at

All experiments were performed in triplicate in three in-
dependent assays. Data were analyzed by Student’s t-test,
expressed as mean – standard deviation, and normalized to
b-actin. *p < 0.05 or **p < 0.01 indicates a statistically sig-
nificant difference. All the statistical analyses were per-
formed by SPSS 19.0 software. For Western blots, data were
analyzed using Image-Pro 6.0 software.
Results
each MOI (*p < 0.05) postinfection for 4 h. Based on the re-
sults, BM-Mø in 0:1 or 6: 1 MOI group were continuously
cultured for 8 or 12 h. Similarly, Wnt5a mRNA levels were
dramatically reduced with time in 6:1 MOI group (*p < 0.05,
Fig. 1F). Together, these results reveal that Wnt5a ubiquitously
reduced temporality and spatiality in H37Rv-treated mice lung
tissues or in H37Rv-infected mice BM-Mø. And also, 1000
CFU for 21 days in vivo and 6: 1 MOI for 12 h in vitro were
chosen for following experiments.

Wnt5a is reduced in MTB-infected mice Wnt5a deficiency attenuates MTB-induced

lung tissues or BM-Mø
As shown in Figure 1A, data from colony enumeration as-
says proved that H37Rv aerosol infection procedures were
successful, which can satisfy the following research. Through
flow cytometry, we confirmed that BM-Mø were successfully
induced by M-CSF (Fig. 1D). To determine the proper dose
and time of MTB infection, mice were treated with H37Rv by
different CFU, and BM-Mø were infected with H37Rv by
different MOI as described in methods. In vivo assay, results
shown in Figure 1B indicate that Wnt5a mRNA level is sig-
nificantly reduced only at 1000 CFU (*p < 0.05) posttreatment
for 7 days with a slight change. Based on the above result, the
rest of mice in 0 or 1000 CFU group was continuously raised to
14 or 21 days. As shown in Figure 1C, we observed that Wnt5a
mRNA levels were markedly reduced with infection time in
1000 CFU group (*p < 0.05). In vitro assay, the result (Fig. 1E)
inflammatory cytokine secretion in mice lung tissues
To explore the biological significance of reduced Wnt5a
for MTB-treated mice, expression of Wnt5a was further
silenced artificially by siRNA interference in vivo, which
was verified by RT-qPCR (Fig. 2A) and Western blot
(Fig. 2B). Then, mRNA levels of inflammatory cytokines
were detected in mice lung tissues. The results shown in
Figure 2C suggest that TNF-a mRNA level was signifi-
cantly higher in H37Rv-treated group than that in untreated
group (**p < 0.01), which is due to multifactor and can be
partly reversed in H37Rv-treated Wnt5a-silenced group
(*p < 0.05). And also, similar results can be observed for
IL-1b (Fig. 2D), IL-12 (Fig. 2E), and IL-6 (Fig. 2F) detec-
tion. These results indicate that Wnt5a with almost entire
deficiency can partially attenuate MTB-induced inflam-
matory responses in mice.

FIG. 1. Wnt5a mRNA levels in H37Rv-treated mice lung tissues or H37Rv-infected mice BM-Mø. Mice were allowed to receive
H37Rv treatment by different CFU (0, 100, 500, or 1000) for indicated days (0, 7, 14, or 21). The success of H37Rv aerosol infection
procedure by different CFU for 7 days was verified by colony enumeration assays. (A) CFU in mice lung tissues. RT-qPCR was
performed to measure Wnt5a mRNA levels. (B, C) Relative Wnt5a mRNA level in mice lung tissues. *p < 0.05 versus CFU = 0 or/
and Day = 0 group. (D) The markers (F4/80 and CD11b) for mice BM-Mø were identified by flow cytometry. Mice BM-Mø received
H37Rv infection by different MOI (0:1, 3:1, 6:1, 9:1) for indicated hours (0, 4, 8, 12). (E, F) Relative Wnt5a mRNA level in mice BM-
Mø. *p < 0.05 versus MOI = 0:1 or/and Hour = 0 group. BM-Mø, bone marrow-derived macrophages; CFU, colony-forming unit;
MOI, multiplicities of infection; RT-qPCR, real-time quantitative polymerase chain reaction.
62 CHEN ET AL.

