Role of Fusion Protein (Interferon α 2-Thymosin α 1) as Antiviral and

Anticancer Agent

Interferon (IFN) belong to a group of cytokines which perform various biological functions
such as anti-viral, anti-tumor and modulation of immune response (Nadeene and Andrew, 2004;
Murashima et al., 2000; Romerio & Zella, 2002). Interferon alpha (IFN-𝛼) is a widely used
cytokine for treatment of hepatitis and cancer (Ratih, 2014). It binds to receptors on surface of
cells and starts its signaling process through JAK-STAT pathway (Stark & Darnell, 2012). IFN-
α shows its antiviral effect either by inhibiting the intracellular virus life cycle or by regulation of
immune-system T-cell response during infection. IFN-α activate several enzymes such as 2-5
oligoadenylate synthetase (2-5 OAS), which causes activation of endoribonuclease RNAse L,
which further cleavage viral RNA and stops viral replication (Samuel, 2001; Malmgaard, 2004).
IFN-α shows its immunoregulatory effect through induction of other cytokines, expansion
of toxicity of natural killer cells, antibody-dependent cellular cytotoxicity and T cell cytotoxicity
and activation of macrophages and dendritic cells [Biron, 1999; Lukaszewski & Brooks, 2001].
Monocytes are differentiated into activated dendritic cells (DCs) which further generate antitumor
T-cell immunity for cancer immunotherapy (Paola, et al., 2010). Direct anti-proliferative activity
of INF-α occurs through inhibition of cancer cell growth by cell cycle arrest, apoptosis, or
differentiation and indirect activity occurs through activation of immune cells such as T cells and
natural killer cells, inhibition of vascularization (antiangiogenesis), and induction of cytokines.
[Samuel, 1999; Sarkar, et al., 1999]. Interferon alpha 2 (IFN- 2) is a commonly used FDA
approved protein of IFN-𝛼 family and has become world’s leading therapeutic protein. (Romerio
& Zella, 2002).
The hepatitis C virus (HCV) is a global health problem and the leading cause of chronic
liver disease in world. HCV infection effect annually more than one million people in world.
(Williams, 2006; Strader et al., 2004; Minello et al., 2005). Due to higher prevalence of hepatitis
infections and carcinomas in developing countries its demand is increasing very rapidly. In
Pakistan, Hepatitis B and C virus are mostly linked to liver carcinomas. Therefore, there is great
need for the availability of cheaper and more effective recombinant human IFN- 2 protein.
Hepatocellular carcinoma (HCC), the most common type of hepatobiliary cancer, is highly
lethal. The global incidence of HCC has continuously increased, with Asian countries accounting
for almost 80% of victims worldwide [Jemal, et al., 2011; - El-Serag, 2002; Altekruse, et al.,
2009]. IFN type I can improve the underlying liver pathology and reduce the risk of HCC in
patients with HBV or HCV infection [Liaw, 2004; . Camma, et al., 2005; Shamliyan, et al., 2009].
Chronic hepatitis B virus (HBV) infection is a critical risk factor for the carcinogenesis and
progression of hepatocellular carcinoma (HCC).
Thymosin α 1
Many cancer patients have depressed cellular immunity and progression of some cancer
appears to be related to impaired suppression of tumor by immune system. Thymosin-α1 (Tα1) is
a thymic peptide that activate immune response in disorders where immune system is ineffective
such as hepatitis, cancers and vaccine non-responsiveness by maturation and differentiation of
lymphocytes (Billich, 2002).
Tα1is used for treatment of chronic hepatitis B, chronic hepatitis C, and some types of
cancer, particularly hepatocellular carcinoma (Martins, et al., 2000). Tα1 can act on both mature
T cells and lymphoid cells to produce cytokines, induce cytokine receptors, and stimulate the
cytotoxic T lymphocytes mediated cytotoxic responses (Romani et al., 2004; Garaci et al., 2012).
The expression of MHC class I is enhanced in both lymphoid and non-lymphoid tissues by Tα1
(Kageshita et al., 1999). This up regulation of expression of MHC class I explains the anti-tumor
effect of Tα1 (Shrivastava et al., 2004). It also modulates the expression of other cytokines such
as IL-2, IL-3, IL-6, IL-12, IL-15, IFN-α and IFN-γ (Goldstein, 2009).
Tα1 also prevent the overstimulation of immune response by stimulating activity of
indoleamine 2-3 dioxygenase which further causes inhibition of cytokines production by
increasing production of regulatory T cells and increases expression of proteins on the surface of
virally infected and tumor cells as immune escape by virally infected and tumor cells has been
correlated with down regulation of antigen presenting cells (Romani, et al., 2006; Shrivastava,
et al., 2004; Pierluigi, et al., 2010). It increases intracellular glutathione that is important for
antiviral effects. (Palamara, et al., 1998).
Tα1 increases the effectiveness of chemotherapy due to increase in tumor infiltring
lymphocytes, ur regulation of anti-tumor T cells and enhanced expression of cell surface markers
and decrease the side effect of chemotherapy due to increase in regulatory T cells and decrease in
proinflammatry cytokines. Multiple studies showed that combination of IFN-α 2 with Tα1 may
provide a safe and more effective therapeutic approach in treatment of CHB patients. (Cynthia, et
al., 2013)

The combination of Tα 1 and IFN-α 2 is used in patients affected by chronic B and C

hepatitis including IFN-non-responders and infected by precore mutants or genotype 1b. Further
studies demonstrated additional biological activities clarifying the mechanism of action of Tα,
partially explaining the synergism with IFN. (Garaci, et al., 2010)

Ta1 has a pleiotropic mechanism of action, affecting multiple immune cell subsets that are
involved in immune suppression. (King, et al., 2016)
Evidence has been provided that combined treatments with thymosin alpha 1 (T alpha 1)
and low doses of interferon (IFN) or interleukin (IL)-2 are highly effective in restoring several
immune responses depressed by tumor growth and/or cytostatic drugs. In addition, when combined
with specific chemotherapy, they are able to increase the anti-tumor effect of chemotherapy while
markedly reducing the general toxicity of the treatment (Garaci, et al., 2000)
Combinatorial therapies, in which Tα1 represents one important mediator, are effective
therapeutic strategy against tumors and will be the key focus for the use of Tα1 in treating cancers
in the future. (Juan, et al, 2010)
Both IFN-α 2 and Tα1 are widely used proteins in the treatment of hepatitis B and C
(Molloy, et al., 1996; Arase et al., 2003). A series of clinical trails show that, when compared
with standard therapeutic regimens, combination therapy of IFNα and Tα1 could significantly
enhance antiviral and biochemical response rates in patients with hepatitis B and C, and is well
tolerated (Saruc., et al., 2002; Saruc et al., 2003). Combination of Tα1 with IFN-α is becoming
one of the most promising options in improving the response rate of chronic hepatitis B virus and
hepatitis C virus infection and decreasing its probability of developing into hepatocellular
carcinoma.
Combination therapy of Tα1 with pegylated interferon α 2 (peg-IFN-α2) reduces the viral
replication sufficiently in patients who had difficulties in treating their hepatitis C with an
advantage of having not too much side effects (Rustgi, 2004). As many patients are non-
responsive to standard ribavarin and peg-IFN therapy (Fried et al., 2002), a combinational therapy
including Tα1, ribavarin and peg-IFN-α2 has been devised which is safe (Camerini et al., 2007).
It is an effective therapy for those patients who are non-responsive to conventional therapies (Poo
et al., 2008).
The goal of this study is to produce pharmaceutically important interferon-α 2-thymosin-
α1 fusion protein for using as substitute of interferon-α 2 and Tα1 used separately in combination
therapy to decrease the cost and increase the effectiveness therapy. The use of Tα1 as a fusion
partner with interferon therapy will possibly stimulate the cells of immune system, including NK,
CD4, and CD8 cells and will trigger dendritic cells (DC) maturation through TLR activation
(Romani et al., 2004; Romani et al., 2006) as impaired DC maturation is an issue in many types
of cancer (Wang et al., 2008; Kim et al., 2009; Kirkwood et al., 2008) and accumulation of
immature DCs is also considered to be a hallmark of tumor patients (Nefedova et al., 2004). Tα1
will stimulate a Th1-type immune response (Peng et al., 2008; Yao et al., 2007; Loggi, 2008) as
Th1-type response has therapeutic value in treating tumors. It will also leads to an increase in
specific anti-tumor cytotoxic T-cells (Rasi et al., 1998). It will increase expression of proteins that
mediate antigen presentation, including major histocompatibility (MHC) Class I, MHC Class II,
and beta-2 microglobulin (Liu et al., 2002).

