Linkping University Medical Dissertations No.

1371

Staphylococcus aureus
- aspects of pathogenesis and molecular epidemiology

Lisa Stark

Department of Clinical Microbiology, Ryhov County Hospital, Jnkping

Division of Medical Microbiology
Department of Clinical and Experimental Medicine
Faculty of Health Sciences
Linkping University, Sweden
Linkping 2013
 Lisa Stark, 2013
Published articles have been reprinted with the permission of the copyright
holders.
Printed in Sweden by LiU-Tryck, Linkping 2013

ISBN 978-91-7519-568-1
ISSN 0345-0082
 Contents

CONTENTS

ABSTRACT.. 1
SAMMANFATTNING P SVENSKA 3
LIST OF PAPERS 5
ABBREVIATIONS. 7
INTRODUCTION 9
Staphylococcus aureus.. 9
Background 9
Epidemiology 10
Antibiotic resistance 11
Methicillin-resistant Staphylococcus aureus. 12
Virulence factors and strategies. 14
Adhesion to host 20

The host 25
Innate immunity 25
Endothelial cells. 28

Typing methods 30
Conventional typing................................................................................31
Phage typing. 31
Molecular typing methods. 32
Pulsed field gel electrophoresis... 32
Multilocus sequence typing. 33
spa typing......... 35
 Contents

Terminal restriction fragment length polymorphism 37

Denaturing gradient gel electrophoresis 38
Microarray....... 40
Gene expression 44
Microarray....... 44
Real-time PCR 45

AIMS 47
RESULTS AND DISCUSSION..48
Isolation and cultivation of S. aureus (papers I and IV).. 48
HUVEC as a model to study interactions with S. aureus (papers I and II).. 52

Internalization and survival of S. aureus in HUVEC (papers I and II). 53

S. aureus induction of apoptosis in endothelial cells (papers I and II). 54
Gene expression in HUVEC infected with S. aureus (papers I and II) 55
Prevalence and molecular epidemiology of S. aureus (paper III). 59
Colonization and persistent carriage of S. aureus (paper III) 61
Antibiotic resistance found in S. aureus (papers II and III).. 62
Multiclonality of S. aureus (papers III and IV) 63
CONCLUSIONS65
Benefit for individuals and perspectives for the future.. 67
ACKNOWLEDGEMENTS 68
REFERENCES.69
 Abstract

ABSTRACT
Staphylococcus aureus is a human commensal colonizing about 30 per cent of
the population. Besides, it is a frequent cause of infections such as skin, wound
and deep tissue infections and also more life-threatening conditions such as
pneumonia, endocarditis and septicaemia. S. aureus may also cause different
toxicoses. Moreover, this bacterium is one of the most common causes of
nosocomial infections worldwide and an increase in antibiotic resistance,
especially against methicillin, is seen. This underlines the importance to
prevent and control outbreaks of S. aureus. The aims of this thesis were to
increase the knowledge of S. aureus virulence and pathogenesis as well as to
understand pattern of colonization and transmission.
Various virulence factors operate together in the pathogenic process of
S. aureus. The virulence of S. aureus was studied by the interaction with human
umbilical vein endothelial cells (HUVEC) as a model. In paper I, we found that
one bacterial isolate survived intracellularly and that 156 genes were
differentially regulated in microarray analysis of HUVEC. The major part of
these genes coded for proteins involved in innate immunity. In paper II, we
wanted to explore possible differences in global gene expression patterns in
HUVEC induced by invasive compared to colonizing isolates of S. aureus. We
also used microarray to investigate possible differences in the presence of
virulence genes between the two groups. The main finding was that virulent
and commensal S. aureus did not differ in interaction with HUVEC and in the
presence of virulence genes. All isolates survived intracellularly for days.
Since no obvious differences in virulence between the two groups of isolates
were found, we focused on epidemiology and transmission patterns.
Colonization with S. aureus is an important risk factor for subsequent S. aureus
infection. In paper III, we investigated S. aureus colonization and transmission
among nursing home residents in three regions in the south of Sweden and
used staphylococcal protein A (spa) typing as an epidemiological tool. A diverse
distribution of different spa types was found and a majority of types were
unique to one individual. Interestingly, we found a local accumulation of one
spa type in one nursing home. Also common spa types were equally distributed
in the different regions. We also noted that some individuals were colonized
with two different spa types of S. aureus and in five of these cases there was
one resistant and one non-resistant strain.
The issue of multiclonal colonization and infection is highly important and
clinical diagnostic laboratories do not routinely address this problem.
1
 Abstract

Therefore, in paper IV a novel method to assess multiclonality of S. aureus was

developed. It was based on denaturing gradient gel electrophoresis with the
amplification of the spa gene. The method simultaneously separated eight
different spa types. It also detected two spa types in an outbreak.
In conclusion, we found no differences in virulence genes and in the interaction
with HUVEC between commensal and invasive isolates. This indicates that any
isolate of S. aureus might have a pathogenic potential. We also confirmed that
some spa types are more successful colonizers with a potential to nosocomial
spread. The method for detection of multiclonality of S. aureus is of importance
in future epidemiological and clinical studies.

2
 Sammanfattning p svenska

SAMMANFATTNING P SVENSKA
Staphylococcus aureus r en bakterie som koloniserar cirka 30 procent av
populationen. Den r dessutom en vanlig orsak till bde hud och srinfektioner
men kan ven orsaka livshotande tillstnd som lunginflammation, endokardit
och sepsis. Vissa stammar kan ocks orsaka toxinmedierade tillstnd.
Drutver r S. aureus ocks en av de vanligaste orsakerna till vrdrelaterade
infektioner i vrlden och en kning av antibiotikaresistens kan ses, srskilt mot
meticillin. Detta understryker vikten av att frebygga och bekmpa utbrott av
S. aureus. Syftet med denna avhandling var att ka kunskapen om virulens och
patogenes hos S. aureus samt att ka frstelsen fr kolonisering och
smittspridningsmnster.
Olika virulensfaktorer bidrar till S. aureus frmga att orsaka infektion och det
r troligt att flera olika faktorer samverkar i den sjukdomsframkallande
processen. Virulensegenskaper hos S. aureus studerades i en
interaktionsmodell med humana endotelceller frn navelstrngar (HUVEC). I
den frsta studien fann vi att bakterien verlevde intracellulrt och med
microarray detekterades 156 olika gener som var reglerade i HUVEC. En stor
del av dessa gener kodade fr proteiner med anknytning till det medfdda
immunfrsvaret. I den andra studien ville vi underska om det fanns skillnader i
genuttryck i HUVEC som infekterats med invasiva jmfrt med koloniserande
isolat av S. aureus. Vi anvnde ocks microarray fr att studera eventuella
skillnader i frekomsten av virulensgener mellan de tv grupperna. Den
viktigaste slutsatsen var att virulenta och koloniserande isolat av S. aureus inte
skiljde sig i interaktionen med HUVEC och inte heller i frekomst av
virulensgener. Alla isolaten verlevde intracellulrt under flera dagar.
Eftersom inga uppenbara skillnader i virulens mellan de tv grupperna kunde
pvisas, fokuserade vi istllet p epidemiologi och smittspridningsmnster.
Kolonisation med S. aureus r en viktig riskfaktor fr att drabbas av S. aureus
infektion. I studie tre underskte vi hur S. aureus koloniserar och eventuellt
sprids bland ldre individer p ett antal ldreboenden i tre regioner i sdra
Sverige. Som ett epidemiologiskt verktyg anvndes typning av
stafylokockprotein A (spa). En stor diversitet i frdelning av olika spa typer
hittades och en majoritet av typerna var unika fr en enskild individ. Ett
3
 Sammanfattning p svenska

intressant fynd var ocks en lokal ansamling av en spa typ p ett av

ldreboendena. De vanligaste spa typerna ptrffades oftast i mer n en av
regionerna. Vi noterade ocks att vissa individer var koloniserade med tv olika
spa typer av S. aureus och fem av dessa individer var samtidigt koloniserade
med en resistent och en icke-resistent stam.
Frgan om multiklonal kolonisering och infektion r mycket viktig och kliniska
laboratorier r i dagslget inte rutinmssigt medvetna om detta problem. I den
fjrde studien utvecklade vi drfr en ny metod fr att kunna studera
multiklonalitet hos S. aureus. Den baseras p denaturerande gradient gel
elektrofores med amplifiering av spa genen. Metoden kunde samtidigt
separera tta olika spa typer och anvndes ocks fr att studera ett lokalt
MRSA utbrott med tv olika stammar.
Sammanfattningsvis fann vi inga skillnader i frekomst av virulensgener eller i
interaktion med HUVEC mellan koloniserande och invasiva isolat. Detta
indikerar att varje isolat av S. aureus kan ha potential att orsaka sjukdom. Vi
bekrftade ocks att vissa spa typer r mer framgngsrika vid kolonisation med
potential till vrdrelaterad spridning. Metoden fr detektion av multiklonalitet
hos S. aureus r av betydelse i framtida epidemiologiska och kliniska studier.

4
 List of papers

LIST OF PAPERS

I. Andreas Matussek, Jan Strindhall, Lisa Stark, Manfred Rohde,

Robert Geffers, Jan Buer, Erik Kihlstrm, Per-Eric Lindgren and Sture
Lfgren. Infection of human endothelial cells with Staphylococcus
aureus induces transcription of genes encoding an innate immunity
response. Scand J Immunol; 2005, 61: 536544

II. Lisa Stark, Andreas Matussek, Jan Strindhall, Robert Geffers, Jan
Buer, Erik Kihlstrm, Stefan Monnecke, Sture Lfgren and Per-Eric
Lindgren. Staphylococcus aureus isolates from blood and anterior
nares induce similar innate immune responses in endothelial cells.
APMIS; 2009, 117: 814824

III. Lisa Stark, Magnus Olofsson, Sture Lfgren, Sigvard Mlstad, Per-
Eric Lindgren and Andreas Matussek. Prevalence and molecular
epidemiology of Staphylococcus aureus in Swedish nursing homes
as revealed in the SHADES study. Epidemiology and Infection; 2013
In press (doi:10.1017/S0950268813002033)

IV. Andreas Matussek,*Lisa Stark,* Olaf Dienus, Joakim Aronsson, Sara

Mernelius, Sture Lfgren and Per-Eric Lindgren. Analyzing
multiclonality of Staphylococcus aureus in clinical diagnostics using
spa-based denaturing gradient gel electrophoresis. Journal of
Clinical Microbiology; 2011, 49: 36473648

* The authors have contributed equally to this work

All papers are reprinted with kind permission from the respective publisher
Paper I. John Wiley and Sons
Paper II. John Wiley and Sons
Paper III. Cambridge University Press
Paper IV. American Society for Microbiology

5
 Abbreviations

ABBREVIATIONS
bp base pair
BURP the algorithm based upon repeat patterns
Cbp collagen binding protein
CC clonal complex
CFU colony forming unit
Clf clumping factor
CPS capsular polysaccharide
Ct threshold cycle
DGGE denaturing gradient gel electrophoresis
ds double-stranded
E efficiency
Eap extracellular adherence protein
ECM extracellular matrix
ECs endothelial cells
Efb extracellular fibrinogen binding protein
ELISA enzyme-linked immunosorbent assay
ET exfoliative toxin
FBP fibrinogen binding protein
FC fold change
FITC fluorescein isothiocyanate
FnBP fibronectin binding protein
Hlg gamma hemolysine
HUVEC human umbilical vein endothelial cells
ICAM intercellular adhesion molecule
Ig immunoglobulin
IL interleukin
LFA lymphocyte function-associated antigen
LPS lipopolysaccharide
Luk leucocidine
MLST multilocus sequence typing
MRSA methicillin resistant Staphylococcus aureus
MSCRAMMs microbial surface components recognizing adhesive matrix molecules

7
 Abbreviations

MSSA methicillin sensitive Staphylococcus aureus

NK-cells natural killer cells
PAMPs pathogen-associated molecular patterns
PBP penicillin binding protein
PFGE pulsed field gel electrophoresis
PRRs pattern recognition receptors
PVL Panton Valentine leukocidin
RFLP restriction fragment length polymorphism
RT revers transcription
SERAMS secreted expanded repertoire adhesive molecules
Spa staphylococcal protein A
SSCP single strand conformation polymorphism
ST sequence type
TGGE temperature gradient gel electrophoresis
TLR toll-like receptor
TNF tumour necrosis factor
TNFR tumour necrosis factor receptor
tRFLP terminal restricted fragment length polymorphism
TSS toxic shock syndrome
VCAM vascular cell adhesion molecule
WGS whole genome sequencing
vWbp von Willebrand binding protein

8
 Introduction

INTRODUCTION
Staphylococcus aureus
Background
Staphylococcus aureus belongs to the family Micrococcaceae and is part of the
genus Staphylococcus, which contains more than 30 species such as
S. epidermidis, S. saprophyticus and S. haemolyticus. Among the staphylococcal
species, S. aureus is by far the most virulent and pathogenic for humans.
S. aureus is a 1 m, Gram-positive cell that in the laboratory may be observed
as single cells, in pairs or as grape-like irregular clusters. It is characterized as
coagulase- and catalase positive, non-motile, non-spore-forming and as
facultative anaerobic. It grows in yellow colonies on nutrient rich media and is
referred to as the yellow staphylococci (Winn Washington 2006).
S. aureus was discovered in 1880 by the surgeon Sir Alexander Ogston. He
observed grape-like clusters of bacteria when examining a purulent discharge
from patients with post-operative wounds during microscopy. He named them
staphyl, the Greek expression for a bunch of grapes. In 1884, Rosenbach
succeeded in isolating yellow bacterial colonies from abscesses and named
them Staphylococcus aureus, aureus from the Latin word for golden.

S. aureus has the ability to adapt to different environments and it may colonize
the human skin, nails, nares and mucus membranes and may thereby
disseminate among recipient host populations via physical contact and aerosols
(Lowy, 1998). Colonization with S. aureus is an important risk factor for
subsequent S. aureus infection (Wertheim et al., 2004; von Eiff et al., 2001).

S. aureus causes a wide range of infections from a variety of skin, wound and
deep tissue infections to more life-threatening conditions such as pneumonia,
endocarditis, septic arthritis and septicemia. This bacterium is also one of the
most common species in nosocomial infections. However, little is known about
the virulence factors behind all these conditions. In addition, S. aureus may also
cause food poisoning, scalded-skin syndrome and toxic shock syndrome,
through production of different toxins (Winn Washington 2006).

9
 Introduction

Epidemiology
The prevalence of S. aureus nasal carriage varies in different populations. In a
general population, the mean carriage rate is 37% (range 19-55 %) (Kluytmans
et al., 1997) but some subpopulations show significantly higher carriage rates,
e.g. patients with insulin-dependent diabetes mellitus, patients in dialysis,
intravenous drug users, individuals with human immunodeficiency virus and
patients with S. aureus skin infections. For example, up to 100 % of patients
with atopic dermatitis are colonized (Hoeger et al., 1992; Kluytmans et al.,
1997; Monti et al., 1996). S. aureus carriage may be classified into three
different groups; persistent carriers (~20 %) presumed to always carry the
bacterium; intermittent carriers (~60 %), who sometimes carry the bacterium;
and non-carriers (~20 %), presumed never to carry the bacterium (Kluytmans et
al., 1997). When comparing populations of different age, the colonization rate
in children has been reported to be significantly higher compared to adults
(Armstrong-Esther, 1976; Cunliffe, 1949; Melles et al., 2004; Noble et al., 1967;
Wertheim et al., 2005a), and in some studies a variation between genders has
been observed, both in the rate of colonization (Mernelius et al., 2013a; Olsen
et al., 2013) and in the presence of different spa types (Sangvik et al., 2011).

Differences in prevalence between various countries have also been noted. In a

recent European study, great variation in the nasal carriage rates was found,
the lowest in Hungary (12 %) and the highest (29 %) in Sweden (den Heijer et
al., 2013). In a Norwegian study, the same rate (29 %) in Norway as in the
general Swedish population has been reported (Olsen et al., 2013).

In one study from Canada, the reported incidence of invasive S. aureus

infections was 28.4 cases /100 000 individuals and infections were more
common in persons over 65 years and in males (Laupland et al., 2003). In the
United States, 0.8 % of all hospital inpatients were diagnosed with an S. aureus
infection and these patients had significantly longer stay in hospital, paid higher
costs and had a higher risk of death than inpatients without S. aureus infection
(Noskin et al., 2005). In Europe the level of bacteraemia caused by methicillin-
sensitive S. aureus (MSSA) consistently increased between 2002-2008 (12125-
15266) (de Kraker et al., 2012).

Over the years, most of the epidemiological studies on S. aureus have been
focused on methicillin resistant S. aureus (MRSA) and the epidemiology of
MSSA has so far been little studied.

10
 Introduction

Antibiotic resistance
At first, penicillin was used to treat S. aureus infections. Soon afterwards,
resistance emerged when strains acquired a genetic element coding for
-lactamase production, and today over 80 % of all S. aureus strains are
resistant to penicillins. The next drug to be introduced for treating infections
with S. aureus was the semisynthetic, penicillinase-resistant penicillin named
oxacillin or methicillin, but shortly after its introduction the first isolate with
resistance was detected (see text below) (Winn Washington 2006).
With the emergence of resistance to the penicillinase-resistant penicillins, the
glucopeptide agent vancomycin became the treatment of choice for infections
with MRSA, and in 1996 the first isolate with intermediate vancomycin
resistance was detected in Japan (Winn Washington 2006). So far, this has not
emerged to be a major concern, but the resistance has been detected in
different parts of the world and needs to be monitored.
Although resistance to methicillin is considered the most important for
S. aureus, other types of resistance exist. For example, a fusidic acid-resistant
impetigo clone has caused infections around Europe. The antibiotic fusidic acid
is used to treat superficial skin infections caused by S. aureus, which include
impetigo and atopic dermatitis (Brown and Thomas, 2002), and the substance
has been in use since the early 1960s. Despite this, the resistance remained low
until the 1990s (Brown and Thomas, 2002). Through the last decade an
increase in prevalence of fusidic acid-resistant S. aureus has been seen in
northern Europe, and this resistance has been primarily associated with strains
causing impetigo bullosa (O'Neill et al., 2004; Osterlund et al., 2002; Tveten et
al., 2002). The resistance is a consequence of the recruitment of the fusB gene
(O'Neill and Chopra, 2006; O'Neill et al., 2004). Since fusidic acid is the primary
treatment for impetigo in many countries, this is likely to be the reason for the
success of this clone in causing disease.
The management with antibiotic-resistant bacteria of infections suffered by the
elderly living in nursing homes is something to take into consideration now and
in the future. For example, MRSA has become endemic in hospitals as well as in
health care settings globally (Chambers and Deleo, 2009; DeLeo and Chambers,
2009). Many nursing home residents have chronic and multiple diseases, and
therefore generally require constant medical care and significant assistance
with daily living. This causes the residents to be considered as unintentional
vectors disseminating pathogens between hospitals and nursing homes but
also the other way around (Bonomo, 2000; Chamchod and Ruan, 2012). So far
this does not seem to be the case in Sweden, where the resistance in general is

11
 Introduction

low and no increase in resistance has been detected for S. aureus isolated from
nursing home residents (Olofsson et al., 2012; Olofsson et al., 2013).
For over 10 years, Swedish laboratories have reported results on the resistance
of S. aureus and other bacteria to a national database ResNet
(http://www.srga.org/ResNet_sok.htm). For S. aureus, information about
resistance to cefoxitin, erytromycin, clindamycin, fusidic acid, gentamicin and
norfloxacin has been registered. The rates for 2010 and 2011 are shown in
Figure 1. When comparing antibiotic resistance between European countries,
Sweden is among those with the lowest rates and France, Belgium and Austria
are those with high resistance for some of the agents (den Heijer et al., 2013).