FIG. 2. Wnt5a and inflammatory cytokine levels in mice lung tissues. Mice were allowed to receive H37Rv infection or
not by 1000 CFU for 21 days. Wnt5a levels were verified by RT-qPCR and Western blot. Inflammatory cytokine levels were
detected by RT-qPCR. (A) Relative Wnt5a mRNA level in lung tissues. (B) Expression of Wnt5a in lung tissues. (A, B)
**p < 0.01 versus Control group. Levels of mRNA were measured in lung tissues for TNF-a (C), IL-1b (D), IL-12 (E), and
IL-6 (F). (C–F) For H37Rv-treated group, *p < 0.05 or **p < 0.01 versus untreated group; for H37Rv-treated Wnt5a-
silenced group, *p < 0.05 versus H37Rv-treated group.

Inhibition of Wnt5a by Sfrp1 overexpression
attenuates MTB-induced inflammatory cytokine
secretion in mice BM-Mø
Continuously, in vitro, we further explored the effects of
up- or downregulated Wnt5a on inflammatory cytokine se-
cretion in mice BM-Mø. First, the up- or downregulation of
Wnt5a was fulfilled in Sfrp1-silenced or -overexpressed
mice BM-Mø, which were verified by RT-qPCR (Fig. 3A)
and Western blot (Fig. 3B). Following, mRNA levels of
inflammatory cytokines were detected. The results shown in
Figure 3C suggest that TNF-a mRNA level was markedly
higher in H37Rv-infected cells than that in uninfected or heat-
inactivated H37Rv-infected cells (**p < 0.01), which can be
attenuated in H37Rv-infected Sfrp1-overexpressed cells
(*p < 0.05), but enhanced in H37Rv-infected Sfrp1-silenced
cells (*p < 0.05). Similar results can also be observed for IL-1b
(Fig. 3D), IL-12 (Fig. 3E), and IL-6 (Fig. 3F) detection. For
these inflammatory cytokines, there was no difference between
uninfected and heat-inactivated H37Rv-infected cells. These
results reveal that inhibition of Wnt5a by Sfrp1 can attenuate
MTB-induced inflammatory cytokine secretion in mice BM-
Mø, which is in accordance with the results in vivo.
Inhibition of Wnt5a by Sfrp1 induces mice BM-Mø
trending to M2 phenotype in MTB-infected cells
To examine whether the reduced Wnt5a has an influence on
the phenotype of mice BM-Mø, the expression of arginase-1
(Arg-1), mannose receptor (MRC-1), TGF-b, and TNF-a was
measured in heat-inactivated H37Rv-infected, H37Rv-infected,
or uninfected cells by RT-qPCR, and Western blot. The results
shown in Figure 4A suggest that Arg-1 level is dramatically
decreased in H37Rv-infected cells (*p < 0.05), which can be
slightly reversed in H37Rv-infected Sfrp1-overexpressed cells
(*p < 0.05). Similar results can be observed for MRC-1
(Fig. 4B) and TGF-b (Fig. 4C) detection, while opposite results
for TNF-a detection (Fig. 4D). For these molecules, there was
no difference between uninfected and heat-inactivated H37Rv-
infected cells. The results suggest that inhibition of Wnt5a by
Sfrp1 can induce mice BM-Mø trending to M2 phenotype in
MTB-infected cells, which hints that the reduced Wnt5a can
also have a regulation effect on BM-Mø phenotype. This
finding reveals a novel way for Mø to manipulate themselves to
resistant MTB-induced immune responses.
Inhibition of Wnt5a by Sfrp1 leads to apoptosis
increase of MTB-infected mice BM-Mø
To explore whether the reduced Wnt5a influences the apo-
ptosis of MTB-infected mice BM-Mø, cell apoptosis was de-
tected in heat-inactivated H37Rv- infected, H37Rv-infected,
or uninfected cells (Fig. 5A). As shown in Figure 5B, cell
apoptosis rate was significantly increased in H37Rv-infected
cells (*p < 0.05), which can be further enhanced in H37Rv-
infected Sfrp1-overexpressed cells (*p < 0.05). These results
indicate that inhibition of Wnt5a by Sfrp1 can lead to apoptosis
WNT5A DEFICIENCY REGULATES MTB-INFECTED MØ 63