OR INTRODUCTION FOR THIS TOPIC COULD BE WRITTEN AS

This study involves construction of interferon α 2-thymosin α 1 fusion gene and a
genetically stable expression system leading to high level expression of interferon-α2-thymosin-
α1 fusion protein in E.coli, its purification and refolding in bioactive form, characterization and
study of its biological activity. This study also includes the targeted delivery of pharmaceutically
important recombinant fusion protein as a result of which safety and tolerability of therapeutic
protein in non target tissues will be improved. The antiviral and anti-cancer efficacy will be
increased by triggering localized immune response and side effects of systemic administration will
be reduced.
The use of fusion protein of IFN-α2 and Tα1 is a promising option for treatment of hepatitis
B and C viral infections and it also decreases probability of onset of hepatocellular carcinoma. The
achievement of above mentioned goals will provide basis for economical in-house
biotechnological production of biopharmaceuticals in Pakistan with enhanced effectiveness.
 Interferons belong to a group of cytokines which perform various biological functions such
as antiviral activity, suppression of tumor cells proliferation and modulation of immune response.
The attachment of interferons to specific receptors on cell surface results in stimulation of different
signaling pathways in the cell. (Nadeene and Andrew, 2004; Murashima et al., 2000; Romerio &
Zella, 2002). There are two types of human interferons on the basis of type of receptors through
which they signal. (Kontsek and Kontsekova, 1997). Type I interferons consist of Interferons
alpha, beta and omega while type II interferons consist of interferon gamma (Biron and Sen, 2001).
Interferon alpha 2 (IFN- 2) is a commonly used FDA approved protein and has become world’s
leading therapeutic protein. Due to prevalence of hepatitis infections and carcinomas in developing
countries its demand is increasing very rapidly. In Pakistan, Hepatitis B and C virus are mostly
linked to liver carcinomas. Therefore, there is great need for the availability of cheaper and more
effective recombinant human IFN- 2 protein.
Thymosin-α1 (Tα1) is a thymic peptide that plays an important function in the maturation,
differentiation and function of lymphocytes (Billich, 2002). It can act on both mature T cells and
lymphoid cells to produce cytokines, induce cytokine receptors, and stimulate the cytotoxic T
lymphocytes mediated cytotoxic responses (Romani et al., 2004; Garaci et al., 2012). The
expression of MHC class I is enhanced in both lymphoid and non-lymphoid tissues by Tα1
(Kageshita et al., 1999). This up regulation of expression of MHC class I explains the anti-tumor
effect of Tα1 (Shrivastava et al., 2004). It also modulates the expression of other cytokines such
as IL-2, IL-3, IL-6, IL-12, IL-15, IFN-α and IFN-γ (Goldstein, 2009).
Both IFN-α 2 and Tα1 are widely used proteins in the treatment of hepatitis B and C
(Molloy, et al., 1996; Arase et al., 2003). A series of clinical trails show that, when compared with
standard therapeutic regimens, combination therapy of IFNα and Tα1 could significantly enhance
antiviral and biochemical response rates in patients with hepatitis B and C, and is well tolerated
(Saruc., et al., 2002; Saruc et al., 2003). Combination of Tα1 with IFN-α is becoming one of the
most promising options in improving the response rate of chronic hepatitis B virus and hepatitis C
virus infection and decreasing its probability of developing into hepatocellular carcinoma.
Combination therapy of Tα1 with pegylated interferon α 2 (peg-IFN-α2) reduces the viral
replication sufficiently in patients who had difficulties in treating their hepatitis C with an
advantage of having not too much side effects (Rustgi, 2004). As many patients are non-responsive
to standard ribavarin and peg-IFN therapy (Fried et al., 2002), a combinational therapy including
Tα1, ribavarin and peg-IFN-α2 has been devised which is safe (Camerini et al., 2007). It is an
effective therapy for those patients who are non-responsive to conventional therapies (Poo et al.,
2008).
The goal of this study is to produce pharmaceutically important interferon-α 2-thymosin-
α1 fusion protein for using as substitute of interferon-α 2 and Tα1 used separately in combination
therapy to decrease the cost and increase the effectiveness therapy. The use of Tα1 as a fusion
partner with interferon therapy will possibly stimulate the cells of immune system, including NK,
CD4, and CD8 cells and will trigger dendritic cells (DC) maturation through TLR activation
(Romani et al., 2004; Romani et al., 2006) as impaired DC maturation is an issue in many types of
cancer (Wang et al., 2008; Kim et al., 2009; Kirkwood et al., 2008) and accumulation of immature
DCs is also considered to be a hallmark of tumor patients (Nefedova et al., 2004). Tα1 will
stimulate a Th1-type immune response (Peng et al., 2008; Yao et al., 2007; Loggi, 2008) as Th1-
type response has therapeutic value in treating tumors. It will also leads to an increase in specific
anti-tumor cytotoxic T-cells (Rasi et al., 1998). It will increase expression of proteins that mediate
antigen presentation, including major histocompatibility (MHC) Class I, MHC Class II, and beta-
2 microglobulin (Liu et al., 2002).
This study involves construction of interferon α 2-thymosin α 1 fusion gene and a
genetically stable expression system leading to high level expression of interferon-α2-thymosin-
α1 fusion protein in E.coli, its purification and refolding in bioactive form, characterization and
study of its biological activity. This study also includes the targeted delivery of pharmaceutically
important recombinant fusion protein as a result of which safety and tolerability of therapeutic
protein in non target tissues will be improved. The antiviral and anti-cancer efficacy will be
increased by triggering localized immune response and side effects of systemic administration will
be reduced.

