Journal of Clinical Virology 54 (2012) 130134

Contents lists available at SciVerse ScienceDirect

Journal of Clinical Virology

journal homepage: www.elsevier.com/locate/jcv

Detection and quantication of inuenza C virus in pediatric respiratory

specimens by real-time PCR and comparison with infectious viral counts
Yoko Matsuzaki a, , Tatsuya Ikeda b , Chieko Abiko b , Yoko Aoki b , Katsumi Mizuta b , Yoshitaka Shimotai a ,
Kanetsu Sugawara a , Seiji Hongo a
a
Department of Infectious Diseases, Yamagata University Faculty of Medicine, Iida-Nishi 2-2-2, Yamagata 990-9585, Japan
b
Department of Microbiology, Yamagata Prefectural Institute of Public Health, Tokamachi 1-6-6, Yamagata 990-0031, Japan

a r t i c l e i n f o a b s t r a c t

Article history: Background: The epidemiological and clinical impacts of inuenza C virus infection may have been under-
Received 8 December 2011 estimated by conventional viral culture screening alone.
Received in revised form 13 February 2012 Objective: To evaluate a newly developed real-time polymerase chain reaction (PCR) assay as a tool for
Accepted 14 February 2012
diagnosing inuenza C virus infection.
Study design: The primers and probe for real-time PCR were designed to amplify the conserved region of
Keywords:
the nucleoprotein gene based on the aligned sequences of nine isolates from 1967 to 2010. Respiratory
Inuenza C virus
specimens from children collected between January 2010 and August 2010 were examined for the pres-
Real-time PCR
Viral load
ence of inuenza C virus by cell culture and real-time PCR. Specimens that were positive for the virus
Cell culture using real-time PCR were further examined using an infectivity assay with embryonated hens eggs.
Infectivity assay Results: Of the 1203 specimens examined, 34 (2.8%) tested positive for the inuenza C virus by cell
culture and 51 (4.2%) tested positive by real-time PCR. The mean viral load and infectivity titer in
specimens that tested positive using cell culture were 3.97 108 copies/ml and 5.43 105 EID50 /ml,
respectively, and those in specimens that were negative using cell culture were 2.18 106 copies/ml
and 3.67 102 EID50 /ml, respectively. In the clinical specimens with viral loads less than 105 copies/ml,
it was not possible to isolate the virus using embryonated hens eggs. The copy number-to-EID50 ratio of
the clinical specimens was much higher, ranging from 32 to 278,000, than those of culture uid, ranging
from 2.3 to 13.5.
Conclusion: The real-time PCR assay described here can be used as a sensitive method for diagnosing
inuenza C virus infection.
2012 Elsevier B.V. All rights reserved.

1. Background 1988, we have monitored inuenza C virus infections in Japan using

Inuenza C virus usually causes a mild upper respiratory tract
illness but can also cause lower respiratory tract illness, such as
bronchitis and pneumonia particularly in children < 2 years old.13
More than 80% of humans acquire antibodies to the virus by the
age of 710 years, which suggests that inuenza C virus infection
is common during childhood.46
Recently, studies on inuenza C virus infection were reported
from Spain,7,8 France,9 Cuba10 and Nigeria.11 Their method of
detection of inuenza C virus used molecular techniques. Since
Abbreviations: CPE, cytopathic effect; EID50 , 50% egg infectious dose; HA, hemag-
glutination; HAU, hemagglutination unit; MDCK, Madin Darby canine kidney; NP,
nucleoprotein; PCR, polymerase chain reaction.
Corresponding author. Tel.: +81 23 628 5249; fax: +81 23 628 5250.
E-mail address: matuzaki@med.id.yamagata-u.ac.jp (Y. Matsuzaki).
a cell culture method, and we have repeatedly succeeded in detect-
ing outbreaks of type C inuenza.1217 However, the cytopathic
effect (CPE) of inuenza C virus in the primary isolation is dif-
cult to recognize due to its relative weakness compared to the
inuenza A or B virus. To understand the epidemiology and clinical
impacts of inuenza C virus infection that may have been under-
estimated by conventional viral culture alone, rapid and sensitive
polymerase chain reaction (PCR) methods that are standardized
from institution to institution are necessary to detect inuenza C
virus.
Phylogenetic analysis of the hemagglutinin-esterase gene that
encodes a surface glycoprotein revealed the existence of six distinct
virus groups.13,15,16 The analysis also showed that the inuenza C
viruses belonging to different antigenic groups were co-circulating
in the community.15,16 To then broadly detect the inuenza C virus
independent of antigenicity or the year of isolation, we chose the
nucleoprotein (NP) gene, which encodes an internal protein, as the
target for nucleic acid amplication.

