Pentecost Ph.D. Thesis

MOLECULAR MECHANISMS OF LISTERIA MONOCYTOGENES
INVASION OF THE INTESTINAL EPITHELIUM
A DISSERTATION
SUBMITTED TO THE DEPARTMENT OF MICROBIOLOGY & IMMUNOLOGY
AND THE COMMITTEE ON GRADUATE STUDIES
OF STANFORD UNIVERSITY
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
Mickey Joseph Pentecost
September 2009
ii
© Copyright by Mickey Joseph Pentecost 2009

All Rights Reserved
iii
I certify that I have read this dissertation and that, in my opinion, it is

fully adequate in scope and quality as a dissertation for the degree of
Doctor of Philosophy.
________________________________
(Manuel R. Amieva) Principal Advisor

________________________________
(Stanley Falkow)

________________________________
(Julie A. Theriot)

________________________________
(W. James Nelson)
Approved for the Stanford University Committee on Graduate Studies.
________________________________
iv
ABSTRACT
Listeria monocytogenes causes invasive disease by crossing the intestinal epithelial

barrier. This process depends on the interaction between the bacterial surface protein
Internalin A (InlA) and the host protein E-cadherin. A second L. monocytogenes
invasin Internalin B (InlB) promotes invasion of numerous non-phagocytic cell types,
but has not been shown to promote oral infection. The receptor for InlB is c-Met, a
receptor tyrosine kinase and the endogenous receptor for Hepatocyte Growth Factor
(HGF). E-cadherin and c-Met are localized to the basolateral side of polarized
epithelial cells and are not thought to be accessible to the apical (lumenal) side across
functional tight junctions.
We used polarized MDCK cells as a model epithelium to determine how L.

monocytogenes gain access to basolateral receptors. We found that L. monocytogenes
do not actively disrupt the tight junctions, but find E-cadherin at a morphologically
distinct subset of intercellular junctions. We identified these sites as naturally
occurring regions where single senescent cells are extruded from the epithelium. The
surrounding cells reorganize to form a multicellular junction (MCJ) that maintains
epithelial continuity. We found that E-cadherin is transiently exposed to the lumenal
surface at MCJs during and after cell extrusion.
We hypothesized that L. monocytogenes utilize analogous extrusion sites for epithelial

invasion in vivo. By infecting rabbit ileal loops, we found that the MCJs at the cell
extrusion zone of villus tips are the specific target for InlA-mediated L.
monocytogenes adhesion and invasion. L. monocytogenes expressing a modified InlA
capable of binding murine E-cadherin (InlAm) specifically invade and replicate within
villous tips of orally infected of mice. We hypothesized that InlB functions
synergistically with InlA to promote intestinal invasion. Utilizing L. monocytogenes
expressing InlAm, we found that InlB promotes oral infection of mice and colonization
of mouse villous tips.
v
We investigated the mechanism by which InlB mediates Listeria invasion at MCJs

using polarized MDCK monolayers. Following InlA-mediated attachment at MCJs, c-
Met activation by InlB increases the rate of bacterial uptake. The efficiency of
invasion is also controlled by intrinsic epithelial properties since MCJs undergo rapid
remodeling and are naturally more endocytic than other junctional sites; MCJs
endocytose fluorescent dextran, a fluid phase marker, from the apical surface into
unique cytoplasmic puncta containing both tight- and adherens junction proteins.
Apical HGF or InlB increase the number and size of dextran puncta at MCJs, but do
not increase endocytosis at other junctions, suggesting that c-Met is apically exposed
at MCJs and that L. monocytogenes can modulate cellular endocytosis during invasion
of this specific site.
Thus, L. monocytogenes exploit the dynamic nature of junctional remodeling and

epithelial renewal to target exposed receptors and hijack host cell processes for
epithelial invasion and intestinal barrier breach.
vi
ACKNOWLEDGMENTS
Throughout this thesis I use the pronoun ‘we’ rather than ‘I’ when discussing results
because this work has been possible only though the assistance and intellectual
contributions of many people. First, I thank my Advisor Manuel Amieva. His patience
and personal generosity have made my graduate career enjoyable and rewarding. I will
rely on him throughout my life for both personal and professional guidance. Manuel
has also created a very interactive, collaborative and friendly lab environment. I thank
my friends and colleagues Michael Howitt, Josephine Lee, Shumin Tan, Lee
Shaughnessy, Brooke Lane, Fabio Bagnoli, Roger Vogelman and Elizabeth Joyce for
experimental and intellectual help and guidance, as well as for the coffee breaks,
costume parties, soccer games, travels, and baked goods.
I wish to thank the rest of my Thesis Committee. Stanley Falkow, James Nelson and
Julie Theriot are dedicated educators and wonderful people who have always been
constructive, available and generous with their time and expertise. In addition to my
committee, Denise Monack, Glen Otto, Susanne Rafelski, Alex Nielsen, Ana
Bakardjiev and Jonathan Hardy have been mentors and collaborators.
I acknowledge the people who made my academic and intellectual growth possible.
My parents Lyn and Dave always provided love and encouragement, but more
importantly, they let me pursue all of my interests. They also gave me my younger
brother and Best Man Will, a chef/artists/musician/handball champ who I admire. I
inherited an interest in science from my grandfathers, Joe Pentecost and Bill
Tiefenbacher, and inherited a love of literature and a sense of civic responsibility from
my grandmothers, Maxene Pentecost and Sally Tiefenbacher. My aunts and uncles,
especially Wendy, Ken, Moira, Tom and June have always given love and support in
every possible way, including housing, warm meals and emotional support during my
schooling.
vii
I would like to thank a scientific mentor, role model, and dear friend, Issar Smith.
Smitty and his former graduate student Ben Gold introduced me to biological research
and began my training microbiology. They also showed me that scientists don’t have
to sacrifice a full life and dedication to family and friends to be professionally
successful and admired.
Finally, I thank my best friend and gorgeous wife, Tina Huang. Tina is the most
talented, warm and generous person in the world. I thank her for love and support
through all the successes, challenges, and changes of homes we have had. I also thank
her for keeping art and excitement in my life.
viii
DEDICATION
The author wishes to dedicate this dissertation to Grandma Sally.

ix
TABLE OF CONTENTS
List of Tables ............................................................................................................... xiii

List of Figures.............................................................................................................. xiv
List of Videos ............................................................................................................. xvii
Chapter 1 : Introduction and Literature Review ............................................................... 1
Research Rationale .................................................................................................... 1
History ...................................................................................................................... 2
Listeria monocytogenes, an Enteroinvasive Bacterial Pathogen............................ 2
Identification ....................................................................................................... 3
Listeriosis: a Disease of Humans and Animals..................................................... 5
Pathogenesis and Epidemiology........................................................................... 6
Listeria in Basic Biological Research .................................................................. 8
Intracellular Parasitism............................................................................................ 10
Stages and Mechanisms of Listeria’s Intracellular Life-Cycle............................ 10
Genetic Regulation of Intracellular Infection ..................................................... 12
Adherence to the Cell Surface............................................................................ 16
Internalin A, Internalin B and the Internalin Family........................................... 16
Internalin A Co-opts the Epithelial Junctions ..................................................... 20
Internalin B Co-opts Growth Factor Signaling ................................................... 23
Synergy Between Internalin A and Internalin B ................................................. 26
Species Specificities of Internalin A and Internalin B ........................................ 27
Animal Models Permissive for Internalin A and Internalin B............................. 29
Tissue Specificities of Internalin A and Internalin B .......................................... 30
Challenging the Internalin Tissue Specificity Dogma......................................... 30
Anatomical and Subcellular Site of Epithelial Invasion: The Polarity Paradox......... 31
The Epithelial Barrier, Cell Renewal and Gastrointestinal Pathogens................. 31
E-cadherin and c-Met are Basolateral Receptors ................................................ 32
The Peyer’s Patch Paradigm .............................................................................. 33
Challenging the Peyer’s Patch Paradigm............................................................ 34
x
Chapter 2 : Internalin A Targets Listeria monocytogenes to Epithelial Junctions at

Sites of Cell Extrusion................................................................................................... 36
Introduction............................................................................................................. 36
Materials and Methods ............................................................................................ 38
Results .................................................................................................................... 43
L. monocytogenes Invade The Epithelium at Distinct Multicellular Junction
Sites............................................................................................................. 43
Apical Attachment to Multicellular Junctions is Dependent on Internalin A....... 48
Quantitative Analysis of L. monocytogenes Adhesion Sites ............................... 50
Multicellular Junctions Form and Persist at Sites of Cell Extrusion.................... 52
L. monocytogenes Attachment Sites are Sites of Cell Extrusion ......................... 55
L. monocytogenes Adhere to Transiently Exposed E-cadherin at Sites of
Cell Extrusion.............................................................................................. 59
Discussion............................................................................................................... 65
Chapter 3 : Internalin A targets L. monocytogenes to the Villus Tip Extrusion Zone...... 69
Introduction............................................................................................................. 69
Materials and Methods ............................................................................................ 72
Results .................................................................................................................... 80
L. monocytogenes Invade Multicellular Junctions at the Villus Tip
Extrusion Zone ............................................................................................ 80
Analysis of L monocytogenes Infection of the Villous Tip Extrusion Zone
by Transmission Electron Microscopy ......................................................... 87
Rational Design of Internalin A variants Predicted to Bind Murine E-
cadherin....................................................................................................... 90
Mutations in Internalin Differentially Affect the Tropism of Listeria for
Epithelial Cells of Different Species ............................................................ 90
InlA S192N Y369S (InlAm) Permits Oral Infection of Mice............................... 95
InlAm Specifies Invasion of the Villus Tips, But Not of Peyer’s Patches ............ 98
Discussion............................................................................................................. 101
Chapter 4 : InlB Targets c-Met and Modulates Endocytosis at Multicellular
Junctions ..................................................................................................................... 103
xi
Introduction........................................................................................................... 103
Materials and Methods .......................................................................................... 105
Results .................................................................................................................. 111
Construction of GFP-expressing Listeria Strains.............................................. 111
ΔinlB GFP L. monocytogenes Express InlA ..................................................... 113
ΔinlB L. monocytogenes Recruit E-cadherin and β-catenin to Sites of
Bacterial Attachment ................................................................................. 116
Internalin B promotes Apical Invasion of Multicellular Junctions .................... 118
InlB Targets c-Met Locally During Apical Invasion of Polarized MDCK
Monolayers................................................................................................ 120
InlB Does Not Influence Listeria Intracellular Replication and Cell-to-cell
Spread Within a Polarized Epithelium........................................................ 122
Junctional Remodeling at Multicellular Junctions Correlates with Increased
Apical Endocytosis .................................................................................... 124
InlB and HGF Modulate Dextran Endocytosis at Multicellular Junctions......... 128
Apical Endocytosis AND L. monocytogenes Invasion at Multicellular
Junctions Require Common Endocytic Machinery ..................................... 128
Discussion............................................................................................................. 132
Chapter 5 : InlB Promotes L. monocytogenes Oral Infection and Colonization of
the Villus Tip Extrusion Zone ..................................................................................... 136
Introduction........................................................................................................... 136
Materials and Methods .......................................................................................... 139
Results .................................................................................................................. 145
Development and Verification of L. monocytogenes Strains expressing
InlAm, InlB and GFP .................................................................................. 145
InlB Promotes Oral Infection of Mice.............................................................. 148
InlB Promotes Colonization of the Villus Tip Extrusion Zone ......................... 150
Discussion............................................................................................................. 154
Chapter 6 : Questions for Future Research................................................................... 157
Do Other Enteric Bacteria Utilize Cell Extrusion Zones?....................................... 157
xii
Are Multicellular Junctions Inherently Permissive for Bacterial Uptake In

Vivo? ............................................................................................................... 159
What are the Cellular Molecular Mechanisms of Listeria Invasion or
Junctional endocytosis at Multicellular Junctions? ........................................... 159
How are Basolateral Receptors Exposed to the Lumenal Surface at
Multicellular Junctions?................................................................................... 161
How Do Listeria and Host Cells Interact at the Villous Tips? ................................ 162
Are the Villus Tips a Site of Colonization or Asymptomatic Carriage?.................. 162
Bibliography ............................................................................................................... 165
xiii
LIST OF TABLES
Number......................................................................................................................Page
Table 3.1: Oligonucleotides Used in Chapter 3.............................................................. 78
Table 3.2: L. monocytogenes Strains Used in Chapter 3................................................. 79
Table 4.1: Oligonucleotides Used in Chapter 4............................................................ 110
Table 4.2: L. monocytogenes Strains Used in Chapter 4............................................... 110
Table 5.1: Oligonucleotides Used in Chapter 5............................................................ 143
Table 5.2: L. monocytogenes Strains Used in Chapter 5............................................... 144
xiv
LIST OF FIGURES
Number......................................................................................................................Page
Figure 1.1: Schematic Representation of the Pathophysiology of Listeria Infection......... 2
Figure 1.2: Molecular and Genetic Requirements for Listeria’s Intracellular Life-
Cycle (Following Page) ............................................................................... 14
Figure 1.3: Domain Organization of Internalins and Sequence Alignments of
Internalin LRR Domains (Following Page) ................................................. 18
Figure 1.4: Structural and Molecular Aspects of InlA/E-cadherin–mediated
Listeria Invasion (Following Page) .............................................................. 21
Figure 1.5: Structural Aspects of InlB/c-Met-mediated Listeria Invasion
(Following Page) ......................................................................................... 24
Figure 1.6: Listeria versus The Apical Junctional Complex of Polarized Epithelia ........ 35
Figure 2.1: Preservation of Barrier Function During L. monocytogenes Infection of
MDCK Cells Polarized on Transwell Filters (Following Page)..................... 44
Figure 2.2: Invasion and Replication of L. monocytogenes at Multicellular Junction
Sites (Following Page)................................................................................. 46
Figure 2.3: Internalin A-dependent Apical Adhesion and Invasion of Polarized
Epithelia ...................................................................................................... 49
Figure 2.4: Tropism of L. monocytogenes for Multicellular Junctions............................ 51
Figure 2.5: Multicellular Junctions Created by Cell Extrusion ....................................... 53
Figure 2.6: L. monocytogenes Adhesion to Sites of Cell Extrusion ................................ 56
Figure 2.7: E-cadherin Associated with L. monocytogenes at Multicellular
Junctions...................................................................................................... 57
Figure 2.8: L. monocytogenes Attachment to Accessible E-cadherin at
Multicellular Junctions of Cell Extrusion Sites............................................. 60
Figure 2.9: Increased E-cadherin Exposure and L. monocytogenes Adhesion in
Calcium Depleted MDCK Monolayers ........................................................ 63
Figure 2.10: L. monocytogenes Adherence to Single Cell Polarity Defects .................... 64
xv
Figure 3.1: L. monocytogenes Invasion of the Intestinal Epithelium at the Villus-

tip Extrusion Zone (Following Page)............................................................ 81
Figure 3.2: Lack of Association of L. monocytogenes Invasion with the Intestinal
Crypts or the Peyer’s Patches; inlA-mutant is Noninvasive (Following
Page) ........................................................................................................... 83
Figure 3.3: L. monocytogenes Associate with Intercellular Junctions Prior to Villus
Tip Invasion................................................................................................. 88
Figure 3.4: L. monocytogenes Infect Cells Adjacent to Apoptotic Cells at the
Villous Tip................................................................................................... 89
Figure 3.5: Internalin Variants with Altered Tropism for Canine and Murine Cells ....... 93
Figure 3.6: InlA R168S E170G Q190G Promotes Invasion of the Murine Intestine....... 94
Figure 3.7: InlA S192N Y369S Reconstitutes Oral Infection in Mice (Following
Page) ........................................................................................................... 96
Figure 3.8: Functional InlA Targets Listeria to the Villus Tip Epithelium
(Following Page) ......................................................................................... 99
Figure 4.1: Construction of GFP Expression Constructs and Verification of InlA
and InlB Expression in GFP Listeria Strains .............................................. 112
Figure 4.2: Activation of c-Met and MDCK Cell Scattering by Purified InlB .............. 115
Figure 4.3: Recruitment of E-cadherin and β-catenin by Listeria to Sites of
Attachment ................................................................................................ 117
Figure 4.4: InlB Mediated Apical Invasion of Polarized MDCK Monolayers. ............. 119
Figure 4.5: Invasion of Listeria Through Local c-Met Activation ................................ 121
Figure 4.6: Lack of a Role for InlB in Intracellular Replication and Cell-to-Cell
Spread ....................................................................................................... 123
Figure 4.7: Unique Para-endocytosis of Junctional Components at Sites of Cell
Extrusion (Following Page) ...................................................................... 125
Figure 4.8: Enhancement of Dynamin-dependent Endocytosis at Multicellular
Junctions by HGF and InlB (Following Page) ............................................ 130
Figure 5.1: Construction of Expression Constructs and Verification of InlAm and
InlB Expression in Listeria ........................................................................ 147
xvi
Figure 5.2: Analysis of the role of InlB in Listeria Oral Infections by

Bioluminescence Imaging.......................................................................... 149
Figure 5.3: Single Infection of Mice with ΔinlAB inlAmB gfp or ΔinlAB InlAm gfp........ 151
Figure 5.4: InlB-mediated Invasion of the Intestinal Villus Tips.................................. 152
Figure 5.5: Coinfection with ΔinlAB inlAmB and ΔinlAB inlAm gfp............................... 153
xvii
LIST OF VIDEOS
Number......................................................................................................................Page
Video 2.1: Cell Extrusion.............................................................................................. 54
Video 2.2: L. monocytogenes Invasion at a Multicellular Junction................................. 58
Video 3.1: Villus Tip Infected with Wild Type Listeria monocytogenes ........................ 85
Video 3.2: Villus Tip Infected with ΔinlA L. monocytogenes......................................... 86
Video 4.1: Junctional Endocytosis at Cell Extrusion.................................................... 127
1
CHAPTER 1 : INTRODUCTION AND LITERATURE REVIEW
RESEARCH RATIONALE
In the United States, food-borne pathogens have been estimated to be responsible for
76 million illnesses, 323,914 hospitalizations, and 5,194 deaths each year (Mead et al.,
1999). Invasive microorganisms that infect the intestinal epithelium and breach the
intestinal barrier cause more than 75% of these deaths. Listeria monocytogenes has
emerged as a significant cause of mortality due to food-borne illness in the United
States since it was responsible for 27.6% of deaths from enteric infection (Mead et al.,
1999). Other important pathogens that invade the epithelium include rotavirus,
Salmonella, Shigella, Yersinia, Enteroinvasive E. coli, and Campylobacter. How these
organisms breach the gastrointestinal epithelial barrier is not fully understood.
Specific interactions between microbial adhesins and cell surface receptors are known
to be critical for invasion (Boyle and Finlay, 2003). Paradoxically, many of the known
adhesin-receptor interactions involve cellular receptors that are not typically present
on the apical (lumenal) side of the gastrointestinal epithelium because intact
intercellular junctions prevent the diffusion of these molecules from the basolateral to
the apical side of the epithelial cells. For example rotavirus, Shigella and Yersinia are
known to use integrin receptors for attachment and entry through the basolateral
(interstitial) surfaces of epithelial cells (Ciarlet et al., 2002; Graham et al., 2003;
Guerrero et al., 2000; Hewish et al., 2000; Isberg and Leong, 1990; Mounier et al.,
1992; Watarai et al., 1996). Similarly, Listeria monocytogenes use the basolateral
junction protein E-cadherin and the basolateral signaling protein c-Met for epithelial
cell invasion (Mengaud et al., 1996; Shen et al., 2000). How and where L.
monocytogenes find receptors for attachment and entry are important questions in the
pathogenesis and clinical outcomes of microbial gastroenteritis and enteric fever.
2
HISTORY
, AN ENTEROINVASIVE BACTERIAL PATHOGEN

The Gram-positive, facultative intracellular bacterium is a
cause of human and animal food-borne infection (Vazquez-Boland et al., 2001). The
initial steps in the pathogenesis of Listeriosis involve colonization and growth in the
intestinal tissue, followed by spread to other organs via the lymphatics or blood stream
(Figure 1.1) (Vazquez-Boland et al., 2001). Invasive Listeriosis is one of the most
deadly bacterial infections with a mortality of ~30%, and the ability of
to survive within hosts is attributed to the organism’s sophisticated
intracellular infection cycle: hijacks endocytic machinery to invade
cells, escapes from the vacuole to replicate within the host cell cytosol, and recruits
components of the host cell cytoskeleton to translocate to neighboring cells, all the
while avoiding the humoral immune system (Figure 1.2A) (Pamer, 2004; Portnoy et
al., 2002; Vazquez-Boland et al., 2001).
Figure 1.1: Schematic Representation of the Pathophysiology of Infection
Figure from (Vazquez-Boland et al., 2001).

3
IDENTIFICATION
Listeria monocytogenes was identified and described in two independent reports in
1926 and 1927. In the first, Murray, Webb and Swann isolated the bacterium during
epidemic outbreak of lethal disease in their rabbit colony in Cambridge, England
(Murray et al., 1926). The disease, affecting young animals within the first few
months of age and pregnant animals, was characterized by development of a distended
belly, rapid weight loss and lethargy interrupted by convulsive struggles. Necropsies
revealed edema of subcutaneous tissues, accumulation of fluids in pleural, pericardial
and peritoneal cavities, enlarged and edematous mesenteric lymph nodes, foci of
necrosis in the liver, and enlarged spleens. These are now well-known pathologies
caused by invasive Listeria.
Although the gastrointestinal tract would not be recognized as a site of L.

monocytogenes host invasion until the 1960s and 1970s, Murray et al. made at least
two important observations that could have put the field in the right direction. First,
the authors stated that the that outbreaks had always occurred at times when “the fresh
food upon which the breeding establishment largely depended either became scarce or
rank,” and noted that “adequate food would terminate the epidemic.” Second, they
identified the location of L. monocytogenes invasion within the gastrointestinal tract
since they could trace the most affected mesenteric lymph nodes to terminal ileum via
the connecting mesenteries. However, they did not understand the significance of
these observations since recreating infection in rabbits and guinea pigs through the
oral route was inefficient. The strength of the gastrointestinal tract as a barrier to
Listeria invasion hampered the recognition of this site as the natural route of infection,
and continues to hamper research into the gastrointestinal phase of Listeriosis.
The feature of the disease that was most compelling to Murray et al. was the ability of
the bacterium to elicit a huge increase in the number of circulating monocytes in the
blood. For this reason, they named the organism Bacterium monocytogenes.
Unfortunately, this characteristic also resulted in the erroneous belief, held through the
1960s, that Listeria was the (or a) cause of infectious mononucleosis despite evidence
4
of viral etiology since the late 1930s and despite the fact that monocytosis was never a
marked feature of human Listeriosis (Gray and Killinger, 1966; Murray, 1955;
Schultz, 1945).
Without knowledge of Bacterium monocytogenes, in 1927 Pirie identified the

bacterium from the livers of a South African gerbil (known as the African Jumping
Mouse) suffering from a plaque-like disease with necrotizing hepatic infection (Gray
and Killinger, 1966; Pirie, 1927). Pirie named the bacterium Listerella hepatolytica in
honor of Joseph Lister (1827 – 1912), the British surgeon and one time president of
the Royal Society who promoted sterile surgery. In 1940, Pirie suggested the use of
the current name Listeria monocytogenes, since Bacterium monocytogenes and
Listerella hepatolytica were identified as the same, and since the genus Listerella had
already been assigned to a group of slime molds in 1906 (Pirie, 1940).
In retrospect, L. monocytogenes was probably identified a number of times prior to

1926. In the 1890s, Gram-positive rods were isolated from tissue sections from
patients who died of Listeriosis-like disease in Germany and In 1911 an organism
named Bacterium hepatitis was isolated from necrotic foci in the liver of a rabbit in
Sweden (Gray and Killinger, 1966; Murray, 1955). In 1917 a ‘diptheroid’ with L.
monocytogenes characteristics was isolated from 5 children with meningitis in
Australia and in 1921 a bacterium later confirmed as L. monocytogenes was isolated
from the cerebrospinal fluid of an Italian soldier (Schultz, 1945). Even after 1926, the
differences in symptoms and diseased hosts, and the difficulty of strain
characterization led identification of a number of species only later confirmed as L.
monocytogenes. These include ‘hemolytic Corenybacterium,’ Listerella hepatolytica,
Listerella monocytogenes hominis, Corenybacterium parvulum, Listerella ovis,
Corenybacterium infantisepticum, Listeria infantiseptica, Listerella bovina, L.
gallinarium, L. cuniculi, L. suis, and L. gerbilli (Gray and Killinger, 1966; Schultz,
1945).
5
LISTERIOSIS: A DISEASE OF HUMANS AND ANIMALS

In the three decades following Murray et al. and Pirie, only sporadic cases of human
Listeriosis were reported (Murray, 1955). Rather, Listeriosis was a curious disease of
animals. Listeria was found associated with numerous species including rabbit, hare,
guinea pig, gerbil, lemming, mouse, rat, hamster, vole, sheep, goat, cattle, pig, horse,
dog, ferret, raccoon, fox, chicken, canary duck, goose and eagle (Gray and Killinger,
1966; Murray, 1955; Schultz, 1945). It should be noted that a number of these
associations are based on fecal shedding as in mice and rats rather than disease.
Despite the initial identification of L. monocytogenes in rabbits, domestic livestock
were recognized as the major victims of Listeriosis, though with some differences in
symptoms and pathology. In contrast to rabbits and some other monogastric animals,
ruminants do not develop monocytosis. Rather, young sheep and cattle can develop
septicemia with or without encephalitis (Gray and Killinger, 1966). Listeriosis of
ruminants was often called ‘circling disease’ since encephalitic animals were observed
walking in circles (Vazquez-Boland et al., 2001).
Between the first confirmed identification of neonatal human Listeriosis in 1933 and
the early 1950s, encephalitis, meningitis and meningoencephalitis in non-pregnant
humans and animals was given the majority of medical and experimental attention
(Gray and Killinger, 1966). However, pregnancy-associated Listeria infection soon
became a great concern when in the early 1950s, hundreds of tragic reports of neonatal
deaths came from hospitals of bombed cities in East Germany being reconstructed
after the war. Gray and Killinger wrote that, “life, or even existence, was difficult….
Food was poor, meager, and rationed, and essentials, such as milk for pregnant
women, were found only in the black markets…. Among the many who died were the
yet unborn. Some of these stillborn infants showed characteristic, distinctive focal
necrosis throughout their tiny bodies” (Gray and Killinger, 1966). This generalized
infection with extensive focal necrosis of the liver, infection of the lungs, central
nervous system and skin was named ‘granulomatosis infantiseptica.’ It is now known
that some infants can also be born apparently well and develop disease within days or
weeks post partum. Although the majority of cases of Listeriosis have been associated
6
with pregnancy, attention is returning to adult disease, which is on the increase due to
immune suppression by HIV and immune suppressant therapies associated with organ
transplants (Farber and Peterkin, 1991).
PATHOGENESIS AND EPIDEMIOLOGY