FIG. 3. The effects of up- or downregulated Wnt5a on inflammatory cytokine secretion in mice BM-Mø. Mice BM-Mø
prepared in methods were allowed to receive heat-inactivated H37Rv infection or H37Rv infection by a MOI of 6:1 for 12 h.
Wnt5a levels were verified by RT-qPCR and Western blot. Inflammatory cytokine levels were detected by RT-qPCR. (A)
Relative Wnt5a mRNA level in BM-Mø. (B) Expression of Wnt5a in BM-Mø. (A, B) *p < 0.05 versus pcDNA3.1/V5-HisA-
empty or siRNA-NC cells. Levels of mRNA were measured in BM-Mø for TNF-a (C), IL-1b (D), IL-12 (E), and IL-6 (F).
(C–F) For H37Rv-infected cells, *p < 0.05 or **p < 0.01 versus uninfected or heat-inactivated H37Rv-infected cells; for
H37Rv-infected Sfrp1-overexpressed or -silenced cells, *p < 0.05 versus H37Rv-infected cells.

increase of MTB-infected mice BM-Mø, which results in the Discussion

destruction of survival environment for MTB. Hence, we
conclude that the reducing of Wnt5a is a tactful strategy Wnt proteins are well known for their role in embryonic
adopted by mice BM-Mø to manipulate theirselves to resistant development and tissue homeostasis (Angers and Moon,
MTB infection. 2009; van Amerongen and Nusse, 2009). Based on recently
64 CHEN ET AL.

FIG. 4. Changes of Arg-1,

MRC-1, TGF-b, and TNF-a
levels in mice BM-Mø. Mice
BM-Mø prepared in methods
were allowed to receive heat-
inactivated H37Rv infection
or H37Rv infection by a MOI
of 6:1 for 12 h. Levels of
mRNA were measured in
BM-Mø by RT-qPCR for
Arg-1 (A), MRC-1 (B),
TGF-b (C), and TNF-a (D).
For H37Rv-infected cells,
*p < 0.05 versus uninfected
or heat-inactivated H37Rv-
infected cells; for H37Rv-
infected Sfrp1-overexpressed
cells, *p < 0.05 versus
H37Rv-infected cells.

accumulated evidences, Wnt signaling was also shown to be
involved in the regulation of inflammatory processes and
infectious diseases (Schaale et al., 2011). In this study, we
discovered that external disturbance triggered Wnt5a lower
expression can attenuate inflammatory cytokine secretion,
induce Mø to trend to M2 phenotype, and increase cell
apoptosis of MTB-infected mice BM-Mø, which may lead
to a prominent protective effect on mice from MTB infec-
tion. Our data revealed a novel strategy that was adopted by
Mø to manipulate themselves to resistant MTB-induced