1386-6532/$ see front matter 2012 Elsevier B.V. All rights reserved.
doi:10.1016/j.jcv.2012.02.012
 Y. Matsuzaki et al. / Journal of Clinical Virology 54 (2012) 130134
While the real-time PCR assay is able to provide rapid and sen-
sitive diagnosis of viral disease, the advantage of cell culture is its
ability to specically detect infectious virus. Here we report the
detection of inuenza C virus in clinical specimens using a real-time
PCR method, compared with the cell culture detection method. We
then performed an infectivity assay using embryonated hens egg
and compared the viral load determined by real-time PCR with the
number of infectious virions.
2. Objectives
The objective of this report is to evaluate the newly developed
real-time PCR assay for inuenza C virus as a tool for the diagnosis
of inuenza C virus infection.
3. Study design
3.1. Clinical specimens and viruses
Nasopharyngeal swab specimens from children under 15 years
of age with acute respiratory infection were collected at pediatric
clinics that were collaborating with the local health authorities in
the Yamagata Prefecture regarding the surveillance of viral dis-
eases in Japan. Informed consent was obtained from the patients
guardians. Between January 2010 and August 2010, a total of 1203
specimens were collected. Each specimen was suspended in 3 ml of
transport medium18 and transported at 4 C to the Yamagata Pre-
fectural Institute of Public Health. After the virus isolation and RNA
extraction, the remainder of the specimens was frozen at 80 C
within 5 days of collection and stored until use in the infectivity
assay.
For validation of the real-time PCR assay, we used three proto-
type strains and six strains isolated from 2000 to 2010 in Japan as
the reference strains (see Fig. 1). These strains were propagated in
the amniotic cavity of 9-day-old embryonated hens eggs. After the
hemagglutination (HA) test using 0.5% chicken erythrocytes, the
strains were frozen and stored at 80 C until use in the infectivity
assay.
3.2. Virus isolation and infectivity assay
Virus isolation was performed using a modied microplate
method as described previously.17,18 When a CPE was observed
in Madin Darby canine kidney (MDCK) cells, identication of
inuenza C virus was performed using a hemagglutinin inhibition
test with the anti-C/AnnArbor/1/50 serum. Infectivity assays were
performed using the end-point dilution method with embryonated
hens eggs as described previously.17
3.3. Synthesis of cDNA and nucleotide sequencing
Viral RNA was extracted from 200 l of specimen or viral uid
using a High Pure Viral RNA Kit (Roche Diagnostics, Manheim,
Germany) and eluted in 50 l of RNase-free distilled water. The
resulting RNA (10 l) was then transcribed into cDNA using random
primers in a 20 l reaction volume as described previously.19
For nucleotide sequencing of the reference strains, tran-
scribed cDNA was used as the template for the amplication
of the full-length NP gene by PCR. The NP gene was amplied
using primers FluC + NP1 (5 -AGCAGAAGCAGGAGATTTGATTTTC-
3 ), corresponding to positions 125, and FluC-NP1809 (5 -
AGCAGTAGCAAGGAGATTTTTGAA-3 ), corresponding to positions
18091786. Puried PCR products were sequenced as described
previously.20 The nucleotide sequences determined in this study
131
were assigned the following accession numbers on GenBank:
AB684308AB684316.
3.4. Real-time TaqMan PCR assays
The following real-time PCR primer and probe
sequences were used: FluCNP+1068 (5 -GCRTGCTTT-
GGRCTTGCTTATG-3 ), FluCNP1161 (5 -ARTTTCCTATTTTCATTC-
TGTTTCTCAAC-3 ) and FluCNP1100probe (5 -FAM-
TTTGGTYTCTGCYATGGTYAGCCAYCCTCT-TAMRA-3 ). They were 
designed using Primer Express software (Applied Biosystems,
Foster City, CA) from nine aligned nucleotide sequences of the
full-length NP gene of the reference strains (Fig. 1).
The real-time PCR assay was performed with a 10-l reac-
tion mixture containing 1 l of cDNA, 0.9 M of each forward and
reverse primer, 0.25 M of the TaqMan probe and 5 l of TaqMan
Fast Universal PCR Master Mix (Applied Biosystems) using an ABI
Prism 7500 Fast Real-Time PCR system. PCR conditions included
an initial activation at 95 C for 20 s, 40 cycles of 3 s at 95 C and
30 s at 60 C. The quantitation of inuenza C virus RNA was per-
formed using a standard curve generated by the threshold cycle
values obtained from serial 10-fold dilutions of in vitro transcripts
containing 102 108 copies of the full-length NP gene. Each sam-
ple was analyzed in triplicate, and the average copy number was
calculated. Results were expressed as viral load per ml of sample
and considered positive when the viral load was above 500 RNA
copies/ml of sample corresponding to 1 copy/reaction of real-time
PCR.
4. Results
4.1. Comparison of primer and probe sequences with the target
sequences of previous isolates
In our earlier study,16 the NP genes of the previous isolates ana-
lyzed by partial sequences of the NP gene (positions 71670) were
split into seven distinct lineages, represented by C/Mississippi/80,
C/Yamagata/26/81, C/Sapporo/71, C/Kanagawa/1/76, C/Aichi/1/81,
C/pig/Beijing/115/81 and C/Miyagi/1/93. We examined the target
sequences (positions 10681161) of a total of 41 strains, which
were isolated from 1950 to 2010, including the seven represen-
tative strains of the NP gene tree. We compared these sequences
and three sequences of the full-length NP gene available in Gen-
Bank (C/AnnArbor/1/50, C/Johannesburg/1/66 and C/California/78)
with the sequences of the newly designated primer set and probe.
The results showed that each was identical to the sequence of one
of the nine reference strains shown in Fig. 1.
4.2. Quantication of inuenza C virus in culture uids by
real-time PCR and infectivity assay
We tested the nine reference strains propagated in the
amniotic cavity of hens egg, which had a HA titer of
2562560 hemagglutination unit (HAU)/ml. As shown in Table 1,
the viral load measured by real-time PCR was almost in agreement
with the infectivity titer. The copy number-to-50% egg infectious
dose (EID50 ) ratio was ranged from 2.3 to 13.5. This result indicates
that the real-time PCR assay can accurately quantify the inuenza
C virus isolated from 1967 to 2010.
4.3. Specicity of the real-time PCR assay
To test whether the primers and probe designed for the real-
time PCR assay were specic for inuenza C virus, we used DNA
or cDNA from 20 other respiratory viruses as templates for real-
time PCR assay. These templates were isolated from stocks of the
132 Y. Matsuzaki et al. / Journal of Clinical Virology 54 (2012) 130134