Review of the Literature

Interferons exert many biological effects (Nadeene and Andrew, 2004) which start after
attachment of interferons to specific cell surface receptors which results in activation of various
signaling pathway in the cell (Murashima et al., 2000; Stark et al., 1998). The activation of
signaling pathways leads to different biochemical and physiological states of the cell such as anti-
proliferation, antiviral effect, antitumor effect, immunomodulatory and apoptotic states (Stark et
al., 1998). Due to interferon attachment to its receptor, five major protein systems are
activated which are protein kinase R (PKR) system (Samuel, 1993), 2-5A oligoadenylate
synthetase (OAS) and RNAse L system, RNA-Specific Adenosine Deaminase (George and
Samuel, 1999), Mx and Nitric Oxide synthase system and major histocompatibility complex
proteins (Bach et al., 1997).
Interferon (IFN) is the the first recombinant cytokine to be licensed in the United State
America for the treatment of a malignancy in 1986, with the approval of IFN-α2a and IFN-α2b for
the treatment of Hairy Cell Leukemia. Human interferon alpha 2 (IFN-2) is a widely used
therapeutic protein with antiviral anticancerous and immunomodulatory effects. IFN 2 therapy
reduces the size of tumors by causing the interaction between natural killer cells (NK cells) and
cancerous cells (Biron et al., 1999). It also reduces the chances of hepatocellular carcinoma which
is caused by Hepatitis B and C virus by reducing the overall viral load in the body. This protein
restricts the cancerous cell growth by the mechanism which is not completely known but it is
considered that cell cycle control apparatus components are usually targeted (Tete et al., 1999).
Interferons are the products of several biotechnology and pharmaceutical companies.
These include interferon alpha 2a (IFN-2a) as Roferon A (Hoffman-La Roche), IFN-2b as
Intron A (Schering Corp), consensus IFN-con as Infergen (Amgen), Alferon N (Interferon
Sciences), and Wellferon (Glaxo Wellcome). In January 2001, the Food and Drug
Administration approved a pegylated form of IFN-2b (PEG-Intron; Schering) for treatment
of chronic hepatitis C in patients not previously treated with IFN-alpha.
The recombinant IFN-2a protein is expressed in different host systems and bacterial
expression system is the most widely used host system. (Pestika, 2007). Bacteria are capable of
producing IFN-2a protein in sufficient amounts that otherwise cannot be isolated in high amounts.
To date for interferon, all the reported bacterial expression systems that are used have high copy
number (30-40) plasmids in conjunction with strong promoters like phage T7, trp, UV-5 lac and
leftward promoter (pL) of bacteriophage lambda.
In the ensuing years, a considerable number of studies have been conducted to establish
the mechanisms of the induction and action of IFN’s anti-tumor activity. These include identifying
the role of Interferon Regulatory Factor 9 (IRF9) as a key factor in eliciting the antiproliferative
effects of IFN-α as well as identifying genes induced by IFN that are involved in recognition of
tumor cells. Recent studies also show that IFN-activated human monocytes can be used to achieve
>95% eradication of select tumor cells. The signaling pathways by which IFN induces apoptosis
can vary. IFN treatment induces the tumor suppressor gene p53, which plays a role in apoptosis
for some tumors, but it is not essential for the apoptotic response. IFN-α also activates
phosphatidylinositol 3-kinase (PI3K), which is associated with cell survival. Downstream of PI3K
is the mammalian target of rapamycin (mTOR) which, in conjunction with PI3K, may act in
signaling induced by growth factors after IFN treatment. This paper will explore the mechanisms
by which IFN acts to elicit its antiproliferative effects and more closely examine the clinical
applications for the anti-tumor potential of IFN (Bekisz et al., 2010).
Tα1 enhances the speed of maturation process of T cells by escalating production of certain
cytokines like IFN-γ, IFN-α, IL-2, IL-3, IL-6, IL-7, IL-10, IL-12 and IL-15 which is followed by
mitogen activation. CD34+ human stem cells are differentiated into CD3+4+ by Tα1. It also induces
differentiation of dendritic cells from CD14+ monocytes (Knutsen et al., 1999). Tα1 shows a lot
of biological activities as it can act on both mature T cells and lymphoid cells to produce cytokines
and induce cytokine receptors (Romani et al., 2004). The expression of MHC class I is also
enhanced in both lymphoid and non-lymphoid tissues by Tα1 (Kageshita et al., 1999). This
upregulation of expression of MHC class I explains the anti-tumor effect of Tα1 (Shrivastava et
al., 2004). By inhibition of NFkB, NF-κB (I-κB) kinase (IKK) and TNF-receptor-associated factor
6 (TRAF6) signaling pathway through inhibitors, Tα1 enhances expression of IL-6 (Zhang et al.,
2005).
Thymosin alpha 1 is also important in suppression of hepatitis C infection. They increased
the expression of cytokines. On incubation with TA1, IFN-a, or both, on production of Th1-
associated cytokines (IL-2, IFN-c) increases. Incubation with Tα1 resulted in a decrease in IL-4
and IL-10, whereas IFN-increased these cytokines (Andreone et al., 2001).
Since it was first identified, thymosin alpha 1 (Tα1) has been characterized as a molecule
retaining pleiotropic effects toward several pathological conditions, in particular, acting as a
modulator of immune response and inflammation. Several properties exerted by Tα1 could be
attributable to a direct action on lymphoid cells. Tα1 has been shown to exert an immune
modulatory activity toward both T cell and natural killer cell maturation and to have an effect on
functions of mature lymphocytes, by stimulating cytokine production and cytotoxic T lymphocytes
mediated cytotoxic responses.
 In various studies, it is shown that Tα1 increases the expression of major
histocompatibility complex class I surface molecules in murine and human tumor cell lines and in
primary cultures of human macrophages. It is also documented that Tα1 is also capable of
increasing the expression of tumor antigens in both experimental and human tumor cell lines. This
effect, which is exerted at the level of the target tumor cells, represents an additional factor
increasing the antitumor activity of Tα1 (Garaci et al., 2012).
The maturity of T cells is enhanced by Tα1 (Ahmed et al., 1979). It plays important role in
differentiating precursor stem cells into CD4+ and CD8+ T cells (Peng et al., 2008).Cells having
viral infection are killed by cytotoxic lymphocytes (CD8+ T cells) and natural killer cells (Rustgi,
2005). It also triggers the activation of dendritic cells. In one case it exerted negative effect on
tumor necrosis factor α and IL-1β which resulted in decrease of degree of severe acute pancreatitis
(Yao et al., 2007). The mechanism of action on immune system by thymosin is unclear. However,
research work has shown that thymosin controls the expression of genes of MHC I, MHC II,
different cytokines and immune regulators (Garaci et al., 2003).When exposure of thymosin is
given, genes of different immune modulators like of chemokines, cytokines and major
histocompatibility were upregulated (Naylor et al., 2007).
Multiple studies have demonstrated an effect of Tα1 on the production of a number of
cytokines by peripheral blood lymphocytes (PBL), among which were migration inhibition factor
(MIF), colony stimulating factor (CSF), (Lopez et al., 1994) including the granulocyte-
macrophage CSF (GMCSF), B cell growth factor, (Kouttab et al., 1988) interferon (IFN), and
interleukin-2 (IL-2) (Sztein, & Serrate, 1989). For this last cytokine, the effect was even greater,
as Leichtling et al. demonstrated that Tα1 was also capable of modulating the expression of high-
affinity IL-2 receptors in mitogen-stimulated normal human lymphocytes (Leichtling et al., 1999).
Since then, Tα1 was thought to act not as a first signal in the induction of cytokine production but,
rather as a super-inducing accessory signal. Because of this characteristic, it appeared of great
potential when used with other cytokines in combination therapies.
The treatment with Tα1 for four days, followed by a single injection of α,β-IFN (Mastino
et al., 1992) hours before testing, strongly restored NK activity in cyclophosphamide (CY)-
suppressed mice. Moreover, Tα1 was able to accelerate the recovery rate of NK activity in bone
marrow reconstituted murine chimeras. The data, taken together, support the concept that the
synergistic effect between Tα1 and α,β-IFN could be the result of action on differentiation of the
NK lineage at different levels.8 NK cells are known to play a major role in the antitumor immune
response. Thus, our approach to the treatment of tumors used a combined protocol consisting of
the administration of Tα1 and IFN or IL-2 after CY. The rationale of the this triple combination
was based on the assumption that chemotherapy, although reducing the tumor mass, induces a
marked suppression of the immune response, which could be restored by means of the combined
immunotherapy.
Thymosin α 1 (Tα1) is an immunomodulatory polypeptide that enhances effector T-cell
responses. In this large randomized study, they evaluated the efficacy and safety of combining Tα1
with dacarbazine (DTIC) and interferon α (IFN-α) in patients with metastatic melanoma. These
results suggest Tα1 has activity in patients with metastatic melanoma and provide rationale for
further clinical evaluation of this agent (Maio et al., 2010).
The mechanism underlying the activity of DTIC+Tα1 is not fully understood, it is possible
that Tα1 potentiates T-cell mediated immune responses directed against tumor antigens released
from cells destroyed by DTIC. It is known that tumor-cell apoptosis induced by cytotoxic agents
can increase levels of cross-presentation of tumor antigens by specialist antigen-presenting cells,
such as dendritic cells (Nowak, et al., 2003). However, this phenomenon is, in itself, usually not
sufficient to induce an immune response in the absence of proinflammatory signals within the
tumor microenviroment (van der Most., et al., 2006). In this respect, the capacity of Tα1 to prime
immune responses, via pleiotropic mechanisms, may be important. A mechanistic link between
DTIC and Tα1 may be related to the fact that T_1 can activate Toll-like receptor 9 (TLR9) on
dendritic cells, (Romani et al., 2007) as this receptor is particularly important in enhancing
antitumor T-cell responses. suggests that potentiation of the intrinsic immune response with Tα1,
in the absence of additional toxicity, may be an important development toward improving clinical
outcomes in patients with metastatic melanoma.
Combined therapy consisting of the use of chemotherapeutic agents associated with
thymosin α1 (Tα1) and cytokines such as α-interferon (αIFN), interleukin-2 (IL-2). It is
demonstrated that the combined treatments with Tα1 plus low doses of IFN (Tα1 + IFN) or IL-2
(Ta1 + IL-2), or IRX-2 (Tα1 + IRX-2) show powerful biological effects both in vitro and in vivo.
In fact, they are able to restore cytotoxic activities in conditions of immune-suppression induced
by different tumours and/or cytostatic drugs. In addition, when these combined treatments are
administered after chemotherapy, they are able to cure or to induce a dramatic inhibition of tumour
growth in different experimental models, i.e. Lewis lung carcinoma (3LL), B-16 melanoma and
Friend-erythro leukemia in mice and DHD-12 colorectal carcinoma in rats (Garaci et al., 2003). In
each of these indications, positive data support the idea that an improvement in immune function
through the use of thymosin alpha 1 is a useful addition to traditional chemotherapies.
Interferon alpha (IFNa) is used for the treatment of hepatitis C infection and whilst
efficacious it is associated with multiple adverse events including reduced leukocyte, erythrocyte,
and platelet counts, fatigue, and depression. These events are most likely caused by systemic
exposure to interferon. It was observed that targeting the therapeutic directly to the intended site
of action in the liver reduce exposure in blood and peripheral tissue and hence improve the safety
and tolerability of IFNa therapy (Coulstock et al., 2013).
The systemic delivery of IFNa not only generates an anti-viral response in the liver, but
also results in leukocyte activation in the blood leading to adverse responses to the therapy
including cytokine release, flu-like symptoms and depression. These side-effects can be severe
which leads to a significant proportion of patients discontinuing treatment (Dusheiko, 1997; Iorio
et al., 1997; Dieperink et al., 2003). The targeting of bioactive molecules to tissues is an attractive
concept and in particular may offer multiple benefits in the treatment of HCV with IFN . The
perceived benefits are twofold, namely increasing the local concentration of a therapeutic
compound at the required site of action, potentially retaining efficacy with a reduced dose, and
reducing undesired activity of a therapeutic in non-target tissues, potentially improving safety and
tolerability. The application of this concept in multiple disease indications has been investigated
using a wide range of methodologies, for example site-specific delivery of cytotoxic drugs for
cancer therapy (Wu & Senter, 2005; Iyer & Kadambi, 2011), liposomal delivery of antigens in
vaccine development (Van Broekhoven et al., 2004) and the targeting of blood-brain barrier (BBB)
receptors to facilitate transfer of biopharmaceuticals from the blood into the brain parenchyma
(Pardridge, 2010).
During antiviral therapy, specific delivery of interferon-a (IFNa) to infected cells may
increase its antiviral efficacy, trigger a localized immune reaction, and reduce the side effects
caused by systemic administration. Targeting IFNa to the liver, while minimizing systemic effects,
may be a strategy to increase its efficacy locally and may increase both efficacy and tolerability of
IFNa-based therapy of HBV infection.
 Objectives
Major objectives of the proposed research work are:

1. Isolation and RT-PCR amplification of gene encoding Interferon Alpha 2

2. Construction of human interferon alpha 2-Thymosin alpha 1 fusion gene

3. Cloning and high level expression of human Interferon alpha 2–Thymosin α 1 fusion

protein

4. Purification, refolding and characterization of the recombinant protein

5. Biological Activity Assessment of Interferon alpha 2–Thymosin α 1 fusion protein

6. Targeted delivery and Immunohistochemical Analysis

Justification and Likely Benefits

Human IFN-α2 exerts biological actions such as broad spectrum antiviral effects and
inhibition of tumor cells proliferation, The Tα1 functions in maturation, differentiation and
function of lymphocytes. Series of clinical studies shows that use of Tα1 with IFN-α 2 reduces the
viral replication and also acts as therapeutic tool for those patients who are not responsive to
conventional antiviral therapy. The use of fusion protein of IFN-α2 and Tα1 is a promising option
for treatment of hepatitis B and C viral infections and it also decreases probability of onset of
hepatocellular carcinoma.
The Tα1 as a fusion partner of IFN-α 2 will help in stimulation of immune system cells
such as Natural killer cells, CD4, CD8, dendritic cells maturation through TLR activation,
stimulation of Th1 type immune response and anti-tumor cytotoxic T cells which will inhibit tumor
cell proliferation. The activation of immune system by Tα1 will also help in clearance of HCV
chronic infection.
The targeted delivery of pharmaceutically important fusion protein to liver by using
antibody, specific to hepatocyte antigen asialoglycoprotein receptor (ASGPR) will improve safety
and tolerability due to reduced activity of therapeutic protein in non target tissues and increase
concentration of therapeutic protein at the site of action which will provide high efficacy with
reduced dose and trigger localized immune response.
 The achievement of above mentioned goals will provide basis for economical in-house
biotechnological production of biopharmaceuticals in Pakistan with enhanced effectiveness.