Figure 1. Resistance of S. aureus in Sweden among isolates from skin and wound infections.
The information is taken from the Swedish Institute for Communicable Disease Control.
(Statistik fr Staphylococcus aureus. www.smittskyddsinstitutet.se/statistik/staphylococcus-
aureus/ [2013-06-19]).

12
 Introduction

Methicillin-resistant Staphylococcus aureus

The massive consumption of antibiotics over the past 50 years has led to the
selection of drug-resistance among S. aureus strains, and by far the most
important is the resistance against methicillin. In 1961, methicillin (celbenin)
became available for treatment of penicillin-resistant S. aureus strains. Only six
months thereafter, the first methicillin-resistant S. aureus was detected and
nosocomial infections began to increase, and in Sweden efforts to combat the
spread were established. In the 1980s the detection of MRSA isolates suddenly
increased, and a few strains began to expand worldwide (Chen et al., 2012).
MRSA is now a leading cause of nosocomial infections worldwide and has also
emerged as a community-associated pathogen (Chambers and Deleo, 2009).
MRSA strains are inherently cross-resistant to virtually all beta-lactam
antibiotics, the most effective and widely used class of antimicrobials.
Moreover, in many countries clinical strains are quite often multi-resistant,
which significantly reduces the therapeutic options for treatment of
staphylococcal infections (Oliveira and de Lencastre, 2011).
The resistance mechanism against methicillin involves the acquisition of the
mecA gene, which is a determinant of a unique penicillin binding protein,
(PBP)2a, that has reduced affinity for -lactames, including cephalosporins
(Hartman and Tomasz, 1981; Song et al., 1987). The expression of PBP2a causes
resistance to all -lactam antibiotics as the protein blocks binding at the active
site for -lactams (Fuda et al., 2005a; Fuda et al., 2005b). mecA is inserted in a
large heterologous chromosomal cassette, the SCCmec element (Ito et al.,
1999).
In the first international molecular epidemiological study of MRSA, it was
discovered that only a few MRSA lineages were responsible for MRSA
infections in hospitals located in Europe, the USA and the Far East (Oliveira et
al., 2002). Later studies have confirmed these results (Enright et al., 2002). In a
recent European study, the prevalence of MRSA, in blood stream infections
varied between 0.5 and 30.2 % in the different participating countries (ECDC).
This was in contrast to the low prevalence of MRSA in the general healthy
population, where the rates did not exceed 2.1 % (den Heijer et al., 2013).
To prevent further spread of MRSA in Sweden, a nationwide surveillance
program was launched. All hospitalized patients at risk of carriage of MRSA (i.e.
known carriage of MRSA, hospital care outside the Nordic countries, or hospital
care in connection with an ongoing outbreak) are screened for the presence of
MRSA and other multi-resistant bacteria. Confirmed carriers of MRSA must be
isolated and contact tracing is performed around this individual.

13
 Introduction

All new cases of MRSA are reported to the Department for Control of
Communicable Diseases in the county as well as to the Swedish Institute for
Communicable Disease Control (since 2000) where the newly discovered
isolates must be sent for national epidemiological surveillance.

Virulence factors and strategies

Various virulence factors contribute to the ability of S. aureus to cause infection
(Figure 2); enzymes (Table 1), toxins (Table 2), adhesion proteins, cell-surface
proteins, factors that help the bacteria to evade the innate immune defense,
and antibiotic resistance mediate survival of the bacteria and tissue invasion at
the site of infection (Zecconi and Scali, 2013). Moreover, certain toxins cause
specific disease entities.

Figure 2. A selection of Staphylococcus aureus virulence factors.

14
 Introduction

In the case of severe S. aureus disease, the infection may not be explained by
the action of a single virulence factor, and it is likely that a number of different
factors operating together in the pathogenic process. This assumption is
supported by studies in animal models where the infection caused by a mutant
isolate, deficient in a single virulence determinant, is compared with the
infection caused by the wild type strain. These studies have indicated a
decrease in severity of the infection (Hienz et al., 1996; Moreillon et al., 1995).
The survival of S. aureus in the host is important for pathogenesis. The bacteria
may be protected by a polysaccharide capsule that inhibits opsonization by
complement and thereby escapes phagocytosis (O'Riordan and Lee, 2004). It
may also secrete cytolytic toxins and tissue-cleaving enzymes (Dinges et al.,
2000). Moreover, S. aureus may expresse a multitude of adhesion factors that
mediate interactions with host cells and extracellular matrix (ECM), allowing
efficient colonization (Chavakis et al., 2005; Foster and Hook, 1998). S. aureus
has developed strategies against the antimicrobial peptides, the complement
system, and the recruitment and actions of phagocytes (Chavakis et al., 2007)
all of which are strategies against the innate immune response of the host
(Foster, 2005; Rooijakkers et al., 2005).

15
 Table 1. Selection of common enzymes regarded as S. aureus virulence factors.
Virulence Enzymatic function Effect as virulence factor in host Reference
factor
Catalase Deactivates free hydrogen peroxide Has been shown to be essential for nasal (Chavakis et al.,
colonization 2007; Cosgrove et
al., 2007)
Coagulase Binds to protrombin and thereby becomes Catalyzes the conversion of fibrinogen to fibrin (Kawabata et al.,
enzymatically active Coating the bacteria with fibrin and makes them 1986)
resistant to opsonization and phagocytosis

Hyaluronidase Degrades hyaluronic acid in connective tissue May convert local tissue into nutrients required for (Dinges et al., 2000;
Hydrolyzes the intracellular matrix of acid bacterial growth Winn Washington
mucopolysaccharides in tissue and, thus may 2006)
act to spread the organisms to adjacent areas
in tissue

Nuclease Exonuclease and endonuclease activity Contributes to evasion of neutrophil extracellular (Berends et al.,
traps 2010; Cheung et al.,
May degrade host tissue into nutrients required for 2004; Dinges et al.,
bacterial growth 2000)

Protease Degrades human fibronectin, fibrinogen and May contribute to the ability of S. aureus to (Imamura et al.,
kininogen disseminate in host 2005; Massimi et al.,
Cleves human 1-protease inhibitor, the Aids in tissue invasion 2002; Potempa et
heavy chain of all human immunoglobulin al., 1986; Prokesova
classes and elastin et al., 1992)

16
 Selection of common enzymes regarded as S. aureus virulence factors (continued).

Staphylokinase Plasminogen activator that converts Neutralizes the bactericidal effect by forming (Chavakis et al.,
plasminogen to a serine protease, plasmin complex with -defensin. 2007; Koch et al.,
More than 67% of S. aureus strains express May cleave complement factor C3 2012; Lahteenmaki
the gene for staphylokinase et al., 2000;
Controls fibrinolysis
Rooijakkers et al.,
The bacteria exploit the proteolytic activity of 2005; Zecconi and
plasmin to degrade components of ECM as well as Scali, 2013)
fibrinogen for dissemination in the host

17
 Table 2. Selection of exotoxins regarded as virulence factors of S. aureus.
Virulence Function Virulence effect on host References
factor
Exfoliative Glutamate-specific serine proteases that The ETA and ETB are the two most important (Becker et al., 2003;
toxins digest desmoglein 1, a keratinocyte cell-cell isoforms and they are associated with Kato et al., 2011;
adhesion molecule. staphylococcal bullous impertigo and staphylococcal Peacock et al., 2002;
scalded skin syndrome Sila et al., 2009;
Exfoliative toxins (ETs) act as molecular Zecconi and Scali,
scissors facilitating bacterial skin invasion ETA ETB ETC (not associated with human disease) 2013)
and ETD
Prevalence of eta and/or etb range from 0.5-3
% in MSSA but 10 % of MRSA strains have Mediate superantigen activity
been found to be eta positive

Hemolysins Pore forming toxin with cytolytic effect on The vast majority of the hemolysins are hemolytic (Chavakis et al.,
erythrocytes and monocytes (toxin) 2007; Zecconi and
-toxin has pro-inflammatory properties on host Scali, 2013)
Cytolytic activity on cytokine containing cells
( hemolysin also known as
sphingomyelinase C)

Neutrophil and monocyte binding

( hemolysin)

18
 Selection of exotoxins regarded as virulence factors of S. aureus (continued).

Leukocidines A bi-component pore-forming leukotoxin. Kills leukocytes (Chavakis et al.,

Consists of one class S protein and one class F 2007; Grumann et
protein. The subunits form a ring with a PVL stimulates and lyses neutrophils and al., 2013; Kaneko
central pore, through which cell contents leak macrophages and Kamio, 2004)

Different members of the group are - -toxin is hemolytic

hemolysin (hlg), Panton-Valentine leukocidin
(PVL) and Leukocidins D, E, M (LukD, LukE,
LukM)

Staphylococcal Gastroenteric toxicity; immunomodulation Causes food poisoning (Chavakis et al.,

enterotoxins via superantigen activity 2007; Pinchuk et al.,
At least 20 serologically different staphylococcal 2010; Zecconi and
superantigens have been described, including SEs A Scali, 2013)
to V

Toxic shock Toxic for endothelium, direct and cytokine- The toxin causes the rare condition toxic shock (Chavakis et al.,
syndrome mediated syndrome (TSS) 2007; Peacock et al.,
toxin 2002; Zecconi and
Mediate superantigen activity These infections are characterized by a rapid onset Scali, 2013)
with high fever, rash, vomiting, diarrhea and multi-
organ failure

19
 Introduction

Adhesion to host
S. aureus expresses several adhesion factors that mediate interactions with
host cells and ECM, and that allow efficient colonization (Figure 3) (Chavakis et
al., 2005; Foster and Hook, 1998). More than one staphylococcal adhesin
usually recognizes a single host ECM component. These adhesins can be
classified into two groups: microbial surface components recognizing adhesive
matrix molecules (MSCRAMMs) (Table 3), and secreted expanded repertoire
adhesive molecules (SERAMS) (Table 4). The major components of
MSCRAMMs, a family constituted of more than 20 members, are fibronectin-
binding proteins (FnBPs), clumping factors (Clfs), staphylococcal protein A (SpA)
and collagen-binding protein (Cbp) (Chavakis et al., 2007; Chavakis et al., 2005;
Foster and Hook, 1998; Mazmanian et al., 2000). SERAMs are a group of five
structurally unrelated secreted adhesins, including the fibrinogen-binding
protein (FBP) A, the coagulase (Coa), the extracellular fibrinogen-binding
protein (Efb), the ECM-binding protein and the extracellular adherence protein
(Eap) (Chavakis et al., 2005), which interact with a broad array of host ligands,
thereby mediating bacteria adhesion but also interfering with host defense
mechanisms (Chavakis et al., 2005).

Figure 3. Example of factors involved in the interaction between S. aureus and the host
cells.

20
 Table 3. Selection of S. aureus virulence factors involved in adhesion to host cells, MSCRAMMs.
Virulence Function Effect on host References
factor
Clumping- Platelet adhesion (fibrin-mediated) Virulence is likely to be increased by bacterial cells becoming (Josefsson et
factor ClfA is a fibrinogen-binding surface protein coated with fibrinogen which inhibits deposition of or access to al., 2008;
opsonins Moreillon et
It may activate serum complement al., 1995)
regulator factor I and convert C3b to iC3b Inactivation of complement factors also resulting in the loss of
and C3d the effect of the opsonin.

ClfA binds complement regulator factor I ClfA mutants are significantly attenuated in murine models for
sepsis and arthritis and in a rat endocarditis model
ClfB binds to cytokeratin 10

Collagen- Adhesin for collagen types I and IV Contributes to the development of septic arthritis (Chavakis et
binding al., 2007;
protein It has been shown that collagen is important in endocarditis, Peacock et al.,
not in the initial process but in the later state 2002)

Fibronectin- Adhesins for fibrinogen (FnBPA only), Adhesin for non-professional phagocytes such as epithelial and (Chavakis et
binding fibronectin and elastin endothelial cells, fibroblasts, osteoblasts and keratinocytes al., 2007; Flock
protein et al., 1987;
Peacock et al.,
2002)

21
 Selection of S. aureus virulence factors involved in adhesion to host cells, MSCRAMMs (continued).

Staphylococcal Binds the Fc- region of all human Inhibits phagocytosis (Goodyear and
protein A immunoglobulin (Ig)G subclasses except Silverman,
IgG3 Binds complement protein C3 and promotes C3-C3b 2003; Peacock
conversion et al., 2002;
Activates platelet aggregation via its Roben et al.,
binding to von Willebrand factor Spa has been shown to initiate staphylococcal pneumonia and 1995; Smith et
spa deficient mutants seem unable to form abscesses in mice al., 2011;
Binds complement protein C3 Zecconi and
Reduces TNF- pro-inflammatory signaling Scali, 2013)
Binds to tumour necrosis factor receptor
(TNFR)1, the receptor for tumour necrosis
factor (TNF)-

22
 Table 4. Selection of S. aureus virulence factors in the group of secreted expanded repertoire adhesive molecules
(SERAMs).
Virulence factor Function Effect on host References
Capsular Alter C3 (capsular polysaccharides Capsules enhance microbial virulence by rendering the (Chavakis et
polysaccharides (CPS)5 and 8) or C3b (CPS1) deposition bacterium resistant to phagocytosis and thereby contribute to al., 2007;
the bacterial persistence in the bloodstream of infected hosts O'Riordan and
Mask C3 (CPS5 and 8) and C3b (CPS1) Lee, 2004)
deposition Fewer complement molecules are able to bind to capsulated
bacteria, which has an antiphagocytic effect
Microorganisms that cause invasive
disease commonly produce extracellular The S. aureus capsules also promotes abscess
capsular polysaccharides

Coagulase Binds and activates prothrombin which Promote coagulation, through binding and activation of (Chavakis et
promotes conversion of fibrinogen to prothrombin al., 2007;
von Willebrand fibrin Cheng et al.,
factor binding The generation of fibrin peptides promotes clot formation. The 2011;
protein The staphylocoagulase-protrombin fibrin clot inhibit phagocytosis by preventing the penetration McAdow et
complex cleaves fibrinogen of phagocytic cells into the site of infection al., 2012)

Coagulase is an important factor in the formation of abscesses.

Abscess formation and blood coagulation cannot occur in
mutant mice lacking genes for both Coa and von Willebrand
binding protein (vWbp)

23
 Selection of S. aureus virulence factors in the group of secreted expanded repertoire adhesive molecules (SERAMs) (continued).

Extracellular Binds to plasma proteins such fibrinogen, Enhances the binding and internalization of S. aureus into (Chavakis et
adhesion fibronectin and protrombin eukaryotic cells al., 2007;
protein Edwards et al.,
Strong interaction between Eap and the May inhibit the binding of leukocytes (T-cells) to activated 2012; Haggar
intercellular adhesion molecule (ICAM)-1 endothelial cells and thereby inhibit the extravasation of et al., 2004;
in vitro leucocytes (monocytes and T-cells) from the bloodstream into Hussain et al.,
the site of infection 2008; Scriba et
Impairs angiogenesis and wound healing al., 2008)
The binding of Eap to ICAM-1 triggers the release of the pro-
Major histocompatibility complex II analog inflammatory cytokines TNF- and interleukin (IL)-6
protein; adhesion to S. aureus cells and
host cells; involved in biofilm formation Blocks neutrophils and T cell recruitment

The vast majority of S. aureus strains seem Inhibits MAP kinase phosphorylation
to secrete Eap but no other staphylococci
Inhibits delayed-type hypersensitivity
Binds to ECM molecules

Binds to ICAM-1

Blocks the lymphocyte function-associated

antigen (LFA)-1 and ICAM-1 interaction

24
 Introduction

The host
Without a functional immune system, we could not resist infections for a long
period of time. Many microbes are pathogenic, and we are constantly in danger
of infections and diseases caused by them. The immunity may be innate or
acquired, and the innate immune recognition has been designed to
discriminate non-self from self with a limited number of recognition molecules.
In this way, virtually all bacteria, viruses, fungi and protozoa are recognized. To
become a pathogen, a bacterium has to be able to survive within a host. This
can be achieved by the acquisition of specific adhesion factors, adaption to
intracellular survival, or the development of a thick capsule.

