Afr. J. Med. med. Sci. (2014) 43, Suppl.

Molecular characterization of Mycobacterium bovis in slaughtered cattle in

North-Central Nigeria and the public health implications
EF Ejeh1, VO Akinseye2, D Igwe3, HK Adesokan2 and SIB Cadmus2
Department of Veterinary Microbiology and Parasitology 1 , University of Maiduguri,
Department of Veterinary Public Health and Preventive Medicine 2, Faculty of
Veterinary Medicine, University of Ibadan and Virology and Molecular
Diagnostic Laboratory3 , International Institute of
Tropical Agriculture, Ibadan, Nigeria

Abstract
Background: The molecular biological techniques of
polymerase chain reaction (PCR) are accurate and rapid
diagnostic methods in the epidemiology of
Mycobacterium species in humans and animals,
especially in developing countries.
Methods: In this study, positive cultures from suspected
tuberculous lesions of slaughtered cattle from two
abattoirs in north-central Nigeria were subjected to a
two-step multiplex PCR technique, based on genus
typing and genomic regions of difference (RD).
Results: Out of 50 suspected tuberculous lesions
cultured, 40 isolates were obtained. Based on genus
typing, 32 of the isolates were identified as
Mycobacterium tuberculosis complex (MTC), one as
non-tuberculous Mycobacterium (NTM) and the
remaining seven were unclassified. Using genomic RD
multiplex PCR, all the 32 isolates initially identified as
MTC were further characterized as M. bovis.
Conclusion: Our findings show that 80% of positive
cultures from suspected tuberculous lesions were
identified as M. bovis; hence, re-confirming M. bovis
as the main cause of bovine tuberculosis in Nigeria.
These results give further credence to the use of PCR-
based molecular techniques as excellent complementary
epidemiological tools in the tracking of bovine
tuberculosis, a zoonotic disease of major public health
importance in Nigeria.
Abstract
Background: The molecular biological techniques of
polymerase chain reaction (PCR) are accurate and rapid
diagnostic methods in the epidemiology of
Mycobacterium species in humans and animals,
especially in developing countries.
Methods: In this study, positive cultures from suspected
tuberculous lesions of slaughtered cattle from two
abattoirs in north-central Nigeria were subjected to a
two-step multiplex PCR technique, based on genus
typing and genomic regions of difference (RD).
Results: Out of 50 suspected tuberculous lesions
cultured, 40 isolates were obtained. Based on genus
typing, 32 of the isolates were identified as
Mycobacterium tuberculosis complex (MTC), one as
non-tuberculous Mycobacterium (NTM) and the
remaining seven were unclassified. Using genomic RD
multiplex PCR, all the 32 isolates initially identified as
MTC were further characterized as M. bovis.
Conclusion: Our findings show that 80% of positive
cultures from suspected tuberculous lesions were
identified as M. bovis; hence, re-confirming M. bovis
as the main cause of bovine tuberculosis in Nigeria.
These results give further credence to the use of PCR-
based molecular techniques as excellent complementary
epidemiological tools in the tracking of bovine
tuberculosis, a zoonotic disease of major public health
importance in Nigeria.

Keywords: Tuberculosis, Polymerase chain Key words: Tuberculosis, Polymerase chain

reaction, diagnosis, Genus typing, Region of reaction, diagnosis, Genus typing, Region of
difference deletion typing. difference deletion typing.

