diversity

Article
Molecular Assisted Identification Reveals Hidden
Red Algae Diversity from the Burica Peninsula,
Pacific Panama
David Wilson Freshwater 1, *, Jennifer N. Idol 1 , Seth L. Parham 1 , Cindy Fernndez-Garca 2 ,
Noemi Len 3 , Paul W. Gabrielson 4 and Brian Wysor 5
1 Center for Marine Science, University of North Carolina at Wilmington, Wilmington, NC 28409, USA;
Jennifer.Idol@jax.org (J.N.I.); sethlparham@gmail.com (S.L.P.)
2 Centro de Investigacin en Ciencias del Mar y Limnloga y Escuela de Biologa, Universidad de Costa Rica,
San Jos 2060, Costa Rica; cindy.fernandezgarcia@ucr.ac.cr
3 Departmento de Botnica, Universidad de Panam, Panam 4, Panam; leon.noemi@gmail.com
4 NCU Herbarium, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599-3280, USA;
drseaweed@hotmail.com
5 Department of Biology, Marine Biology & Environmental Science, Roger Williams University,
Bristol, RI 02809, USA; bwysor@rwu.edu
* Correspondence: freshwaterw@uncw.edu; Tel.: +1-910-962-2375

Academic Editor: Rupert Ormond

Received: 31 January 2017; Accepted: 8 April 2017; Published: 14 April 2017

Abstract: The marine flora of Panama harbors a rich diversity of green, red and brown algae,
and despite chronic understudy, it is reported as the second most diverse marine flora along the
Pacific Central American coast, with 174 macroalgal species. Extensive new collections and molecular
assisted identification (MAI) by an international team of researchers has revealed an even greater
diversity for this country. Here, the intertidal and shallow subtidal marine flora of the remote
Burica Peninsula is introduced. This area is characterized by an uplifted extensive intertidal flat
composed of firm, sedimentary benthos known as mudrock, on which abundant algal communities
thrive, even during extended periods of exposure. A collection of nearly 200 brown, green and red
macroalgae specimens representing the first marine floristic inventory of this region was made in
January 2011, and results of analyses of 45 foliose red algae specimens are presented. DNA sequence
data for several loci (rbcL-3P; COI-5P; UPA) have been generated for molecular assisted identification
and to guide morphological assessments. Twenty-six species were identified among the specimens
including 21 new Pacific Panama records, as well as previously unrealized transisthmian distributions,
and two new species, Neorubra parvolacertoides sp. nov. and Grateloupia irregularis sp. nov.

Keywords: COI-5P; DNA barcoding; marine algae; marine floristics; Pacific Panama; rbcL; UPA

1. Introduction
. . . our surroundings seemed ideal for successful work with the marine floraexcept for the one
unhappy fact, which gradually became apparent, that a marine flora, in the ordinary sense, was in
that region almost non-existent.
Marshall Avery Howe [1]

The study of marine algae from the Pacific coast of Panama had an inauspicious start. An extreme
tidal amplitude and often hot and dry conditions make the intertidal environment of Pacific Panama
inhospitable for most marine algae and the subtidal region has only rarely been explored. This is
especially true for the Gulf of Chiriqui. Taylor [2] made limited, collections of marine algae from the

Diversity 2017, 9, 19; doi:10.3390/d9020019 www.mdpi.com/journal/diversity

Diversity 2017, 9, 19 2 of 39
Diversity 2017, 9, 19 2 of 38
This is especially true for the Gulf of Chiriqui. Taylor [2] made limited, collections of marine algae
from the middle and eastern regions of the Gulf during the 1934 and 1939 Allan Hancock
middle and eastern regions of the Gulf during the 1934 and 1939 Allan Hancock expeditions to the
expeditions to the Galapagos Islands. Only a few subsequent efforts followed in this region and
Galapagos Islands. Only a few subsequent efforts followed in this region and substantial marine algal
substantial marine algal collections had only been made around the Coiba Island world heritage site
collections had only been made around the Coiba Island world heritage site [3,4].
[3,4].
The Burica Peninsula is a phycologically unexplored region in the western Gulf of Chiriqui,
The Burica Peninsula is a phycologically unexplored region in the western Gulf of Chiriqui, and
and Punta Burica, the southernmost point of the peninsula, is a relatively remote area accessible by
Punta Burica, the southernmost point of the peninsula, is a relatively remote area accessible by
motorized vehicle only at low tide (Figure 1). There are no known collecting sites or reports of marine
motorized vehicle only at low tide (Figure 1). There are no known collecting sites or reports of
macroalgae from this area [5]. In contrast, multiple collections had been made along the immediately
marine macroalgae from this area [5]. In contrast, multiple collections had been made along the
adjacent southeastern coast of Costa Rica [2,6], however, these have all been from sites within Golfo
immediately adjacent southeastern coast of Costa Rica [2,6], however, these have all been from sites
Dulce and not along the western coast of the Burica Peninsula.
within Golfo Dulce and not along the western coast of the Burica Peninsula.
The Punta Burica intertidal zone is distinctive from other sites throughout the region, in being
The Punta Burica intertidal zone is distinctive from other sites throughout the region, in being
composed of compacted, fine-grained, layered sedimentary rock known as mudstone. This layered
composed of compacted, fine-grained, layered sedimentary rock known as mudstone. This layered
substratum has a block-in-matrix texture at various scales produced by sedimentary processes, and has
substratum has a block-in-matrix texture at various scales produced by sedimentary processes, and
been thrust at an angle to the ground (Figure 1B,C) owing to tectonic activity dating back 3060 Ka [7,8].
has been thrust at an angle to the ground (Figure 1B,C) owing to tectonic activity dating back 3060
It is the product of thrust sheets of the NW margin of the Caribbean plate being forced over the
Ka [7,8]. It is the product of thrust sheets of the NW margin of the Caribbean plate being forced over
subducting Nazca plate, along the Cocos Ridge. The differential integrity of these tilted marine
the subducting Nazca plate, along the Cocos Ridge. The differential integrity of these tilted marine
sediments, thought to be of Charcoal Azul or Armuelles formations [7], results in layers of intact
sediments, thought to be of Charcoal Azul or Armuelles formations [7], results in layers of intact
benthos, separated by eroded channels that form labyrinths of interconnected channels and pools on
benthos, separated by eroded channels that form labyrinths of interconnected channels and pools on
the ebb tide (Figure 1C). The compacted sediments can be easily broken by a light hammer, but are
the ebb tide (Figure 1C). The compacted sediments can be easily broken by a light hammer, but are
also not compromised under the weight of a small truck. These traits appear to make the Burica
also not compromised under the weight of a small truck. These traits appear to make the Burica
intertidal an adequate habitat for the colonization of marine algae, characterized by turfs and biofilms
intertidal an adequate habitat for the colonization of marine algae, characterized by turfs and
of microfilamentous and encrusting algae that occupy exposed substrates at low tide (Figure 1D).
biofilms of microfilamentous and encrusting algae that occupy exposed substrates at low tide
Colonization of this habitat may be facilitated by the ability of turf algae to penetrate a porous and
(Figure 1D). Colonization of this habitat may be facilitated by the ability of turf algae to penetrate a
laminated surface that also retains moisture. In addition, the entrainment of water in small intertidal
porous and laminated surface that also retains moisture. In addition, the entrainment of water in
pools supports the development of small, foliose algal communities (Figure 1E).
small intertidal pools supports the development of small, foliose algal communities (Figure 1E).

Figure 1. (A) Map showing the location of Punta Burica along the Pacific coast of Panama. Collection
Figure 1. (A) Map showing the location of Punta Burica along the Pacific coast of Panama. Collection
sites
sites are
are shown
shown as as dots
dots onon inset:
inset: (1)
(1) intertidal
intertidal mudstone
mudstone substrate
substrateand
andtide
tide pools,
pools,near
nearMono
MonoFeliz,
Feliz,
Punta Burica; (2) shallow subtidal mixed sediment-rock substrate just beyond the
Punta Burica; (2) shallow subtidal mixed sediment-rock substrate just beyond the surf zone, near Mono surf zone, near
Mono Feliz, Burica;
Feliz, Punta Punta Burica; (3) subtidal
(3) subtidal rock and rock andsubstrate
bolder bolder substrate
southwest southwest of Isla(4)
of Isla Burica; Burica; (4) high
high intertidal
intertidal rock, east side of Burica peninsula; (B) Vehicle on the road to Punta Burica
rock, east side of Burica peninsula; (B) Vehicle on the road to Punta Burica with extensive intertidal with extensive
intertidal
mudstonemudstone layersatexposed
layers exposed low tide;at(C) low tide;Burica
Punta (C) Punta Burica
intertidal andintertidal
shallow and shallow
subtidal subtidal
habitat: long,
habitat: long, shallow tide pools formed by the erosion of intertidal mudstone layers
shallow tide pools formed by the erosion of intertidal mudstone layers thrust on angles and deeper thrust on angles
and deeper
channels channels (D)
to seaward; to Turf
seaward; (D) Turf algal
algal community community
growing growing
on intertidal on intertidal
mudstone mudstone
substrate; (E) Tide
substrate; (E) Tide
pool algal community. pool algal community.
Diversity 2017, 9, 19 3 of 38

Molecular Assisted Identification (MAI) uses relatively short DNA sequences to cluster specimens
into species for further phylogenetic and morphological analyses [9]. Where appropriate baseline
data is available, DNA sequences may be used as DNA barcodes to provide objective species
identifications of specimens [10]. Saunders [11] and Robba et al. [12] introduced the five prime
end of the mitochondrial marker cytochrome c oxidase subunit 1 (COI-5P) for DNA barcoding in
red algae and many subsequent studies have demonstrated its utility for species delimitation and
identification e.g., [1315]. Domain V of the plastid-encoded large ribosomal subunit gene, which is
also referred to as the Universal Plastid Amplicon (UPA) and the RuBisCO large subunit gene (rbcL),
specifically the 30 end of this locus (rbcL-3P) are other DNA sequences that have been used to delimit
and identify red macroalgae e.g., [1618].
Here MAI results based on three DNA loci (rbcL-3P, COI-5P and UPA) and morphological
characters for foliose marine red macroalgae collected from Punta Burica, Panama are presented,
and when suitable background data is available, their phylogenetic relationships explored.
An unrealized diversity of species including many new records for Pacific Panama and the eastern
tropical Pacific are revealed. Two new species are described and others identified that may represent
new species, but require additional study. That 26 species are documented among 45 specimens, from
a preliminary investigation spanning only 3 days of field work, foreshadows a likely productivity of
further field investigations coupled with MAI methods, and contradicts the apparent non-existent
diversity mentioned by Howe [1].

2. Materials and Methods

Marine macroalgae were collected at four sites around Punta Burica, Panama during 810 January
2011 (Figure 1A). Specimens were sorted in the field, a herbarium specimen made and a portion of
the thallus dried with silica gel desiccant [19]. When specimens were small and possibly included
a mixture of species, the entire collection was silica gel dried, brought back to the lab, and sorted
after rewetting. Vouchers (herbarium specimens and/or permanent slides) for all collections were
accessioned in the David J. Seiren Herbarium at the University of North Carolina Wilmington (WNC),
and duplicates deposited in the herbaria of the University of Panama (UPAN), the University of Costa
Rica (USJ), and Roger Williams University. Specimen collection data is publically available at doi:
www.dx.doi.org/10.5883/DS-RAPBPAN.
Silica gel dried specimens were rewet with seawater and sorted to insure monospecificity of samples.
Total genomic DNA was extracted from these samples following the protocol of Hughey et al. [20] or
using the illustra Nucleon Phytopure Genomic DNA Extraction Kit (GE Healthcare, Pittsburgh, PA, USA).
Three different loci UPA, COI-5P and rbcL-3P were targeted for amplification and sequencing in this
study. PCR amplifications were set up and run as described in Freshwater et al. [21] and Mamoozadeh
and Freshwater [9]. Successful amplifications were cleaned using a StrataPrep PCR Purification Kit
(Stratagene, La Jolla, CA, USA) and used as templates in BigDye Terminator v.3 (ThermoFisher Scientific,
Foster City, CA, USA) sequencing reactions. Sequence reactions were cleaned with a Zymo DNA
Sequencing Clean up Kit (Zymo Research, Irvine, CA, USA) and run on an ABI 3130xl Genetic Analyzer
(ThermoFisher Scientific). Primers used in amplification and sequencing reactions are shown in Table 1.
Amplifications with the rbcL-3P primer pair also spanned the rbcL-rbcS spacer region, but this locus was
specifically analyzed for only the collected Asparagopsis specimens.

Table 1. Oligonucleotide primers used in the amplification and sequencing of three loci from marine
red algae of Punta Burica, Panama.

Locus Primer Sequence Citation

COI-5P GHalF TCAACAAATCATAAAGATATYGG [22]
GazR1 ACTTCTGGATGTCCAAAAAAYCA [11]
GWSFn TCAACAAAYCAYAAAGATATYGG [13]
GWSRx ACTTCTGGRTGICCRAARAAYCA [23]
rbcL-3P F753 GGAAGATATGTATGAAAGAGC [24]
RrbcSstart GTTCCTTGTGTTAATCTCAC Modified from [24]
Diversity 2017, 9, 19 4 of 38

Table 1. Cont.

Locus Primer Sequence Citation

5P-rbcL 1 F57 GTAATTCCATATGCTAAAATGGG [24]
R893 GAATAAGTTGARTTWCCIGCAC [25]
UPA p23SrV-f1 GGACAGAAAGACCCTATGAA [16]
p23SrV-r1 TCAGCCTGTTATCCCTAGAG [16]
1 Used to generate the larger rbcL segments for Polysiphonia sensu lato species.

Individual sequence reactions were compiled and edited using Sequencher (Gene Codes
Corporation, Ann Arbor, MI, USA) and final sequences accessioned in the BOLD and GenBank
databases. Accession numbers and sequences are available at doi: dx.doi.org/10.5883/DS-RAPBPAN.
Alignments of the different loci were constructed using MUSCLE [26] as implemented in the Geneious
software package (Biomatters Limited, Aukland, New Zealand) and adjusted by eye. UPGMA cluster
diagrams were generated from alignments of the three loci with the Geneious tree builder option and
Jukes-Cantor distances. These analyses were done exclusively to cluster sequences by similarity for
genetic species definition, and UPGMA was used explicitly to indicate that phylogenetic relationships
were not inferred. Closest taxonomic affinities of the cluster-analyses defined genetic species were
determined by BLAST [27] queries. DNA sequence data sets to examine the phylogenetic relationships
of individual species were compiled from GenBank, aligned using MUSCLE and analyzed with
RAxML [28] and MrBayes [29] as implemented in Geneious. Data matrix dimensions and specific
methodologies for these analyses are included in Supplementary Material Table S1.

3. Results
3.1. Overall Barcoding Cluster Analyses
Forty-five samples of foliose red algae were included in this study, and sequence data for at least
two of the three targeted loci were generated for all but two of the samples (Table 2). Cluster analyses
of the UPA data resulted in 24 clusters or individual sequences at least 1.1% different from the next
closest cluster/sequence (Figure 2A). These clusters and individual sequences were considered to
represent sequence-based species. Sequence variation within clusters of multiple specimens ranged
from 00.5%. The maximum intra-cluster value was for the Gelidium specimens that rbcL-3P and COI-5P
analyses indicated were different species and the next highest intra-cluster sequence variation was
0.3%. Cluster analysis of rbcL-3P also revealed 24 sequenced-based species (Figure 2B). Intra-cluster
sequence variation ranged from 00.5%, and clusters or individual sequences were at least 0.9%
different. As with the UPA data, the maximum intra-cluster variation value was between specimens
of Ceratodictyon that formed distinct clusters in UPA and COI-5P analyses. The next highest rbcL-3P
intra-cluster variation value was only 0.1%. The species identified by cluster analyses of these two data
sets were identical except that the UPA cluster diagram did not clearly differentiate the two Gelidium
species collected, and the rbcL-3P cluster diagram did not clearly differentiate the two Ceratodoctyon
species collected. The analysis of the COI-5P data clearly differentiated 26 sequenced-based species
(Figure 2C) including all those in the UPA and rbcL-3P data. Intra-cluster variation ranged from 00.3%,
and clusters or individual sequences were at least 6.5% different.
Initial assessments by BLAST searches provided identifications at the genus level for all sequenced
specimens (Table 2), but in some cases investigation of the current generic nomenclature was required
because of changes that had occured since the submission of sequences into GenBank. Examples of
this were the specimens of Hommersandiophycus and Ceratodictyon. Positive species identifications
based on BLAST results were also possible for some specimens. The study of Centroceras by Won et
al. [30] populated GenBank with rbcL sequence data for multiple species and provided the contex
by which positive identifications of PHYKOS-4594 and PHYKOS-4600 as C. gasparrini were made.
Similarly, Grusz and Freshwater [31] and Boo et al. [32] deposited rbcL and COI sequences for Gelidium
sclerophyllum type specimens in GenBank and this allowed the positive identification of PHYKOS-4514,
4629, and 4645 as this species.
Diversity 2017, 9, 19 5 of 38

Table 2. MAI Identification, PHYKOS database collection number and closest BLAST result for 45 red algal collections from Punta Burica, Panama. Values in
parentheses represent BLAST maximum identity scores. 1 First report from Pacific Panama; 2 First report from the tropical East Pacific. " = BLAST result is identical to
that of the previous PHYKOS number.

PHYKOS rbcL-3P COI-5P UPA

MAI ID Coll. No. BLAST BLAST BLAST
1 Tricleocarpa cylindrica (J. Ellis and
4617 Tricleocarpa cylindrica (98%) - Dichotomaria marginata and Galaxaura rugosa (97%)
Solander) Huisman and Borowitzka
4634 Tricleocarpa cylindrica (96%)
1,2
Hommersandiophycus borowitzkae Ganonema yoshizaki and Hommersandiophycus
4618 Hommersandiophycus borowitzkae (99%) Ganonema yoshizakii (91%)
(Huisman) S.-M. Lin and Huisman borowitzkae (99%)
1 Izziella sp. 4576 Izziella formosana (98%) Izziella orientalis (95%) Izziella formosana (100%)
4599 -
1 Liagora ceranoides J.V. Lamouroux 4614 Liagora ceranoides (100%) Liagora sp. (96%) Liagora ceranoides (99%)
1 Neoizziella asiatica S.-M. Lin, S.-Y.
4619 Neoizziella asiatica (100%) Neoizziella divaricata (99%) Neoizziella asiatica (100%)
Yang and Huisman
1 Gelidium sclerophyllum W.R. Taylor 4514 - Gelidium sclerophyllum (98%) Gelidium sclerophyllum (100%)
4629 Gelidium sclerophyllum (100%) -
4645

1 Gelidium floridanum and

Gelidium sp. 4564 Gelidium floridanum and G. sclerophyllum (99%) Gelidium sclerophyllum (99%)
Gelidium sp. (94%)
4566
4597
Millerella myriocladus, M. tinerfensis and M.
Millerella sp. 4570 Milerella myriocladus (86%) Millerella sp. (97%)
felicinii (93%)
Asparagopsis sp. 4636 Asparagopsis taxiformis (97%) Asparagopsis taxiformis (100%) Asparagopsis taxiformis (100%)
4646 - -
1 Plocamium sp. 4643 Plocamium pacificum [as P. cartilagineum] (99%) Plocamium pacificum (95%) Plocamium cartilagineum and P. telfairiae (99%)
1,2 Hypnea flava Nauer, Cassano and
4574 Hypnea flava (99%) Hypnea spinella (96%) Hypnea spinella (99%)
M.C. Oliveira
Hypnea pannosa J. Agardh 4631 Hypnea pannosa (100%) Hypnea panosa (99%) Hypnea nudifica + 4 others (99%)

1,2 Grateloupia angusta, G.

Neorubra parvolacertoides sp. nov. 4528 Neorubra decipiens (96%) Grateloupia phuquocensis + 6 others (98%)
taiwanensis (91%)
4589
Diversity 2017, 9, 19
MAI ID
1,2 Grateloupia irregularis sp. nov.
1 Ceratodictyon repens (Ktzing)
R.E. Norris
1,2 Ceratodictyon scoparium (Montagne
and Millardet) R.E. Norris
1 Gracilaria tikvahiae, G. cuneifolia and
Gracilaria sp.1
1 Gracilaria sp.2
1 Gracilaria damaecornis, G. isabellana, G. chouae
Gracilaria sp.3
1,2
Aglaothamnion sp.
Centroceras gasparrinii (Meneghini)
Ktzing
1,2 Spyridia sp.
1 Melanothamnus
Melanothamnus sp.
1,2 Polysiphonia binneyi Harvey
1,2 Polysiphonia sp.
Wilsonosiphonia howei (Hollenberg)
D. Bustamante, Won and T.O. Cho
6 of 38
Table 2. Cont.
PHYKOS rbcL-3P COI-5P UPA
Coll. No. BLAST BLAST BLAST
4522 Grateloupia dichotoma and G. filicina (97%) Prionitis filiformis (92%) Grateloupia phuquocensis (99%)
4556
4620
4627 - Ceratodictyon scoparia (94%) Ceratodictyon scoparia (99%)
4632 Ceratodictyon repens (100%)
4635
4590 Ceratodictyon sp. Calerita (100%) Ceratodictyon scoparium (99%) Ceratodictyon scoparium (100%)
4640 Gracilaria incurvata (94%) Gracilaria parvispora + 6 others (99%)
G. isabellana (97%)
4519 - Gracilaria galetensis (92%) Gracilaria galetensis (98%)
4541 Gracilaria galetensis (97%)
4630
Gracilaria isabellana,
4548 Gracilaria parvispora + 7 others (99%)
and G. parvispora (98%) G. caudata (94%)
Callithamnion tetragonum and Callithamnion corymbosum and
4553 Aglaothamnion halliae and A. hookeri (96%)
Aglaothamnion sp. (91%) Aglaothamnion spp. (96%)
4594 C. gasparrini (100%) Centroceras clavulatum (94%) Centroceras sp. (99%)
4600
4584 - Spyridia filamentosa (95%) -
4568 Melanothamnus pseudovillum (98%) Melanothamnus spp. and Polysiphonia spp. (98%)
pseudovillum (97%)
4534 Polysiphonia binneyi (99%) Polysiphonia echinata (93%) Polysiphonia sp. (97%)
4515 Polysiphonia sp. (99%) Polysiphonia sp. (99%) Herposiphonia sp., Symphyocladia latiuscula (97%)
4525
4526
4552 -
4657 Wilsonosiphonia howei (99%) - Wilsonosiphonia howei (99%)
4663 Wilsonosiphonia howei (97%) -
Diversity 2017, 9, 19 7 of 38
Diversity 2017, 9, 19 7 of 39

Figure
Figure 2.
2. UPGMA
UPGMAcluster
clusterdiagrams
diagramsforforthree
threesequenced
sequencedloci:
loci:(A)
(A)UPA,
UPA,(B)
(B)rbcL-3P,
rbcL-3P,(C)
(C) COI-5P.
COI-5P.
Boxed
Boxed species
species were
were not
not clearly
clearly separated
separated by
by the
the analysis.
analysis.