Innate immunity
The innate immune system, also known as the non-specific immune system or
the first line of defense, is based on mechanisms and cells that defend the host
from infection caused by different microorganisms. The system acts in an
immunologically non-specific way. The innate immune system is available to
rapidly protect the host from foreign invaders in contrast to the adaptive
immune system, which requires days to weeks to become active for the first
time of recognition. The function of the innate immunity includes several
factors and mechanisms such as physical and chemical barriers to infectious
agents represented by skin and mucosal membranes, as well as recruitment of
inflammatory cells to the site of infection through the production of cytokines.
Furthermore, other included mechanisms are activation of the complement
cascade, the activation of cells for phagocytosis, which clears cell debris and
antigen-antibody complexes, and the activation of the adaptive immune
system through antigen presentation by macrophages and dendritic cells (Coico
Richard 2009; Doan Thao 2013; Peter, 2006).
The physical barriers are the epithelial surfaces of the skin, the epithelium of
the mucosa membranes of, for example, the gastrointestinal and respiratory
tracts where cilia help remove infectious agents. Also, mucus at different sites
of the body is a protection against infectious agents. There are also chemical
and environmental barriers such as the acidic pH of the skin, stomach and
vagina. Molecules such as defensins, RNases, DNases and lysozyme, secreted
by various cell types, also serve as environmental barriers. Another kind of
barrier is the biological barrier consisting of commensal microbes. Commensal
microbes are those that exist in a symbiotic relationship with the body on the
skin and in the gastrointestinal tract. Microbes in these tracts defend their

25
 Introduction

territory and inhibit the establishment of potentially pathogenic microbes

(Doan Thao 2013).
The complement system, also a part of the innate immune system, is a
biochemical cascade that supports clearing of pathogens. The cascade is
composed of a series of pro-enzymes and related factors that sequentially
activate each other, resulting in the production of a variety of biologically
active proteins. The proteins trigger the recruitment of inflammatory cells, and
"tag" pathogens for destruction by other cells by opsonizing, or coating the
surface of the pathogen. Some of the proteins also increase vascular
permeability.
Cells belonging to the innate immune system include: natural killer (NK) cells,
mast cells, eosinophils, basophils and phagocytic cells, such as neutrophils,
macrophages and dendritic cells. These cells collectively perform two
important functions; they are able to recognize the presence of an unknown
invader, for example, a bacterial infection, and they provide an immediate
cellular response to the presence of an infectious agent. The nature of this
cellular response differs according to the nature of the cell and the way in
which it is stimulated (Peter, 2006).
The innate immune system recognizes the presence of pathogens by different
receptors on cells belonging to this defense system, and these cell surface
receptors are called pattern recognition receptors (PRRs). These receptors
recognize molecules that are mostly shared by pathogens but distinguishable
from host molecules, collectively referred to as pathogen-associated molecular
patterns (PAMPs). One important family of PRRs is the toll-like receptors (TLR),
which recognize a wide variety of pathogen-associated molecules. Different
TLRs are present on various immunological cells and they identify microbial
products such as double-stranded RNA found in viral infections,
lipopolysaccharide (LPS) present in Gram-negative bacteria, bacterial
lipoproteins, unmethylated DNA, and flagellin. After the recognition, a
response to eliminate or limit the spread of the pathogen within the host is
started with activation of phagocytosis and cytokine production to stimulate
other cells (Doan Thao 2013).
At the beginning of an infection, one of the PRRs recognizes a PAMP which
leads to the activation of the cell, thereby releasing inflammatory mediators
responsible for the clinical signs of inflammation such as pain, swelling, redness
and heat (Coico Richard 2009; Peter, 2006). This process is stimulated by
chemical factors released by affected cells. The aim of the inflammatory
response is to recruit cells which release factors into the bloodstream from
surrounding tissue to assist in the remove of pathogens, dead cells or damaged

26
 Introduction

tissue. Four important events occur during an inflammatory response to

promote this aim; vasodilation, activation of endothelial cells, increased
vascular permeability and production of chemotactic factors (Coico Richard
2009; Peter, 2006).
Vasodilation of the blood vessels increases the blood flow at the inflammatory
site, increasing the supply of cells and other factors to the area. Activation of
endothelial cells leads to increased expression of cell adhesion molecules,
promoting the migration of leucocytes from blood to tissue. Increased vascular
permeability makes it easier for cells and proteins to pass through the blood
vessel wall and enter the tissue. Chemotactic factors are produced that attract
cells into the tissue from the blood stream (Coico Richard 2009; Peter, 2006).
During inflammation, mast cells release chemical factors such as histamine,
bradykinin, serotonin, leukotrienes, and prostaglandins. These factors are
responsible for sensitizing pain receptors, cause prolonged vasodilation of the
blood vessels, and attract phagocytes, especially neutrophils. Neutrophils will
then trigger other parts of the immune system by releasing factors that recruit
other leukocytes. Cytokines are produced by macrophages and other cells of
the innate immune system and mediate the inflammatory response (Figure 4)
(Lotze and Tracey, 2005).

27
 Introduction

Figure 4. Overview of the innate immune response associated with a bacterial invasion.
(Modified picture from TRENDS in Immunology)

Endothelial cells
The endothelium consists of a thin layer of cells that lines the inner surface of
blood vessels and lymphatic vessels. It is an interface between circulating blood
or lymph in the lumen and the rest of the vessel wall. The cells that form the
endothelium are called endothelial cells (ECs). ECs in direct contact with blood
are called vascular ECs, whereas those in direct contact with lymph are known
as lymphatic ECs. The EC surface in an adult human is composed of
approximately 1 x 1013 to 6 x 1013 cells and it covers a surface of approximately
1 to 7 m2. ECs line vessels in every organ system and regulate the flow of
nutrients, biologically active molecules and all kinds of different blood cells.
The endothelium acts through the presence of membrane-bound receptors for
different kinds of molecules including proteins, as well as through specific
junctional proteins and receptors that control cell-cell and cell-matrix
interactions (Cines et al., 1998).

28
 Introduction

ECs are involved in many aspects of vascular biology. They act as a semi-
selective barrier between the vessel lumen and surrounding tissue, they control
the passage of different kinds of chemical factors, and they are central in the
extravasation of white blood cells from the bloodstream. Furthermore, the
endothelium has a function in coagulation. ECs normally provide a non-
thrombogenic surface because they contain, for example, heparan-sulfate
which acts as a cofactor for activating antithrombin, a protease that inactivates
several factors in the coagulation cascade.
Another important function of the ECs is their role in cell migration from the
blood stream to the surrounding tissue. This is a strictly controlled process so
that the cells only go where they are required. One important factor for
controlling this migration is adhesion molecules, present on leucocytes and
ECs, and it is the interaction between these cells that enables the migration of
leucocytes across the endothelium. There are many different adhesion
molecules which are represented by four families; selectins (leucocytes and
ECs), integrins (leucocytes), mucin-like vascular addressins (leucocytes and
some ECs), and members of the immunoglobulin superfamily (expressed on
ECs). Different adhesion molecules bind to each other in a specific manner,
which leads to a cell-cell interaction between leucocytes and ECs. Adhesion
molecules are expressed on different cell types; some are expressed constantly
on the cell surface and others are induced by cell activation, primarily by
cytokines. The process by which cells leave the bloodstream and cross the
endothelium to enter into various tissues is called extravasation. Extravasation
can be divided into three stages; rolling, activation and adhesion. In case of an
inflammation, vasodilatation occurs, leading to slower blood flow, and thereby
facilitates the leucocyte migration. Inflammatory mediators such as TNF-
activate ECs and stimulate the expression of E-selectin and P-selectin on the
surface of ECs. These molecules bind to sialyl-Lewisx on neutrophils and
contribute to the rolling. When the leucocytes have started to roll they have
become ready to adhere strongly to the ECs by release of IL-8 from ECs. This
procedure is performed with the binding between LFA-1 on the surface of
neutrophils and ICAM-1 on the ECs. When the leucocyte is firmly attached to
the endothelium it squeezes between the ECs, making contact with the
basement membrane underneath. This process is poorly understood but
involves additional adhesion molecules. In inflamed tissue there will be a
gradient of molecules from both microorganisms and immune cells with
maximum levels at the center of the infection. The leucocyte will travel against
these gradients moving towards the increasing concentrations of molecules
such as LPS, complement factor C5a and IL-8 (Peter, 2006).

29
 Introduction

Typing methods
To prevent and control outbreaks of S. aureus, and for epidemiological
investigations, appropriate typing methods are needed. Numerous methods,
both phenotypic and genotypic, have been used for the typing of S. aureus. In
the past, typing methods were based on phenotype characteristics, such as
serotype, biotype, phage-type or antibiogram, of which phage-typing was the
most common. Today these methods have been replaced with molecular
genotyping. The genotyping methods can be divided into sequence-based
(multilocus sequence typing [MLST] and staphylococcal protein A [spa] typing)
and non-sequence based (pulsed field gel electrophoresis [PFGE], restriction
fragment length polymorphism [RFLP]) (Mulligan and Arbeit, 1991). The various
methods differ in requirements of equipment and expertise and are also
different in cost-effectiveness. The most used methods for typing of S. aureus
are PFGE, regarded as gold standard, MLST and spa typing. The choice of
method depends on the problem to be solved and the epidemiological
situation in which the method is going to be used, as well as the time and
geographical extent of its use (David et al., 2013). Methods based on DNA
sequencing are objective and suitable for database analysis. Non-sequence-
based methods often involve subjectiv interpretations with comparison of gel
patterns and fingerprint images. Those image-based methods do not provide
reproducible biological criteria to evaluate the relatedness between different
strains, and it is difficult to maintain an international database and retrieval of
patterns for comparison between different laboratories (Sabat et al., 2013).
International harmonization of typing techniques is important to establish
surveillance networks for global epidemiological studies such as for MRSA
control.
The development of next generation sequencing will, in the near future, enable
whole genome sequencing (WGS) even in smaller research and clinical
laboratories, and may be used in outbreaks and in epidemiological
investigations (Pallen et al., 2010; Sabat et al., 2013).
Molecular fingerprinting is the basis of a group of molecular methods aimed at
generating a fingerprint of an unknown microbial community or an individual
strain and in the past 20 years, several methods based on the direct
amplification and analysis of the 16S ribosomal RNA gene have been
developed. Methods included in this group are denaturing gradient gel
electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE),
single-strand conformation polymorphism (SSCP), and terminal RFLP (tRFLP)
(Su et al., 2012). We have adapted one of these methods, DGGE, to distinguish

30
 Introduction

different clones of S. aureus based on the spa gene since the 16S rRNA gene is
not sufficiently discriminatory.
One issue connected to typing of different bacterial isolates is that the concept
of a strain or a clone is not fully defined. (Dijkshoorn et al., 2000; Tenover
et al., 1995). The problem is that the definition of a clone or strain depends on
the discriminatory power of the test and/or on the number of different tests
applied (Monecke et al., 2011). If type specified in connection with the
method used to define the relatedness between the isolates is used (e.g spa
type, MLST type etc.), it will perhaps be less confusing.

Conventional typing method

Phage typing
Until the beginning of the 1990s, phage typing was the main method used for
typing of S. aureus to discriminate among strains related to outbreaks. This
method is based on virus infecting bacteria called bacteriophages that are able
to infect S. aureus, and some of them can only infect a single strain of that
species (Bannerman et al., 1995). The bacterial isolate is grown on an agar
plate. Inoculation of different phages on the agar surface is then performed.
After incubation the susceptible phage regions will show a clearing where the
bacteria have been lysed and this is used to differentiate the staphylococcal
isolates from each other (Blair and Williams, 1961).
This method had several weaknesses such as: characterization of phenotypic
markers has poor reproducibility, it is not possible to type all isolates, and due
to the large number of phages stocks needed, only a few reference laboratories
could use the method (Bannerman et al., 1995).
When PFGE, the first molecular method to be used for epidemiological
investigations of S. aureus, was compared with phage typing, PFGE was found
to be better than phage typing at distinguishing epidemiologically related
strains from unrelated strains. In addition, it was found that all strains were
typable with PFGE (Bannerman et al., 1995).

31
 Introduction

Molecular typing methods

Pulsed field gel electrophoresis
PFGE has so far been regarded as the gold standard for molecular typing of
S. aureus. In the 1990s, this method replaced phage typing as a tool in
outbreaks and epidemiological investigations and has since become one of the
most used methods for typing of different bacteria (Sabat et al., 2013).
In PFGE, highly purified genomic DNA from bacterial isolates is digested with
rare-cutting restriction enzymes that cut in given sites within the genomic
sequence, resulting in fragments of different sizes (50 000-250 000 base pairs
[bp]). The restriction fragments are comparable large (hundreds of thousands
of bp), which may be separated on an agarose gel by pulse field
electrophoresis, in which the orientation of the electric field across the gel is
changed periodically. The separated fragments are then visualized as bands on
the agarose gel after staining with a DNA binding dye. The bands form a
specific band pattern, which may be compared to other patterns from different
isolates (Buckingham Lela 2007).
PFGE has a high discriminatory power and a wide typeability (high
epidemiological concordance) since S. aureus isolates and nearly all strains are
typable by this method (Bannerman et al., 1995; Mehndiratta and Bhalla,
2012). This method also addresses a large portion of an investigated genome
(90 %) (Buckingham Lela 2007; Sabat et al., 2013). Another advantage is that
large fragments are separated, resulting in relatively few bands in the gel,
which facilitates the interpretation of the results (Sabat et al., 2013). Criteria
for PFGE pattern interpretation which can be used to facilitate the assessment
of the results have been produced (Tenover et al., 1997; Tenover et al., 1995).
The disadvantages of PFGE are that it is technically demanding, labor-intensive
and time-consuming. It may require three to four days to complete one
analysis (Bannerman et al., 1995). It is also difficult to distinguish bands of
nearly identical size. The evaluation depends on the judgment of the observer
and there are difficulties comparing results between different laboratories
(Buckingham Lela 2007; Olive and Bean, 1999; Sabat et al., 2013). In inter-
laboratory studies the results have shown widely discrepant results (Cookson et
al., 1996; Mulvey et al., 2001; van Belkum et al., 1998). PFGE may also
overestimate the genetic differences, and it has been reported that PFGE
results have insufficient stability in long-term epidemiological surveillance, due
to the long evolutionary history of pandemic clones (Hallin et al., 2007; Melles
et al., 2007).

32
 Introduction

The technique has been compared to other techniques in various studies and
has been found useful in the characterization of outbreak strains (Bannerman
et al., 1995; Cookson et al., 1996; Hallin et al., 2007; Melles et al., 2007).

Multilocus sequence typing

MLST characterizes bacterial isolates after amplification of different
housekeeping genes. It is based on the principles of phenotypic multilocus
enzyme electrophoresis (Selander et al., 1986), which depends on the
difference in electrophoretic mobility of enzymes present in a bacterium. The
first developed MLST method was for typing of Neisseria meningitides (Maiden
et al., 1998) and has since then become a popular tool for epidemiological
studies of many different bacterial species and for studies of the molecular
evolution of different pathogens (Enright et al., 2000; Jones et al., 2003;
Maiden et al., 1998; Sabat et al., 2013).
The bacterial housekeeping genes are essential and therefore present in the
genome of all S. aureus strains. The housekeeping genes provide reliable
information about the relationship between isolates, since they are not
subjected to selective forces, and thereby change slowly. Mostly, seven
housekeeping genes are sequenced over approximately 450-500 bases and the
sequences are assigned as alleles. An isolate type, called the sequence type
(ST), is a collection of all seven alleles (Figure 5), the profile of the alleles and an
MLST clone are defined as a set of isolates with identical sequences at all seven
loci (Buckingham Lela 2007; Enright et al., 2000).

33
 Introduction

Figure 5. Description of the performance of an MLST analysis.

The advantage of this sequence-based method is that there is a standardized

nomenclature and the allele sequences and ST profiles are available in large
global databases, facilitating the communication of results between different
laboratories. Also, reproducibility is high and primer sequences and protocols
may be standardized and are electronically available.
The disadvantage is that the technique is expensive, labor-intensive and time
consuming, due to include a number of various gene targets (Birtles et al.,
2005; Rakeman et al., 2005; Sabat et al., 2013).
MLST may be used to investigate evolutionary relationships among bacteria
and it provides good discriminatory power to differentiate isolates
(Mehndiratta and Bhalla, 2012). The technique has also been used to identify
livestock-associated MRSA strains and their transmission between humans and
animal species (Cuny et al., 2010). When comparing MLST with other
techniques like PFGE and spa typing, a good agreement between results
obtained by the different methods has been reported (Cookson et al., 1996;
Hallin et al., 2007; Melles et al., 2007; Strommenger et al., 2006).

34
 Introduction

spa typing
spa typing represents the group of methods designated single-locus sequence
typing, which means that sequence variations of a single target gene are
compared. The genes selected are usually of short sequence repeat regions
that are sufficiently polymorphic to provide useful resolution (Mehndiratta and
Bhalla, 2012). The spa gene of S. aureus harbors a variable number of tandem
repeats in the 3coding polymorphic X region of the protein A gene (Figure 6).

Figure 6. Description of the staphylococcal protein A gene (modified from Current Opinion
in Microbiology (Kim et al., 2012)).

The X region consists of repeated units, 21 or 24 bp long. The sequence of

these repeated units varies in at least one bp (Table 5a) and to this date, 601
different repeats have been described (http://www.spaserver.ridom.de). The
variable part of the X region may have 2-16 repeats. The spa type is deduced
from the order of specific repeats and is associated with a figure (Table 5b)
(Buckingham Lela 2007; Sabat et al., 2013; Shopsin et al., 1999).

35
 Introduction

Table 5a. Sequences of different repeats.

Repeat Sequence

r16 AAAGAAGACGGCAACAAACCTGGT
r17 AAAGAAGACGGCAACAAGCCTGGT
r20 AAAGAAGACAACAACAAACCTGGC
r23 AAAGAAGACGGCAACAAACCTGGC
r26 GAGGAAGACAACAAAAAACCTGGT
r34 AAAGAAGACAACAAAAAACCTGGT

Table 5b. Repeat succession of different spa

types.
spa types Repeat succession

t002 26-23-17-34-17-20-17-12-17-16
t008 11-19-12-21-17-34-24-34-22-25
t015 08-16-02-16-34-13-17-34-16-34
t069 08-16-02-16-34-13-17-34-16-16-34
t097 07-23-12-12-23

spa typing is a cost effective method compared to other molecular typing

methods, and it has a rapid turn-around time. It is stable, easy to use and has
high reproducibility. There is also a standardized international nomenclature
which facilitates communication of results. The sequence results are reported
to an international database from which you receive the spa type. In this
database you may learn if a certain spa type has been identified in other
hospitals or countries and how common it is. The level of the discriminatory
power makes it suitable for local short-term outbreaks.
A disadvantage of this method is that it is based on single-locus typing and
therefore may misclassify particular types due to recombination and/or
homoplasy (Sabat et al., 2013). MRSA isolates lacking the spa gene have been
described and spa typing could not be used for these strains (Baum et al.,
2009).