Correspondence: Dr S.I.B. Cadmus, Department of Veterinary
Public Health and Preventive Medicine, University of Ibadan,
Ibadan, Nigeria. E-mail: simeonc5@gmail.com
Introduction
Tuberculosis (TB) remains a disease of major public
health importance with an estimated 8.6 million new
cases and 1.4 million deaths reported globally in 2012
[1]. It is caused by acid-fast bacteria belonging to
members of the Mycobacterium tuberculosis complex
 EF Ejeh, VO Akinseye, D Igwe, HK Adesokan and SIB Cadmus
(MTC), which include: M. tuberculosis, M. bovis, M.
caprae, M. africanum, M. microti, M. canettii and
M. pinnipedi. Bovine tuberculosis (bTB) caused
primarily by M. bovis is a zoonotic disease found mainly
in developing countries where control measures are
largely non-existent, and the disease is accentuated by
poor hygiene practices [2]. It constitutes a significant
economic burden to the livestock industry [3], resulting
in a huge global economic loss totaling over $3 billion
annually [4]. In Africa, bTB represents a major
challenge in livestock production, and this is worsened
by poverty and lack of coordinated control and
eradication programmes, leading up to significant public
health threat. Consequently, the disease impacts
negatively on human livelihood in the region by
compromising sustainable food supply, income and social
status [5]. Although in recent times various studies have
provided information on the importance of zoonotic TB
in Africa, the extent of the disease in humans and
livestock is still largely unknown [6-9].
In Nigeria, there are limited studies on bTB,
and most of those available were based on pathological
examinations of suspected tuberculous organs at the
abattoirs [2, 10]. Other studies involved few tuberculin
skin tests in cattle herds [11-13] and scanty reports on
bacterial isolation and molecular characterization [6, 9,
14-17]. Furthermore, most studies on culture and
Fig. 1: A map of Benue State showing Makurdi and Otukpo Local Government Areas where abattoir studies were carried out.
molecular typing so far reported in Nigeria were based
on animals screened in southwestern Nigeria [6, 9, 14-
15], where the cattle population is low compared to
northern Nigeria with abundance of cattle [18].
In carrying out molecular epidemiology of TB,
several methods have been explored and the level of
sophistication deployed depends on the resources
available in such settings [19]. However, majority of
these molecular methods are based on the polymerase
chain reaction (PCR), a technique widely used in
identifying and differentiating members of the genus
Mycobacterium [19-20]. To date, PCR techniques are
widely used on wildlife species and cattle for the
differentiation of mycobacteria of the MTC from those
of non-tuberculous mycobacteria (NTM), as well as
for more specific differentiation of M. bovis from other
members of the MTC [21-23].
The aim of this study therefore was to use a
two-step multiplex PCR technique based on genus
typing and genomic regions of difference (RD) deletion
typing to confirm and characterize members of the
MTC from positive cultures obtained from suspected
tuberculous lesions of slaughtered cattle in abattoirs in
North-Central Nigeria.
 Molecular characterization of Mycobacterium bovis
Materials and methods
Study area
Sample collection was carried out in two major abattoirs
(i.e. Otukpo and Makurdi Abattoirs) in Benue State,
northern-central Nigeria (Fig.1). Like most states in
north-central Nigeria, livestock activities and the risks
of transmission of zoonotic diseases abound in Benue
State. This is evident in indiscriminate human-animal
interactions in deplorable hygiene conditions that could