FIG. 5. Changes of cell apoptosis in mice BM-Mø. Mice BM-Mø prepared in methods were allowed to receive heat-
inactivated H37Rv infection or H37Rv infection by a MOI of 6:1 for 12 h. (A) Cell apoptosis was measured by Annexin V-
FITC Apoptosis Detection Kits. (B) Quantification of relative apoptotic mice BM-Mø. For H37Rv-infected cells, *p < 0.05
versus uninfected or heat-inactivated H37Rv-infected cells; for H37Rv-infected Sfrp1-overexpressed cells, *p < 0.05 versus
H37Rv-infected cells.
WNT5A DEFICIENCY REGULATES MTB-INFECTED MØ
immune responses and enhance MTB-induced Mø apoptosis
in mice, which can increase our understanding of the in-
teraction between MTB and Mø.
Currently, the pro-inflammatory effects of Wnt5a have
been found in several inflammatory diseases, such as sepsis
(Chen et al., 2015), atherosclerosis (Bhatt et al., 2012), and
rheumatoid arthritis (de Sousa Rabelo et al., 2010). Wnt5a
can act through Ca2+/calmodulin-dependent protein kinase
(CaMKII) and that this pathway can contribute to the in-
flammatory response of Mø (Pereira et al., 2008), which is
the first cell type encountered by invaded MTB (Ernst,
1998). A Blumenthal et al. (2006) previously found that
Wnt5a was induced in MTB-infected human Mø and plays a
pro-inflammatory effect. Similarly, our data also identified
the pro-inflammatory roles of Wnt5a in MTB-infected mice
BM-Mø. Differently, reduction of Wnt5a was ubiquitously
observed in MTB-treated mice lung tissues or MTB-infected
mice BM-Mø in our study, which was in accordance with
the findings by Reiling and colleagues (Schaale et al., 2013).
The different response of Wnt5a expression to MTB-
infection in human and mice Mø may hint different inter-
action pattern between MTB and Mø.
In our study, Wnt5a was proved to be significantly re-
duced in MTB-treated mice lung tissues or MTB-infected
mice BM-Mø in dose and time-dependent manner. In Wnt5a
deficiency mice lung tissues or BM-Mø, MTB-induced in-
creases of pro-inflammatory cytokines, including TNF-a,
IL-1b, IL-12, and IL-6, can be markedly attenuated, which
indirectly reflected the pro-inflammatory effect of Wnt5a
during MTB infection. Among these cytokines, TNF-a is
essential for lung granuloma formation of tuberculosis
patients (Chensue et al., 1994).
For the past few years, the concept of Mø polarization has
been widely developed and further sophisticated (Schaale
et al., 2013). At present, Mø are deemed as a spectrum of
phenotypic subtypes ranging from classically activated Mø
(M1) to the alternatively activated Mø (M2) based on gene
expression induced in response to pathogen- or cytokine-
derived stimulation (Benoit et al., 2008; Mosser and
Edwards, 2008). In this study, meanwhile, we discovered
that Wnt5a deficiency can contribute to the tendency of
mice Mø to be M2 phenotype, which can be reflected by the
slightly reversed expressions of Arg-1, MRC-1, TGF-b, and
TNF-a in MTB-infected Wnt5a deficiency mice BM-Mø.
Among the above molecules, Arg-1 and MRC-1 are the
well-known markers of M2 Mø (Yang et al., 2012).
As always, the interaction between MTB and Mø is
complex and difficult to illustrate. When MTB enters into
the distal airways, patrolling Mø can provide a critical in-
tracellular niche that is required for MTB to infect alveolar
Mø and establish infection in the human host (Lee et al.,
2009). However, induction of Mø apoptosis is associated
with the killing of intracellular MTB (Molloy et al., 1994;
Oddo et al., 1998). In our study, Mø apoptosis was signifi-
cantly increased in MTB-infected mice BM-Mø and further
markedly enhanced in MTB-infected Wnt5a deficiency mice
BM-Mø, which are unfavorable for MTB survival. Hence,
the reduction of Wnt5a in MTB-infected mice BM-Mø is a
tactful strategy adopted by Mø against MTB infection. Be-