36
 Introduction

The advantages of this method make it currently the most useful for
characterizing S. aureus isolates at the local, national and international levels
(Friedrich et al., 2008; Grundmann et al., 2010; Hallin et al., 2007; Harmsen et
al., 2003; Melin et al., 2009). Strommenger et al. reported the spa typing
technique to be an excellent tool for national and international surveillance as
well as for short-term local epidemiology. However, additional markers may be
needed to overcome its limitations as a single-locus typing method (Hallin et
al., 2007; Strommenger et al., 2006).

Terminal restriction fragment length polymorphism

tRFLP is based on PCR amplification of a target gene, and the amplification is
performed with one or both of the primers having a fluorescent molecule
labeled at their 5 end. In case both primers are labeled, different fluorescent
dyes are required. The mixture of amplified PCR-products is then digested with
restriction enzymes. The restricted fragments are separated by the use of
sequencing equipment. The terminal fragments are determined in a
fluorescence detector. As only one part of the digested PCR fragments are
labeled, only the terminal fragments are determined while all other fragments
are ignored. Thus, tRFLP is different from RFLP in which all digested fragments
are visualized. The result of a tRFLP is often visualized as an intensity plot called
an electropherogram. In an electropherogram the X-axis marks the sizes of the
fragments while the Y-axis marks the fluorescence intensity of each fragment.
tRFLP has commonly been used to study the diversity of different bacteria in a
variety of communities but it has also been modified to distinguish different
isolates of S. aureus based on amplification of the coa or the spa gene
(Mehndiratta and Bhalla, 2012; Mehndiratta et al., 2009). Since RFLP mostly
has been used in studies of different microbial communities there is very few if
any comparative studies with other typing methods for S. aureus.
One disadvantage of tRFLP is that different bacteria might give
indistinguishable patterns in the electropherogram due to the presence of a
restriction site in the same position as the PCR product. This may be overcome
by digestion in parallel by several enzymes or by labeling of both the primers
with different fluorochromes (Buckingham Lela 2007; Liu et al., 1997). RFLP is
also technically demanding and great efforts must be put into the design of the
assay, as rare polymorphisms have been reported to confound RFLP results
(Gold et al., 2001).

37
 Introduction

Denaturing gradient gel electrophoresis

DGGE (Figure 7) was originally performed on restriction fragments to detect
gene mutations (Buckingham Lela 2007). This method was then further
developed to study the genetic diversity of complex microbial populations by
separation of amplified products from the 16S rRNA gene (Muyzer et al., 1993).

Figure 7. Flow scheme of the procedure for the DGGE-analysis.

The method is based on the possibility of detecting differences in the

denaturation of molecules with different sequences and the technique allows
the detection of differences as small as one nucleotide. The difference in
binding power between bp on the DNA strand affects the denaturation
properties of double-stranded (ds) DNA. For DGGE, dsDNA fragments, 200-700
bp in length, are prepared by PCR amplification or by restriction digestion. The
products are then separated on polyacrylamide gels containing a denaturing
gradient of urea and formamid (Figure 8). As the dsDNA fragments move
through the gel, the denaturing conditions increase with higher concentrations
of urea and formamid. At a given concentration, a sequence reaches its
38
 Introduction

denaturing point and the strands begin to separate (melt). Domains of different
sequences, with different melting characteristics, separate at different points in
the gradient. This results in different lengths of migration in the gel. Complete
strand separation is prevented by naturally occurring or artificially placed GC-
rich sequences (GC-clamps). These may be conveniently placed at the ends of
PCR products by using primers tailed on the 5 end with a 40 bp 5 GC tail
(Buckingham Lela 2007; Fischer and Lerman, 1983). Like tRFLP, DGGE could also
be adapted to separate isolates of S. aureus based on amplification of the spa
gene (Matussek et al., 2011).

Figure 8. The principle of DGGE. A: Description of the gradient gel. B: Description of melted
DNA. Large molecules migrate slower in the gel than small molecules.

39
 Introduction

Microarray
Microarray for bacterial typing can be carried out on a chip with a collection of
DNA probes attached to a solid surface in a particular pattern. These probes
detect complementary nucleotide sequences in different bacterial isolates. The
array is constructed to detect genes that serve as markers for specific bacterial
strains, or to detect allelic variants of a gene that is present in all strains of a
particular species. The probes in the array may be cDNA, PCR products (>200
bp) or oligonucleotides (up to 70 bp). A common procedure is that total DNA is
extracted from the bacterium of interest. This target DNA is then labeled,
either chemically or by an enzymatic reaction, and is then hybridized to the
array. Unbound target DNA is removed during the following washing steps with
buffers of different concentrations. The signal from a successful hybridization
between the labeled target DNA and an immobilized probe is measured
automatically. The data produced are then analyzed using dedicated software
(Buckingham Lela 2007; Sabat et al., 2013).
DNA microarrays appear to be very well suited for bacterial typing, and
microarrays are currently widely used to analyze genomic mutations, such as
single-nucleotide polymorphisms. In addition, microarray technology is an
efficient tool for the detection of extra-genomic elements (McCarthy et al.,
2012; McCarthy and Lindsay, 2012). One advantage of microarrays is that
pathogens may be simultaneously genotyped and profiled to determine their
antimicrobial resistance and virulence potential (Buckingham Lela 2007; Sabat
et al., 2013). The whole genome microarray approach is a useful alternative to
whole genome sequencing and saves time, effort and expense, and it may be
used in real-time outbreak investigations (Sabat et al., 2013).
One disadvantage is that microarray analysis does not allow the identification
of sequences which are not included in the array (Sabat et al., 2013).

40
 Table 6. Comparison between different typing methods for S. aureus.
Method Used/Suitable for Advantages Disadvantages Comments
Denaturing Detection of Can separate sequences Time consuming Has not yet fully been (Matussek et al.,
gradient gel simultaneous of the same length evaluated in clinical 2011)
electrophoresis colonization with Low throughput situations
different strains

Microarray May be used in real- Distinguishes between Needs specialized Commercial test is now (Sabat et al.,
time outbreak very similar but non- equipment available but the 2013)
investigations identical sequences reproducibility within
High cost of materials and and between different
instruments laboratories needs to be
established

Multilocus Long-term Defines core genetic Time consuming For short-term outbreak
sequence epidemiology populations situations MLST has only (Sabat et al.,
typing Low throughput moderate 2013; Stefani et
Evolutionary studies Highly reproducible within discriminatory power al., 2012;
and between laboratories High cost Struelens et al.,
2009)
Standard nomenclature Limited discriminatory Enright 2002,
power Robinson 2003
The method may be used
for other pathogens as
well

41
 Comparison between different typing methods for S. aureus (continued).

Pulsed field gel Has been Highly discriminatory Time consuming Reproducible within the (Sabat et al.,
electrophoresis considered as gold laboratory but not 2013; Struelens et
standard for typing May be used for other Technically demanding between laboratories al., 2009)
S. aureus(MRSA) in pathogens as well
Low-throughput ST398 non-typable by
outbreak situations
Multiple nomenclature standard protocol
Local outbreak
investigations and Misclassification of some
as part of typing lineages
system for long-
term surveillance at
regional and
national level

Staphylococcal First line outbreak Time effective in Misclassification of a small Has become the primary (Hallin et al.,
protein A situations transmission studies number of lineages typing method for 2007; Sabat et al.,
typing regional and national 2013; Stefani et
Short term local High throughput May require MRSA surveillance al., 2012;
epidemiology complementary typing of schemes Strommenger et
Standard nomenclature other methods
Local surveillance al., 2006;
Easy to share and Not for globally Struelens et al.,
and infection Only used for typing of distributed spa types
control purposes compare sequence results S. aureus 2009)

National Highly reproducible

surveillance within and between
laboratories

Attributions of MLST STs

by BURP algorithm

42
 Comparison between different typing methods for S. aureus (continued).

Terminal Local investigation No information No information Not commonly used for (Mehndiratta et
restriction of isolates typing of S. aureus and al., 2009)
fragment therefore not compared
length with other mentioned
polymorphism methods

Whole genome Will become a Compares different Specialized equipment The challenge will be to (Pallen et al.,
sequencing powerful tool for genomes with a single- handle and analyze all 2010; Sabat et al.,
outbreak nucleotide resolution High cost the information and 2013)
investigations and there is a need for user-
surveillance Portable friendly informatics
schemes in routine platforms
clinical practice Easy to share and
compare sequence results Studies of the mode and
Evolutionary studies tempo of genomic
of pathogens in the May be used for all kinds evolution in different
short term and over of pathogens bacteria lineages must
longer time scales be performed

Investigation of how this

method works when
applied to real world
problems

43
 Introduction

Gene expression
Microarray
Microarrays for studies of gene expression are like arrays for genotyping, and
are also based on DNA/RNA-hybridization (Figure 9). cDNA (250-5000 bp) or
oligonucleotides (25-75 bp) corresponding to genes of interest, are attached to
a solid surface, usually glass or a silica surface. The RNA from the sample of
interest (cell cultures, tissue or blood) is reverse transcribed (RT) into cDNA,
and then possibly transcribed to cRNA with incorporation of a fluorescent dye.
The labeled cDNA/cRNA is then hybridized to the array. After stringent washing
the array is scanned in a confocal microscopy scanner.
This kind of analysis allows for simultaneous study of thousands of genes in a
single assay, e.g. all open reading frames in the human genome may be
detected. However, the complexity of such wide-ranging analysis makes
microarray more of a screening method. To verify differentially expressed
genes, quantitative real-time PCR may be used.

Figure 9. Example of a possible procedure to perform gene expression analysis by

microarray.

44
 Introduction

Real-time PCR
Since the introduction of PCR in 1988 (Mullis et al., 1986), its performance has
not changed significantly, even though it has been modified and improved over
the years. The greatest change has probably been the introduction of real-time
PCR in 1993 (Higuchi et al., 1993). In conventional PCR, you only evaluate the
end product of the PCR-reaction. In real-time PCR a fluorescent dye binds to
the amplified DNA at each cycle. The fluorescent signal is continuously
registered and is directly proportional to the amplified amount of DNA, which
allows interpretation of the reaction in real time. By the incorporation of a
standard with a known concentration of a target, it is possible to determine the
initial amount of a sample (Buckingham Lela 2007).
Real-time PCR has several advantages over traditional PCR. With real-time PCR
it is possible to detect smaller variations in target copies compared to
conventional PCR. Also, the quantitative detection range is much broader
compared to conventional PCR, where only the endpoint product is analyzed.
Nucleic acid amplification and detection are carried out in the same closed
vessel, thereby minimizing the risk of cross-contamination between analyses.
With continuous data collection, less time is required to obtain the result
compared to conventional PCR where agarose gel electrophoresis must be
performed to complete the analysis (Bustin, 2000).
Real-time PCR can also be used to investigate gene expression. As for
microarray, mRNA is used as starting material which requires a step of reverse
transcription before the PCR analysis. To study changes in gene expression in,
for example, stimulated cells, the expression are related to unstimulated cells.
In order to correct for variations in starting amount of sample, a reference
gene, a so-called, housekeeping gene is used for normalization. This gene
should be expressed at a constant level in all cells. However, this perfect gene
does not exist, so it is important to validate the reference gene to be used for
the experiment. There are different methods to quantify alterations in mRNA
levels using real-time PCR; the standard curve method (Larionov et al., 2005),
the Pfaffl method (Pfaffl, 2001) or the delta-delta ct method (Livak and
Schmittgen, 2001).
The standard curve method includes a set of standards, with known
concentrations, for the mRNA from both the target gene and the reference
gene. By use of the standards, the amount of target and reference mRNA can
be calculated. With this information it is possible to use the equation below
(Figure 10). The fold change (FC) (stimulated versus unstimulated cells) for the
target gene as well as for the reference gene is calculated and by dividing these
values the ratio for target gene expression is given.

45
 Introduction

With the Pfaffl method, the relative expression ratio is calculated only from the
real-time PCR efficiencies (E) and the threshold cycle (ct) deviation of, for
example, stimulated cells versus unstimulated cells (Figure 10). A standard
curve is only needed to determine an average efficiency of the assay both for
the target and the reference gene.
The delta-delta ct method was one of the first methods to be used for relative
quantification in combination with real-time PCR. However, optimal and
identical real-time amplification efficiencies of target and reference gene are
presumed in this method. The delta ct value between target and reference
gene of stimulated cells is calculated. The same calculation is performed for the
unstimulated cells. Finally the delta-delta ct value between stimulated and
unstimulated cells is calculated (Figure 10).

Figure 10. Different equations used to calculate relative quantities in gene expression
analysis.

46
 Aims

AIMS
The general aim of this thesis is to increase the knowledge of S. aureus
pathogenesis and to elucidate the pattern of colonization. The virulence of
S. aureus is studied by the interaction with human umbilical vein endothelial
cells (HUVEC) as a model. To contribute to better knowledge of S. aureus
colonization and spread in the community the spa type distribution, antibiotic
susceptibility, prevalence, and carriage, among nursing home residents is
studied and a method to assess multiclonality is developed.

The specific aims are:

x To evaluate the induction of gene expression in HUVEC by S. aureus
infection (Papers I and II).
x To explore possible differences in virulence between S. aureus isolates
from patients with septiceamia compared to commensal isolates. This is
done by:
a) exploring a possible difference in the ability of internalization,
intracellular survival and induction of apoptosis of S. aureus in HUVEC
(Papers I and II).
b) studying global gene expression patterns in HUVEC (Paper II).
x To investigate the presence of virulence genes in the two groups of
S. aureus isolates, by the use of DNA-based genotyping (Paper II).
x To study the epidemiology of S. aureus by molecular typing to explore
possible variations in its ability to colonize and spread. Swedish nursing
homes are used as a model, and the prevalence, carriage rate and issue
of multiclonality as well as the spatial and temporal spa type distribution
are evaluated (Paper III).
x To develop a denaturing gradient gel electrophoresis assay for S. aureus
utilizing spa to further characterize multiclonal colonization and infection
(Paper IV).

47
 Results and discussion

RESULTS AND DISCUSSION

Isolation and cultivation of S. aureus (papers I-IV)
In the first paper a clinical isolate of S. aureus, characterized in previous
studies, was used (Strindhall et al., 2002). This isolate was selected due to its
ability to induce high up-regulation of cell adhesion molecules and to highly
stimulate the production of cytokines in HUVEC without being cytotoxic. These
properties were important since we wanted to ensure we obtained a genetic
answer. When performing microarray analysis, large amounts of good quality
RNA are required, therefore a non-cytotoxic isolate was chosen.
In paper II, non-virulent isolates of S. aureus were compared with clinical
virulent isolates. Five randomly selected isolates from a collection of S. aureus
samples obtained from healthy male nasal carriers in a previous study
(Matussek et al., 2007), represented the non-virulent group. S. aureus isolates
obtained from blood cultures from five individuals without prior signs of
disease or infection (diabetes, endocarditis, drug addicts and persons who had
undergone surgery within the last three years were excluded) were included in
the virulent group. These isolates were selected from a study of personal
records. spa typing was performed to ensure that all isolates belonged to
different strains. All ten strains were also genotyped with a DNA-based
microarray to determine the presence of genes encoding virulence
determinants.
Prior to the array analysis, the bacterial isolates were lysed and treated with
proteinase K before purification of bacterial DNA. A multiplex PCR-reaction was
used for simultaneous amplification of all target genes, and PCR-products were
labeled by incorporation of biotin-16-dUTP. After denaturation, the products
were hybridized to the array. After washing and addition of a blocking reagent,
horseradish-peroxidase-streptavidin conjugate was added. This was followed
by incubation and washing. The array tube was placed in a reading device and
Seramun Green precipitating dye was added. An image of the array was
recorded and analyzed. Analysis of hybridization patterns indicated the
presence or absence of individual genes as well as the assignment of isolates to
clonal complexes or sequence types.
There was no difference in the presence of the selected virulence genes
between the two groups of colonizing and invasive strains (Table 7 and 8).
Thus, it seems that there is no difference in virulence between colonizing and
invasive strains. This is in line with studies showing that most of the isolates
48
 Results and discussion

causing invasive infections are recruited from the colonizing flora of the
anterior nares (Wertheim et al., 2005b; Wertheim et al., 2004; von Eiff et al.,
2001). This indicates that the risk of future infection cannot be predicted only
by characterizing a nasal isolate. The result of the interaction between bacteria
and the host is also dependent on host factors (van den Akker et al., 2006).
In paper III, samples from the anterior nares, the throat, the groin and from
active skin lesions (if any) were collected from individuals participating in a
study called SHADES (The Study of Health and Drugs among the Elderly in
Swedish Nursing Homes) (Ernsth Bravell et al., 2011). If possible, samples were
collected every six months during the study period. After the start of the study
it was discovered that throat sampling was very demanding and difficult to
perform in this group of elderly individuals and therefore it was problematic to
get throat samples on many of the occasions. All samples were cultured in an
enrichment broth for S. aureus before culture on blood agar plates or agar
plates selective for S. aureus.
In paper IV, clinical enrichment broth samples associated with an MRSA
outbreak were used together with isolates from a strain collection bank at the
Department of Microbiology at Ryhov County Hospital, Jnkping.

49
 Table 7. Presence of enterotoxin genes.
Isolate Tst1 seA seA seA seB seC seD seE seG seH seI seJ seK seL seM seN seO seQ seR seU/Y ORFC Etoxin
320E N315 M14 homolog
CI
CII
CIII
CIV
CV
BI
BII
BIII
BIV
BV
*308
gene not present, gene present, ambivalent result. Isolates designated B belong to the group of invasive isolates and isolates
designated C belong to the group of colonizing isolates. *Isolate used in paper I.

50
 Table 8. Presence of different genes representing other virulence determinants.
Leucocidines Bovine PVL Leucocidine Leucocidine homologes Hemolysine and staphylokinase
lukD/E
Isolate lukF lukS hlgA lukF- lukS- lukF- lukM lukD lukE lukX lukY lukY hl hla hlb sak hld Hl_III
PV PV P83 MRSA252
CI
CII
CIII
CIV
CV
BI
BII
BIII
BIV
BV
308*

ExfoliativeToxin Protease Epidermal cell differentiation inhibitors

Isolate etA etB etD splA aplB edinA edinB edinC
CI
CII
CIII
CIV
CV
BI
BII
BIII
BIV
BV
308*
gene not present, gene present, ambivalent result. Isolates designated B belong to the group of invasive isolates and isolates
designated C belong to the group of colonizing isolates.*Isolate used in paper I.