Prior to the use of antibiotics, mortality of invasive Listeriosis was at least 70% (Gray
and Killinger, 1966). By the late 1960s, that had dropped to roughly 50% and now
stands at roughly 30% (Farber and Peterkin, 1991; Gray and Killinger, 1966; Mead et
al., 1999; Vazquez-Boland et al., 2001). We note that the statistics are skewed by the
high mortality rates in the very young and very old; The case fatality rates is thought
to be as high as 50% for infants and as high as 20% for people over 60 years of age
(Bortolussi, 2008). Despite the decrease in percent mortality, Listeriosis remains one
of the most deadly food-borne illnesses. Furthermore, over the decades there has been
an increase in both incidence of infection and in total death, even when accounting for
improved detection and diagnosis (Farber and Peterkin, 1991). By the 1960s only ~
500 human deaths due to L. monocytogenes were identified throughout the world
(Gray and Killinger, 1966). More recent estimates suggest approximately 500 deaths
per year in the U.S. (Mead et al., 1999).
Factors contributing to the increase in Listeriosis include industrialized farming and

industrialized food production which has increased prevalence of L. monocytogenes in
the environment and in food. Because of industrialization of cattle production, cows
now represent 80-90% of all animal Listeriosis, and livestock infections can be traced
to contaminated feed, notably poorly fermented silage (Fenlon, 1985, 1986). The
epidemiological connection between silage feed and infection had been made by the
early 1960s, although confirmation of the food-borne route of infection would wait
nearly 20 years with the advent of human epidemics (Farber and Peterkin, 1991; Gray
and Killinger, 1966; Vazquez-Boland et al., 2001). Infected animals perpetuate the
expansion of L. monocytogenes in the environment and at least 10% of asymptomatic
animals are known to shed L. monocytogenes in their feces (Esteban et al., 2009;
Husu, 1990; Unnerstad et al., 2000) Thus, livestock amplify and shed L.
7
monocytogenes in the farm environment, leading to new or sustained infections and

potential contamination of animal and human foodstuffs (Farber and Peterkin, 1991;
Gray and Killinger, 1966; Nightingale et al., 2005; Nightingale et al., 2004).
Industrialized food processing of ‘ready to eat’ food products has led to increased
exposure because L. monocytogenes grows at refrigeration temperatures and is highly
resistant to food preservation techniques such as smoking, curing or added chemical
preservatives. A study surveying luncheon meats, deli salads, fresh soft "Hispanic-
style" cheeses, bagged salads, blue-veined and soft mold-ripened cheeses, smoked
seafood, and seafood salads detected Listeria in nearly all food types as high as 106
CFU / g (Gombas et al., 2003). L. monocytogenes contamination has resulted in
numerous disease epidemics and costly food recalls (Gottlieb et al., 2006). Protection
of food from L. monocytogenes is of such great financial and public health importance
that the FDA recently approved bacteriophage (listeriocidal virus) as a food additive to
ready to eat meat and poultry products (Lang, 2006).
Frequent and severe outbreaks of Listeriosis from ready to eat foods beginning in the
1980s provided the first unequivocal epidemiological evidence that Listeria is a food-
borne pathogen. Previously proposed routes of invasion included inhalation, ocular
inoculation, cutaneous infection (either by tick bite or by handling contaminated
animal material), through sexual transmission, and from mothers to newborns through
the vaginal canal during child-birth (Gray and Killinger, 1966). Because many thought
that Listeria had to be transmitted directly from animal to human, Gray and Killinger
made the off-color joke: “it is fortunate that L. monocytogenes has not been isolated
from a stork, or surely this poor bird would be blamed not only for his big bill but also
for transmitting the bacterium to newborn infants” (Gray and Killinger, 1966).
The link to food was made in 1981 after an epidemic in Canada involving 41 people
(34 perinatal and 7 adult) was linked to consumption of prepackaged ready-to-eat
coleslaw. A sample of coleslaw from a patient’s refrigerator was contaminated with
the epidemic strain, and the cabbage was traced to a farm that fertilized with manure
from a flock of sheep that had two members die of Listeriosis (Schlech et al., 1983).
8
More recently, an outbreak of Listeriosis in Canada in the summer of 2008 resulted in

57 confirmed cases and 22 deaths. The outbreak was traced to contaminated meat
from the processing plant of Maple Leaf food products and caused a massive
nationwide recall of 220 products from the company (Austen, 2008; Canada, 2009). In
addition to epidemiological correlations, molecular genetics and phylogenetics show
that L. monocytogenes evolved to invade the intestinal epithelium (see below).
The emergence of the AIDS epidemic was also a major factor influencing the increase
in incidence of Listeriosis in the 1980s. As an intracellular pathogen, L.
monocytogenes avoids a humoral immune response, and antibodies are not protective
against L. monocytogenes (Cerny et al., 1988; Miki and Mackaness, 1964). Rather
clearance of L. monocytogenes requires components of cell-mediated immunity
including neutrophils and activated macrophages, and protective immunity requires
CD8 T-cells (Pamer, 2004). A majority of adults with Listeriosis have underlying
conditions that suppress T-cell or other cellular immune responses (Farber and
Peterkin, 1991; Vazquez-Boland et al., 2001). These include leukemias, lymphomas,
chemotherapy, immunosuppressant therapy, cirrhosis of the liver, alcoholism, kidney
disease, diabetes, lupus, advanced age, and HIV infection. HIV as a predisposing
factor accounts for as much as 20% of adult Listeriosis (Farber and Peterkin, 1991;
Vazquez-Boland et al., 2001). That it is not higher is probably due to frequent
treatment of AIDS patients with antimicrobials for numerous infections (Farber and
Peterkin, 1991). These data also suggests that L. monocytogenes should be considered
an opportunistic pathogen, targeting the very young, the very old and the immune
compromised. The corollary is that invasive disease may be a distraction from the
‘real’ or evolved natural biology of Listeria infection, which probably includes
subclinical carrier states in as yet unrecognized natural hosts.
LISTERIA IN BASIC BIOLOGICAL RESEARCH

Immunologists were interested in L. monocytogenes long before the emergence of the
organism as a public health risk. Initially, L. monocytogenes-induced monocytosis in
rabbits was used to investigate the origin and development of monocytes (Gray and
9
Killinger, 1966). Since the 1960s, L. monocytogenes has been used as a model
intracellular parasite and was instrumental in understanding innate and protective cell
mediated immunity, including the roles of T-cells and activated macrophages in
intracellular parasite clearance (Mackaness, 1962, 1969; Miki and Mackaness, 1964;
North, 1970, 1978; Pamer, 2004; Shaughnessy et al., 2007). In the past 20 years, with
the increasing power of biochemical and genetic approaches, L. monocytogenes has
contributed to molecular dissection of intracellular (e.g. TLRs, NODs, NFκB,
Caspase-1, Myd88) and intercellular (e.g. CCL2, TNF, IFN-γ, IFN-β) immune
signaling (Pamer, 2004).
In the 1990s and 2000s, L. monocytogenes emerged as a tool for studying cell biology
(Hamon et al., 2006). (There are now numerous books and journals devoted to this
approach; e.g. Cellular Microbiology and Cell Host and Microbe.) Stanley Falkow has
stated that bacteria are the worlds best cell biologists and Julie Theriot writes on her
lab website, “we spy on them [L. monocytogenes] as they've spied on cells, trying to
learn what they know.” For example, the ability of L. monocytogenes ActA to
polymerize actin forming a propulsive actin ‘comet tail’ has shed great light on
mechanisms of eukaryotic cell motility and cytoskeletal force generation, the
biomechanics and biochemistry of actin polymerization, and the physical properties of
the eukaryotic cytosol (Auerbuch et al., 2003; Cameron et al., 2000; Chakraborty et
al., 1995; Dabiri et al., 1990; Domann et al., 1992; Kocks et al., 1992; Lacayo and
Theriot, 2004; Niebuhr et al., 1997; Rafelski and Theriot, 2002, 2004; Robbins et al.,
1999; Shenoy et al., 2007; Skoble et al., 2000; Tilney and Portnoy, 1989). The ability
of L. monocytogenes InlA to bind the junctional protein E-cadherin has shed light on
the components and function of the intercellular junctions. For example, ARHGAP10
(Rho GTPase-activating protein 10) was found to be necessary for InlA mediated
bacterial invasion and then shown to be a novel regulator of the epithelial junctions
(Sousa et al., 2005a). A second Invasin, InlB targets c-Met, a receptor kinase, to
induce bacterial uptake by Clathrin-mediated endocytosis and has been used to study
c-Met trafficking (Li et al., 2005; Veiga and Cossart, 2005). We believe that the study
10
of InlA/InlB mediated Listeria invasion will provide a fuller understanding of how

intercellular junctions are regulated by endocytosis.
INTRACELLULAR PARASITISM
Although some normally extracellular bacteria are capable of survival and replication
within the cytosol of cells, e.g. when given access by microinjection, it should not be
assumed that the cytosol is necessarily hospitable (Goetz et al., 2001). Although little
is known about the specific chemical makeup of the cytosol, intracellular bacteria have
taught us that the cytosol is a reducing environment limiting in free iron and aromatic
amino acids (Ray et al., 2009). Nor is the cytosol necessarily a protective environment.
Intracellular bacteria must find a new niche before significant intracellular immune
detection or host cell killing that would expose the bacteria to humoral and
inflammatory host responses. Thus, intracellular bacteria like Shigella flexneri,
Burkholderia pseudomallei, Listeria monocytogenes, Francisella tularensis and
Rickettsia species have evolved mechanisms to invade cells, escape the primary
vacuole, acquire nutrients, modulate intracellular immune detection, and in some cases
spread directly to neighboring cells, avoiding exposure to the extracellular milieu (Ray
et al., 2009).
STAGES AND MECHANISMS OF LISTERIA’S INTRACELLULAR LIFE-CYCLE

L. monocytogenes is capable of infecting phagocytic and nonphagocytic cells. Surface
proteins like Internalin A (InlA) and Internalin B (InlB) bind host cell receptors and
induce internalization of bacteria by nonphagocytic cells. Internalization of Listeria
occurs through a so-called ‘zipper-like’ mechanism where host cell plasma membrane
is closely opposed to the bacterium during internalization (Figure 1.2A) (Karunasagar
et al., 1994). Following initial internalization, cytosolic bacteria escape from the
vacuole/endosome by secreting enzymes that disrupt the vacuolar membrane. Listeria
uses the enzymes listeriolysin O (LLO) and two type C phospholipases (Figure 1.2A)
(Portnoy et al., 1988; Portnoy et al., 1994; Portnoy et al., 1992; Smith et al., 1995a;
Smith and Portnoy, 1993). LLO binds cholesterol in the vacuolar membrane and forms
11
pores, which serve to prevent vacuolar maturation into a lysosome and to destabilize
the membrane for bacterial escape (Beauregard et al., 1997; Bielecki et al., 1990;
Henry et al., 2006; Portnoy et al., 1992; Shaughnessy et al., 2006). hly, encoding LLO,
is transcribed only after cell invasion (see below) and LLO is activated by
acidification of the vacuole and by the host derived enzyme gamma-interferon-
inducible lysosomal thiol reductase (Glomski et al., 2002; Singh et al., 2008).
Following vacuolar disruption LLO is rapidly degraded in the cytosol (Glomski et al.,
2003; Glomski et al., 2002; Schnupf et al., 2006; Schnupf et al., 2007). This temporal
and spatial compartmentalization of LLO expression and activity prevents disruption
of cell plasma membranes that would cause cytotoxicity and expose Listeria to the
extracellular environment (Glomski et al., 2003; Schnupf and Portnoy, 2007). The
secreted phosphatidylinositol-specific phospholipase C (PI-PLC, encoded by plcA)
functions with LLO to disrupt the single membrane primary vacuole (Figure 1.2A).
Some cytosolic bacteria like Listeria monocytogenes, Shigella flexneri, Burkholderia

pseudomallei, Rickettsia spp., Mycobacterium marinum and viruses like Vaccinia
virus have evolved mechanisms to hijack the host cell cytoskeleton for intracellular
and intercellular motility. Either by expressing proteins that directly bind actin, or by
expressing proteins that bind actin nucleators, these microbes polymerize and elongate
actin filaments to generate propulsive ‘actin comet tails’ (Cudmore et al., 1995; Ray et
al., 2009; Stamm et al., 2003). Upon entry into the cytosol L. monocytogenes
expresses the surface protein ActA, which directly binds actin (Figure 1.2A) (Kocks et
al., 1992; Theriot et al., 1992; Tilney and Portnoy, 1989). Listeria actin comet tail
formation requires ActA concentrated on a single pole of the bacterium (Kocks and
Cossart, 1993; Kocks et al., 1993; Smith et al., 1995b). This occurs only after
intracellular L. monocytogenes have undergone a few rounds of replication since
polarization of ActA is linked to new ActA synthesis and to cell wall growth (Moors
et al., 1999; Rafelski and Theriot, 2005, 2006). Thus, ActA expression and actin tail
formation is also a good indication of bacterial viability in the cytosol.
When actin comet tails propel the bacterium into host cell plasma membrane, a
neighboring cell may internalize the resulting protrusion, or ‘listeriopod’ (Figure
12
1.2A). Presented but unpublished research from Keith Ireton’s lab suggests that the
virulence factor InlC may promote cell-to-cell spread by interacting with the apical
junctions and making them more “slack” and permissive for protrusion formation
(Engelbrecht et al., 1996; Rajabian, 2008). Successful uptake of the protrusion also
requires cooperation of the recipient cell and may depend on the state of cell-cell
adhesion and/or the organization of the submembranous cytoskeleton (Robbins et al.,
1999). Once the protrusion is fully internalized in the recipient cell, the resultant
double membrane vacuole is disrupted by LLO and phosphatidylcholine-specific
phospholipase C (PC-PLC, encoded by plcB) (Camilli et al., 1993; Marquis and
Hager, 2000; Smith et al., 1995a). A Listeria metalloprotease (Mpl) regulates this
process by proteolytically activating PC-PLC upon acidification of the secondary
vacuole (Marquis et al., 1997). Free bacteria can now repeat the intracellular infectious
cycle, which is critical for Listeria pathogenesis. Loss of any stage of the intracellular
infectious cycle severely attenuates Listeria pathogenicity (Portnoy et al., 2002).
GENETIC REGULATION OF INTRACELLULAR INFECTION

Many of the genes required for the intracellular infection cycle of L. monocytogenes
are organized in a genetic island, LIPI-1 (Figure 1.2B). Following cell invasion, this
core set of genes is upregulated by the master regulator of virulence genes, Positive
Regulatory Factor A (PrfA). (Chakraborty et al., 1992). PrfA also regulates some
virulence genes outside LIPI-1, such as the inlAB locus, inlC and hpt (Figure 1.2B)
(Chico-Calero et al., 2002; Engelbrecht et al., 1996). InlC is required for full virulence
and may promote cell-to-cell spread (Engelbrecht et al., 1996; Rajabian, 2008). hpt
encodes a glucose-6-phosphate translocase that allows pathogenic Listeria species to
use hexose phosphates from the host cell cytosol as a carbon energy source (Chico-
Calero et al., 2002).
To regulate genes, PrfA dimers bind a 14-bp (7-bp invariant) consensus sequence or a
‘‘PrfA-box’’ directly upstream of promoters (Figure 1.2B). PrfA’s activity is regulated
on numerous levels including autoregulation of its own transcription and allosteric
regulation of DNA binding activity by either a cofactor or a repressor (Scortti et al.,
13
2007). In addition, translation of prfA is temperature-dependent since a transition to

37˚ dissolves a secondary structure in prfA RNA that otherwise prevents ribosome
binding (Scortti et al., 2007). The degree of PrfA’s rgulation of a given promoter is in
part determined by the degree of homology of the PrfA-box to the canonical PrfA-box
sequence. For example the PrfA-box upstream of inlAB has mutations that result in
only weak regulation and InlA is nearly undetectable during intracellular growth
(Engelbrecht et al., 1996; Kazmierczak et al., 2003; Lingnau et al., 1995; McGann et
al., 2007a; McGann et al., 2008; Scortti et al., 2007). In contrast, actA has a canonical
PrfA-box and is upregulated by as much as 300-fold following cell invasion, making
ActA the most abundant surface or secreted protein during intracellular growth (Figure
1.2B) (Brundage et al., 1993; Moors et al., 1999; Scortti et al., 2007; Shetron-Rama et
al., 2002).
Although InlA and InlB are only weakly regulated by PrfA, they are strongly
regulated by the general stress response sigma factor, σB (Figure 1.2B) (Kazmierczak
et al., 2003; Kim et al., 2004; Kim et al., 2005). Sigma factors are dissociable protein
subunits of prokaryotic RNA polymerase (RNAP) that provide promoter recognition
specificity to the RNAP holoenzyme and contribute to DNA strand separation during
transcription initiation. Most transcription in exponentially growing Listeria is
mediated by an RNAP holoenzyme carrying the ‘housekeeping’ sigma factor σA,
which is similar in function to E. coli σ70. In contrast, σB is activated is response to a
variety of stresses including heat, high osmolarity, high ethanol concentrations, high
and low pH, and oxidizing agents leading to transcription of the σB regulon (van
Schaik and Abee, 2005). σB increases InlA expression in response to acid and osmotic
stress simulating the intestinal environment, and σB is also required for InlA/InlB
expression and cell invasion in the absence of a specific stress (Kim et al., 2005;
McGann et al., 2008; McGann et al., 2007b; Sue et al., 2004).
prfA is partially regulated by σB. σA-RNAP transcribes prfA from both prfA promoters,
while σB-RNAP shares one prfA promoter (Figure 1.2B). In addition, PrfA regulates
prfA transcription from a PrfA-box upstream of plcA (Figure 1.2B). Another gene
regulated by both PrfA and σB is bsh encoding a bile salt hydrolase that contributes to
14
L. monocytogenes survival within the intestinal lumen and fecal shedding in a guinea
pig model of oral infection (Dussurget et al., 2002; Kazmierczak et al., 2003). Thus, it
appears that the core virulence genes are regulated as two sets. First, the genes
required for survival in the gastrointestinal tract and needed in preparation for cell
invasion (inlA, inlB, bsh) are regulated by σB and partially regulated by PrfA. The
second set includes the genes required for intracellular parasitism (hly, mpl, plcA,
plcB, actA, hpt, inlC), which are strongly regulated by PrfA, but not influence by a
stress response. Given this model, it is tempting to speculate that a third, independent
set regulated by σB, but not PrfA, might be important for L. monocytogenes in an
environmental reservoir or during noninvasive persistence in the gastrointestinal tract.
This set includes the genes encoding the surface internalins InlC2, InlD, and InlE,
which have not been found to be important for invasive disease (Dramsi et al., 1997;
Kazmierczak et al., 2003).
Figure 1.2: Molecular and Genetic Requirements for Listeria’s Intracellular Life-
Cycle (Following Page)
(A). Inside, a cartoon depicting key Listeria proteins and stages in the intracellular
life-cycle of L. monocytogenes, which include entry, escape from a vacuole, actin
nucleation, actin-based motility, and cell-to-cell spread. Outside, electron micrographs
from which the cartoon was derived (Tilney and Portnoy, 1989). Figure from (Portnoy
et al., 2002). (B) Physical and transcriptional organization of Listeria pathogenicity
island-1 (LIPI-1), genes the inlAB operon, and the inlC and hpt monocistrons. PrfA-
boxes are indicated by black squares, known promoters indicated by ‘‘P’’ and
transcripts are indicated by dotted lines. Adapted from a figure in (Scortti et al., 2007)
and data in (Garner et al., 2006; Kim et al., 2005; McGann et al., 2008; McGann et al.,
2007b; Ollinger et al., 2009; Ollinger et al., 2008).
15
16
INVASION OF NONPHAGOCYTIC CELLS
ADHERENCE TO THE CELL SURFACE

From the bacterial perspective, phagocytic cells are not necessarily a
preferential cell type to infect since immune cells, especially activated macrophages,
can kill Listeria (Shaughnessy and Swanson, 2007). ActA- mediated cell-to-cell
spread allows Listeria to translocate between cell types and Listeria infects
nonphagocytic cells such as hepatocytes, endothelial cells, fibroblasts and neurons. At
least in tissue culture, Listeria can directly invade many non-phagocytic cell types
through the interaction of surface adhesins with host cell surface receptors. Putative
Listeria adhesins include Internalin A (InlA), Internalin B (InlB), InlJ, ActA, Listeria
adhesion protein (LAP), P60 (Iap), Ami, FbpA, and Vip (Cabanes et al., 2005; Dramsi
et al., 2004; Jaradat et al., 2003; Milohanic et al., 2001; Pilgrim et al., 2003; Sabet et
al., 2005; Suarez et al., 2001; Wampler et al., 2004). Only Internalin A (InlA),
Internalin B (InlB) efficiently promote invasion, while the other proteins appear to
function as adhesins primarily in the absence of InlA and InlB or if overexpressed. In
addition, some have known functions or spatiotemporal patterns of expression that
suggests that they evolved for purposes other than invasion (e.g. p60, Ami, ActA,
FbpA) (Domann et al., 1992; Dramsi et al., 2004; Kocks et al., 1992; Milohanic et al.,
2001; Pilgrim et al., 2003). InlA is necessary and sufficient for invasion of epithelial
cells (Gaillard et al., 1991; Lecuit et al., 1997; Mengaud et al., 1996). While InlB
promotes invasion of multiple cell types including epithelial cells, endothelial cells,
fibroblasts and hepatocytes (Banerjee et al., 2004; Copp et al., 2003; Dramsi et al.,
1995; Greiffenberg et al., 1998; Ireton et al., 1999; Li et al., 2005; Lingnau et al.,
1995; Marino et al., 2002; Marino et al., 1999; Niemann et al., 2007; Parida et al.,
1998; Shen et al., 2000).
INTERNALIN A, INTERNALIN B AND THE INTERNALIN FAMILY

InlA and InlB are expressed from adjacent genes transcribed both independently and
biciscronically from the inlAB locus (Figure 1.2B) (Gaillard et al., 1991). They were
identified in a genetic screen of L. monocytogenes transposon-insertion mutants unable
17
to invade the enterocyte-like colon carcinoma cell line Caco-2 (Gaillard et al., 1991).
In the study, InlA was found to be necessary for attachment and invasion, and InlA
was sufficient to reconstitute invasion when expressed in the non-invasive species L.
innocua. Southern Blot analysis with an inlA-based probe suggested that inlA and inlB
were members of a larger highly homologous family (Gaillard et al., 1991). The
family now includes at least eight additional members: inlC, inlC2, inlE, inlF, inlG,
inlH, inlI, and inlJ. In addition, there are also at least 15 Internalin-like genes
identified through genomic analyses (Figure 1.3A) (Bierne and Cossart, 2007; Bierne
et al., 2007; Cabanes et al., 2002; Domann et al., 1997; Dramsi et al., 1997;
Engelbrecht et al., 1996; Lingnau et al., 1996; Raffelsbauer et al., 1998; Sabet et al.,
2008). Only InlA and InlB are well understood.
The defining characteristic of Internalins is a leucine rich repeat (LRR) domain of 3 to

28 repeats of 22 amino acids each (Figure 1.3A, 1.3B). Each repeat contains a short β-
strand and a spatially larger 310-helix and each LRR wraps in a right-handed direction
to stack upon one another. The entire LRR domain takes a solenoid ‘sickle’ shape with
parallel stacked β-strands forming the concave face and stacked 310-helices forming
the convex face (Figure 1.3B, Figure 1.4A, 1.4B, Figure 1.5B) (Bierne et al., 2007;
Marino et al., 1999, 2000; Schubert and Heinz, 2003). In addition, each repeat is
rotated ~5 degrees with respect to its predecessor giving the sickle-shaped solenoid a
superhelical twist (Figure 1.4A, 1.4B, Figure 1.5B (Bierne et al., 2007; Marino et al.,
1999, 2000; Schubert et al., 2001; Schubert and Heinz, 2003; Schubert et al., 2002).
An N-terminal cap and an Ig-Like IR domain always flank the LRR domain and it is
thought that these domains stabilize the LRR domain by shielding the hydrophobic
core from an aqueous environment (Schubert and Heinz, 2003). Internalin and
Internalin-like proteins all have an N-terminal signal sequence suggesting that these
proteins are processed to the bacterial surface by the general secretory pathway
(Figure 1.3A) (Bierne et al., 2007; Rafelski and Theriot, 2006). All but InlC, a
secreted Internalin, are attached to the bacterial surface, generally through a C-
terminal peptidoglycan-anchoring sequence (e.g. LPXTG) or C-terminal domains that
18
associate noncovalently with the bacterial cell wall (e.g. GW domains that bind
lipoteichoic acid) (Figure 1.3A) (Engelbrecht et al., 1996).
Figure 1.3: Domain Organization of Internalins and Sequence Alignments of

Internalin LRR Domains (Following Page)
(A) The three families of internalins by reference to their association with the bacterial
surface are as follows: I, LPXTG-internalins; II, GW- or WxL-internalins; III, secreted
internalins. InlH results from a recombination event between InlC2 and InlD. Figure
from (Bierne et al., 2007). (B) Sequence alignments of L. monocytogenes Internalin
LRR regions for InlB, InlA, InlC, InlC2, InlD, InlE, InlF, InlG, and InlH. Asterisks
show conserved Internalin LRR residues, and bars show the position and extent of b-
strands 310-helices. Hydrophobic, negatively charged, and positively charged residues
predicted to be surface exposed are highlighted in yellow, red, and cyan, respectively.
Figure from (Marino et al., 2000).
19
20
INTERNALIN A CO-OPTS THE EPITHELIAL JUNCTIONS

Using affinity chromatography E-cadherin was identified as the cellular receptor for
InlA (Mengaud et al., 1996). E-cadherin is a transmembrane cell surface glycoprotein
and the dominant adhesion molecule of epithelial adherens junctions (Figure 1.4A)
(D'Souza-Schorey, 2005; Hartsock and Nelson, 2008). Like other classical cadherens
(N, P, and R-cadherin), E-cadherin contains five Ig-like extracellular domains (ECs),
and the most N-terminal E-cadherin EC1 makes a trans-pairing interaction with E-
cadherin on adjacent cells (Hartsock and Nelson, 2008). Internalin A co-opts E-
cadherin by binding EC1 within the concave face the LRR domain (Figure 1.4A,
1.4B) (Schubert et al., 2002). The E-cadherin-E-cadherin interaction is Ca2+ dependent
as is the interaction between InlA and E-cadherin (Schubert et al., 2002). Each E-
cadherin-E-cadherin interaction is relatively weak, Kd = 720 µM (Haussinger et al.,
2004). The InlA-E-cadherin interaction is ~100X stronger with a Kd = 8+/-4 μM
(Wollert et al., 2007a; Wollert et al., 2007b). The total strength of cell-cell or Listeria-
cell adherence is due to the high density of the individual protein-protein interactions,
like a molecular Velcro.
Although InlA binds the extracellular domain of E-cadherin, it is the function of the
intracellular domain that is required for bacterial uptake. It appears that many, if not
all of the intracellular components required for maintaining the integrity, tension or
endocytic recycling of the intercellular junctions are also involved in generating the
forces that reorganize cell membrane and internalize the bacterium. Experiments with
cytochalasin first demonstrated that Listeria internalization requires a functional actin
cytoskeleton (Wells et al., 1998). The cytoplasmic domain of E-cadherin dynamically
interacts with the actin cytoskeleton through interactions with α- and β-catenin and
both of these proteins are recruited to the site of bacterial attachment (the endocytic
cup) and are required for internalization (Drees et al., 2005; Hartsock and Nelson,
2008; Lecuit et al., 2000; Yamada et al., 2005). p120, which binds the juxtamembrane
region of E-cadherin and regulates E-cadherin stability at the junctions, is also
recruited to the endocytic cup (Hartsock and Nelson, 2008; Lecuit et al., 2000). A
study of InlA-dependent invasion identified ARHGAP10 as a novel regulator of α-
21
and β-catenin at cell-cell junctions, possibly through regulation of RhoA and CDC42
(Sousa et al., 2005a). Myosin VIIA and its ligand Vezatin, which generate tension
required to hold cells together, were found to be involved in Listeria internalization
(Sousa et al., 2004). Hakai, a ubiquitin ligase involved in Clathrin-dependent E-
cadherin internalization is recruited to the site of Listeria invasion and is required for
InlA mediated internalization (Bonazzi et al., 2008; Fujita et al., 2002). Finally, E-
cadherin can be internalized through Clathrin-dependent and Caveolin-dependent
pathways and InlA mediated invasion also utilizes both for efficient invasion (Bonazzi
et al., 2008). All combined, these results suggest that regulation of E-cadherin stability
at the membrane and Listeria binding and internalization via E-cadherin are
mechanistically related.
Figure 1.4: Structural and Molecular Aspects of InlA/E-cadherin–mediated Listeria

