BIOL 2153 Genetics Name: ____ANSWER KEY___________

In-class Exercise, Spring 2010 print legibly!

Circle your section number below [1-4] Paws: ___________________@lsu.edu

1 = 7:40 Wed. 2 = 8:40 Wed. 3 = 11:40 Wed. 4 = 12:40 Wed.

Base Composition of DNA sequences

Chargaff’s rules were obtained using 1940s-era biochemical methods. With modern DNA
sequencing technology, we can obtain DNA sequences directly, but generally the data come in
the form of single strands. We can then use Watson-Crick base-pair rules to infer the sequence
of the opposite or complementary strand. For example, consider this partial DNA sequence [we
will call this the ‘given’ strand] for a type of histone protein in the starfish Stylasterias forreri:

5'-CGCAAGAGTACTGGGGGTAAAGCCCCCCGAAAGCAGTTGGCGACCAAGGCTGCCCGAAAG
AGTGCCCCGGCTACCGGCGGCGTGAAGAAACCCCACCGTTACAGGCCTGGTACCGTGGCA
CTGCGGGAGATTCGCCGTTACCAGAAAAGCACAGAGCTGCTTATCCGAAAACTCCCTTTC
CAGAGACTGGTCCGTGAAATAGCGCAAGACTTCAAGACCGAACTCCGATTCCAGAGCTCA
GCAGTGATGGCGCTTCAAGAAGCGAGCGAGGCATATCTCGTGGGACTCTTCGAAGACACA
AATCTGTGTGCCATCCACGCCAAGCGGGTG-3'

Counting the numbers of the various base types and the total number of bases is simple but
tedious. It turns out that there are 330 bases in the above sequence: 94 are G, 86 are A, 54 are T
and 96 are C. IMPORTANT NOTE: BECAUSE THESE NUMBERS COME FROM A
SINGLE STRAND, THERE IS NO NECESSITY FOR THE MOLAR AMOUNTS TO
FOLLOW CHARGAFF’S RULES. If we express these abundances as percentages, we get the
following table [rounded to nearest 1%]:
g 94 28.48 a 86 26.06 t 54 16.36 c 96 29.09

%G %A %T %C
given strand 94/330=28% 86/330=26% 54/330=17% 96/330=29%
complement 29% 17% 26% 28%

1. Using your understanding of the Watson-Crick base-pair rules, fill in the base frequencies in
the above table for the complement [as percentages].

2. What is the %GC for the given strand? _____57%___________

3. What is the %GC for the complement of the given strand? _____57%_________

4. Is it always true that the %GC for a given strand and its complement will be equal?
YES or NO [circle one]

If you finish early: sequences like this histone gene that have %GC>50 are described as GC-rich,
or equivalently as AT-poor.
 195
Appendix VII: Additional base composition problems
The base-composition rules that Erwin Chargaff determined for double-stranded DNA:

[A] = [T]; [C] = [G]; and [purines] = [pyrimidines], where [ ] = molar amount

place strong constraints (limitations) on the values that these numbers can take. Even without knowing
Chargaff’s rules, because [A]+[T]+[C]+[G] = 100%, there are only 3 independent numbers, when molar
amounts of the four nucleotide types are expressed as percentages of the total. Chargaff’s equalities above
place additional limitations on the values that the molar amounts can take.

Note: Questions 1-3 below deal with three different double-stranded DNA molecules, and can be answered
using only simple arithmetic and your knowledge of the Watson-Crick pairing rules. Some numbers
cannot be determined from the available information; in those cases, write in “ND.”

1. In particular, if we know [A] = 30% for a DNA molecule, we can determine which of the following
numbers? [write in all values that can be determined]

%C = __20%___ %T = __30%____ %G = ___20%___ %GC = __40%___

2. Also, if we know %GC = 60% for a DNA molecule, we can determine which of the following
numbers? [write in all values that can be determined]

%C = __30%__ %T = __20%__ %G = __30%____ %A = __20%___

3. Finally, if we know [A]+[C]= 50% for a DNA molecule, we can determine which of the following
numbers? [write in all values that can be determined] Note: A wide range of base composition values
are compatible with [A]+[C]=50%, including the sequences from question 1 and 2 above, so the
molar amounts cannot be determined.
%C = __ND___ %T = __ND___ %G =____ND__ %A = __ND___ %GC = __ND___

4 In the laboratory, it is possible to synthesize short, synthetic, single-stranded DNA sequences. These
synthetic DNA molecules, commonly called oligos, can either have a defined [known] sequence, or
else one or more positions within the sequence can vary randomly. Suppose that 6-base oligos are
synthesized that have a random 50%/50% mixture of Gs and Cs at each position. What is the
probability that a particular synthetic molecule would have the sequence 5'GGGCCC3'?

[½ ]6 = 1/64 - note that the arithmetic needed for this question is exactly the same as calculating
the sequence of any particular series of 6 coin tosses, like H H H T T T.