51
 Results and discussion

HUVEC as a model to study interactions with S. aureus

(papers I and II)

ECs located on the inner surface of blood vessels, are key effector cells and
activate the innate immune response. Innate immunity has an important role in
the defense against S. aureus infections through identifying the bacteria by
pattern recognition molecules, activating complement and phagocytosis
(Medzhitov and Janeway, 1998). In papers I and II, HUVEC was used as a model
to study the interaction of different S. aureus isolates with ECs. Human
umbilical cords were collected at the maternity ward at Ryhov County Hospital,
Jnkping. The umbilical cords were collected according to a modified protocol
from Jaffe et al. (Jaffe et al., 1973) in PBS pH 7.4 with ampicillin and
streptomycin and ECs were isolated within 72 hours. The vein was flushed with
PBS pH 7.4 before collagenase was inserted, and the cord was incubated at
37 C. After incubation, the cord was gently squeezed to loosen as many
endothelial cells as possible in the vein. The collagenase was then collected in a
tube and subsequently centrifuged. The cells were washed once with PBS
before being seeded into 25 mL culture flasks with cell culture medium. The
cells were incubated at 37 C in 5 % CO2. Within 2-3 days, the endothelial cells
became confluent with growth that formed a cobblestone-monolayer. The
passage of the cells was performed by trypsin/EDTA and the cells were used for
experiments in passage 2-3.
HUVEC was cultured in 6-, 12- or 24-well plates prior to the experiments and
grown to confluence. S. aureus isolates were cultured on blood agar plates and
the bacterial cells were suspended in PBS pH 7.4 to 0.5 McFarland and
incubated with HUVEC for 1h. Extracellular bacteria were then killed with
lysostaphin, and cell culture medium was added for indicated periods of times.
In both papers I and II an unphysiologically high number of bacteria (108
CFU/mL) was used to infect HUVEC. This concentration of bacteria was, in a
previous work (Strindhall et al., 2002), found to be optimal for activation of
HUVEC in this infection model. This can be compared with the number of
bacteria present in blood of patients with bacteremia which is often less than
10 CFU/mL (Reimer et al., 1997; Yagupsky and Nolte, 1990).
In papers I and II, the conditions for infection of HUVEC with S. aureus were the
same. After the infection period, HUVEC with internalized bacteria was
incubated for different periods of time. In paper I, the experiment was
performed after an incubation of 18 h, and in paper II the incubation time was
4 h only. The short period of incubation in paper II was chosen due to a
cytotoxic effect observed for some of the isolates after 6 h of interaction with
52
 Results and discussion

HUVEC. Cytotoxic damage may lead to destruction of RNA and hamper

microarray analysis. In paper I, a non-cytotoxic strain was used and for this
reason a longer incubation time could be used.

Internalization and survival of S. aureus in HUVEC (papers I and II)

In paper I, the adhesion and internalization of S. aureus to HUVEC was
examined using electron microscopy, the adherence was evaluated with field
emission electron microscopy, and internalization of bacteria was investigated
with transmission electron microscopy. The results showed that S. aureus
adhered to and was internalized into HUVEC. The bacteria cells were found in
endosomes and after 18 h of incubation, dividing bacteria were observed
(Figure 1 in paper I). The same result was observed in a study similar to ours
(Grundmeier et al., 2010). This indicates that S. aureus is an facultative
intracellular pathogen (Fraunholz and Sinha, 2012). In paper II the isolates
ability to adhere to ECs was examined with acridine orange staining. The ECs
were cultured on glass slides before infection with S. aureus. After washing,
adherent cells were stained with the DNA-binding dye and the results were
observed under fluorescence microscope. In both papers I and II, the
intracellular survival of internalized S. aureus was quantified with viable count.
The experiment was performed in triplicate wells in 24 well plates. The cells
were infected for 24, 48 and 72 h, respectively. After incubation, the cell
culture medium was cultured on blood agar plates. Adherent ECs were lysed
with a buffer that did not affect the bacteria, and then cultured on blood agar
plates after dilution. After overnight incubation for 24 h, the bacteria colonies
were counted. Three independent experiments were performed for each
strain. These experiments showed that all bacteria isolates used in papers I and
II survived for at least 72 h.
S. aureus has been described as an extracellular pathogen, although an
intracellular phase in S. aureus infections has been shown by the ability to
invade various cell types including ECs (Figure 11) (Grundmeier et al., 2010;
Ogawa et al., 1985; Vriesema et al., 2000). This ability was confirmed in our
studies (Figure 1 in paper I). An intracellular phase of S. aureus infection may
protect the bacteria from phagocytosis by professional phagocytes (Fraunholz
and Sinha, 2012) and may also protect the bacteria from antibiotics that are
unable to act intracellulary (Krut et al., 2004). From paper I it cannot be
concluded whether the pro-inflammatory response detected required the
internalization of S. aureus, or if the adherent bacteria were enough. However,
Beekhuizen et al (Beekhuizen and van de Gevel, 2007) concluded in a study on

53
 Results and discussion

the effect of interferon- on HUVEC-S. aureus interaction, that activation of ECs

is a consequence of interaction of S. aureus with the EC surface, rather than
result that occurs after bacterial internalization.

Figure 11. Scanning electron microscopy (performed by M. Rohde) shows adherence and
initial uptake of S. aureus into HUVEC after 1 h of incubation (paper I). HUVEC were cultured
on 12 mm cover glass in 24-well plates and incubated with approximately 1 x 107 CFU/mL of
bacteria in cell culture medium without antibiotics. White bar represent 1 m.

S. aureus induction of apoptosis in endothelial cells

(papers I and II)

After incubation of internalized S. aureus with HUVEC for different periods of

time, the cells or cell culture medium were prepared for the following analysis.
For the flow cytometry experiments on ECs, unattached cells in the medium
were collected by centrifugation. The monolayer of HUVEC in the wells was
treated with trypsin, and after they were detached, they were transferred to
new tubes. The pelleted cells from the same well were transferred to the
trypsonized cells from the same well. After washing, the ECs were marked with
different kinds of fluorochromes. For detection of apoptotic cells, Annexin V
antibodies conjugated with fluorescein isotiocyanate (FITC) were used and
propidiumiodide was added to detect necrotic cells. This experiment was done
on cells infected for 4, 8, 12 and 24 h, respectively. In paper I, no sign of
apoptosis was observed after 42 h of interaction with the non-cytotoxic strain
used. In paper II, six of ten strains (two colonizing and four invasive) induced
apoptosis after 12 and 24 h of incubation, but not after 4 h. There was also no

54
 Results and discussion

difference between isolates in the regulation of genes connected to apoptosis,

not even when comparing the apoptotic isolates with the non-apoptotic. There
were only a limited number of differentially regulated genes connected to
apoptosis, which supported the data from the apoptosis experiment. This may
be explained by the short incubation time (4 h). None of the ten strains induced
necrosis in HUVEC.
Krut et al. (Krut et al., 2004) suggested an exclusive relationship between
S. aureus and fibroblasts or keratinocytes in that either S. aureus or the host
cells is killed. For the isolates in paper II, our results indicated that S. aureus
isolates survive intracellularly without killing the ECs for at least 72 h. This may
represent a niche for invasive S. aureus, which might be of importance in
persistence and recurrence of infection as well as in the choice of antibiotic
strategy. Of the antibiotics commonly used to treat S. aureus infections, only
rifampicin is able to eliminate intracellular S. aureus (Krut et al., 2004). In a
mouse peritonitis model a poor correlation between the intracellular
accumulation of antibiotics and the actual intracellular effect was found
(Sandberg et al., 2009).
For measurement of soluble cytokines and chemokines with enzyme-linked
immunosorbent assay (ELISA), the cell culture medium was centrifuged before
the start of the analysis. In paper I, ten proteins were investigated (Figure 3 in
paper I), while six were investigated in paper II (Figure 2 in paper II). For the
detection of vascular cell adhesion molecule (VCAM)-1 on the surface of ECs,
monoclonal FITC-conjugated antibodies were used.

Gene expression in HUVEC infected with S. aureus

(papers I and II)

After infection of HUVEC for 18 h as described in paper I and for 4 h, reported

in paper II, RLT buffer was added to each well of infected HUVEC, in order to
preserve the RNA in the cells. Total RNA was isolated and the amount and
quality were investigated. To get a sufficient amount of RNA (1.5 g) and to
compensate for variation in HUVEC from different donors, equal amounts of
RNA from HUVEC infected with the same bacteria isolate from three
independent experiments were mixed. RNA was converted to ds cDNA, and
thereafter cDNA was transcribed to cRNA with a mixture of unlabeled dNPTs
and biotin-labeled CTP and UTP. Fragmentation of cRNA (100-150 bases) was
performed, and thereafter the samples represented by denatured cRNA were
loaded onto the microarray chip (22,283 probe sets representing 14,239
human genes). Hybridized cRNA was then fluorescently labeled by adding
55
 Results and discussion

streptavidin-phycoerythrin. After scanning, the results were evaluated and

genes with at least a threefold or greater change in signal intensity in two
independent experiments compared to uninfected cells, were considered
regulated.
In the study described in paper I, 194 probe sets representing 156 different
genes were differentially regulated, 149 were up-regulated and seven were
down-regulated. As expected, genes representing the innate immune response
were differentially regulated. The following groups were found: genes
associated with adhesion, antigen presentation, apoptosis, cytokines and
chemokines, and genes associated with complement (Table 2 in paper I). The
highest increase in mRNA levels was found in the group of cytokines and
chemokines, and many of these were also detected with ELISA (Figure 3 in
paper I).
In the study described in paper II, there was no difference in gene regulation
between the two groups of invasive and colonizing S. aureus isolates. However,
there was a great variability in the number of differentially regulated genes in
HUVEC (51-156) between the different isolates (Table 9). This variation could
not be explained by any difference in the presence of virulence genes in the
different S. aureus isolates (Tables 7 and 8). In paper II, a core set of genes in
HUVEC was differentially regulated after infection with all ten isolates (Table 5
in paper II). There were 45 genes, classified into the following groups;
apoptosis, cell metabolism, cytokines and chemokines, signaling and
transcription factors and interferon-associated genes. One may speculate that
these genes always become differentially regulated at the onset of an infection
with S. aureus, independent of the isolates characteristics. The majority of
these 45 genes may also be connected to an innate immune response in ECs.
Grundmeier et al showed that different clinical isolates varied greatly in their
ability to induce an inflammatory response in ECs but that many of the
differentially regulated genes were involved in innate immunity (Grundmeier et
al., 2010).

56
 Results and discussion

Table 9. Number of differentially regulated genes at different fold changes*.

Strain
FC up BI BII BIII BIV BV CI CII CIII CIV CV
2 71 125 145 156 88 117 156 126 106 51
5 17 37 44 45 21 35 50 40 26 13
10 10 17 19 21 12 15 23 17 13 5
FC down
2 22 101 49 12 130 31 181 78 41 138
5 2 5 3 1 4 0 5 2 1 8
*Fold change (FC) is the factor of regulation of mRNA from S. aureus infected HUVEC versus
non-infected HUVEC. Strains designated B belong to the group of invasive isolates and
isolates designated C belong to the group of colonizing isolates.

57
 Figure 12. Hierarchical cluster analysis of human genes (I) measured in duplicate by Affymetrix Gene Chip (Hu.U133plus 2.0) after 4 h of incubation of HUVEC
with different S. aureus. Columns represent strains and isolates designated B belong to invasive isolates and C belong to colonizing isolates, N represent
uninfected cells. The horizontal lines represent different genes as shown in II, which is an enlarged section of I. Green color shows down-regulated genes and
red color up-regulated genes

58
.
 Results and discussion

The array results in both papers I and II were confirmed with real time RT-PCR
on a selection of genes involved in the inflammatory response. These
experiments were performed with the same pooled RNA samples that were
used for the microarray analysis. For relative quantification, the housekeeping
gene RPS9 was used for normalization. All analyzed genes, nine in paper I
(Figure 2 in paper I) and seven in paper II (Figure 1 in paper II), confirmed the
array results, with only one exception in paper II. The protein expression in
HUVEC infected with S. aureus was also investigated to confirm the gene
expression results. The levels of 10 soluble proteins in paper I and six in paper
II, were measured after different incubation times. In paper I, nine of the ten
tested proteins were elevated (Figure 3 in paper I), and in paper II all
cytokines/chemokines were elevated, with no difference between the two
groups of bacteria (Figure 2 in paper II). The expression of all analyzed proteins
increased over time.

Prevalence and molecular epidemiology of S. aureus (paper III)

Differences in S. aureus prevalence have been reported depending on the
population studied (Kluytmans et al., 1997). The prevalence varies between
10-85 % and a majority of these studies were on populations within hospital
settings and on people with different conditions (Kluytmans et al., 1997). In
recent studies on general populations, a great difference has also been found
between different countries (den Heijer et al., 2013), and indications of
difference between gender have been observed (Mernelius et al., 2013a; Olsen
et al., 2013). In paper III, we found an overall prevalence of 49 % among all
participating individuals sampled in three locations (anterior nares, throat and
groin), independent of which body site was tested or how many sites were
colonized. When only the anterior nares were studied, 31 % were colonized,
and 34 % were colonized in the throat. Most studies have focused on
colonization of the anterior nares, and the colonization rate for this body site
in our investigation is in agreement with recent data from a study on a general
population in Sweden (den Heijer et al., 2013). The anterior nares has been
considered as the most consistent site of S. aureus colonization (Kluytmans et
al., 1997; Williams, 1963), but recent studies have suggested that colonization
of the throat is more prevalent (Lee et al., 2011; Marshall and Spelman, 2007;
Nilsson and Ripa, 2006), and in paper III the highest colonization rate was found
in the throat, which supports these findings. The variations in prevalence rates
may be due to individual differences such as genetic (Olsen et al., 2012; van
Belkum et al., 2007; van den Akker et al., 2006), (antibiotic) treatment, diseases

59
 Results and discussion

and environmental factors. The variations may also be a consequence of

differences in sampling technics, logistic factors and culture conditions
(VandenBergh et al., 1999). It is known that decolonization of the nose usually
has a decolonizing effect on the skin and perineum (Parras et al., 1995; Varga
and White, 1961), as well as a reducing effect on postoperative infections (Perl
et al., 2002). Whether decolonization of the throat has the same effect is still
not known.
From epidemiological studies in hospital settings or in general populations, a
diverse distribution of spa types has been found (Grundmann et al., 2010;
Mernelius et al., 2013a; Miko et al., 2013; Sangvik et al., 2011). In paper III, a
diverse distribution was also found. Three different geographical regions in the
south of Sweden were included, and we did not find any difference in spa type
distribution between the different regions. However, in one of the regions,
signs of the clonal spread of one spa type were found, as this specific spa type
was found in seven of nine individuals at the same nursing home.
BURP cluster analysis of all spa types (n=98) found in the longitudinal study in
paper III revealed 10 clusters and 14 singletons. The four largest clonal clusters
(CC) were spa-CC 015, spa-CC 012, spa-CC 084 and spa-CC 005 and these
included 45 % of all detected spa types. Two of these most common clusters
were also the most common in the Swedish HITS-study (Mernelius et al.,
2013b) from the same region as our study reported in paper III. Of the 35
individuals that carried different spa types at any time during the study period,
21 carried the different strains on the same occasion and 18 changed spa type
over time. Three individuals carried spa types that were closely related, and in
two of these individuals both spa types were present on the same sampling
occasion. Because of the difference in the number of samples, mainly between
the nares and throat, we are not able to draw any conclusions about how often
an individual changes strains. It was showen in a study by Sakwinska et al.
(Sakwinska et al., 2010) that replacement of S. aureus strains occurred quite
infrequently but that the mutation rate in the spa locus was high.

60
 Results and discussion

Colonization and persistent carriage of S. aureus (paper III)

Usually, three categories of S. aureus carriage are described: persistent,
intermittent and non-carriers (Eriksen et al., 1995; Hu et al., 1995; Kluytmans et
al., 1997; Kuehnert et al., 2006; Nouwen et al., 2004; Wertheim et al., 2005b).
Recently, a reclassification of the carriage groups has been suggested, namely
persistent carriers and others (van Belkum et al., 2009). The definition of a
persistent carrier varies from study to study, depending on how many samples
they include, at what interval the samples are obtained, and how many positive
cultures are needed to meet the classification of a persistent carrier
(VandenBergh et al., 1999). Also, most studies are based on samples from the
anterior nares. In paper III, we found 20 % persistent carriers in the anterior
nares if three out of three samples were required to contain S. aureus. We
found that 17 % were carrying the same spa type on all three occasions.
Carriage rates based on two sampling occasions from the nares showed that
S. aureus was isolated on both occasions in 22 % of the individuals, and in 19 %
of the individuals S. aureus of the same spa type was found. This indicates that
two sampling occasions may be enough to confirm if an individual is a
persistent S. aureus carrier or not. Our rates are in agreement with other
studies (Kluytmans et al., 1997; van Belkum et al., 2009). It is important to
identify the group of persistent carriers because they have an increased risk of
infection (Nouwen et al., 2004; Wertheim et al., 2004; von Eiff et al., 2001). In
about 80 % of cases, S. aureus infections are caused by the carrier strain
present on the nasal mucosa of the patient (Wertheim et al., 2004; von Eiff et
al., 2001). Another piece of evidence that the strain carried in the nares is
causing disease is that eradication of S. aureus from the anterior nares has
proved to be effective in reducing the incidence of infection by the bacteria
(Bode et al., 2010; Kluytmans and Wertheim, 2005; Perl et al., 2002).
The importance of carrying S. aureus in the throat is still not known. In paper
III, we found a rate of 7 % persistent S. aureus throat carriage. This is a lower
figure than shown by Nilsson et al. (Nilsson and Ripa, 2006). Explanations for
the low rate in our study could be the low number of individuals that agreed to
samples being taken on three sampling occasions from this body site, and that
the obtained throat samples were of poor quality.
Due to the discrepancy in the number of sampling occasions for the different
sampling sites, the throat and nares were analyzed separately in order to
evaluate the carriage state. In the nares, 20 % of the individuals were colonized
with S. aureus on three occasions during one year, but for the throat the
corresponding rate was only 7 %. Also the carrier state for an individual was
evaluated. An individual was considered as a carrier of S. aureus if the

61
 Results and discussion

bacterium was found in one or more of the three sampling sites. Forty-four
individuals were sampled at all three sampling sites on three sampling
occasions, and 25 % of these individuals were colonized with S. aureus on all
three occasions. In 20 % the same spa type was isolated on all the occasions. In
30 % of the individuals, S. aureus was not detected at any sampling site on any
of the three occasions.