sides, we guess that Wnt5a deficiency induced BM-Mø
apoptosis increase may entirely or partially contribute to the
reduction of inflammatory cytokine secretion mentioned
65
above, which will be illuminated in our further study. In
summary, our study revealed that Wnt5a deficiency can lead
to a resistance of Mø to MTB-induced immune responses
and reinforce MTB-induced Mø apoptosis in mice.
Disclosure Statement
No competing financial interests exist.
References
Angers, S., and Moon, R.T. (2009). Proximal events in Wnt
signal transduction. Nat Rev Mol Cell Biol 10, 468–477.
Benoit, M., Desnues, B., and Mege, J-L. (2008). Macrophage
polarization in bacterial infections. J Immunol 181, 3733–
3739.
Bhatt, P.M., Lewis, C.J., House, D.L., Keller, C.M., Kohn, L.D.,
Silver, M.J., et al. (2012). Increased Wnt5a mRNA expression in
advanced atherosclerotic lesions, and oxidized LDL treated hu-
man monocyte-derived macrophages. Open Circ Vasc J 5, 1–7.
Blumenthal, A., Ehlers, S., Lauber, J., Buer, J., Lange, C.,
Goldmann, T., et al. (2006). The Wingless homolog WNT5A
and its receptor Frizzled-5 regulate inflammatory responses of
human mononuclear cells induced by microbial stimulation.
Blood 108, 965–973.
Chandolia, A., Rathor, N., Sharma, M., Saini, N.K., Sinha, R.,
Malhotra, P., et al. (2014). Functional analysis of mce4A
gene of Mycobacterium tuberculosis H37Rv using antisense
approach. Microbiol Res 169, 780–787.
Chen, M., Zhong, W., Hu, Y., Liu, J., and Cai, X. (2015).
Wnt5a/FZD5/CaMKII signaling pathway mediates the effect
of BML-111 on inflammatory reactions in sepsis. Int J Clin
Exp Med 8, 17824–17829.
Chensue, S.W., Warmington, K., Ruth, J., Lincoln, P., Kuo,
M-C., and Kunkel, S.L. (1994). Cytokine responses during
mycobacterial and schistosomal antigen-induced pulmonary
granuloma formation. Production of Th1 and Th2 cytokines
and relative contribution of tumor necrosis factor. Am J Pa-
thol 145, 1105–1113.
Christman, M.A., Goetz, D.J., Dickerson, E., McCall, K.D.,
Lewis, C.J., Benencia, F., et al. (2008). Wnt5a is expressed in
murine and human atherosclerotic lesions. Am J Physiol
Heart Circ Physiol 294, H2864–H2870.
de Sousa Rabelo, F., da Mota, L.M.H., Lima, R.A.C., Lima,
F.A.C., Barra, G.B., de Carvalho, J.F., et al. (2010). The Wnt
signaling pathway and rheumatoid arthritis. Autoimmun Rev
9, 207–210.
Dheda, K., Booth, H., Huggett, J.F., Johnson, M.A., Zumla, A.,
and Rook, G.A. (2005). Lung remodeling in pulmonary tu-
berculosis. J Infect Dis 192, 1201–1210.
Ernst, J.D. (1998). Macrophage receptors for Mycobacterium
tuberculosis. Infect Immun 66, 1277–1281.
Green, S.J., Tarone, G., and Underhill, C.B. (1988). Aggregation of
macrophages and fibroblasts is inhibited by a monoclonal anti-
body to the hyaluronate receptor. Exp Cell Res 178, 224–232.
Heldwein, K.A., and Fenton, M.J. (2002). The role of Toll-like
receptors in immunity against mycobacterial infection. Mi-
crobes Infect 4, 937–944.
Hölscher, C., Atkinson, R.A., Arendse, B., Brown, N., My-
burgh, E., Alber, G., et al. (2001). A protective and agonistic
function of IL-12p40 in mycobacterial infection. J Immunol
167, 6957–6966.
Kikuchi, A., Yamamoto, H., and Sato, A. (2009). Selective
activation mechanisms of Wnt signaling pathways. Trends
Cell Biol 19, 119–129.
66
Kremer, L., Estaquier, J., Brandt, E., Ameisen, J.C., and Locht,
C. (1997). Mycobacterium bovis Bacillus Calmette Guerin
infection prevents apoptosis of resting human monocytes. Eur
J Immunol 27, 2450–2456.
Lee, J., Hartman, M., and Kornfeld, H. (2009). Macrophage
apoptosis in tuberculosis. Yonsei Med J 50, 1–11.
Love, S., Shannon, B., Myrvik, Q., and Lynn, W. (1979). Char-
acterization of macrophage agglutinating factor as a hyaluronic
acid-protein complex. J Reticuloendothel Soc 25, 269–282.