3.2.
3.2. Species
Species Treatments
Treatments

3.2.1.
3.2.1. Tricleocarpa
Tricleocarpa cylindrica (J. Ellis and Solander) Huisman and Borowitska
Sequences
Sequences from fromPHYKOS-4617
PHYKOS-4617 andand PHYKOS-4634
PHYKOS-4634 were were
found found to bematches
to be closest closesttomatches
Tricleocarpa to
Tricleocarpa
species, with species, with
a closest a closesttohomology
homology rbcL-3P and to rbcL-3P
COI-5P and COI-5Pof sequences
sequences specimens ofidentified
specimens as
identified
Tricleocarpaas Tricleocarpa
cylindrica (Tablecylindrica (Table 2).
2). Phylogenetic Phylogenetic
analyses analyses
of Tricleocarpa of Tricleocarpa
species species resolved
rbcL-3P sequences rbcL-3P
sequences resolved
the Punta Burica the Punta
specimens Burica
within a T.specimens
cylindrica within
clade thata T.includes
cylindrica clade thatfrom
specimens includes specimens
the Indo-Pacific,
from the Indo-Pacific,
Hawaiian Islands and Hawaiian
CaribbeanIslands
(Figureand 3A).Caribbean
The Punta(Figure
Burica 3A). The Punta
specimens wereBurica
weakly specimens
grouped
were weaklylikelihood
(maximum grouped (maximum
bootstrap [ML] likelihood
= 76%; bootstrap
Bayesian [ML] = 76%; Bayesian
posterior posterior
probabilities [PP] probabilities
= 0.84) with
[PP] = 0.84)from
specimens withThailand,
specimens from Thailand,
Indonesia Indonesiawithin
and Guadeloupe and Guadeloupe within data
this clade. COI-5P this isclade. COI-5P
available for
data
mostisofavailable
these same for specimens
most of these andsame specimens
analyses of this and
locusanalyses of this locus
more strongly supportsmore (MLstrongly
= 96; PPsupports
= 0.91)
(ML = 96; PP = 0.91)
this relationship this3B).
(Figure relationship (Figure 3B).among
Percent divergences Percent T. divergences among
cylindrica rbcL-3P and T. COI-5P
cylindrica rbcL-3P
sequences
and
rangedCOI-5P
from sequences
0.02.0% and ranged fromrespectively.
0.07.3%, 0.02.0% and 0.07.3%,
Pairwise respectively.
divergences Pairwise
between divergences
the Punta Burica
between
specimensthe andPunta Burica
the most specimens
closely and the in
allied specimens most closely alliedanalyses
the phylogenetic specimens werein the phylogenetic
1.52.0% for rbcL-3P
analyses werefor
and 1.64.7% 1.52.0%
COI-5P.for rbcL-3P and 1.64.7% for COI-5P.
The
The specimens
specimens were collected from two different different habitats.
habitats. PHYKOS-4617
PHYKOS-4617 was was growing
growing on on
mudstone substrateinintide
mudstone substrate tide pools
pools alongalong the Punta
the Punta BuricaBurica shoreline,
shoreline, while PHYKOS-4634
while PHYKOS-4634 was collected was
collected fromboulders
from subtidal subtidal atboulders at 35off
35 m depth m the
depth off the southwest
southwest point of Islapoint of Isla
Burica Burica
(Figure 1). (Figure 1). The
The specimens
specimens
were heavily were heavily
calcified calcified
except except
at the at the non-calcified
non-calcified joints, and joints, and had dichotomously
had dichotomously branched
branched cylindrical
cylindrical axes that were constricted at branch points (Figure 4A,B).
axes that were constricted at branch points (Figure 4A,B). They had relatively few, longitudinally They had relatively few,
longitudinally
oriented medullary orientedcellmedullary
filaments; cell filaments;
inflated inflated
subsurface subsurface
cells, and fused, cells,polygonal
and fused, polygonal
surface cells
surface
(Figure cells
4C). (Figure 4C).
Remarks:
Remarks: Previous
Previous studies
studies [33,34]
[33,34] found
found thatthat specimens
specimens of of Tricleocarpa
Tricleocarpa from
from a wide geographic
geographic
range matched the
range matched themorphology
morphologydescribed
describedfor forT.T. cylindrica
cylindrica [35],
[35], butbut varied
varied greatly
greatly in their
in their rbcLrbcLand and
COI
COI sequences,
sequences, suggesting
suggesting the presence
the presence of cryptic
of cryptic species.species. Both PHYKOS-4617
Both PHYKOS-4617 and PHYKOS-4634
and PHYKOS-4634 matched
matched the morphological
the morphological concept ofconcept of T. cylindrica,
T. cylindrica, and they are andresolved
they arewithresolved
varying with varying
levels levels of
of support in
support in aincludes
a clade that clade that includes
specimens from specimens
the Caribbean from where
the Caribbean
the type was where the type
collected. was collected.
However, the level
However,
of sequence thevariation
level of sequence
between variation
the Puntabetween the Punta Burica
Burica specimens specimens
and other specimensand other
in thisspecimens
clade are
in this clade
greater than the areintraspecific
greater thanvalues
the intraspecific
that have been valuesfoundthat
in have
manybeenstudiesfound
i.e., in manyand
[36,37], studies
althoughi.e.,
[36,37], and although T. cylindrica is assigned to the Punta Burica specimens here, a world-wide
reassessment of the species is needed to determine its true distribution. Tricleocarpa cylindrica has
Diversity 2017, 9, 19 8 of 38

Diversity
T. 2017,is
cylindrica 9, assigned
19 to the Punta Burica specimens here, a world-wide reassessment of the species 8 of 39
Diversity 2017,
is needed 9, 19
to determine 8 offrom
its true distribution. Tricleocarpa cylindrica has been recorded previously 39

both the Caribbean and Pacific coasts of Central America e.g., [5,38,39]. This is the first report ofe.g.,
been recorded previously from both the Caribbean and Pacific coasts of Central America the
been recorded
[5,38,39]. ThisPacific previously
is the from
first report bothspecies
of the the Caribbean andPanama.
from Pacific Pacific coasts of Central America e.g.,
species from Panama.
[5,38,39]. This is the first report of the species from Pacific Panama.

Figure 3. Maximum likelihood trees for the (A) rbcL-3P alignment of Tricleocarpa species and
Figure
Figure 3. 3.Maximum
Maximumlikelihood
likelihood trees
trees for
for the
the (A)
(A) rbcL-3P
rbcL-3Palignment
alignmentofofTricleocarpa
Tricleocarpaspecies and
species (B)(B)
and T. T.
(B) T. cylindrica specimen COI-5P sequences. Bootstrap support and Bayesian posterior probability
cylindricaspecimen
cylindrica specimenCOI-5P
COI-5Psequences.
sequences. Bootstrap
Bootstrap support
supportandandBayesian
Bayesianposterior
posteriorprobability values
probability values
values are given for branches when >70% and >0.75, respectively.
areare given
given forbranches
for brancheswhen
when>70%
>70% and
and >0.75,
>0.75, respectively.
respectively.

Figure 4. Tricleocarpa cylindrica. (A) Herbarium specimen, scale = 1 cm; (B) Surface view of whole
Figure 4. Tricleocarpa cylindrica. (A) Herbarium specimen, scale = 1 cm; (B) Surface view of whole
Figure
mount4.showing
Tricleocarpa cylindrica.joints
non-calcified (A) Herbarium
at branchingspecimen,
point, scalescale
= 500= m;
1 cm;(C)(B) Surface view
Transverse ofwith
section whole
mount showing non-calcified joints at branching point, scale = 500 m; (C) Transverse section with
mount showing
widely non-calcified
spaced medullary joints
filaments at branching
(arrows) point,
and inflated scale = 500
subsurface cellsm; (C) Transverse
(arrowheads), scale = section
50 m. with
widely spaced medullary filaments (arrows) and inflated subsurface cells (arrowheads), scale = 50 m.
widely spaced medullary filaments (arrows) and inflated subsurface cells (arrowheads), scale = 50 m.
3.2.2. Hommersandiophycus borowitzkae (Huisman) S.-M. Lin and Huisman
3.2.2. Hommersandiophycus borowitzkae (Huisman) S.-M. Lin and Huisman
3.2.2. Hommersandiophycus
BLAST searches of the borowitzkae
rbcL-3P (Huisman)
sequence for S.-M. Lin and Huisman
PHYKOS-4618 revealed a 99% similarity with
BLAST
specimens searches
of of the rbcL-3P
Hommersandiophycus sequence
borowitzkae. for
The PHYKOS-4618
UPA sequence revealed
BLAST showeda 99% similarity
a 99% with
similarity
BLAST searches of the rbcL-3P sequence for PHYKOS-4618 revealed a 99% similarity with
specimens of Hommersandiophycus
with specimens borowitzkae.
of both H. borowitzkae The UPA sequenceHuisman,
and Ganonema BLAST showed a 99%andsimilarity
specimens of Hommersandiophycus borowitzkae. The UPAyoshizaki
sequence BLAST showed I.A. Abbott A.R.
a 99% similarity
with specimens
Sherwood, of both
and H. borowitzkae
BLASTand Ganonema yoshizaki Huisman,(Table
I.A. Abbott and A.R. Sherwood,
with specimens oftheboth
COI-5P
H. borowitzkae showed no close
and Ganonema homology
yoshizaki Huisman, 2). I.A.
Hommersandiophycus
Abbott and A.R.
and the
species COI-5P
were BLAST
resolved asshowed
a no
strongly close
to fully homology
supported (Table
clade 2).
(maximumHommersandiophycus
likelihood species
bootstrap [ML]were
=
Sherwood, and the COI-5P BLAST showed no close homology (Table 2). Hommersandiophycus
resolved
99%; as a strongly
Bayesian to fully
posterior supported
probabilities clade
[PP] = (maximum
1.00) in likelihood
phylogenetic bootstrap
analyses of [ML] =sequences
rbcL-3P 99%; Bayesian
for
species were resolved as a strongly to fully supported clade (maximum likelihood bootstrap [ML] =
Liagoraceae
posterior species (Figure
probabilities [PP] =5). PHYKOS-4618
1.00) in phylogeneticis positioned
analyses in aofclade
rbcL-3Pwithsequences
H. borowitzkae
for specimens
Liagoraceae
99%; Bayesian posterior probabilities [PP] = 1.00) in phylogenetic analyses of rbcL-3P sequences for
species (Figure 5). PHYKOS-4618 is positioned in a clade with H. borowitzkae specimens fromTseng)
from Taiwan and The Philippines (ML = 87%; PP = 1.00) that is sister to H. samaensis (C.K. Taiwan
Liagoraceae species (Figure 5). PHYKOS-4618 is positioned in a clade with H. borowitzkae specimens
andShowe M. Lin and(ML
The Philippines Huisman.
= 87%; The
PP =Western
1.00) thatPacific H. to
is sister borowitzkae
H. samaensis specimens shared
(C.K. Tseng) identical
Showe rbcL
M. Lin and
from Taiwan and The Philippines (ML = 87%; PP = 1.00) that is sister to H. samaensis (C.K. Tseng)
sequences
Huisman. Thethat were only
Western 0.2%
Pacific H.different
borowitzkaefrom that of theshared
specimens Panama specimen.
identical rbcLDivergences
sequences thatbetween
were H.
only
Showe M. Lin and Huisman. The Western Pacific H. borowitzkae specimens shared identical rbcL
borowitzkae
0.2% differentspecimens and sequences available from other Hommersandiophycus
between H. borowitzkae species specimens
ranged from
sequences
3.99.1%. thatfrom
werethat of the
only 0.2%Panama
different specimen.
from thatDivergences
of the Panama specimen. Divergences between and
H.
sequences available from other Hommersandiophycus species ranged from 3.99.1%.
borowitzkae specimens and sequences available from other Hommersandiophycus species ranged from
3.99.1%.
Diversity 2017, 9, 19 9 of 38
Diversity 2017, 9, 19 9 of 39

HQ901777 Neoizziella asiatica Philippines

JX878370 Neoizziella asiatica Australia
HQ901788 Neoizziella asiatica Taiwan
88/-
PHYKOS-4619 Neoizziella asiatica
100
JX878371 Neoizziella asiatica New Caledonia
1.0
89 HQ901780 Neoizziella asiatica Taiwan
88/-
0.99 HQ901778 Neoizziella asiatica Taiwan (type)
77/0.90
HQ901781 Neoizziella divaricata Taiwan
88
1.0 LC066218 Otohimella japonica Japan
-/0.74 JX878368 Macrocarpus perennis Australia
100 GU357693 Titanophycus validus Bahamas
74 1.0 GU357694 Titanophycus setchellii Taiwan
1.0
KP238491 Akalaphycus setchelliae Taiwan
96 GU357678 Liagora viscida Spain
1.0 HM572263 Liagora harveyana New Zealand
-/0.83
HQ901786 Liagora albicans Taiwan
0.95
GU357679 Liagora boergesenii Taiwan
92
0.96 GU357681 Liagora ceranoidesTaiwan
100 GU357682 Liagora ceranoides FL, USA
1.0 JX878367 Liagora ceranoides Australia
91 91 PHYKOS-4614 Liagora ceranoides
1.0 1.0 100 GU357688 Izziella formosana Taiwan
100 1.0 GU357689 Izziella formosana Taiwan
75 1.0
PHYKOS-4576 Izziella sp.
78 73 0.96
0.99
GU357685 Izziella kuroshioensis Taiwan
0.99
GU357690 Izziella hommersandii Taiwan
GU357696 Stenopeltis gracilis Taiwan
100 KP238496 Helminthora lindaueri New Zealand
74 1.0 KP238494 Helminthora divaricata Ireland
0.97 KF667095 Hommersandiophycus borowitzkae Taiwan
71/- KF667093 Hommersandiophycus borowitzkae Taiwan
87 KF667097 Hommersandiophycus borowitzkae Philippines
88 1.0
0.84 1.0
PHYKOS-4618 Hommersandiophycus borowitzkae
99
KF667102 Hommersandiophycus samaensis Taiwan
1.0
93
KF667098 Hommersandiophycus clavatus Taiwan
1.0 100 KF667107 Trichogloeopsis mucosissima Japan
1.0 KF667108 Trichogloeopsis pedicellata Bahamas
100 GU357700 Ganonema farinosum Philippines
1.0 GU357699 Ganonema farinosum Taiwan
98 GU357701 Helminthocladia australis Taiwan
98 1.0 KP238492 Helminthocladia calvadosii Spain
1.0
JX878365 Cumagloia andersonii OR, USA
HQ901787 Dermonema virens Taiwan 0.1

Figure
Figure 5.
5. Maximum
Maximum likelihood
likelihood tree
tree for
for Liagoraceae
Liagoraceae species
species rbcL-3P
rbcL-3P sequences
sequences with
with Punta
Punta Burica
Burica
species
species shown bold font.
shown in bold font. Bootstrap
Bootstrapsupport
supportand
andBayesian
Bayesianposterior
posterior probability
probability values
values areare given
given for
for branches
branches when
when >70%
>70% andand >0.75,
>0.75, respectively.
respectively.

PHYKOS-4618 was collected from mudstone substrate in a tide pool along the Punta Burica
PHYKOS-4618 was collected from mudstone substrate in a tide pool along the Punta Burica
shoreline (Figure 1).
shoreline (Figure 1).
Remarks: Hommersandiophycus borowitzkae was originally described as Ganonema borowitzkae
Remarks: Hommersandiophycus borowitzkae was originally described as Ganonema borowitzkae
Huisman based on Western Australia specimens [40]. Lin et al. [41] established Hommersandiophycus
Huisman based on Western Australia specimens [40]. Lin et al. [41] established Hommersandiophycus
for G. borowitzkae and two other Ganonema species after molecular and morphological analyses
for G. borowitzkae and two other Ganonema species after molecular and morphological analyses resolved
resolved these species in a distinct clade with a number of synapomorphic characters states for
these species in a distinct clade with a number of synapomorphic characters states for carpogonial
carpogonial branches and carposporophytes. The examined PHYKOS-4618 specimen was male and
branches and carposporophytes. The examined PHYKOS-4618 specimen was male and matched the
matched the description of spermatangia initials being cut off from subapical cells and developing in
description of spermatangia initials being cut off from subapical cells and developing in clusters [41]
clusters [41] (Figure 6A,B). The species was known only from East Asia (Taiwan, The Philippines)
(Figure 6A,B). The species was known only from East Asia (Taiwan, The Philippines) and Western
and Western Australia, and this is the first report from the Eastern Pacific.
Australia, and this is the first report from the Eastern Pacific.

3.2.3.
3.2.3. Izziella
Izziellasp.
sp.
Sequences
Sequences ofof PHYKOS-4576
PHYKOS-4576 and and PHYKOS-4599
PHYKOS-4599shared sharedidentical
identicalCOI-5P
COI-5Pand
andUPA
UPA sequences,
sequences,
but
but an rbcL-3P sequence was only generated from PHYKOS-4576. These sequences werewere
an rbcL-3P sequence was only generated from PHYKOS-4576. These sequences found
found to
to have
have closest
closest homology
homology to sequences
to sequences from Izziella
from Izziella formosana
formosana (Yamada)
(Yamada) ShoweS.-Y.Yang
Showe M.Lin, M.Lin, S.-Y.Yang and
and Huisman
Huisman (rbcL-3P, UPA) and I. orientalis (J. Agardh) Huisman and Schils (COI-5P) in BLAST
searches (Table 2). An Izziella clade received weak (ML = 73%) to strong (PP = 0.99) support in the
identified as I. orientalis that share identical sequences. The COI-5P sequence divergence between
specimens from Panama and Hawaii is 5%.
The PHYKOS-4576 and PHYKOS-4599 specimens were collected from intertidal pools along the
Punta Burica shoreline (Figure 1). They were 89 cm in height and irregularly branched with many
short branchlets (Figure 6C). Assimilatory filaments had cylindrical lower cells and ellipsoidal to
Diversity 2017, 9, 19 10 of 38
obovoid upper cells (Figure 6D).
Remarks: Four Izziella species are currently recognized and distinguished by size, branching and
specifics of carpogonial
(rbcL-3P, UPA) branches
and I. orientalis and involucral
(J. Agardh) Huisman filaments [42,43].
and Schils Two in
(COI-5P) of BLAST
these species,
searches are(Table
known 2).
onlyIzziella
An from Taiwan. Izziellaweak
clade received orientalis
(MLhas beento
= 73%) recorded in both
strong (PP = 0.99)thesupport
Indian and Pacific
in the Oceans, rbcL-3P
Liagoraceae while I.
formosana,(Figure
analyses originally described fromwas
5). PHYKOS-4576 Taiwan,
fully was also recently
supported as the reported
sister taxafrom
to I.Pacific Costa
formosana andRica [39].
rbcL-3P
This is the first report of an Izziella species from Pacific Panama. Few Liagoraceae
sequence divergences between the sequenced specimens were only 2.4%. The only COI-5P sequence are reported along
the Pacific
data available coast of Centralis America
in GenBank for three [5], and thefrom
specimens family
the is little studied
Hawaiian Islandsinidentified
the region. as The Punta
I. orientalis
Burica specimens likely represent a new Izziella species, but a better understanding
that share identical sequences. The COI-5P sequence divergence between specimens from Panama and of Eastern Pacific
Liagoraceae
Hawaii is needed to make this determination.
is 5%.
The PHYKOS-4576 and PHYKOS-4599 specimens were collected from intertidal pools along the
3.2.4. Liagora
Punta Buricaceranoides
shoreline J.V. Lamouroux
(Figure 1). They were 89 cm in height and irregularly branched with many
shortBLAST
branchlets (Figure 6C). Assimilatory
searches with the PHYKOS-4614 filaments
sequenceshadrevealed
cylindrical loweraffinity
a closest cells and ellipsoidal
with specimensto
obovoid
identifiedupper cells (Figure
as Liagora 6D).(rbcL-3P), Liagora sp. (COI-5P), and L. ceranoides (UPA) (Table 2).
ceranoides
LiagoraRemarks:
speciesFour Izziellaaspecies
formed are currently
well supported recognized and
monophyletic distinguished
clade (ML = 92%; by size,
PP =branching
0.96) in and
the
specifics of carpogonial branches and involucral filaments [42,43]. Two of these
Liagoraceae rbcL-3P analyses (Figure 5). PHYKOS-4614 was resolved within a clade of L. ceranoides species, are known
only
specimens collectedIzziella
from Taiwan. orientalis geographic
from multiple has been recorded in both
locations. the Indian
The rbcL-3P and Pacific
sequence Oceans,within
divergences while
I. formosana,
this clade were only 0.00.3% despite the wide geographic separation of the analyzed specimens.[39].
originally described from Taiwan, was also recently reported from Pacific Costa Rica
This PHYKOS-4614
is the first reportwasof an Izziella species
collected from Pacific
from mudstone Panama.inFew
stubstrate tideLiagoraceae
pool alongare thereported along
Punta Burica
the Pacific(Figures
shoreline coast of1C Central America
and 6C). It was[5], and the family
moderately is little
calcified studied insmall
and relatively the region. The Punta
(3 cm high), with
Burica specimens likely represent a new Izziella species, but a better understanding
sparse, irregular branching proximally and prolific, widely dichotomous branching distally (Figure of Eastern Pacific
Liagoraceae is needed
6E). The ultimate branchesto make
were this determination.
generally short, 12 mm diameter tapering to 0.5 mm diameter apices.