Methodology
Isolation and RT-PCR Amplification of Gene Encoding Interferon alpha 2
Total RNA will be isolated from the human peripheral blood mononuclear cells isolated
from heparinized or citrate blood by density gradient centrifugation over Histopaque (Sigma
Aldrich, USA). Total RNA thereafter will be extracted from the harvested cells by TriZol reagent
(Rio et al., 2010) and be used as template for subsequent reverse transcription and polymerase
chain reaction (RT-PCR). For amplification of interferon alpha 2, gene-specific forward and
reverse primers designed using online Oligonucleotide Properties Calculator/Primer 3.0 computer
software programs, will be used.
Construction of Human Interferon Alpha 2-Thymosin alpha 1 (IFN α 2-Tα 1) Fusion Gene
Amplified interferon alpha 2 gene and Thymosin alpha 1 gene will be fused together by
polymerase chain reaction using a set of primers given below. INFα 2-Tα1 will be a recombinant
fusion gene composed of INFα 2 gene fused with Tα1 gene at its 3' end with oligonucleotide
encoding a linker peptide (Gly-Gly-Gly- Gly-Ser) inserted between them.
Th-F 5’-CAAACTTGCAAGAAAGTTTACGTAGTAAAGAAGGTGGAGGCGGAAGCGAC-3’
INF-R 5’-GTCGCTTCCGCCTCCACCTTCTTTACTACGTAAACTTTCTTGCAAGTTTG-3’
Th-R 5’-CCGCGTCTCCGGTGGTTCTCGGCCTCCTCCACC-3’
IT-F1 5’CCATGGGATGTGATCTGCCTCAA 3’
IT-R1 5’GGATCCTAGTTCTCGGCCTCCTC 3’
IT-F2 5’ CCATGGGATGTGATCTGCCTCAA3’
IT-R2 5’ CTCGAGGTTCTCGGCCTCCTC3’
Cloning and high level expression of human IFN α 2-Tα1 Fusion Protein
IFN α 2-Tα 1 fusion gene will be cloned and expressed in E. coli expression systems
separately. IFN α 2-Tα 1 will be ligated in pTZ57R/T vector by TA cloning method using TA
cloning kit (Thermo). After that, E.coli cells will be transformed with pTZ57-IFN α 2-Tα 1
recombinant vectors by using standard protocol (Sambrook and Russel, 2001). The screening of
white recombinant colonies will be done by colony PCR to confirm the presence of IFN α 2-Tα 1
gene sequences. Plasmid DNA will be isolated from recombinant clones by using the standard
procedure (Sambrook and Russel, 2001) and restriction analysis and Plasmid PCR of recombinant
cloning vectors pTZ57-IFN α 2-Tα 1 will be performed to check for the presence of insert. The
sequence analysis of recombinant plasmids (pTZ57-IFN α 2-Tα 1) will also be performed.
Following cloning, both genes (IFN α 2-Tα 1) will be sub-cloned in pET expression
plasmid according to the standard protocols (Sambrook and Russell, 2001) and recombinant
vectors (pET57-IFN α 2-Tα 1) will be proceed to transformation and over expression in E. coli
BL21 DE3 (Codon Plus) strain. The E. coli expression systems will be optimized with respect to
cultivation media, inducer (IPTG, lactose) concentration and time and duration of induction in
shake-flask cultures.
Purification, Refolding and characterization of recombinant IFN α 2-Tα 1 fusion protein
Different chromatographic techniques such as nickel chromatography, ion exchange
chromatography will be used to purify and recover yield of fusion protein. Before purification,
recombinant Interferon alpha 2–Thymosin α 1 fusion protein expressed as inclusion bodies will be
separated by centrifugations and then washed with detergents to remove the membrane proteins
and other contaminants. Following washing steps, the recombinant Interferon alpha 2–Thymosin
α fusion protein will be solubilized either by using strong chaotropic agents or by a combination
of alkaline pH and mild concentration of denaturant.
Purified recombinant proteins will be analyzed by SDS-PAGE, western blotting, RP-HPLC
and MALDI-TOF mass spectrometry. CD spectrometeric analysis will be used for analyzing the
biologically active conformation of recombinant interferon alpha 2b and Interferon alpha 2–
Thymosin α fusion protein.
Biological Activity Assessment
To achieve biologically active 3-D conformation recombinant proteins will be refolded in
the presence of oxidized and reduced species containing solution.
In order to check the biological activity of recombinant Interferon alpha 2–Thymosin α 1
fusion protein, different cell based bioassays will be performed.
Targeted Delivery of Therapeutic Fusion protein to Liver by Specific Antibodies
Therapeutic fusion protein will be chemically fused to antibody specific to hepatocyte
antigen asialoglycoprotein receptor (ASGPR) through sulfo-SMCC linker. The fusion protein-
antibody complex will be injected in mice. To check the presence and effect of fused antibody,
immunohistochemical analysis will be performed,
Time Plan
This project is planned to complete within time schedule of three years. The detail of time
plan is given below.
Time (months)
Objectives 3 6 9 12 15 18 21 24 27 30 33 36

Isolation and RT-PCR amplification

of gene encoding IFN 2
Construction of human in IFN 2-
Tα1 fusion gene
Cloning and high level expression of
IFN 2 and human IFN 2– Tα1
fusion protein
Purification, refolding and
characterization of the recombinant
proteins
Biological Activity Assessment of
IFN 2 and human IFN 2– Tα1
fusion protein
Targeted delivery and Immuno-
phistochemical Analysis

OR FOLLOW FOLLOWING Materials and Methods

Amplification IFN α 2 Gene & Construction of IFN α 2-Tα 1 Fusion Gene
For amplification of IFN α 2 gene, total RNA was isolated from human blood by TRI
reagent method (Sigma-Aldrich, USA) according to the manufacturer’s instructions and cDNA
was synthesized from total RNA by using M-MuLV Reverse transcriptase and Oligo(dT)18 primer
as per manufacturer's instructions provided with first strand cDNA synthesis kit (Thermo Fisher
Scientific®.). IFN α 2 gene was amplified with forward (IF 5’ TGTGATCTGCC TCAAACC 3’)
and reverse primers (IR 5’ TTCTTTACTACGTAAACTTTC 3’) designed from sequence
available in NCBI GenBank (Accession No.). PCR reaction was performed in iCycler (Biorad)
using 2 μL of first strand cDNA as template in 25 μL reaction volume containing 5 units of Taq
DNA polymerase (Thermo scientific, Germany), 1X PCR buffer, 2.5 mM dNTPs, 2 mM MgCl2,
2.5 μM of each forward and reverse primers. Gradient PCR was carried out for the standardization
of annealing temperature. PCR profile was set as Initial denaturation for 4 minutes at 95°C
followed by 35 cycles of denaturation for 45 seconds at 94°C, annealing for 45 seconds at different
temperatures (53.4oC, 54.6oC, 56.2oC, 57.4oC, 58.2oC, and 58.5oC) and elongation for 1 minute at
72°C with a final elongation step of 20 minutes at 72°C. The amplified PCR product was analyzed
by 1% agarose gel electrophoresis and purified by GeneJET Gel Extraction Kit (Thermo
Scientific).
Tα 1 gene was synthesized from Integrated DNA Technologies (IDT®) according to the
sequence available in NCBI GenBank (Accession No.) Glycine as linker was inserted at 5’ end of
Tα 1 gene (Table) between the two sequences of IFN α 2 & Tα1. The synthesized sequence is
5’GGTGGAGGCGGAAGCGACGCCGCCGTGGACACCAGCAGCGAGATCACCACCAAGGACCT
GAAGGAGAAGAAGGAGGTGGTGGAGGAGGCCGAGAAC-3’

Fusion gene comprising IFN α 2 and Tα 1 was constructed by overlap extension PCR by
using set of primers given in Table 1.
In overlap extension PCR, first 10 cycles were performed with Tα 1 forward primer (T–F
5’-CAAACTTGCAAGAAAGTTTACGTAGTAAAGAAGGTGGAGGCGGAAGCGAC-3’) &
IFNα-2 reverse primer (I-R 5’-GTCGCTTCCGCCTCCACCTTCTTTACTACGTAAACTTTC
TTGCAAGTTTG-3’) in a reaction mixture with purified IFN α 2 and Tα 1 genes as templates, 5
units of Taq DNA polymerase (Thermo scientific, Germany), 1X PCR buffer, 2.5 mM dNTPs, 2
mM MgCl2 and PCR profile was set as denaturation at 95 °C for 1 min, annealing at 55 °C-62 °C
for 1 min and extension at 72 °C for 1 mins.
After 10 cycles of reaction, IT-F (5’CCATGGGATGTGATCTGCCTCAA3’) and IT-R
(5’CTCGAGGTTCTCGGCCTCCTC3’) primers were added in reaction mixture for amplification
of IFN α 2-Tα 1 Fusion Gene and subjected to 30 cycles of denaturation at 95 °C for 1 min,
annealing at 58 °C for 1 min and extension at 72°C for 1 mins followed by final extension at 72
°C for 10 mins. The restriction site of Nco1 (5/ CCATGG 3/) and XhoI (5/ CTCGAG 3/) were
inserted in IT-F and IT-R primers, respectively. PCR product was further analyzed by 1% agarose
gel electrophoresis. INFα 2-Tα1 is recombinant fusion gene composed of INFα 2 gene fused with
Tα1 gene at its 3' end with oligonucleotide encoding a linker peptide (Gly-Gly-Gly-Gly-Ser)
inserted between them.