Primer and probe Forward primer Probe Reverse primer

sequence
GCRTGCTTTGGRCTTGCTTATG TTTGGTYTCTGCYATGGTYAGCCAYCCTCT ARTTTCCTATTTTCATTCTGTTTCTCAAC

C/Johannesburg/4/67 GCATGCTTTGGACTTGCTTATG TTTGGTCTCTGCTATGGTTAGCCACCCTCT AGTTTCCTATTTTCATTCTGTTTCTCAAC

C/NewJersey/76
C/Greece/79
C/Yamagata/3/2000
C/Miyagi/4/2002
C/Yamagata/15/2004
C/Yamagata/3/2005
C/Yamagata/1/2007
C/Yamagata/2/2010
......................
......................
..G...................
......................
......................
...........G..........
......................
......................
..................C........... .............................
.............................. .............................
............C.....C........... .............................
........................T..... .............................
.............................. .A...........................
......T...........C........... .............................
.............................. .............................
..................C........... .............................

Fig. 1. Real-time PCR primers and probe sequences (5 3 ) designed for the detection of inuenza C virus and alignment with the target sequences of the reference strains.
The forward primer, FluCNP+1068, corresponds to positions 10681089 of the NP gene; the reverse primer, FluCNP1161, corresponds to positions 11611133; the probe,
FluCNP1100probe, corresponds to positions 11001129. Residue R is either an A or a G, and residue Y is either a C or a T.

Table 1
Viral load in culture uids calculated by HA test, real-time PCR and infectivity assay.