Figure 6. Liagoraceae species of Punta Burica. (A) Habit of Hommersandiophycus borowitzkae, scale = 1
Figure 6. Liagoraceae species of Punta Burica. (A) Habit of Hommersandiophycus borowitzkae, scale = 1 cm;
cm; (B) Clusters of spermatangia (arrows) developing on H. borowitzkae assimilatory filaments, scale
(B) Clusters of spermatangia (arrows) developing on H. borowitzkae assimilatory filaments, scale = 20 m;
= 20Izziella
(C) m; (C) Izziella
sp. in sp. in
situ; (D) situ;sp.
Izziella (D)assimilatory
Izziella sp. filaments,
assimilatory filaments,
scale = 50 m;scale = 50 m;
(E) Liagora (E) Liagora
ceranoides habit,
ceranoides habit, scale = 1 cm; (F) Neoizziella asiatica habit, scale = 1 cm; (G) N. asiatica assimilatory
scale = 1 cm; (F) Neoizziella asiatica habit, scale = 1 cm; (G) N. asiatica assimilatory filament with 5-celled
filament with
carpogonial 5-celled
branch carpogonial
(arrow), scale = branch
20 m; (arrow), scale =carposporophyte
(H) N. asiatica 20 m; (H) N. asiatica carposporophyte
with terminal chains of
with terminal chains of carposporangia
carposporangia (arrows), scale = 20 m. (arrows), scale = 20 m.

3.2.4. Liagora ceranoides J.V. Lamouroux

BLAST searches with the PHYKOS-4614 sequences revealed a closest affinity with specimens
identified as Liagora ceranoides (rbcL-3P), Liagora sp. (COI-5P), and L. ceranoides (UPA) (Table 2). Liagora
species formed a well supported monophyletic clade (ML = 92%; PP = 0.96) in the Liagoraceae rbcL-3P
analyses (Figure 5). PHYKOS-4614 was resolved within a clade of L. ceranoides specimens collected
from multiple geographic locations. The rbcL-3P sequence divergences within this clade were only
0.00.3% despite the wide geographic separation of the analyzed specimens.
Diversity 2017, 9, 19 11 of 38

PHYKOS-4614 was collected from mudstone stubstrate in tide pool along the Punta Burica
shoreline (Figures 1C and 6C). It was moderately calcified and relatively small (3 cm high), with
sparse, irregular branching proximally and prolific, widely dichotomous branching distally (Figure 6E).
The ultimate branches were generally short, 12 mm diameter tapering to 0.5 mm diameter apices.
Remarks: Morphologically PHYKOS-4614 closely matched descriptions of L. ceranoides [44,45].
Liagora ceranoides was originally described from the Virgin Islands in the Western Atlantic, and it has
been reported in tropical waters around the globe. Although Lin et al. [45] demonstrated that some
specimens identified as L. ceranoides in the Indo-Pacific represented a different genus and species, they
also showed that L. ceranoides was distributed in Indo-Pacific as well as Western Atlantic. This species
has been reported from the Pacific coast of Costa Rica [5]. Taylor [2] stated that it was common in
Golfo Dulce, Costa Rica, which opens to the Pacific on the western side of the Burica penninsula, but it
was not found during recent sampling.

3.2.5. Neoizziella asiatica Showe M. Lin, S.-Y. Yang and Huisman

The rbcL and UPA sequences of PHYKOS-4619 were found by BLAST searches to match sequences
of Neoizziella asiatica specimens. BLAST searches of the PHYKOS-4619 COI-5P sequences returned
a 99% sequence similarity to an Hawaiian specimen identified as N. divaricata (C.K. Tseng) Showe
M. Lin, S.-Y. Yang and Huisman. This is the only Neoizziella COI-5P sequence available in GenBank
and may represent a mis-identified specimen of N. asiatica. Sequences of rbcL-3P for PHYKOS-4619
and N. asiatica specimens from geographically diverse locations in the western Pacific were resolved
in a fully supported clade that was well supported (ML = 89%; PP = 0.99) as the sister species to
N. divaricata in the Liagoraceae rbcL-3P phylogeny (Figure 5). Pairwise sequence divergences among
PHYKOS-4619 and the western Pacific N. asiatica specimens ranged from 0.00.6%, and these sequences
were 5.96.2% divergent from the two available Taiwan N. divaricata rbcL sequences.
The specimen was collected from a tide pool along the Punta Burica shoreline (Figure 1).
It was attached to the substrate by a discoid holdfast, and axes had 67 orders of dichotomous
to subdichotomous branching and untapered ultimate branches with obtuse apicies (Figure 6F).
The specimen was a female gametophyte with many carpogonial branches of 56 cells and mature
carposporophytes (Figure 6G,H).
Remarks: PHYKOS-4619 matches the morphological descriptions of N. asiatica [46] except in its
stature, which was less than 3 cm, and number of carpogonial branch cells, which was 56 versus
the 45 reported by Lin et al. [46]. Neoizziella currently includes only two species, N. asiatica and
N. divaricata [42,46]. A recent Costa Rica record of Neoizziella asiatica was the first from outside of the
Indo-Pacific region [39]. This is the first report of the species from Pacific Panama.

3.2.6. Gelidium sclerophyllum W.R. Taylor

PHYKOS-4514, PHYKOS-4629, and PHYKOS-4645 shared identical COI-5P and UPA sequences.
An rbcL-3P sequence was not generated for PHYKOS-4514, but PHYKOS-4629 and 4645 also shared
identical sequences at this locus. BLAST searches indicated exact matches and 98% identity with COI
sequences from Pacific Costa Rica specimens of Gelidium sclerophyllum (Table 2).
All three collections were made from subtidal hard substrates. PHYKOS-4514 was collected
from the mixed sediment-mudstone bottom just beyond the surf zone off the Punta Burica shoreline.
PHYKOS-4629 and PHYKOS-4645 were collected from subtidal boulders at 35 m depth off the
southwest point of Isla Burica (Figure 1).
Remarks: The rbcL-3P and COI-5P sequences of the Punta Burica specimens and Costa Rica
GenBank records have been tied to a partial rbcL [31] and full rbcL and COI [32] sequences from type
specimens providing positive identifications. Gelidium sclerophyllum and G. floridanum W.R. Taylor
have been consistently resolved together in a strongly supported clade that increased sampling is
revealing to represent a closely related species complex [31,32,47]. Gelidium sclerophyllum has been
reported from Mexico south to Ecuador, but this is the first report from Panama. A detailed description
Diversity 2017, 9, 19 12 of 38

of the species was recently provided by Grusz and Freshwater [31], and the Punta Burica specimens
match this description including the characteristic wide sterile margin around tetrasporangial sori and
axes frequently
Diversity 2017, 9, 19 with emarginate apices (Figure 7A,B). 12 of 39

Figure 7.
Figure 7. Gelidium
Gelidiumsclerophyllum
sclerophyllum and Gelidium
and sp. sp.
Gelidium (A) G.
(A)sclerophyllum habit,habit,
G. sclerophyllum scale =scale
500 m;
= 500 (B)m;
G.
sclerophyllum tetrasporangial sori on erect axis and branchlets showing emarginate
(B) G. sclerophyllum tetrasporangial sori on erect axis and branchlets showing emarginate apices, apices, and wide
sterile
and margins
wide sterilesurrounding sori, scale =sori,
margins surrounding 200 scale
m; (C) Gelidium
= 200 m; (C) sp.Gelidium
habit, scale
sp. =habit,
500 m; (D)=Gelidium
scale 500 m;
sp. branching point of stoloniferous branch where multiple prostrate (arrows)
(D) Gelidium sp. branching point of stoloniferous branch where multiple prostrate (arrows) and erect axes
and
originate,
erect axesscale = 200 m;
originate, scale(E)=Gelidium
200 m; sp.
(E)tetrasporangial sorus at the tip of
Gelidium sp. tetrasporangial an erect
sorus axis,
at the tipscale
of an= erect
100 m.
axis,
scale = 100 m.
3.2.7. Gelidium sp.
Gelidium sp. PHYKOS-4566, and PHYKOS-4597, shared identical sequences for the three
3.2.7.PHYKOS-4564,
tested loci except for PHYKOS-4566,
PHYKOS-4564, PHYKOS-4566 where the COI sequence
and PHYKOS-4597, sharedwasidentical
one basesequences
pair different from
for the the
three
other two sequences. BLAST searches revealed a close affinity
tested loci except for PHYKOS-4566 where the COI sequence was one base pair different from with Gelidium floridanum and G.
sclerophyllum
the other two(Table 2), andBLAST
sequences. this Punta Buricarevealed
searches Gelidiumaspecies is believed
close affinity withtoGelidium
be part of a complex
floridanum of
and
closely related species.
G. sclerophyllum (Table 2), and this Punta Burica Gelidium species is believed to be part of a complex of
Allrelated
closely three collections
species. were made from the intertidal mudstone sustrate along the Punta Burica
shoreline (Figure
All three collections1) where werethey grew
made as athe
from short turf. The
intertidal thalli were
mudstone composed
sustrate along the of Punta
an extensive
Burica
system of tangled stoloniferous axes that gave rise, sometimes
shoreline (Figure 1) where they grew as a short turf. The thalli were composed of an extensivein clusters, to generally short (<5
system
mm),
of simple
tangled to irregularly
stoloniferous axesbranched
that gave erect axes (Figure
rise, sometimes 7C,D), although
in clusters, some
to generally taller
short (<5axes
mm),with more
simple to
regular distichous branching were observed. The latter were similar in
irregularly branched erect axes (Figure 7C,D), although some taller axes with more regular distichousoutline to small specimens of
G. sclerophyllum
branching but lackedThe
were observed. emarginate
latter were tips and in
similar theoutline
sometimesto smallswollen sterileofmargins
specimens around
G. sclerophyllum
tetrasporangial
but lacked emarginate sori (Figure 7E). the sometimes swollen sterile margins around tetrasporangial sori
tips and
Remarks:
(Figure 7E). Phylogenetic analyses of rbcL-3P revealed four separate groupings of specimens
within this clade
Remarks: (Figure 8).analyses
Phylogenetic These include a well
of rbcL-3P supported
revealed fourG.separate
floridanum, a strongly
groupings supportedwithin
of specimens clade
of specimens from Brazil and one from Caribbean Costa Rica that
this clade (Figure 8). These include a well supported G. floridanum, a strongly supported clade was originally identified as G.
of
floridanum, a weakly supported clade of G. sclerophyllum specimens from Punta
specimens from Brazil and one from Caribbean Costa Rica that was originally identified as G. floridanum, Burica, Pacific Costa
Rica
a and Galapagos
weakly supported clade Islands,
of and the clade ofspecimens
G. sclerophyllum Gelidium sp. specimens
from collected
Punta Burica, fromCosta
Pacific Punta Burica.
Rica and
Thomas and Freshwater [48] suggested based on rbcL sequence
Galapagos Islands, and the clade of Gelidium sp. specimens collected from Punta Burica. Thomas divergences and slight
and
morphological differences, that there was a genetic dicontinuity between
Freshwater [48] suggested based on rbcL sequence divergences and slight morphological differences, specimens they identified
as G.there
that floridanum from Caribbean
was a genetic dicontinuity Costa Rica and
between G. floridanum
specimens in the Western
they identified Atlantic.from
as G. floridanum Recent species
Caribbean
delimination analyses with both UPA and COI-5P data distinguished
Costa Rica and G. floridanum in the Western Atlantic. Recent species delimination analyses with G. floridanum from a closely
both
related sister species that included the Caribbean Costa Rica G. floridanum
UPA and COI-5P data distinguished G. floridanum from a closely related sister species that included [18], and this separation
wasCaribbean
the also present CostainRica
theG.analyses here[18],
floridanum (Figure
and this8). separation
Gelidium sclerophyllum
was also present andinG. thefloridanum are
analyses here
considered to represent geminate sister species with a transisthmian distribution
(Figure 8). Gelidium sclerophyllum and G. floridanum are considered to represent geminate sister species [31]. Our current
analyses
with suggest thatdistribution
a transisthmian these three[31]. species are partanalyses
Our current of a complexsuggestofthat closely
theserelated taxa that
three species also
are part
includes the second unidentified Punta Burica Gelidium species. Analyses
of a complex of closely related taxa that also includes the second unidentified Punta Burica Gelidium of additional specimens
and the Analyses
species. inclusionofofadditional
more variable
specimens COIand datatheare required
inclusion to determine
of more variable COI the data
exactare number
required and
to
relationships
determine theofexact
the species
numberinvolved in this complex.
and relationships of the species involved in this complex.
Gelidium pusillum (Stackhouse) Le Jolis was the only Gelidium species recorded from Pacific
Panama by Taylor [2], and Littler and Littler [49] included both G. pusillum and G. pusillum var.
pacificum W.R. Taylor in their web database. The Punta Burica Gelidium species has the general
morphological characteristics that were associated with the previous concept of a widely distributed
G. pusillum,however, the current concept of G. pusillum restricts its distribution to the North Atlantic
 Diversity 2017, 9, 19 13 of 38

Gelidium pusillum (Stackhouse) Le Jolis was the only Gelidium species recorded from Pacific Panama
by Taylor [2], and Littler and Littler [49] included both G. pusillum and G. pusillum var. pacificum W.R.
Taylor
Diversity 2017, in their web database. The Punta Burica Gelidium species has the general morphological 13 of 39
9, 19
characteristics that were associated with the previous concept of a widely distributed G. pusillum,
however, the current concept of G. pusillum restricts its distribution to the North Atlantic [50]. A number
Pacific [5], but they are generally poorly known. Additional morphological and molecular analyses
of small Gelidium and Pterocladiella species are reported from the eastern tropical Pacific [5], but they are
are required to determine the relationship of this species to others reported in the region and if it
generally poorly known. Additional morphological and molecular analyses are required to determine
represents thearelationship
new species.of this species to others reported in the region and if it represents a new species.

Figure 8. Maximum
Figure 8. likelihood
Maximum tree tree
likelihood of rbcL-3P sequences
of rbcL-3P sequences for Gelidiumspecimens
for Gelidium specimens in the G.
in the
floridanumG. sclerophyllum
G. floridanumG. species
sclerophyllum complex.
species complex. Bootstrap
Bootstrap support
support and Bayesianand Bayesian
posterior posterior
probability
values are shown on branches when >70% and >0.75 respectively.
probability values are shown on branches when >70% and >0.75 respectively.
3.2.8. Millerella sp.
3.2.8. Millerella sp.
BLAST searches with sequences of PHYKOS-4570 returned a closest affinity with Millerella spp.
BLAST
(Table searches withamount
2). The largest sequences of PHYKOS-4570
of available Gelidiellacaeaereturned a closest
sequence data affinity
is for the with
rbcL locus, Millerella
and trees spp.
(Table 2).generated with these
The largest data resolve
amount PHYKOS-4570
of available within a strongly
Gelidiellacaeae supported
sequence dataMillerella
is for clade but with
the rbcL locus, and
no close relationship to any of the other sequenced species (Figure 9).
trees generated with these data resolve PHYKOS-4570 within a strongly supported Millerella clade
The specimens were growing as a short turf on the intertidal mudstone substrate along the
but with no close relationship to any of the other sequenced species (Figure 9).
Punta Burica shoreline (Figure 1). PHYKOS-4570 matched the states of all important morphological
characters described for Millerella species. Attachment rhizoids were in irregularly arranged clumps on
stoloniferous axes and developed from outer cortical cells (Figure 10A,B). Second-order cell filaments
developed from the axial cell filament in a distichous pattern during vegetative growth (Figure 10C,D).
Tetrasporangial sori formed at the tips of erect axes and branches, and had acropetally developing
tetrasporangia that were regularly arranged following the pattern of the second-order cell filaments,
with six tetrasporangia in a row on both sides of a sorus (Figure 10E).
Diversity 2017, 9, 19 14 of 38
Diversity 2017, 9, 19 14 of 39

Figure 9. Maximum likelihood tree of rbcL-3P sequences for Gelidiellaceae species. Bootstrap
support and Bayesian posterior probability values are shown on branches when >70% and >0.75
respectively.

The specimens were growing as a short turf on the intertidal mudstone substrate along the
Punta Burica shoreline (Figure 1). PHYKOS-4570 matched the states of all important morphological
characters described for Millerella species. Attachment rhizoids were in irregularly arranged clumps
on stoloniferous axes and developed from outer cortical cells (Figure 10A,B). Second-order cell
filaments developed from the axial cell filament in a distichous pattern during vegetative growth
(Figure 10C,D). Tetrasporangial sori formed at the tips of erect axes and branches, and had
Figure
Figure 9.9.developing
Maximumlikelihood
Maximum likelihood
treetree of rbcL-3P
of rbcL-3P sequences
sequences for Gelidiellaceae
for Gelidiellaceae species.species. Bootstrap
Bootstrap supportof the
acropetally tetrasporangia that were regularly arranged following the pattern
support
and and
Bayesian Bayesian
posterior posterior
probabilityprobability
values are values
shown are
on shown
brancheson branches
when >70% when
and >70%
>0.75 and >0.75
respectively.
second-order cell filaments, with six tetrasporangia in a row on both sides of a sorus (Figure 10E).
respectively.

The specimens were growing as a short turf on the intertidal mudstone substrate along the
Punta Burica shoreline (Figure 1). PHYKOS-4570 matched the states of all important morphological
characters described for Millerella species. Attachment rhizoids were in irregularly arranged clumps
on stoloniferous axes and developed from outer cortical cells (Figure 10A,B). Second-order cell
filaments developed from the axial cell filament in a distichous pattern during vegetative growth
(Figure 10C,D). Tetrasporangial sori formed at the tips of erect axes and branches, and had
acropetally developing tetrasporangia that were regularly arranged following the pattern of the
second-order cell filaments, with six tetrasporangia in a row on both sides of a sorus (Figure 10E).
Figure 10. Millerella sp. morphological characteristics. (A) Habit of simple erect axes growing from a
Figure 10. Millerella sp. morphological characteristics. (A) Habit of simple erect axes growing from
stoloniferous axis with irregular clumps of attachment rhizoids; left erect axis with a tetrasporangial
a stoloniferous axis with irregular clumps of attachment rhizoids; left erect axis with a tetrasporangial
sorus at the apical tip, scale = 200 m; (B) Optical longitudinal section of stoloniferous axis with
sorus at the apical tip, scale = 200 m; (B) Optical longitudinal section of stoloniferous axis with
rhizoids developing from outer cortical cells (arrow), scale = 20 m; (C) Tip of erect axis with a
rhizoids developing from outer cortical cells (arrow), scale = 20 m; (C) Tip of erect axis with a distinct
distinct
apical apical
cell cell and second-order
and second-order cell filaments
cell filaments arising
arising from from the
the central central
axial axial cell
cell filament in filament in a
a distichous
distichous pattern, scale = 20 m; (D) Transverse sections through erect axes at earlier (left)
pattern, scale = 20 m; (D) Transverse sections through erect axes at earlier (left) and later (right) and later
stages of vegetative development; the central axial cell (arrowhead) and cells of the second-order
cell filaments (arrows) are clearly visible, scale = 20 m; (E) Tetrasporangial sorus with acropetally
developing tetrasporangia in a regular arrangement, scale = 20 m.

Figure 10. Millerella sp. morphological characteristics. (A) Habit of simple erect axes growing from a
Remarks: Santelices
stoloniferous axis with irregular clumps ofParviphycus
[51] described to accomodate
attachment rhizoids; Gelidiellaceae
left erect axis species with
with a tetrasporangial
a distichous
sorus at arrangement
the apical tip,ofscale
second-order
= 200 m; cell
(B) filaments and the development
Optical longitudinal of sporangia
section of stoloniferous in with
axis regularly
arranged rows.
rhizoids Further from
developing morphological and
outer cortical DNA
cells sequence
(arrow), scale =analyses
20 m; (C)leadTip
Boo
of et al. [52]
erect axis to describe
with a
distinct apical cell and second-order cell filaments arising from the central axial cell filament in a
distichous pattern, scale = 20 m; (D) Transverse sections through erect axes at earlier (left) and later
 Pacific.
Both PHYKOS-4636 and PHYKOS-4646 were collected from subtidal boulders at 45 m depth
off the southwest point of Isla Burica (Figures 1A and 11A). The specimens were all in the
Falkenbergia-stage and some had tetrasporangia (Figure 11B,C).
Remarks:
Diversity 2017, 9, 19Currently there are two recognized species of Asparagopsis, A. armata Harvey, and A.
15 of 38
taxiformis. The most recent DNA sequence analyses of the genus utilized nuclear-encoded LSU,
chloroplast-encoded RuBisCO spacer, and mitochondria-encoded cox2-3 spacer sequences to
Millerella and Perronella for some of the species classified within Parviphycus. Dawson [6,53,54]
identify two major lineages within A. armata and five within A. taxiformis [56]. Dijoux et al. [56]
described a number of small Gelidiella species from the tropical East Pacific, and other small
designated lineages based on cox2-3 spacer haplotypes, which were not generated here, but
Gelidiellaceae such as Parviphycus tenuissimus (Feldmann et Hamel) B. Santelices and P. trinitatensis
RuBisCO spacer sequences for PHYKOS-4636 and PHYKOS-4646 matched the haplotypes of A.
(W.R. Taylor) M.J. Wynne have also been reported from Pacific Central America e.g., [5,55]. The status
taxiformis specimens found in their Lineage 4. This lineage contained specimens distributed widely
of the Punta Burica Millerella species as new or representative of one of these reported species will
within the Pacific and Indian Oceans including specimens from the Gulf of Panama and Costa Rica
require a reassessment of the Gelidiellaceae in the East Pacific.
[56]. The taxonomic status of this lineage requires further study, but its genetic distiction [56,57] and
recentAsparagopsis
3.2.9. morphological sp. differentiation from other lineages [58] suggests that it represents a biological
species distinct from A. taxiformis.
BLAST searches
Asparagopsis (as of
A.PHYKOS-4636
taxiformis) wassequences returned
first reported fromidentical
Panamamatches (COI-5P,etUPA)
by Andreakis or close
al. [57], who
homology (rbcL-3P) to sequences of specimens identified as Asparagopsis taxiformis
included tetrasporophyte (Falkenbergia-stage) specimens collected from the Pacific terminus of the (Delile) Trevisan.
Only
Panama a UPA sequence
Canal, Gulf was generatedinfor
of Panama PHYKOS-4646,
their biogeography andstudy.
it was Zanolla
identical et
to that of PHYKOS-4636.
al. [58] reported that
GenBank specimens
Falkenbergia-stage with identical
specimens of A. COI-5P
taxiformisand UPA sequences
lineages were from the Pacific.
could be morphologically distinguished by the
lengthBoth
andPHYKOS-4636
width of axialand PHYKOS-4646
cells, were
width of apical collected
cells from subtidal
and thickness of cell boulders at 45
walls. While m depth off
measurements
the southwest point of Isla Burica (Figures 1A and 11A). The specimens were all in the Falkenbergia-stage
of these characters from Punta Burica specimens overlap with those cited for Lineage 4 by Zanolla et
and some
al. [58], had tetrasporangia
a greater (Figure
level of variation was11B,C).
seen.