Antibiotic resistance found in S. aureus (papers II and III)

In paper II, the presence of some resistance genes as virulence factors was
investigated. Only resistance against -lactamase was detected in the majority
of the isolates (7 of 10 isolates). The investigated genes were; blaZ (-
lactamase), mecA (modified penicillin binding protein), ermA, ermC, linA, msrA,
vatA, vatB, vga, vgaA, vgB (macrolides/lincosamines/streptogramines), aacA-
aphD, aadD, aphA3 (aminoglycosides), sat (streptothricine), dfrA
(trimethoprim), far1 (fusidic acid), mupR (mupirocin), tetK, tetM (tetracycline),
vanA, vanB, vanZ (vancomycin resistance genes in enterococci).
Overall, in paper III low antibiotic resistance was found among the nursing
home residents and there was no association between resistance and spa type.
The most prevalent resistance was that against ciprofloxacin. None of the
isolates were resistant to vancomycin, gentamicin, erythromycin, linezolid or
rifampicin and no MRSA isolates were detected.
It has been suggested that nursing home residents may be a reservoir for
antimicrobial resistance (Bonomo, 2000), but this was not observed in our
study (paper III). Also, a study by van der Donk et al showed no higher
prevalence of resistance among nursing home residents compared with the
remaining population in the same area (van der Donk et al., 2013). Further
studies correlating resistance to antibiotic load at a unit or in relation to various
conditions of residents, should be conducted. Even in countries with a high
prevalence of MRSA in hospital settings, the prevalence found among the
nursing home residents was lower (Pfingsten-Wurzburg et al., 2011).

62
 Results and discussion

Multiclonality of S. aureus (papers III and IV)

The bacterial isolates or pelleted bacteria from enrichment broth were lysed at
95 C before DNA isolation. The PCR-reaction was performed with the same
primers as for spa typing (Kahl et al., 2005) with the difference that a GC-clamp
was attached to the forward primer. The PCR products were then analyzed on a
polyacrylamide gradient gel, using a DCode universal mutation detection
system. The gel contained a gradient of urea and formamid, ranging from 15 %
to 50 %. After running the gel electrophoresis at 62 C for 14 h, the gel was
stained with SYBERGold and the presence of separated bands was visualized in
UV transillumination, using a charge-coupled device (CCD) camera.
In paper III, we identified a number of individuals colonized with S. aureus at
more than one body site on the same sampling occasion. In some of these
individuals, S. aureus belonging to two different spa types was detected. The
issue of multiclonality is important and is not addressed in clinical laboratory
diagnostics, where often only one isolate is analyzed. This might lead to an
inconclusive report as a more virulent and antibiotic resistant strain may be
missed, and in epidemiological investigations misleading results may be
reported. This was illustrated in paper III, where five individuals were colonized
with one resistant and one non-resistant isolate of S. aureus, and these isolates
belonged to different spa types. Whether the two strains isolated from an
individual were also present at one body site could not be evaluated in this
study due to the study protocol, but this question should be further
investigated.
In order to detect different clones of S. aures in one sample, a method that is
independent of culture was developed in paper IV. This method is based on
DGGE and amplification of the spa gene. First, the PCR conditions required
were optimized, and then the attachment of the GC-clamp to the spa primer
was evaluated. The discriminatory power and the sensitivity of the method
were evaluated, and we found that it was possible, from the spa gene, to
detect PCR-products with the same length but different sequences. Moreover,
the sensitivity was found to be 1:1000 when a serial dilution of a mixture of
two S. aureus isolates was amplified. This is a great advantage but another
benefit is that no prior isolation from a culture is needed. A disadvantage is
that the method is time consuming and, like other gel-based methods, the
result is based on individual assessment.
The spa DGGE method was also tested on samples previously obtained in an
investigation of an MRSA outbreak (Figure 13). In this outbreak, two different
but closely related S. aureus spa types (t015 and t069) were detected (Table
10).
63
 Results and discussion

Table 10. Comparison of repeat succession of

two closely related spa types.
t069 08-16-02-16-34-13-17-34-16-16-34
t015 08-16-02-16-34-13-17-34-16-34

Broth samples from colonized individuals (n=13) were analyzed with the new
spa DGGE method. The results showed that two individuals were
simultaneously colonized with both t015 and t069 at one body site and one
individual was colonized with the different strains at different body sites on the
same sampling occasion.

Figure 13.Overview of colonized individuals within an MRSA outbreak with the detection of
two different spa types. *In samples from two of the individuals both spa types were
simultaneously detected with DGGE (Figure 2 in paper IV). Line A represents nursing home
residents, line B staff at the nursing home, and line C relatives to staff. The ovals represent
females and rectangles represent males. Samples were taken from the nares (N), throat (T)
and groin (G).

For some of the individuals colonized with S. aureus in paper III, broth samples
were collected and frozen. In the future, these samples will be analyzed with
the spa DGGE method developed in paper IV. With the results from paper III, it
will be interesting to investigate how commonly multiple colonization occures
in this population of nursing home residents. The result may then be compared
with our result in paper III where we found a rate of 23 % with simultaneous
colonization of different clones of S. aureus at different body sites.

64
 Conclusion

CONCLUSION
The focus of this thesis is on the pathogenesis and molecular epidemiology of
S. aureus. The interaction model, S. aureus and HUVEC, was suitable for
evaluateing the virulence of S. aureus. To study the epidemiology of S. aureus,
antibiotic resistance and transmission patterns including multiclonality, nursing
home residents are important and suitable populations.
Paper I:
The microarray revealed the induction of broad activity of the innate immune
response in HUVEC after infection with S. aureus.
An intracellular phase of S. aureus infection was observed and an intracellular
survival period of at least 42 h was documented.
Paper II:
Genotyping by microarray revealed no differences between invasive and non-
invasive isolates of S. aureus in their content of virulence genes.
The gene expression in HUVEC after infection with S. aureus revealed no
differences, when the results of invasive and non-invasive isolates were
compared.
Among the genes induced in HUVEC by all S. aureus isolates, the dominance of
the innate immune response was confirmed.
Apoptosis of HUVEC was induced by isolates representing the invasive as well
as the non-invasive groups. None of the ten isolates induced necrosis.
An intracellular phase of S. aureus infection was confirmed, since all ten
isolates survived for at least 42 h, as documented by viable count.

65
 Conclusion

Paper III:
High diversity among strains of S. aureus colonizing the population of nursing
home residents.
Possible spread of one clone within one of the nursing homes.
Overall, the prevalence of antibiotic-resistant strains was low and no MRSA was
found.
Antibiotic resistance was more prevalent in multiclonal carriers and
simultaneous detection of resistant and non-resistant strains was registered.
There was relatively high prevalence of S. aureus among the individuals in this
population of elderly.
Paper IV:
The newly developed DGGE method for detection of different S. aureus spa
types in one sample was sensitive and had a high discriminatory power.
The spa-DGGE method may be useful for checking clinical samples to ensure
the detection of possible multiclonal infections thereby guaranteeing correct
treatment.
The method was useful in the investigation of an MRSA outbreak comprising
two different spa types, and may be used as a tool for epidemiological
investigations.

66
 Conclusion

Benefits for individuals and future perspectives

S. aureus is a highly pathogenic bacterium and at the same time a frequent
commensal in humans. In this thesis no easily detected virulence factors
characterizing an isolate as highly virulent or of low virulence were found. This
means that all S. aureus isolates must be regarded as potentially pathogenic in
a clinical situation.
The documentation of the intracellular phase of the infection has implications
for the choice of antibiotic treatment.
Although surveillance of antibiotic resistance is low today, due to the fear of a
future spread of resistant clones, increased surveillance is warranted. Nursing
home residents comprising a group of individuals that have frequent contact
with hospital settings and therefore represent an important and convenient
group that may be the basis for an early warning system of antibiotic
resistance.
The newly-developed DGGE method for multiclonal detection of S. aureus,
offers the possibility to ascertain the correct antibiotic treatment. It also
increases the quality of epidemiological investigations.
The low prevalence of S. aureus in the groin samples indicates that this body
site may be omitted in screening programs. On the other hand, a high
prevalence was found in throat samples, which indicates that this body site
should be included in screening programs. The importance of throat
colonization for autologous infections and for transmission should be further
evaluated.

67
 Acknowledgements

ACKNOWLEDGEMENTS
I would like to express my sincere gratitude to all who, in one way or another,
have helped and supported me during these years and who in different ways
have contributed to the completion of this thesis. I thank you all, and
especially:
Per-Eric Lindgren, my main supervisor, for support, advice and guidance over
the years.
Sture Lfgren, Erik Kihlstrm, Jan Strindhall and Andreas Matussek, my co-
supervisors, for support, advice and guidance over the years. A special thanks
to Sture for the support during the last year.
All my great colleagues and friends, present and past, at the Department of
Clinical Microbiology, Ryhov County Hospital for invaluable support,
understanding and great encouragement over all these years. You are the best!
All my friends at the section of Molecular Biology at the Department of Clinical
Microbiology, Ryhov County Hospital, it is you who made this to the world's
best place to work.
The girls at the office (the kiss and cry corner) and to you who sometimes visit
us, for help, great support and discussions about almost everything.
Anna J, Anna , Diana, Gun and Vera for help with figures and other technical
things.
All co-authors in Sweden and Germany for making my articles possible.
All my great friends for love, support and just being my friends and for that
some of you never stop asking questions.
Jonas because you wanted to run with me.
My family for letting me be me.

This work was supported by grants from Futurum the Academy of Healthcare,
Jnkping County Council and the Health Research Council in the South-East of
Sweden (FORSS).

68
 References

REFERENCES
Armstrong-Esther, C.A., 1976. Carriage patterns of Staphylococcus aureus in a healthy non-hospital
population of adults and children. Ann Hum Biol 3, 221-227.
Bannerman, T.L., Hancock, G.A., Tenover, F.C., Miller, J.M., 1995. Pulsed-field gel electrophoresis as a
replacement for bacteriophage typing of Staphylococcus aureus. J Clin Microbiol 33, 551-555.
Baum, C., Haslinger-Loffler, B., Westh, H., Boye, K., Peters, G., Neumann, C., Kahl, B.C., 2009. Non-
spa-typeable clinical Staphylococcus aureus strains are naturally occurring protein A mutants.
J Clin Microbiol 47, 3624-3629.
Becker, K., Friedrich, A.W., Lubritz, G., Weilert, M., Peters, G., Von Eiff, C., 2003. Prevalence of genes
encoding pyrogenic toxin superantigens and exfoliative toxins among strains of
Staphylococcus aureus isolated from blood and nasal specimens. J Clin Microbiol 41, 1434-
1439.
Beekhuizen, H., van de Gevel, J.S., 2007. Gamma interferon confers resistance to infection with
Staphylococcus aureus in human vascular endothelial cells by cooperative proinflammatory
and enhanced intrinsic antibacterial activities. Infect Immun 75, 5615-5626.
Berends, E.T., Horswill, A.R., Haste, N.M., Monestier, M., Nizet, V., von Kockritz-Blickwede, M., 2010.
Nuclease expression by Staphylococcus aureus facilitates escape from neutrophil
extracellular traps. J Innate Immun 2, 576-586.
Birtles, A., McCarthy, N., Sheppard, C.L., Rutter, H., Guiver, M., Haworth, E., George, R.C., 2005.
Multilocus sequence typing directly on DNA from clinical samples and a cultured isolate to
investigate linked fatal pneumococcal disease in residents of a shelter for homeless men. J
Clin Microbiol 43, 2004-2008.
Blair, J.E., Williams, R.E., 1961. Phage typing of staphylococci. Bull World Health Organ 24, 771-784.
Bode, L.G., Kluytmans, J.A., Wertheim, H.F., Bogaers, D., Vandenbroucke-Grauls, C.M., Roosendaal,
R., Troelstra, A., Box, A.T., Voss, A., van der Tweel, I., van Belkum, A., Verbrugh, H.A., Vos,
M.C., 2010. Preventing surgical-site infections in nasal carriers of Staphylococcus aureus. N
Engl J Med 362, 9-17.
Bonomo, R.A., 2000. Multiple antibiotic-resistant bacteria in long-term-care facilities: An emerging
problem in the practice of infectious diseases. Clin Infect Dis 31, 1414-1422.
Brown, E.M., Thomas, P., 2002. Fusidic acid resistance in Staphylococcus aureus isolates. Lancet 359,
803.
Buckingham Lela , F.M.L., 2007. Molecular Diagnostics fundamentals, methods, & clinical
applications. F. A. Davis Company, Philadelphia.
Bustin, S.A., 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase
chain reaction assays. J Mol Endocrinol 25, 169-193.
Chambers, H.F., Deleo, F.R., 2009. Waves of resistance: Staphylococcus aureus in the antibiotic era.
Nat Rev Microbiol 7, 629-641.
Chamchod, F., Ruan, S., 2012. Modeling the spread of methicillin-resistant Staphylococcus aureus in
nursing homes for elderly. PLoS One 7, e29757.
Chavakis, T., Preissner, K.T., Herrmann, M., 2007. The anti-inflammatory activities of Staphylococcus
aureus. Trends Immunol 28, 408-418.
Chavakis, T., Wiechmann, K., Preissner, K.T., Herrmann, M., 2005. Staphylococcus aureus interactions
with the endothelium: the role of bacterial "secretable expanded repertoire adhesive
molecules" (SERAM) in disturbing host defense systems. Thromb Haemost 94, 278-285.
Chen, F.J., Siu, L.K., Lin, J.C., Wang, C.H., Lu, P.L., 2012. Molecular typing and characterization of nasal
carriage and community-onset infection methicillin-susceptible Staphylococcus aureus
isolates in two Taiwan medical centers. BMC Infect Dis 12, 343.

69
 References

Cheng, A.G., DeDent, A.C., Schneewind, O., Missiakas, D., 2011. A play in four acts: Staphylococcus
aureus abscess formation. Trends Microbiol 19, 225-232.
Cheung, A.L., Bayer, A.S., Zhang, G., Gresham, H., Xiong, Y.Q., 2004. Regulation of virulence
determinants in vitro and in vivo in Staphylococcus aureus. FEMS Immunol Med Microbiol
40, 1-9.
Cines, D.B., Pollak, E.S., Buck, C.A., Loscalzo, J., Zimmerman, G.A., McEver, R.P., Pober, J.S., Wick,
T.M., Konkle, B.A., Schwartz, B.S., Barnathan, E.S., McCrae, K.R., Hug, B.A., Schmidt, A.M.,
Stern, D.M., 1998. Endothelial cells in physiology and in the pathophysiology of vascular
disorders. Blood 91, 3527-3561.
Coico Richard , S.G., 2009. Immunology a short course. John Wiley & Sons, New Jersey.
Cookson, B.D., Aparicio, P., Deplano, A., Struelens, M., Goering, R., Marples, R., 1996. Inter-centre
comparison of pulsed-field gel electrophoresis for the typing of methicillin-resistant
Staphylococcus aureus. J Med Microbiol 44, 179-184.
Cosgrove, K., Coutts, G., Jonsson, I.M., Tarkowski, A., Kokai-Kun, J.F., Mond, J.J., Foster, S.J., 2007.
Catalase (KatA) and alkyl hydroperoxide reductase (AhpC) have compensatory roles in
peroxide stress resistance and are required for survival, persistence, and nasal colonization in
Staphylococcus aureus. J Bacteriol 189, 1025-1035.
Cunliffe, A.C., 1949. Incidence of Staphylococcus aureus in the anterior nares of healthy children.
Lancet 2, 411-414.
Cuny, C., Friedrich, A., Kozytska, S., Layer, F., Nubel, U., Ohlsen, K., Strommenger, B., Walther, B.,
Wieler, L., Witte, W., 2010. Emergence of methicillin-resistant Staphylococcus aureus (MRSA)
in different animal species. Int J Med Microbiol 300, 109-117.
David, M.Z., Taylor, A., Lynfield, R., Boxrud, D.J., Short, G., Zychowski, D., Boyle-Vavra, S., Daum, R.S.,
2013. Comparing pulsed-field gel electrophoresis with multilocus sequence typing, spa
typing, staphylococcal cassette chromosome mec (SCCmec) typing, and PCR for panton-
valentine leukocidin, arcA, and opp3 in methicillin-resistant Staphylococcus aureus isolates at
a U.S. Medical Center. J Clin Microbiol 51, 814-819.
de Kraker, M.E., Jarlier, V., Monen, J.C., Heuer, O.E., van de Sande, N., Grundmann, H., 2012. The
changing epidemiology of bacteraemias in Europe: trends from the European Antimicrobial
Resistance Surveillance System. Clin Microbiol Infect.
DeLeo, F.R., Chambers, H.F., 2009. Reemergence of antibiotic-resistant Staphylococcus aureus in the
genomics era. J Clin Invest 119, 2464-2474.
den Heijer, C.D., van Bijnen, E.M., Paget, W.J., Pringle, M., Goossens, H., Bruggeman, C.A., Schellevis,
F.G., Stobberingh, E.E., Team, A.S., 2013. Prevalence and resistance of commensal
Staphylococcus aureus, including meticillin-resistant S aureus, in nine European countries: a
cross-sectional study. Lancet Infect Dis 13, 409-415.
Dijkshoorn, L., Ursing, B.M., Ursing, J.B., 2000. Strain, clone and species: comments on three basic
concepts of bacteriology. J Med Microbiol 49, 397-401.
Dinges, M.M., Orwin, P.M., Schlievert, P.M., 2000. Exotoxins of Staphylococcus aureus. Clin Microbiol
Rev 13, 16-34, table of contents.
Doan Thao , M.R., Viselli Susan , Waltenbaugh Carl 2013. Immunology. Lippincott Williams & Wilkins,
Baltimore and Philadelphia.
Edwards, A.M., Bowden, M.G., Brown, E.L., Laabei, M., Massey, R.C., 2012. Staphylococcus aureus
extracellular adherence protein triggers TNFalpha release, promoting attachment to
endothelial cells via protein A. PLoS One 7, e43046.
Enright, M.C., Day, N.P., Davies, C.E., Peacock, S.J., Spratt, B.G., 2000. Multilocus sequence typing for
characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus
aureus. J Clin Microbiol 38, 1008-1015.
Enright, M.C., Robinson, D.A., Randle, G., Feil, E.J., Grundmann, H., Spratt, B.G., 2002. The
evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proc Natl Acad
Sci U S A 99, 7687-7692.