Virus strains HA test Real-time PCR Infectivity assay Copies/EID50 ratio

Hemagglutination titer (HAU/ml) Number of copies (copies/ml) 50% egg infectious dose (EID50 /ml)

C/Johannesburg/4/67 1024 1.37 1011 1.05 1010 13.0

C/NewJersey/76 1024 4.61 1011 3.41 1010 13.5
C/Greece/79 1024 4.00 1011 5.00 1010 8.0
C/Yamagata/3/2000 2560 7.91 1011 2.37 1011 3.3
C/Miyagi/4/2002 512 1.11 1010 4.80 109 2.3
C/Yamagata/15/2004 512 1.10 1011 2.08 1010 5.3
C/Yamagata/3/2005 512 2.94 1011 3.17 1010 9.3
C/Yamagata/1/2007 256 2.14 1011 3.17 1010 6.8
C/Yamagata/2/2010 256 1.70 1011 2.08 1010 8.2

inuenza viruses A(H1N1), A(H3N2), A(H1N1)pdm09 and B, parain-
uenza viruses 1, 2 and 3, respiratory syncytial viruses A and B,
human metapneumoviruses A and B, measles virus, mumps virus,
rhinovirus, coxsackieviruses A and B, enterovirus 71, echovirus,
poliovirus, adenovirus, cytomegalovirus and herpes simplex virus.
None of the templates resulted in a positive signal, conrming that
the designed primers and probe were specic for inuenza C virus.
4.4. Detection of inuenza C virus in respiratory specimens by cell
culture and real-time PCR
4.5. Quantication of inuenza C virus in respiratory specimens
using real-time PCR and infectivity assay
Differences of virus quantity between specimens that were
positive and negative by cell culture were examined. The mean
viral load in specimens that were positive by cell culture was
3.97 108 copies/ml versus 2.18 106 copies/ml for specimens that
were negative by cell culture (P = 0.0467). Fig. 2 shows the num-
ber of specimens that were positive or negative by cell culture and
stratied by real-time PCR viral load. Among the 17 specimens that

Between January 2010 and August 2010, 1203 specimens were

examined for the presence of inuenza C virus by cell culture and
real-time PCR. Of the 1203 specimens examined, 34 (2.8%) tested 20
positive by cell culture and 51 (4.2%) tested positive using real-time 18
Number of real-time PCR positive

PCR. All of the 34 cell culture-positive specimens were found to be

positive using real-time PCR (Table 2). Therefore, taking the cell cul- 16
ture results as the gold standard, the sensitivity, specicity, positive 14
predictive value and negative predictive value for the real-time PCR
were found to be 100%, 98.5%, 66.7% and 100%, respectively. Of the 12
34 cell culture-positive specimens, 9 were found to be positive for 10
other viruses by cell culture using microplate method: ve tested
positive for parainuenza virus 1, one for enterovirus 71, one for 8
coxsackievirus A4 and two for cytomegalovirus.
6

Table 2 4
Results of cell culture and real-time PCR on 1203 clinical specimens from children
tested for inuenza C virus.
2