Figure 11. Asparagopsis sp. and Plocamium sp. from Punta Burica. (A) Asparagopsis sp. Falkenbergia
Figure 11. Asparagopsis sp. and Plocamium sp. from Punta Burica. (A) Asparagopsis sp. Falkenbergia
stage growing on subtidal rock at 5 m depth, southwest of Isla Burica; (B) Asparagopsis sp.
stage growing on subtidal rock at 5 m depth, southwest of Isla Burica; (B) Asparagopsis sp.
Falkenbergia stage vegetative filament with characteristic three pericentral cells, sclae = 50 m;
(C) Asparagopsis sp. Falkenbergia stage filaments producing tetrasporangia, scale = 50 m;
(D) Plocamium sp. branching pattern with lower most ramuli in a group that are not larger or recurved,
scale = 500 m.

Remarks: Currently there are two recognized species of Asparagopsis, A. armata Harvey,
and A. taxiformis. The most recent DNA sequence analyses of the genus utilized nuclear-encoded LSU,
chloroplast-encoded RuBisCO spacer, and mitochondria-encoded cox2-3 spacer sequences to identify
two major lineages within A. armata and five within A. taxiformis [56]. Dijoux et al. [56] designated
lineages based on cox2-3 spacer haplotypes, which were not generated here, but RuBisCO spacer
sequences for PHYKOS-4636 and PHYKOS-4646 matched the haplotypes of A. taxiformis specimens
found in their Lineage 4. This lineage contained specimens distributed widely within the Pacific and
Indian Oceans including specimens from the Gulf of Panama and Costa Rica [56]. The taxonomic
status of this lineage requires further study, but its genetic distiction [56,57] and recent morphological
differentiation from other lineages [58] suggests that it represents a biological species distinct from
A. taxiformis.
Asparagopsis (as A. taxiformis) was first reported from Panama by Andreakis et al. [57],
who included tetrasporophyte (Falkenbergia-stage) specimens collected from the Pacific terminus
of the Panama Canal, Gulf of Panama in their biogeography study. Zanolla et al. [58] reported
that Falkenbergia-stage specimens of A. taxiformis lineages could be morphologically distinguished
by the length and width of axial cells, width of apical cells and thickness of cell walls. While
measurements of these characters from Punta Burica specimens overlap with those cited for Lineage 4
by Zanolla et al. [58], a greater level of variation was seen.
Diversity 2017, 9, 19 16 of 38

3.2.10. Plocamium sp.

PHYKOS-4643 sequences were found to have closest homology to GenBank sequences from
specimens identified as Plocamium pacificum Kylin (rbcL-3P 99%; COI-5P 95%), or P. cartilagineum
(Linnaeus) P.S. Dixon and P. telfairiae (W.J. Hooker and Harvey) Harvey ex Ktzing (UPA 99%). However,
phylogenetic analyses of available rbcL-3P sequences and cluster analyses of available COI-5P sequences
did not strongly associate PHYKOS-4643 with P. pacificum or any other Plocamium species.
PHYKOS-4643 was collected from subtidal boulders at 35 m depth off the southwest point of
Isla Burica.
Remarks: The only reports of Plocamium species from the Pacific coast of Central America are
found in the Littler and Littler [49] web database of Pacific Panama marine algae. They list two species,
P. cartilagineum subsp. pacificum (Kylin) P.C. Silva [=P. pacificum Kylin] and P. violaceum Farlow. The
included images of the former show recurved pinnae and these are also part of the description
and figure of this species in Abbott and Hollenberg [59]. Recurved branches were not present in
PHYKOS-4643, which more closely matches the images of P. violaceum in the Littler and Littler [49]
list. Plocamium violaceum was described by Farlow [60] based on California specimens, and he noted
that ramuli were arranged in alternate groups of 3 or 4, with the lower most ramulus in a group
larger than the others and slightly recurved. Lower ramuli in the Punta Burica specimen were not
noticably larger or recurved (Figure 11D). COI-5P divergences between the Punta Burica and California
P. violaceum specimens (5.65.9%) were greater than that between Punta Burica and specimens identified
as P. pacificum from California, P. oregonum Doty from Oregon, and P. nanum G.W. Saunder and
K.V. Lehmkuhl from France. Both the morphological and molecular discripancies indicate that the
PHYKOS-4643 Plocamium specimen is not P. violaceum, and likely represents a new species.

3.2.11. Hypnea flava Nauer, Cassano and M.C. Oliveira

BLAST searches with PHYKOS-4574 sequences returned records from specimens identified as
either Hypnea flava from Brazil (rbcL-3P 99%) or H. spinella from Hawaii (COI-5P 96%, UPA 99%).
Phylogenetic analyses of rbcL-3P sequences from Hypnea species resolved the Punta Burica specimen
within a fully-supported H. flava clade (Figure 12). The rbcL-3P divergence between the Pacific
specimen from Punta Burica and the Brazilian specimens was only 0.91.0%.
PHYKOS-4574 specimens were collected from tide pools in the mudstone substrate along the
Punta Burica shoreline (Figure 1) and included tetrasporophytes, which are described here for the
first time. Tetrasporangial sori surround the median, swollen portions of generally short branchlets,
200300 m in diameter and may cover a majority of the branchlet surface, especially during early
stages of development (Figure 13A). Sori sometimes also develop on the apical portions of longer
branchlets or as patches on the surface of predominately vegetative axes. Tetrasporangia mother
cells are cut off laterally from inner cortical cells and develop into zonately divided tetrasporangia
(Figure 13B).
Remarks: The Punta Burica specimens closely matched the vegetative morphology of Brazilian
H. flava, but reproductive specimens were not available when the species was orginally described by
Nauer et al. [61], and tetrasporophytic thalli are described here for the first time. This is the first report
of the species outside of Brazil.

3.2.12. Hypnea pannosa J. Agardh

PHYKOS-4631 rbcL-3P and COI-5P sequences were found to be identical, or nearly identical with
GenBank sequences assigned to Hypnea pannosa. BLAST searches of the PHYKOS-4631 UPA sequence
returned sequences of five species all at 99% similarity. Sequences of Eastern- and Western Pacific
H. pannosa specimens formed a well- to fully-supported clade in the Hypnea rbcL-3P tree (Figure 12).
Hypnea pannosa was originally described based on specimens from the Pacific coast of Mexico, and the
Punta Burica rbcL-3P sequence was a match for that of a Pacific Mexico specimen.
Diversity 2017, 9, 19 17 of 39
sequence returned sequences of five species all at 99% similarity. Sequences of Eastern- and Western
Pacific H.returned
sequence pannosa sequences
specimensofformed a well-
five species to 99%
all at fully-supported clade in of
similarity. Sequences theEastern-
Hypneaand
rbcL-3P tree
Western
(Figure 12). Hypnea pannosa was originally described based on specimens from the
Pacific H. pannosa specimens formed a well- to fully-supported clade in the Hypnea rbcL-3P treePacific coast of
Mexico, and the Punta Burica rbcL-3P sequence was a match for that of a Pacific Mexico
(Figure 12). Hypnea pannosa was originally described based on specimens from the Pacific coast of specimen.
Diversity 2017, 9, 19 17 of 38
Mexico, and the Punta Burica rbcL-3P sequence was a match for that of a Pacific Mexico specimen.

Figure 12. Maximum likelihood tree of rbcL-3P sequences for Hypnea species of the sections
Pulvinatae
Figure and Spinuligerae.
12. Maximum
Maximum Bootstrap
likelihood support andsequences
Bayesian posterior probability values are shown
Figure 12. likelihood treetree of rbcL-3P
of rbcL-3P sequences for Hypnea
for Hypnea species
species of of thePulvinatae
the sections sections
on branches
Pulvinatae when
and >70% and Bootstrap
Spinuligerae. >0.75 respectively.
and Spinuligerae. Bootstrap support andsupport and
Bayesian Bayesian
posterior posterior values
probability probability valueson
are shown are shown
branches
on branches
when when
>70% and >70%
>0.75 and >0.75 respectively.
respectively.
The PHYKOS-4643 collection was made from subtidal boulders at 45 m depth off the
The PHYKOS-4643
southwest point of Islacollection
Burica (Figurewas made 1). from subtidalhad
Specimens boulders at 45 m depth
compressed off the entangled,
southwest
The PHYKOS-4643 collection was made from subtidal boulders atto45 subterete,
m depth off the
point of Isla
irregularly Burica
branched (Figure
axes 1).
with Specimens
little had
differencecompressed
between to
the subterete,
diameter entangled,
of axes and irregularly
branches. branched
Axes also
southwest point of Isla Burica (Figure 1). Specimens had compressed to subterete, entangled,
axes with little and
anastomosed difference
had between attachments
multiple the diameter of to axes
the and branches.
substrate. The Axes
PuntaalsoBurica
anastomosed
specimensand had
had
irregularly branched axes with little difference between the diameter of axes and branches. Axes also
multiple
generally attachments
acute to to the substrate.
widely acute The Punta
branch tips Burica
and specimens hadsori
tetrasporangial generally acute to
developed onwidely
both acute
small
anastomosed and had multiple attachments to the substrate. The Punta Burica specimens had
branch tips and
branchlets and tetrasporangial sori13C,D).
developed on both small branchlets and major axes (Figure 13C,D).
generally acutemajor axes (Figure
to widely acute branch tips and tetrasporangial sori developed on both small
Remarks:
Remarks: Hypnea pannosa is a widely recorded species fromfrom
tropical waterswaters
and also Pacific
also Central
branchlets andHypnea
major axespannosa
(Figure is a13C,D).
widely recorded species tropical and Pacific
America
Central [5]. Taylor
America [2] collected
[5]. Taylor specimens from high tide pools at Isla Secas in the central Gulf of
Remarks: Hypnea pannosa[2]iscollected
a widelyspecimens
recorded from species high
fromtidetropical
pools atwaters
Isla Secas
andinalso
the Pacific
central
Chiriqui, Panama.
Gulf of America
Chiriqui,[5].The
Panama.Punta Burica specimens matched the morphological descriptions of this species
Central TaylorThe Punta Burica
[2] collected specimens
specimens frommatched
high tidethe morphological
pools at Isla Secasdescriptions
in the central of
from
this Pacific from
species Mexico and Hawaii
Pacific Mexico [44,62,63].
and Hawaii Some specimens
[44,62,63]. Some identified
specimens H. pannosaasinH.
asidentified the western
pannosa in
Gulf of Chiriqui, Panama. The Punta Burica specimens matched the morphological descriptions of
Pacific are
the species described
westernfrom
Pacific as being
are describedmostly terete [6466]
as Hawaii
being mostly and probably
tereteSome[6466]represent a different
and probably species;
represent however,
a different
this Pacific Mexico and [44,62,63]. specimens identified as H. pannosa in
no DNAhowever,
species; sequence no dataDNAis currently
sequence available
data is for these available
currently specimens. for these specimens.
the western Pacific are described as being mostly terete [6466] and probably represent a different
species; however, no DNA sequence data is currently available for these specimens.

Figure 13.
Figure 13. Hypnea
Hypnea flava
flava and
and H.
H. pannosa.
pannosa. (A)
(A) H.
H. flava
flava tetrasporangial
tetrasporangial sorus
sorus surrounding
surrounding the
the median
median
portion
Figure of
portion13. branchlet,
of Hypnea flava
branchlet, scale =
and=H.
scale 100
100 m; (B)
pannosa.
m; (B)(A)H. flava
H. H. tetrasporangia
flava
flava mother
tetrasporangial
tetrasporangia cell
soruscell
mother (TMC)
surroundingcut off
(TMC) cut the laterally
median
off laterally
portion of branchlet,
from cortical scale = 100shown
cell (pit connection m; (B)
withH. an
flava tetrasporangia
arrow), mother
and mature celldivided
zonately (TMC) tetrasporangium
cut off laterally
(arrowhead), scale = 20 m; (C) H. pannosa transverse section through compressed prostrate branch with
holdfast structure, scale = 100 m; (D) H. pannosa branches bearing tetrasporangial sori, scale = 200 m.
 from cortical cell (pit connection shown with an arrow), and mature zonately divided
tetrasporangium (arrowhead), scale = 20 m; (C) H. pannosa transverse section through compressed
prostrate branch with holdfast structure, scale = 100 m; (D) H. pannosa branches bearing
tetrasporangial sori, scale = 200 m.
Diversity 2017, 9, 19 18 of 38
3.2.13. Neorubra parvolacertoides Freshwater and P.W. Gabrielson sp. nov.
BLAST
3.2.13. searches
Neorubra with PHYKOS-4528,
parvolacertoides Freshwater and PHYKOS-4589
P.W. Gabrielson rbcL-3P
sp. nov.sequences revealed a closest
affinity with sequences of Neorubra decipiens (Montagne) M.S. Calderon, G.H. Boo and S.M. Boo
BLAST searches with PHYKOS-4528, PHYKOS-4589 rbcL-3P sequences revealed a closest affinity
(Table 2). COI-5P and UPA sequence BLAST searches provided little context for the identification of
with sequences of Neorubra decipiens (Montagne) M.S. Calderon, G.H. Boo and S.M. Boo (Table 2).
this species. Phylogenetic analyses with available rbcL-3P sequences from species of Grateloupia sensu
COI-5P and UPA sequence BLAST searches provided little context for the identification of this species.
lato resolved PHYKOS-4528 and PHYKOS-4589 within a fully supported Neorubra clade (Figure 14).
Phylogenetic analyses with available rbcL-3P sequences from species of Grateloupia sensu lato resolved
Cluster analyses of a 137 bp section of the rbcL-3P locus from Eastern Pacific types and
PHYKOS-4528 and PHYKOS-4589 within a fully supported Neorubra clade (Figure 14). Cluster
contemporary
analyses of a 137topotype specimens
bp section furtherlocus
of the rbcL-3P indicated that thePacific
from Eastern Punta types
Buricaand
Neorubra species topotype
contemporary is unique
(Figure 15).
specimens further indicated that the Punta Burica Neorubra species is unique (Figure 15).
Remarks:
Remarks:Gargiulo
Gargiuloetetal.al.[67]
[67]recently
recently described
described morphological character states
morphological character states of
of the
thefemale
female
reproductive system and post-fertilization development for a number of newly
reproductive system and post-fertilization development for a number of newly distinguished generadistinguished genera
previously
previouslysynonymized
synonymizedunder underGrateloupia
Grateloupiathat
that also
also were
were resolved
resolved as as distinct
distinct clades
clades within
withinrbcLrbcL
phylogenies
phylogeniesofofGrateloupia
Grateloupia sensu
sensu lato.
lato. Continued molecularand
Continued molecular andmorphological
morphological investigation
investigation hashas
led led
to
todescriptions
descriptionsof of additional genera [6870], including Neorubra, which contains two
additional genera [6870], including Neorubra, which contains two species, N. decipiens species, N.
decipiens
and N. and N. denticulata
denticulata (Montagne) (Montagne) M.S. Calderon,
M.S. Calderon, G.H. BooG.H.and Boo
S.M. and
Boo.S.M. Boo. Considering
Considering the position the
position of PHYKOS-4528 and PHYKOS-4589 specimens within a fully
of PHYKOS-4528 and PHYKOS-4589 specimens within a fully supported Neorubra clade and theirsupported Neorubra clade
and their uniqueness
uniqueness among knownamong known
eastern eastern
Pacific taxaPacific taxathe
we regard wePunta
regard the Punta
Burica Burica
specimens as aspecimens
new Neorubra as a
new Neorubra
species species
that we thathere.
describe we describe here.

Figure 14. Maximum likelihood tree of rbcL-3P alignment for 74 Grateloupia sensu lato taxa. Bootstrap
support values and Bayesian posterior probabilities are given for branches when >70% and >0.75
respectively. Punta Burica Neorubra and Grateloupia specimens are shown in bold type.
Diversity 2017, 9, 19 19 of 39

Figure 14. Maximum likelihood tree of rbcL-3P alignment for 74 Grateloupia sensu lato taxa.
Bootstrap
Diversity support values and Bayesian posterior probabilities are given for branches when >70% and
2017, 9, 19 19 of 38
>0.75 respectively. Punta Burica Neorubra and Grateloupia specimens are shown in bold type.

Figure 15.
Figure 15. UPGMA
UPGMA cluster
cluster diagram
diagram of
of aa 137
137 bp
bp section
section of
of the
the rbcL-3P
rbcL-3P locus
locus from
from eight
eight historical
historical type
type
specimens, four contemporary specimens from or near species type localities and specimens
specimens, four contemporary specimens from or near species type localities and specimens of the of the
Punta Burica Neorubra and Grateloupia species.
Punta Burica Neorubra and Grateloupia species.

Neorubra parvolacertoides Freshwater and P.W. Gabrielson sp. nov.

Neorubra parvolacertoides Freshwater and P.W. Gabrielson sp. nov.
Figure 16AD.
Figure 16AD.
Description: Thalli dark red with horizontal bands, sometimes wavy, of lighter color; small and
Description: Thalli dark red with horizontal bands, sometimes wavy, of lighter color; small and
erect, 912 mm high, laceolate to clavate with extended proximal tapering (Figure 16A,B); bases
erect, 912 mm high, laceolate to clavate with extended proximal tapering (Figure 16A,B); bases terete
terete to subterete, becoming compressed to flattened distally, 0.51.5 mm wide, 150400 m thick;
to subterete, becoming compressed to flattened distally, 0.51.5 mm wide, 150400 m thick; with one
with one order of short, irregular distichous branching; axes multiaxial; tips obtuse to widely acute;
order of short, irregular distichous branching; axes multiaxial; tips obtuse to widely acute; medulla
medulla of longitudinal filaments of elongated cells; cortex of anticlinal filaments; medulla-cortex
of longitudinal filaments of elongated cells; cortex of anticlinal filaments; medulla-cortex transition
transition gradual; outer cortex of 57 layers of small, globose to elliptical, pigmented cells, 15 m
gradual; outer cortex of 57 layers of small, globose to elliptical, pigmented cells, 15 m 210 m;
210 m; inner cortex of 34 layers of elliptical to stellate cells, 47 m 1018 m (Figure 16C,D);
inner cortex of 34 layers of elliptical to stellate cells, 47 m 1018 m (Figure 16C,D); COI-5P
COI-5P sequence = GenBank accession KY656538, rbcL-3P sequence = GenBank accession KY573975,
sequence = GenBank accession KY656538, rbcL-3P sequence = GenBank accession KY573975, UPA
UPA sequence = GenBank accession KY573934.
sequence = GenBank accession KY573934.
Holotype: WNC 34262, herbarium specimen and two slides (WNC 2012-s073, WNC 2012-s074)
Holotype: WNC 34262, herbarium specimen and two slides (WNC 2012-s073, WNC 2012-s074)
in packet on sheet, collection # PHYKOS-4528, attached to rock on mixed sediment-rock bottom just
in packet on sheet, collection # PHYKOS-4528, attached to rock on mixed sediment-rock bottom just
beyond breakers, 3 m depth, near Mono Feliz, Punta Burica, Panama, 8 January 2011, leg. B. Wysor
beyond breakers, 3 m depth, near Mono Feliz, Punta Burica, Panama, 8 January 2011, leg. B. Wysor
and D.W. Freshwater.
and D.W. Freshwater.
Paratype: slide # WNC 2011-s072, collection PHYKOS-4589, growing with brown algal turf,
Paratype: slide # WNC 2011-s072, collection PHYKOS-4589, growing with brown algal turf,
shallow subtidal, <1 m depth, near Mono Feliz, Punta Burica, Panama, 9 January 2011, leg. B. Wysor
shallow subtidal, <1 m depth, near Mono Feliz, Punta Burica, Panama, 9 January 2011, leg. B. Wysor
and D.W. Freshwater.
and D.W. Freshwater.
Type Locality: Punta Burica, Panama, 08.03042 N; 082.87574 W
Type Locality: Punta Burica, Panama, 08.03042 N; 082.87574 W
Etymology: The epithet refers to the field name given to this species by its collectors who
Etymology: The epithet refers to the field name given to this species by its collectors who thought
thought that it resembled small lizards of the region.
that it resembled small lizards of the region.
Comment: The diminutive size, <15 mm tall, and having only 1 order of branches distinguishes
Comment: The diminutive size, <15 mm tall, and having only 1 order of branches distinguishes
N. parvolacertoides from all other Halymeniales in the eastern tropical Pacific. It is an order of
N. parvolacertoides from all other Halymeniales in the eastern tropical Pacific. It is an order of magnitude
magnitude smaller than both described species of Neorubra, N. decipiens and N. denticulata
smaller than both described species of Neorubra, N. decipiens and N. denticulata (Montagne) M.S.
(Montagne) M.S. Calderon, G.H. Boo and S.M. Boo and, being tropical, does not overlap the
Calderon, G.H. Boo and S.M. Boo and, being tropical, does not overlap the distributions of the
distributions of the aforementioned species.
aforementioned species.
Diversity 2017, 9, 19 20 of 38

3.2.14. Grateloupia irregularis P.W. Gabrielson and Freshwater sp. nov

PHYKOS-4522, PHYKOS-4556, and PHYKOS-4620 all shared identical sequences for the three
examined loci. BLAST searches returned a variety of Grateloupia sensu lato species, but none at a level
of homology indicating a potential species match. Cluster analyses with a short segment of the rbcL-3P
locus showed that this species was distinct from all the included eastern Pacific Grateloupia sensu lato
types and contemporary topotype specimens (Figure 15). Phylogenetic analyses of the rbcL-3P locus
resolved this specimen within a well supported Grateloupia sensu stricto clade (Figure 14). Similar to
Neorubra parvolacertoides, the uniqueness among known eastern Pacific taxa and position within the
well resolved Grateloupia clade, indicates that these specimens represent a previously undescribed
Grateloupia species.
Diversity 2017, 9, 19 20 of 39