faciltate disease transmission, particularly among the
Fulani (i.e. the nomadic cattle-rearing etnic group of
Northern Nigeria) and other livestock workers (i.e.
marketers, butchers, meat handlers, meat inspectors
and veterinarians).
Sample collection and processing
After careful post-mortem examination following the
World Animal Health Organisation (OIE) procedures
[24], suspected tuberculous lesions were identified and
obtained from slaughtered cattle between July and
December, 2012. Samples collected were placed in
labelled sterile screw-capped, leak-proof specimen
containers and frozen at -20 0 C until they were
processed. The tissues were processed as earlier
described [6, 14]. Thereafter, they were inoculated on
Lowenstein-Jensen slopes with pyruvate and/or glycerol
and incubated at 37C for 12 weeks. Isolates were
harvested for molecular typing by scraping the growth
from a slope into 200 l of 7H9 Middlebrook broth and
heating at 80C for 1 h.
Table 1: Genus typing primers
Primer Name Primer sequence Product
size
MYCGEN-F AGAGGTTGATCCTGGCTCAG 1030bp
MYCGEN-R TGCACACAGGCCACAAGGGA
MYCGEN-F AGAGGTTGATCCTGGCTCAG 180bp
MYCAV-R ACCAGAAGACATGCGTCTTG
MYCINT-F CCTTTAGGCGCATGTCTTTA 850bp
MYCGEN-R TGCACACAGGCCACAAGGGA
TB1-F GAACAATCCGGAGTTGACAA 372bp
TB1-R AGCACGCTGTCAATCATGTA
Mycobacterium genus typing
The Mycobacterium genus typing is a multiplex PCR
technique that involves the amplification of species-
specific DNA fragments for the identification of
Mycobacterium spp.. It also simultaneously
differentiates species of the MTC from those of NTM.
This PCR technique uses six different primers that
target a sequence region within the 16S rRNA gene
specific for the genus Mycobacterium (Table 1). In
our study, PCR amplification pr ocedure and
interpretation of results were carried out as previously
described by Wilton and Cousins [25]. Briefly, heat-
killed mycobacterial isolates from culture-positive
samples were used as DNA template. DNA
amplification was done in a thermocycler with each
reaction mixture containing 2l DNA template, 5l of
Q-buffer, 10X Buffer, 25mM MgCl2, 4l 10 mM
dNTPs, 0.5l of each primer (50 pmol / l) and 0.2l
HotStarTaq DNA polymerase (Qiagen, Hilden,
Germany) which was made up to 25l with ultra-pure
water. The reaction mixture was then heated in a
Programme Thermal Controller (MyGene Series Peltier,
Model MG 96+) using the following amplification
programme: 95 C for 10 min for enzyme activation,
followed by 35 cycles at 95C for 1 min for denaturation,
61C for 0.5 min for annealing, and 72C for 2 min for
extension. After the last cycle, the samples were
incubated at 72C for 10 min. Thereafter, PCR
amplification products were fractionated by
electrophoresis in 3.0% agarose in 1 X TBE pH 83 at
6 V/cm for 4 h, and visualized by staining with ethidium
bromide [26].
Table 2: Deletion typing primers
Primer Primer sequence Product size
Name
RD1 AAGCGGTTGCCGCCGACCGACC Present (146bp)
CTGGCTATATTCCTGGGCCCGG
GAGGCGATCTGGCGGTTTGGGG
RD4 ATGTGCGAGCTGAGCGATG Present (172bp)
TGTACTATGCTGACCATGCG Absent (268bp)
AAAGGAGCACCATCGTCCAC
RD9 CAAGTTGCCGTTTCGAGCC Present (235bp)
CAATGTTTGTTGCGCTGC Absent (108bp
GCTACCCTCGACCAAGTGTT
RD12 GGGAGCCCAGCATTTACCTC Present (369bp)
GTGTTGCGGGAATTACTCGG Absent (306bp)
AGCAGGAGCGGTTGGATATTC
Region of difference (RD) deletion typing
Region of difference deletion typing is a multiplex PCR
technique that differentiates members of the MTC by
amplifying genomic regions of difference (RD1, RD4,
RD9, and RD12) (Table 2). This method identifies
specific strains based on the presence and,or absence
of the RD-region. PCR amplification procedures were
carried out as earlier described [26]. Each reaction
 EF Ejeh, VO Akinseye, D Igwe, HK Adesokan and SIB Cadmus