Table 1: Primer sequences for amplification of IFN α 2 gene & construction of IFN α 2-Tα 1 Fusion Gene

Primers Name Primers Sequences

IF 5’ TGTGATCTGCC TCAAACC 3’

IR 5’ TTCTTTACTACGTAAACTTTC 3’

T–F 5’AAACTTGCAAGAAAGTTTACGTAGTAAAGAAGGTGGAGGCGGAAGCGAC-3

T–R 5’-GTCGCTTCCGCCTCCACCTTCTTTACTACGTAAACTTTC TTGCAAGTTTG-3’

IT-F 5’CCATGGGATGTGATCTGCCTCAA3’

IT-R 5’CTCGAGGTTCTCGGCCTCCTC3’

Cloning and Sequence Analysis

IFN α 2-Tα 1 fusion gene was ligated into pTZ57R/T vector to construct pTA- IFN α 2-Tα
1 recombinant vector by using TA cloning kit (Thermo Scientific) and transformed in E coli (DH
5α) and screened on LB agar ampicillin plates containing X-Gal (20 μg/ml) and IPTG (0.1 mM).
Recombinant clones were confirmed by colony PCR and recombinant plasmid (pTA- IFN α 2-Tα
1) was isolated by the standard procedure (Sambrook and Russel, 2001). Recombinant plasmid
(pTA- IFN α 2-Tα 1) was further subjected to restriction and sequence analysis. The sequence of
cloned IFN α 2-Tα 1 fusion gene was analyzed by blast in the NCBI software to compare the DNA
sequence homology with reported gene sequences of IFN α 2 (Accession No.) and Tα 1
(Accession No.).
Sub-cloning and Expression Analysis of IFN α 2-Tα 1 Fusion Protein:
IFN α 2-Tα 1 fusion gene was sub-cloned in pET28a (+) expression vector (Novagen,
USA) by restriction cloning using restriction enzymes Nco1 and Xho1and ligation using T4 DNA
ligase. Recombinant vector (pET 28a- IFN α 2-Tα 1) was transformed into competent cells
(Sambrook and Russel, 2001) of E. coli BL21 (DE3), screened on LB agar kanamycin (40 µg/ml)
plate and transformed clones were confirmed by colony PCR.
The IFN α 2-Tα 1 fusion gene was expressed under T7 lac promoter of pET28a (+)
expression vector (Novagen, USA) in E. coli strain BL21 (DE3) by induction with Isopropyl β-D-
thiogalactoside (IPTG). 10 ml LB broth containing kanamycin (40 µg/ml) was inoculated with
single colony of E. coli BL21 (DE3) transformed with pET 28a- IFN α 2-Tα 1 vector and incubated
at 37℃, 200 rpm for overnight. Next day, 50 ml LB broth containing kanamycin (40 µg/ml) was
inoculated with overnight culture and incubated at 37°C until OD600 reached 0.5. When the OD600
of the bacterial culture was reached 0.5, 5 mL of uninduced sample was removed as control and
pelleted at 6000 rpm for 15 minutes at 4°C and stored at -20°C. After that remaining culture was
induced with IPTG to a final concentration of 0.5 mM and incubated at 37℃ for 4 hours. Induced
cells were harvested at 6000 rpm for 15 min at 4°C and pellet was resuspended in PBS (137 mM
NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 2 mM KH2PO4) pH 7.4. Cell were lysed in 4 x loading
dye (loading dye recipe) by syringing and analyzed by 12 % SDS-PAGE. The expression level of
recombinant protein induced by IPTG at different concentrations and time intervals was checked
by electrophoretic pattern on 12% SDS-PAGE.
Transformed E.coli BL21 (DE3) cells with pET 28-IT were grown in 10 ml TB medium
supplemented with 1% glucose and kanamycin (40 µg/ml) until OD600nm 0.7 is achieved. Next day
culture with OD600 0.7 was harvested at 10000 rpm for 10 minutes and resuspend cell pellet in 5
of ml TB medium with 1% glucose and kanamycin (40µg/ml). After that 100 ml of TB medium
with 1% glucose and kanamycin (40µg/ml) was inoculated with 4 ml of above culture and
incubated at 37C in shaking incubator until OD600 0.5 (~ 2-2.5 hours) is achieved. Remove 3 ml
of un-induced sample, pellet down cells at 10000 rpm for 10 minutes at 4C. Add IPTG at final
concentration of 1mM to the remaining culture and incubated at 37 rpm for 5-hours. 3 ml of
induced sample was collected for SDS-PAGE analysis to check expression and pellet down
remaining culture at 10000 rpm for 10 minutes at 4C.

Expression Optimization, Solublizing and Refolding Studies

The E. coli expression system was optimized with respect to cultivation media,

concentrations of inducers (IPTG, lactose) and duration of induction in shake-flask cultures. The
expression of IFN α 2-Tα 1 fusion gene was optimized by using IPTG (0.2 mM-1.0 mM) and

lactose (0. 2 mM and 1.0 mM), media (LB and TB media), time & temperature of incubation.

10 ml E. coli cultures in LB-kanamycin and TB-kanamycin media were induced with

different concentrations of IPTG and lactose separately when OD600nm reached 0.6 and incubated

for different time durations. After incubation, OD600nm of all cultures was measured and cells were

harvested at 6000 rpm for 20 minutes at 4C. Cell pellets were resuspended in I ml (10 X dilution)

of Lysis buffer (50mM Tris-Cl pH 6.3, 100 mM NaCl, 5mM EDTA and 1mM PMSF) separately

and subjected to lysis by sonication. All cell lysates were centrifuged at 6000 rpm for 20 minutes

at 4C and cell pellets and supernatants were analyzed by 12 % SDS-PAGE for screening of

expression level, localization and solubility. Total cell proteins fraction, soluble cytoplasmic

fraction and insoluble cytoplasmic fraction were analyzed by 13% SDS-PAGE.

After that, insoluble cytoplasmic fraction was washed with 100 ml of wash buffer I (50

mM Tris-Cl, pH 6.31, 5mM EDTA, 0.5 % Triton X100, 5mM PMSF) and incubated on ice for 1

hour. The pellet was collected by centrifugation at 8000 rpm for 30 minutes at 4C and washed with

100 ml of wash buffer II (50mM Tris-Cl pH=6.3 5mM PMSF) followed by washing in 100 ml of

50 mM Tris-Cl pH 6.31. At each steps, the supernatants were analyzed by 12 % SDS-PAGE for

the loss of inclusion bodies (IBs) during washings.

To determine the best solubilization condition, aliquots of the cell pellet with equal

amounts of the insoluble protein were resuspended in each of the solubilizing solution (table) and

incubated for 4 hours with shaking on ice.

The solubilized IBs were centrifuged at 12000 rpm for 15 minutes at 4°C to remove the

insoluble particles. The clear solution was processed for refolding of recombinant fusion protein.

Recombinant protein was refolded by dialysis of the solubilized solution of IBs (containing
recombinant IT) against the refolding buffer (50mM Tris-Cl pH 6.31, 5mM L-cysteine, 1mM L-

cystine, 10% glycerol, 5% sucrose, 1mM PMSF, and 1% SDS). The refolding buffer volume was

50 times the volume of inclusion body solution. The solution was kept at 4°C with the change of

buffer after every 4 hours. The solution was then dialyzed against the Dialysis Buffer I (50mM

Tris-Cl pH 6.31, 10% glycerol, 1mM PMSF), Dialysis Buffer II (50mM Tris-Cl pH 6.31, 1mM

PMSF), Dialysis Buffer III (25mM Tris-Cl pH 6.31, 1mM PMSF) and Dialysis Buffer IV (10mM

Tris-Cl pH 6.31, 1mM PMSF). After refolding, the protein was analyzed on 12% SDS-PAGE and

% age of protein in each fraction was measured by Gel Documentation System (SynGene). Protein

contents in the liquid samples were estimated either by Bradford assay by using bovine serum

albumin (BSA) as the standard (Bradford 1976).

List of Solutions used to Solubilize Inclusion Bodies

Sr. No. Solubilization Solutions Compositions

1 A 100mM Tris-Cl, 2M Urea, pH 8.5

2 B 100mM Tris-Cl, 4M Urea, pH 8.5

3 C 100mM Tris-Cl, 6M Urea, pH 8.5

4 D 100mM Tris-Cl, 2M Urea, pH 9.5

5 E 100mM Tris-Cl, 4M Urea, pH 9.5

6 F 100mM Tris-Cl, 6M Urea, pH 9.5

7 G 100mM Tris-Cl, 2M Urea, pH 10.5

8 H 100mM Tris-Cl, 4M Urea, pH 10.5

 9 I 100mM Tris-Cl, 6M Urea, pH 10.5

10 J 100mM Tris-Cl, 0.5% NLS pH 6.31

11 K 100mM Tris-Cl, 1% NLS, pH 6.31

12 L 100mM Tris-Cl, 1% SDS, pH 6.31

13 M 100mM Tris-Cl, 7M Gdn-Cl, pH 6.31

Purification by FPLC and Western Blotting

After refolding process, the protein was subjected to purification by Ni2+ affinity
chromatography by using Ni-NTA resin (Invitrogen). The protein sample was loaded onto column
(1.5 X 7.5cm) packed with Ni2+-NTA resin (Invitrogen) and equilibrated with denaturing binding
buffer (8 M urea, 20 mM sodium phosphate pH 7.8 and 500 mM NaCl). Wash the resin with 20
column volumes of wash buffer (50 mM NaH2PO4 pH 8, 300mM NaCl, 10 mM imidazole pH to
8). Elution of adsorbed fusion proteins was achieved with buffer containing 200 mM imidazole.
Eluted fractions were dialysed against 1X PBS for 3hr on magnetic stirrer at 40C to remove
imidazole. After dialysis, fractions were lyophilized and analyzed by 12 % SDS-PAGE for desired
protein.
Both purified and unpurified protein samples were resolved by 12% SDS-PAGE and
transferred on to nitrocellulose membrane by using transblot semi dry apparatus (Biorad) at 20 V
for 1 h by using transfer buffer (25 mM Tris-Cl (pH 8.3), 192 mM glycine, and 20 % (v/v)
methanol). To block the non-specific membrane sites, the blot was incubated in 5% (w/v) skimmed
milk in TBS-T buffer [20 mM Tris (pH 7.6), 13 mM NaCl, 0.1 % (v/v) Tween 20] for 1 hour at
4oC to block nonspecific binding sites for 30 min. After blocking, the membrane was incubated
with mouse anti-interferon antibody (1:3000 dilutions) for 1 h at room temperature with gentle
shaking on a rotatory shaker. The blot was washed three times with 1X TBS-T buffer (10
minutes/wash) and the membrane was incubated in mouse anti-human IgE conjugated with
alkaline phosphatase (1:5000 diluted in 1X TBS-T) at room temperature for 2 hours. After
washing, the colour reaction was developed by incubating the blot in BCIP/NBT substrate solution
in carbonate buffer (pH 9.8) containing 0.1M NaHCO3 and 1 mM MgCl2. The reaction was
stopped by washing the membrane in several changes of water. Finally, the strip was air dried and
then analysed.
MALDI-TOF analysis

The HPLC purified protein fractions (1 mg/ml) were subjected to MALDI-TOF analysis.
1 µl (50 pmol) protein sample was mixed with 20 µl of matrix B (5 mg Sinapinic acid dissolved
in 1 ml of 30 % acetonitril containing 0.3 % TFA). From this mixture, 5 µl of sample was spotted
on stainless steel mass spectrometric plate and allowed to dry for 20-25 minutes. Before doing the
mass analysis of interferon alpha 2b, the mass spectrophotometer was calibrated with standard
protein such as myoglobin (16 kDa). The mass spectra of protein fractions were recorded while
number of laser shots per spectrum was 100. On X-axis of mass spectrum, mass (m/z) was
described while on Y-axis % intensity of laser shot was described. The mass spectrophotometer
used in this study was of Bruker Autoflex.