Real-time PCR result No. of specimens with Total 0

cell culture result 3-4 5-6 7-8 9-10
Positive Negative log10 viral copies/ml
Positive 34 17 51
Fig. 2. The number of real-time PCR positive specimens by viral load (log 10 viral
Negative 0 1152 1152
copies/ml) among specimens that were negative (light columns) or positive (dark
Total 34 1169 1203
columns) using cell culture.
 Y. Matsuzaki et al. / Journal of Clinical Virology 54 (2012) 130134
Fig. 3. The viral load quantied by real-time PCR and infectivity assay in clinical specimens that were positive (left panel) and negative (right panel) using cell culture. Open
diamonds in the right panel indicate the specimens that were negative using embryonated hens eggs.
were negative using cell culture, 15 (88.2%) had viral loads less than
1 107 copies/ml.
To determine whether specimens that were positive in real-
time PCR and negative in cell culture were true positive or negative,
isolation in embryonated hens eggs was performed and the infec-
tivity titer in clinical specimens was measured. The relationship
between the number of viral copies and infectivity titer in 47 spec-
imens is shown in Fig. 3, which excludes four specimens that were
found to be unsuitable for the infectivity assay. The mean infec-
tivity titer in specimens that were positive by cell culture was
5.43 105 EID50 /ml, whereas the mean infectivity titer in speci-
mens that were negative using cell culture but positive using virus
culture in embryonated eggs was 3.67 102 EID50 /ml. Among the
15 specimens that were negative using cell culture, eight (53.5%)
had viral loads less than 1 105 copies/ml, and these eight spec-
imens were also negative for the virus in the culture assay using
embryonated eggs. In 39 specimens in which an EID50 could be
measured, the copy numbers of 34 specimens (87%) were 100- to
10,000-fold greater than the number of infectious particles calcu-
lated by the infectivity assay. The highest copy number-to-EID50
ratio was 278,000, whereas the lowest ratio was 32.
5. Discussion
The real-time PCR assay described here was more sensitive than
cell culture for the detection of inuenza C virus. This assay accu-
rately detected and quantied the reference strains belonging to
all six known genetic lineages of the NP gene. Thus, it will be a
useful tool for various investigations, such as those studying the
seasonal distribution of inuenza C virus infections or the clinical
impact of these infections that may have been underestimated by
conventional viral culture alone.
The 4.2% prevalence (51/1203) of inuenza C virus found in res-
piratory specimens obtained during the 2010 inuenza season is
comparable to the 3.9% prevalence (49/1263) in 2004 reported by
our previous investigation using both cell culture and the reverse
transcription-PCR method.17 We documented that the nationwide
epidemic of inuenza C virus occurred in Japan in 2004. An out-
break of inuenza C virus comparable to that of 2004 was identied
133
in 2010, indicating that inuenza C virus is an important pathogen
among children resulting in respiratory outbreaks in the commu-
nity.
The disadvantage of PCR methods for diagnosis of viral disease
is that it detects the viral nucleic acids but does not specically
detect the infectious virus. Therefore, we tried to determine the
relationship between the copy numbers of viral nucleic acid and
numbers of infectious virus. The amniotic cavity of embryonated
hens eggs has a higher sensitivity than MDCK cells to inuenza C
virus. Therefore, we used embryonated eggs for the infectivity assay
as a sensitive substrate in which to propagate inuenza C virus.
The majority (88.2%) of the inuenza C virus-negative clinical
specimens using cell culture detection had less than 107 copies/ml
(Fig. 2). In other words, clinical specimens with viral loads greater
than 107 copies/ml have sufcient infectious particles and these
particles can be isolated by cell culture. Clinical specimens with
viral loads between 105 and 107 copies/ml have an intermediate
number of infectious particles that can be isolated using the cell
culture technique. Clinical specimens with viral loads less than
105 copies/ml have so few infectious particles that they are unable
to be isolated using cell culture or embryonated eggs. These data
could be useful for the diagnosis of inuenza C virus infection based
on quantitative real-time PCR result.
There may be a reason that the ratio of copy number-to-EID50
of the clinical specimens was much higher, ranging from 32 to
278,000, compared to specimens from culture uid, ranging from
2.3 to 13.5. The relatively lower number of infectious virus to