Fig. 2: Electrophoretic fractionation of PCR products in 3% agarose from the genus typing of the isolates. Lanes 1-9 and 11-19: M.
tuberculosis complex; Lanes 10 & 20: Non mycobacteria species, Lane 21: H37Rv, Lane 22: M. avium, Lane M: molecular weight marker
(100 bp ladder).

mixture consisted 1l DNA template, 5l Q-buffer, 2.5l Results

10 buffer, 2l 25 mM MgCl2, 4l 10 mM dNTPs, Overall, 249 animals were examined, 20 of which
0.5l of each primer (50 pmol / l), 0.125l HotStarTaq altogether had 50 tuberculous lesions from various
plus DNA polymerase (Qiagen, Hilden, Germany), and predisposed sites including the lungs, liver, kidney,
was made up to 25l with ultra-pure water. The reaction pleura, spleen and lymph nodes, with 80.0% (40/50)
mixture was then heated in the thermocycler using the of these yielding positive growth by culture (Table
following amplification procedure: 95C for 15 min for 3).
enzyme activation, followed by 45 cycles at 94C for 1
min, 62C for 1 min, and 72C for 1 min. After the last Genus typing
cycle, the samples were incubated at 72C for 10 min. Using genus typing, 33 of the isolates were identified
PCR amplification products were fractionated by as belonging to the Genus Mycobacteria (Fig.2).
electrophoresis in 3.0% agarose in 1xTBE pH 83 at Specifically, 32 of the isolates showed bands typical
6V/cm for 4 h, and visualized by staining with ethidium of the members of the MTC (i.e. produced PCR
bromide [26]. products at 1030 bp and 372 bp), one NTM (i.e.
produced PCR products at 1030 bp and 180 bp) and
Table 3: Mycobacterial growth from suspected tuberculosis the remaining seven did not generate any visible band.
lesions
Deletion typing
Growth on Lowenstein- Jensen Media
Using deletion typing, all the 32 isolates earlier
Predilection Total samples Number Number identified by genus typing as MTC were confirmed
sites processed by Positive Negative as M. bovis judging fr om the PCR pr oducts
culture (%) (%) generated (indicating whether regions RD1, RD4,
RD9, and RD12 were absent or present in the
Lungs 16 13 (81.3) 3 (18.8)
respective mycobacterial isolates) (Fig.3). This
Liver 4 4 (100.0) 0 (0.0)
Lymph nodes 22 15 (68.2) 7 (31.8)
implies that 64.0% (32/50) of earlier suspected TB
Spleen 4 4 (100.0) 0 (0.0) lesions from the slaughtered cattle were caused by
Kidney 1 1 (100.0) 0 (0.0) M. bovis. Overall, all the isolates (100%) from the
Heart 1 1 (100.0) 0 (0.0) spleen, kidney, heart and pleura, as well as 76.9%,
Pleura 1 2 (100.0) 0 (0.0) 75.0% and 73.3% of isolates from the lungs, liver
Total 50 40 (80.0) 10 (20.0) and lymph nodes respectively, were classified as M.
bovis (Table 4).
 Molecular characterization of Mycobacterium bovis

Fig. 3: Electrophoretic fractionation of PCR products in 3% agarose. Lanes 1-9, Lanes 11-19 & 21 show bands typical of M.bovis, Lane
22 is the reference strain H37Rv Lane M is the molecular weight marker (100 bp ladder).

Table 4: Summary of the molecular typing of isolates from different organs/tissues

Organs Isolates M. bovis NTM No amplification

Lungs 13 10 (76.9) (0.0) 3 (23.1)

Liver 4 3 (75.0) (0.0) 1 (25.0)
Lymph nodes 15 11 (73.3) 1(6.7) 3 (20.0)
Spleen 4 4 (100.0) 0 (0.0) 0 (0.0)
Kidney 1 1 (100.0) 0(0.0) 0 (0.0)
Pleura 2 2 (100.0) 0 (0.0) 0 (0.0)
Diaphragm 0 0 (0.00) 0 (0.0) 0 (0.0)
Total 40 32 (80.00) 1(2.50) 7 (17.50)