Invasion (Following Page)
(A) Bacterial surface attached InlA binds the N-terminal EC1 domain of the
transmembrane junctional protein E-cadherin. Figure from (Schubert et al., 2002). (B)
Ribbon and Space fill model of Wt InlA- human E-cadherin. Figure from (Schubert
and Heinz, 2003). (C) Detailed View of the Interactions between InlA and hEC1. All
residue side chains involved in direct interactions or as ligands to bridging ions/water
are indicated in ball-and-stick representation. InlA β strands and adjacent coils are
shown in violet. Figure from (Schubert et al., 2002). (D) View of the hydrophobic
pocket in InlA, which accommodates P16 of hEC1. Hydrogen bonds are indicated by
green dotted lines. In mice, E-cadherin P16 is replaced by glutamate (yellow model).
Figure from (Schubert et al., 2002). (E) Superposition of InlA-hEC1 and InlAm-mEC1
complexes. Figure from (Wollert et al., 2007b). (F) The carboxylate of E16 mEC1
(yellow) occupies the same hydrophobic pocket of InlAm as P16 hEC1 (violet) in InlA.
Figure from (Wollert et al., 2007b). (G) Partial alignment of E-cadherin sequences
from various species. Note critical residue 16. (H) Cartoon diagram of molecular
components involved in formation of the adherens junction (AJ). Figure from (Ireton,
2007). (I) Cartoon diagram of molecular components involved in InlA-mediated
Listeria entry. Proteins or domains known to contribute to both uptake of Listeria and
AJ formation appear in yellow. Molecules that promote bacterial entry, but are not yet
known to participate in AJ formation are in orange. Proteins that regulate AJ
assembly, but have not yet been directly demonstrated to participate in internalization
of Listeria, are in green. Figure from (Ireton, 2007).
22
23
INTERNALIN B CO-OPTS GROWTH FACTOR SIGNALING

InlB promotes L. monocytogenes invasion of cells by binding the extracellular domain
of c-Met, a receptor tyrosine kinase (Banerjee et al., 2004; Copp et al., 2003; Dramsi
et al., 1995; Greiffenberg et al., 1998; Ireton et al., 1999; Li et al., 2005; Lingnau et
al., 1995; Marino et al., 2002; Marino et al., 1999; Niemann et al., 2007; Parida et al.,
1998; Shen et al., 2000). Although InlB is unrelated by sequence or structure to the
endogenous c-Met ligand, Hepatocyte Growth Factor (HGF), it acts as an exogenous
c-Met agonist. Binding of InlB to c-Met results in phosphorylation and ubiquitination
of c-Met, leading to recruitment of Clathrin, protein adaptors such as Gab1, Shc or
Cbl, and activation of type I phosphatydylinositol 3-kinase (PI3K) (Ireton, 2007;
Ireton et al., 1996; Ireton et al., 1999; Li et al., 2005; Shen et al., 2000; Veiga and
Cossart, 2005; Veiga et al., 2007). PI3K can regulate Rac, Cofilin and the Arp2/3
complex, which control cytoskeletal dynamics and are required for bacterial uptake
(Bierne et al., 2001; Ireton et al., 1999).
c-Met is a disulfide-linked two-chain heterodimer that is initially translated as a 1390

amino acid precursor. The c-Met precursor polypeptide is cleaved between residues
307 and 308 to yield a small, extracellular α chain and a large, multidomain
transmembrane β chain. The α chain and amino acids 308–514 of the β chain form the
N-terminal semaphorin (Sema) domain, which is the binding site for HGF. The
extracellular portion of the β chain also contains a small cysteine-rich domain and four
Ig-like domains (Ig1–Ig4). A transmembrane helix links the extracellular portion of c-
Met to the cytoplasmic juxtamembrane and tyrosine kinase domains (Niemann et al.,
2007). Biochemical studies of InlB / c-Met binding demonstrated that InlB it does not
compete with HGF for c-Met binding, yet both agonists result in seemingly identical
kinase signaling and endocytic trafficking of c-Met (Li et al., 2005; Shen et al., 2000).
A recent crystal structure of InlB bound to c-Met shows that InlB acts as a molecular
clamp that forces the flexible Met receptor into a signaling-competent conformation
(Figure 1.5A) (Niemann et al., 2007). Like InlA, the concave surface of the LRR
domain is the binding interface in InlB (Figure 1.5B). InlB makes two important
24
interactions with c-Met via two interfaces: The InlB LRR region and Met Ig1 are the
primary interface (Figure 1.5B, 1.5C, 1.5D), while a secondary less extensive contact
involves the InlB IR region and the Sema domain of c-Met (Figure 1.5B). The primary
binding interface approximately encompasses residues 599-660 in c-Met. The residues
in c-Met thought to be critical for binding are indicated in Figure 1.5C, 1.5D (red and
pink) and shown in alignments with arrows in Figure 1.5E.
Other receptors for InlB have been identified, but play only supporting roles in
promoting invasion. Negatively charged cell surface heparin sulfate proteoglycans
(HGPGs) can bind the InlB GW domains and promote invasion. The GW domains
noncovalently anchor InlB to lipoteichoic acid in the bacterial cell wall (Jonquieres et
al., 1999; Marino et al., 2002). It is thought that HSPGs on the host cell surface might
locally displace InlB from adherent bacteria, thereby presenting InlB to c-Met
(Banerjee et al., 2004; Ireton, 2007). Using affinity chromatography gC1qR, the
receptor for complement component C1q, was also found as a receptor for the InlB
GW domains (Braun et al., 2000). gC1qR may also present InlB to c-Met. However,
there is no conclusive role for gC1qR in Listeria invasion (Ireton, 2007).
Figure 1.5: Structural Aspects of InlB/c-Met-mediated Listeria Invasion (Following

Page)
A) HGF and InlB non-competitively bind and induce conformational changes in c-Met
promoting kinase signaling. Figure from (Veiga and Cossart, 2007). (B) The GW
domains of cell-dissociated InlB induce clustering via interaction with heparin sulfate
proteoglycans (HSPGs) on the host cell. Adapted from a Figure in (Niemann et al.,
2007). (C) Close-up showing Y170 and Y214 of InlB interacting with K599 and K600
of c-Met. Y170 makes hydrogen bonds (dotted orange lines) to K599 and the R602
side chain. Intra- and intermolecular salt bridges (dotted purple lines), hold the side
chains of K599 and K600 in place. Figure from (Niemann et al., 2007). (D) Side
chains of residues from β strands C, F, and G of the c-Met Ig1 domain form a
hydrophobic pocket into which W124 from the concave face of the InlB LRR binds.
Figure from (Niemann et al., 2007). (E) Clustal X alignment of c-Met binding
interface from C and D, with critical residues indicated (arrows). Boxed residues
represent differences that may account for InlB insensitivity of Guinea pig and Rabbit
c-Met. (F) Phosphorylation of c-Met cytoplasmic tail recruits adaptors and signaling
molecules. Figure from (Ireton, 2007). (G) InlB-mediated entry. Proteins or domains
shown to be involved in InlB-mediated bacterial uptake are in orange. PI 3-kinase and
25
its lipid product PIP3 might affect F-actin through (1) actin polymerization, (2)
recruiting WAVE2 (3) inducing membrane association of a guanine nucleotide
exchange factor (GEF) for Rac1. Figure from (Ireton, 2007).
26
SYNERGY BETWEEN INTERNALIN A AND INTERNALIN B

Because InlA is covalently attached to the bacterial cell wall, it acts as an adhesin
(promotes adhesion) and an invasin (promotes bacterial uptake). In contrast, InlB is
only loosely associated with the bacterial surface and appears to function as an
invasin, but not an adhesin (at least of epithelial cells) (Pentecost et al., 2006). InlB
acts synergistically with InlA during invasion of cultured epithelial cells (Bergmann et
al., 2002; Dramsi et al., 1995; Lingnau et al., 1995). However, the mechanism of
synergy between the two proteins is poorly understood because the invasion pathways
are often investigated independent of one another. This is generally accomplished by
genetic deletion of one protein from L. monocytogenes, expression of one protein in
the closely related L. innocua, which lacks internalins, or by use of beads coated with
only one protein at a time. In addition, most of what we know about InlB signaling is
the result of an experimental trick where InlB is made adhesive for the bacterium by
artificially linking the protein to the bacterial cell wall through genetic addition of a
cell wall anchor sequence (Bierne et al., 2001; Bierne et al., 2005; Braun et al., 1999;
Dramsi and Cossart, 2003; Jonquieres et al., 2001; Khelef et al., 2006; Seveau et al.,
2004; Seveau et al., 2007; Veiga and Cossart, 2005; Veiga et al., 2007). Yet, whether
InlB signals through c-Met local to the attached bacterium, and whether InlB is
dissociated, remains attached, or diffuses across an epithelium is critical to
understanding how and why InlB promotes invasion.
We hypothesize that InlB regulates uptake by imitating the regulatory role of RTKs on
endocytosis of the epithelial junctions, and more specifically the role of c-Met in
regulating E-cadherin endocytosis. For example, growth factor activation of receptor
tyrosine kinases has been shown to induce macropinocytosis of E-cadherin (Bryant et
al., 2007). c-Met and E-cadherin are co-endocytosed in HGF treated MDCK cells
(Kamei et al., 1999). InlB mimics HGF for c-Met activation and internalization (Li et
al., 2005). InlB can promote Clathrin-mediated internalization of Listeria while HGF
similarly promotes Clathrin-mediated internalization of E-cadherin (Izumi et al., 2004;
Veiga and Cossart, 2005; Veiga et al., 2007). c-Met signaling regulates p120, Hakai,
and Clathrin, which in turn have been shown to regulate E-cadherin endocytosis or
27
InlA-mediated Listeria invasion (Bonazzi et al., 2008; Cozzolino et al., 2003; Fujita et
al., 2002; Lecuit et al., 2000; Veiga and Cossart, 2005). Thus InlA and InlB should be
studied in the same context to determine how Listeria invasion is mechanistically
related to growth factor regulation of E-cadherin endocytosis.
SPECIES SPECIFICITIES OF INTERNALIN A AND INTERNALIN B
Internalin A Does Not Bind Murine E-cadherin

Although L. monocytogenes has been cultured in association with mice and rats, these
species have never been found to acquire natural disease (Gray and Killinger, 1966;
Lecuit et al., 1997; Murray, 1955). Furthermore, it has long been recognized that mice
and rats are not easily or consistently infected via the oral route. Oral infections have
generally required extremely high doses, which often failed to produce lethal infection
(Gaillard et al., 1996; Huleatt et al., 2001; MacDonald and Carter, 1980; Marco et al.,
1992; Pron et al., 1998; Roll and Czuprynski, 1990; Zachar and Savage, 1979).
Although internalins are critical for host cell invasion in tissue culture, a role for
internalins in intestinal invasion could not be established until relatively recently
(Lecuit et al., 2001). For example, infections of mice found no role for InlA or InlB
and initial rates of translocation of the rat intestine by L. monocytogenes is low,
independent of inlAB, hly or actA, and is similar to translocation by L. innocua, which
lacks internalins (Gaillard et al., 1991; Gaillard et al., 1996; Pron et al., 1998).
It was found that mouse epithelial cells were resistant to L. monocytogenes invasion
because InlA does not bind murine E-cadherin (Lecuit et al., 1999). The species
specificity of InlA was shown to depend primarily on the difference of a single amino
acid in E-cadherin, the 16th, which is a proline in permissive species (human, rabbit,
guinea pig) but a glutamic acid in mice and rats (Figure 1.4 G). A P16E mutation in
human E-cadherin is sufficient to prevent InlA binding (Figure 2.10C, 2.10D) (Lecuit
et al., 1999). Crystal structures of InlA bound with human E-cadherin then revealed
the nature of the specificity: P16 of EC1 adopts a strained cis-conformation to fit in a
hydrophobic pocket between β-strands 6 and 7 in InlA (Figure 1.4C, D) (Schubert et
al., 2002). The bulky and charged nature of glutamic acid at residue 16 in mouse and
28
rat E-cadherin prevents a close association of InlA (Figure 1.4C, D) (Wollert et al.,
2007a; Wollert et al., 2007b). A transgenic mouse was developed where human E-
cadherin is expressed from the promoter of the intestinal fatty acid binding protein
(iFABP) gene, which is turned on in non-proliferative small intestinal enterocytes.
This model demonstrated that InlA could promote L. monocytogenes invasion of the
intestinal epithelium by interacting with permissive E-cadherin (Lecuit et al., 2001).
We note that canine E-cadherin is also expected to bind InlA. Canine E-cadherin is
identical to human E-cadherin in the first 30 amino acids, which also contains the
critical proline at position 16 required for InlA interaction. Furthermore, the E-
cadherin residues in closest contact with InlA (V3, I4, P5, P6, K14, P16, F17, P18,
K19, Q23, K25, N27, V48, W59, E64, M92) are all conserved in the human and
canine sequences (Figure 1.4G) (Schubert et al., 2002). Furthermore L. monocytogenes
efficiently infects Madin Darby Canine Kidney cells, and dogs, unlike mice and rats,
are susceptible to Listeriosis (Gray and Killinger, 1966; Robbins et al., 1999).
Internalin B Does Not Activate Guinea Pig or Rabbit c-Met

InlB has also been found to be species specific. Following intravenous inoculation of
guinea pigs and rabbits, an inlB mutant exhibits no attenuation in the liver (Khelef et
al., 2006). In contrast, InlB appears to promote colonization of the livers of mice given
a high infectious dose intravenously (Dramsi et al., 1995; Dramsi et al., 2004; Gaillard
et al., 1996; Khelef et al., 2006). It was shown that transfection of guinea pig and
rabbit cells with human c-Met restores the ability of InlB to stimulate c-Met and
promote Listeria invasion (Khelef et al., 2006). Thus InlB activates c-Met on human,
canine mouse and rat cells but not guinea pig or rabbit (Khelef et al., 2006; Shen et al.,
2000). Cow and sheep c-Met is also permissive for InlB according to unpublished data
in (Disson et al., 2008). The structural basis for InlB species specificity is not known.
However, there are some intriguing differences between the c-Met sequence from
permissive and nonpermissive species within the InlB binding region (Figure 1.5E).
For example, I639 in human c-Met is mutated to tyrosine in rabbit and leucine in
guinea pig and T646 is mutated to arginine in rabbit and is absent in guinea pig. We
29
hypothesize that ‘humanizing’ these residues will restore binding to InlB by rabbit and
guinea pig c-Met.
ANIMAL MODELS PERMISSIVE FOR INTERNALIN A AND INTERNALIN B

The ‘humanized’ mouse expressing hE-cadherin in the intestinal epithelium limits the
study of InlA-mediated invasion to the intestine (Lecuit et al., 2001). Furthermore, if
InlB function requires InlA-mediated adhesion, this mouse model could also be
insufficient to establish a role for InlB at extra-intestinal sites. For example, a role for
InlB in crossing the fetoplacental barrier was not found in mice even though mice are
permissive for InlB (Le Monnier et al., 2007). However, a second ‘humanized’
transgenic mouse was recently developed by knocking-in murine E-cadherin with
E16P mutation (Disson et al., 2008). Both InlA and InlB were implicated in
fetoplacental infection in this model where InlA is adhesive. Although this model
appears to be sufficient to study InlA and InlB in the same context, we are concerned
by the fact that mE-cadherinE16P binds InlA with a lower affinity (96 µM) than hE-
cadherin (8 µM) (Wollert et al., 2007b). It was recently found that gerbils are
permissive for InlA and InlB functions (Disson et al., 2008). However, in contrast to
mice, this model lacks the power of forward genetics and also lacks well characterized
reagents.
Rather than making permissive mice, we were interested in generating L.

monocytogenes strains with InlA mutations that would allow binding to murine E-
cadherin. Our efforts are detailed in Chapter 3. In addition, a recent independent effort
in Germany recently succeeded in generating a mouse-adapted InlA. In designing
mutations that would increase the binding of InlA to human E-cadherin, InlA S192N
Y369S (InlAm) was found to have an equivalent binding affinity for mouse E-cadherin
(Kd = 10+/-2 μM) as wild type InlA has for human E-cadherin (8+/-4 μM) (Figure
1.4E) (Wollert et al., 2007b). The S192N mutation displaces a water molecule and
introduces a direct hydrogen bond between N192 in InlA and F17 in human EC1. As
an unexpected consequence, S192N allows E16 of mEC1 to adopt a relaxed trans
conformation and the carboxy group of E16 of mEC1 occupies the same hydrophobic
30
pocket of InlA as P16 of hEC1 in InlA/hEC1 (Figure 1.4E, 1.4F) (Wollert et al.,
2007a; Wollert et al., 2007b). The second mutation improves overall binding at the
major interface of the InlA-E-cadherin interaction. Y369S replaces the bulky tyrosine
sidechain with a serine, which makes a water-mediated hydrogen bond to N27 in EC1
(Wollert et al., 2007a; Wollert et al., 2007b). The binding of InlAm and murine E-
cadherin promotes oral infection of mice through the intestinal epithelium (Wollert et
al., 2007b).
TISSUE SPECIFICITIES OF INTERNALIN A AND INTERNALIN B

Loss of Internalin A abrogates intestinal invasion of guinea pigs, but has no effect on
pathogenesis when mutant bacteria are administered intravenously (Lecuit et al.,
2001). Whether InlB also promotes efficient invasion of the intestine in permissive
hosts has implications for the success of Listeria invasion and colonization at this site.
However, InlB has not been found to be important for intestinal invasion, but rather
for colonization of mouse livers after intravenous infection (Dramsi et al., 2004;
Khelef et al., 2006). Furthermore InlB did not appear to affect invasion of the intestine
of transgenic mice expressing human E-cadherin in the intestine (Khelef et al., 2006).
Thus, the current dogma is that InlA and InlB have evolved to target different tissues
at different stages of infection: InlA is required for intestinal infection and is
subsequently dispensable for invasive disease in non-pregnant animals, while InlB
primarily mediates invasion of other tissues, notably the liver (Ireton, 2007; Schubert
and Heinz, 2003).
CHALLENGING THE INTERNALIN TISSUE SPECIFICITY DOGMA

There is reason to hypothesize a role for InlB in intestinal invasion. First, c-Met is
present on many tissues, including epithelia suggesting that InlB may also promote
infection of the gastrointestinal tract or other barriers (Di Renzo et al., 1991; Disson et
al., 2008; Fukamachi et al., 1994; Ishikawa et al., 2001; Kato et al., 1997a, b; Neo et
al., 2005; Nusrat et al., 1994; Sunitha et al., 1999; Wormstone et al., 2000). Indeed, as
mentioned above, InlB appears to play a role in crossing of fetoplacental barrier after
31
intravenous inoculation, but only with the coexpression of a functional InlA (Disson et
al., 2008). Second, InlA and InlB are coregulated and are upregulated in the intestinal
tract and under conditions simulating the gastrointestinal tract (Kim et al., 2005;
McGann et al., 2007b; Sue et al., 2004; Toledo-Arana et al., 2009). Third, InlB
promotes infection of cultured epithelial cells, including primary intestinal epithelial
cells from permissive animal models, like gerbils (Disson et al., 2008).
ANATOMICAL AND SUBCELLULAR SITE OF EPITHELIAL INVASION: THE

POLARITY PARADOX
THE EPITHELIAL BARRIER, CELL RENEWAL AND GASTROINTESTINAL PATHOGENS

The gastrointestinal epithelium fulfills two seemingly incompatible tasks. On the one
hand, it maintains a tight epithelial barrier that controls fluid and solute transport,
separates the external (lumenal) environment from the internal (interstitial)
environment, and prevents invasion of potentially harmful microbes. The tight and
adherens junctions that comprise the apical junctional complex (AJC) are the
intercellular glue that maintains this barrier (Anderson et al., 2004; Balda and Matter,
1998; Laukoetter et al., 2006). On the other hand, the epithelium continuously
disassembles the barrier in a conveyor belt of rapid cell renewal and cell death. 1010
cells are shed per day and a new epithelial monolayer is generated every 3-6 days as a
continuous flow of cell division, differentiation, migration and cell loss along the
crypt-villus axis (Bullen et al., 2006). Epithelial renewal continuously threatens the
integrity of the epithelial barrier since dead cells must be removed and detached
through junction disassembly followed by epithelial junction reassembly.
The epithelium also needs to maintain its functions and integrity in the face of
continuous exposure to potentially invasive microbes, and their metabolic products
and toxins. Most bacterial-epithelial relationships in the intestine are benign, and in
some cases symbiotic (the gastrointestinal lumen is thought to be home to more
bacterial cells than the total number of cells in the body). However a number of
invasive bacterial and viral pathogens have evolved mechanisms to breach the
32
intestinal barrier. Interestingly, many of these invasive microbes cross the epithelial
barrier by utilizing cellular receptors that are found only on the basolateral membrane
of the epithelial cell, and thus should not be available on the lumenal surface of an
intact epithelium since the AJC also allows cells to separate the plasma membrane into
distinct apical versus basolateral domains. For example, rotaviruses and Yersiniae bind
integrins, a class of adhesion and signaling molecules found solely on the basolateral
sides of enterocytes (Guerrero et al., 2000; Isberg and Leong, 1990).
E-CADHERIN AND C-MET ARE BASOLATERAL RECEPTORS

L. monocytogenes’ receptors E-cadherin and c-Met are also basolateral proteins that
co-localize at the adherens junction, below the epithelial tight junction (Boller et al.,
1985; Boyle and Finlay, 2003; Crepaldi et al., 1994; Nusrat et al., 1994; Sousa et al.,
2005b). Even prior to identification of these receptors, it was known that L.
monocytogenes invades polarized epithelial cells most efficiently from the basolateral
side (Gaillard and Finlay, 1996; Temm-Grove et al., 1994). For example, when
cultured epithelial cells are plated sparsely and grown as small islands of cells, the
edge cells do not have a continuous tight junction to prevent mixing of apical and
basolateral proteins and L. monocytogenes preferentially infects these cells (Gaillard
and Finlay, 1996; Temm-Grove et al., 1994). Some cultured epithelial cell lines will
become more differentiated and polarized over time in culture and L. monocytogenes
invasion of confluent monolayers of Caco-2 cells decreases with epithelial monolayer
maturity. The epithelial cell-to-cell junctions are Ca2+-dependent and disrupting the
intercellular junctions with calcium chelators, there by exposing lateral cell
membranes, increases L. monocytogenes invasion of polarized epithelial monolayers
(Gaillard and Finlay, 1996). These data present a paradox that L. monocytogenes has
evolved to use receptors that are not accessible during infection of the gastrointestinal
epithelium from the lumen.
33
THE PEYER’S PATCH PARADIGM

The prevailing hypothesis to explain the discrepancy between receptor localization
and the site of infection has been that enteric pathogens may not directly enter
enterocytes from the lumenal side. Rather, they first invade the intestine by taking
advantage of the function of M-cells (Clark and Jepson, 2003). M-cells are modified
epithelial cells overlying the intestinal lymphoid follicles known as Peyer’s patches
(PP). They are capable of phagocytosis and also express ‘basolateral’ receptors on
their lumenal surface. M-cells normally function in immune surveillance by engulfing
lumenal antigens and presenting them to dendritic cells and macrophages found
underneath the Peyer’s patch epithelium.
Some pathogens, like Salmonella typhi, which causes enteric fever in humans, and
Salmonella typhimurium which causes a similar disease in mice, have been shown to
enter through M-cells before spreading systemically through the lymphatics and blood
stream (Jensen et al., 1998; Jones et al., 1994). Yersinia pseudotuberculosis expresses
the protein Invasin to attach to and stimulate entry through integrin receptors (Marra
and Isberg, 1997). Although integrins are found only on the basolateral surface of
enterocytes, they have been detected on the apical surface of M-cells (Clark et al.,
1998). In humans, Yersinia pseudotuberculosis causes a self-limited enteritis and
occasionally mesenteric adenitis. In mice this pathogen is able to invade and spread
systemically and cause an enteric fever-like syndrome. Similarly Shigella, which also
use integrins for basolateral enterocyte invasion has been proposed to first cross the
intestinal epithelial barrier through M-cells (Mounier et al., 1992; Zychlinsky et al.,
1994). The same model has been proposed for Listeria monocytogenes (Gaillard and
Finlay, 1996; Jensen et al., 1998; Pron et al., 1998). For example, Jean-louis Gaillard
and B. Brett Finlay postulated: “because invasion of these highly differentiated cells
[enterocytes] is thought to be exclusively basolateral, L. monocytogenes must utilize
another site of entry. This could be the M cell, as reported for other bacterial
pathogens. This hypothesis is in agreement with previous results showing that listeriae
given to rodents penetrate mostly into the Peyer’s patches” (Gaillard and Finlay,
1996).
34
CHALLENGING THE PEYER’S PATCH PARADIGM

The Peyer’s patch model of intestinal invasion has been challenged as a paradigm.
Salmonella typhimurium was found to be able cause septicemia in mice without
invading M cells and colonizing Peyer's patches (Vazquez-Torres et al., 1999). More
recent data on Yersinia pseudotuberculosis also shows that this microbe has Peyer’s
patch independent modes of entry, since mice that lacked Peyer’s patches were
colonized in the liver and spleen without the need for replication in the intestinal
lymphatics (Barnes et al., 2006). Also in wild type mice, systemic colonization by Y.
pseudotuberculosis occurred after expansion within intestinal niche independent of the
Peyer’s patches or mesenteric lymph nodes (Barnes et al., 2006). The intestinal niche,
be it cellular or anatomical, has not yet been defined.
In mice and rats, L. monocytogenes replication within the intestine is restricted to

Peyer’s patches (Marco et al., 1997; Marco et al., 1992; Prats et al., 1997; Pron et al.,
1998). However, as described above, it was later found that mice and rats differ in a
crucial amino acid in E-cadherin, which abrogates the interaction with InlA and makes
epithelial cells immune to L. monocytogenes entry (Lecuit et al., 1999). Previous
studies of Listeriosis in permissive hosts such as the guinea pig have found replicating
L. monocytogenes in enterocytes located within villous intestine far from Peyer’s
patches (Racz et al., 1972). The transgenic mouse model that expresses human E-
cadherin in the intestine also showed direct invasion of L. monocytogenes into
enterocytes in the intestine independent of the presence of Peyer’s patches (Lecuit et
al., 2001). Taken together, studies suggesting that Listeria invade the intestine through
Peyer’s Patches may have missed a major site and pathway of invasion.
35
Figure 1.6: versus The Apical Junctional Complex of Polarized Epithelia
(A) Cartoon diagram of a polarized MDCK monolayer in a transwell. (B) Cartoon

diagram of polarized enterocytes at an intestinal villus tip. (C) Cartoon depiction of
at the Apical Junctional Complex of a Polarized Epithelium. Note the
paradoxical relationship between invasions InlA and InlB and basolateral
receptors, E-cadherin and c-Met, inaccessible across the epithelial tight junctions. (D)
Cartoon depiction of hypothetical binding of to basolateral
receptors across a disrupted Apical Junctional Complex.
36
CHAPTER 2 : INTERNALIN A TARGETS LISTERIA MONOCYTOGENES TO

EPITHELIAL JUNCTIONS AT SITES OF CELL EXTRUSION
Mickey Pentecost performed the experiments. Portions of this chapter were published
in (Pentecost et al., 2006).
INTRODUCTION
Invasion of non-phagocytic cells by L. monocytogenes is mediated by at least two

bacterial surface proteins, Internalin A (InlA) and Internalin B (InlB) (Cabanes et al.,
2002; Dramsi et al., 1995; Gaillard et al., 1991). InlA binds an extracellular domain of
E-cadherin, a transmembrane cell-to-cell adhesion molecule (da Silva Tatley et al.,
2003; Lecuit et al., 1999; Lecuit et al., 1997; Mengaud et al., 1996; Schubert et al.,
2002). InlA is necessary for invasion of epithelial cells and is sufficient to reconstitute
invasion when expressed in the non-pathogenic and non-invasive species, Listeria
innocua (Gaillard et al., 1991; Lecuit et al., 1997; Mengaud et al., 1996). InlB binds
the extracellular domain of c-Met, a receptor tyrosine kinase (Shen et al., 2000).
Although InlB is unrelated by sequence or structure to the endogenous c-Met ligand,
Hepatocyte Growth Factor (HGF), it acts as an exogenous c-Met agonist and mediates
L. monocytogenes invasion of multiple cell types (Banerjee et al., 2004; Copp et al.,
2003; Dramsi et al., 1995; Greiffenberg et al., 1998; Ireton et al., 1999; Li et al., 2005;
Lingnau et al., 1995; Marino et al., 2002; Marino et al., 1999; Niemann et al., 2007;
Parida et al., 1998; Shen et al., 2000). InlB acts synergistically with InlA during
invasion of cultured epithelial cells through an unknown mechanism (Bergmann et al.,
2002; Dramsi et al., 1995; Lingnau et al., 1995).
In a pioneering electron microscopy study of Listeria enteritis in the guinea pig, L.