Molloy, A., Laochumroonvorapong, P., and Kaplan, G. (1994).
Apoptosis, but not necrosis, of infected monocytes is coupled
with killing of intracellular bacillus Calmette-Guerin. J Exp
Med 180, 1499–1509.
Mosser, D.M., and Edwards, J.P. (2008). Exploring the full spec-
trum of macrophage activation. Nat Rev Immunol 8, 958–969.
Oddo, M., Renno, T., Attinger, A., Bakker, T., MacDonald,
H.R., and Meylan, P.R. (1998). Fas ligand-induced apoptosis
of infected human macrophages reduces the viability of in-
tracellular Mycobacterium tuberculosis. J Immunol 160,
5448–5454.
Pereira, C., Schaer, D.J., Bachli, E.B., Kurrer, M.O., and
Schoedon, G. (2008). Wnt5A/CaMKII signaling contributes
to the inflammatory response of macrophages and is a target
for the antiinflammatory action of activated protein C and
interleukin-10. Arterioscler Thromb Vasc Biol 28, 504–510.
Rahman, M.A., Sobia, P., Gupta, N., Van Kaer, L., and Das, G.
(2014). Mycobacterium tuberculosis subverts the TLR-2-
MyD88 pathway to facilitate its translocation into the cytosol.
PLoS One 9, e86886.
Reiling, N., Klug, K., Krallmann-Wenzel, U., Laves, R., Goyert,
S., Taylor, M.E., et al. (2001). Complex encounters at the
macrophage-mycobacterium interface: studies on the role of the
mannose receptor and CD14 in experimental infection models
with Mycobacterium avium. Immunobiology 204, 558–571.
Reiling, N., Hölscher, C., Fehrenbach, A., Kröger, S.,
Kirschning, C.J., Goyert, S., et al. (2002). Cutting edge: toll-
like receptor (TLR) 2-and TLR4-mediated pathogen recog-
nition in resistance to airborne infection with Mycobacterium
tuberculosis. J Immunol 169, 3480–3484.
Russell, D.G., Cardona, P-J., Kim, M-J., Allain, S., and Altare,
F. (2009). Foamy macrophages and the progression of the
human tuberculosis granuloma. Nat Immunol 10, 943–948.
CHEN ET AL.
Schaale, K., Brandenburg, J., Kispert, A., Leitges, M., Ehlers,
S., and Reiling, N. (2013). Wnt6 is expressed in granuloma-
tous lesions of Mycobacterium tuberculosis—infected mice
and is involved in macrophage differentiation and prolifera-
tion. J Immunol 191, 5182–5195.
Schaale, K., Neumann, J., Schneider, D., Ehlers, S., and Reiling,
N. (2011). Wnt signaling in macrophages: augmenting and
inhibiting mycobacteria-induced inflammatory responses. Eur
J Cell Biol 90, 553–559.
Surinkaew, S., Dawson, K., Qi, X.-Y., Sun, Y., Huang, H.,
Chen, Y., et al. (2015). Role of Wnts and secreted frizzled-
related protein-1 in atrial fibroblast pathophysiology during
atrial fibrotic remodeling. Circulation 132, A11625-A.
van Amerongen, R., and Nusse, R. (2009). Towards an inte-
grated view of Wnt signaling in development. Development
136, 3205–3214.
Venketaraman, V., Dayaram, Y.K., Talaue, M.T., and Connell,
N.D. (2005). Glutathione and nitrosoglutathione in macro-
phage defense against Mycobacterium tuberculosis. Infect
Immun 73, 1886–1889.
Yang, L., Chu, Y., Wang, Y., Zhao, X., Xu, W., Zhang, P., et al.
(2014). siRNA-mediated silencing of Wnt5a regulates in-
flammatory responses in atherosclerosis through the MAPK/
NF-kB pathways. Int J Mol Med 34, 1147–1152.
Yang, Q., Shi, Y., He, J., and Chen, Z. (2012). The evolving
story of macrophages in acute liver failure. Immunol Lett
147, 1–9.
Address correspondence to:
Guobao Li, MS
Department of Pulmonary Diseases
Shenzhen Third People’s Hospital
No.29, Bulan Road
Longgang District
Shenzhen 518112
China
E-mail: guobaoligbl@163.com
Received for publication June 16, 2016; received in revised
form September 26, 2016; accepted September 26, 2016.
Copyright of DNA & Cell Biology is the property of Mary Ann Liebert, Inc. and its content
may not be copied or emailed to multiple sites or posted to a listserv without the copyright
holder's express written permission. However, users may print, download, or email articles for
individual use.