Figure 16. Neorubra parvolaertoides. (A) Holotype specimen WNC34262, scale = 5 mm; (B) Surface
Figure 16. Neorubra parvolaertoides. (A) Holotype specimen WNC34262, scale = 5 mm; (B) Surface view
view of wholemount specimen with short distichous branches and horizontal band of lightly
of wholemount specimen
pigmented cortical with
cells, scaleshort
= 200distichous branches
m; (C) Transverse and of
section horizontal
compressed bandaxisof lightly
with pigmented
medulla of
cortical cells, scale = 200 m; (C) Transverse section of compressed axis with medulla of longitudinal
longitudinal cell filaments and cortex of anticlinal cell filaments, scale = 50 m; (D) Tangential section
cell filaments and cortex
of axis showing elongatedof anticlinal
medullary cell
cells filaments, scale
and anticlinal = 50
cortical cellm; (D) Tangential
filaments, section of axis
scale = 20 m.
showing elongated medullary cells and anticlinal cortical cell filaments, scale = 20 m.
3.2.14. Grateloupia irregularis P.W. Gabrielson and Freshwater sp. nov
Grateloupia irregularis P.W. Gabrielson and Freshwater sp. nov.
PHYKOS-4522, PHYKOS-4556, and PHYKOS-4620 all shared identical sequences for the three
Figureexamined
17AE. loci. BLAST searches returned a variety of Grateloupia sensu lato species, but none at a level
Description:
of homology Thalli various
indicating shadesspecies
a potential of red;match.
smallCluster
and erect, 1020
analyses mm
with a high, lanceolate
short segment to linear,
of the
fractiflexus
rbcL-3P locus showed that this species was distinct from all the included eastern Pacific Grateloupia bases,
in part (Figure 17A), attached by discoid holdfast, narrow terete to subterete
quickly becoming
sensu lato typescompressed to flattened
and contemporary except
topotype at tips (Figure
specimens and young ultimate branches
15). Phylogenetic analyseswhere
of theterete,
rbcL-3P
0.251.5 mm locus
wide;resolved
200350 thism
specimen
thick; within a well
with up supported
to four orders Grateloupia sensu disticus
of irregular, stricto clade (Figure and
branching
14). Similar
sometimes sparsly to scattered
Neorubra parvolacertoides,
small denticulatethe uniqueness among
proliferations; axesknown easterntips
multiaxial; Pacific taxamedulla
acute; and of
position within the well resolved Grateloupia clade, indicates that these specimens represent a
widely spaced, longitudinal filaments of elongated cells; cortex of anticlinal filaments; medulla-cortex
previously undescribed Grateloupia species.
transition sharp; outer cortex of 56 layers of small, mostly elliptical cells, 25 m 310 m;
Grateloupia
inner cortex of 23irregularis
layers ofP.W. Gabrielson
globose and Freshwater
to elliptical sp. nov.
or stellate cells, 510 m 1020 m (Figure 17B);
Figure 17AE.
tetrasporangia across entire thallus surface of main axes and branches (Figure 17C); tetrasporangial
Description: Thalli various shades of red; small and erect, 1020 mm high, lanceolate to linear,
mother cells cut off from inner cells of the outer cortex, becoming somewhat elongated and irregular
fractiflexus in part (Figure 17A), attached by discoid holdfast, narrow terete to subterete bases,
in shape during
quickly development;
becoming compressed tetrasporangia cruciate
to flattened except at tipsto decussately
and cruciate
young ultimate divided(Figure
branches where terete, 17D);
spermatiangial sori covered by thick sheath, outer cortical cells develop into
0.251.5 mm wide; 200350 m thick; with up to four orders of irregular, disticus branching elongated spermatangial
and
mother cells (Figure 17E); COI-5P sequence = GenBank accession KY656551,
sometimes sparsly scattered small denticulate proliferations; axes multiaxial; tips acute; medullarbcL-3P sequence
of =
GenBankwidely spaced,KY573991,
accession longitudinal
UPAfilaments
sequenceof= GenBank
elongated accession
cells; cortex of anticlinal filaments;
KY573951.
medulla-cortex transition sharp; outer cortex of 56 layers of small, mostly elliptical cells, 25 m
310 m; inner cortex of 23 layers of globose to elliptical or stellate cells, 510 m 1020 m
(Figure 17B); tetrasporangia across entire thallus surface of main axes and branches (Figure 17C);
tetrasporangial mother cells cut off from inner cells of the outer cortex, becoming somewhat
elongated and irregular in shape during development; tetrasporangia cruciate to decussately
cruciate divided(Figure 17D); spermatiangial sori covered by thick sheath, outer cortical cells
 Diversity 2017, 9, 19 21 of 39

accession
Diversity 2017, 9,KY656551,
19 rbcL-3P sequence = GenBank accession KY573991, UPA sequence = GenBank
21 of 38
accession KY573951.

Figure 17. Grateloupia irregularis. (A) Holotype specimen WNC34263, scale = 1 cm; (B) Transverse
Figure 17. Grateloupia irregularis. (A) Holotype specimen WNC34263, scale = 1 cm; (B) Transverse
section through tetrasporophytic axis with loosely arranged, widely spaced longitudinal filaments of
section through tetrasporophytic axis with loosely arranged, widely spaced longitudinal filaments of
elongated medullary cells and anticlinal cortical cell filaments, scale = 30 m; (C) Whole mount of
elongated medullary cells and anticlinal cortical cell filaments, scale = 30 m; (C) Whole mount
tetrasporphytic specimen, scale = 500 m.; (D) Transverse section of tetrasporophytic axis showing
of tetrasporphytic specimen, scale = 500 m.; (D) Transverse section of tetrasporophytic axis
elongated and irregularly shaped tetraspore mother cells (arrows) and decussately cruciate
showing elongated and irregularly shaped tetraspore mother cells (arrows) and decussately cruciate
tetrasporangia, scale = 15 m; (E) Transverse section of fertile male axis with widely spaced
tetrasporangia, scale = 15 m; (E) Transverse section of fertile male axis with widely spaced medullary
medullary filaments, anticlinal cortical filaments, and elongated spermatangial mother cells covered
filaments, anticlinal cortical
by a thick outer sheath, filaments,
scale = 20 m. and elongated spermatangial mother cells covered by a thick
outer sheath, scale = 20 m.
Holotype: WNC 34263, herbarium specimen and two slides (WNC 2012-s067, WNC 2012-s068)
in Holotype:
packet on sheet,
WNCcollection # PHYKOS-4556,
34263, herbarium specimen attached
and twoto rock on(WNC
slides mixed 2012-s067,
sediment-rock
WNC bottom just
2012-s068)
beyond breakers, 3 m depth, near Mono Feliz, Punta Burica, Panama, 8 January 2011,
in packet on sheet, collection # PHYKOS-4556, attached to rock on mixed sediment-rock bottom just leg. B. Wysor
and D.W.
beyond Freshwater
breakers, 3 m depth, near Mono Feliz, Punta Burica, Panama, 8 January 2011, leg. B. Wysor
and D.W. Freshwater 34264, herbarium specimen and two slides (WNC 2012-s071, WNC 2012-s072)
Paratypes: WNC
in Paratypes:
packet on sheet,
WNCcollection # PHYKOS-4522,
34264, herbarium specimen attached to rock
and two on (WNC
slides mixed sediment-rock
2012-s071, WNC bottom just
2012-s072)
beyond breakers, 3m depth, near Mono Feliz, Punta Burica, Panama, 8 January 2011, leg. B. Wysor
in packet on sheet, collection # PHYKOS-4522, attached to rock on mixed sediment-rock bottom just
and D.W. Freshwater; Slides WNC 2012-s069 and WNC 2012-s070, collecction # PHYKOS-4620,
beyond breakers, 3m depth, near Mono Feliz, Punta Burica, Panama, 8 January 2011, leg. B. Wysor and
growing in mixed algal turf, shallow subtidal, <1 m depth, near Mono Feliz, Punta Burica, Panama, 9
D.W. Freshwater; Slides WNC 2012-s069 and WNC 2012-s070, collecction # PHYKOS-4620, growing
January 2011, leg. B. Wysor and D.W. Freshwater
in mixed algal turf, shallow subtidal, <1 m depth, near Mono Feliz, Punta Burica, Panama, 9 January
Type locality: Punta Burica, Panama, 08.03042 N; 082.87574 W
2011, leg. B. Wysor and D.W. Freshwater
Etymology: The epithet reflects the irregular branching pattern exhibited by the species.
Type locality: Similar
Punta Burica, Panama, 08.03042 N; 082.87574 W
Comment: to N. parvolacertoides, the diminutive size of G. irregularis, <15 mm tall,
Etymology:itThe
distinguishes fromepithet
other reflects the irregular
previously describedbranching
species ofpattern
eastern exhibited by theHalymeniales.
tropical Pacific species.
Comment: Similar to N. parvolacertoides, the diminutive size of G. irregularis,
Grateloupia irregularis has more orders of branches (Figure 17A) and its medulla is comprised <15 mm oftall,
distinguishes it from other previously described species of eastern tropical Pacific Halymeniales.
loosely arranged filaments (Figure 17B) compared to N. parvolacertoides (Figure 16 A,C respectively).
Grateloupia irregularis has more orders of branches (Figure 17A) and its medulla is comprised of loosely
3.2.15. Ceratodictyon
arranged repens17B)
filaments (Figure (Ktzing) R.E. Norris
compared to N. parvolacertoides (Figure 16 A,C respectively).
BLAST searches of COI-5P and UPA sequences for PHYKOS-4627, PHYKOS-4632 and
3.2.15. Ceratodictyon repens (Ktzing) R.E. Norris
PHYKOS-4635 returned closest matches (94% and 99% respectively) with sequences of Ceratodictyon
BLAST (Table
scoparium searches of rbcL-3P
2). An COI-5Psequences
and UPA wassequences for for
not generated PHYKOS-4627,
PHYKOS-4627,PHYKOS-4632
but searches withand
PHYKOS-4635
this locus forreturned
the otherclosest matchesshowed
two samples (94% and 99%
them to respectively) with
be matches for thesequences
sequence of Ceratodictyon
from a South
African (Table
scoparium specimen
2). AnofrbcL-3P
C. repens. Phylogenetic
sequences analyses of
was not generated forrbcL-3P data forbutmembers
PHYKOS-4627, searches of
withthe
this
locus for the other two samples showed them to be matches for the sequence from a South African
specimen of C. repens. Phylogenetic analyses of rbcL-3P data for members of the Lomentariaceae
resolve these C. repens specimens within a strongly supported Cearatodictyon clade (Figure 18).
 Diversity 2017, 9, 19 22 of 39

Lomentariaceae
Diversity 2017, 9, 19 resolve these C. repens specimens within a strongly supported Cearatodictyon clade
22 of 38
(Figure 18).
Diversity 2017, 9, 19 22 of 39

Lomentariaceae resolve these C. repens specimens within a strongly supported Cearatodictyon clade
(Figure 18).

Figure
Figure 18.18.Maximum
Maximum likelihood
likelihood tree
tree of
of Lomentariaceae
Lomentariaceae rbcL-3P
rbcL-3Psequences
sequences available
availablein in
GenBank.
GenBank.
Bootstrap
Figuresupport
18. values
Maximum and Bayesian
likelihood tree posterior
of probabilities
Lomentariaceae are
rbcL-3P given
sequencesfor
Bootstrap support values and Bayesian posterior probabilities are given for branches whenbranches
available when
in >70%
GenBank. andand
>70%
>0.75 Bootstrap support
respectively. values
Punta and Ceratodictyon
Burica Bayesian posterior probabilities
specimens are are given
shown in for branches
larger type. when >70% and
>0.75 respectively. Punta Burica Ceratodictyon specimens are shown in larger type.
>0.75 respectively. Punta Burica Ceratodictyon specimens are shown in larger type.
All Punta Burica specimens were growing in tufts on subtidal rocks at 45 m depth off the
All Punta All Punta
Burica Burica specimens
specimens weregrowing
were growing in in tufts
tufts on
onsubtidal
subtidal rocks at 45
rocks atm 45depth off the off the
m rise
depth
southwest point of Isla Burica (Figure 1). The thalli consisted of prostrate axes giving to erect
southwest southwest
point point
of Islaof Isla
Burica Burica
(Figure(Figure
1). 1).
The The thalli
thalli consisted
consisted of
of prostrate
prostrate axes
axes giving
giving rise to
rise erect
to erect axes
axes up to 23 cm in height (Figure 19A). Erect axes were proximally terete and became distally
axes up to 23 cm in height (Figure 19A). Erect axes were proximally terete and became distally
upcompressed.
to 23 cm in height (Figure 19A). Erect axes were proximally terete and became distally compressed.
compressed.
Remarks:
Remarks: Saunders
Saunders
Remarks:
etetal.
Saunders al.[71]
[71]
et al.
established
established
[71]
that
establishedthat
Gelidiopsis
that Gelidiopsis
was
was
Gelidiopsis was
agenus
genus
a agenus
within
within
within the the
the Rhodymeniales
Rhodymeniales
Rhodymeniales
family
familyLomentariaceae.
Lomentariaceae.
family Ceratodictyon
Lomentariaceae. Ceratodictyon was was
Ceratodictyon originally
was originallydescribed
originally for anfor
described
described algal species
foran an algal
algal living symbiotically
species
species livingliving
with a symbiotically
sponge with
symbiotically [72].with
a Norris
a sponge
sponge [73] proposed
[72].
[72]. [73]the
Norris[73]
Norris merger
proposed
proposed the Ceratodictyon
theofmerger
merger ofof and and
Ceratodictyon
CeratodictyonGelidiopsis,
Gelidiopsis,
and but this
Gelidiopsis,
synonymy but this synonymy
was generally
but this synonymy was
was not generally
followed
generally not followed
not until
followed until
DNAuntil DNA
sequence sequence
DNA analyses analyses
sequence supported supported their
their congeneric
analyses supported their
congeneric
congeneric
status [74,75]. statusstatus
Ceratodictyon[74,75].
[74,75]. Ceratodictyon
repens
Ceratodictyon repenswas
repens
was originally was originallyfrom
originally
described described
Newfrom
described fromNewNew
Caledonia Caledonia
andCaledonia and is
is reportedand from
is
reported from many Indo-Pacific localities e.g., [65,76]. The species is known from El Salvador in the
reported
many from many
Indo-Pacific Indo-Pacific
localities localities
e.g., [65,76]. Thee.g., [65,76].isThe
species knownspecies
from is known from El
El Salvador inSalvador
the tropicalin the
East
tropical East Pacific (as Gelidiopsis repens (Ktzing) Weber-van Bosse [55,77]), but this is the first
tropical
Pacific (as East Pacificrepens
Gelidiopsis (as Gelidiopsis repens (Ktzing) Weber-van Bosse [55,77]), but this is the first
report from Panama. (Ktzing) Weber-van Bosse [55,77]), but this is the first report from Panama.
report from Panama.

Figure 19. Habits of Punta Burica Ceratodictyon species. (A) Ceratodictyon repens, scale = 1 cm; (B) C.
19. Habits
Figure scoparium, of Punta Burica Ceratodictyon species. (A) Ceratodictyon repens, scale = 1 cm;
scale = 1 cm.
C. scoparium,
(B)Figure scale
19. Habits of = 1 cm.Burica Ceratodictyon species. (A) Ceratodictyon repens, scale = 1 cm; (B) C.
Punta
3.2.16. Ceratodictyon
scoparium, scoparium (Montagne and Millardet) R.E. Norris
scale = 1 cm.
3.2.16. Ceratodictyon scoparium
BLAST results (Montagne
with sequences and Millardet)
of PHYKOS-4590 R.E.that
showed Norris
they were identical to the rbcL-3P
3.2.16.sequence
Ceratodictyon scoparium (Montagne and Millardet) R.E. Norris
of an unidentified Ceratodictyon sp. from Pacific Mexico, and identical (UPA) and 99%
BLAST results with sequences of PHYKOS-4590 showed that they were identical to the rbcL-3P
(COI-5P)
BLAST similar
results to sequences
with sequences from Hawaiian specimens
of PHYKOS-4590 ofthat
C. they
scoparium. PHYKOS-4590
to thewas
sequence of an unidentified Ceratodictyon sp. from showed
Pacific Mexico, wereidentical
and identical (UPA) rbcL-3P
and 99%
resolved sister to the Punta Burica C. repens specimens in the rbcL-3P phylogeny (Figure 18).
sequence of an unidentified Ceratodictyon sp. from Pacific Mexico, and identical
(COI-5P) similar to sequences from Hawaiian specimens of C. scoparium. PHYKOS-4590 was resolved (UPA) and 99%
(COI-5P) similar to sequences from Hawaiian specimens of C.
sister to the Punta Burica C. repens specimens in the rbcL-3P phylogeny (Figure 18).scoparium. PHYKOS-4590 was
resolved sister to the Punta Burica C. repens specimens in the rbcL-3P phylogeny (Figure
The PHYKOS-4590 specimens were growing as a turf on the exposed intertidal mudstone substrate 18).
and in tide pools along the Punta Burica shoreline (Figure 1).
Remarks: Ceratodictyon scoparium was originally described from Runion Island in the western
Indian Ocean and similar to C. repens is reported throughout much of the Indo-Pacific [35].
Morphologically the two species are also similar, with both demonstrating the condensed branching
Diversity 2017, 9, 19 23 of 38

that results in a pseudopalmate appearance for some axes [44,76]. Punta Burica C. scoparium specimens
were smaller in stature than both the collected C. repens specimens (Figure 19B) and Hawaiian
specimens of C. scoparium described by Abbott [44] although they otherwise closely match Abbotts
description. This small stature may have an environmental basis as the Punta Burica C. scoparium was
growing as a turf in the intertidal mudstone and tide pool habitat. This is the first record of C. scoparium
from the eastern Pacific.

3.2.17. Gracilaria Species

Sequences for the three analyzed loci from five of the Punta Burica specimens (PHYKOS-4519,
4541, 4548, 4630, and 4640) separated out as three related species: (1) PHYKOS-4640; (2) PHYKOS-4519,
4541 and 4630; (3) PHYKOS-4548 (Figure 2). BLAST searches with these sequences returned
Gracilaria specimen hits, but none with homology at a level to suggest species identifications (Table 2).
Phylogenetic analyses of publically available rbcL-3P sequence data for Gracilaria species resolved
all three of the Punta Burica species within Gracilaria sensu stricto (Figure 20). Gracilaria sp. 2 was
strongly supported in a sister position to G. galetensis Gurgel, Fredericq and J.N. Norris, a species of
the tropical Western Atlantic that was originally described from Caribbean Panama. Thus, these two
species potentially represent a transisthmian geminate species pair. Gracilaria sp. 1 and Gracilaria sp. 3
were resolved within a strongly supported clade of Gracilaria species from both the Western Atlantic
and Pacific (Figure
Diversity 2017, 9, 19 20). 24 of 39

Figure
Figure 20. Maximum
20. Maximum likelihood
likelihood tree tree of Gracilaria
of Gracilaria rbcL-3P
rbcL-3P sequences
sequences fromfrom GenBank.
GenBank. Bootstrap
Bootstrap support
support values and Bayesian posterior probabilities are given for branches when >70% and >0.75
values and Bayesian posterior probabilities are given for branches when >70% and >0.75 respectively.
respectively. Punta Burica Gracilaria specimens are shown in larger type.
Punta Burica Gracilaria specimens are shown in larger type.
Remarks: Eight species of Gracilaria are reported from Pacific Central America. Most of these are
Gracilarialarge
relatively sp. 1compared
was collected
to the from
Puntasubtidal rock atGracilaria
Burica species. 45 m depth
brevis off
W.R.the southwest
Taylor point of Isla
was originally
described
Burica (Figure as
1).reaching onlyof5 Gracilaria
Specimens cm in height
sp.[2], and itcollected
2 were was included in the from
subtidally Littlerboth
and the
Littler [49] web
mixed sediment
database of Pacific Panama species. The Punta Burica Gracilaria sp.3 is similar
and mudstone bottom just beyond the surf zone along Punta Burica (PHYKOS-4519; PHYKOS-4541), to G. crispata Setchell
and Gardner and G. spinigera E.Y. Dawson in having acute, dentate-like apices, but the collected
Punta Burica specimens were much smaller than the reported sizes for these species [62]. A
comprehensive examination of tropical eastern Pacific Gracilaria species will be needed to determine
if the Punta Burica species are simply juvenile growth forms or undescribed species. At least two, if
not all three of these species are unreported for Panama.
Diversity 2017, 9, 19 24 of 38

and rocks at 45 m depth off the southwest point of Isla Burica. Gracilaria sp. 3 was also collected
from the mixed sediment and mudstone bottom just beyond the Punta Burica surf zone. Observed
specimensFigureof the20.three
Maximum
specieslikelihood tree of
were small andGracilaria
mostlyrbcL-3P sequences
less than from (Figure
2 cm high GenBank.21).Bootstrap
Gracilaria sp. 3
support values and Bayesian posterior probabilities are given for branches when >70% and >0.75
differed from the others in having dissected, acute branch apices (Figure 21C).
respectively. Punta Burica Gracilaria specimens are shown in larger type.
Remarks: Eight species of Gracilaria are reported from Pacific Central America. Most of these
are relatively largeEight
Remarks: compared
species ofto Gracilaria
the Puntaare Burica species.
reported Gracilaria
from Pacific brevis
Central W.R. Taylor
America. Most ofwas originally
these are
described as reaching
relatively only 5 cm
large compared in Punta
to the heightBurica
[2], and it was
species. included
Gracilaria in the
brevis W.R.Littler
TaylorandwasLittler [49] web
originally
described
database as reaching
of Pacific Panama only 5 cm in The
species. height [2], and
Punta it was
Burica includedsp.3
Gracilaria in the
is Littler
similar andto Littler [49] web
G. crispata Setchell
database of Pacific Panama species. The Punta Burica Gracilaria sp.3 is similar
and Gardner and G. spinigera E.Y. Dawson in having acute, dentate-like apices, but the collected to G. crispata SetchellPunta
Buricaand Gardner and
specimens wereG.much
spinigera E.Y. Dawson
smaller than thein having acute,
reported dentate-like
sizes for apices,
these species butAthe
[62]. collected
comprehensive
Punta Burica specimens were much smaller than the reported sizes for these species [62]. A
examination of tropical eastern Pacific Gracilaria species will be needed to determine if the Punta Burica
comprehensive examination of tropical eastern Pacific Gracilaria species will be needed to determine
species are simply juvenile growth forms or undescribed species. At least two, if not all three of these
if the Punta Burica species are simply juvenile growth forms or undescribed species. At least two, if
species
notare unreported
all three of thesefor Panama.
species are unreported for Panama.