Discussion primary cause of bTB among the infected cattle, and

Using a combination of culture and two-step multiplex
PCR techniques, it was found that 64.0% (32/50) of
earlier suspected TB lesions from slaughtered cattle in
North-Central Nigeria were caused by M. bovis. This
finding provides unequivocal evidence regarding the
etiology of bTB among slaughtered cattle, which
strengthened findings fr om our post-mortem
examination, as well as corroborated earlier work done
by Pavlik et al. [27] in Czech Republic. The approach
explored in this study provides a simple, straightforward,
unambiguous and specific PCR-based typing method
that explicitly identifies M. bovis. As previously
reported, the PCR technique enables the rapid and
accurate identification of members of MTC [26].
Moreimportantly, our findings confirm M. bovis as the
re-emphasise its endemicity in the Nigerian cattle
population. Again, since the RD1 region was intact in
all the 32 M. bovis isolates, this shows that they were
not products of vaccination against bTB. More so,
vaccination of cattle against bTB is not carried out in
Nigeria.
It is worth emphasizing that M. bovis infection
in cattle remains a disease of major public health
concern in most developing countries, and equally
constitutes a significant economic challenge to the
livestock industry in developed countries like the United
Kingdom [28-29]. Although several reports have
indicated the endemicity of bTB in the Nigerian cattle
population [6, 10, 12-13, 15,16], epidemiological tracking
of the disease has been made problematic by dearth of
 EF Ejeh, VO Akinseye, D Igwe, HK Adesokan and SIB Cadmus
diagnostic facilities. Therefore, control measures are
difficult to implement with the consequence of zoonotic
transmission of the disease to those directly involved in
livestock business and to the general public [30]. A clear
indication of this was the isolation of M. bovis from
some livestock workers in Nigeria [31] and in a two-
year old girl whose parents were reported to be involved
in livestock business [32]. Other reports of M. bovis
infection in humans have also been made in different
parts of Nigeria and these were attributable to
consumption of unpasteurized milk and other milk
products from infected animals [17, 33-35].
Co-incidentally, none of the isolates recovered
from this study was M. tuberculosis. This is confirmed
by the absence of the RD9 and RD12 regions from the
32 isolates using the deletion typing technique. Though
previous reports have indicated the presence of M.
tuberculosis in slaughtered cattle in Nigeria [9, 16],
the non- isolation of this species in the present study
does not preclude its presence from infected cattle in
the region. Nevertheless, judging from the high
prevalence of HIV/AIDS and concomitant human TB
infections in the study area [36], it is plausible to suggest
that human-to-animal transmission of M. tuberculosis
may exist. Therefore, further large scale epidemiological
investigations will be required to confirm the possibility
of this mode of transmission in Northern Nigeria and
other parts of the country, as was done in Ethiopia and
other parts of Africa [37-41].
Again, the 80% growth rate and subsequent
64% confirmation of M. bovis from the 50 lesions
cultured demonstrate that routine post-mortem
examination of slaughtered cattle is useful as an ancillary
tool in the diagnosis of bTB. This is particularly relevant
in resource-limited settings where bTB and NTM are
endemic. This assertion is in agreement with earlier
reports [42-44] that indicated meat inspection as a
predictor of bTB in slaughtered cattle in Ethiopia and
Nigeria.
Our findings notwithstanding, this study had
some limitations. Firstly, the strains of M. bovis obtained
were not further differentiated into smaller clusters using
methods like the spoligotyping and variable number of
tandem repeats (VNTR). These additional typing
techniques would have allowed comparison of these
strains with those obtained from cattle and humans in
earlier studies in Nigeria, thereby providing deeper
insights into the epidemiology of bTB in the country.
Secondly, livestock workers in the study area were not
screened for TB and therefore, it was impossible to
determine the occurrence of zoonotic transmission of
the disease.
Conclusion
Findings from this study demonstrate the usefulness of
a two-step multiplex PCR technique in identifying M.