monocytogenes was found to infect the columnar enterocytes (epithelial cells) of small
intestinal villi (Racz et al., 1972). How L. monocytogenes gains access to E-cadherin
and c-Met in vivo remains an important and unresolved issue, since E-cadherin and c-
Met are present primarily on the lateral membranes, but not the apical surface, of
37
intestinal epithelial cells (Boller et al., 1985; Boyle and Finlay, 2003; Crepaldi et al.,
1994; Nusrat et al., 1994; Sousa et al., 2005b). Several lines of evidence suggest that
L. monocytogenes invades polarized epithelial cells most efficiently from the
basolateral side (Gaillard and Finlay, 1996; Temm-Grove et al., 1994). First, L.
monocytogenes preferentially infect the lateral edges of islets of cultured epithelial
cells (Gaillard and Finlay, 1996; Temm-Grove et al., 1994). Second, L.
monocytogenes invasion decreases with epithelial monolayer maturity. Third, L.
monocytogenes invasion of a confluent epithelial monolayer can be increased by
disrupting the intercellular junctions, thereby exposing lateral cell membranes
(Gaillard and Finlay, 1996). It has been proposed that L. monocytogenes gains access
to E-cadherin during an apical infection through the activation of c-Met by InlB
(Cossart et al., 2003). However, c-Met, a basolateral receptor, is not known to be
exposed or activated by HGF on the apical side of epithelia (Balkovetz et al., 1997;
Crepaldi et al., 1994).
We used Madin-Darby canine kidney (MDCK) cells to investigate how L.

monocytogenes breaches the apical surface of an epithelial barrier (Figure 1.6A). We
chose this cell line because MDCK cells form a polarized epithelium with tight
junctions when grown on permeable filter supports (Figure 1.6A), and because MDCK
cells are permissive for L. monocytogenes invasion (Nelson, 2003; Robbins et al.,
1999). Moreover, canine E-cadherin is identical to human E-cadherin in the critical
InlA binding region (Figure 1.4G), and InlB activates c-Met signaling in MDCK cells
(Shen et al., 2000). We show here that apical invasion of an MDCK epithelium by L.
monocytogenes regularly occurs and is critically dependent on the interaction between
InlA and E-cadherin. Detailed microscopic analyses of adhesion and entry reveal that
L. monocytogenes has a specific tropism for the junctions at cell extrusion sites where
E-cadherin is transiently exposed to the apical surface.
38
MATERIALS AND METHODS
MDCK cell culture. MDCK II/G cells were kindly provided by Dr. W. James Nelson
(Stanford University, Stanford, California) and were maintained at 37°C in 5% CO2
atmosphere in DMEM (Gibco, San Diego, California) supplemented with 10% fetal
bovine serum (FBS, Gibco). To culture polarized MDCK monolayers, cells were
trypsinized and seeded on 12 mm polycarbonate tissue culture inserts (Transwell
filters; Costar, Cambridge, Massachusetts) at a density of 106 cells/cm2 and
supplemented with fresh basal media daily for 4 days. Verification of tight junction
barrier function of intact monolayers was performed as described in (Vogelmann and
Nelson, 2005) and shown in Figure 2.1. For apical versus basal comparison of L.
monocytogenes infection, cells were cultured on 3 µm-pore Transwell filters. For all
other experiments, cells were cultured on 0.4 µm-pore Transwell filters. To disrupt
calcium-dependent intercellular junctions, immediately prior to infection, MDCK
monolayers were incubated in low calcium media (5 µM Ca2+; (Vogelmann and
Nelson, 2005)) for 30 minutes, and then switched back to DMEM (1.8 mM Ca2+).
L. monocytogenes strains and culture conditions. 10403S, a wild-type (Wt) L.

monocytogenes strain, and isogenic mutant strains DP-L4405 (ΔinlA), DP-L4406
(ΔinlB) and DP-L3078 (ΔactA) were kindly provided by Dr. Daniel A. Portnoy
(University of California, Berkeley, California) and have been described previously
(Bakardjiev et al., 2004; Skoble et al., 2000). GFP-expressing 10403S strain DH-
L1039 (Wt-GFP) was kindly provided by Dr. Darren E. Higgins (Harvard University,
Boston, Massachusetts) and has been described in (Agaisse et al., 2005; Shen and
Higgins, 2005). L. monocytogenes were grown on BHI-agar or in BHI-broth
(BD/Difco, San Jose, California). Cultures of ActA-RFP and Wt-GFP were
supplemented with chloramphenicol. For infection, L. monocytogenes strains were
inoculated with a loop from a fresh plate into 3 ml BHI-broth and grown 13-15 hours
at room temperature without agitation.
Assays of L. monocytogenes cell adherence and invasion. Bacterial cells were

harvested at 10,000g for 1 minute and resuspended to 0.5 OD600 (7x108 CFU/ml) in
39
room temperature DMEM. Immediately prior to infection, MDCK cells were

transferred to 37°C DMEM. L. monocytogenes were added to polarized MDCK cells
at a multiplicity of infection (MOI) of 140:1 bacteria per cell in 500 µl of DMEM and
were allowed to adhere for 10 minutes at 37°C in 5% CO2 atmosphere. Cell
monolayers were washed by pipeting with 3 changes of fresh 37°C DMEM to remove
non-adhered L. monocytogenes. This point was considered time 0:00 for all analyses.
Invasion of cells was allowed to proceed for 1 hour in DMEM at 37°C in 5% CO2
atmosphere (1:00). The media was replaced with DMEM containing 50 µg/ml
gentamicin and incubated for 20 minutes to kill extracellular L. monocytogenes (1:20).
Finally, the media was replaced with DMEM containing 10 µg/ml gentamicin and
incubated at 37°C in 5% CO2 atmosphere up to 5:00. At appropriate time points, the
above infection sequence was interrupted in order to assay for L. monocytogenes
adhesion, invasion, or intracellular replication as described below.
To assay for cell adhesion, at 0:00, monolayers were either fixed and analyzed by
microscopy or dispersed and plated for colony forming units (CFUs). Adhesion by
microscopic analysis was determined from at least 3 40X fields (~2000 MDCK cells /
field) from each of at least 3 infected monolayers per strain tested. For adhesion by
CFU counts, the entire Transwell-monolayer excised from the frame was dispersed by
15 seconds of vortex agitation in 500 µl of PBS 1% saponin. Appropriate dilutions of
the suspension were plated onto BHI-agar. Short-term PBS incubation and the
presence of saponin were determined not to affect L. monocytogenes viability (not
shown). To assay for cell invasion, at 1:20, monolayers were washed by pipeting with
3 changes of fresh 37°C DMEM to remove gentamicin. Intracellular L.
monocytogenes were recovered by 15 seconds of vortex agitation in 500 µl of PBS (-
Ca2+, -Mg2+) 1% saponin. Appropriate dilutions of the suspension were plated onto
BHI-agar for CFU determination. For analysis of intracellular replication, at various
time points, cell monolayers were fixed and analyzed by immunofluorescence
microscopy. To determine the percentage of invasion sites at multicellular junctions,
monolayers were fixed at 3:00. At least 100 randomly observed L. monocytogenes foci
(or ΔactA infected cells) were analyzed from each of at least three infected
40
monolayers for each strain tested. Experiments were performed at least three times.
Prism software (GraphPad, San Diego, California) was utilized for construction of
graphs and statistical analysis of data. Student’s t-test was used to compare two
sample groups. ANOVA with Bonferroni post-tests were used to analyze 3 or more
sample groups. Pearson product-moment correlation coefficient was used to analyze
distributions.
Antibody blocking of L. monocytogenes cell adherence. E-cadherin was blocked

with mouse mAb anti-E-cadherin antibody (rr1) (Gumbiner and Simons, 1986, 1987)
and gp135 was blocked with mouse mAb anti-gp135 (clone 3F2/DB) (Ojakian and
Schwimmer, 1988). Both antibodies were kindly provided by Dr. W. James Nelson.
To normalize the concentration of these antibodies, a dilution series of each was
blotted under vacuum suction onto nitrocellulose using a 96-well biodot apparatus
(Bio-Rad, Hercules, California). The blot was allowed to dry fully, and then incubated
for 1 hour at room temperature in blocking solution containing a 1:1 mixture of Li-Cor
blocking buffer (Li-Cor Biosciences, Lincoln, Nebraska) and PBS. The blot was
incubated in goat anti-mouse Alexafluor660 antibodies (Molecular probes, Eugene,
Oregon) diluted 1:5000 in blocking solution for 1 hour. The blot was washed 3 times
for 5 minutes in PBS 0.1% Tween-20, 3 times for 2 minutes in PBS, then imaged with
a Li-Cor Odyssey infrared imaging system. The integrated fluorescence intensity for
each dot was quantified using Li-Cor Odyssey software.
Polarized MDCK cells were blocked at 4° C for 30 minutes in 100 µl of apically

applied DMEM 10% FBS (Mock), gp135 antibody in undiluted hybridoma
supernatant, or mouse monoclonal anti-E-cadherin antibody diluted in DMEM 10%
FBS to the same effective concentration (equivalent dot-blot integrated fluorescence
intensity) as the gp135 antibody. Cell monolayers were washed by pipeting with 2
changes of DMEM. L. monocytogenes were added to polarized MDCK cells at an
MOI of 140:1 in 500 µl of media and were allowed to adhere for 5 minutes at room
temperature. Cell monolayers were washed by pipeting with 3 changes of fresh room
temperature DMEM to remove non-adhered L. monocytogenes. Cells and adherent L.
41
monocytogenes were fixed and adhesion was quantified by microscopy analysis of at

least 3 40X fields from each of 3 infected monolayers per blocking condition.
Transfection constructs and Polarized MDCK cell Transfection. CagA-GFP and

GFP expression constructs were developed in (Bagnoli et al., 2005). An expression
construct encoding the extracellular domains of human E-cadherin fused human Fc
and a GPI anchor (E-cadherin-Fc-GPI), a monomeric version of the fusion protein
described in (Perez et al., 2005) was the kind gift of W. James Nelson (Stanford
University). A variant of this construct, E-cadherinP16E-Fc-GPI was made by
Quickchange site directed mutagenesis (Stratagene) with the following PAGE purified
primers:
Ecadherin_P16E 5’-tgcccggaaaacgagaaaggcgagtttcctaaaaacctggttcag-3’ and
Ecadherin_P16E_antisense 5’-ctgaaccaggtttttaggaaactcgcctttctcgttttccgggca-3’.
MDCK cells were seeded on transwell filters and a confluent density (~106 cells / cm2)
and allowed to polarize for 1 or 3 days. Cells were transfected using Lipofectamine
2000 reagent (Invitrogen) as described in (Bagnoli et al., 2005) for CagA-GFP or GFP
or with TURBOFECT reagent (Fermentas) for E-cadherin-Fc-GPI or E-cahderinP16E-
Fc-GPI according to the manufacturers instructions. (TURBOFECT has a simpler
procedure and less cell toxicity than Lipofectamine 2000 while yielding similar
transfection efficiency.) The transfection constructs were allowed 24 h expression. L.
monocytogenes were added to the cell surfaces at an MOI of 140:1 in 500 µl of media
and were allowed to adhere for 5 or 10 minutes at 37°C in 5% CO2 atmosphere.
Microscopy and antibodies. Time-lapse microscopy was performed essentially as

described in (Bagnoli et al., 2005). For immunofluorescence microscopy, samples
were fixed with 2% paraformaldehyde in 100 mM phosphate buffer, pH 7.4 (15
minutes for cell monolayers, and 1 hour for tissues), and were permeabilized in
phosphate-buffered saline (PBS) 1% saponin 3% bovine serum albumin (BSA) or left
unpermeabilized by blocking samples and diluting antibodies/probes in PBS 3% BSA.
After incubation with appropriate antibodies/probes, samples were mounted with
42
Vectashield mounting medium (Vector Laboratories, Burlingame, California) and

imaged with a confocal microscope (Bio-Rad, Hercules, CA). For visualization of
intestinal villi, we mounted intact tissue blocks and imaged the stained tissues without
prior embedding and sectioning. The samples were imaged by confocal microscopy
where optical sections were taken at 0.5 µm resolution through both the cell
monolayers and the intestinal villi. Z-stacks were reconstructed into three-dimensions
using Volocity software (Improvision, Lexington, Massachusetts). Figures were
assembled with Photoshop software (Adobe, San Jose, California).
L. monocytogenes were detected by incubation of samples with Listeria O antisera

(rabbit) poly types 1 & 4 (BD/Difco, San Jose, California 1:600 dilution). Tight
junctions were detected by incubating samples with mouse anti-ZO-1 antibodies
(Zymed, South San Francisco, California 1:300 dilution, and see (Vogelmann and
Nelson, 2005)). E-cadherin was detected by incubating samples with mouse mAb rr1,
an antibody that recognizes an extracellular epitope of E-cadherin at 1:50 to 1:100
dilution (Gumbiner and Simons, 1986, 1987). Gp135 was detected with mouse mAb
anti-gp135 (clone 3F2/DB, undiluted hybridoma supernatant) (Babyatsky and
Podolsky, 2003). E-cadherin-Fc-GPI was detected by direct immunofluorescence with
Alexa647 anti-human IgG. Anti-IgG Alexa-fluor conjugated antibodies of appropriate
species reactivity and fluorescence spectra were used for secondary detection
(Molecular Probes, Eugene, Oregon). An immunofluorescence inside/outside staining
that distinguishes extracellular from intracellular L. monocytogenes was modified
from (Amieva et al., 2002) with appropriate antibodies for this study. Actin was
visualized by incubating samples with Alexa-fluor conjugated phalloidins (Molecular
Probes). To visualize all nuclei, permeabilized samples were incubated with toto-3
(Molecular Probes). To visualize senescent cells, live samples were incubated with
Sytox Green (Molecular Probes).
43
RESULTS
L. MONOCYTOGENES INVADE THE EPITHELIUM AT DISTINCT MULTICELLULAR JUNCTION

SITES
We infected polarized MDCK monolayers on Transwell filters from the apical or basal
side to determine whether L. monocytogenes differentially invade these two membrane
domains. After 10 minutes, the monolayers were washed to remove non-adherent
bacteria and the cell-associated L. monocytogenes were allowed to invade the
epithelium for 1 hour. Any remaining extracellular bacteria were killed with
gentamicin for 20 minutes, and viable intracellular L. monocytogenes were quantified.
Bacterial infection in these conditions did not disrupt the integrity of the monolayer
(Figure 2.1). Basal invasion of a polarized MDCK epithelium is 5-fold more efficient
than apical invasion (Figure 2.2A), despite the fact that the filter support masks 85%
of the basal surface area. We tested a range of multiplicity of infections (MOIs) from 1
to 150 bacteria per cell and found that the higher level of basal invasion is independent
of the infectious dose (p < 0.01 for all MOIs). However, at all inocula tested there was
a detectable level of apical invasion.
We analyzed the sites of apical versus basal invasion by confocal immunofluorescence

microscopy. At various time points after internalization, monolayers were fixed and
probed with antibodies to L. monocytogenes. The infected monolayers were
counterstained for the tight junctions (anti-ZO-1). We observed that sites of basal
infection were distributed throughout the monolayer (Figure 2.2B). In contrast, we
noted that after apical infection, L. monocytogenes concentrate at distinct sites where
multiple (five or more) elongated cells join at a central multicellular junction (Figure
2.2C-F). By 3 hours of infection, small foci of replicating bacteria are found within
cells at multicellular junction sites (Figure 2.2D) and by five hours, large foci of
bacteria are localized at the original sites of entry (Figure 2.2E). These bacteria were
viable and replicative, since they had acquired actin-based intracellular motility as
indicated by the associated tail of polymerized actin (Figure 2.2D, inset) (Domann et
al., 1992; Kocks et al., 1992; Robbins et al., 1999; Tilney and Portnoy, 1989).
44
Virtually all L. monocytogenes foci (97%+/-1.1%, mean +/- SD; 3 hours post-
infection) are centered at multicellular junctions made by five or more MDCK cells.
However, multicellular junctions are specialized sites of invasion only from the apical
side. In contrast to apical infection, less than 1% of basally infected cells were
associated with a multicellular junction joining five or more cells (Figure 2.2B).
To confirm that cells with multicellular junctions are the primary sites of apical
invasion, we used a mutant of L. monocytogenes that invades host cells normally but is
unable to spread to adjacent cells because it lacks the actA gene, which is necessary
for actin-based cell-to-cell spread (ΔactA, Figure 1F) (Kocks et al., 1992; Skoble et
al., 2000). At 3 hours post-infection, ΔactA L. monocytogenes infected cells are
members of a multicellular junction sites with a frequency of 97%+/-0.8.
Figure 2.1: Preservation of Barrier Function During L. monocytogenes Infection of

MDCK Cells Polarized on Transwell Filters (Following Page)
Triplicate samples of filters without cells, uninfected monolayers, and infected

monolayers were examined. Confluent MDCK cells were polarized for 4 days on 0.4
µm Transwell filters prior to starting the experiments. At time zero, a set of
monolayers was infected through the apical compartment as described in the materials
and methods section. After washing unattached bacteria, 500 ng of fluorescent dextran
(conjugated to Alexa647 dye from Molecular Probes) diluted in media was added to
the apical chambers. Samples from the basolateral compartment were collected at
different timepoints, and the fluorescence intensity measured in a Li-Cor Odyssey
scanner. A dilution series of dextran solution was used to generate a standard curve of
fluorescence intensity relative to dextran concentration, and to determine the linear
range of our measurements (top graph). A linear best-fit of the dilution series was used
to calculate the background level (Y-intercept). The experimental samples were
measured at 1 hour intervals after start of infection. The fluorescence intensity was
background subtracted, converted to a dextran quantity. Negative values were
normalized to zero. The amount of dextran found in the basolateral compartment was
plotted over time (bottom graph). Error bars represent one standard deviation from the
mean of three independent samples.
45
46
Figure 2.2: Invasion and Replication of L. monocytogenes at Multicellular Junction

Sites (Following Page)
Polarized MDCK monolayers on Transwell filters were infected from the apical (A, C,
D, E, F) or basal (A, B) sides with L. monocytogenes. (A) Viable colony forming units
(CFU) of intracellular L. monocytogenes were determined after gentamicin treatment.
Means and standard deviations from quadruplicate samples are shown. Sample groups
are significantly different: unpaired t-test p<0.0001. (B-D) 3-D reconstructions of
confocal immunofluorescence images of the invasion sites. Upper panels are
reconstructions of Z-sections. (B) At 3 hours after basal infection, foci of replication
were visualized with antibodies to L. monocytogenes (green) and ZO-1 (red). Arrow
indicates a multicellular junction site. (C) At 1 hour after apical infection, a
representative site of invasion was visualized with antibodies to ZO-1 (blue). To
evaluate intracellular vs. extracellular bacteria, we performed an inside/outside
staining where extracellular adherent L. monocytogenes were stained before
permeabilization in green and both intracellular and extracellular bacteria were stained
after permeabilization in red. External L. monocytogenes thus appear as a combination
of red/green or yellow. (D) At 3 hours after apical infection, sites of replication were
visualized with antibodies to L. monocytogenes (green) and ZO-1 (red), and with
phalloidin (blue) to show actin comet-tails in association with the cytoplasmic
bacteria, inset. (E) At 5 hours after apical infection, foci of replication and spread were
visualized with antibodies to ZO-1 (red) and L. monocytogenes (green). (F) Using the
same methodology as in (E), monolayers were infected with ΔactA L. monocytogenes
(green), which are capable of cell invasion and intracellular replication but not cell-to-
cell spread. Scale bars 10 µm.
47
48
APICAL ATTACHMENT TO MULTICELLULAR JUNCTIONS IS DEPENDENT ON INTERNALIN

A
We infected polarized MDCK monolayers with wild type L. monocytogenes, an inlA-
deletion mutant (ΔinlA) or an inlB-deletion mutant (ΔinlB) to determine which
invasins are needed for apical invasion. Following a period of internalization, the
infected monolayers were treated with gentamicin and then the number of viable
intracellular bacteria was determined (Figure 2.3). Apical invasion requires InlA, since
ΔinlA L. monocytogenes invasion is almost eliminated (2% of wild type, Figure 2A).
Invasion by ΔinlB L. monocytogenes is also reduced (43% of wild type, Figure 2.3A).
However, when ΔinlB invasion was analyzed by confocal microscopy, the tropism for
multicellular junction sites remained (98%+/-1.4% of foci; 3 hours post-infection).
To determine whether the defects in invasion are due to defects in attachment, we

infected polarized MDCK monolayers for 10 minutes, removed non-adherent bacteria
and quantified attachment by confocal immunofluorescence microscopy. The vast
majority of wild type L. monocytogenes (98%+/-1.5%) attach to polarized MDCK
monolayers directly above ZO-1 staining, the site of the tight junctions (Figure 2.3C,
2.3D) and adhesion, like invasion, is concentrated at multicellular junction sites
(Figure 2.3C, 2.3D). Adhesion is entirely dependent on InlA, since we did not find any
ΔinlA L. monocytogenes associated with the epithelium using an equivalent inoculum
(Figure 2.3B). In contrast, ΔinlB L. monocytogenes adhere to polarized MDCK
monolayers as frequently (Figure 2.3B) and as specifically to the junctions (98%+/-
1.2%) as wild type. These results suggest that InlA is the major adhesin, that adhesion
is required for entry, and that InlB contributes to internalization but not attachment.
49
Figure 2.3: Internalin A-dependent Apical Adhesion and Invasion of Polarized

Epithelia
(A-B) polarized MDCK monolayers were infected from the apical side with wild type
(Wt), or . (A) Invasion was determined by
quantification of viable colony forming units (CFU) of intracellular bacteria after
gentamicin treatment. Means and standard deviations from quadruplicate samples are
shown. Sample groups are significantly different: one-way analysis of variance
p<0.0001; Bonferroni t test p<0.001 for all pairwise analyses. (B) Adhesion after 10
minutes of infection. Means and standard deviations of the number of
adhered per 1000 cells from triplicate samples are shown. (C)
Confocal microscopy visualization of wild type adhered to a
monolayer stained with antibodies to (green) and ZO-1 (red).
Bacteria are found only at multicellular junctions and are conspicuously absent
elsewhere. (D) A higher magnification area demonstrating concentrated adhesion at a
multicellular junction. Scale bars 10 m.
50
QUANTITATIVE ANALYSIS OF L. MONOCYTOGENES ADHESION SITES

To quantitatively define the tropism between L. monocytogenes and multicellular
junctions, we first characterized the frequency and distribution of multicellular
junctions throughout the monolayer, and then related this to sites of bacterial
attachment. Each cell in an epithelium joins more than one cell through a cell-cell
junction. However, a fraction of cell junctions join a group of cells at a single point to
form a multicellular junction. The number of cells that come together to form a
junction can be used to define a “junction type.” In Figure 2.4 we plotted the
frequency of each junction type in the form of a bar graph, noting that junction types
with increasing multicellularity are less common. To determine whether there is a
preferred junction type for L. monocytogenes adhesion, we counted the number of L.
monocytogenes associated with each junction type, and plotted these as well in Figure
2.4. We find an increasing number of bacteria colocalize with junctions joining an
increasing number of cells (Figure 2.4, Pearson correlation coefficient for wild type L.
monocytogenes r=0.95, p=0.0001; ΔinlB L. monocytogenes r=0.85, p=0.0037). This
correlation between increasing multicellularity at a junction and bacterial attachment
is striking, given that the frequency of multicellular junctions rapidly decreases.
Overall 74% of L. monocytogenes were adhered at multicellular junctions joining five
or more cells, which represent only 2% of all junctions.
We found no indication that L. monocytogenes induce these sites through alterations of

cellular or junctional morphology, since infected and uninfected monolayers have the
same frequencies of junctional types, and since L. monocytogenes are associated with
these sites rapidly, within 5 to 10 minutes of infection. We therefore concluded that L.
monocytogenes take advantage of preexisting multicellular junctions as a special site
on the epithelial surface that permits adhesion and invasion.
51
Figure 2.4: Tropism of for Multicellular Junctions
Cell junction types and adhesion sites were analyzed by quantitative

confocal microscopy. The grey bars (left y-axis) represent the frequency of junction
types, defined as the number of cells that meet at a junction, based on analysis of three
randomly imaged regions (~500 cells / region) of a polarized MDCK monolayer. The
black circles (right y-axis) represent the number of adhered per
junction type. Pearson correlation coefficient r=0.95, p=0.0001. Bottom: examples of
adhesion sites shown by confocal microscopy and visualized with antibodies to
(green) and ZO-1 (red). adhered to multicellular
junctions with 3, 6 and 9 cells are shown. Scale bar 10 m.
52
MULTICELLULAR JUNCTIONS FORM AND PERSIST AT SITES OF CELL EXTRUSION

Since junctions are dynamic structures, we asked when and where multicellular
junctions form in an MDCK epithelium. Sites with similar morphology were shown to
develop when apoptotic cells are extruded from the epithelial monolayer into the
apical media (Corfe et al., 2000; Rosenblatt et al., 2001). We confirmed that
multicellular junctions form during cell extrusion in uninfected MDCK monolayers
and analyzed the kinetics of this process by time-lapse video microscopy (Figure
2.5A, Video 2.1). A cell targeted for extrusion is initially morphologically
indistinguishable from the surrounding cells (Figure 2.5A, 0 hrs). Once the extrusion
process is initiated, it occurs rapidly, within approximately 40 minutes (Figure 2.5A, 1
hr), leaving a characteristic rosette-like arrangement of the surrounding cells with a
central multicellular junction. This pattern of cellular and junctional organization is
maintained for several hours longer than the actual extrusion event (Figure 2.5A, 6
hrs). No monolayer defects were detected at these sites, since the adjacent cells
reorganize to maintain epithelial continuity.
To examine entire monolayers for sites of cell extrusion, we stained extruding cells
with Sytox Green and examined them by confocal immunofluorescence microscopy.
This high affinity nucleic acid dye stains the nuclei of dying or dead cells but cannot
cross the impermeable membranes of live cells. Sytox staining revealed cells in
various stages of the extrusion process. Before a dying cell is extruded, the tight
junctions surrounding the cell dip toward the basal side of the monolayer (Figure
2.5B-D). When a cell is nearly extruded from the monolayer, the surrounding cells
form a funnel-shaped multicellular junction below the plane of the Sytox positive cell
nucleus (Figure 2.5C). Even after the loss of Sytox-positive cells, staining of the
epithelial monolayer nuclei can pinpoint extrusion sites since there is always a
conspicuously missing nucleus at multicellular junctions joining five or more cells.
Furthermore, the funnel-like rearrangement of junctions persists after extrusion has
completed (Figure 2.5D).
53
Figure 2.5: Multicellular Junctions Created by Cell Extrusion
(A) Top panels show reorganization of cells around a site of cell extrusion monitored
live by time-lapse differential interference contrast microscopy. The extruding cell is
colored in purple, and adjacent cells are outlined in black to show changes in the shape
and relative location of the cells over time. The cells surrounding the extruded cell are
numbered to illustrate their position at the start and after resolution of the multicellular
junction. The bottom strip shows the process of extrusion, beginning at hour 1 of
observation, and continuing for 40 minutes; frames at 10-minute intervals. Early (B)
and late stages (C) of cell extrusion from a polarized MDCK epithelium were imaged
by confocal microscopy after staining the monolayer for apoptotic nuclei with Sytox
Green and with antibodies to ZO-1 (red). (D) Staining of all the cell nuclei in the
monolayer with toto-3 (blue) illustrates that a missing nucleus is evident at extrusion
sites after cell extrusion is completed. Reconstructed Z-section panels (B-D, top)
reveal the rearrangement of junctions that occurs during cell extrusion. Scale bar 10
m.
54
Video 2.1: Cell Extrusion
QuickTime DIC time-lapse video of cell extrusion from MDCK monolayer, shown in
Figure 2.5A.
55
L. MONOCYTOGENES ATTACHMENT SITES ARE SITES OF CELL EXTRUSION