Figure 21. Habits of Punta Burica Gracilaria species. (A) Gracilaria sp. 1 (aniline blue stained, whole
Figure 21. Habits of Punta Burica Gracilaria species. (A) Gracilaria sp. 1 (aniline blue stained, whole
mount slide specimen), scale = 5 mm; (B) Gracilaria sp. 2, scale = 5 mm; (C) Gracilaria sp. 3, scale = 5 mm.
mount slide specimen), scale = 5 mm; (B) Gracilaria sp. 2, scale = 5 mm; (C) Gracilaria sp. 3, scale = 5 mm.
3.2.18. Aglaothamnion sp.
3.2.18. Aglaothamnion sp.
The PHYKOS-4553 rbcL-3P BLAST search returned sequences of Aglaothamnion halliae (Collins)
N.E. Aponte, D.L. Ballantine and J.N. Norris and A. hookeri (Dillwyn) Maggs and Hommersand at 96%
similarity, and a variety of Aglaothamnion and Callithamnion species without close homology in BLAST
searches with COI-5P and UPA. Analyses of the rbcL-3P locus with other available Callithamnieae
sequences resolved the Punta Burica species within a clade that also included A. halliae, A. hookeri and
another unidentified Aglaothamnion species (Figure 22).
PHYKOS-4553 was growing attached to mudstone substrate on the mixed sediment and mudstone
bottom just beyond the surf zone at Punta Burica (Figure 1).
Remarks: There currently is little available sequence data for species of Aglaothamnion or Callithamnion,
and their relationships within the tribe Callithamnieae has been best characterized by concatenated data
sets of multiple loci, albeit with limited taxon sampling [78,79]. Aglaothamnion and Callithamnion species
are similar in general habit with both genera having distichous or radial, alternate branching from
a uniseriate main axis. The genera are separated by the presence of multinucleate cells in Callithamnion,
in contrast to Aglaothamnion having only uninucleate cells [80]. Aglaothamnion has been relatively well
characterized in the tropical Western Atlantic [81], but both Aglaothamnion and Callithamnion are poorly
known in the tropical East Pacific [5]. Taylor [2] included five species in his list, four of which were newly
described by him. However, two were from Pacific Mexico and the remaining three were only collected
in the Galapagos Islands. Callithamnion marshallense E.Y. Dawson is the only species of either genus
known from Pacific Central America with reports from Costa Rica [5], and it is also included in the Littler
and Littler [49] web database of Pacific Panama species. The Punta Burica species had lateral branchlets
that develop from nearly all main axis cells in an alternate distichous pattern (Figure 23A,B), in contrast
to C. marshallense that has branchlets develop in an alternate radial pattern and not from every main
axis cell [82]. The Punta Burica specimen was male, and spermatangia development was similar to that
described for other Aglaothamnion species [44,81]. Spermatangial initials were cut off from the adaxial side
Diversity 2017, 9, 19 25 of 38

of lateral branchlet cells towards their distal ends and divided to form antheridial stands [83] that cut
off spermatia and may overlap with the adjacent branchlet cell (Figure 23B,C). PHYKOS-4553 was similar
to Taylors
Diversity[2] description
2017, 9, 19 of C. pacificum W.R. Taylor, which is only known from the type 25collection,
of 39

(epiphytic on larger algae dredged from 4184 m depth near Isla Soccoro, Mexico) an environment that is
The PHYKOS-4553 rbcL-3P BLAST search returned sequences of Aglaothamnion halliae (Collins)
likely quite different from the turbulent mixed sediment and mudstone bottom where the Punta Burica
N.E. Aponte, D.L. Ballantine and J.N. Norris and A. hookeri (Dillwyn) Maggs and Hommersand at
specimen was collected. Callithamnion pacificum, may be further distinguished by its more irregular
96% similarity, and a variety of Aglaothamnion and Callithamnion species without close homology in
branching,
BLASTthoughsearches clearly,
withadditional
COI-5P and study of both
UPA. is needed
Analyses to determine
of the theirwith
rbcL-3P locus relationship. Regardless,
other available
this species has not sequences
Callithamnieae be reported previously
resolved fromBurica
the Punta Pacificspecies
Panama or Pacific
within a cladeCentral America
that also and
included A. may
represent a new
halliae, species.
A. hookeri and another unidentified Aglaothamnion species (Figure 22).

Diversity 2017, 9, 19 26 of 39

Aglaothamnion species [44,81]. Spermatangial initials were cut off from the adaxial side of lateral
branchlet cells towards their distal ends and divided to form antheridial stands [83] that cut off
spermatia and may overlap with the adjacent branchlet cell (Figure 23B,C). PHYKOS-4553 was
similar to Taylors [2] description of C. pacificum W.R. Taylor, which is only known from the type
collection, (epiphytic on larger algae dredged from 4184 m depth near Isla Soccoro, Mexico) an
environment that is likely quite different from the turbulent mixed sediment and mudstone bottom
where the 22.
Figure Punta
Maximum Burica specimen
likelihood tree was collected. rbcL-3P
Callithamnion pacificum, mayBootstrap
be further
Figure 22. Maximum likelihood tree ofofCallithamnieae
Callithamnieae rbcL-3Psequences
sequences from
fromGenBank.
GenBank. Bootstrap
distinguished by its more
support values irregular branching, thoughare clearly, additional study
whenof bothandis needed
>0.75 to
support values andand Bayesian
Bayesian posterior
posterior probabilities
probabilities are given
givenforforbranches
branches when>70%
>70% and >0.75
determine their relationship.
respectively. The Punta Burica Regardless, thisspecies
Aglaothamnion speciesis has
shownnotinbe reported
larger type. previously from Pacific
respectively. The Punta Burica Aglaothamnion species is shown in larger type.
Panama or Pacific Central America and may represent a new species.
PHYKOS-4553 was growing attached to mudstone substrate on the mixed sediment and
mudstone bottom just beyond the surf zone at Punta Burica (Figure 1).
Remarks: There currently is little available sequence data for species of Aglaothamnion or
Callithamnion, and their relationships within the tribe Callithamnieae has been best characterized by
concatenated data sets of multiple loci, albeit with limited taxon sampling [78,79]. Aglaothamnion and
Callithamnion species are similar in general habit with both genera having distichous or radial,
alternate branching from a uniseriate main axis. The genera are separated by the presence of
multinucleate cells in Callithamnion, in contrast to Aglaothamnion having only uninucleate cells [80].
Aglaothamnion has been relatively well characterized in the tropical Western Atlantic [81], but both
Aglaothamnion and Callithamnion are poorly known in the tropical East Pacific [5]. Taylor [2] included
five species in his list, four of which were newly described by him. However, two were from Pacific
Mexico and the remaining three were only collected in the Galapagos Islands. Callithamnion
marshallense
Figure 23. E.Y. Dawson issp.
Aglaothamnion the(A)only species
Habit of either
of Punta Buricagenus known
specimen; from Pacific
(B) Apical portionsCentral America
of two axes
Figure
withwith23. Aglaothamnion
reports sp. (A) Habit ofisPunta Burica specimen; (B) Apical portions of two axes with
alternate distichous pattern of branching and antheridial stands on the adaxial side of of
from Costa Rica [5], and it also included in the Littler and Littler [49] web database
alternate
Pacific distichous
Panama
branchlets, scale
pattern
species. Them;
= 100
of branching
Punta(C) Burica
and
Fertile species
antheridial
hadwith
male axis
stands
lateral on stands
branchlets
antheridial
thethat
adaxial side of
develop
at variousfrom
branchlets,
nearly
stages of all
scale =axis
100cells
m; in(C)
maindevelopment an Fertile
alternatemale axis
distichous with antheridial
pattern (Figure stands
23A,B), at
in various
contrast
(arrowheads) and spermatia being cut off (arrows), scale = 20 m. tostages
C. of development
marshallense that has
(arrowheads)
branchlets developand spermatia being cut
in an alternate off (arrows),
radial pattern andscalenot= 20
fromm.every main axis cell [82]. The Punta
3.2.19.
Burica Centroceras
specimen was gasparrinii (Meneghini)
male, and Ktzing
spermatangia development was similar to that described for other
PHYKOS-4594 and PHYKOS-4600 shared identical sequences for the three analyzed loci.
BLAST searches with COI-5P and UPA returned specimens identified as Centroceras clavulatum (C.
Agardh) Montagne (94%) and Centroceras sp. (99%) respectively. The Punta Burica specimens
rbcL-3P sequences were found to be exact matches with a specimen identified as C. gasparrinii that
had been collected from near the Pacific terminus of the Panama canal. Phylogenetic analyses of
Diversity 2017, 9, 19 26 of 38

3.2.19. Centroceras gasparrinii (Meneghini) Ktzing

PHYKOS-4594 and PHYKOS-4600 shared identical sequences for the three analyzed loci. BLAST
searches with COI-5P and UPA returned specimens identified as Centroceras clavulatum (C. Agardh)
Montagne (94%) and Centroceras sp. (99%) respectively. The Punta Burica specimens rbcL-3P sequences
were found to be exact matches with a specimen identified as C. gasparrinii that had been collected from
near the Pacific terminus of the Panama canal. Phylogenetic analyses of rbcL-3P sequence data available
from Diversity
GenBank 2017,resolved
9, 19 Pacific Panama specimens in a well supported C. gasparrinii clade (Figure
27 of 3924).

Figure 24. Maximum likelihood tree of Centroceras species rbcL-3P sequences from GenBank.
Figure 24. Maximum likelihood tree of Centroceras species rbcL-3P sequences from GenBank. Bootstrap
Bootstrap support values and Bayesian posterior probabilities are given for branches when >70% and
support values and Bayesian posterior probabilities are given for branches when >70% and >0.75
>0.75 respectively. The Punta Burica C. gasparrinii specimens are shown in larger type.
respectively. The Punta Burica C. gasparrinii specimens are shown in larger type.

Both specimen collections were made from intertidal turfs growing on the mudstone substrate
along the Punta Burica shoreline (Figure 1).
Remarks: Centroceras gasparrinii was long considered a synonym of C. clavulatum until the
detailed morphological and molecular analyses of Won et al. [30] established that the shape of acropetal
cortical cells, spines and gland cells were vegetative characters that could be used to distinguish most
Centroceras species and these have been used in subsequent studies describing new species [84,85].
Erect axes of Punta Burica specimens had forcipate, slightly inrolled apices, di-trichotomous branching
and nodal cortication characteristics as descibed for C. gasparrini [30] (Figure 25A,B). Tetrasporangia
were produced in a whorl around the axes at upper nodes (Figure 25C).

Figure 25. Centroceras gasparrinii. (A) Axis with dichotomous branching and forcipate, slightly
enrolled tips, scale = 200 m; (B) Cortical unit with four cortical initials (numbered cells) derived
from a pericentral cell (P) with the acropetal cortical cells cut off from initials 13 indicated (arrows),
scale = 20 m; (C) Fertile tetrasporophyte axis with tetrasporangia produced in whorls at the nodes,
scale = 100 m.
Diversity 2017, 9, 19 27 of 38

Dawson [86] reported C. minutum Yamada from Pacific Panama, and this was the only record of
Centroceras from Pacific Central America until the study of Won et al. [30] that included C. gasparrinii.
The two species are easily distinguished by branching pattern, which is alternate in C. minutum and
di-trichotomous in C. gasparrinii. Centroceras gasparrinii is reported from both Caribbean and Pacific
Figure 24. Maximum likelihood tree of Centroceras species rbcL-3P sequences from GenBank.
Panama, and notably at both termini of the Panama Canal. Whether these populations are more closely
Bootstrap support values and Bayesian posterior probabilities are given for branches when >70% and
related than>0.75
theirrespectively.
intra-oceanic conspecifics
The Punta remains
Burica C. gasparrinii to be studied.
specimens are shown in larger type.

Figure 25. Centroceras gasparrinii. (A) Axis with dichotomous branching and forcipate, slightly
Figure 25. Centroceras gasparrinii. (A) Axis with dichotomous branching and forcipate, slightly enrolled
enrolled tips, scale = 200 m; (B) Cortical unit with four cortical initials (numbered cells) derived
tips, scale = 200
from m; (B) Cortical
a pericentral unitthe
cell (P) with with four cortical
acropetal cortical initials
cells cut(numbered cells)
off from initials derived
13 from
indicated a pericentral
(arrows),
cell (P) with the acropetal cortical cells cut off from initials 13 indicated (arrows), scale = 20
scale = 20 m; (C) Fertile tetrasporophyte axis with tetrasporangia produced in whorls at the nodes, m; (C) Fertile
tetrasporophyte axis with tetrasporangia produced in whorls at the nodes, scale = 100 m.
scale = 100 m.

3.2.20. Spyridia sp.9, 19

Diversity 2017, 28 of 39

Only a COI-5P
3.2.20. sequence was generated from PHYKOS-4584, and BLAST searches revealed
Spyridia sp.
a closest match (95%) with a specimen identified as Spyridia filamentosa (Wulfen) Harvey from Hawaii.
Only a COI-5P sequence was generated from PHYKOS-4584, and BLAST searches revealed a
The nextclosest
closest matches
match (8889%)
(95%) with wereidentified
a specimen to otherasHawaiian specimens
Spyridia filamentosa also identified
(Wulfen) S. filamentosa.
Harvey fromasHawaii.
The
ThePHYKOS-4584 collection
next closest matches (8889%)was
weremade
to otherfrom a tide
Hawaiian pool along
specimens the Punta
also identified Burica shoreline
as S. filamentosa.
(Figure 1). TheThe PHYKOS-4584
specimen displays the
collection general
was morphological
made from characteristics
a tide pool along of Spyridia
the Punta Burica including
shoreline
(Figure 1). The specimen displays the general morphological characteristics of Spyridia
fully corticated indeterminate axes with a determinate branchlet produced by each indeterminate axis including
fully corticated indeterminate axes with a determinate branchlet produced by each indeterminate
cell; inderminate axis cortication alternating bands of shorter, broader nodal cells and longer, narrower
axis cell; inderminate axis cortication alternating bands of shorter, broader nodal cells and longer,
internodal cells, and determinate branchlets corticated only at nodes and with some tips terminated by
narrower internodal cells, and determinate branchlets corticated only at nodes and with some tips
acuminate spines by
terminated (Figure 26). spines (Figure 26).
acuminate

Figure 26. Spyridia sp. from Punta Burica. (A) Apical region of interminate axis with one determinate
Figure 26. Spyridia sp. from Punta Burica. (A) Apical region of interminate axis with one determinate
branchlet produced by each axial cell in a radial pattern. Some of the determinate branchlets have
branchlet
beenproduced
broken offby each specimen
during axial cellpreservation
in a radial pattern.
(arrows), scaleSome
= 200 of the
m; (B)determinate
Inderminate axisbranchlets
have been broken off during specimen preservation (arrows), scale = 200 m; (B) Inderminate
cortication pattern of alternating bands of shorter, broader and narrower, longer cells, scale = 20 m; axis
cortication pattern of alternating
(C) Determinate branchlet withbands of shorter,
nodal bands broader
of corticating and
cells narrower,
and longer
an acuminate cells,= 50
tip, scale scale
m.= 20 m;
(C) Determinate branchlet with nodal bands of corticating cells and an acuminate tip, scale = 50 m.
Remarks: Spyridia filamentosa is widely reported around the globe [42], but previous studies have
revealed that it is a complex of cryptic species [8789]. Conklin and Sherwood [89] identified two
separate S. filamentosa lineages within the Hawaiian Islands based on nuclear-encoded LSU
sequences and determinate branchlet cell dimensions. The Hawaiian specimen with a 95% COI-5P
similarity to the Punta Burica species was part of Conklin and Sherwoods LSU lineage-1, and the
specimens for the next closest BLAST hits were part of their LSU lineage-2 [89]. Although the
Diversity 2017, 9, 19 28 of 38

Remarks: Spyridia filamentosa is widely reported around the globe [42], but previous studies
have revealed that it is a complex of cryptic species [8789]. Conklin and Sherwood [89] identified
two separate S. filamentosa lineages within the Hawaiian Islands based on nuclear-encoded LSU
sequences and determinate branchlet cell dimensions. The Hawaiian specimen with a 95% COI-5P
similarity to the Punta Burica species was part of Conklin and Sherwoods LSU lineage-1, and the
specimens for the next closest BLAST hits were part of their LSU lineage-2 [89]. Although the
dimensions of determinate branchlet cells were found by Conklin and Sherwood [89] to be consistent
character states separating the Hawaii S. filamentosa LSU lineages, other morphological characters
used to distinguish Spyridia species have been found to be variable within species and even the same
thallus [90,91]. Taylor [2] reported S. filamentosa from Isla Taboga in the Bay of Panama and Littler and
Littler [49] included it in their web database. Based on its Adriatic Sea type locality and the established
diversity of cryptic species that are included under this name, the Punta Burica species and other
reports of S. filamentosa from Pacific Central America most likely do not belong in this species and
should be considered as unidentified Spyridia species.

3.2.21. Melanothamnus sp.

BLAST searches with rbcL-3P and COI-5P sequences for PHYKOS-4568 showed a closest match
with sequences from a specimen identified as Melanothamnus pseudovillum (Hollenberg) Daz-Tapia
and Maggs (as Polysiphonia pseudovillum Hollenberg) from Caribbean Panama (Table 2). The Caribbean
Panama M. pseudovillum and PHYKOS-4568 Melanothamnus sp. were also fully supported as sister
species in Diversity
phylogenetic
2017, 9, 19
analyses of rbcL sequences of Polysiphonia sensu lato species (Figure 27).
29 of 39

Figure 27. Maximum likelihood rbcL tree of Polysiphonia sensu lato and other species of closely related
Figure 27. Maximum likelihood rbcL tree of Polysiphonia sensu lato and other species of closely related
genera. Bootstrap support values and Bayesian posterior probabilities are given for branches when
genera. Bootstrap support
>70% and >0.75 values The
respectively. andPunta
Bayesian
Burica posterior probabilities
specimens are aretype.
shown in larger given for branches when
>70% and >0.75 respectively. The Punta Burica specimens are shown in larger type.
The Punta Burica Melanothamnus species was found growing as patches of near monospecific
turf within tide pools (Figures 1A and 28A). Axes were ecorticate with four pericentral cells
displaying plastids restricted to their radial walls, and had rhizoids that were cut off from
pericentral cells (Figure 28BD). Tetrasporangia developed in short straight series that shifted to
offset positions around the axis (Figure 28E).
Remarks: Melanothamnus was a poorly known genus of two relatively robust rhodomelacean
species restricted in distribution to northeast Africa and southwest Asia [92,93]. Recent DNA
Diversity 2017, 9, 19 29 of 38

The Punta Burica Melanothamnus species was found growing as patches of near monospecific turf
within tide pools (Figures 1A and 28A). Axes were ecorticate with four pericentral cells displaying
plastids restricted to their radial walls, and had rhizoids that were cut off from pericentral cells
(Figure 28BD). Tetrasporangia developed in short straight series that shifted to offset positions around
the axis (Figure 28E).
Remarks: Melanothamnus was a poorly known genus of two relatively robust rhodomelacean
species restricted in distribution to northeast Africa and southwest Asia [92,93]. Recent DNA
sequence analyses of Polysiphonia sensu lato species did not resolve Melanothamnus, Fernandosiphonia,
and Neosiphonia as independent monophyletic lineages [94]. This combined with a re-evaluation
of morphological characters lead to the synonymy of Fernandosiphonia and Neosiphonia under
Melanothamnus. The restriction of plastids to radial walls and their absence from the outer walls
of pericentral cells along with 3-celled carpogonial branches are synapomorphic character states for
Melanothamnus species [94]. Rhizoids that are cut off from pericentral cells is another character state
shared by Melanothamnus species, but this is a state that is found in many Rhodomelaceae genera.
Many of the character states observed in the Punta Burica Melanothamnus species match those
described for Caribbean Panama M. pseudovillum [95], but the two species differ in the development
of tetrasporangia, which is considered to be a consistent character within Polysiphonia sensu lato
Diversity 2017, 9, 19 30 of 39
species [25]. Caribbean Panama M. pseudovillum had tetrasporangia that developed in a long
spiral
series, series, in contrast
in contrast to the to the short
offset offsetstraight
short straight series
series of of tetrasporangia
tetrasporangia observed
observed in the Burica
in the Punta Punta
Burica
species. species.

Figure 28. Melanothamnus sp. from Punta Burica. (A) In situ image of specimens growing as a turf
Figure 28. Melanothamnus sp. from Punta Burica. (A) In situ image of specimens growing as a turf
within tide pools; (B) Smash preparation showing one central axial (arrows) and four pericentral
within tide pools; (B) Smash preparation showing one central axial (arrows) and four pericentral cells
cells per segment, scale = 20 m; (C) Pericentral cells displaying plastids (arrows) restricted to radial
per segment, scale = 20 m; (C) Pericentral cells displaying plastids (arrows) restricted to radial walls,
scale =scale
walls, = 20
20 m; (D)m; (D) Rhizoid
Rhizoid cut off
cut off from from pericentral
pericentral cell, scalecell,
= 50scale = 50Tip
m; (E) m; (E) Tipaxis
of fertile of fertile axis
producing
producing tetrasporangia mother cells (arrows) in offset, short straight series,
tetrasporangia mother cells (arrows) in offset, short straight series, scale = 20 m. scale = 20 m.

The rbcL-3P divergence between the Caribbean Panama M. pseudovillum and Punta Burica
Melanothamnus sp. was 2.0%, which is generally considered to represent the low end of interspecific
divergence values for Polysiphonia sensu lato species e.g., [9698]. COI-5P divergence values in red
algae are generally greater than those for rbcL in complementary comparisons e.g., [99,100]. A recent
study of the closely related species Melanothamnus japonica (Harvey) Daz-Tapia and Maggs, M.
Diversity 2017, 9, 19 30 of 38

The rbcL-3P divergence between the Caribbean Panama M. pseudovillum and Punta Burica
Melanothamnus sp. was 2.0%, which is generally considered to represent the low end of interspecific
divergence values for Polysiphonia sensu lato species e.g., [9698]. COI-5P divergence values in red algae
are generally greater than those for rbcL in complementary comparisons e.g., [99,100]. A recent study of
the closely related species Melanothamnus japonica (Harvey) Daz-Tapia and Maggs, M. harveyi (Bailey)
Daz-Tapia and Maggs, and Polysiphonia akkeshiensis Segi found interspecific COI-5P divergences ranging
from 1.73.2% [101]. The COI-5P divergence of 2.8% between the Caribbean Panama M. pseudovillum
and Punta Burica Melanothamnus sp. falls within this range of interspecific values for closely related
species, and they represent a transisthmian geminate species pair.