70
 References

Eriksen, N.H., Espersen, F., Rosdahl, V.T., Jensen, K., 1995. Carriage of Staphylococcus aureus among
104 healthy persons during a 19-month period. Epidemiol Infect 115, 51-60.
Ernsth Bravell, M., Westerlind, B., Midlov, P., Ostgren, C.J., Borgquist, L., Lannering, C., Molstad, S.,
2011. How to assess frailty and the need for care? Report from the Study of Health and Drugs
in the Elderly (SHADES) in community dwellings in Sweden. Arch Gerontol Geriatr 53, 40-45.
European Center for Disease Prevention and Control (ECDC). Annual Surveillance Report. Reporting
on 2009 surveillance data and 2010 epidemic intelligence data. Stockholm: ECDC, 2011.
http://www.ecdc.europa.eu/en/publications/Publications/1111_SUR_Annual_Epidemiologic
al_Report_on_Communicable_Diseases_in_Europe.pdf (accessed april 25, 2013)
Fischer, S.G., Lerman, L.S., 1983. DNA fragments differing by single base-pair substitutions are
separated in denaturing gradient gels: correspondence with melting theory. Proc Natl Acad
Sci U S A 80, 1579-1583.
Flock, J.I., Froman, G., Jonsson, K., Guss, B., Signas, C., Nilsson, B., Raucci, G., Hook, M., Wadstrom, T.,
Lindberg, M., 1987. Cloning and expression of the gene for a fibronectin-binding protein from
Staphylococcus aureus. EMBO J 6, 2351-2357.
Foster, T.J., 2005. Immune evasion by staphylococci. Nat Rev Microbiol 3, 948-958.
Foster, T.J., Hook, M., 1998. Surface protein adhesins of Staphylococcus aureus. Trends Microbiol 6,
484-488.
Fraunholz, M., Sinha, B., 2012. Intracellular Staphylococcus aureus: live-in and let die. Front Cell
Infect Microbiol 2, 43.
Friedrich, A.W., Daniels-Haardt, I., Kock, R., Verhoeven, F., Mellmann, A., Harmsen, D., van Gemert-
Pijnen, J.E., Becker, K., Hendrix, M.G., 2008. EUREGIO MRSA-net Twente/Munsterland--a
Dutch-German cross-border network for the prevention and control of infections caused by
methicillin-resistant Staphylococcus aureus. Euro Surveill 13.
Fuda, C., Hesek, D., Lee, M., Morio, K., Nowak, T., Mobashery, S., 2005a. Activation for catalysis of
penicillin-binding protein 2a from methicillin-resistant Staphylococcus aureus by bacterial
cell wall. J Am Chem Soc 127, 2056-2057.
Fuda, C.C., Fisher, J.F., Mobashery, S., 2005b. Beta-lactam resistance in Staphylococcus aureus: the
adaptive resistance of a plastic genome. Cell Mol Life Sci 62, 2617-2633.
Gold, B., Hanson, M., Dean, M., 2001. Two rare confounding polymorphisms proximal to the factor V
Leiden mutation. Mol Diagn 6, 137-140.
Goodyear, C.S., Silverman, G.J., 2003. Death by a B cell superantigen: In vivo VH-targeted apoptotic
supraclonal B cell deletion by a Staphylococcal Toxin. J Exp Med 197, 1125-1139.
Grumann, D., Nubel, U., Broker, B.M., 2013. Staphylococcus aureus toxins - Their functions and
genetics. Infect Genet Evol.
Grundmann, H., Aanensen, D.M., van den Wijngaard, C.C., Spratt, B.G., Harmsen, D., Friedrich, A.W.,
European Staphylococcal Reference Laboratory Working, G., 2010. Geographic distribution of
Staphylococcus aureus causing invasive infections in Europe: a molecular-epidemiological
analysis. PLoS Med 7, e1000215.
Grundmeier, M., Tuchscherr, L., Bruck, M., Viemann, D., Roth, J., Willscher, E., Becker, K., Peters, G.,
Loffler, B., 2010. Staphylococcal strains vary greatly in their ability to induce an inflammatory
response in endothelial cells. J Infect Dis 201, 871-880.
Haggar, A., Ehrnfelt, C., Holgersson, J., Flock, J.I., 2004. The extracellular adherence protein from
Staphylococcus aureus inhibits neutrophil binding to endothelial cells. Infect Immun 72,
6164-6167.
Hallin, M., Deplano, A., Denis, O., De Mendonca, R., De Ryck, R., Struelens, M.J., 2007. Validation of
pulsed-field gel electrophoresis and spa typing for long-term, nationwide epidemiological
surveillance studies of Staphylococcus aureus infections. J Clin Microbiol 45, 127-133.
Harmsen, D., Claus, H., Witte, W., Rothganger, J., Claus, H., Turnwald, D., Vogel, U., 2003. Typing of
methicillin-resistant Staphylococcus aureus in a university hospital setting by using novel
software for spa repeat determination and database management. J Clin Microbiol 41, 5442-
5448.

71
 References

Hartman, B., Tomasz, A., 1981. Altered penicillin-binding proteins in methicillin-resistant strains of
Staphylococcus aureus. Antimicrob Agents Chemother 19, 726-735.
Hienz, S.A., Schennings, T., Heimdahl, A., Flock, J.I., 1996. Collagen binding of Staphylococcus aureus
is a virulence factor in experimental endocarditis. J Infect Dis 174, 83-88.
Higuchi, R., Fockler, C., Dollinger, G., Watson, R., 1993. Kinetic PCR analysis: real-time monitoring of
DNA amplification reactions. Biotechnology (N Y) 11, 1026-1030.
Hoeger, P.H., Lenz, W., Boutonnier, A., Fournier, J.M., 1992. Staphylococcal skin colonization in
children with atopic dermatitis: prevalence, persistence, and transmission of toxigenic and
nontoxigenic strains. J Infect Dis 165, 1064-1068.
Hu, L., Umeda, A., Kondo, S., Amako, K., 1995. Typing of Staphylococcus aureus colonising human
nasal carriers by pulsed-field gel electrophoresis. J Med Microbiol 42, 127-132.
Hussain, M., von Eiff, C., Sinha, B., Joost, I., Herrmann, M., Peters, G., Becker, K., 2008. eap Gene as
novel target for specific identification of Staphylococcus aureus. J Clin Microbiol 46, 470-476.
Imamura, T., Tanase, S., Szmyd, G., Kozik, A., Travis, J., Potempa, J., 2005. Induction of vascular
leakage through release of bradykinin and a novel kinin by cysteine proteinases from
Staphylococcus aureus. J Exp Med 201, 1669-1676.
Ito, T., Katayama, Y., Hiramatsu, K., 1999. Cloning and nucleotide sequence determination of the
entire mec DNA of pre-methicillin-resistant Staphylococcus aureus N315. Antimicrob Agents
Chemother 43, 1449-1458.
Jaffe, E.A., Nachman, R.L., Becker, C.G., Minick, C.R., 1973. Culture of human endothelial cells derived
from umbilical veins. Identification by morphologic and immunologic criteria. J Clin Invest 52,
2745-2756.
Jones, N., Bohnsack, J.F., Takahashi, S., Oliver, K.A., Chan, M.S., Kunst, F., Glaser, P., Rusniok, C.,
Crook, D.W., Harding, R.M., Bisharat, N., Spratt, B.G., 2003. Multilocus sequence typing
system for group B streptococcus. J Clin Microbiol 41, 2530-2536.
Josefsson, E., Higgins, J., Foster, T.J., Tarkowski, A., 2008. Fibrinogen binding sites P336 and Y338 of
clumping factor A are crucial for Staphylococcus aureus virulence. PLoS One 3, e2206.
Kahl, B.C., Mellmann, A., Deiwick, S., Peters, G., Harmsen, D., 2005. Variation of the polymorphic
region X of the protein A gene during persistent airway infection of cystic fibrosis patients
reflects two independent mechanisms of genetic change in Staphylococcus aureus. J Clin
Microbiol 43, 502-505.
Kaneko, J., Kamio, Y., 2004. Bacterial two-component and hetero-heptameric pore-forming cytolytic
toxins: structures, pore-forming mechanism, and organization of the genes. Biosci Biotechnol
Biochem 68, 981-1003.
Kato, F., Kadomoto, N., Iwamoto, Y., Bunai, K., Komatsuzawa, H., Sugai, M., 2011. Regulatory
mechanism for exfoliative toxin production in Staphylococcus aureus. Infect Immun 79, 1660-
1670.
Kawabata, S., Morita, T., Miyata, T., Kaida, S., Igarashi, H., Iwanaga, S., 1986. Difference in enzymatic
properties between "staphylothrombin" and free alpha-thrombin. Ann N Y Acad Sci 485, 27-
40.
Kim, H.K., Thammavongsa, V., Schneewind, O., Missiakas, D., 2012. Recurrent infections and immune
evasion strategies of Staphylococcus aureus. Curr Opin Microbiol 15, 92-99.
Kluytmans, J., van Belkum, A., Verbrugh, H., 1997. Nasal carriage of Staphylococcus aureus:
epidemiology, underlying mechanisms, and associated risks. Clin Microbiol Rev 10, 505-520.
Kluytmans, J.A., Wertheim, H.F., 2005. Nasal carriage of Staphylococcus aureus and prevention of
nosocomial infections. Infection 33, 3-8.
Koch, T.K., Reuter, M., Barthel, D., Bohm, S., van den Elsen, J., Kraiczy, P., Zipfel, P.F., Skerka, C., 2012.
Staphylococcus aureus proteins Sbi and Efb recruit human plasmin to degrade complement
C3 and C3b. PLoS One 7, e47638.
Krut, O., Sommer, H., Kronke, M., 2004. Antibiotic-induced persistence of cytotoxic Staphylococcus
aureus in non-phagocytic cells. J Antimicrob Chemother 53, 167-173.

72
 References

Kuehnert, M.J., Kruszon-Moran, D., Hill, H.A., McQuillan, G., McAllister, S.K., Fosheim, G., McDougal,
L.K., Chaitram, J., Jensen, B., Fridkin, S.K., Killgore, G., Tenover, F.C., 2006. Prevalence of
Staphylococcus aureus nasal colonization in the United States, 2001-2002. J Infect Dis 193,
172-179.
Lahteenmaki, K., Kuusela, P., Korhonen, T.K., 2000. Plasminogen activation in degradation and
penetration of extracellular matrices and basement membranes by invasive bacteria.
Methods 21, 125-132.
Larionov, A., Krause, A., Miller, W., 2005. A standard curve based method for relative real time PCR
data processing. BMC Bioinformatics 6, 62.
Laupland, K.B., Church, D.L., Mucenski, M., Sutherland, L.R., Davies, H.D., 2003. Population-based
study of the epidemiology of and the risk factors for invasive Staphylococcus aureus
infections. J Infect Dis 187, 1452-1459.
Lee, C.J., Sankaran, S., Mukherjee, D.V., Apa, Z.L., Hafer, C.A., Wright, L., Larson, E.L., Lowy, F.D.,
2011. Staphylococcus aureus oropharyngeal carriage in a prison population. Clin Infect Dis
52, 775-778.
Liu, W.T., Marsh, T.L., Cheng, H., Forney, L.J., 1997. Characterization of microbial diversity by
determining terminal restriction fragment length polymorphisms of genes encoding 16S
rRNA. Appl Environ Microbiol 63, 4516-4522.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time
quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408.
Lotze, M.T., Tracey, K.J., 2005. High-mobility group box 1 protein (HMGB1): nuclear weapon in the
immune arsenal. Nat Rev Immunol 5, 331-342.
Lowy, F.D., 1998. Staphylococcus aureus infections. N Engl J Med 339, 520-532.
Maiden, M.C., Bygraves, J.A., Feil, E., Morelli, G., Russell, J.E., Urwin, R., Zhang, Q., Zhou, J., Zurth, K.,
Caugant, D.A., Feavers, I.M., Achtman, M., Spratt, B.G., 1998. Multilocus sequence typing: a
portable approach to the identification of clones within populations of pathogenic
microorganisms. Proc Natl Acad Sci U S A 95, 3140-3145.
Marshall, C., Spelman, D., 2007. Re: is throat screening necessary to detect methicillin-resistant
Staphylococcus aureus colonization in patients upon admission to an intensive care unit? J
Clin Microbiol 45, 3855.
Massimi, I., Park, E., Rice, K., Muller-Esterl, W., Sauder, D., McGavin, M.J., 2002. Identification of a
novel maturation mechanism and restricted substrate specificity for the SspB cysteine
protease of Staphylococcus aureus. J Biol Chem 277, 41770-41777.
Matussek, A., Stark, L., Dienus, O., Aronsson, J., Mernelius, S., Lofgren, S., Lindgren, P.E., 2011.
Analyzing multiclonality of Staphylococcus aureus in clinical diagnostics using spa-based
denaturing gradient gel electrophoresis. J Clin Microbiol 49, 3647-3648.
Matussek, A., Taipalensuu, J., Einemo, I.M., Tiefenthal, M., Lofgren, S., 2007. Transmission of
Staphylococcus aureus from maternity unit staff members to newborns disclosed through
spa typing. Am J Infect Control 35, 122-125.
Mazmanian, S.K., Liu, G., Jensen, E.R., Lenoy, E., Schneewind, O., 2000. Staphylococcus aureus
sortase mutants defective in the display of surface proteins and in the pathogenesis of
animal infections. Proc Natl Acad Sci U S A 97, 5510-5515.
McAdow, M., Missiakas, D.M., Schneewind, O., 2012. Staphylococcus aureus secretes coagulase and
von Willebrand factor binding protein to modify the coagulation cascade and establish host
infections. J Innate Immun 4, 141-148.
McCarthy, A.J., Breathnach, A.S., Lindsay, J.A., 2012. Detection of mobile-genetic-element variation
between colonizing and infecting hospital-associated methicillin-resistant Staphylococcus
aureus isolates. J Clin Microbiol 50, 1073-1075.
McCarthy, A.J., Lindsay, J.A., 2012. The distribution of plasmids that carry virulence and resistance
genes in Staphylococcus aureus is lineage associated. BMC Microbiol 12, 104.
Medzhitov, R., Janeway, C.A., Jr., 1998. Self-defense: the fruit fly style. Proc Natl Acad Sci U S A 95,
429-430.

73
 References

Mehndiratta, P.L., Bhalla, P., 2012. Typing of Methicillin resistant Staphylococcus aureus: a technical
review. Indian J Med Microbiol 30, 16-23.
Mehndiratta, P.L., Bhalla, P., Ahmed, A., Sharma, Y.D., 2009. Molecular typing of methicillin-resistant
Staphylococcus aureus strains by PCR-RFLP of SPA gene: a reference laboratory perspective.
Indian J Med Microbiol 27, 116-122.
Melin, S., Melin, S., Haeggman, S., Melin, S., Haeggman, S., Olsson-Liljequist, B., Sjolund, M., Nilsson,
P.A., Isaksson, B., Lofgren, S., Matussek, A., 2009. Epidemiological typing of methicillin-
resistant Staphylococcus aureus (MRSA): spa typing versus pulsed-field gel electrophoresis.
Scand J Infect Dis 41, 433-439.
Melles, D.C., Gorkink, R.F., Boelens, H.A., Snijders, S.V., Peeters, J.K., Moorhouse, M.J., van der Spek,
P.J., van Leeuwen, W.B., Simons, G., Verbrugh, H.A., van Belkum, A., 2004. Natural
population dynamics and expansion of pathogenic clones of Staphylococcus aureus. J Clin
Invest 114, 1732-1740.
Melles, D.C., van Leeuwen, W.B., Snijders, S.V., Horst-Kreft, D., Peeters, J.K., Verbrugh, H.A., van
Belkum, A., 2007. Comparison of multilocus sequence typing (MLST), pulsed-field gel
electrophoresis (PFGE), and amplified fragment length polymorphism (AFLP) for genetic
typing of Staphylococcus aureus. J Microbiol Methods 69, 371-375.
Mernelius, S., Lofgren, S., Lindgren, P.E., Blomberg, M., Olhager, E., Gunnervik, C., Lenrick, R., Thrane,
M.T., Isaksson, B., Matussek, A., 2013a. The effect of improved compliance with hygiene
guidelines on transmission of Staphylococcus aureus to newborn infants: The Swedish
Hygiene Intervention and Transmission of S aureus study. Am J Infect Control.
Mernelius, S., Lofgren, S., Lindgren, P.E., Matussek, A., 2013b. The role of broth enrichment in
Staphylococcus aureus cultivation and transmission from the throat to newborn infants:
results from the Swedish hygiene intervention and transmission of S. aureus study. Eur J Clin
Microbiol Infect Dis.
Miko, B.A., Hafer, C.A., Lee, C.J., Sullivan, S.B., Hackel, M.A., Johnson, B.M., Whittier, S., Della-Latta,
P., Uhlemann, A.C., Lowy, F.D., 2013. Molecular characterization of methicillin-susceptible
Staphylococcus aureus clinical isolates in the United States, 2004 to 2010. J Clin Microbiol 51,
874-879.
Monecke, S., Coombs, G., Shore, A.C., Coleman, D.C., Akpaka, P., Borg, M., Chow, H., Ip, M.,
Jatzwauk, L., Jonas, D., Kadlec, K., Kearns, A., Laurent, F., O'Brien, F.G., Pearson, J., Ruppelt,
A., Schwarz, S., Scicluna, E., Slickers, P., Tan, H.L., Weber, S., Ehricht, R., 2011. A field guide to
pandemic, epidemic and sporadic clones of methicillin-resistant Staphylococcus aureus. PLoS
One 6, e17936.
Monti, G., Tonetto, P., Mostert, M., Oggero, R., 1996. Staphylococcus aureus skin colonization in
infants with atopic dermatitis. Dermatology 193, 83-87.
Moreillon, P., Entenza, J.M., Francioli, P., McDevitt, D., Foster, T.J., Francois, P., Vaudaux, P., 1995.
Role of Staphylococcus aureus coagulase and clumping factor in pathogenesis of
experimental endocarditis. Infect Immun 63, 4738-4743.
Mulligan, M.E., Arbeit, R.D., 1991. Epidemiologic and clinical utility of typing systems for
differentiating among strains of methicillin-resistant Staphylococcus aureus. Infect Control
Hosp Epidemiol 12, 20-28.
Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., Erlich, H., 1986. Specific enzymatic amplification
of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol 51 Pt 1,
263-273.
Mulvey, M.R., Chui, L., Ismail, J., Louie, L., Murphy, C., Chang, N., Alfa, M., Canadian Committee for
the Standardization of Molecular, M., 2001. Development of a Canadian standardized
protocol for subtyping methicillin-resistant Staphylococcus aureus using pulsed-field gel
electrophoresis. J Clin Microbiol 39, 3481-3485.
Muyzer, G., de Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial populations by
denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified
genes coding for 16S rRNA. Appl Environ Microbiol 59, 695-700.