 Use Circular Dichroism Spectroscopy, Receptor Binding studies and Biological

Activity assay along with above mentioned methodology for better assessment.

Results
Construction of INFα 2-Tα1 Fusion Gene & Cloning
A cDNA prepared from human blood poly (A+) RNA was used as template to amplify and
clone human IFN α 2 gene. Gradient PCR analysis revealed a product of approximately 495bp.
PCR conditions were optimized at different annealing temperatures and the best gene amplification
was found to be at 56.7°C (Figure 1). Purified IFN α 2 gene fragment was fused with synthetic Tα
1 by overlap extension PCR and analyzed by 1% agarose gel electrophoresis (Figure 1). INFα 2-
Tα1 is recombinant fusion gene composed of INFα 2 gene fused with Tα1 gene at its 3' end with
oligonucleotide encoding a linker peptide (Gly-Gly-Gly-Gly-Ser) inserted between them (figure
2).
Purified INFα 2-Tα1 fusion gene was ligated into pTZ57R/T vector (Thermo Scientific) to
construct the recombinant pTZ- INFα 2-Tα1 vector. This vector was transformed into E. coli strain
DH5α. Transformation was confirmed by colony PCR of selected clones. PCR product was
analyzed on 1% agarose gel revealed a band of bp thus confirming the presence of gene.
Recombinant plasmid was isolated by alkaline lysis method (Sambrook and Russell, 2001) and
subjected to restriction digestion by Nco1 and Xho 1 for restriction analysis.
 Fig. 1: Analysis of INFα 2-Tα1 fusion gene (a) and amplified IFN α 2 gene (b) by 1% agarose
gel electrophoresis

Figure 2: Diagrammatic representation of Interferon Alpha 2-Thymosin Alpha 1 fusion gene

generated by overlap extension PCR. IR and TF primers were used for introducing over lapping
regions at 3' ends of both genes which further act as primers during first 10 cycles of amplification.
After 10 cycles, IT-F and IT-R primers were added for amplification of INFα 2-Tα1 fusion gene.
Restriction site of Nco1 was introduced by IT-F at 5 end and Xho1 by IT-R at 3 end of fusion
gene.

Sequence Analysis and Insilco Study

After confirmation of clones by colony PCR and restriction analysis, the recombinant
cloning vector pTZ-INFα2-Tα1 was sent for sequencing from Advance Biosciences International,
Pakistan. The sequence of cloned INFα 2-Tα1 fusion gene was analyzed by BLAST in the NCBI
software to compare the DNA sequence homology with reported INFα 2 and Tα1 gene sequences
(Accession No).

IT Reference Sequence
TGTGATCTGCCTCAAACCCACAGCCTGGGTAGCCGTCGTACCTTGATGCTCCTGGCACAGATGCGTCGT
ATCTCTCTTTTCTCCTGCTTGAAAGACCGTCATGACTTTGGCTTTCCGCAGGAAGAATTTGGCAACCAG
TTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAGATGATCCAGCAGATCTTCAATCTCTTCAGCACA
AAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGACAAATTCTACACTGAACTCTACCAGCAGCT
GAATGACCTGGAAGCCTGTGTGATACAGGGGGTGGGGGTGACAGAGACTCCGCTGATGAAAGAAGAC
TCCATTCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTCTATCTGAAAGAGAAGAAATACAGCCC
TTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAAGAAA
GTTTACGTAGTAAAGAAGGTGGAGGCGGAAGCGACGCCGCCGTGGACACCAGCAGCGAGATCACCAC
CAAGGACCTGAAGGAGAAGAAGGAGGTGGTGGAGGAGGCCGAGAAC

IT query sequence ABI

CNCNTGACTGATTACGCCAGCTCTAATACGACTCACTATAGGGAAAGCTTGCATGCAGGCCTCTGCAG
TCGACGGGCCCGGGATCCGATTCCATGGGATGTGATCTGCCTCAAACCCACAGCCTGGGTAGCCGT
CGTACCTTGATGCTCCTGGCACAGATGCGTCGTATCTCTCTTTTCTCCTGCTTGAAAGACCGTCA
TGACTTTGGCTTTCCGCAGGAAGAATTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTC
CTCCATGAGATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGA
TGAGACCCTCCTAGACAAATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGT
GTGATACAGGGGGTGGGGGTGACAGAGACTCCGCTGATGAAAGAAGACTCCATTCTGGCTGTG
AGGAAATACTTCCAAAGAATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTTGTGCCTGGG
AGGTTGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAAGAAAGTTTACGT
AGTAAAGAAGGTGGAGGCGGAAGCGACGCCGCCGTGGACACCAGCAGCGAGATCACCACCAAG
GACCTGAAGGAGAAGAAGGAGGTGGTGGAGGAGGCCGAGAACCTCGAGAATCTAGATGCATTCG
CGAGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTA
CCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACC
GATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGAAATTGTAAGCGTTAATATTTTGTTA
AAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCT
TATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATT
AAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCACTACGTGAAC
ATCACCTAATCAAGTTTTTGGGGTCGAGGTGCGTAAAGCCTAAATCGGACCCTAAAGGGAGCCCCGAT
TTAAACTTGACGGGGAAAGCCGGCAACTTGCCAAAAAGAAGGAAAAAACGAAAGGACGGCCCTAGG
GCCTTGCAAATAAANGGTCACTTTGCGGAAACACANACCCCGCGGTTAAGGCGCCTCAGGGCGGTCG
GGGGCTTTTCGGGAAAGGGCGGAACCCCTTTTTTTATTTATAAAATCACAAAAGTCCCCNCGAGAAAA
CCTGGAAAGTCNNATTNAAAGGAAANNAGATACATTNCCCGTCTCCACTNTTTNCGTNNCCTCTNNTT
CTCCACNCNNNCANNANAATATATAACTTTGGGCGGCCTCCCCTAGACCNCCAACTCCAACCTTCTCTT
N

3D Model of IFNα2-Tα1 Fusion Protein

IT vs IFNR2
 IT vs. Toll like receptors

Insilico Prediction of Anti-Cancer Activity

Insilico Prediction of Anti-viral Activity
Expression Optimization, Solubilizing & Refolding Studies
The expression of INFα 2-Tα1 fusion gene was carried out in E. coli BL-21 (DE3) Codon
plus, using pET28a (+) as expression vector under the control of inducible T7 promoter as His-
tag fusion. INFα 2-Tα1 fusion gene was subcloned in pET28a (+) vector and transformed in E.coli
BL21 (DE3) cells. Transformed clones were further screened by colony PCR.
Transformed E.coli BL21 (DE3) cells with pET 28-IT were grown in 10 ml LB media and
induced with 1mM IPTG when OD600 0.5 is achieved. After that, each culture was analyzed for
total cell protein by 12% SDS-PAGE and accurate expression of recombinant fusion IT was
observed that has approximate molecular weight of 22 kDa (Figure). The growth of transformed
E.coli BL21 (DE3) cells and expression of recombinant IT was also analyzed in TB, M9NG and
YP media (figure). IT was expressed expressed in E.coli BL21 (DE3) as fusion protein with
hexahistidyl-tag which facilitates its purification. Expression parameters such as medium
composition (Table), induction at varying concentrations of IPTG (Figure), time intervals (figure
10) and lactose mediated induction were optimized for maximum expression. Maximum
expression of recombinant IT protein was obtained after induction with 10mM lactose for 8 hours
at 37°C. While IPTG induced maximum expression was obtained at 1 mM IPTG for 5 hours at
37oC. Furthermore, cells expressing recombinant IT were lysed by sonication, centrifuged and
analyzed by 12 % SDS-PAGE to check expression in soluble or insoluble form. It was observed
by the presence of IT fusion protein in insoluble cytoplasmic fraction that it was expressed in the
form of inclusion bodies.
Out of eight different solubilization buffers tested, recombinant IT protein was best
solubilized in the buffer containing 0.1% NLS (N-Lauroyl Sarcosine sodium salt). This solution
was further used for solubilization of inclusion bodies (Figure). Protein refolding was carried out
using cysteine/cysteine as mediators that promote bond formation, and sucrose, glycerol and NLS
as mediators that enhance native structure and inhibit aggregation.

Purification by FPLC and Western Blot Analysis

The recombinant fusion protein TMa1–cBLyS was roduced in 500 ml cultures. After the cells were
disrupted by sonication, 50% of the fusion proteins could be detected in the supernatants and the
others in intracellular precipitate. While only cBLyS was expressed with the same vector, host and
same culture conditions, 80% of expressed protein was inclusion bodies. We assume it was due to
TMa1 being a heat-stable, acidic polypeptide which might improve the solubility of the
recombinant fusion protein.
Expression vector pET-28a was selected because the target protein was expressed as a fusion
protein with a (His)6-tag in order to facilitate subsequent purification. So, the fusion protein was
purified in one-step procedure by Ni-NTA affinity sepharose column. Different concentrations of
the imidazole were tested in equilibrium buffer. The most unspecific binded proteins could be
eluted by 30 mM imidazole. TMa1–BLyS was eluted with buffer containing 200 mM imidazole.
The result of SDS-PAGE analysis showed that the purity was no less than 85% (Figure 2). No
attempts were made to remove the impurities by further purification steps.
Purified to near homogeneity by fast protein liquid chromatography on aQFF anion exchange
column.