5. Suppose that 4-base oligos are synthesized with the following sequence:

5' C N A N 3'

where the position identified as N can be A, C, T or G with 25% probability each. What are the
probabilities that a particular synthetic molecule would fall into each of the following three sequence
groups:
5' C N A Y 3' 5' C R A N 3' 5' C R A Y 3'

Answers: _1x1 x1x ½ = ½ __ 1x ½ x1x1 = ½ __ 1x½ x1x ½ = 1/4_

Note: the arithmetic is similar to question 4 except that only 1 or 2 positions are variable, not 6.
BIOL 2153, Sections 1-4, Dr. Foltz, Principles of Genetics, Spring Term 2010, Homework #5a Answers

1. What is the base sequence of the DNA strand that would be comp lementary to the following single-stranded
DNA molecules:

a. 5’ AGTTACCTGATCGTA 3’

3’ TCAATGGACTAGCAT 5’

b. 5’ TTCTCAAGAATTCCA 3’

3’ AAGAGTTCTTAAGGT 5’

2. Two double-stranded 25 base-pair DNA fragments are heated in solution. Fragment A has 60 percent GC,
and fragment B has 40 percent GC. Which fragment has higher density? Which fragment is more
thermostabile?

Fragment A, with higher %GC, has higher density and is more thermostabile than fragment B.

3. The percent cytosine in a double-stranded DNA is 17. What is the percent adenine in that DNA?

In double-stranded DNA, if (C) = 17 percent, then (G) = 17 percent. This means that the DNA has 34
percent G-C, and 66 percent A-T base pairs. The DNA will have 33 percent A.

4. A double-stranded DNA molecule is 100,000 base pairs (100 kilobases) long.

a. How many nucleotides does it contain?

Each base pair has 2 nucleotides, so the molecule has 200,000 nucleotides.

b. How many complete turns are there in the molecule?

There are 10 base pairs per complete 360° turn, so that there will be 100,000/10 = 10,000 complete turns
in the molecule.

5. Assume that the two strands of one very long dsDNA molecule are separated from each other and purified.
One purified strand is analyzed and has an [A+T]/[G+C] ratio of .66 and an [A+G]/[T+C] ratio of 2.33. HINT:
because these ratios are calculated for single strands, there is no necessary requirement that [purines] =
[pyrimidines].

a. The [A+T]/[G+C] ratio of the other purified (comp lementary) strand is 2/3

b. The [A+G]/[T+C] ratio of the other purified (complementary) strand is 3/7

There is a little arithmetic in question #5, but mostly this question tests your understanding of the
implications of the Watson-Crick basepairing rules. For part a, every time the given strand has an “A”
at a particular site, the complementary strand must have a “T” and vice versa. Let the frequencies of A,
T, G and C in the given strand be w, x, y and z. Then the [A+T]/[G+C] ratio of the given strand is
[w+x]/[y+z] = 2/3, and the [A+T]/[G+C] ratio of the complementary strand is [x+w]/[z+y] , which must
also equal 2/3. For part b, every time the given strand has a purine at a particular site, the
complementary strand must have a pyrimidine. So the [purine]/[pyrimidine] ratio of the complementary
strand must be the reciprocal of the [purine]/[pyrimidine] ratio of the given strand, or 1 / [7/3] = 3/7.
Spring 2010, answer key to assigned homework questions on page XIV
For questions 5-8, a tetranucleotide is any single-stranded sequence of four consecutive nucleotides,
commonly represented as 5'-N1 N2 N3 N4 -3', where each N=A or C or T or G. A trinucleotide is
any consecutive single-stranded sequence of three nucleotides, and can be depicted as 5'-N1 N2 N3 -3'.
The answer to question #5 [How many different tetranucleotide sequences......] is 4x4x4x4=256.

6. Assume that all four nucleotide types [A or C or T or G] are equally frequent in a long single-
stranded DNA sequence [called the ‘given sequence’]. What is the probability that a
randomly-drawn tetranucleotide sequence from the given sequence would have at least one A?

1 - Probability [ no A anywhere in the tetranucleotide ] = 1 - [3/4]4 = 1 - 81/256 =

175/256

7. For questions 7-8, suppose for the given DNA sequence in question #6 that the nucleotide
types are not equally frequent, but have the following relative frequencies:

A = 2/10; T = 3/10; C = 4/10; G = 1/10.

What are the nucleotide frequencies for the opposite strand to the given DNA sequence?

A = _3/10____; T = __2/10___; C = __1/10___; G = __4/10___.

8. For the given DNA sequence in question #7 with unequal nucleotide frequencies, what is the
probability that a randomly-drawn trinucleotide sequence from the given sequence would
have at least one C?

1 - Probability [ no C anywhere in the trinucleotide ] = 1 - [ 6/10 ]3 = 1 - [ 3/5 ]3 =

1 - 27 / 125 = 98/125

9. If a 60-bp double-stranded DNA molecule has a %GC = 33.33% = 1/3, how many total
hydrogen bonds would be present in this molecule?

1/3 of base pairs are G-C pairs with 3 H bonds and 2/3 are A-T pairs with 2 H bonds

so 60 ( [ 3 x 1/3 ] + [ 2 x 2/3 ] ) = 140 total H bonds