the number of nucleic acid in clinical specimens may be due to
specimen quality, time in transport, and injury of a viral par-
ticle by immunity. Further studies, including clinical data, will
determine at what viral load in a clinical specimen is there a
signicant pathogenic role of the virus in respiratory illness. In
conclusion, the real-time PCR assay described here is a suitable
rapid, specic and sensitive method for diagnosing inuenza C virus
infection.
Conict of interest
None declared.
134 Y. Matsuzaki et al. / Journal of Clinical Virology 54 (2012) 130134
Acknowledgments
We thank Yoko Kadowaki for her technical assistance.
Funding: This work was supported by a grant-in-aid for Scientic
Research from the Japanese Ministry of Education, Culture, Sports,
Science and Technology.
Ethical approval: Not required.
References
1. Katagiri S, Ohizumi A, Homma M. An outbreak of type C inuenza in a childrens
home. J Infect Dis 1983;148:516.
2. Moriuchi H, Katsushima N, Nishimura H, Nakamura K, Numazaki Y. Community-
acquired inuenza C virus infection in children. J Pediatr 1991;118:2358.
3. Matsuzaki Y, Katsushima N, Nagai Y, Shoji M, Itagaki T, Sakamoto M, et al. Clin-
ical features of inuenza C virus infection in children. J Infect Dis 2006;193:
122935.
4. Dykes AC, Cherry JD, Nolan CE. A clinical, epidemiologic, serologic, and virologic
study of inuenza C virus infection. Arch Intern Med 1980;140:12958.
5. Homma M, Ohyama S, Katagiri S. Age distribution of the antibody to type C
inuenza virus. Microbiol Immunol 1982;26:63942.
6. Nishimura H, Sugawara K, Kitame F, Nakamura K, Sasaki H. Prevalence of the
antibody to inuenza C virus in a northern Luzon Highland Village, Philippines.
Microbiol Immunol 1987;31:113743.
7. Calvo C, Garca-Garca ML, Centeno M, Prez-Brena P, Casas I. Inuenza C virus
infection in children, Spain. Emerg Infect Dis 2006;12:16212.
8. Antn A, Marcos MA, Codoner FM, de Molina P, Martnez A, Cardenosa N, et al.
Inuenza C virus surveillance during the rst inuenza A (H1N1) 2009 pandemic
wave in Catalonia, Spain. Diagn Microbiol Infect Dis 2011;69:41927.
9. Gouarin S, Vabret A, Dina J, Petitjean J, Brouard J, Cuvillon-Nimal D, et al. Study
of inuenza C virus infection in France. J Med Virol 2008;80:14416.
10. Ramos AP, Herrera BA, Ramrez OV, Valds CS, Hernndez AG, Gonzalez G, et al.
Detection of inuenza C during an outbreak at an internal school, using a molec-
ular tool; Havana, Cuba, September 2006. Int J Infect Dis 2008;12:e12930.
11. Akinloye OM, Rnkk E, Savolainen-Kopra C, Ziegler T, Iwalokun BA, Deji-
Agboola MA, et al. Specic viruses detected in nigerian children in association
with acute respiratory disease. J Trop Med 2011;2011:690286.
12. Matsuzaki Y, Muraki Y, Sugawara K, Hongo S, Nishimura H, Kitame F, et al. Cocir-
culation of two distinct groups of inuenza C virus in Yamagata City, Japan.
Virology 1994;202:796802.
13. Matsuzaki Y, Mizuta K, Kimura H, Sugawara K, Tsuchiya E, Suzuki H, et al. Charac-
terization of antigenically unique inuenza C virus strains isolated in Yamagata
and Sendai cities, Japan, during 19921993. J Gen Virol 2000;81:144752.
14. Matsuzaki Y, Sugawara K, Mizuta K, Tsuchiya E, Muraki Y, Hongo S, et al.
Antigenic and genetic characterization of inuenza C viruses which caused
two outbreaks in Yamagata City, Japan, in 1996 and 1998. J Clin Microbiol
2002;40:4229.
15. Matsuzaki Y, Mizuta K, Sugawara K, Tsuchiya E, Muraki Y, Hongo S, et al. Frequent
reassortment among inuenza C viruses. J Virol 2003;77:87181.
16. Matsuzaki Y, Takao S, Shimada S, Mizuta K, Sugawara K, Takashita E, et al. Char-
acterization of antigenically and genetically similar inuenza C viruses isolated
in Japan during the 19992000 season. Epidemiol Infect 2004;132:70920.
17. Matsuzaki Y, Abiko C, Mizuta K, Sugawara K, Takashita E, Muraki Y, et al. A nation-
wide epidemic of inuenza C virus infection in Japan in 2004. J Clin Microbiol
2007;45:7838.
18. Mizuta K, Abiko C, Aoki Y, Suto A, Hoshina H, Itagaki T, et al. Analysis of monthly
isolation of respiratory viruses from children by cell culture using a microplate
method: a two-year study from 2004 to 2005 in Yamagata, Japan. Jpn J Infect Dis
2008;61:196201.
19. Murata T, Katsushima N, Mizuta K, Muraki Y, Hongo S, Matsuzaki Y. Prolonged
norovirus shedding in infants 6 months of age with gastroenteritis. Pediatr
Infect Dis J 2007;26:469.
20. Matsuzaki Y, Mizuta K, Aoki Y, Suto A, Abiko C, Sanjoh K, et al. A two-year survey
of the oseltamivir-resistant inuenza A(H1N1) virus in Yamagata, Japan and the
clinical effectiveness of oseltamivir and zanamivir. Virol J 2010;7:53.