74
 References

Nilsson, P., Ripa, T., 2006. Staphylococcus aureus throat colonization is more frequent than
colonization in the anterior nares. J Clin Microbiol 44, 3334-3339.
Noble, W.C., Valkenburg, H.A., Wolters, C.H., 1967. Carriage of Staphylococcus aureus in random
samples of a normal population. J Hyg (Lond) 65, 567-573.
Noskin, G.A., Rubin, R.J., Schentag, J.J., Kluytmans, J., Hedblom, E.C., Smulders, M., Lapetina, E.,
Gemmen, E., 2005. The burden of Staphylococcus aureus infections on hospitals in the
United States: an analysis of the 2000 and 2001 Nationwide Inpatient Sample Database. Arch
Intern Med 165, 1756-1761.
Nouwen, J.L., Ott, A., Kluytmans-Vandenbergh, M.F., Boelens, H.A., Hofman, A., van Belkum, A.,
Verbrugh, H.A., 2004. Predicting the Staphylococcus aureus nasal carrier state: derivation
and validation of a "culture rule". Clin Infect Dis 39, 806-811.
O'Neill, A.J., Chopra, I., 2006. Molecular basis of fusB-mediated resistance to fusidic acid in
Staphylococcus aureus. Mol Microbiol 59, 664-676.
O'Neill, A.J., Larsen, A.R., Henriksen, A.S., Chopra, I., 2004. A fusidic acid-resistant epidemic strain of
Staphylococcus aureus carries the fusB determinant, whereas fusA mutations are prevalent
in other resistant isolates. Antimicrob Agents Chemother 48, 3594-3597.
O'Riordan, K., Lee, J.C., 2004. Staphylococcus aureus capsular polysaccharides. Clin Microbiol Rev 17,
218-234.
Ogawa, S.K., Yurberg, E.R., Hatcher, V.B., Levitt, M.A., Lowy, F.D., 1985. Bacterial adherence to
human endothelial cells in vitro. Infect Immun 50, 218-224.
Olive, D.M., Bean, P., 1999. Principles and applications of methods for DNA-based typing of microbial
organisms. J Clin Microbiol 37, 1661-1669.
Oliveira, D.C., de Lencastre, H., 2011. Methicillin-resistance in Staphylococcus aureus is not affected
by the overexpression in trans of the mecA gene repressor: a surprising observation. PLoS
One 6, e23287.
Oliveira, D.C., Tomasz, A., de Lencastre, H., 2002. Secrets of success of a human pathogen: molecular
evolution of pandemic clones of meticillin-resistant Staphylococcus aureus. Lancet Infect Dis
2, 180-189.
Olofsson, M., Lindgren, P.E., Ostgren, C.J., Midlov, P., Molstad, S., 2012. Colonization with
Staphylococcus aureus in Swedish nursing homes: a cross-sectional study. Scand J Infect Dis
44, 3-8.
Olofsson, M., Toepfer, M., Ostgren, C.J., Midlov, P., Matussek, A., Lindgren, P.E., Molstad, S., 2013.
Low level of antimicrobial resistance in Escherichia coli among Swedish nursing home
residents. Scand J Infect Dis 45, 117-123.
Olsen, K., Danielsen, K., Wilsgaard, T., Sangvik, M., Sollid, J.U., Thune, I., Eggen, A.E., Simonsen, G.S.,
Furberg, A.S., 2013. Obesity and Staphylococcus aureus Nasal Colonization among Women
and Men in a General Population. PLoS One 8, e63716.
Olsen, K., Falch, B.M., Danielsen, K., Johannessen, M., Ericson Sollid, J.U., Thune, I., Grimnes, G.,
Jorde, R., Simonsen, G.S., Furberg, A.S., 2012. Staphylococcus aureus nasal carriage is
associated with serum 25-hydroxyvitamin D levels, gender and smoking status. The Tromso
Staph and Skin Study. Eur J Clin Microbiol Infect Dis 31, 465-473.
Osterlund, A., Eden, T., Olsson-Liljequist, B., Haeggman, S., Kahlmeter, G., Swedish Study Group on
Fusidic Acid-resistant Staphylococcus, a., 2002. Clonal spread among Swedish children of a
Staphylococcus aureus strain resistant to fusidic acid. Scand J Infect Dis 34, 729-734.
Pallen, M.J., Loman, N.J., Penn, C.W., 2010. High-throughput sequencing and clinical microbiology:
progress, opportunities and challenges. Curr Opin Microbiol 13, 625-631.
Parras, F., Guerrero, M.C., Bouza, E., Blazquez, M.J., Moreno, S., Menarguez, M.C., Cercenado, E.,
1995. Comparative study of mupirocin and oral co-trimoxazole plus topical fusidic acid in
eradication of nasal carriage of methicillin-resistant Staphylococcus aureus. Antimicrob
Agents Chemother 39, 175-179.

75
 References

Peacock, S.J., Moore, C.E., Justice, A., Kantzanou, M., Story, L., Mackie, K., O'Neill, G., Day, N.P., 2002.
Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus
aureus. Infect Immun 70, 4987-4996.
Perl, T.M., Cullen, J.J., Wenzel, R.P., Zimmerman, M.B., Pfaller, M.A., Sheppard, D., Twombley, J.,
French, P.P., Herwaldt, L.A., Mupirocin, The Risk Of Staphylococcus Aureus Study, T., 2002.
Intranasal mupirocin to prevent postoperative Staphylococcus aureus infections. N Engl J
Med 346, 1871-1877.
Peter, W., 2006. Understanding immunology. Pearson Education Limited, Essex, Great Britain.
Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic
Acids Res 29, e45.
Pfingsten-Wurzburg, S., Pieper, D.H., Bautsch, W., Probst-Kepper, M., 2011. Prevalence and
molecular epidemiology of meticillin-resistant Staphylococcus aureus in nursing home
residents in northern Germany. J Hosp Infect 78, 108-112.
Pinchuk, I.V., Beswick, E.J., Reyes, V.E., 2010. Staphylococcal enterotoxins. Toxins (Basel) 2, 2177-
2197.
Potempa, J., Watorek, W., Travis, J., 1986. The inactivation of human plasma alpha 1-proteinase
inhibitor by proteinases from Staphylococcus aureus. J Biol Chem 261, 14330-14334.
Prokesova, L., Potuznikova, B., Potempa, J., Zikan, J., Radl, J., Hachova, L., Baran, K., Porwit-Bobr, Z.,
John, C., 1992. Cleavage of human immunoglobulins by serine proteinase from
Staphylococcus aureus. Immunol Lett 31, 259-265.
Rakeman, J.L., Bui, U., Lafe, K., Chen, Y.C., Honeycutt, R.J., Cookson, B.T., 2005. Multilocus DNA
sequence comparisons rapidly identify pathogenic molds. J Clin Microbiol 43, 3324-3333.
Reimer, L.G., Wilson, M.L., Weinstein, M.P., 1997. Update on detection of bacteremia and fungemia.
Clin Microbiol Rev 10, 444-465.
Roben, P.W., Salem, A.N., Silverman, G.J., 1995. VH3 family antibodies bind domain D of
staphylococcal protein A. J Immunol 154, 6437-6445.
Rooijakkers, S.H., van Kessel, K.P., van Strijp, J.A., 2005. Staphylococcal innate immune evasion.
Trends Microbiol 13, 596-601.
Sabat, A.J., Budimir, A., Nashev, D., Sa-Leao, R., van Dijl, J., Laurent, F., Grundmann, H., Friedrich,
A.W., Markers, E.S.G.o.E., 2013. Overview of molecular typing methods for outbreak
detection and epidemiological surveillance. Euro Surveill 18, 20380.
Sakwinska, O., Blanc, D.S., Lazor-Blanchet, C., Moreillon, M., Giddey, M., Moreillon, P., 2010.
Ecological temporal stability of Staphylococcus aureus nasal carriage. J Clin Microbiol 48,
2724-2728.
Sandberg, A., Hessler, J.H., Skov, R.L., Blom, J., Frimodt-Moller, N., 2009. Intracellular activity of
antibiotics against Staphylococcus aureus in a mouse peritonitis model. Antimicrob Agents
Chemother 53, 1874-1883.
Sangvik, M., Olsen, R.S., Olsen, K., Simonsen, G.S., Furberg, A.S., Sollid, J.U., 2011. Age- and gender-
associated Staphylococcus aureus spa types found among nasal carriers in a general
population: the Tromso Staph and Skin Study. J Clin Microbiol 49, 4213-4218.
Scriba, T.J., Sierro, S., Brown, E.L., Phillips, R.E., Sewell, A.K., Massey, R.C., 2008. The Staphyloccous
aureus Eap protein activates expression of proinflammatory cytokines. Infect Immun 76,
2164-2168.
Selander, R.K., Caugant, D.A., Ochman, H., Musser, J.M., Gilmour, M.N., Whittam, T.S., 1986.
Methods of multilocus enzyme electrophoresis for bacterial population genetics and
systematics. Appl Environ Microbiol 51, 873-884.
Shopsin, B., Gomez, M., Montgomery, S.O., Smith, D.H., Waddington, M., Dodge, D.E., Bost, D.A.,
Riehman, M., Naidich, S., Kreiswirth, B.N., 1999. Evaluation of protein A gene polymorphic
region DNA sequencing for typing of Staphylococcus aureus strains. J Clin Microbiol 37, 3556-
3563.
Sila, J., Sauer, P., Kolar, M., 2009. Comparison of the prevalence of genes coding for enterotoxins,
exfoliatins, panton-valentine leukocidin and tsst-1 between methicillin-resistant and

76
 References

methicillin-susceptible isolates of Staphylococcus aureus at the university hospital in

olomouc. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub 153, 215-218.
Smith, E.J., Visai, L., Kerrigan, S.W., Speziale, P., Foster, T.J., 2011. The Sbi protein is a multifunctional
immune evasion factor of Staphylococcus aureus. Infect Immun 79, 3801-3809.
Song, M.D., Wachi, M., Doi, M., Ishino, F., Matsuhashi, M., 1987. Evolution of an inducible penicillin-
target protein in methicillin-resistant Staphylococcus aureus by gene fusion. FEBS Lett 221,
167-171.
Stefani, S., Chung, D.R., Lindsay, J.A., Friedrich, A.W., Kearns, A.M., Westh, H., Mackenzie, F.M., 2012.
Meticillin-resistant Staphylococcus aureus (MRSA): global epidemiology and harmonisation
of typing methods. Int J Antimicrob Agents 39, 273-282.
Strindhall, J., Lindgren, P.E., Lofgren, S., Kihlstrom, E., 2002. Variations among clinical isolates of
Staphylococcus aureus to induce expression of E-selectin and ICAM-1 in human endothelial
cells. FEMS Immunol Med Microbiol 32, 227-235.
Strommenger, B., Kettlitz, C., Weniger, T., Harmsen, D., Friedrich, A.W., Witte, W., 2006. Assignment
of Staphylococcus isolates to groups by spa typing, SmaI macrorestriction analysis, and
multilocus sequence typing. J Clin Microbiol 44, 2533-2540.
Struelens, M.J., Hawkey, P.M., French, G.L., Witte, W., Tacconelli, E., 2009. Laboratory tools and
strategies for methicillin-resistant Staphylococcus aureus screening, surveillance and typing:
state of the art and unmet needs. Clin Microbiol Infect 15, 112-119.
Su, C., Lei, L., Duan, Y., Zhang, K.Q., Yang, J., 2012. Culture-independent methods for studying
environmental microorganisms: methods, application, and perspective. Appl Microbiol
Biotechnol 93, 993-1003.
Tenover, F.C., Arbeit, R.D., Goering, R.V., 1997. How to select and interpret molecular strain typing
methods for epidemiological studies of bacterial infections: a review for healthcare
epidemiologists. Molecular Typing Working Group of the Society for Healthcare Epidemiology
of America. Infect Control Hosp Epidemiol 18, 426-439.
Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A., Murray, B.E., Persing, D.H., Swaminathan,
B., 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel
electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33, 2233-2239.
Tveten, Y., Jenkins, A., Kristiansen, B.E., 2002. A fusidic acid-resistant clone of Staphylococcus aureus
associated with impetigo bullosa is spreading in Norway. J Antimicrob Chemother 50, 873-
876.
van Belkum, A., Emonts, M., Wertheim, H., de Jongh, C., Nouwen, J., Bartels, H., Cole, A., Cole, A.,
Hermans, P., Boelens, H., Toom, N.L., Snijders, S., Verbrugh, H., van Leeuwen, W., 2007. The
role of human innate immune factors in nasal colonization by Staphylococcus aureus.
Microbes Infect 9, 1471-1477.
van Belkum, A., van Leeuwen, W., Kaufmann, M.E., Cookson, B., Forey, F., Etienne, J., Goering, R.,
Tenover, F., Steward, C., O'Brien, F., Grubb, W., Tassios, P., Legakis, N., Morvan, A., El Solh,
N., de Ryck, R., Struelens, M., Salmenlinna, S., Vuopio-Varkila, J., Kooistra, M., Talens, A.,
Witte, W., Verbrugh, H., 1998. Assessment of resolution and intercenter reproducibility of
results of genotyping Staphylococcus aureus by pulsed-field gel electrophoresis of SmaI
macrorestriction fragments: a multicenter study. J Clin Microbiol 36, 1653-1659.
van Belkum, A., Verkaik, N.J., de Vogel, C.P., Boelens, H.A., Verveer, J., Nouwen, J.L., Verbrugh, H.A.,
Wertheim, H.F., 2009. Reclassification of Staphylococcus aureus nasal carriage types. J Infect
Dis 199, 1820-1826.
van den Akker, E.L., Nouwen, J.L., Melles, D.C., van Rossum, E.F., Koper, J.W., Uitterlinden, A.G.,
Hofman, A., Verbrugh, H.A., Pols, H.A., Lamberts, S.W., van Belkum, A., 2006. Staphylococcus
aureus nasal carriage is associated with glucocorticoid receptor gene polymorphisms. J Infect
Dis 194, 814-818.
van der Donk, C.F., Rijnders, M.I., Donker, G.A., de Neeling, A.J., Nys, S., Stobberingh, E.E., 2013. Is
living in a border region a risk for a high prevalence of resistance? Eur J Clin Microbiol Infect
Dis 32, 989-995.

77
 References

VandenBergh, M.F., Yzerman, E.P., van Belkum, A., Boelens, H.A., Sijmons, M., Verbrugh, H.A., 1999.
Follow-up of Staphylococcus aureus nasal carriage after 8 years: redefining the persistent
carrier state. J Clin Microbiol 37, 3133-3140.
Varga, D.T., White, A., 1961. Suppression of nasal, skin, and aerial staphylococci by nasal application
of methicillin. J Clin Invest 40, 2209-2214.
Wertheim, H.F., Melles, D.C., Vos, M.C., van Leeuwen, W., van Belkum, A., Verbrugh, H.A., Nouwen,
J.L., 2005a. The role of nasal carriage in Staphylococcus aureus infections. Lancet Infect Dis 5,
751-762.
Wertheim, H.F., van Leeuwen, W.B., Snijders, S., Vos, M.C., Voss, A., Vandenbroucke-Grauls, C.M.,
Kluytmans, J.A., Verbrugh, H.A., van Belkum, A., 2005b. Associations between Staphylococcus
aureus Genotype, Infection, and In-Hospital Mortality: A Nested Case-Control Study. J Infect
Dis 192, 1196-1200.
Wertheim, H.F., Vos, M.C., Ott, A., van Belkum, A., Voss, A., Kluytmans, J.A., van Keulen, P.H.,
Vandenbroucke-Grauls, C.M., Meester, M.H., Verbrugh, H.A., 2004. Risk and outcome of
nosocomial Staphylococcus aureus bacteraemia in nasal carriers versus non-carriers. Lancet
364, 703-705.
Williams, R.E., 1963. Healthy carriage of Staphylococcus aureus: its prevalence and importance.
Bacteriol Rev 27, 56-71.
Winn Washington , A.S., Janda William , Koneman Elmer , Procop Gary , Schreckenberger Paul ,
Woods Gail 2006. Koneman's Color Atlas and Textbook of Diagnostic Microbiology Lippincott
Williams & Wilkins, Philadelphia.
von Eiff, C., Becker, K., Machka, K., Stammer, H., Peters, G., 2001. Nasal carriage as a source of
Staphylococcus aureus bacteremia. Study Group. N Engl J Med 344, 11-16.
Vriesema, A.J., Beekhuizen, H., Hamdi, M., Soufan, A., Lammers, A., Willekens, B., Bakker, O., Welten,
A.G., Veltrop, M.H., van De Gevel, J.S., Dankert, J., Zaat, S.A., 2000. Altered gene expression
in Staphylococcus aureus upon interaction with human endothelial cells. Infect Immun 68,
1765-1772.
Yagupsky, P., Nolte, F.S., 1990. Quantitative aspects of septicemia. Clin Microbiol Rev 3, 269-279.
Zecconi, A., Scali, F., 2013. Staphylococcus aureus virulence factors in evasion from innate immune
defenses in human and animal diseases. Immunol Lett 150, 12-22.

78