bovis from suspected tuberculous lesions among cattle
slaughtered in abattoirs in Nigeria. The study also
reveals that M. bovis is the dominant species of MTC
circulating among infected cattle in the region; hence,
demonstr ating the effectiveness of PCR-based
molecular techniques in the diagnosis and
epidemiological investigation of bTB. Finally,
considering the public health implications of M. bovis
infection among the cattle screened, we recommend
public health education campaigns as well as the
screening of livestock workers in the region for
tuberculosis in order to curtail the spread of the disease.
References
1. WHO. Global tuberculosis report 2013. http://
www.who.int/tb/publication/ global report/2013/
gtbr 13 full.pdf. Accessed 10 January 2014.
2. Igbokwe IO, Madaki IY, Danburam S, Ameh JA,
Aliyu MM and Nwosu CO. Prevalence of
pulmonary tuberculous lesions in cattle
slaughtered in abattoirs in North-Eastern Nigeria.
Revue dElevage et de Medecine Veterinaire des
Pays Tropicaux 2001; 54: 191194.
3. Krebs J. Bovine Tuberculosis in Cattle and
Badgers. Ministry of Agriculture, Fisheries and
Food Publications;; London, United Kingdom.
1997.
4. Steele JH. Regional and Country Status Report.
In: Thoen C.O. and Steele J.H. (Eds.)
Mycobacterium bovis infection in animals and
humans, Iowa press, Ames. 1996; 169172.
5. World Health Organization. The Control of
Neglected Zoonotic Diseases. A route to poverty
allevation.. Geneva, World Health Organization,
2006. Ref Type: Report
6. Cadmus S, Palmer S, Melissa O, James D and
Karen G. Molecular analysis of human and bovine
tubercle bacilli from a local setting in Nigeria. J
Clin Microbiol 2006; 44: 2934.
7. Ameni G, Desta F and Firdessa R. Molecular
typing of Mycobacterium bovis isolated from
tuberculosis lesions of cattle in north-eastern
Ethiopia. Vet Rec 2010; 167: 138141.
 Molecular characterization of Mycobacterium bovis
8. Michel AL, Muller B and Van Helden PD.
Mycobacterium bovis at the animal-human
interface: a problem, or not? Vet Microbiol 2010;
140: 371381.
9. Jenkins AO, Cadmus SIB, Venter EH,et al.
Molecular epidemiology of human and animal
tuberculosis in Ibadan, South-western Nigeria. Vet
Microbiol 2011, 139 147.
10. Aliyu MM, Adamu JY and Bilyaminu YA. Current
prevalence of tuberculous lesions among
slaughtered cattle in northeastern states of
Nigeria. Revue lev. Md. vt. Pays trop 2009;
62: 13-16.
11. Yohanna CA, Ijabone IF and Cadmus SIB.
Prevalence of bovine tuberculosis using single
comparative intradermal tubeculin test (SCITT)
in Fulani herds in Nasarawa state, north central
Nigeria. Sokoto J. Vet Sci 2008; 7(2): 46-48.
12. Danbirni S, Okaiyeto SO, Joshua IA, Sackey KB,
Anthony KC and Abdulkadir IA. Prevalence of
tuberculosis in a herd of cattle of a tuberculous
herdman following trace back information from
a hospital in Taraba State, Nig J Animal Prod Adv
2012; 325-328.
13. Ibrahim S, Cadmus SIB, Umoh JU, et al.
Tuberculosis in humans and cattle in Jigawa State,
Nigeria: risk factors analysis. Vet Med Int 2012;
12: 1- 5.
14. Cadmus SIB, Atsanda, NN, Oni SO and Akang
EEU. Bovine tuberculosis in one cattle herd in
Ibadan in Nigeria. Vet. Med. Czech 2004; 49:
406412.
15. Cadmus SI, Adesokan HK, Jenkins AO and van
Soolingen D. Mycobacterium bovis and M.
tuberculosis in goats, Nigeria. Emerg Infect Dis
2009; 15: 2066-2067.
16. Cadmus SI, Yakubu MK and Magaji AA.
Mycobacterium bovis, but also M africanum
present in raw milk of pastoral cattle in north-
central Nigeria. Trop Animl Hlth Prod 2010; 42:
10471048.
17. Abubakar A. Epidemiology of human and bovine
tuberculosis in the Federal Capital Territory and
Kaduna State of Nigeria. PhD Thesis 2007.
University of Plymouth; xxiii + 166pp
18. Blench R. Traditional Livestock Breeds:
Geographical Distribution and Dynamics in
Relation to the Ecology of West Africa, Overseas
Development Institute, London, UK 1999.
19. Pavlik I, Dvorska L, Bartos M, et al. Molecular
epidemiology of bovine tuberculosis in the Czech
Republic and Slovakia in the period 19652001
studied by spoligotyping Vet Med Czech 2002;
47: 181194
20. Anonymous. Bovine tuberculosis. Manual of
diagnostic tests and vaccines for terrestrial
animals: Office International des Epizooties (OIE),
2009; Chapter 2.4.7.
21. Kazwala RR. Molecular epidemiology of bovine
tuberculosis in Tanzania. Ph.D. Thesis, 1997,
University of Edinburgh.