To determine whether L. monocytogenes sites of adhesion are equivalent to sites of
cell extrusion, we reexamined bacterial adhesion sites with regard to 1) the presence of
extruding cells (Sytox), 2) missing nuclei (toto-3), and 3) the funnel-like
rearrangement of the tight junctions (anti-ZO-1). Figure 2.6A shows that L.
monocytogenes adhere to the junctions at sites where cells are in the process of
extrusion. These sites represent a small subset of multicellular junctions since the
extrusion process occurs rapidly. All L. monocytogenes adhesion sites at multicellular
junctions joining five or more cells have the characteristic absence of a nucleus
(Figure 2.6B) and funnel-like rearrangement of the tight junctions (Figure 2.6A).
Therefore, these are also sites where cell extrusion has occurred recently.
We characterized the kinetics of L. monocytogenes invasion of multicellular junctions

by time-lapse microscopy. Figure 2.7 shows a time course of Wt GFP L.
monocytogenes invasion of a confluent monolayer of E-cadherin-RFP MDCK cells.
Two Listeria cells are adhered to a multicellular junction and are internalized into
different MDCK cells within ~20 minutes. E-cadherin-RFP is associated with L.
monocytogenes during internalization (Figure 2.7, arrowheads, Video 2.2). Thus L.
monocytogenes rapidly invade the multicellular junctions of cell extrusion sites
following attachment and E-cadherin is seen associated with L. monocytogenes during
this process (Figure 2.6, Figure 2.7, Video 2.2)
56
Figure 2.6: Adhesion to Sites of Cell Extrusion
Polarized MDCK monolayers on Transwell filters were infected from the apical side
with wild type for 10 minutes. (A) Extruding cells were stained
with Sytox green prior to fixation. Antibodies to (red) were used to
visualize adhered bacteria, and anti-ZO-1 (blue) antibodies were used to visualize the
cell junctions. (B) Monolayers were stained with antibodies to
(green) and ZO-1 (red), and with toto-3 (blue), which illustrates missing nuclei at
adhesion sites. Scale bars 10 m.
57
Figure 2.7: E-cadherin Associated with at Multicellular Junctions
Frames from a movie of E-cadherin-RFP expressing MDCK cells (clone Ectd9)

infected with Wt-GFP . are internalized by 15-20
minutes and are associated with E-cadherin (inset, arrow heads) during invasion and
prior to lysis of the vacuole.
58
Video 2.2: L. monocytogenes Invasion at a Multicellular Junction
QuickTime fluorescence time-lapse movie of Wt-GFP L. monocytogenes invading E-

cadherin-RFP MDCK cells shown in Figure 2.7.
59
L. MONOCYTOGENES ADHERE TO TRANSIENTLY EXPOSED E-CADHERIN AT SITES OF CELL

EXTRUSION
We hypothesized that the molecular basis of apical adhesion might be E-cadherin
exposed at cell extrusion sites, since ΔinlA L. monocytogenes do not adhere to the
apical surface of polarized MDCK monolayers, whereas wild type and ΔinlB L.
monocytogenes adhere primarily at multicellular junctions. Non-permeabilized
polarized MDCK monolayers were incubated on the apical side with a monoclonal
antibody that detects the extracellular domain of E-cadherin (Gumbiner and Simons,
1986, 1987). Apical E-cadherin is readily detected at the multicellular junctions
associated with cells in the process of extrusion (Figure 2.8A) as well as at
multicellular junction sites where an extruded cell has already been lost (Figure 2.8B).
Adhered L. monocytogenes are commonly found over regions of apical E-cadherin
exposure at cell junctions (Figure 2.8C). Furthermore, incubating polarized MDCK
monolayers in low calcium medium, which disrupts the intercellular junctions,
increases L. monocytogenes adherence to the epithelium specifically at intercellular
regions where E-cadherin is exposed (Figure 2.9) (Gaillard and Finlay, 1996; Temm-
Grove et al., 1994).
To confirm that the receptor for L. monocytogenes at multicellular junctions is E-

cadherin and not a novel InlA receptor, we blocked apical E-cadherin by pretreating
live MDCK monolayers with the anti-E-cadherin antibody, or the equivalent amount
of antibody for the apical glycoprotein gp135 as a control (Ojakian and Schwimmer,
1988). To ensure that equal amounts of anti-E-cadherin and anti-gp135 antibodies
were used, we determined the relative antibody concentrations using a quantitative dot
blot analysis of the antibody solutions (Figure 2.8D). The anti-E-cadherin antibody,
which only stains multicellular junctions, blocks adhesion by 70%. In contrast, the
anti-gp135 antibody, which decorates the entire apical surface, has no effect on L.
monocytogenes adhesion (Figure 2.8D and 2.8E). These results suggest that there
exists a temporal window of junctional reorganization during cell extrusion that
transiently exposes E-cadherin for adhesion of L. monocytogenes.
60
Figure 2.8: Attachment to Accessible E-cadherin at Multicellular

Junctions of Cell Extrusion Sites
(A-B) Polarized MDCK monolayers on Transwell filters were incubated with Sytox
green prior to fixation. Monolayers were left unpermeabilized and stained from the
apical side with an antibody to the extracellular domain of E-cadherin (red) and with
phalloidin to visualize the F-actin cytoskeleton (blue). (A) A site with a cell in the
process of extrusion. (B) A site where extrusion has been completed. (C) Polarized
MDCK monolayers on Transwell filters were infected from the apical side with
for 10 minutes then stained from the apical side with antibodies to
(green) and E-cadherin (red) without permeabilizing the sample. (D)
Polarized MDCK monolayers on Transwell filters were pretreated with anti-gp135 or
anti-E-cadherin antibodies then infected with for 5 minutes. Means
and standard deviations of the number of adhered per 1000 cells
from triplicate samples are shown. The E-cadherin antibody-treated sample group is
significantly different: one-way analysis of variance p=0.0004. Bonferroni t test Mock
versus gp135 p>0.05; Mock or gp135 versus E-cadherin p<0.001. Shown below the
bar graph, blocking antibody concentrations were normalized using a fluorescence-
based dot-blot analysis ([Ab] Dot-blot). (E) Confocal immunofluorescence images
show the localization of the blocking antibodies (red), adhered
(green) and the F-actin cytoskeleton (blue). Scale bars 10 m.
61
L. MONOCYTOGENES DETECTS JUNCTIONAL REMODELING AND LOSS OF CELL POLARITY
We hypothesized that the interaction between Internalin A and E-cadherin makes L.

monocytogenes a specific probe of epithelial polarity since L. monocytogenes invades
efficiently through the basal side of polarized MDCK monolayers and since Apical
invasion occurs specifically at sites where E-cadherin becomes exposed. Although the
molecular mechanism had not been determined, prior studies support this hypothesis
since Listeria have an affinity for the basolateral edges of islets of cells, since invasion
of the apical side of polarized epithelial cells decreases with epithelial monolayer
maturity and increased epithelial polarity and since disruption of epithelial junctions
by calcium depletion increases Listeria attachment and subsequent invasion (Gaillard
and Finlay, 1996; Temm-Grove et al., 1994).
To test whether removal of calcium from polarized MDCK monolayers would result
in loss of polarity and thus increase L. monocytogenes association, MDCK monolayers
were incubated in low calcium medium (0.5 µM Ca2+) for 30 minutes, then returned to
DMEM (1.8 mM Ca2+) and infected on the apical side with an MOI of 140:1 L.
monocytogenes per cell. Samples were either fixed for immunofluorescence confocal
microscopy analysis or were lysed in PBS 1% saponin, dispersed and plated on BHI-
agar to determine the number of attached L. monocytogenes by colony forming units
(CFUs). The attachment of L. monocytogenes to monolayers pretreated with low
calcium medium is significantly greater than attachment to mock treated (plain
DMEM) monolayers (Figure 2.9A, p<0.001). Treatment of MDCK monolayers with
low calcium medium for short periods of time begins to open some junctions and L.
monocytogenes associate with junctions that had disrupted and punctate staining of the
tight junction protein ZO-1 (Figure 2.9B). Furthermore, Listeria attachment occurs at
junctional regions where, in the absence of permeabilization of the fixed monolayer,
accessible E-cadherin was exposed for staining with an antibody to the extracellular
region (antibody rr1, Figure 2.9C). Thus L. monocytogenes can detect gross changes in
monolayer polarity and junctional integrity.
We hypothesized that L. monocytogenes could also detect alterations in cell polarity at

a singe cell level. Our lab showed that the H. pylori protein CagA expressed from a
62
transfection construct in MDCK cells disrupts the fence and barrier function of
epithelial junctions resulting in apical exposure of E-cadherin (Bagnoli et al., 2005).
To test whether Listeria could serve as a probe for the loss of polarity induced by
CagA, we infected MDCK monolayers transfected to express GFP-CagA (Figure
2.10A) or GFP as a control (Figure 2.10B) or and then infected the monolayers with L.
monocytogenes for 5 minutes to analyze the adhesion sites. L. monocytogenes readily
attach to GFP-CagA-expressing cells, but not GFP expressing cells or the surrounding
untransfected polarized MDCK cells. Thus L. monocytogenes is a sensitive probe for
junctional integrity at a single cell level in the absence of global loss of junctional
integrity.
We hypothesized that the extracellular domain of E-cadherin fused to a

glycosylphosphoinositol (GPI) anchor would be expressed on the apical surface
without junctional perturbation since GPI-anchored proteins are enriched in the apical
membranes of polarized epithelial cells (e.g. Gp135, Figure 2.8E) and since GPI
fusion proteins are exported to and retained at the apical surfaces of MDCK cells
(Lisanti et al., 1990). To test whether Listeria could detect apically-expressed E-
cadherin, we expressed E-cadherin-Fc-GPI in polarized MDCK cells and infected
them with GFP Expressing Listeria for 10 minutes (Figure 2.10C). As a control, we
expressed E-cadherinP16E-Fc-GPI, a variant with a single amino acid substitution that
abrogates the InlA-E-cadherin interaction (Figure 2.10D) (Lecuit et al., 1999). L.
monocytogenes readily attach to MDCK cells expressing E-cadherin-Fc-GPI, but not
to cells expressing E-cadherinP16E-Fc-GPI, and apical expression of E-cadherin does
not disrupt the epithelial junctions.
63
Figure 2.9: Increased E-cadherin Exposure and Adhesion in

Calcium Depleted MDCK Monolayers
Polarized MDCK monolayers were untreated (Control) or incubated in low calcium

medium (Low Ca2+) prior to apical infection with Wt at an MOI of
140:1 for 10 minutes. (A) Adhesion was determined by dispersion and plating for
colony forming units (CFU). Means and standard deviations of CFU / 1000 cells from
triplicate samples are shown. Sample groups are significantly different: unpaired t-test
p<0.001. (B) Region of a low Ca2+ monolayer stained for (green)
and ZO-1 (red). (C) Region of a low Ca monolayer left unpermeabilized and stained
2+
for (green) and E-cadherin (red). Scale bars 10 m.

64
Figure 2.10: Adherence to Single Cell Polarity Defects
(A-B) 3-day polarized MDCK monolayers on Transwells were transfected with

expression constructs for CagA-GFP (A) or GFP (B) and after 24h expression were
infected with for 5 minutes. (C-D) 1-day polarized MDCK
monolayers on Transwells were transfected with expression constructs for E-cadherin-
Fc-GPI (C) or E-cadherinP16E-Fc-GPI (D) and after 24h expression were infected
with GFP-expressing for 10 minutes. Scale bars 10 m.
65
DISCUSSION
Many pathogenic microbes preferentially interact with constituents of basolateral

epithelial cell membranes for invasion (Sousa et al., 2005b; Vogelmann et al., 2004).
For example, the parasite Toxoplasma gondii somehow breaches the tight junctions to
migrate between cells (Barragan et al., 2005). Rotaviruses bind integrins, a class of
adhesion and signaling molecules found solely on the basolateral sides of enterocytes
(Guerrero et al., 2000). The bacterium Shigella flexneri, like Listeria monocytogenes,
preferentially invades the basolateral membranes of polarized epithelial cells (Gaillard
and Finlay, 1996; Mounier et al., 1992). Paradoxically, the basolateral aspect of
epithelial cells is not readily accessible to most microbes. In addition to the
mechanical clearing mechanisms and immune defenses of the lumenal compartment,
the tight junctions of epithelia restrict access to the basolateral membrane domain.
Some pathogens have evolved mechanisms to undermine, modify or bypass the
epithelial tight junctions. For example, Vibrio cholerae secretes a protease that can
degrade the tight junction protein occludin (Wu et al., 2000). Helicobacter pylori and
enteropathogenic E. coli disrupt the junctions from the inside-out by injecting effector
proteins into epithelial cells (Amieva et al., 2003; Dean and Kenny, 2004). Yersinia
circumvent the tight junctions of enterocytes by accessing β1-integrin receptors
exposed on the apical surface of M-cells (Autenrieth and Firsching, 1996; Clark et al.,
1998; Isberg and Leong, 1990; Isberg et al., 1987; Marra and Isberg, 1997). In this
chapter we asked how L. monocytogenes gains access to its basolateral receptors E-
cadherin and c-Met in an intact epithelium since this bacterial pathogen is not known
to actively disrupt the epithelial tight junctions.
We found that L. monocytogenes is able to invade a polarized epithelium from the

apical side essentially only at vulnerable points formed by extrusion of senescent cells.
As the first step of invasion, L. monocytogenes adhere almost exclusively over
multicellular junctions and adhesion is dependent on expression of Internalin A (InlA),
suggesting that its receptor is available at these junctions. Indeed, when we pretreated
the apical side of monolayers with an anti-E-cadherin blocking antibody, adhesion was
66
significantly reduced, demonstrating that L. monocytogenes does access E-cadherin at

junctional sites.
How does L. monocytogenes encounter E-cadherin across the tight junctions? It has
been hypothesized that L. monocytogenes could breach the junctions though the
activation of c-Met by InlB, since c-Met signaling modulates junction assembly
(Balkovetz et al., 1997; Cossart et al., 2003; Grisendi et al., 1998). However, we found
that active disruption of the junctions was not necessary, since attachment occurs
rapidly, since an inlB-mutant was not impaired for adhesion, and since E-cadherin is
transiently exposed apically at normally occurring multicellular junction sites.
Multicellular junctions represent only 2% of all junctions in a monolayer but are the
sites of adhesion for 74% of all L. monocytogenes. Interestingly, invasion is even more
specific for these sites than adhesion, since foci of intracellular L. monocytogenes are
associated with multicellular junctions 97% of the time. These data compelled us to
determine the nature of the multicellular junctions susceptible to L. monocytogenes
invasion, identifying them as sites of apoptotic cell extrusion. During this process,
senescent cells are released apically while the adjoining cells rapidly move in to seal
the epithelial defect (Corfe et al., 2000; Rosenblatt et al., 2001), forming a
multicellular junction that persists for many hours.
Biochemical studies have shown that both tight junction proteins and adherens
junction proteins are degraded in apoptotic cells, which may facilitate their
detachment from neighboring cells (Bojarski et al., 2004; Keller and Nigam, 2003;
Schmeiser and Grand, 1999; Steinhusen et al., 2001). Junctional remodeling creates a
transient breach of the epithelial barrier, as it has been shown that cell extrusion
produces localized defects in transepithelial electrical resistance (Gitter et al., 2000).
We also documented junction remodeling and disruption, since the tight junctions at
extrusion sites are reorganized basally in a funnel-like shape and since E-cadherin is
exposed at these sites. These structural rearrangements render the multicellular
junctions susceptible to apical invasion by L. monocytogenes. The sites of L.
monocytogenes attachment to polarized monolayers are spatially closely associated
with tight junctions, as marked by the scaffolding protein ZO-1. Previous work using
67
freeze fracture and electron microscopy has shown that the tight junction strands
surrounding extruding cells are in the process of being remodeled (Madara, 1990).
Several possibilities exist to explain the availability of E-cadherin to L.
monocytogenes at these sites. For instance, tight junction strand remodeling could
result in a local loss in fence function, and localization of E-cadherin above the tight
junctions. Alternatively, the process of tight junction formation and remodeling may
involve interactions between tight junction proteins, the scaffolding protein ZO-1, and
the E-cadherin complex that could result in E-cadherin exposure on the apical surface
(Rajasekaran et al., 1996).
We have shown the utility of L. monocytogenes as a sensitive probe for cell polarity in
relation to E-cadherin subcellular localization. We used L. monocytogenes to detect
the perturbation of polarity by Helicobacter pylori CagA. Interestingly, CagA,
associated with gastric cancer, has been called a prokaryotic oncoprotein
(Hatakeyama, 2003a, b). Indeed, it has recently been shown to function as a
prokaryotic mimic of the eukaryotic Gab adaptor protein in the Shp-2 signaling
pathway, which is involved in regulation of polarity and is disregulated in many
cancers (Botham et al., 2008). Furthermore, E-cadherin expression and polarity is
aberrant in many tumor types. Although these experiments do not represent the natural
biology of L, monocytogenes infection, they highlight a use of L. monocytogenes as a
tool for cell biological studies of cell polarity and cancer biology; Listeria may be
used to test the effects on polarity of other putative polarity genes/polarity proteins or
oncogenes/oncoproteins expressed in polarized cells.
Since E-cadherin is naturally exposed at extrusion sites in polarized MDCK

monolayers, we hypothesize that other basolateral proteins also become exposed at
extrusion sites in polarized MDCK monolayers (in Chapter 4 we will discuss how
InlB targets its receptor Met at these specific sites). Since numerous microbes utilize
basolateral proteins to interact with or invade epithelial cells we believe that cell
extrusion sites will prove to be utilized by other pathogens as a general mechanism for
accessing basolateral receptors. For example, preliminary results from our lab suggest
that the Yersinia enterocolitica Invasin protein, which binds β1-integrin receptors,
68
targets the bacterium to cell extrusion sites in polarized MDCK cells (unpublished
observations) and co-infections of L. monocytogenes and ΔyadA Y. enterocolitica
(inv+) show binding of both bacteria at the same junctional sites (Brooke Lane, Lee
Shaughnessy, personal communication). Invasion of cell extrusion sites in polarized
MDCK monolayers suggests that L. monocytogenes invasion and translocation of the
small intestine might occur at the apical tips of the intestinal villi, where enterocytes
apoptose and are expelled into the intestinal lumen by a normal mechanism of cell
extrusion. However, this model contradicts the long-standing assumption that L.
monocytogenes breach the intestinal tract by way of Peyer’s patches (Jensen et al.,
1998; MacDonald and Carter, 1980; Marco et al., 1992; Pron et al., 1998). In chapter 3
we test these competing models and investigate whether L. monocytogenes also targets
extrusion sites in vivo.
69
CHAPTER 3 : INTERNALIN A TARGETS L. MONOCYTOGENES TO THE

VILLUS TIP EXTRUSION ZONE
Mickey Pentecost performed the experiments with assistance from Glen Otto (rabbit
ileal loop operation), Nafisa Ghori (TEM sample preparation), and from Patrick
Eimerman and Jonathan Hardy (bioluminescence imaging experiments). Portions of
this chapter are in preparation for publication. Portions of this chapter were published
in (Pentecost et al., 2006).
INTRODUCTION
Listeria monocytogenes, a Gram-positive, facultative intracellular bacterial pathogen,

is a source of human food-borne illness (Mead et al., 1999; Vazquez-Boland et al.,
2001). It was first discovered as a causative agent of septicemia in rabbits (Murray et
al., 1926). In humans it causes a range of clinical manifestations from asymptomatic
intestinal carriage and gastroenteritis to invasive and disseminated disease.
Septicemia, meningoencephalitis and infection of the fetus in pregnant women are the
most serious manifestations of Listeriosis (Vazquez-Boland et al., 2001). The
gastrointestinal tract is the primary site of entry for pathogenic Listeria species, and
contaminated food is the major source of infection in both epidemic and sporadic
cases (Farber and Peterkin, 1991; Pinner et al., 1992). After invasion of the small
intestine, L. monocytogenes can spread to and infect the liver, spleen, central nervous
system and, in pregnant women, the placenta (Vazquez-Boland et al., 2001).
The anatomical site and the mechanism by which L. monocytogenes breaches the
intestinal epithelial barrier are controversial. In mice, L. monocytogenes invasion and
replication within the gastrointestinal tract is independent of InlA and is restricted to
the Peyer’s patches, suggesting a predominant role for specialized phagocytic M-cells
in bacterial uptake (Jensen et al., 1998; Lecuit et al., 1999; Lecuit et al., 2001;
MacDonald and Carter, 1980; Marco et al., 1992). Similarly in rats, intestinal
70
translocation rates are low and independent of the inlAB locus, suggesting a passive
process that does not involve InlA or InlB (Pron et al., 1998). However, mice and rats
are not natural hosts for L. monocytogenes. Furthermore, mouse and rat E-cadherin
differ from human E-cadherin at an important amino acid residue that renders cells
resistant to InlA-mediated invasion (Lecuit et al., 1999). In contrast, L. monocytogenes
can directly invade enterocytes in guinea pigs, which are naturally susceptible to
Listeriosis (Lecuit et al., 2001; Racz et al., 1972). In transgenic mice, enterocytes
expressing human E-cadherin are also susceptible to invasion by L. monocytogenes
(Lecuit et al., 2001).
In Chapter 2, we demonstrated that Listeria target sites of altered cell polarity or

junctional integrity in a model polarized epithelial monolayer. These sites occur
naturally where senescent cells are extruded from the epithelium. The surrounding
cells deform and extend centrally/radially to maintain epithelial continuity with a
central multicellular junction joining them. L. monocytogenes takes advantage of this
temporal window of junctional reorganization that exposes E-cadherin. These studies
suggested that L. monocytogenes targets an analogous site in vivo.
In the small intestine enterocytes are generated within the crypts and migrate up the
lateral sides of the villi (Babyatsky and Podolsky, 2003). The apex of the villus is
defined as the extrusion zone, where enterocytes undergo programmed cell death and
expelled into the intestinal lumen (Babyatsky and Podolsky, 2003; Sancho et al.,
2004). Therefore, in contrast to an MDCK epithelium, where cell extrusion occurs
throughout the monolayer (~15 sites / 1000 cells in 4-day polarized monolayers), cell
turnover in vivo is temporally and spatially regulated. We hypothesized that L.
monocytogenes would specifically target the tips of small intestinal villi through the
interaction of Internalin A with E-cadherin. We first tested this hypothesis by infecting
Rabbit ileal loops and examined the sites of Invasion by immunofluorescence confocal
microscopy and transmission electron microscopy.
We sought to develop a mouse infection model to test the hypothesis that L.

monocytogenes invade the villous tips after oral infection and to determine the
71
contribution of Peyer’s patches to Listeria infection of the mammalian small intestine.

The murine model of systemic Listeriosis is one of the best-studied bacterial infections
and mice have been used as an important model to study Listeriosis, especially the
innate and adaptive components of immunity that are important in controlling
systemic Listeriosis following intravenous or intraperitoneal inoculation (Pamer,
2004). However, the intestinal phase of invasion has lagged behind in these studies,
since mice infected intragastrically with L. monocytogenes are very resistant to
infection due to the inability of InlA to bind murine E-cadherin (Lecuit et al., 1999;
Lecuit et al., 2001).
We mutated the Internalin A (inlA) gene of Listeria to enhance the ability of InlA to
bind murine E-cadherin to create a “mouse-adapted” L. monocytogenes. We developed
InlA variants that promoted infection of murine cells and mouse intestine. Another
group arrived at a set of mutations in InlA that fully reconstitute binding of murine E-
cadherin (InlAm) (Wollert et al., 2007b). We used InlAm expressing L. monocytogenes
to confirm that InlA targets Listeria to the intestinal villous tips during oral infection.
72
Bacterial strains and culture conditions. 10403S, a wild-type (Wt) L.