MALDI-TOF and CD Spectrum

Circular dichroism spectroscopic analysis showed that the secondary structure contents of the
purified GCSF are similar to the commercially available GCSF.
MALDI-TOF analysis of recombinant human interferon alpha 2b after HPLC

The purified human interferon alpha 2b protein peaks after HPLC were subjected to
MALDI-TOF analysis. The peaks obtained from HPLC analysis were labeled as I, II and III before
proceeding for MALDI-TOF analysis. Each peak was subjected separately to MALDI-TOF
analysis and results indicated that peak I’s experimental mass was e~19264.3 Dalton (Figure 29)
while peak III’s experimental mass was ~19411 Dalton (Figure 29) corresponding to human
interferon alpha 2b and the latter with an N-terminal methionine respectively. However, peak II’s
experimental mass was found to be ~19309 Dalton. This indicated the oxidation of certain amino
acid residues as a result the cumulative mass increased from 19264.3 Dalton to 19309 Dalton with
a difference of 44 Dalton (Figure 29, Table 20). As pointed out above, the theoretical values of
human interferon alpha 2b protein with and without methionine, as determined from Protparam
are19269 Dalton and 19400 Dalton (appendix-B). Thus peak I (~19264.3 Dalton) is assigned to
human interferon alpha 2b with out methionine at N-terminal while peak III (~19411 Dalton) to
interferon alpha 2b species with methionine at N-terminal region. However peak II (19309 Dalton)
could be oxidized form of human interferon alpha 2b with out methionine at the N-terminal region
with ~ 3 oxygen atoms attached to protein, so mass had increased from 19264.3 Dalton to ~19309
Dalton. The theoretical increase in mass, for 3 oxygen atoms, should be 48 Dalton and 44 Daltons
observed in the present study is within experimental error, since MALDI analysis by Autoflex
used in the present work, in the 20,000 mass range shows a fluctuation of 5-10 Dalton

Receptor Binding Studies

Anti-cancer Assay

Cloning and sequence analysis

Fig. 12 (a): Restriction map of pET-28a (+) expression vector. (Adapted from Novagen). (b): Restriction map of

hybrid expression vector (pET28a-IT). The IT gene was directionally subcloned between NcoI and XhoI restriction

sites.
Induction (5hr, 1mM IPTG)
Lane 2 Uninduced fraction, lane 3 total cell protein fraction, lane 4 soluble cytoplasmic fractions,
lane 6 inclusion bodies/insoluble lane 7 cytoplasmic fraction, lane 8 washed inclusion bodies, lane
9 solubilized inclusion bodies, lane 10 refolded protein

Solubilization of inclusion bodies (lane 1 molecular weight marker.lane 2 100mM Tris-Cl, 1%

NLS, pH 9.5, lane 3-6 100mM Tris-Cl, 2M,4M,6M,8M Urea, pH 9.5 lane 7-8 100mM Tris-Cl,
6M & 7M Gdn-Cl, pH 9.5)
Lane 2 inclusion bodies, lane 3 & 4 pellet & supernatant 100Mm tris Cl pH=6.1 7M Gdn-Cl, lane
5 & 6 pellet & supernatant 100Mm tris Cl pH=6.1 1% NLS, lane 7 & 8 pellet & supernatant
100Mm tris Cl pH=6.1 1% SDS, lane 9 & 10 pellet & supernatant 100Mm tris Cl pH=6.1 8M Urea
IT CD Spectrum