22. Miller J, Jenny A, Rhyan J, Saari D and Suarez
D. Detection of Mycobacterium bovis in
formalin-fixed, paraffin-embedded tissues of cattle
and elk by pcr amplification of an IS6110 sequence
specific for Mycobacterium tuberculosis
complex organisms. J Vet Diagn Invest 1997; 9:
244249.
23. Cleaveland S, Mlengeya T, Kazwala RR, et al.
Tuberculosis in Tanzanian wildlife. J Wildlife Dis
2005; 41: 446-453.
24. Office International des Epizooties. OIE terrestrial
manual 2008.
25. Wilton S and Cousins D. Detection and
identification of multiple mycobacterial pathogens
by DNA amplification in a single tube. PCR Meth
Appl 1992; 1(4): 269 273.
26. Warren RM, Gey Van Pittius NC, Barnard M, et
al. Differentiation of Mycobacterium tuberculosis
complex by PCR amplification of genomic regions
of difference. Int J Tuberc Lung Dis 2006; 10:
818- 822.
27. Pavlik I, Ayele WY, Parmova I. et al. Incidence
of bovine tuberculosis in cattle in seven Central
European countries during the years 19901999.
Veterinarni Medicina 2002b; 47: 4551.
28. Krebs J. Bovine Tuberculosis in Cattle and
Badgers. Ministry of Agriculture, Fisheries and
Food Publications; London, United Kingdom.
1997.
29. de la Rua-Domenech R. Human Mycobacterium
bovis infection in the United Kingdom: incidence,
risks, control measures and review of the zoonotic
aspects of bovine tuberculosis Tuberculosis 2006;
86: 77109.
30. Cadmus SIB. T he transmission chain of
Mycobacterium bovis from cattle to humans and
within the human settings in Nigeria: facts, realities
and the way forward. Trop Vet 2010; 28: 1-12.
 EF Ejeh, VO Akinseye, D Igwe, HK Adesokan and SIB Cadmus
31. Adesokan HK, Jenkins AO, van Soolingen D and
Cadmus SIB. Mycobacterium bovis infection in
livestock workers in Ibadan, Nigeria: evidence of
occupational exposure. Int J Tuberc and Lung Dis
2012; 16: 13881392.
32. Cadmus S, Oluwasola OA and Gordon S. Molecular
methods for the accurate assessment of
Mycobacterium bovis infection. Int J Tuberc and
Lung Dis 2005; 9: 705.
33. Alhaji I. Bovine tuberculosis in four northern states
of Nigeria. PhD Thesis 1976. Ahmadu bello
University, Zaria, Nigeria; vii +236 pp.
34. Idrisu A and Schnur renberger P. Public
significance of bovine tuberculosis in four northern
states of Nigeria: a mycobacteriological study. Nig
Med J 1977; 7: 384 387.
35. Idigbe EO, Anyiwo C.E and Onwujekwe DI.
Human pulmonary infection with bovine and
atypical mycobacteria in Lagos, Nigeria. J Trop
Med Hyg 1986; 89: 143 148.
36. Federal Ministry of Health, Nigeria Technical
Report. National HIV prevalence: Sentinel survey
among pregnant women attending antenatal clinics
in Nigeria. National HIV sero-prevalence sentinel
survey 2008.
37. Ameni G and Erkihum A. Bovine tuberculosis on
small-scale dairy farms in Adama Town, central
Ethiopia, and farmer awareness of the disease.
Rev. sci. tech. Off. int. Epiz 2007; 26: 711-719.
38. Asiimwe B. Molecular characterization of
Mycobacterium tuberculosis complex from
Kampala, Uganda. PhD Thesis 2008. Makerere
University, Uganda. iv + 30pp.
39. Berg S, Firdessa R, Habtamu M, et al. The Burden
of Mycobacterial Disease in Ethiopian Cattle:
Implications for Public Health. PLoS One 2009;
4: e5068. DOI: 10.1371/journal.pone.0005068.
40. Mamo G, Abebe F, Legesse M, et al. Molecular
epidemiology of M. tuberculosis complex using
spoligotyping and MIRU-VNTR typing and
zoonotic transmission of M. bovis in PTB patients
of Afar Pastoral Region of Ethiopia. TB Research
Annual Conference & Commemoration of World
TB Day March 21-24, 2013; Addis Ababa
Ethiopia.
41. Mallard K, McNerney R, Crampin AC, et al.
Molecular detection of mixed infections of
Mycobacterium tuberculosis strains in sputum
samples from patients in Karonga district,
Malawi. J Clin Microbiol 2010; 48: 45124518.
42. Cadmus SIB, Alonge DO and Adesokan HK.
Meat inspection and cultural isolation of
Mycobacteria as predictors of bovine
tuberculosis in Ibadan, Nigeria. Trop Vet 2007;
25: 101-105.
43. Bekele M and Belay I. Evaluation of routine meat
inspection procedure to detect bovine tuberculosis
suggestive lesions in Jimma Municipal Abattoir,
South West Ethiopia. Global Veterinaria 2011; 6:
172-179.
44. Aylate A, Shah SN, Aleme H and Gizaw TT. Bovine
tuberculosis: prevalence and diagnostic efficacy of
routine meat inspection procedure in Woldiya
municipality abattoir north Wollo zone, Ethiopia. Trop
Anim Health Prod 2013; 45, 855-864.