monocytogenes strain, and the isogenic mutant strains DP-L4405 (ΔinlA) were kindly
provided by Dr. Daniel A. Portnoy (University of California, Berkeley, California) and
have been described previously (Bakardjiev et al., 2004; Skoble et al., 2000). GFP-
expressing 10403S strain DH-L1039 (Wt-GFP) was kindly provided by Dr. Darren E.
Higgins (Harvard University, Boston, Massachusetts) and has been described in
(Agaisse et al., 2005; Shen and Higgins, 2005). JAT-395, 10403S that expresses
monomeric red fluorescent protein fused to ActA (ActA-RFP) has recently been
described (Rafelski and Theriot, 2005). Listeria strain 2C (10403S flaA::Tn4001
luxABCDE kmR) has been described in (Hardy et al., 2004). L. monocytogenes were
grown on BHI-agar or in BHI-broth (BD/Difco, San Jose, California) supplemented
with streptomycin at 200 μg/ml, chloramphenicol at 7.5 μg/ml or erythromycin at 5
μg/ml, when appropriate. One-shot Top10 E. coli (Invitrogen), used for general
cloning steps, was cultured in LB broth and on LB agar supplemented with kanamicin
at 50 μg/ml or choramphenicol at 25 μg/ml, when appropriate. E. coli strain SM10
(λpir) was kindly provided by Dr. Denise Monack (Stanford University, Stanford,
California). E. coli SM10 (λ pir), used for conjugation reactions, was cultured in LB
supplemented with kanamicin at 30 μg/ml and chloramphenicol at 25 μg/ml, when
appropriate.
Generation of L. monocytogenes strains expressing Internalin A variants, GFP

and luciferase. The tRNAARG site-specific shuttle integration vectors pPL2 and pPL3,
which confer chloramphenicol resistance to Listeria, and pPL3e, which confers
erythromycin resistance to Listeria, were the kind gift of Dr. Daniel Portnoy (U.C.
Berkeley) and Dr. Darren E. Higgins (Harvard University, Boston, Massachusetts).
Listeria strain DH-L1039 expresses GFP under the control of the Hyper-SPO1
promoter fused to the 5’ UTR of hly (pHyperSPO1-hly5’UTR-GFP). Genomic DNA
was prepared from DH-L1039 using a Qiagen Tissue Kit. Using PFU Hot-start High
Fidelity polymerase and primers 37/33, the pHyperSPO1-hly5’UTR-GFP construct
73
was PCR amplified, gel purified and ligated into pCR4-BluntTOPO to generate
pMP71. pMP71 was subsequently sequenced (by Sequetech) using primers T3 and T7.
pHyperSPO1-hly5’UTR-GFP from SalI digested pMP71 was ligated with SalI
digested pPL3 and pPL3e to generate pMP74 and pMP76, respectively.
The L. monocytogenes inlA (~ -700 bp, including all promoters and ribosomal binding
site, to +180 bp) was PCR-amplified from 10403S Genomic DNA using PFU Hot-
start High Fidelity polymerase and primers 1/2. Note, this primer pair has been used
previously to amplify and reconstitute InlA expression in Listeria (Bakardjiev et al.,
2004). inlA was subcloned into pCR4-BluntTOPO to generate pMP2 and the sequence
was verified using primers T3, T7, 4, 5, 22, and 23. Quickchange site-directed
mutagenesis (Stratagene) was used with the primers listed in Table 3.1 to introduce
specific mutations of inlA in pMP2, which were subsequently sequence with primers
T3, T7, 4, and 5. Wt inlA or mutated inlA variants were digested with BamHI and
ligated with BamHI digested pPL2, pMP74 or pMP76. These constructs, as well as
pMP74, pMP76, were transformed into SM10 (λpir), and introduced to DP-L4405
(ΔinlA) by conjugative mating as described (Table 3.2) (Lauer et al., 2002). Genomic
DNA was isolated from Listeria strains with a Qiagen tissue kit and site specific
vector integration was confirmed by PCR with primers NC16/PL95 as described in
(Lauer et al., 2002). Briefly, recipient L. monocytogenes were grown in BHI overnight
at 30˚ C and donor SM10 (λpir) strains were grown in LB cm 25 µg/ml km 30 µg/ml
overnight at 30˚ C. Strains were back-diluted 1:50 in BHI for Listeria and LB cm 25
µg/ml and grown at 30˚ C for 2h. Swinnex 25 filter holders (Millipore, SX0002500)
were assembled with 25 mm 0.45 µm-pore type HA filters (Millipore, HAWP02500)
and 25 mm silicone gaskets (Millipore, SX0002501) and attached to a Lauer lock 12
cc syringe. The filters were washed with 10 ml BHI and 2.5 ml of each donor and
recipient were mixed and filtered. The filter was washed with 10 ml BHI, removed
from the filter holder and incubated bacterial side up on BHI plates at room
temperature for 45 minutes and then transferred to 30 ˚C for at least 45 minutes.
Bacteria were resuspended from the filter by pipeting with 1 ml BHI. 25 µl of the
resuspended bacterial solution was added to 3 ml of melted top agar (LB 7.5% agar) at
74
42 ˚C and poured evenly over the surface of BHI-agar chloramphenicol 7.5 µg/ml
streptomycin 200 µg/ml or BHI erythromycin 5 µg/ml streptomycin 200 µg/ml plates
and incubated at 37 ˚C for 1-2 days. Reconstitution of InlA expression was confirmed
by Western analysis of Listeria lysates with anti-InlA antibodies (1:5000, CLP011AP;
Cedarlane Laboratories, Ontario, Canada; Chapter 4 and Chapter 5). GFP expression
was verified by epifluorescence microscopy of Listeria cells. Listeria strains were
made bioluminescent by transduction of flaA::Tn4001 luxABCDE kmR from donor
strain 2C as described in (Hardy et al., 2004).
Cell culture and infection. MDCK II/G cells were kindly provided by Dr. W. James
Nelson (Stanford University, Stanford, California). MDCK and GSM06 cells were
maintained at 37°C in 5% CO2 atmosphere in DMEM (Gibco, San Diego, California)
supplemented with 10% fetal bovine serum (FBS, Gibco). For experiments, cells were
trypsinized and seeded on 12 well polycarbonate tissue culture dishes. Bacterial cells
were harvested at 10,000g for 1 minute and resuspended to 0.5 OD600 (7x108 CFU/ml)
in room temperature DMEM. Immediately prior to infection, MDCK cells were
transferred to 37°C DMEM. L. monocytogenes were added to cells at a multiplicity of
infection (MOI) of 100:1 bacteria per cell and were allowed to adhere for 10 minutes
at 37°C in 5% CO2 atmosphere. This point was considered time 0:00 for all analyses.
Invasion of cells was allowed to proceed for 1 hour in DMEM at 37°C in 5% CO2
atmosphere (1:00). The media was replaced with DMEM containing 50 µg/ml
gentamicin and incubated for 20 minutes to kill extracellular L. monocytogenes (1:20).
At 1:20, monolayers were washed by pipeting with 3 changes of fresh 37°C DMEM to
remove gentamicin. Intracellular L. monocytogenes were recovered by lysing cells in
500 µl of PBS 1% saponin. Appropriate dilutions of the suspension were plated onto
BHI-agar for CFU determination.
L. monocytogenes infection of rabbit ileal loops. The animal experimental protocol

was reviewed and approved by the institutional animal care and use committee of
Stanford University. Methods for ileal loop preparation and inoculation were modified
from previous descriptions (Burrows and Musteikis, 1966; De and Chatterje, 1953). A
New Zealand White rabbit weighing 2 kg was fasted for 36 hours prior to surgery.
75
After pre-medication with an intramuscular (IM) injection of glycopyrrolate (0.02

mg/kg), anesthesia was induced with ketamine (40 mg/kg IM) and xylazine (5 mg/kg
IM). An intravenous catheter was placed to allow fluid administration during the
surgery (20 ml/kg/hr lactated Ringer's solution), an endotracheal tube was placed, and
anesthesia was maintained using isoflurane gas. A midline celiotomy was performed
to expose the bowel. The ileocecal junction was identified, and the ileum was double
ligated with silk ties just proximal to the sacculus rotundus. A series of ligated loops
were then prepared starting with the terminal ileum and working retrograde along the
small intestine with particular care taken to preserve the vasculature and keep the gut
moist. Infected loops ranged in length from 4.5-5 cm in length. A non-inoculated
"spacer" loop of 2-3 cm was left between all inoculated loops. Loops were stretched
and measured after preparation and then inoculated with 4x107 CFU/ml of Wt-GFP or
4x108 CFU/ml Wt-GFP, Wt, ΔinlA, ActA-RFP L. monocytogenes in BHI broth using a
25-gauge needle to a volume of 0.1 ml per cm of loop to provide a uniform initial
distention. After inoculation, the small intestine was returned to its normal anatomic
position and the abdominal and skin incisions were sutured closed. Isoflurane
administration was discontinued and the animal was moved to a recovery area and
placed on a warm-water heating pad. The endotracheal tube was removed when the
animal regained consciousness, and pain control was provided by the administration of
hydromorphone post-operatively at a dose of 0.2 mg/kg IM, which was repeated every
2 hours as needed. At the planned endpoint of 4 hours post-inoculation, the animal
was euthanized with an intravenous overdose of pentobarbital. Individual loops were
harvested by incisions through spacer loops, and then opened, washed gently by
dipping in sterile saline, and fixed flat (lumenal side up).
L. monocytogenes infection of mouse ileal loops. C57BL/6 mice weighing 20-25g

were be fasted for 24 hours prior to surgery but allowed free access to water.
Anesthesia was induced by intraperitoneal injection with a mixture of ketamine (40
mg/kg) and xylazine (4-5 mg/kg) in water and the animal was kept on a 37 ˚C pad for
the duration of the procedure. For each mouse a midline celiotomy was performed to
expose the bowel. The ileocecal junction was identified, and the ileum was ligated
76
with a silk tie just proximal to the cecum. A second circumferential ligature placed 4-5
cm proximal. A suspension of ~108 Listeria in DMEM was inoculated via a
hypodermic needle into the loop serving as an experimental incubation chamber. The
intestine was returned to the abdominal cavity and the incision was closed with small
surgical staples. The mouse was kept under anesthetic for 3 hours at which time the
mouse was euthanized with CO2 and the intestines were removed. For
immunofluorescence analysis, the tissue was washed, fixed and prepared for confocal
microscopy as described above. For intracellular CFU recovery, the tissue was treated
with 50 µg/ml gentamicin in DMEM for 1h and then washed in DMEM 3X to remove
the antibiotic. The tissue was homogenized and plated on BHI agar with our without
7.5 µg/ml chloramphenicol. The competitive index of two strains was determined by
the following: C.I.= (Stain A output / Strain B output)/ (Stain A input / Strain B input).
Oral Infection, tissue CFU determination, and non-invasive bioluminescence

imaging of Mice. Listeria cultures were grown at 30˚ C overnight without agitation,
pelleted and resuspended in PBS at 5X109 CFU / ml. Female 8 week old BALB/c mice
were food restricted overnight and inoculated by gavage with a volume of 200 μl. An
IVIS Spectrum system (Xenogen Corp., Alameda, CA) was used for non-invasive
bioluminescence imaging of mice according to instructions of the manufacturer.
Briefly, at selected time point after inoculation, isoflurane gas anesthetic was
administered at 2% in oxygen using the Matrix system (Xenogen Corp.). The images
were obtained using an integration time of 5 min at a binning of 10 pixels. For tissue
homogenization and CFU determination, mice were euthanized with CO2 gas and
tissues, homogenized in 0.2% NP-40 substitute in water, were plated onto BHI 200
µg/ml streptomycin with either 7.5 µg/ml chloramphenicol or 5 µg/ml erythromycin
for competition experiments. The competitive index of two strains was determined by
the following: C.I.= (Strain A output / Strain B output)/ (Strain A input / Strain B
input).
Microscopy and antibodies. Tissue for transmission electron microscopy was

prepared as described in (Jones et al., 1994). For immunofluorescence microscopy,
samples were fixed with 2% paraformaldehyde in 100 mM phosphate buffer, pH 7.4
77
(15 minutes for cell monolayers, and 1 hour for tissues), and were permeabilized in
phosphate-buffered saline (PBS) 1% saponin 3% bovine serum albumin (BSA) or left
unpermeabilized by blocking samples and diluting antibodies/probes in PBS 3% BSA.
After incubation with appropriate antibodies/probes, samples were mounted with
Vectashield mounting medium (Vector Laboratories, Burlingame, California) and
imaged with a confocal microscope (Bio-Rad, Hercules, CA). For visualization of
intestinal villi, we mounted intact tissue blocks and imaged the stained tissues without
prior embedding and sectioning. The samples were imaged by confocal microscopy
where optical sections were taken at 0.5 µm resolution through both the cell
monolayers and the intestinal villi. Z-stacks were reconstructed into three-dimensions
using Volocity software (Improvision, Lexington, Massachusetts). Figures were
assembled with Photoshop software (Adobe, San Jose, California).
L. monocytogenes were detected by incubation of samples with Listeria O antisera

(rabbit) poly types 1 & 4 (BD/Difco, San Jose, California 1:600 dilution). Tight
junctions were detected by incubating samples with mouse anti-ZO-1 antibodies
(Zymed, South San Francisco, California 1:300 dilution, and see (Vogelmann and
Nelson, 2005). E-cadherin was detected with mAB anti-Ecadherin (Transduction
Labs, 1:600 dilution). Anti-IgG Alexa-fluor conjugated antibodies of appropriate
species reactivity and fluorescence spectra were used for secondary detection
(Molecular Probes, Eugene, Oregon). Actin was visualized by incubating samples with
Alexa-fluor conjugated phalloidins (Molecular Probes). To visualize all nuclei,
permeabilized samples were incubated with toto-3 or TOPRO-3 (Molecular Probes).
To visualize senescent cells, live samples were incubated with Sytox Green
(Molecular Probes).
78
# Name Sequence (5' to 3') Purpose or Reference
T3 attaaccctcactaaaggg Anneals 5' of inserts in pCR4 Blunt-TOPO. Used for sequencing.
T7 taatacgactcactatagg Anneals 3' of inserts in pCR4 Blunt-TOPO. Used for sequencing.
Anneals ~700 bp 5' of inlA. Underlined BamHI site. (Bakardjiev et

1 InlA_Coding_Forward cgggatccaacgagccaaccgtgg
al., 2004)
Anneals ~ 180 3' of inlA. Underlined BamHI site. (Bakardjiev et al.,

2 InlA_Coding_Reverse cgggatcctctccgcttgtactttcgcc
2004)
4 InlA_seq_Forward ggagtatggattaacacgagcaa Anneals within inlA coding region. Used for sequencing.
5 InlA_seq_Reverse gtcattctcaaaggttgctgtgta Anneals within inlA coding region. Used for sequencing.
22 InlA_seq_Forward2 atgatttttcggatgcagg Anneals within inlA coding region. Used for sequencing.
23 InlA_seq_Forward3 attgactgaaccagctaagcc Anneals within inlA coding region. Used for sequencing.
6 InlA_R168S agatatagacccgcttaaaaatctaacaaatttaaatagcctagaactatctagtaacac Quickchange mutagenesis of inlA

7 InlA_R168S_antisense gtgttactagatagttctaggctatttaaatttgttagatttttaagcgggtctatatct Quickchange mutagenesis of inlA
8 InlA_R168S_E170G acagatatagacccgcttaaaaatctaacaaatttaaatagcctaggactatctagtaacacgatta Quickchange mutagenesis of inlA
InlA_R168S_E170G_
9 taatcgtgttactagatagtcctaggctatttaaatttgttagatttttaagcgggtctatatctgt Quickchange mutagenesis of inlA
antisense
10 InlA_E170G tctaacaaatttaaatcggctaggactatctagtaacacgattagtg Quickchange mutagenesis of inlA
11 InlA_E170G_antisense cactaatcgtgttactagatagtcctagccgatttaaatttgttaga Quickchange mutagenesis of inlA
12 InlA_Q190G gctttcaggtttaactaatctacagggattatcttttggtaatcaagtgaca Quickchange mutagenesis of inlA
InlA_Q190G_antisens
13 tgtcacttgattaccaaaagataatccctgtagattagttaaacctgaaagc Quickchange mutagenesis of inlA
e
14 InlA_Q190G_L191V cgctttcaggtttaactaatctacagggagtatcttttggtaatcaagtgacagat Quickchange mutagenesis of inlA
InlA_Q190G_ L191V_
15 atctgtcacttgattaccaaaagatactccctgtagattagttaaacctgaaagcg Quickchange mutagenesis of inlA
antisense
47 InlA_S192N gctttcaggtttaactaatctacagcaattaaattttggtaatcaagtgacaga Quickchange mutagenesis of inlA
48 InlA_S192N_antisense tctgtcacttgattaccaaaatttaattgctgtagattagttaaacctgaaagc Quickchange mutagenesis of inlA
49 InlA_Y369S gtttaacaaagcttcaaagattatttttcagtaataacaaggtaagtgacgtaagctcac Quickchange mutagenesis of inlA
50 InlA_Y369S_antisense gtgagcttacgtcacttaccttgttattactgaaaaataatctttgaagctttgttaaac Quickchange mutagenesis of inlA
Anneals 5' to tRNAARG in L. monocytogenes genome. (Lauer et al.,
27 NC16 gtcaaaacatacgctcttatc
2002)
Anneals within PSAint in pPL2, pPL3 and pPL3e. Used with NC16
28 PL95 acataatcagtccaaagtagatgc to verify pPL2, pPL3 and pPL3e plasmid integration. (Lauer et al.,
2002)
Anneals at 3' of transcriptional stop site of GFP. Used to amplify
33 salI_gfpmut2_reverse aggtcgacttatttgtatagttc GFP expression construct from DH-L1039. Underlined SalI site.
(Shen and Higgins, 2005)
Anneals at 5' of Hyper SPO1 promoter. Used to amplify GFP
37 #2_salI_pHYSPO1 ccgtcgacaattttgcaaaaagttgttgacttt
expression construct from DH-L1039. (Shen and Higgins, 2005)
Table 3.1: Oligonucleotides Used in Chapter 3

79
Strain Relevant Characteristics*
10403S Wild type (Wt) L. monocytogenes serotype 1/2a. smR

2C 10403S flaA::Tn4001 luxABCDE kmR (flaA-Lux kmR) (Hardy et al., 2004)
DH-L1039 Wt GFP, cmR (Shen and Higgins, 2005)
DP-L4405 10403S ∆inlA (Bakardjiev et al., 2004)
LM 46 ∆inlA + Vector (pPL2) cmR (this study)
LM 47 ∆inlA + inlA cmR (this study)
LM 48 ∆inlA + inlA R168S E170G Q190G, cmR (this study)
LM 49 ∆inlA + inlA R168S E170G Q190G L191V, cmR (this study)
LM 72 ∆inlA + inlA, GFP, cmR (this study)
LM 73 ∆inlA + inlA, GFP, emR (this study)
LM 74 ∆inlA + inlA R168S E170G Q190G, GFP, cmR (this study)
LM 78 ∆inlA + inlA R168S E170G Q190G Y369S, GFP, emR (this study)
LM 77 ∆inlA + inlA S192N Y369S, GFP, cmR (this study)
LM 89 ∆inlA + inlA S192N Y369S, GFP, emR (this study)
LM 82 ∆inlA + inlA, GFP, cmR, flaA-Lux kmR (this study)
LM 87 ∆inlA + inlA S192N Y369S, GFP, cmR, flaA-Lux kmR (this study)
Table 3.2: L. monocytogenes Strains Used in Chapter 3
*GFP, green fluorescent protein; smR, streptomycin resistant 200 µg/ml; cmR,
chloramphenicol resistant 7.5 µg/ml; emR, erythromycin resistant 5 µg/ml; kmR,
kanamycin resistant 30 µg/ml
80
RESULTS
L. MONOCYTOGENES INVADE MULTICELLULAR JUNCTIONS AT THE VILLUS TIP

EXTRUSION ZONE
We infected rabbit ileal loops with L. monocytogenes and examined the sites of in vivo
attachment and entry to test the hypothesis that L. monocytogenes invade the villous
tip extrusion zone (Chapter 2). This experimental system was used because rabbits are
natural hosts for L. monocytogenes, and rabbits have InlA-permissive E-cadherin
(Lecuit et al., 1999; Murray et al., 1926). Figure 3.1 shows 3-dimensional confocal
reconstructions of villi from a rabbit ileal loop infected with 4x107 CFU/ml of Wt-
GFP L. monocytogenes for 4 hours. By imaging multiple 40X fields, we estimate that
at least 50% of villi had L. monocytogenes associated with the villus tips (Figure 3.1B,
Video 3.1). Although L monocytogenes were embedded in the mucus above and
between villi, we did not find L. monocytogenes associated with the epithelium along
the lateral sides of the villi, or with cells of the intestinal crypts (Figure 3.1A and
3.2A). The same result was observed in ileal loops infected with Wt L. monocytogenes
that do not express GFP visualized with anti-L. monocytogenes antibodies (not
shown). We did not find L. monocytogenes associated with Peyer’s patches (Figure
3.2B), although there were L. monocytogenes associated with the tips of villi
surrounding Peyer’s patches (Figure 3.2C).
We determined that L. monocytogenes invasion preferentially occurs at the tips of the

intestinal villi, since intracellular bacteria could only be found at the villus tips after
the 4-hour infection (Figure 3.1A). Some intracellular L. monocytogenes had already
accumulated actin on their surface, indicating that they were viable and had escaped
from the internalization vacuole (Figure 3.1C). As an additional control for the
viability of internalized bacteria, we infected a rabbit ileal loop with a strain of L.
monocytogenes carrying a transgene with monomeric red fluorescent protein fused to
ActA (ActA-RFP) (Rafelski and Theriot, 2005). Since the ActA protein is expressed
only after bacteria enter the host cell cytoplasm (Freitag and Jacobs, 1999; Shetron-
Rama et al., 2002), these bacteria express ActA-RFP only after successful invasion
81
(Rafelski and Theriot, 2005). ActA-RFP-expressing L. monocytogenes were only

found at the tips of the villi (Figure S3D). ΔinlA L. monocytogenes at an inoculum of
4x108 CFU/ml failed to invade the epithelium (Figure 3.2E, Video 3.2).
We stained the infected intestinal tissues with anti-ZO-1 antibodies to determine

whether in vivo adhesion and invasion of L. monocytogenes also occurs at
multicellular junctions associated with extrusion. Adherent bacteria consistently
colocalized with junctional staining, and were commonly found at multicellular
junctions that occur in the extrusion zone of the villus tips (Figure 3.1E). Similar to
our results in MDCK cell cultures, staining for nuclei of enterocytes in the villi
revealed that L. monocytogenes readily associate with the junctions surrounding
extruding cells (Figure 3.1D). These results indicate that the sites of apoptotic cell
extrusion from an epithelium are uniquely permissive for L. monocytogenes invasion
in vivo as well as in tissue culture.
Figure 3.1: L. monocytogenes Invasion of the Intestinal Epithelium at the Villus-tip

Extrusion Zone (Following Page)
(A) Optical longitudinal section through a villus tip from Wt-GFP L. monocytogenes
infected rabbit intestinal tissue stained with phalloidin for F-actin (red) and with toto-3
for nuclei (blue). GFP-expressing bacteria are shown in green. (B) 3-dimensional
reconstruction of villus tips viewed from the lumenal side from tissue stained as in
(A). (C) Optical cross-section through 3-dimensional reconstruction of a villus tip
revealing intracellular L. monocytogenes (green). F-actin (red) is stained with
phalloidin. Right: enlarged view of infected cell revealing actin nucleation on the
surface of Wt-GFP L. monocytogenes. (D) 3-dimension confocal reconstruction of
villus tip from tissue stained with antibodies to ZO-1 (red) and with toto-3 for nuclei
(blue). Arrow indicates a cell being extruded. (E) 3-dimensional reconstruction of
infected villus tip stained with antibodies to ZO-1 (red), showing a multicellular
junction. Scale bars 10 µm.
82
83
Figure 3.2: Lack of Association of L. monocytogenes Invasion with the Intestinal

Crypts or the Peyer’s Patches; inlA-mutant is Noninvasive (Following Page)
(A) A rabbit ileal loop was infected with 4x107 CFU/ml of Wt L. monocytogenes
expressing GFP (Wt-GFP) for 4 hours. Optical sections through crypt-villus axis did
not reveal L. monocytogenes associated with the intestinal crypts (arrows). L.
monocytogenes were found at the tips of the villi (inset). Tissue was stained with
antibodies to ZO-1 (red) and with toto-3 for nuclei (blue). (B) A rabbit ileal loop with
a Peyer’s patch was infected with 4x108 CFU/ml of Wt-GFP L. monocytogenes for 4
hours. Tissue was stained with phalloidin for F-actin (red). L. monocytogenes were not
found associated with the follicle associated epithelium overlying the Peyer’s patch,
(C) but were found at the tips of adjacent villi. (D) A rabbit ileal loop was infected
with 4x108 CFU/ml of ActA-RFP L. monocytogenes for 4 hours. Red fluorescent
bacteria were only found within cells at the tips of the villi stained with phalloidin for
F-actin (blue). (E) A rabbit ileal loop was infected with 4x108 CFU/ml of ΔinlA L.
monocytogenes for 4 hours. Tissue was stained with antibodies to L. monocytogenes
(green), with fluorescent phalloidin for F-actin (red) and with toto-3 for nuclei. Optical
section through a 3-dimensional reconstruction of villus tips is shown. No intracellular
ΔinlA L. monocytogenes were found.
84
85
Video 3.1: Villus Tip Infected with Wild Type Listeria monocytogenes
QuickTime movie of a complete optical scan through a rabbit intestinal villus tip
infected with wild type-GFP L. monocytogenes (green), and counterstained with
phalloidin (red) to visualize the cytoskeleton and toto-3 (blue) to visualize nuclei.
86
Video 3.2: Villus Tip Infected with ΔinlA L. monocytogenes
QuickTime movie of an intestinal villus tip processed as in Video 3.1, but infected
with 10X the amount (4x108 CFU/ml) of ΔinlA L. monocytogenes (green) than shown
for wild type-GFP L. monocytogenes. Cells were counterstained with phalloidin (red)
to visualize the cytoskeleton and toto-3 (blue) to visualize nuclei.
87
ANALYSIS OF L MONOCYTOGENES INFECTION OF THE VILLOUS TIP EXTRUSION ZONE BY

TRANSMISSION ELECTRON MICROSCOPY
From the rabbit ileal loop infection experiment, we also prepared tissue for analysis by
transmission electron microscopy. Figure 3.3 and 3.4 show villous tips from a rabbit
ileal loop infected with 4x107 CFU/ml of Wt-GFP L. monocytogenes for 4 hours. Prior
to invasion L. monocytogenes are attached to the intercellular junctions (Figure 3.3,
3.1D. 3.1E). Interestingly, there is no evidence of an intact tight junction in the
electron micrograph shown in Figure 3.3. This is similar to immunofluorescence
confocal micrographs that show discontinuous ZO-1 staining at the tight junctions of
villous tip extrusion sites and L. monocytogenes often invading at subcellular sites
where ZO-1 is absent (Figure 3.1D, 3.1E). The absence of continuous tight junctions
at the villous tips may be due to the dynamic nature of cell extrusion sites and the
necessity for simultaneous breakdown and reformation of the junctions to allow the
extrusion of dying cells and maintain an epithelial barrier (see Chapter 2). Thus, L.
monocytogenes targets remodeling epithelial junctions in vivo.
Figure 3.4 shows multiple L. monocytogenes inside of an enterocyte at the villous tip.
This infected cell neighbors a cell undergoing apoptosis, which displays a loss of
brush border microvilli / loss of polarity, a condensed nucleus and vesiculated
cytoplasm. Note, there is no observable tight junction between the apoptotic cell and
its neighbors. The infected cell, which has multiple L. monocytogenes, may be pre-
apoptotic since its cytoplasm is also vesiculated and since the rate of cell extrusion
from mammalian villous tips is on the order of minutes (Babyatsky and Podolsky,
2003). It is interesting that invasion of cells neighboring apoptotic sites occurs, yet
invasion of apoptotic cells does not (Chapter 2, Figure 3.4). It is possible that
apoptotic cells are not readily bound by L. monocytogenes or that bound L.
monocytogenes are not internalized (Bojarski et al., 2004; Keller and Nigam, 2003;
Schmeiser and Grand, 1999; Steinhusen et al., 2001).
88
Figure 3.3: Associate with Intercellular Junctions Prior to Villus

Tip Invasion
(A) Wt-GFP associated with an intercellular junction at the rabbit

villous tip. (B) Inset in A. (C) Inset in B.
89
Figure 3.4: Infect Cells Adjacent to Apoptotic Cells at the Villous

Tip
(A-B) Sequential EM sections from an infected rabbit villous tip. (C) Inset in B. (D)
Inset in C.
90
RATIONAL DESIGN OF INTERNALIN A VARIANTS PREDICTED TO BIND MURINE E-

CADHERIN
We wanted to determine whether Internalin A promotes invasion of the villus tip

extrusion zone of orally infected mice. Mice are the most well studied mammalian
experimental model and the availability of transgenic and genetic knockout mice make
this model appealing for studying infectious disease. However, mice are not naturally
susceptible to oral Listeria since a single amino acid difference in murine E-cadherin
abrogate InlA binding and Listeria do not invade the intestinal epithelium (Lecuit et
al., 1999; Lecuit et al., 2001). We hypothesized that compensatory mutation of InlA
that allows for the E16 in murine E-cadherin would increase the binding of these
proteins. This is a crucial step towards generation of a mouse oral infection model
utilizing “mouse-adapted” Listeria. In collaboration with Brent Hamoaka and Partho
Ghosh (U.C. San Diego) we modeled an E-cadherin P16E mutation in silico using the
published InlA/E-cadherin X-ray crystal structure (Schubert et al., 2002), similar to
the model shown in Figure 1.4D. All of the rotamers of E16 exhibit steric clashes with
mainchain atoms in InlA β-strands that make up the leucine rich repeat (LRR).
WinCoot and O graphics interface software were used to model in favored rotamers
for the E16 sidechain. To stabilize the E16 rotamers with the least steric hindrance,
and to reduce the charge of the hydrophobic pocket a set of three compensatory
mutations were suggested by Brent Hamoaka: R168S, E170G, Q190G, Figure 1.4D.
An addition mutation of L191V was suggested. However, this mutation would alter
the LRR consensus sequence (Figure 1.4D).
MUTATIONS IN INTERNALIN DIFFERENTIALLY AFFECT THE TROPISM OF LISTERIA FOR