3.2.22. Polysiphonia binneyi Harvey

PHYKOS-4534 COI-5P and UPA sequences were found by BLAST searches to be closest matches
with specimens of Polysiphonia echinata Harvey and a Polysiphonia sp. respectively. Searches with the
PHYKOS-4534 rbcL-3P sequence revealed a close homology (99%) with the sequence from a Caribbean
Panama P. binneyi specimen, and they were resolved together with strong support in the Polysiphonia
sensu lato rbcL phylogeny (Figure 27).
The PHYKOS-4534 sample was collected with a mixture of other algae from mixed
sediment-mudstone bottom just beyond the Punta Burica surf zone (Figure 1), and a limited amount
of material
Diversity 2017, was
9, 19 available for study. The specimens shared character states described for Caribbean 31 of 39
Panama P. binneyi including four pericentral cells; basally attenuated lateral branches; segments that
were mostly
that were shorter
mostly thanthan
shorter broad withwith
broad this this
being especially
being especiallyprominent
prominent near axes
near tips;
axes trichoblasts
tips; trichoblastsor
scar cells at each segment, and tetrasporangia in spiral series
or scar cells at each segment, and tetrasporangia in spiral series (Figure 29). (Figure 29).
Remarks: Mamoozadeh and
Remarks: Mamoozadeh and Freshwater
Freshwater [95] [95] generated
generated rbcL rbcL sequences from four Caribbean Caribbean
Panama specimens identified as P. binneyi. binneyi. Three shared identical sequences
sequences and and these were 1.1%
different
different from
fromthethefourth
fourthspecimen
specimenover overthe
therbcL-3P
rbcL-3P region.
region. Direct comparisons
Direct comparisons of the
of Punta
the PuntaBurica and
Burica
Caribbean
and Caribbean P. binneyi rbcL-3P
P. binneyi sequences
rbcL-3P showed
sequences that they
showed that differed by 0.81.6%.
they differed This isThis
by 0.81.6%. within what
is within
has
what been
hasgenerally considered
been generally an intraspecific
considered level oflevel
an intraspecific variation e.g., [95,96].
of variation Comparisons
e.g., [95,96]. of COI-5P
Comparisons of
sequences among these
COI-5P sequences amongspecimens are currentlyare
these specimens notcurrently
possible because Mamoozadeh
not possible because and Freshwater and
Mamoozadeh [95]
were unable [95]
Freshwater to amplify and sequence
were unable this locus
to amplify and from the Caribbean
sequence this locus binneyi
P.from thespecimens.
CaribbeanPolysiphonia
P. binneyi
binneyi
specimens. Polysiphonia binneyi is resolved in a strongly supported clade thatonly
is resolved in a strongly supported clade that is part of a series of clades distantly
is part related
of a series of
to Polysiphonia
clades sensu stricto
only distantly that
related to need reclassification
Polysiphonia at the
sensu stricto genus
that needlevel see [94]. Originally
reclassification described
at the genus level
from KeyOriginally
see [94]. West, FL, described
USA, this from
species
Keywas previously
West, FL, USA, known only from
this species was the tropicalknown
previously Western Atlantic
only from
and Caribbean
the tropical [42]. Atlantic and Caribbean [42].
Western

Figure 29.
Figure 29. Polysiphonia
Polysiphoniabinneyi
binneyifrom
fromPunta
PuntaBurica.
Burica.(A) (A)
AxesAxes
withwith
segments shorter
segments than broad,
shorter scale
than broad,
= 200 m; (B) Tip of axis with segments much shorter than broad and trichoblasts (arrows)
scale = 200 m; (B) Tip of axis with segments much shorter than broad and trichoblasts (arrows) produced produced
on every
on everysegment,
segment,scale
scale= =5050 m;
m; (C)(C) Pericentral
Pericentral cellscells
withwith plastids
plastids present
present on outer
on outer walls
walls and and
two two
visible
visible
scar scar
cells cells (arrows),
(arrows), scale =scale = 50
50 m; m;
(D) (D) Tetrasporangia
Tetrasporangia developing
developing in a spiral
in a spiral series,series,
scale =scale = 50 m.
50 m.

3.2.23. Polysiphonia sp.

BLAST searches with sequences of PHYKOS-4515, PHYKOS-4525, PHYKOS-4526 and
PHYKOS-4552 resulted in hits with sequences from Caribbean Panama specimens identified as
Polysiphonia sp. for rbcL-3P and COI-5P, and species of Herposiphonia and Symphyocladia for UPA.
Analyses of rbcL sequences in this study resolve the Caribbean and Pacific Panama specimens within
a fully supported clade that terminates an independent lineage among representatives of
Diversity 2017, 9, 19 31 of 38

3.2.23. Polysiphonia sp.

BLAST searches with sequences of PHYKOS-4515, PHYKOS-4525, PHYKOS-4526 and
PHYKOS-4552 resulted in hits with sequences from Caribbean Panama specimens identified as
Polysiphonia sp. for rbcL-3P and COI-5P, and species of Herposiphonia and Symphyocladia for UPA.
Analyses of rbcL sequences in this study resolve the Caribbean and Pacific Panama specimens within
a fully supported clade that terminates an independent lineage among representatives of Herposiphonia,
Lophosiphonia, Pterosiphonia, Symphyocladia, and Wilsonosiphonia (Figure 27).
All four specimen collections were made from the mixed sediment-mudstone bottom just beyond
the Punta Burica surf zone. Axes were ecorticate and had four pericentral cells with relatively large
central axial cells; rhizoids were cut off from pericentral cells, and trichoblasts and scar cells were
variable in pattern. Mid-axis segments were approximately 1 as long as wide, but this abruptly
shifted to 0.5 as long as wide in upper portions of axes giving them an elongated clavate shape
(Figure 30A).
Remarks: The Caribbean Panama Polysiphonia sp. rbcL and COI-5P sequences were generated
from four specimens that shared identical sequences at both loci [102], and direct comparisons
with the Punta Burica sequences revealed only 0.1% (rbcL) and 0.3% (COI-5P) divergence. The
Punta Burica and Caribbean Panama Polysiphonia sp. specimens shared states for all observed key
morphological characters. Reproductive structures were not observed in Caribbean specimens [102],
but tetrasporangia in spiral series were seen developing in short lateral branches of the Punta Burica
specimens (Figure 30A,B). Previous phylogenetic analyses have resolved this species as an independent
lineage 19 close affinity to any Polysiphonia sensu lato genera [95].
with9,no
Diversity 2017, 32 of 39

Figure 30.
Figure 30. Polysiphonia
Polysiphonia sp.
sp. from
from Punta
Punta Burica.
Burica. (A)
(A) Erect
Erect axis
axis with
with aa short
short lateral
lateral branches
branches bearing
bearing
tetrasporangia (arrows) and segments that become shorter than broad distally, scale = 200 m;
tetrasporangia (arrows) and segments that become shorter than broad distally, scale = 200 m; (B) Short (B)
Short lateral
lateral branchbranch with tetrasporangia
with tetrasporangia in a spiral
in a spiral series,series,
scale =scale = 100 m.
100 m.

3.2.24. Wilsonosiphonia
3.2.24. howei (Hollenberg)
Wilsonosiphonia howei (Hollenberg) D.
D. Bustamante,
Bustamante, Won
Won and
and T.O.
T.O.Cho
Cho
Sequences for
Sequences the three
for the three analyzed
analyzed loci
loci from
from PHYKOS-4657
PHYKOS-4657 and and PHYKOS-4663
PHYKOS-4663 returned
returned BLAST
BLAST
hits for Caribbean Panama specimens of Wilsonosiphonia howei (Table 2). Variation
hits for Caribbean Panama specimens of Wilsonosiphonia howei (Table 2). Variation between the Pacificbetween the
Pacific
and and Caribbean
Caribbean specimensspecimens
in nearlyincomplete
nearly complete rbcL sequences
rbcL sequences was and
was 1.11.2% 1.11.2% and in
in COI-5P COI-5P
sequences
sequences 2.72.9%. Phylogenetic analyses of rbcL sequences for Polysiphonia sensu lato species
2.72.9%. Phylogenetic analyses of rbcL sequences for Polysiphonia sensu lato species and closely related and
closely related genera resolve the Pacific and Caribbean Wilsonosiphonia howei together
genera resolve the Pacific and Caribbean Wilsonosiphonia howei together in a fully supported clade in a fully
supported
(Figure 27).clade (Figure 27).
Both PHYKOS-4657
Both PHYKOS-4657 and and PHYKOS-4663
PHYKOS-4663 were collected from
were collected short turf
from short turf patches
patches growing
growing onon high
high
intertidal rocks along the eastern shoreline of the Burica Peninusla (Figure 1). These
intertidal rocks along the eastern shoreline of the Burica Peninusla (Figure 1). These specimens specimens
displayed the
displayed the key
key morphological
morphological characters
characters states
states attributed
attributed to
to Wilsonosiphonia
Wilsonosiphonia species
species including
including
rhizoids cut off from the distal ends of pericentral cells and taproot shaped, multicellular rhizoid
tips (Figure 31A,B). The specimens were also ecorticate; had 1014 pericentral cells around relatively
wide central axial cells (Figure 31C); displayed a pericentral cell shift to offset positons across
segments; tetrasporangia that develop in a spiral series (Figure 31D), and cystocarps that were ovate
and without enlarged pericarp cells around the ostiole (Figure 31E).
Diversity 2017, 9, 19 32 of 38

rhizoids cut off from the distal ends of pericentral cells and taproot shaped, multicellular rhizoid tips
(Figure 31A,B). The specimens were also ecorticate; had 1014 pericentral cells around relatively wide
central axial cells (Figure 31C); displayed a pericentral cell shift to offset positons across segments;
tetrasporangia that develop in a spiral series (Figure 31D), and cystocarps that were ovate and without
enlarged pericarp cells around the ostiole (Figure 31E).
Remarks: Wilsonosiphonia howei was originally described as Polysiphonia howei Hollenberg based
on specimens from the Bahamas [2]. Taylor [2] also refered Pacific Panama specimens collected from
Isla Taboga in the Bay of Panama to this species, and it has been widely reported in warm-temperate
and tropical waters since then e.g., [90,103105]. Mamoozadeh and Freshwater [95] suggested that the
concept of W. howei (as Polysiphonia howei) encompassed multiple species based on reported variation
in spermatiagial branch development e.g., [104,106,107], pericentral cell numbers e.g., [44,90], and
divergence between available nuclear-encoded 18S rRNA gene sequences. Bustamante et al. [103]
included two new species in Wilsonosiphonia when they described the genus, W. fujiae D. Bustamante,
Won and T.O. Cho, the generitype, and W. indica D. Bustamante, Won and T.O. Cho. They also
considered the previous concept of W. howei to included multiple species, and suggested that its
distribution was limited to the western Atlantic. Two recent barcoding analyses of Polysiphonieae [101]
and Pterosiponieae [108] species found maximum intraspecific divergences in rbcL and COI-5P
sequences to be 0.7% and 0.9% respectively. The rbcL (1.11.2%) and COI-5P (2.72.9%) divergences
between the Pacific Panama and Caribbean Panama W. howei specimens analyzed here suggest that
they are separate species and represent a transisthmian geminate pair. An examination of W. howei
from throughout its current distribution in needed to determine how many species may be included
under
Diversitythis
2017,name.
9, 19 33 of 39

Figure 31. Wilsonosiphonia howei morphological characters. (A) Rhizoids with multicellular taproot
Figure 31. Wilsonosiphonia howei morphological characters. (A) Rhizoids with multicellular taproot
tips near
tips near the
the apical
apical tip
tipof
ofaaprostrate
prostrateaxis,
axis,scale
scale= =5050m;
m;(B)(B)
Base of of
Base a rhizoid showing
a rhizoid that
showing it isitcut
that off
is cut
from the distal end of the pericentral cell, scale = 25 m; (C) Squash preparation of
off from the distal end of the pericentral cell, scale = 25 m; (C) Squash preparation of axis with 10 axis with 10
elogated pericentral cells and a relatively wide central axial (arrows) per segment, scale
elogated pericentral cells and a relatively wide central axial (arrows) per segment, scale = 50 m; = 50 m; (D)
Tetrasporangia
(D) Tetrasporangiadeveloping
developingin ainspiral series,
a spiral series,scale
scale= =5050m;
m;(E)
(E) Optical
Optical section
section through
through ovateovate
cystocarp with
cystocarp withdeveloping
developing narrowly
narrowly obovateobovate carpospores
carpospores and non-enlarged
and non-enlarged pericarp
pericarp cells surrounding cells
surrounding the ostiole (arrows),
the ostiole (arrows), scale = 50 m. scale = 50 m.

4. Discussion
4. Discussion
Molecular assisted identification proved to be a useful tool in this study of the previously
Molecular assisted identification proved to be a useful tool in this study of the previously
unexplored Punta Burica marine algal flora. The three loci employed in the initial DNA barcoding
unexplored Punta Burica marine algal flora. The three loci employed in the initial DNA barcoding
approach showed different levels of variation with COI-5P having the highest, rbcL-3P the next
approach showed different levels of variation with COI-5P having the highest, rbcL-3P the next
highest and UPA the lowest. Despite these differences, cluster analyses with the three loci grouped
highest and UPA the lowest. Despite these differences, cluster analyses with the three loci grouped
the specimens into nearly identical genetic species, and analyses of the more variable COI-5P
the specimens into nearly identical genetic species, and analyses of the more variable COI-5P
sequences resolved only one more species than analyses of complementary rbcL-3P and UPA
sequences resolved only one more species than analyses of complementary rbcL-3P and UPA
sequences. Searches of publicly available databases with these sequences suggested at minimum
sequences. Searches of publicly available databases with these sequences suggested at minimum
possible genus-level classifications, and guided the assessment of morphological characters for the
possible genus-level classifications, and guided the assessment of morphological characters for the
verification of species-level classifications. However, careful evaluation of search results is required
verification of species-level classifications. However, careful evaluation of search results is required
because many database entries have not been updated to the most recent classification and others
represent misidentifications.
The recent compilation of marine algae reported in the Central American Pacific by
Fernndez-Garca et al. [5] recorded 379 species in the region. Pacific Panama had the second highest
number with 174, yet there were no records of marine algae from the western Gulf of Chiriqui
Diversity 2017, 9, 19 33 of 38

because many database entries have not been updated to the most recent classification and others
represent misidentifications.
The recent compilation of marine algae reported in the Central American Pacific by
Fernndez-Garca et al. [5] recorded 379 species in the region. Pacific Panama had the second highest
number with 174, yet there were no records of marine algae from the western Gulf of Chiriqui mainland
coast, and fewer than 20 species had been reported from islands in this area [24,109]. As pointed
out in Fernndez-Garca et al. [5], much of the discrepancy in the number of reported species along
Pacific Central America is a product of exploration effort, as the regions high heterogeneity in habitats
and physical environmental factors should be conducive to generally high marine algal diversity.
In contrast to the small number of marine algal records in the western Gulf of Chiriqui, the adjacent
coastal area of southeastern Costa Rica to the west has a high number of reported species, but it is also
one of the better-explored areas in Pacific Central America [5].
Despite our Punta Burica collecting being limited to only four short events, numerous species of
red, green and brown algae were found. The 26 species treated here represent only the collections of
foliose red algae and are the first reports of marine algae from the mainland coast of the western Gulf of
Chiriqui. Twenty-one of these are new reports for Panama, and nine are new reports for Pacific Central
America. Four records appear to be new to the Pacific entirely, including the two newly described
species, Neorubra parvolacertoides and Grateloupia irregularis, as well as Polysiphonia binneyi and Hypnea
flava. It is perhaps not surprising, given the paucity of historical study for this remote region of Panama
that 12 of the 26 species reported here likely represent novel species, requiring further morphological
and molecular examination.
The mudstone substrate in the Punta Burica intertidal zone provides an environment more
conducive to the attachment and growth of marine algae than many other hard substrates along
the Pacific Panama coast. Perhaps this distinctive environment has driven evolutionary adaptation
resulting in a local biodiversity hotspot. Alternatively, it may simply be, as others have asserted [56],
that the more we look, the more we find and that as our geographic coverage expands within Panama
or throughout Central America, redundancy in species richness assessment will be revealed.
Another important aspect of the work presented here is the recognition of transisthmian geminate
species pairs. Evolutionary divergence between geminate species may facilitate the calibration of
important DNA barcode markers, at least among closely related species. The greater the availability of
geminate species pairs for marine algae lacking a meaningful fossil record, the more accurately
can molecular calibrations be estimated, while recognizing the inherent challenge e.g., [110] to
isthmian-derived evolutionary rate calculations. Here, the value of DNA barcoding as a floristics
tools is remarkable; DNA barcoding in our floristic study has provided a more accurate assessment of
marine algal biodiversity, even when the amount of material or specimens available for study was
small. Continued DNA barcoding studies of the Burica green, brown and red algal floras, as well as
continuing studies of the Panamanian marine flora more generally, will undoubtedly shed new light
on the novelty of the mudrock environment as a potential refuge for algal diversity and continue to
illuminate new subjects for studying the evolutionary biology of marine macroalgae.

Supplementary Materials: The following are available online at www.mdpi.com/1424-2818/9/2/19/s1, Table S1:
Data matrix dimensions and analysis parameters for phylogenetic analyses carried out in this study.
Acknowledgments: This study was funded by US National Science Foundation Biotic Surveys and Inventories
grant 0743334, the Center for Marine Science DNA-Algal Trust, and the Red Pond Trust. The authors wish to thank
Melissa Smith for help with graphics and Melissa LaCroce for technical help with putting the manuscript together.
Author Contributions: B.W. organized and planned the collecting expedition; B.W., D.W.F., C.F.-G. and N.L.
collected the studied specimens, S.L.P., P.W.G. and D.W.F. generated sequence data; J.N.I., P.W.G. and D.W.F.
carried out DNA sequence and morphological analyses; D.W.F., P.W.G., C.F.-G. and B.W. wrote the paper.
Conflicts of Interest: The authors declare no conflict of interest.
Diversity 2017, 9, 19 34 of 38

References
1. Howe, M.A. Report on a botanical visit to the Isthmus of Panama. J. N. Y. Bot. Gard. 1910, 11, 3044.
2. Taylor, W.R. Pacific Marine Algae of the Allan Hancock Expeditions to the Galapagos Islands; The University of
Southern California Press: Los Angeles, CA, USA, 1945; p. 528.
3. Wysor, B. An annotated list of marine Chlorophyta from the Pacific coast of the republic of Panama with
a comparison to Caribbean Panama species. Nova Hedwigi. 2004, 78, 209241. [CrossRef]
4. Littler, M.M.; Littler, D.S. Coralline algal rhodoliths form extensive benthic communities in the Gulf of
Chiriqui, Pacific Panama. Coral Reefs 2008, 27, 553. [CrossRef]
5. Fernndez-Garca, C.; Riosmena-Rodrguez, R.; Wysor, B.; Tejada, O.L.; Corts, J. Checklist of the Pacific
marine macroalgae of Central America. Bot. Mar. 2011, 54, 5373. [CrossRef]
6. Dawson, E.Y. Marine algae from the Pacific Costa Rican gulfs. Contrib. Sci. 1957, 15, 128.
7. Morell, K.D.; Fisher, D.M.; Gardner, T.W.; Femina, P.L.; Davidson, D.; Teletzke, A. Quaternary outer fore-arc
deformation and uplift inboard of the Panama Triple Junction, Burica Peninsula. J. Geophys. Res. 2011, 116,
B05402. [CrossRef]
8. Buchs, D.M.; Baumgartner, P.O.; Baumgartner-Mora, C.; Bandini, A.N.; Jackett, S.-J.; Diserens, M.-O.; Stucki, J.
Late Cretaceous to Miocene seamount accretion and mlange formation in the Osa and Burica Peninsulas
(Southern Costa Rica): Episodic growth of a convergent margin. In The Origin and Evolution of the Caribbean
Plate; Lorente, J.K., Pindell, M.A., Eds.; Geological Society: London, UK, 2007; Volume 28, pp. 411456.
9. Mamoozadeh, N.R.; Freshwater, D.W. Taxonomic notes on Caribbean Neosiphonia and Polysiphonia
(Ceramiales, Flordeophyceae): Five species from Florida, USA and Mexico. Bot. Mar. 2011, 54, 269292.
[CrossRef]
10. Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; de Waard, J.R. Biological identifications through DNA barcodes.
Philos. Trans. R. Soc. B 2003, 270, 313321. [CrossRef] [PubMed]
11. Saunders, G.W. Applying DNA barcoding to red macroalgae: A preliminary appraisal holds promise for
future applications. Phil. Trans. R. Soc. B 2005, 360, 18791888. [CrossRef] [PubMed]
12. Robba, L.; Russell, S.J.; Barker, G.L.; Brodie, J. Assessing the use of the mitochondrial cox1 marker for use in
DNA barcoding of red algae (Rhodophyta). Am. J. Bot. 2006, 93, 11011108. [CrossRef] [PubMed]
13. Le Gall, L.; Saunders, G.W. DNA barcoding is a powerful tool to uncover algal diversity: A case study of the
Phyllophoraceae (Gigartinales, Rhodophyta) in the Canadian flora. J. Phycol. 2010, 46, 374389. [CrossRef]
14. Milstein, D.; Saunders, G.W. DNA barcoding of Canadian Ahnfeltiales (Rhodophyta) reveals a new
speciesAhnfeltia borealis sp. nov. Phycologia 2012, 51, 247259. [CrossRef]
15. Lyra, G.D.M.; Gurgel, C.F.D.; Costa, E.D.S.; de Jesus, P.B.; Oliveira, M.C.; Oliveira, E.C.; Davis, C.C.;
Nunes, J.M.D.C. Delimitating cryptic species in the Gracilaria domingensis complex (Gracilariaceae,
Rhodophyta) using molecular and morphological data. J. Phycol. 2016, 52, 9971017. [CrossRef] [PubMed]
16. Sherwood, A.R.; Presting, G.G. Universal primers amplify a 23S rDNA plastid marker in eukaryotic algae
and cyanobacteria. J. Phycol. 2007, 43, 605608. [CrossRef]
17. Sherwood, A.R.; Sauvage, T.; Kurihara, A.; Conklin, K.T.; Presting, G.G. A comparative analysis of COI, LSU
and UPA marker data for the Hawaiian florideophyte Rhodophyta: Implications for DNA barcoding of red
algae. Cryptogam. Algologie 2010, 31, 451465.
18. Iha, C.; Milstein, D.; Guimares, S.M.P.B.; Freshwater, D.W.; Oliveira, M.C. DNA barcoding reveals high
diversity in the Gelidiales of the Brazilian southeast coast. Bot. Mar. 2015, 58, 295305. [CrossRef]
19. Chase, M.W.; Hills, H.H. Silica gel: An ideal material for field preservation of leaf samples for DNA studies.
Taxon 1991, 40, 215220. [CrossRef]
20. Hughey, J.R.; Silva, P.C.; Hommersand, M.H. Solving taxonomic and nomenclatural problems in Pacific
Gigartinaceae (Rhodophyta) using DNA from type material. J. Phycol. 2001, 37, 10911109. [CrossRef]
21. Freshwater, D.W.; Braly, S.K.; Stuercke, B.; Hamner, R.M.; York, R.A. Phylogenetic analyses of North Carolina
Rhodymeniales. I. The genus Asteromenia. J. N. C. Acad. Sci. 2005, 121, 4955.
22. Saunders, G.W. A DNA barcode examination of the red algal family Dumontiaceae in Canadian waters
reveals substantial cryptic species diversity. 1. The foliose Disea-Neodilsea complex and Weeksia. Botany 2008,
86, 773789. [CrossRef]
23. Saunders, G.W.; McDevit, D.C. Methods for DNA barcoding photosynthetic protists emphasizing the
macroalgae and diatoms. Methods Mol. Biol. 2012, 858, 207222. [PubMed]
Diversity 2017, 9, 19 35 of 38