 Helix 16.5%
 Antiparralel beta sheets 43.4%
 Parallel betasheet14%
 Beta turns 21.6%
Control
References
Andreone, P., Cursaro, C., Gramenzi, A., Margotti, M., Ferri, E., Talarico, S., et al. (2001). In vitro
effect of thymosin-a1 and interferon-a on Th1 and Th2 cytokine synthesis in patients with
chronic hepatitis C. Journal of Viral Hepatitis, 8,194-201
Arase, Y., Tsubota, A., Suzuki, Y., Suzuki, F., Kobayashi, M., Someya, T., Akuta, N., Hosaka, T.,
Saitoh, S., Ikeda, K., Kobayashi, M. and Kumada, H. (2003) A pilot study of thymosin alpha1
therapy for chronic hepatitis B patients. Intern Med, 42, 941-946
Bach, E.A., Aguet, M. and Schreiber, R.D. (1997). The IFN gamma receptor: a paradigm for
cytokine receptor signaling. Annu. Rev. Immunol., 15, 563-591.
Bekisz, J., Baron S., Balinsky, C., Morrow, A. and Zoon. K.C. (2010). Antiproliferative Properties
of Type I and Type II Interferon. Pharmaceuticals, 3, 994-1015
Billich A. (2002). Thymosin alpha1. SciClone Pharmaceuticals. Curr Opin Investig Drugs, 3, 698-
707
Biron, C.A., Nguyen, K.B., Pien, G.C., Cousens, L.P. and Salazar-Mather, T.P. (1999). Natural
killer cells in antiviral defense: Function and regulation by innate cytokines. Annu. Rev.
Immunol., 17, 189–220.
Biron, CA. and Sen, GC. 2001. Interferons and other cytokines, p. 321-351. In D. M. Knipe, P. M.
Howley, D. E. Griffin, M. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 4th
ed. Lippincott-Raven, Philadelphia, Pa.
Camerini, R., Ciancio, A., De Rosa, A., and Rizzetto, M. (2007). Studies of therapy with thymosin
alpha 1 in combination with pegylated interferon alpha2a and ribavirin in no responder
patients with chronic hepatitis C. Ann NY Acad Sci., 1112, 368–74.
Coulstock, E., Sosabowski, J., Ovecka1, M., Rob, P., Laura, G., Clare, M., Armin S., Marie, D.,
Julie. F., Jerome, B., Grainne, D., Adam, W. (2013). Liver-Targeting of Interferon-Alpha
with Tissue-Specific Domain Antibodies. PLoS ONE, 8.
Dieperink, E., Ho, S.B., Thuras, P., Willenbring, M.L. (2003). A prospective study of
neuropsychiatric symptoms associated with interferon-alpha-2b and ribavirin therapy for
patients with chronic hepatitis C. Psychosomatics, 44, 104–112.
Dusheiko, G. (1997) Side effects of alpha interferon in chronic hepatitis C. Hepatology, 26, 112–
121.
Fried, M.W., Shiftman, M.X., Reddy, K.R., Smith, C., Marinos, G., GoncalesJr, F.L., et al. (2002).
Peginterferon alfa-2a plus ribavirin for chronic hepatitis C vious infection. N Engl J Med.,
347, 975–982.
Goldstein, A.L. (2009). From lab to bedside: emerging clinical applications of thymosin alpha 1.
Expert Opin Biol Ther. 9,593–608.
Garaci, E., Pica, F., Serafino, A., Balestrieri, E., Matteucci, C., Moroni, G., Sorrentino, R.,
Zonfrillo, M. and Sinibaldi-Vallebona, P. (2012). Thymosin α1 and cancer: action on
immune effector and tumor target cells. Ann. N.Y. Acad. Sci., 1269, 1–9
Garaci, E., Pica, F., Sinibaldi-Vallebona, P., Pierimarchi, P., Mastino, A., Matteucci, C., et al.
2003. Thymosin alpha 1 in combination with cytokines and chemotherapy for the treatment
of cancer. Int Immunopharmacol., 3, 1145–50.
George, C.X. and Samuel, C.E. (1999). Human RNA specific adenosine deaminase ADAR1
transcripts possess alternative exon 1 structures that initiate from different promoters, one
constitutively active and the other interferon-inducible. Proc. Natl. Acad. Sci., 96, 4621-
4626.
Heim, M.H. (1999). The Jak-STAT pathway: cytokine signalling from the receptor to the nucleus.
J. Receptor Signal Transduction Res., 19, 75-120.
Iorio, R, Pensati, P, Botta, S, Moschella, S, Impagliazzo, N, et al. (1997). Side effects of alpha-
interferon therapy and impact on health-related quality of life in children with chronic viral
hepatitis. Pediatr Infect Dis J., 16, 984–990.
Iyer, U. and Kadambi, V.J. (2011). Antibody drug conjugates - Trojan horses in the war on cancer.
J Pharmacol Toxicol Methods, 64, 207–212.
Kageshita, T., Hirai, S., Ono, T., Hicklin, D.J. and Ferrone, S. (1999). Down-regulation of HLA
class I antigen-processing molecules in malignant melanoma: association with disease
progression. American Journal of Pathology, 154,745-754.
Kim, H.A., Ko, H.M. and Hu, H.W. (2009). CpG-ODN-based immunotherapy is effective in
controlling the growth of metastasized tumor cells. Cancer Letters, 274, 160-164.
Kirkwood, J.M., Tarhini, A.A. and Panelli, M.C. (2008). Next generation of immunotherapy for
melanoma. Journal of Clinical Oncology, 26, 3445-3455.
Knutsen, A.P., Freeman, J.J., Mueller, K.R., et al. (1999). Thymosin α1 stimulates maturation of
CD 34+ stem cells into CD3+4+ cells in an in vitro thymic epithelia organ coculture model.
Int J Immunopharmacol., 21, 15-6
Kontsek, P. and Kontsekova, E. (1998). Present views on interferons. Bratisl Lek Listy, 99, 226-
30.
Kouttab, N.M., Goldstein, A.L. and Lu, M. et al. (1988). Production of human B and T cell growth
factors is enhanced by thymic hormones. Immunopharmacology, 16, 97–105.
Leichtling, K.D., S.A. Serrate & M.B. Sztein. 1990. Thymosin alpha 1 modulates the expression
of high affinity interleukin-2 receptors on normal human lymphocytes. Int.J.
Immunopharmacol. 12: 19–29.
Liu, C., Patel, A. and Zhu, H. (2002). In vitro studies to identify host genes or pathways involved
in immune-mediated response to thymosin alpha 1 and peginterferon. Hepatology and
Gastroenterology, 12, 23-29.
Loggi, E., Gramenzi, A., Margotti, M., Cursaro, C., Galli, S., Vitale, G., Grandini, E., Scuteri,
A., Vukotic, R., Andreone, P. and Bernardi M. (2008). In vitro effect of thymosin alpha 1
and interferon alpha on Th1 and Th2 cytokine synthesis in patients with HbEAg-negative
chronic hepatitis B. J Viral Hepat., 15, 442-8
Lopez, M., Carpano, S., Cavaliere, R., Di Lauro L., Ameglio, F., Vitelli G., et al. Biochemotherapy
with thymosin α 1, interleukin-2 and dacarbazine in patients with metastatic melanoma:
clinical and immunological effects. (1994). Ann Oncol, 5, 741–6.
Maio, M., Andrzej, M, Alessandro, T, Uwe, T, Virginia, F, Jacek, J, Claus, G, Thierry, L, Bernard,
G, Pere, G, Katalin, G, Roberto, C, and Francesco, C. (2010). Large Randomized Study of
Thymosin α 1, Interferon Alfa, or Both in Combination With Dacarbazine in Patients With
Metastatic Melanoma. J Clin Oncol, 28, 1780-1787.
Mastino, A., Favalli, C. and Grelli, S. (1992). Combination therapy with thymosin alpha 1
potentiates the antitumor activity of interleukin-2 with cyclophosphamide in the treatment of
the Lewis Lung carcinoma in mice. International Journal of Cancer, 50, 493-499.
Mogensen, K.E., Lewerenz, M., Reboul, J., Lutfalla, G. and Uze, G. (1999). The type I interferon
receptor: structure, function, and evolution of a family business. J. Interferon Cytokine Res.,
19, 1069-1098.
Molloy, P.J., Azzouz, M. and Van, T. (1996). Treatment of chronic hepatitis B and hepatitis C
with interferon alfa-2b. Am Fam Physician, 54, 1598-1605
Murashima, S., Kumashiro, R., Ide, T., Miyajima, .I, Hino, T., Koga, Y., Ishii, K., Ueno, T.,
Sakisaka, S. and Sata, M. (2000). Effect of interferon treatment on serum 2, 5’-
oligoadenylate synthetase levels in hepatitis C-infected patients. J. Med. Virol., 62, 185–190.
Nadeene, P. and Andrew, C.G.P. (2004). Identification of a novel gene family that includes the
interferon-inducible human genes 6–16 and ISG12. BMC Genomics, 5, 8-19.
Naylor, P.H., Quadrini, K., Garaci, E., Rasi, G., Hadden, J.W. (2007). Immunopharmacology of
thymosin alpha 1 and cytokine synergy. Ann NY Acad Sci., 1112, 235–44.
Nefedova, Y., Huang, M. and Kusmartsev, S. (2004). Hyperactivation of STAT3 Is Involved in
Abnormal Differentiation of Dendritic Cells in Cancer. Journal of Immunology, 172, 464-
474
Nowak, A.K., Lake, R.A., Marzo, A.L., et al. (2003). Induction of tumor cell apoptosis in vivo
increases tumor antigen cross-presentation, cross-priming rather than cross-tolerizing host
tumor-specific CD8 T cells. J Immunol, 170, 4905-4913.
Pardridge, W.M. (2010). Biopharmaceutical drug targeting to the brain. J Drug Targeting, 18, 157–
167.
Peng, Y., Chen, Z., Yu, W., Zhou, Q., Xu, L., Mao, F.F., et al. (2008). Effects of thymic
polypeptides on the thymopoiesis of mouse embryonic stem cells. Cell Biol Int. 32, 1265–
71.
Pestka, S. (2007). Purification and cloning of interferon alpha. Curr. Top. Microbiol. Immunol.,
316, 23-37.
Poo, J.L., Sánchez, A, F., Kershenobich, D., García Samper, X., Torress-Ibarra, R., Góngora, J.,
et al. (2008). Efficacy of triple therapy with thymalfasin, peginterferon alpha-2a, and
ribavirin for the treatment of hispanic chronic HCV nonresponders. Ann Hepatol., 7, 369–
75.
Rasi, G., Silecchia, G. and Sinibaldi-Vallebona, P. (1994). Anti-tumor effect of combined
treatment with thymosin alpha 1 and interleukin-2 after 5-fluorouracil in liver metastases
from colorectal cancer in rats. International Journal of Cancer, 57, 701-705.
Roberts, R.M., Liu, L., Guo, Q., Leaman, D. and Bixby, J. (1998). The evolution of the type I
interferons. J. Interferon Res., 18, 805-816.
Romani, L., Bistoni, F. and Perruccio, K. (2006). Thymosin alpha1 activates dendritic cell
tryptophan catabolism and establishes a regulatory environment for balance of inflammation
and tolerance. Blood, 108, 2265-2274.
Romani, L., Bistoni, F., Gaziano, R., Bozza, S., Montagnoli, C., et al. (2004). Thymosin α1
activates dendritic cells for antifungal Th1 resistance through toll-like receptor signaling.
Blood, 103, 4232-9
Romani, L., Bistoni, F., Montagnoli, C., et al. (2007). Thymosin alpha1: An endogenous regulator
of inflammation, immunity, and tolerance. Ann N Y Acad Sci., 1112, 326-338.
Romerio F, Zella D. (2002). MEK and ERK inhibitors enhance the anti-proliferative effect of
interferon-alpha 2 b. FASEB J, 16, 1680-1682
Rustgi, V. (2004). Combination therapy of thymalfasin (thymosin-alpha 1) and peginterferon alfa-
2a in patients with chronic hepatitis C virus infection who are non-responders to standard
treatment. J Gastro enterol Hepatol., 19, 76–80.
Rustgi, V.K. (2005). Thymalfasin for the treatment of chronic hepatitis C infection. Expert Rev
Anti Infect Ther., 3, 885–92.
Sambrook, J. and Russel, DW. 2001. Molecular cloning: a laboratory manual. 3ed. New York;
Cold Spring Harbor Laboratory Press, ISBN 0-87969-577-3.
Samuel, C.E. (1993). The eIF-2α protein kinases, regulators of translation in eukaryotes from yeasts
to humans. J. Biol. Chem., 268, 7603-7606.
Samuel, C.E. (2001). Antiviral Actions of Interferons. Clinical Microbiology Reviews, 14, 4778-
809.
Saruc, M., Ozden, N., Turkel, N., Ayhan, S., Hock, L.M., Tuzcuoglu, I. and Yuceyar H. (2003).
Long-term outcomes of thymosin-alpha 1 and interferon alpha-2b combination therapy in
patients with hepatitis B e antigen (HBeAg) negative chronic hepatitis B. J Pharm Sci., 92,
1386-1395
Saruc, M., Yuceyar, H., Kucukmetin, N., Demir, M.A. and Kandiloglu, A.R. (2002). Combination
thymosin-alpha 1 and interferon-alpha 2b in the treatment of anti-HBe-positive chronic
hepatitis B in Turkey. Hepatogastroenterology,49, 798-802
Shrivastava, P., Singh, S.M. & Singh. N. (2004). Effect of thymosin alpha 1 on the antitumor
activity of tumor–associated macrophage-derived dendritic cells. J. Biomed. Sci., 11, 623–
630.
Stark, G.R., Kerr, I.M., Williams, B.R., Silverman, R.H. and Schreiber, R.D. (1998). How cells
respond to interferons. Annu. Rev. Biochem., 67, 227-264.
Sztein, M.B. & S.A. Serrate. (1989). Characterization of the immunoregulatory properties of
thymosin alpha 1 on interleukin-2 production and interleukin-2 receptor expression in normal
human lymphocytes. Int. J. Immunopharmacol., 11, 789–800
Tete, S., Pappalardo, S., Fioroni, M., Salini, L., Imperatrice, A.M. and Perfetti, E.G. (1999). Bcl-
2, p53, Ki-67 and apoptotic index in cancerous and precancerous lesions of the oral
leukoplakia with isotretinoin. Minerva Stomatol., 48, 411-8
Van Broekhoven, C.L., Parish, C.R., Demangel, C., Britton, W.J and, Altin, J.G. (2004). Targeting
dendritic cells with antigen-containing liposomes: a highly effective procedure for induction
of antitumor immunity and for tumor immunotherapy. Cancer Res, 64, 4357–4365.
van der Most, R.G., Currie, A., Robinson, B.W., et al. (2006). Cranking the immunologic engine
with chemotherapy: Using context to drive tumor antigen cross presentation towards useful
antitumor immunity. Cancer Res, 66, 601-604.
Wang, R.F., Miyahara, Y. and Wang, H.Y. (2008). Toll-like receptors and immune regulation:
implications for cancer therapy. Oncogene, 27, 181-189.
Wu, A.M. and Senter, P.D. (2005). Arming antibodies: prospects and challenges for
immunoconjugates. Nat Biotechnol., 23, 1137–1146.
Yao, Q., Doan, L.X. and Zhang, R. (2007). Thymosin alpha 1 modulated dendritic cell
differentiation and functional maturation from peripheral blood CD14+ monocytes.
Immunology Letters, 110, 110-120.
Yao, W., Zhu, Q., Yuan, Y., Qiao, M., Zhang, Y., and Zhai, Z. (2007). Thymosin alpha 1 improves
severe acute pancreatitis in rats via regulation of peripheral T cell number and cytokine serum
level. J Gastroen Hepatol., 22, 1866–71.
Zhang, P., Chan, J., Dragoi, A.M., et al. (2005). Activation of IKK by thymosin α1 requires the
TRAF6 signaling pathway. EMBO Rep., 6, 531-7

Thanks for Reading!