EPITHELIAL CELLS OF DIFFERENT SPECIES
We tested whether L. monocytogenes expressing InlA variants had altered invasion of
confluent monolayers of Madin Darby Canine Kidney (MDCK) epithelial cells or the
mouse gastric epithelial cell line GSM06. L. monocytogenes invasion of MDCK cells
is InlA dependent (Chapter 2) and it is likely that InlA has a similar affinity for canine
E-cadherin as for human E-cadherin. After 10 minutes of infection, the MDCK or
GSM06 monolayers were washed to remove non-adherent bacteria and the cell-
91
associated L. monocytogenes were allowed to invade the epithelium for 1 hour. Any
remaining extracellular bacteria were killed with gentamicin for 20 minutes, and
viable intracellular L. monocytogenes were quantified by lysing the cells in PBS 1%
saponin and plating the lysate on BHI-agar plates. L. monocytogenes expressing InlA
R168S E170G Q190G or InlA R168S E170G Q190G L191V have ~2 fold decreased
invasion of MDCK cells as compared to Wt InlA (p < 0.001) Figure 3.5A). This may
be due to a disruption of a hydrogen bond between R168 and E170 (Figure 1.4D).
However, these InlA variants promoted invasion of GSM06 cells by ~ 1 fold (Figure
3.5B). InlA R168S E170G Q190G promotes significant invasion compared to Wt InlA
(p < 0.001). The additional L191V mutation does not improve GSM06 invasion but
further decreases InlA mediated invasion of MDCK (Figure 3.5A).
Increased invasion of GSM06 cells by L. monocytogenes expressing InlA R168S

E170G Q190G is due to an increased adherence to GSM06 cells since attachment of L.
monocytogenes expressing this variant is also ~ 1 fold greater than L. monocytogenes
expressing Wt InlA (Figure 3.5C, None). Incubating GSM06 monolayers in calcium-
free PBS to disrupt the intercellular junctions increases InlA R168S E170G Q190G
mediated attachment (Figure 3.5C, 25 min no Ca). Furthermore, depletion of calcium
increases the attachment difference between L. monocytogenes expressing InlA R168S
E170G Q190G and L. monocytogenes expressing Wt. InlA from ~1 fold to ~3-4 fold.
L. monocytogenes expressing InlA R168S E170G Q190G are restored in the ability to
recruit E-cadherin to the endocytic cup during invasion of non-confluent GSM06 cells
(Figure 3.5D).
We infected mouse ileal-loops to determine whether InlA R168S E170G Q190G could
promote the invasion of L. monocytogenes in the murine intestine. At 3h post
infection, InlA R168S E170G Q190G expressing Listeria (green) have invaded the
villous tips (f-actin is red, nuclei are blue, Figure 3.6A). We infected ileal loops with
an equal ratio of Wt L. monocytogenes and L. monocytogenes expressing InlA R168S
E170G Q190G for 3h and then treated the tissue with 100 µg/ml gentamicin for 1 h to
kill extracellular L. monocytogenes. The gentamicin was removed by washes in
DMEM and CFUs were recovered by tissue homogenization. L. monocytogenes
92
expressing InlA R168S E170G Q190G outcompete Wt L monocytogenes for invasion

(Figure 3.6B) and are equally sensitive to gentamicin (Figure 3.6 C, C’).
As we were developing and characterizing these InlA mutations, another group

engineered a variant of L. monocytogenes strain EGD InlA (InlA S192N Y369S or
InlAm) that was found to have an equivalent binding affinity for mouse E-cadherin (Kd
= 10+/-2 μM) as Wild type InlA has for hE-cadherin (8+/-4 μM) (Wollert et al.,
2007a; Wollert et al., 2007b). The InlA proteins from L. monocytogenes strains EGD
and 10403S are the same length (801 amino acids), but differ by 7 amino acid
mismatches (98.9% similarity, 99.4% identity). L. monocytogenes expressing 10403S
InlA S192N Y369S have ~20-fold increase in invasion of murine cells (Figure 3.5B).
Note, this is roughly equivalent to the increase in invasion of due to Wt InlA over an
inlA-null mutant in MDCK cells (Figure 2.3A, Figure 3.5A). Thus the few amino acid
differences in InlA between strains do not affect the gain of function from S192N and
Y369S mutations. We added the Y369S mutation from InlAm to InlA R168S E170G
Q190G, generating InlA R168S E170G Q190G Y369S. Although this mutation did
not improve invasion of GSM06 cells, it restored invasion of MDCK cells to roughly
Wt levels (Figure 3.5A, 3.5B). Thus we have identified a number of mutations of InlA
that differentially affect binding of E-cadherin from different species.
93
Figure 3.5: Internalin Variants with Altered Tropism for Canine and Murine Cells
Various Internalin A mutations were expressed in . A)

Invasion of canine epithelial cells MDCK by InlA-variant expressing . B)
Invasion of mouse gastric epithelial cells GSM06 by InlA-variant expressing .
C) Attachment of Wt InlA-expressing and InlA R168S E170G Q190G expressing
to confluent GSM06 monolayers pretreated with DMEM (No treatment) or
Ca2+/Mg2+ -free PBS (25 min no Ca). D) InlA R168S E170G Q190G expressing
Listeria (red) recruit E-cadherin (green) at the site of attachment to GSM06 cells.
94
Figure 3.6: InlA R168S E170G Q190G Promotes Invasion of the Murine Intestine
(A) Optical longitudinal section through a villus tip from a mouse ileal loop infected
with InlA expressing InlA R168S E170G Q190G. The tissue was
stained with antibodies for Listeria (green), phalloidin for F-actin (red) and with topro-
3 for nuclei (blue). (B) Competitive index of Listeria invasion of mouse ileal loops.
Plotted is the intracellular CFU ratios of mutant versus wt from mouse ileal loops
infected with an equal mixture of InlA expressing InlA R168S
E170G Q190G (cmR) and Wt . (C) Sensitivity of Wt
to a gentamicin gradient strip. (C’) Identical sensitivity of InlA
expressing InlA R168S E170G Q190G (cmR) to a gentamicin gradient
strip.
95
INLA S192N Y369S (INLAM) PERMITS ORAL INFECTION OF MICE

We used in vivo bioluminescence imaging (BLI) to characterize the ability of InlAm to
promote L. monocytogenes infection of mice via the oral route. L. monocytogenes
expressing the Photorhabdus luminescens lux operon (luxABCDE) produce light
without the addition of exogenous substrate (luciferin) and bioluminescent L.
monocytogenes have been used to visualize infection after intravenous (IV) infection
(Francis et al., 2000; Hardy et al., 2004; Hardy et al., 2006; Riedel et al., 2007). We
complemented ΔinlA L. monocytogenes with either Wt InlA or InlAm and also made
these trains bioluminescent by phage transduction of flaA::Tn4001 luxABCDE kan
from donor strain 2C (Hardy et al., 2004). Strains were grown overnight to stationary
phase at 30 ˚C without agitation in BHI broth, pelleted, resuspended in PBS. Bacteria
were administered to mice by oral gavage with a feeding needle.
At a dose of 109 CFU, bioluminescent L. monocytogenes expressing InlAm produce an

infection confined to the gastrointestinal tract and mesenteric lymph nodes, observed
as a focal signal from the lower abdomen and confirmed by dissection and reimaging
of organs (Figure 3.7A, B). In the small intestine, signal is observed from regions with
or without Peyer’s Patches (Figure 3.7B). This signal represents replicative bacteria
since BLI signal is maximal from L. monocytogenes in logarithmic growth and since
the BLI signal from orally inoculated mice increases from day 1 to day 4 post-
infection (Figure 3.7A) (Hardy et al., 2004). At this dose, no mice die or develop
signal from the liver or spleen and the infection is cleared by 7 days (Figure 3.7A, B).
In contrast, bioluminescent L. monocytogenes expressing Wt InlA are largely cleared
from the gastrointestinal tract and fail to establish significant BLI signal in the mouse
(Figure 3.7A).
At a dose of 2x109 and higher, BLI signal from L. monocytogenes expressing InlAm are
seen in the spleen and from the gall bladder as well as the lower abdomen (also see
Chapter 4). Mice infected orally with very high doses of bioluminescent L.
monocytogenes expressing Wt InlA developed BLI signals in the spleen, gall bladder
or abdomen, and appeared distressed as indicated by ruffled fur (Figure 3.7C).
96
However, for any given dose (and at each time point) L. monocytogenes expressing
InlAm produced either greater BLI signal or greater lethality than L. monocytogenes
expressing Wt InlA (Figure 3.7D).
Figure 3.7: InlA S192N Y369S Reconstitutes Oral Infection in Mice (Following Page)
(A) 8 week old female BALB/c mice were infected with 109 ΔinlA L. monocytogenes
expressing either Wt InlA, GFP and flaA::Lux (Wt InlA), or InlAm, GFP and flaA::Lux
(InlAm) and Imaged with an IVIS spectrum system at the indicated time points post-
infection. (B) Organs from InlAm infected mice were reimaged on days 2-4. (C) 8
week old female BALB/c mice were infected with 7X109 ΔinlA L. monocytogenes
expressing either Wt InlA, GFP and flaA::Lux (Wt InlA), or InlAm, GFP and flaA::Lux
(InlAm) and Imaged with an IVIS spectrum system at the indicated time points post-
infection. (D) 8 week old female BALB/c mice were infected with 3.5X1010 ΔinlA L.
monocytogenes expressing either Wt InlA, GFP and flaA::Lux (Wt InlA), or InlAm,
GFP and flaA::Lux (InlAm) and Imaged with an IVIS spectrum system at the indicated
time points post-infection. Mice marked with an X died on the given day. The scale
bars indicate pseudocolor representation photons/second/cm2/steradian from a 5-
minute exposure with a binning of 10.
97
98
INLAM SPECIFIES INVASION OF THE VILLUS TIPS, BUT NOT OF PEYER’S PATCHES
We examined the sites of L. monocytogenes invasion of the intestine to test the
hypothesis that Listeria invade the villus tip extrusion zone after oral infection as seen
in our rabbit ileal loop infection. At early time points after infection, L.
monocytogenes expressing InlAm and GFP, but not L. monocytogenes expressing Wt
InlA and GFP are readily found in the enterocytes at the tips of villi in the distal ileum
(Figure 3.8A). Only sporadic villi were infected. Few villi in the jejunum and no villi
in the duodenum were found with Listeria. L. monocytogenes in the villous tips were
replicative, since they had formed actin comet tails (Figure 3.8B). To our knowledge,
this is the first demonstration of Listeria comet tails in vivo. Furthermore, it appears
that Listeria comet tails form right-handed helices as predicted by a kinematic model
and from cell free comet tail assays (Shenoy et al., 2007; Zeile et al., 2005).
We infected mice with an equal mixture of Listeria expressing InlAm (emR) or Wt InlA
(cmR) in competition to quantify the contribution of The InlAm-mE-cadherin
interaction to infection. After 24 h of infection, a homogenate of the entire small
intestine, without washing or gentamicin treatment, was plated on differentially
selective plates (BHI 200 µg/ ml streptomycin with either 5 µg/ml erythromycin or 7.5
µg/ml chloramphenicol). There were ~10X more Listeria expressing InlAm versus Wt
InlA within the entire small intestine including lumenal contents (Figure 3.8C). We
next dissected the small intestine into regions containing just villi (Figure 3.8 C,
Villous) or regions with Peyer’s Patches (domed epithelium overlying a lymphoid
follicle and villi). Compared to the ratio in the entire intestine, the ratio of L.
monocytogenes with InlAm to L. monocytogenes with Wt InlA was increased in villous
epithelium (to ~20) and decreased in Peyer’s Patch containing regions (~5). (Note that
Listeria expressing InlAm are also ~20X more invasive into GSM06 than Listeria
expressing Wt InlA, Figure 3.5B.) This confirms the dominant role of InlA in
targeting Listeria to the villus tips and suggests that nonspecific phagocytosis by M-
cells in the dome epithelium may account for the ability of L. monocytogenes with the
“wrong” InlA (i.e. Wt InlA in mice and rats) or lacking InlA to invade the Peyer’s
99
patches (Jensen et al., 1998; Lecuit et al., 1999; Lecuit et al., 2001; MacDonald and
Carter, 1980; Marco et al., 1992; Pron et al., 1998; Wollert et al., 2007b).
Figure 3.8: Functional InlA Targets Listeria to the Villus Tip Epithelium (Following
Page)
(A-B) 8 week old female BALB/c mice were infected by oral gavage with 1010 ΔinlA
L. monocytogenes expressing InlAm and GFP L. monocytogenes and tissue was fixed
at 4h post infection and imaged by confocal immunofluorescence microscopy.
Phalloidin stained F-actin is shown in red, TOPRO-3 stained nuclei are shown in blue
and Listeria are green. (A) 3-dimensional reconstruction of villus tips from the distal
ileum viewed from the lumenal side. Arrows indicate intracellular bacterial plaques.
(B) Higher magnification 3D reconstruction of an infected villus tip (top panel) and
optical sections through the villus tips at indicated depths from the summit (bottom
panels). Scale bars, 10 µm. (C) B) 7-9 week old BALB/c mice infected orally with a
1:1 ratio (5 X 108 each) of the indicated strains. After 24h the ratio of the strains
(Competitive index, CI) from the entire small intestine (S.I.), regions without (Villous)
and regions with Peyer’s Patches (PPs) was determined.
100
101
DISCUSSION
In this Chapter, we demonstrated that he tropism of L. monocytogenes for extrusion

sites is not exclusive to cultured cells (Chapter 2), but also occurs in vivo. Cell
production within the intestinal crypts is balanced by cell shedding from the extrusion
zone at the villus tips (Babyatsky and Podolsky, 2003). Therefore, we predicted this
anatomical site would be the target for L. monocytogenes invasion in vivo (Chapter 2).
Studies exploring the initial site of Listeria entry in mice and rats have suggested that
L. monocytogenes cannot invade enterocytes, but rather crosses the epithelium through
M-cells of the Peyer’s patches (Jensen et al., 1998; Marco et al., 1997; Marco et al.,
1992). Although this may represent an important site of entry at very high inocula, it is
unlikely to be the primary mode of epithelial invasion because mice and rats are not
naturally susceptible to Listeriosis due to differences in E-cadherin in the InlA binding
region (Lecuit et al., 1999). In contrast, an early electron microscopy study of
intestinal tissue from orally inoculated guinea pigs found intracellular L.
monocytogenes within enterocytes near the tips of the intestinal villi (Racz et al.,
1972). In another study using guinea pigs and transgenic mice expressing human E-
cadherin in enterocytes, foci of L. monocytogenes were found within the intestinal villi
near the apical tips (Lecuit et al., 2001). Consistent with these observations, we found
that L. monocytogenes adhere to and invade exclusively at the villus tips and found no
bacteria invading lateral sides of villi, the intestinal crypts or the Peyer’s patches
during early infection of rabbit ileal loops. Examining the villus tips more closely, we
readily found that the invading bacteria were associated with multicellular junctions
and the junctions surrounding protruding cells at the extrusion zone.
We wanted to confirm the observations from the rabbit ileal loop infection model with
an oral infection model. L. monocytogenes can invade the intestine of Guinea Pigs,
however this model is not amenable to the host-side forward genetic approaches, for
example those available with transgenic and genetic knockout mice (Lecuit et al.,
2001). Mice and rats are not infected orally with L. monocytogenes due to differences
in their E-cadherin as compared to susceptible mammalian hosts (Lecuit et al., 1999).
102
Thus we began a structure function analysis of InlA to test mutations in InlA predicted
to accommodate the binding of murine E-cadherin. We found a set of mutations in
InlA that improved invasion of mouse epithelial cells in tissue culture and also of
mouse intestine in an Ileal loop infection model. Concurrently, another group
developed and published alternative mutations that proved to have much better
binding of murine E-cadherin, fully recapitulating a wild type interaction (Wollert et
al., 2007a; Wollert et al., 2007b). We used this InlA variant, designated InlAm, to
confirm that L. monocytogenes specifically invade the small intestinal villous tips
through the interaction between InlA and E-cadherin. Furthermore, we combined this
technology with transgenic bioluminescence to develop a non-invasive modality for
visualizing the anatomical sites of L. monocytogenes replication during murine oral
Listeriosis. These technologies will be useful in dissecting both pathogen and host
genetic and molecular interactions necessary for L. monocytogenes colonization or
dissemination in mammals.
103
CHAPTER 4 : INLB TARGETS C-MET AND MODULATES ENDOCYTOSIS AT

MULTICELLULAR JUNCTIONS
Mickey Pentecost performed the experiments. Portions of this chapter are in

preparation for publication.
INTRODUCTION
The receptors for InlA and InlB, E-cadherin and c-Met, are basolateral proteins not
expressed on the apical side of polarized epithelial cells (Balkovetz et al., 1997; Boller
et al., 1985; Crepaldi et al., 1994). We identified the cell extrusion zone at the tips of
the intestinal villi as a novel site involved in microbial invasion independent of
Peyer’s Patches (Chapters 3) (Pentecost et al., 2006). As cells are extruded from the
villus tip into the intestinal lumen, the neighboring epithelial cells come together and
form a multicellular cell-cell junction (MCJ) that seals the defect left by the extruded
cell (Gordon and Hermiston, 1994; Grossmann et al., 2002; Madara, 1990; Mayhew et
al., 1999; Pentecost et al., 2006). Remodeling MCJs transiently expose E-cadherin to
the lumen of the intestine in vivo (Chapter 3). L. monocytogenes also targets analogous
MCJs in polarized epithelial monolayers in tissue culture (Chapter 2) (Corfe et al.,
2000; Pentecost et al., 2006; Rosenblatt et al., 2001). Thus, MCJs are
morphologically unique subcellular sites within polarized epithelia relevant to the
analysis of host-pathogen interactions.
We sought to further characterize the molecular mechanisms employed by L.

monocytogenes to specifically target and invade MCJs. We analyzed the role of InlB
in promoting infection of MCJs using a polarized model epithelium of MDCK cells
grown on permeable filter supports. We show here that InlB does not promote
attachment to MCJs, but locally targets c-Met to promote invasion at MCJs. Following
invasion, InlB is dispensable and does not promote intracellular replication, as has
been suggested (Gregory et al., 1997).
104
We also find that the efficiency of bacterial invasion of MCJs is not solely defined by
the bacterium, but is also defined by the intrinsic activities of the MCJ. We previously
observed that MCJs were more permissive to L. monocytogenes invasion than other
junctional sites of bacterial attachment (Chapter 2). Thus, we hypothesized that MCJs
had increased endocytic potential since the junctions are rapidly remodeled during cell
extrusion. We found that MCJs, but not non-MCJ sites, of polarized MDCK
monolayers internalize significant amounts of soluble fluorescent dextran into
endocytic puncta that also contain E-cadherin and tight junction ZO-1. Soluble InlB
and HGF modulate uptake at MCJs, but not at Non-MCJs, by increasing the number
and size of endocytic puncta. This process is dependent on Dynamin, a component of
the endocytic machinery also necessary for L. monocytogenes invasion at MCJs
(Veiga and Cossart, 2005; Veiga et al., 2007).
105

monocytogenes strain, and isogenic mutant strains DP-L4405 (ΔinlA), DP-L4406
(ΔinlB) and DP-L4404 (ΔinlAB) were kindly provided by Dr. Daniel A. Portnoy
(University of California, Berkeley, California) and have been described previously
(Bakardjiev et al., 2004). GFP-expressing 10403S strain DH-L1039 (Wt-GFP) was
kindly provided by Dr. Darren E. Higgins (Harvard University, Boston,
Massachusetts) and has been described in (Agaisse et al., 2005; Shen and Higgins,
2005). L. monocytogenes were grown on BHI-agar or in BHI-broth (BD/Difco, San
Jose, California) supplemented with streptomycin at 200 μg/ml, chloramphenicol at
7.5 μg/ml or erythromycin at 5 μg / ml, when appropriate. One-shot Top10 E. coli
(Invitrogen), used for general cloning steps, was cultured in LB broth and on LB agar
supplemented with kanamicin at 50 μg/ml or choramphenicol at 25 μg/ml, when
appropriate. E. coli strain SM10 (λpir) was kindly provided by Dr. Denise Monack
(Stanford University, Stanford, California). E. coli SM10 (λ pir), used as the donor for
bacterial conjugation, was cultured in LB supplemented with kanamicin at 30 μg/ml
and chloramphenicol at 25 μg / ml, when appropriate.
Chemicals and Reagents. HGF (stored at -80 ˚C as 5µg/ml in H2O 0.1%BSA) was
used at 0.1 µg/ml, InlB or GW[2-3] (stored at -80 ˚C as 25 mg / ml in10 mM sodium
acetate pH 4.5, 1 mM DTT, 0.5 mM EDTA) was used at 1 µg/ml, c-Met Inhibitor
(SU11274, Calbiochem) was used at 2.5 µM/0.15% DMSO, Dynasore was used at 80
µM/0.1%DMSO, Nystatin was used at 50 µM/0.5%Methanol.
Generation of GFP-expressing Listeria Strains. The tRNAARG site-specific shuttle

integration vectors pPL3, which confers chloramphenicol resistance to Listeria, and
pPL3e, which confers erythromycin resistance to Listeria, were the kind gift of Dr.
Darren E. Higgins (Harvard University, Boston, Massachusetts). Listeria strain DH-
L1039 expresses GFP under the control of the Hyper-SPO1 promoter fused to the 5’
UTR of hly (pHyperSPO1-hly5’UTR-GFP). Genomic DNA was prepared from DH-
L1039 using a Qiagen Tissue Kit. Using PFU Hot-start High Fidelity polymerase and
106
primers 37/33, the pHyperSPO1-hly5’UTR-GFP construct was PCR amplified, gel

purified and ligated into pCR4-BluntTOPO to generate pMP71. pHyperSPO1-
hly5’UTR-GFP from SalI digested pMP71 was ligated with SalI digested pPL3 and
pPL3e to generate pMP74 and pMP76, respectively. Orientation of the GFP cassette
within pMP74 and pMP76 was determined by EagI diagnostic digest. pMP74 and
pMP76 were transformed into SM10 (λpir) and introduced to Wt ΔinlA, ΔinlB or
ΔinlAB L. monocytogenes by conjugative mating as described in (Lauer et al., 2002).
Briefly, recipient L. monocytogenes were grown in BHI overnight at 30˚ C and donor
SM10 (λpir) strains were grown in LB cm 25 µg/ml kan 30 µg/ml overnight at 30˚ C.
Strains were back-diluted 1:50 in BHI for Listeria and LB cm 25 µg/ml and grown at
30˚ C for 2h. Swinnex 25 filter holders (Millipore, SX0002500) were assembled with
25 mm 0.45 µm-pore type HA filters (Millipore, HAWP02500) and 25 mm silicone
gaskets (Millipore, SX0002501) and attached to a Lauer lock 12 cc syringe. The filters
were washed with 10 ml BHI and 2.5 ml of each donor and recipient were mixed and
filtered. The filter was washed with 10 ml BHI, removed from the filter holder and
incubated bacterial side up on BHI plates at room temperature for 45 minutes and then
transferred to 30 ˚C for at least 45 minutes. Bacteria were resuspended from the filter
by pipeting with 1 ml BHI. 25 µl of the resuspended bacterial solution was added to 3
ml of melted top agar (LB 7.5% agar) at 42 ˚C and poured evenly over the surface of
BHI-agar cm 7.5 µg/ml sm 200 µg/ml or BHI em 5 µg/ml sm 200 µg/ml plates and
incubated at 37 ˚C for 1-2 days. Genomic DNA was isolated from all Listeria strains
with a Qiagen tissue kit and site specific vector integration was confirmed by PCR
with primers NC16/PL95 as described in (Lauer et al., 2002). Colonies were verified
for GFP expression by fluorescence under a dissecting microscope with a GFP filter.
Western and whole-Listeria blot analysis of InlA and InlB expression. For Western
analysis of Listeria lysates, 2 ml of an overnight culture of Listeria in BHI was
centrifuged and the pellet was boiled in an equal volume of 2X SDS sample buffer,
subjected to SDS PAGE, and resolved proteins were transferred to nitrocellulose by
semi-dry transfer. For dot blot analysis of Listeria, bacteria were fixed in 2%
paraformaldehyde in 100 mM phosphate buffer, pH 7.4 for 10 minutes, pelleted and
107
washed in PBS, and transferred to nitrocellulose under suction using a 96-well dot-
blot apparatus. For whole Listeria blot analysis, bacteria were transferred from BHI
agar plates to nitrocellulose disks and fixed for with 2% paraformaldehyde in 100 mM
phosphate buffer, pH 7.4 for 10 minutes and the rinsed in PBS to remove non-adhered
bacteria. All blots were blocked in a 1:1 mixture of Licor blocking solution:PBS
overnight. For primary detection, blots were incubated for 1-2 h with a mouse
monoclonal InlA antibody (CLP011AP; Cedarlane Laboratories, Ontario, Canada;
1:5000 dilution in Licor blocking solution/PBS; (Rafelski and Theriot, 2006)) and a
rabbit polyclonal InlB antibody (4329 immunized with InlB-His6, bleed 2; 1:5000
dilution in Licor blocking solution/PBS). Blots were extensively washed with PBS
0.1% Tween20 and then incubated for 1-2 h with Alexa660 Anti-rabbit (pseudo-
colored red) and anti-mouse800 (pseudo-colored green) secondary antibodies (1:5000
dilution in Licor blocking solution/PBS), extensively washed with PBS 0.1%
Tween20, washed with PBS to remove Tween20, and then scanned on an Odyssey
Licor scanner.
Cell culture and infection. MDCK II/G cells were kindly provided by Dr. W. James
Nelson (Stanford University, Stanford, California) and maintained at 37°C in 5% CO2
atmosphere in DMEM (Gibco, San Diego, California) supplemented with 5% fetal
bovine serum (FBS, Gibco). For experiments, cells were trypsinized and seeded on 12
well polycarbonate tissue culture dishes or 12 mm polycarbonate tissue culture inserts
(Transwell filters; Costar, Cambridge, Massachusetts) at a density of 106 cells/cm2 and
supplemented with fresh basal media daily for 4 days. c-Met inhibitor was added to
the monolayers 12 h prior to infection. Listeria were grown overnight in BHI broth
and bacterial cells were harvested at 10,000g for 1 minute and resuspended to 0.5
OD600 (7x108 CFU/ml) in room temperature DMEM. Immediately prior to infection,
MDCK cells were transferred to 37°C DMEM. L. monocytogenes were added to cells
at a multiplicity of infection (MOI) of 100:1 bacteria per cell and were allowed to
adhere for 10 minutes at 37°C in 5% CO2 atmosphere. Cell monolayers were washed
by pipeting with 3 changes of fresh 37°C DMEM to remove non-adhered L.
monocytogenes. This point was considered time 0:00 for all analyses. Invasion of cells
108
was allowed to proceed for 1 hour in DMEM at 37°C in 5% CO2 atmosphere (1:00).
The media was replaced with DMEM containing 50 µg/ml gentamicin and incubated
for 30 minutes to kill extracellular L. monocytogenes (1:30). At 1:30, monolayers were
washed by pipeting with 3 changes of fresh 37°C DMEM to remove gentamicin. At
appropriate time points, the above infection sequence was interrupted in order to assay
for L. monocytogenes adhesion, invasion, or intracellular replication as described
below. To assay for cell adhesion, at 0:00, monolayers were either fixed and analyzed
by microscopy or dispersed and plated for colony forming units (CFUs). For adhesion
by CFU counts, cell monolayers were dispersed in 500 µl of PBS (-Ca2+, -Mg2+) 1%
saponin. Appropriate dilutions of the suspension were plated onto BHI-agar. To assay
for cell invasion, at 1:30, monolayers were washed by pipeting with 3 changes of fresh
37°C DMEM to remove gentamicin. Intracellular L. monocytogenes were recovered in
500 µl of PBS (-Ca2+, -Mg2+) 1% saponin. Appropriate dilutions of the suspension
were plated onto BHI-agar for CFU determination. Prism software (GraphPad, San
Diego, California) was utilized for construction of graphs and statistical analysis of
data. Student’s t-test was used to compare two sample groups. ANOVA with
Bonferroni post-tests were used to analyze 3 or more sample groups.
Dextran endocytosis assays. MDCK II/G cells were trypsinized and seeded on 12
mm polycarbonate tissue culture inserts (Transwell filters; Costar, Cambridge,
Massachusetts) at a density of 106 cells/cm2 and supplemented with fresh basal media
daily for 5 days. The media was changed to plain DMEM. Inhibitors or vehicle
(DMSO, Methanol) were applied to the apical and basal side at -2 hours. InlB, GW[2-
3], or HGF were added at -1h to the apical side and 1mg / ml neutral fixable Texas
Red 10 kDa dextran was applied at 0 h for 30 minutes to the apical side. Monolayers
were washed 4 X to remove extracellular dextran and monolayer were fixed and
processed for immunofluoresence microscopy. 60X magnification confocal images
were analyzed using Volocity software (Improvision) to quantify intracellular dextran.
To quantify and quantitatively describe fluorescent dextran puncta, an analysis script
was designed to find objects within 5-100% fluorescence intensity, exclude objects
less than 0.5 µm3 or greater than 100 µm3 (dead cells above the monolayer often filled
109
with dextran) and separate touching objects with an object size guide of 0.1 µm3. The
data were clipped to a region of interest 50 µm X 50 µM centered at a multicellular
junction (MCJ) or at non-MCJ regions.
Microscopy and antibodies. Time-lapse microscopy was performed essentially as

described in (Bagnoli et al., 2005). For immunofluorescence microscopy, samples
were fixed with 2% paraformaldehyde in 100 mM phosphate buffer, pH 7.4 for 15
minutes, and were permeabilized in phosphate-buffered saline (PBS) 1% saponin 3%
bovine serum albumin (BSA) or left unpermeabilized by blocking samples and
diluting antibodies/probes in PBS 3% BSA. After incubation with appropriate
antibodies/probes, samples were mounted with Vectashield mounting medium with
DAPI (Vector Laboratories, Burlingame, California) and imaged with a confocal
microscope (Bio-Rad, Hercules, CA). The samples were imaged by confocal
microscopy where optical sections were taken at 0.5 µm resolution through both the
cell monolayers and the intestinal villi. Z-stacks were reconstructed into three-
dimensions using Volocity software (Improvision, Lexington, Massachusetts). Figures
were assembled with Photoshop software (Adobe, San Jose, California).
L. monocytogenes were detected by incubation of samples with biotin rabbit anti-L.