24. Freshwater, D.W.; Rueness, J. Phylogenetic relationships of some European Gelidium (Gelidiales, Rhodophyta)
species, based on rbcL nucleotide sequence analysis. Phycologia 1994, 33, 187194. [CrossRef]
25. Stuercke, B.; Freshwater, D.W. Consistency of morphological characters used to delimit Polysiphonia sensu
lato species (Ceramiales, Florideophyceae): Analyses of North Carolina, USA specimens. Phycologia 2008, 47,
541559. [CrossRef]
26. Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput.
Nucleic Acids Res. 2004, 32, 17921797. [CrossRef] [PubMed]
27. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol.
1990, 215, 403410. [CrossRef]
28. Stamatakis, A. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa
and mixed models. Bioinformatics 2006, 22, 26882690. [CrossRef] [PubMed]
29. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17,
754755. [CrossRef] [PubMed]
30. Won, B.Y.; Cho, T.O.; Fredericq, S. Morphological and molecular characterization of species of the genus
Centroceras (Ceramiaceae, Ceramiales), including two new species. J. Phycol. 2009, 45, 227250. [CrossRef]
[PubMed]
31. Grusz, A.L.; Freshwater, D.W. Studies of Costa Rican Gelidiales (Florideophyceae). II. Two Pacific taxa
including Gelidium microglossum, n. sp. Pac. Sci. 2014, 68, 97110. [CrossRef]
32. Boo, G.H.; Hughey, J.R.; Miller, K.A.; Boo, S.M. Mitogenomes from type specimens, a genotyping tool
for morphologically simple species: Ten genomes of agar-producing red algae. Sci. Rep. 2016, 6, 35337.
[CrossRef] [PubMed]
33. Wang, W.-L.; Liu, S.-L.; Lin, S.-M. Systematics of the calcified genera of the Galaxauraceae (Nemaliales,
Rhodophyta) with an emphasis on Taiwan species. J. Phycol. 2005, 41, 685703. [CrossRef]
34. Wiriyadamrikul, J.; Geraldino, P.J.L.; Huisman, J.M.; Lewmanomont, K.; Boo, S.M. Molecular diversity of
the calcified red algal genus Tricleocarpa (Galaxauraceae, Nemaliales) with the description of T. jejuensis and
T. natalensis. Phycologia 2013, 52, 338351. [CrossRef]
35. Huisman, J.M.; Borowitzka, M.A. A revision of the Australian species of Galaxaura (Rhodophyta,
Galaxauraceae), with a description of Tricleocarpa gen. nov. Phycologia 1990, 29, 150172. [CrossRef]
36. Le Gall, L.; Saunders, G.W. Establishment of a DNA-barcode library for the Nemaliales (Rhodophyta) from
Canada and France uncovers overlooked diversity in the species Nemalion helminthoides (Velley) Batters.
Cryptogam. Algologie 2010, 31, 403421.
37. Machn-Snchez, M.; Rousseau, F.; Le Gall, L.; Cassano, V.; Neto, A.I.; Sentes, A.; Fuji, M.T.;
Gil-Rodrguez, M.C. Species diversity of the genus Osmundea (Ceramiales, Rhodophyta) in the Macaronesian
region. J. Phycol. 2016, 52, 664681. [CrossRef] [PubMed]
38. Taylor, W.R. Marine Algae of the Eastern Tropical and Subtropical Coasts of the Americas; The University of
Michigan Press: Ann Arbor, MI, USA, 1960; p. 870.
39. Costa, J.; Lin, S.-M.; Macaya, E.; Fernndez-Garcia, C.; Verbruggen, H. Chloroplast genomes as a tool to
resolve red algal phylogenies: A case study in the Nemaliales. BMC Evol. Biol. 2016, 16, 205218. [CrossRef]
[PubMed]
40. Huisman, J.M. The type and Australian species of the red algal genera Liagora and Ganonema (Liagoraceae,
Nemaliales). Aust. Syst. Bot. 2002, 15, 773838. [CrossRef]
41. Lin, S.-M.; Huisman, J.M.; Ballantine, D.L. Revisiting the systematics of Ganonema (Liagoraceae, Rhodophyta)
with emphasis on species from the northwest Pacific Ocean. Phycologia 2014, 53, 3751. [CrossRef]
42. Guiry, M.D.; Guiry, G.M. AlgaeBase. World-Wide Electronic Publication, National University of Ireland,
Galway, 2017. Available online: www.algaebase.org (accessed on 30 January 2017).
43. Lin, S.-M.; Yang, S.-Y.; Huisman, J.M. Systematic revision of the genera Liagora and Izziella (Liagoraceae,
Rhodophyta) from Taiwan based on molecular analyses an carposporophyte development, with the
description of two new species. J. Phycol. 2011, 47, 352365. [CrossRef] [PubMed]
44. Abbott, I.A. Marine Red Algae of the Hawaiian Islands; Bishop Museum Press: Honolulu, HI, USA, 1999; p. 477.
45. Lin, S.-M.; Huisman, J.M.; Payri, C. Characterization of Liagora ceranoides (Liagoraceae, Rhodopyta) on the
basis of rbcL sequence analyses and carposporophyte development, including Yoshizakia indopacifica gen. et
sp. nov. from the Indo-Pacific region. Phycologia 2013, 52, 161170. [CrossRef]
Diversity 2017, 9, 19 36 of 38

46. Lin, S.-M.; Yang, S.-Y.; Huisman, J.M. Systematics of Liagora with diffuse gonimoblasts based on rbcL
sequences and carposporophyte development, including the description of the genera Neoizziella and
Macrocarpus (Liagoraceae, Rhodophyta). Eur. J. Phycol. 2011, 46, 249262. [CrossRef]
47. Boo, G.H.; Kim, K.M.; Nelson, W.A.; Riosmena-Rodrguez, R.; Yoon, K.J.; Boo, S.M. Taxonomy and
distribution of selected species of the agarophyte genus Gelidium (Gelidiales, Rhodophyta). J. Appl. Phycol.
2014, 26, 12431251. [CrossRef]
48. Thomas, D.T.; Freshwater, D.W. Studies of Costa Rican Gelidiales (Rhodophyta): Four Caribbean taxa
including Pterocladiella beachii sp. nov. Phycologia 2001, 40, 340350. [CrossRef]
49. Littler, D.S.; Littler, M.M. Marine Plants of Pacific Panama. 2009. Available online: http://biogeodb.stri.si.
edu/pacificalgae/list (accessed on 30 January 2017).
50. Kim, K.M.; Boo, S.M. Phylogenetic relationships and distribution of Gelidium crinale and G. pusillum
(Gelidiales, Rhodophyta) using cox1 and rbcL sequences. Algae 2012, 27, 8394. [CrossRef]
51. Santelices, B. Parviphycus, a new genus in the Gelidiellaceae (Gelidiales, Rhodophyta). Cryptogam. Algologie
2004, 25, 313326.
52. Boo, G.H.; Nguyen, T.V.; Kim, J.Y.; Le Gall, L.; Rico, J.M.; Bottalico, A.; Boo, S.M. A revised classification of
the Gelidiellaceae (Rhodophyta) with descriptions of three new genera: Huismaniella, Millerella and Perronella.
Taxon 2016, 65, 965979. [CrossRef]
53. Dawson, E.Y. The marine algae of the Gulf of California. Allan Hancock Pac. Exped. 1944, 3, 189454.
54. Dawson, E.Y. Marine red algae of Pacific Mexico. Part I. Bangiales to Corallinaceae subf. Corallionoidea.
Allan Hancock Pac. Exped. 1953, 17, 1239.
55. Dawson, E.Y. Plantas Marinas de la zona de las mareas de El Salvador. Pac. Nat. 1961, 2, 389461.
56. Dijoux, L.; Viard, F.; Payri, C. The more we search, the more we find: Discovery of a new lineage and new
species complex in the genus Asparagopsis. PLoS ONE 2014, 9, e103826. [CrossRef] [PubMed]
57. Andreakis, N.; Procaccini, G.; Maggs, C.; Kooistra, W.H.C.F. Phylogeography of the invasive seaweed
Asparagopsis (Bonnemaisoniales, Rhodophyta) reveals cryptic diversity. Mol. Ecol. 2007, 16, 22852299.
[CrossRef] [PubMed]
58. Zanolla, M.; Carmona, R.; De La Rosa, J.; Salvador, N.; Sherwood, A.R.; Andreakis, N.; Altamirano, M.
Morphological differentiation of cryptic lineages within the invasive genus Asparagopsis (Bonnemaisoniales,
Rhodophyta). Phycologia 2014, 53, 233242. [CrossRef]
59. Abbott, I.A.; Hollenberg, G.J. Marine Algae of California; Stanford University Press: Stanford, CA, USA, 1976;
p. 827.
60. Farlow, W.G. On some algae new to the United States. Proc. Am. Acad. Arts Sci. 1877, 4, 235245. [CrossRef]
61. Nauer, F.; Guimares, N.R.; Cassano, V.; Yokoya, N.S.; Oliveira, M.C. Hypnea species (Gigartinales,
Rhodophyta) from the southeastern coast of Brazil based on molecular studies complemented with
morphological analyses, including descriptions of Hypnea edeniana sp. nov. and H. flava sp. nov. Eur. J. Phycol.
2014, 49, 550575. [CrossRef]
62. Dawson, E.Y. Marine red algae of Pacific Mexico, part 4. Gigartinales. Pac. Nat. 1961, 2, 191343.
63. Norris, J.N. Marine Algae of the Northern Gulf of California II: Rhodophyta; Smithsonian Institution Scholarly
Press: Washington, DC, USA, 2014; Volume 96, pp. 1555.
64. Payri, C.; De Ramon NYeurt, A.; Orempuller, J. Algae of French Polynesia; Au Vent Des Iles: Tahiti, France,
2000; p. 320.
65. De Ramon NYeurt, A. Marine algae from the Suva Lagoon and reef, Fiji. Aust. Syst. Bot. 2001, 14, 689869.
66. Littler, D.S.; Littler, M.M. South Pacific Reef Plants, A Divers Guide to the Plant Life of South Pacific Coral Reefs;
Offshore Graphics, Inc.: Washington, DC, USA, 2003; p. 331.
67. Gargiulo, G.M.; Morabito, M.; Manghisi, A. A re-assessment of reproductive anatomy and postfertilization
development in the systematics of Grateloupia (Halymeniales, Rhodophyta). Cryptogam. Algologie 2013, 34,
335. [CrossRef]
68. Calderon, M.S.; Boo, G.H.; Boo, S.M. Neorubra decipiens gen. & comb. nov. and Phyllymenia lancifolia comb.
nov. (Halymeniales, Rhodophyta) from South America. Phycologia 2014, 53, 409422.
69. Calderon, M.S.; Boo, G.H.; Boo, S.M. Morphology and phylogeny of Ramirezia osornoensis gen. & sp. nov.
and Phyllymenia acletoi sp. nov. (Halymeniales, Rhodophyta) from South America. Phycologia 2014, 53, 2336.
Diversity 2017, 9, 19 37 of 38

70. Calderon, M.S.; Boo, G.H.; Boo, S.M. Corrigendum of Morphology and phylogeny of Ramirezia osornoensis
gen. & sp. nov. and Phyllymenia acletoi sp. nov. (Halymeniales, Rhodophyta) from South America. Phycologia
2016, 55, 610.
71. Saunders, G.W.; Strachan, I.M.; Kraft, G.T. The families of the order Rhodymeniales (Rhodophyta):
A molecular-systematic investigation with a description of Faucheaceae fam. nov. Phycologia 1999, 38, 2340.
[CrossRef]
72. Zanardini, G. Phyceae papuanae novae vel minus cognitae a Cl. O. Beccari in itinere ad Novam Guineam
annis 1872-75 collectae. Nuovo Giorn. Bot. Ital. 1878, 10, 3440.
73. Norris, R.E. The systematic position of Gelidiopsis and Ceratodictyon (Gigartinales, Rhodophyceae), genera
new to South Africa. S. Afr. J. Bot. 1987, 53, 239246. [CrossRef]
74. Le Gall, L.; Dalen, J.L.; Saunders, G.W. Phylogenetic analyses of the red algal order Rhodymeniales supports
recognition of the Hymenocldiaceae fam. nov., Fryeellaceae fam. nov., and Neogastroclonium gen. nov.
J. Phycol. 2008, 44, 15561571. [CrossRef] [PubMed]
75. Filloramo, G.V.; Saunders, G.W. Application of multigene phylogenetics and site-stripping to resolve
intraordinal relationships in the Rhodymeniales (Rhodophyta). J. Phycol. 2016, 52, 339355. [CrossRef]
[PubMed]
76. De Clerck, O.; Tronchin, E.M.; Schils, T. Red Algae, Rhodophyceae. In Guide to the Seaweeds of Kwazulu-Natal;
De Clerk, O., Bolton, J.J., Anderson, R.J., Coppejans, E., Eds.; Scripta Botanica Belgica 33, National Botanic
Garden of Belgium: Meise, Belgium, 2005; pp. 132267.
77. Tejada, O.L. Listado de macroalgas en el litoral de El Salvador, basado en registros entre 1961 al 2001.
In Diagnstico de la Diversidad Biolgica de El Salvador; Flores, V.O., Handal, A., Eds.; Red Mesoamericana de
Recursos Biticos: Mexico City, Mexico, 2003; pp. 1171.
78. Hommersand, M.H.; Freshwater, D.W.; Lopez-Bautista, J.M.; Fredericq, S. Proposal of the Euptiloteae
Hommersand et Fredericq trib. nov. and transfer of some southern hemisphere Ptiloteae to the Callithamnieae
(Ceramiaceae, Rhodophyta). J. Phycol. 2005, 42, 203225. [CrossRef]
79. Rodrguez-Prieto, C.; Freshwater, D.W.; Hommersand, M.H. Vegetative and reproductive development of
Mediterranean Gulsonia nodulosa (Ceramiales, Rhodophyta) and its genetic affinities. Phycologia 2013, 52,
357367. [CrossRef]
80. McIvor, L.; Maggs, C.A.; Stanhope, M.J. RbcL sequences indicate a single evolutionary origin of multinucleate
cells in the red algal tribe Callithamnieae. Mol. Phylogenet. Evol. 2002, 23, 433446. [CrossRef]
81. Aponte, N.E.; Ballantine, D.L.; Norris, J.N. Aglaothamnion halliae comb. nov. and A. collinsii sp. nov.
(Ceramiales, Rhodophyta): Resolution of nomenclatural and taxonomic confusion. J. Phycol. 1997, 33, 8187.
[CrossRef]
82. Dawson, E.Y. An annotated list of marine algae from Eniwetok Atoll, Marshall Islands. Pac. Sci. 1957, 11,
92132.
83. Brgesen, F. The marine algae of the Danish West Indies. Part 3. Rhodophyceae (3). Dansk Bot. Arkiv. 1917, 3,
145240.
84. Won, B.Y.; Fredericq, S.; Cho, T.O. Two new species of Centroceras (Ceramiales, Rhodophyta) from
KwaZulu-Natal, South Africa. Eur. J. Phycol. 2010, 45, 240246. [CrossRef]
85. Schneider, C.W.; Cianciola, E.N.; Popolizio, T.R.; Spagnuolo, D.S.; Lane, C.E. A molecular-assisted alpha
taxonomic study of the genus Centroceras (Ceramiaceae, Rhodophyta) in Bermuda reveals two novel species.
Algae 2015, 30, 1533. [CrossRef]
86. Dawson, E.Y. New records of marine algae from Pacific Mexico and Central America. Pac. Nat. 1960, 1,
3152.
87. Zuccarello, G.C.; Sandercock, B.; West, J.A. Diversity within red algal species: Variations in world-wide
samples of Spyridia filamentosa (Ceramiaceae) and Murrayella periclados (Rhodomelaceae) using DNA markers
and breeding studies. Eur. J. Phycol. 2002, 37, 403417. [CrossRef]
88. Zuccarello, G.C.; Purdhomme van Reine, W.F.; Stegenga, H. Recognition of Spyridia griffithsiana comb. nov.
(Ceramiales, Rhodophyta): A taxon previously misidentified as Spyridia filamentosa from Europe. Bot. Mar.
2004, 47, 481489. [CrossRef]
89. Conklin, K.Y.; Sherwood, A.R. Molecular and morphological variation of the red alga Spyridia filamentosa
(Ceramiales, Rhodophyta) in the Hawaiian Archipelago. Phycologia 2012, 51, 347357. [CrossRef]
Diversity 2017, 9, 19 38 of 38

90. Kapraun, D.F. An Illustrated Guide to the Benthic Marine Algae of Coastal North Carolina I. Rhodophyta;
The University of North Carolina Press: Chapel Hill, NC, USA, 1980; p. 206.
91. Schneider, C.W.; Searles, R.B. Seaweeds of the Southeastern United States, Cape Hatteras to Cape Canaveral; Duke
University Press: Durham, NC, USA, 1991; p. 553.
92. Wynne, M.J.; Banaimoon, S.A. The occurrence of Jolyna laminarioides (Phaeophyta) in the Arabian Sea and
the Indian Ocean, and a new report of Melanothamnus somalensis (Rhodophyta). Bot. Mar. 1990, 33, 213218.
[CrossRef]
93. Shameel, M. Melanothamnus afaqhusainii, a new red alga from the coast of Karachi. Pak. J. Bot. 1999, 31,
211214.
94. Daz-Tapia, P.; McIvor, L.; Freshwater, D.W.; Verbruggen, H.; Wynne, M.J.; Maggs, C.A. The genera
Melanothamnus Bornet & Falkenberg and Vertebrata S.F. Gray constitute well-defined clades of the red
algal tribe Polysiphonieae (Rhodomelaceae, Ceramiales). Eur. J. Phycol. 2017, 52, 130.
95. Mamoozadeh, N.R.; Freshwater, D.W. Polysiphonia sensu lato (Ceramiales, Florideophyceae) species of
Caribbean Panama including Polysiphonia lobophoralis sp. nov. and Polysiphonia nuda sp. nov. Bot. Mar. 2012,
55, 317347. [CrossRef]
96. McIvor, L.; Maggs, C.A.; Provan, J.; Stanhope, M.J. rbcL sequences reveal multiple cryptic introductions of
the Japanese red alga Polysiphonia harveyi. Mol. Ecol. 2001, 10, 911919. [CrossRef] [PubMed]
97. Kim, M.S.; Yang, E.C. Taxonomic note of Polysiphonia pacifica (Ceramiales, Rhodophyta) complex with focus
on Pacific isolates. Algae 2005, 20, 1523. [CrossRef]
98. Bustamante, D.E.; Won, B.Y.; Cho, T.O. Polysiphonia ulleungensis sp. nov. (Rhodomelaceae, Rhodophyta): A new
diminutive species from Korea belonging to Polysiphonia sensu stricto. Algae 2014, 29, 111120. [CrossRef]
99. Freshwater, D.W.; Tudor, K.; OShaughnessy, K.; Wysor, B. DNA barcoding in the red algal order Gelidiales:
Comparison of COI with rbcL and verification of the barcoding gap. Cryptogam. Algologie 2010, 31, 435449.
100. Tan, J.; Lim, P.-E.; Phang, S.-M.; Hong, D.D.; Sunarpi, H.; Hurtado, A.Q. Assessment of four molecular
markers as potential DNA barcodes for red algae Kappaphycus Doty and Eucheuma J. Agardh (Solieriaceae,
Rhodophyta). PLoS ONE 2012, 7, e52905. [CrossRef] [PubMed]
101. Savoie, A.M.; Saunders, G.W. Evidence for the introduction of the Asian red alga Neosiphonia japonica and its
introgression with Neosiphonia harveyi (Ceramiales, Rhodophyta) in the Northwest Atlantic. Mol. Ecol. 2015,
24, 59275937. [CrossRef] [PubMed]
102. Mamoozadeh, N.R. Morphological and Molecular Analyses of Polysiphonia sensu lato in Southern Central
America and the Caribbean. Masters Thesis, University of North Carolina Wilmington, Wilmington, NC,
USA, 2010.
103. Bustamante, D.E.; Won, B.Y.; Miller, K.A.; Cho, T.O. Wilsonosiphonia gen. nov. (Rhodomelaceae, Rhodophyta)
based on molecular and morpho-anatomical characters. J. Phycol. 2017, 53. [CrossRef] [PubMed]
104. Kapraun, D.F.; Lemus, A.J.; Bula Meyer, G. Genus Polysiphonia (Rhodophyta, Ceramiales) in the tropical
western Atlantic. I. Colombia and Venezuela. Bull. Mar. Sci. 1983, 33, 881898.
105. Skelton, P.A.; South, G.R. The benthic marine algae of the Samoan Archipelago, South Pacific, with emphasis
on the Apia District. Beih. Nova Hedwig. 2007, 132, 1350.
106. Hollenberg, G.J. An account of the species of the red alga Polysiphonia of the central and western tropical
Pacific Ocean. II. Polysiphonia. Pac. Sci. 1968, 22, 198207.
107. Dawes, C.J.; Mathieson, A.C. The seaweeds of Florida; University Press of Florida: Gainesville, FL, USA, 2008;
p. 591.
108. Savoie, A.M.; Saunders, G.W. A molecular phylogenetic and DNA barcode assessment of the tribe
Pterosiphonieae (Ceramiales, Rhodophyta) emphasizing the Northeast Pacific. Botany 2016, 94, 917939.
[CrossRef]
109. Lemoine, P. Les Corallinacees de lArchipel des Galapagos et du Golfo de Panama. Arch. Mus. Hist. Nat.
1929, 6, 4788.
110. Knowlton, N.; Weigt, L.A. New dates and new rates for divergence across the Isthmus of Panama.
Proc. Biol. Sci. 1998, 265, 22572263. [CrossRef]

2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).