monocytogenes (Accurate Chemical & Scientific Corp., Westbury, NY; 1:100 tissue,
1:600 tissue culture). Tight junctions were detected by incubating samples with mouse
anti-ZO-1 antibodies (Zymed, South San Francisco, California 1:300 dilution, and see
(Vogelmann and Nelson, 2005)). Alexa-fluor conjugated streptavidin or Anti-IgG
Alexa-fluor conjugated antibodies of appropriate species reactivity and fluorescence
spectra were used for secondary detection (Molecular Probes, Eugene, Oregon). An
immunofluorescence inside/outside staining that distinguishes extracellular from
intracellular L. monocytogenes was modified from (Amieva et al., 2002) with
appropriate antibodies for this study. Actin was visualized by incubating samples with
Alexa-fluor conjugated phalloidins (Molecular Probes). To visualize all nuclei,
permeabilized samples were incubated with TOPRO-3 (Molecular Probes).
110
T3 attaaccctcactaaaggg Anneals 5' of inserts in pCR4 Blunt-TOPO. Used for sequencing.
27 NC16 gtcaaaacatacgctcttatc Anneals 5' to tRNAARG in L. monocytogenes genome. (Lauer et al., 2002)
Anneals within PSAint in pPL2, pPL3 and pPL3e. Used with NC16 to
28 PL95 acataatcagtccaaagtagatgc
verify pPL2, pPL3 and pPL3e plasmid integration. (Lauer et al., 2002)
Anneals at 3' of transcriptional stop site of GFP. Used to amplify GFP
33 salI_gfpmut2_reverse aggtcgacttatttgtatagttc expression construct from DH-L1039. Underlined SalI site. (Shen and
Higgins, 2005)
Anneals at 5' of Hyper SPO1 promoter. Used to amplify GFP expression
construct from DH-L1039. (Shen and Higgins, 2005)

DP-L4405 10403S ∆inlA (Bakardjiev et al., 2004)
DP-L4406 10403S ∆inlB (Bakardjiev et al., 2004)
DP-L4404 10403S ∆inlAB (Bakardjiev et al., 2004)
LM 124 Wt GFP, cmR (this study)
LM 125 ∆inlA GFP, cmR (this study)
LM 126 ∆inlB GFP, cmR (this study)
LM 127 ∆inlAB GFP, cmR (this study)
LM 128 Wt GFP, emR (this study)
LM 129 ∆inlA GFP, emR (this study)
LM 130 ∆inlB GFP, emR (this study)
LM 131 ∆inlAB GFP, emR (this study)
chloramphenicol resistant 7.5 µg/ml; emR erythromycin resistant 5 µg/ml
111
RESULTS
CONSTRUCTION OF GFP-EXPRESSING LISTERIA STRAINS

We developed GFP-expression constructs to make any Listeria strain fluorescent. We
utilized two site-specific shuttle integration vectors: pPL3 confers chloramphenicol
resistance to Listeria, and pPL3e confers erythromycin resistance. We used both pPL3
and pPL3e to clone and express GFP so that we could use these two constructs to
differentially select Listeria strains with antibiotics, e.g. for competition experiments.
pPL3 and pPL3e encode a PSA prophage integrase operon that integrates at, and
reconstitutes, the Listeria tRNAARG locus. Thus they provide a relatively easy way to
stably express trans genes from within the Listeria chromosome without disrupting
gene coding regions (Lauer et al., 2002). Into pPL3 and pPL3e, we cloned a GFP
expression cassette amplified from Wt GFP strain DH-L1039 to essentially
recapitulate the pPL3-based construct that was used to generate DH-L1039 (Shen and
Higgins, 2005). GFP expression constructs were introduced into the genomes of
ΔinlA, ΔinlB, and ΔinlAB L. monocytogenes by conjugative mating from SM10 (λpir)
donor stains. GFP expression by L. monocytogenes was verified by observation of
fluorescent colonies under a dissecting scope with a GFP filter and by epifluorescence
and confocal microscopy, shown below.
112
Figure 4.1: Construction of GFP Expression Constructs and Verification of InlA and
InlB Expression in GFP Strains
(A) tRNAARG integration construct for expression of GFP and a

chloramphenicol resistance cassette. (B) tRNAARG integration construct for
expression of GFP and an erythromycin resistance cassette. (C) Whole dot-
blot analysis of InlA expression. The indicated non-GFP strains
were fixed and transferred onto nitrocellulose and probed with mouse anti-InlA
antibodies and rabbit anti- antibodies. Alexa660 Anti-rabbit (red) and anti-
mouse800 (green) secondary antibodies were used. Where both antibodies stain, the
merge is a combination of green and red, or yellow. (D) Western blot analysis of InlA
expression by the indicated non-GFP strains. (E) Western blot analysis of InlB
expression by the indicated GFP-expressing (emR) strains. (F) Western blot analysis of
InlA expression by the indicated GFP-expressing (emR) strains. (G) Whole
blot analysis of GFP-expressing strains. The indicated strains were
transferred onto nitrocellulose, fixed, and probed with mouse anti-InlA antibodies and
rabbit anti-InlB antibodies. Alexa660 Anti-rabbit (red) and anti-mouse800 (green)
secondary antibodies were used. Where both antibodies stain, the merge is a
combination of green and red, or yellow.
113
ΔINLB GFP L. MONOCYTOGENES EXPRESS INLA
The genetic knockouts of inlA, inlB and inlAB were previously verified by Southern
blot analysis (Bakardjiev et al., 2004). However, since InlA and InlB are in an operon,
we wanted to make sure that deletion of one gene did not abrogate expression of the
other, i.e. that there were no polar effects. We first obtained a mouse monoclonal InlA
antibody (CLP011AP; Cedarlane Laboratories, Ontario, Canada) that was
characterized for immunofluorescence in (Rafelski and Theriot, 2006). We confirmed
that this antibody worked for whole Listeria dot-blot (Figure 5.1 C) and Western blot
against Listeria lysates (Figure 5.1D). InlA was clearly absent in ΔinlA and present in
ΔinlB. InlA was often a doublet with weakly stained bands of lower molecular weight,
an observation consistent with other studies (Figure 5.1D) (Lebrun et al., 1996;
Mengaud et al., 1996). We also note that Western analysis of ΔinlA lysates showed
faint bands of low molecular weight (not shown). It would be interesting to determine
whether these bands represent cross-reactivity of the antibody with other members of
the Internalin protein family.
For these studies we also developed an InlB antibody since there were no
commercially available InlB antibodies. We obtained purified InlB-His6 and a
truncated InlB-variant comprised of the second and third GW domains (GW[2-3]-
His6) from Dr. Partho Ghosh (University of California, San Diego). Prior to
immunizing animals, we confirmed that the InlB was biologically active in an MDCK
cell scatter assay. The rationale is that antibodies raised against functional InlB, i.e.
not misfolded or degraded, are likely to work for immunofluoresnce detection of
native protein. Over the course of several hours, small islands of MDCK cells
dissociate and become motogenic (scatter) in response to c-Met activation by HGF or
by InlB (Figure 2) (Shen et al., 2000). HGF and InlB mediated scattering is concurrent
with loss of tight junction ZO-1 staining at cell peripheries (Figure 2). We also
confirmed that scattering depends on c-Met since a highly specific c-Met kinase
inhibitor (SU11274) efficiently blocks scattering and loss of ZO-1 staining. GW[2-3]
domains were insufficient to induce cell scattering since the LRR domain is required
for c-Met activation (Figure 4.2) (Bierne and Cossart, 2002; Copp et al., 2003; Lecuit
114
et al., 1997; Machner et al., 2003; Marino et al., 1999, 2000; Niemann et al., 2007;
Shen et al., 2000).
Rabbits were immunized with InlB-His6. Western blot of InlB was specific and
confirmed absence of InlB in ΔinlB GFP and the presence of InlB in ΔinlA GFP
(Figure 5.1 E). When Listeria were grown on plates and transferred to nitrocellulose
membranes, InlB staining was strong and appeared to have higher specific to
nonspecific staining than the monoclonal anti-InlA antibody (Figure 4.1G). Using this
method, we also confirmed that ΔinlAB lacked InlA and InlB expression, which is
relevant to the next chapter in which we reconstitute InlA and InlB expression in a
ΔinlAB background. Thus the in-frame InlA deletion mutant retains InlB expression
and the in-frame InlB mutant retains InlA-expression.
115
Figure 4.2: Activation of c-Met and MDCK Cell Scattering by Purified InlB
MDCK cells were plated at low density and grown as small islands of cells. Cell were
pretreated with a c-Met inhibitor or DMSO and treated with HGF, InlB or GW[2-3]
for 8h. Cells were fixed, stained with phalloidin for F-actin (red) and with anti-ZO-1
antibodies (green), imaged with a confocal microscope and reconstructed in 3D. Scale
bar 10 m.
116
ΔINLB L. MONOCYTOGENES RECRUIT E-CADHERIN AND β-CATENIN TO SITES OF

BACTERIAL ATTACHMENT
It has been shown that InlA recruits E-cadherin and E-cadherin-binding proteins to the
site of bacterial invasion of non-polarized cells (Lecuit et al., 2000; Sousa et al.,
2005a). We infected nonpolarized MDCK (canine kidney epithelial) and T84 (human
intestinal epithelial) cells with Wt GFP and ΔinlB GFP L. monocytogenes for 20
minutes and counterstained the cells with antibodies to E-cadherin or to β-catenin
(Figure 4.3). Both strains were capable of recruiting E-cadherin and β-catenin in both
epithelial cell lines (Figure 2.8, Figure 4.3). We note that use of non-polarized cells is
an artificial system with regard to Listeria infection of polarized epithelial cells and
with respect to the subcellular site of infection at cell junctions (Chapter 2). However
it is easier to observe protein recruitment within flat cell membrane. InlA is the only
known L. monocytogenes protein that binds E-cadherin. Furthermore we showed that
loss of InlA abolishes adherence to epithelial cells, while ΔinlB adheres the same as
Wt L. monocytogenes and blocking E-cadherin greatly reduces cell attachment (Figure
2.3D, Figure 2.8D). Thus, this data indicates that ΔinlB GFP express functional InlA.
117
Figure 4.3: Recruitment of E-cadherin and -catenin by to Sites of

Attachment
(A) Recruitment of -catenin by Wt GFP and recruitment of E-

cadherin and -catenin by GFP in subconfluent, unpolarized
MDCK cells. E-cadherin and -catenin are shown in red or grayscale, nuclei are in
blue. (B) Recruitment of E-cadherin and -catenin by Wt GFP and GFP
in subconfluent, unpolarized T84 monolayers. E-cadherin and -
catenin are shown in red or grayscale.
118
INTERNALIN B PROMOTES APICAL INVASION OF MULTICELLULAR JUNCTIONS

We infected polarized MDCK monolayers with Wt GFP or ΔinlB GFP L.
monocytogenes, to determine whether InlB promotes infection through the apical
surface of a model polarized epithelial barrier. The absence of InlB does not
significantly impair apical attachment during a 10-minute infection since ΔinlB L.
monocytogenes retain expression of InlA and bind E-cadherin (Figure 2.3B, Figure
4.4A) (Pentecost et al., 2006). Following attachment, Listeria were allowed to invade
for a period of 1h, the infected monolayers were treated with gentamicin for 30
minutes and the number of viable intracellular bacteria was determined. InlB is
necessary for efficient infection since ΔinlB GFP L. monocytogenes invasion is
significantly reduced (~35% of Wt, p < 0.0001 Figure 2.3A, Figure 4.4A). At various
time points during internalization, polarized MDCK monolayers were fixed and
analyzed by confocal immunofluorescence microscopy. An inside-outside staining
protocol that distinguishes attached extracellular bacteria from internalized bacteria
demonstrates that Wt GFP L. monocytogenes begin to invade within the first 20
minutes of infection, while ΔinlB GFP L. monocytogenes invade between 20 and 40
minutes of infection (Figure 4.4B, 4.4C). Thus, InlB is not necessary for attachment
but modulates the rate of internalization. As previously shown, Wt and ΔinlB L.
monocytogenes invade polarized MDCK monolayers at multicellular junctions
(MCJs), which represent sites of recent cell extrusion, analogous to extrusion sites at
the villus tips (Chapter 2, Figure 4.4B) (Pentecost et al., 2006).
119
Figure 4.4: InlB Mediated Apical Invasion of Polarized MDCK Monolayers.
MDCK monolayers were infected with Wt GFP or GFP . (A)

Adhesion after 10 min of infection, left, or invasion determined by quantification of
viable CFUs of intracellular bacteria after gentamicin treatment, right. (B)
Representative sites of Wt GFP or GFP invasion were
visualized with phalloidin for F-actin (blue). To evaluate intracellular versus
extracellular bacteria, we performed an outside staining where extracellular adherent
were stained before permeabilization in red. External
thus appear as a combination of red/green or yellow. Scale bar 10 m.
(C) Quantification of intracellular Wt GFP or GFP from
Immunofluorescence images as in (B). NS, not significantly different; ***, p < 0.001
120
INLB TARGETS C-MET LOCALLY DURING APICAL INVASION OF POLARIZED MDCK

MONOLAYERS
InlB binds and activates c-Met (Shen et al., 2000). However, c-Met is a basolateral
protein not known to be exposed on the apical side of epithelia (Balkovetz et al., 1997;
Crepaldi et al., 1994). MDCK cells were pretreated with the c-Met Kinase inhibitor
SU11274 or DMSO as a control then infected Wt GFP or ΔinlB GFP L.
monocytogenes to determine whether Listeria invasion through the apical surface of
MDCK monolayers requires signaling through c-Met. The c-Met kinase inhibitor
reduces Wt GFP L. monocytogenes invasion to the level of ΔinlB GFP L.
monocytogenes invasion but has no effect on the invasion of ΔinlB GFP L.
monocytogenes (Figure 4.5A). Thus, multicellular junctions are unique apical sites
where Listeria InlA binds E-cadherin and then Listeria stimulates c-Met kinase
signaling with InlB (Pentecost et al., 2006).
InlB mimics HGF to influence cell survival and epithelial polarity (Bierne and
Cossart, 2002; Galan, 2000). It has been suggested that InlB functions as a soluble and
diffuse factor since InlB is only loosely associated with the bacterial cell and a large
proportion can become liberated (Bierne and Cossart, 2002; Galan, 2000; Jonquieres
et al., 1999). We wondered whether InlB functions to make all cells in an epithelium
more permissive to infection. We infected MDCK monolayers with a mixture of Wt
GFP and ΔinlB GFP L. monocytogenes to determine whether exogenous InlB from Wt
GFP L. monocytogenes rescues the defect of ΔinlB GFP L. monocytogenes invasion.
Wt GFP and ΔinlB GFP L. monocytogenes were mixed in a 1:1 ratio and MDCK
monolayers either untreated or treated with c-Met kinase inhibitor were infected at
various multiplicities of infection (MOIs), allowed to adhere for 10 minutes, washed
to remove nonadhered bacteria and allowed to invade for 1h. Monolayers were treated
with gentamicin for 30 minutes to kill extracellular bacteria and then gentamicin was
washed away and intracellular bacteria were recovered. At all MOIs tested, ΔinlB GFP
was approximately one third as invasive as Wt GFP and different MOIs did not
significantly change this relationship (Figure 4.5B, p>0.05 versus one another, in
blue). Confirming the previous result using single infections (Figure 4.5A), the c-Met
121
kinase inhibitor resulted in equal invasion of Wt GFP and GFP (Figure 4.5B, p
> 0.05, C.I. not significantly different than 1.) Thus, under the conditions of our
infection protocol, InlB functions only for the benefit of Wt GFP .
That is, InlB does not affect bacterial invasion at a distance (Figure 4.4).
Figure 4.5: Invasion of Through Local c-Met Activation
(A) MDCK monolayers were treated with either DMSO or a c-Met inhibitor prior to
infection with Wt GFP or GFP . (B) Confluent MDCK
monolayers were either untreated or treated with c-Met inhibitor SU11274 prior and
during infection with a 1:1 ratio of the indicated strains at the indicated multiplicity of
infection (MOI). The ratio of the strains recovered after gentamicin treatment was
determined (competitive index, C.I.). A t-test was used to compare each individual
group with a hypothetical value of 1 and Two-way ANOVA with bonferroni post-tests
was used to compare between groups.
122
INLB DOES NOT INFLUENCE LISTERIA INTRACELLULAR REPLICATION AND CELL-TO-

CELL SPREAD WITHIN A POLARIZED EPITHELIUM
We investigated the role of InlB in L. monocytogenes intracellular replication and cell-

to-cell spread since there is conflicting data regarding the role of InlB in these
processes. In one study, an InlB-mutant was delayed in replication within hepatocytes
and the authors concluded that InlB promotes intracellular replication (Gregory et al.,
1997). However, in a study where L. monocytogenes were microinjected into Caco-2
cells, an inlAB mutant retained Wt levels of intracellular growth and cell-to-cell spread
(Goetz et al., 2001). Polarized MDCK monolayers were infected with Wt GFP or
ΔinlB GFP L. monocytogenes at an MOI of 10 bacteria / cell. After ten minutes of
attachment, the epithelial monolayers were washed to remove nonadherent bacteria. L.
monocytogenes were allowed to invade for 1h at which time the monolayers were
maintained in media containing gentamicin to kill extracellular bacteria. At various
time points, the monolayers were fixed and analyzed by confocal immunofluorescence
microscopy. At each time point during infection Wt GFP L. monocytogenes plaques
are greater in area and bacterial number than ΔinlB GFP L. monocytogenes plaques
(Figure 4.6A). However, the plaque doubling time was determined to be essentially
identical between the two strains (Figure 4.6B). Thus, InlB influences the rate of
epithelial invasion at MCJs but is not involved in intracellular growth or cell-to-cell
spread following initial invasion of the epithelium.
123
Figure 4.6: Lack of a Role for InlB in Intracellular Replication and Cell-to-Cell Spread
(A) Polarized MDCK monolayers were fixed at the indicated time points post
infection, and stained with phalloidin for F-actin (red). Top panels represent a central
X-Y-Z planes and lower panels are extended focus views of the same. Scale bars 10
m. (B) Quantification of per plaque. Exponential curves were fit to all data
points per strain, fit (R2) and doubling times (Td) are indicated.
124
JUNCTIONAL REMODELING AT MULTICELLULAR JUNCTIONS CORRELATES WITH

INCREASED APICAL ENDOCYTOSIS
MCJs joining 5 or more cells represent ~2% of all junctions and nearly three quarters
of L. monocytogenes adhere to these sites (Chapter 2) (Pentecost et al., 2006).
Interestingly, invasion at these sites is more specific than adhesion since 97% of foci
of L. monocytogenes originate at MCJ sites (Chapter2, Figure 4.6A) (Pentecost et al.,
2006). Thus, adherence to the apical surface of polarized MDCK cells is not a
sufficient requisite for invasion/endocytosis of Listeria. We wondered whether MCJs
were more permissive to Listeria entry than other junctional sites of Listeria
adherence because of greater endocytic potential or endocytic activity.
We first examined mixed cultures of plain MDCK cells and MDCK cells expressing
E-cadherin-GFP and observed para-endocytosis reminiscent of previously described
“paracytophagy” (Robbins et al., 1999). In figure 4.7A, an extruded cell appears phase
bright and in the fluorescent image, an MCJ forms at the base of the E-cadherin-GFP
expressing extruded cell. Puncta of E-cadherin-GFP are observed in MDCK cells
surrounding the extruded cell. To determine whether puncta of E-cadherin derived
from the extruded cells or neighboring live cells in the monolayer, we analyzed
monolayers of mixed MDCK and MDCK E-cadherin-RFP cells by time-lapse
microscopy. We found that puncta of internalized E-cadherin-RFP within unmarked
MDCK cells primarily derived from the extruded cell concurrent with the extrusion
process (Figure 4.7B, Video 4.1). These data highlight the dynamic nature of sites of
cell extrusion with respect to junctional rearrangement and junctional endocytosis.
We treated polarized MDCK monolayers from the apical side with neutral Texas Red
dextran to determine whether junctional endocytosis at MCJs also resulted in
increased uptake from the apical surface (Figure 4.8). After 30 minutes, the
monolayers were extensively washed and fixed for immunofluorescence confocal
microscopy. Puncta of internalized dextran ~1-2 µm2 were readily found at MCJs and
the fluorescence intensity of dextran at MCJs was higher than at non-multicellular
junction (Non-MCJ) regions of the polarized monolayer (Figure 4.8A, 4.8E).
125
Interestingly, internalized dextran at MCJs colocalized with E-cadherin as well as ZO-

1, a protein associated with the tight junctions in polarized cells (Figure 4.8E)
(Hartsock and Nelson, 2008). As observed by others, small puncta of dextran (<0.5
µm2) were internalized at the apical surface of polarized cells but were below the limit
of detection set to minimize pixel saturation during confocal acquisition (data not
shown) (Shurety et al., 1998). Thus, significant fluid phase endocytosis occurs at MCJ
extrusion sites in a polarized epithelium and endocytic puncta are sufficiently large to
accommodate the volume of a bacterium. Since Listeria target MCJs for attachment
and invasion, a constitutive process of endocytosis by host cells may promote the
internalization of attached bacteria.
Figure 4.7: Unique Para-endocytosis of Junctional Components at Sites of Cell

Extrusion (Following Page)
(A) Phase contrast and fluorescence image of a confluent monolayer of mixed MDCK
and E cadherin-GFP MDCK cells (green) stained with DAPI (blue). Asterisk indicates
cell being extruded and arrows indicate puncta of E-cadherin-GFP. (B) DIC and
Fluorescence time-course images from a live confluent monolayer of mixed MDCK
and E-cadherin-RFP MDCK cells. Cells surrounding a cell being extruded are
numbered, an asterisk indicates the extruded cell and arrows indicate endocytosed
puncta containing E-cadherin-RFP.
126
127
Video 4.1: Junctional Endocytosis at Cell Extrusion
QuickTime DIC and Fluorescence time-lapse video of cell extrusion from mixed
MDCK and MDCK E-cadherin-RFP monolayer, shown in Figure 4.7B.
128
INLB AND HGF MODULATE DEXTRAN ENDOCYTOSIS AT MULTICELLULAR JUNCTIONS

Growth factor activation of receptor tyrosine kinases has been shown to induce
macropinocytosis of E-cadherin (Bryant et al., 2007). Furthermore, c-Met and E-
cadherin are coendocytosed in HGF treated MDCK cells (Kamei et al., 1999). We
pretreated Polarized MDCK cells from the apical side for 1h with HGF or InlB and
find that both significantly increased the amount of dextran endocytosed at MCJs
(p<0.001), but not at non-multicellular junction regions compared to untreated cells (p
> 0.05, Figure 4.8A). We note that as another control treatment, GW[2-3] has no
effect on endocytosis compared to untreated monolayers (data not shown). Like
untreated monolayers, puncta of dextran were associated with junctional proteins at
MCJs in HGF and InlB treated monolayers (Figure 4.8A and data not shown).
Increased endocytosis of dextran after HGF and InlB treatment is the product of a
significant increase in the number of puncta of dextran observed (untreated versus
InlB or HGF p<0.001, Figure 4.8C) and a significant increase in the amount of dextran
internalized as determined by fluorescence (Untreated versus InlB p<0.05, Untreated
versus HGF p<0.01, Figure 4.8D). Thus InlB, a molecular mimic of HGF, modulates
apical endocytosis at sites of cell extrusion, which may favor internalization of InlB
expressing bacteria.
APICAL ENDOCYTOSIS AND L. MONOCYTOGENES INVASION AT MULTICELLULAR

JUNCTIONS REQUIRE COMMON ENDOCYTIC MACHINERY
It has recently been shown that InlA and InlB specifically target endocytic machinery
to the sites of Listeria invasion in nonpolarized cells. Notably, InlB mediated invasion
requires molecular machinery associated with Clathrin based endocytosis, including
Dynamin (Bonazzi et al., 2008; Pizarro-Cerda et al., 2007; Veiga and Cossart, 2005;
Veiga et al., 2007). We pretreated polarized MDCK monolayers with Dynasore, an
inhibitor of Dynamin, or DMSO as a control, prior to addition of fluorescent dextran
to determine whether endocytosis through MCJs requires functional Dynamin.
Pretreatment of polarized cells with Dynasore inhibits nearly all apical endocytosis of
dextran at multicellular junctions regardless of HGF or InlB treatment (Figure 4.7F,
129
4.7G). Indeed, uptake at multicellular junctions was not significantly higher than
uptake at non-multicellular junctions within monolayers treated with Dynasore (Figure
4.7G). We did not find a role for Caveolin mediated uptake since pretreatment with
Nystatin is not significantly different from pretreatment with DMSO for all conditions
and at all sites (Data not shown). Thus InlB promotes a Dynamin dependent apical
endocytosis at multicellular junctions.
We pretreated Polarized MDCK monolayers with Dynasore or Nystatin infected them

with either Wt GFP L. monocytogenes or ΔinlB GFP L. monocytogenes (Figure 4.8H,
4.8I, and data not shown). Using an inside-outside immunofluorescence staining and
confocal microscopy analysis of monolayers infected for 1h, we find that L.
monocytogenes invade control cells and cells treated with Nystatin at MCJs, but do not
invade cells treated with Dynasore (Figure 4.7H and data not shown). Listeria were
allowed to invade for a period of 1h, the infected monolayers were treated with
gentamicin for 30 minutes and the number of viable intracellular bacteria was
determined. Compared to control cells treated with DMSO, cells treated with
Dynasore are significantly less permissive for Listeria invasion (Figure 4.8I, ~10%;
DMSO, p < 0.001; ΔinlB GFP p < 0.001) (Veiga et al., 2007). In contrast, 50 µM
Nystatin, shown in (Lisanti et al., 1993) to be a biologically effective concentration,
did not significantly inhibit Listeria invasion compared to the vehicle, Methanol (data
not shown). Thus, Dynamin is required for apical fluid-phase endocytosis at
multicellular junctions and for L. monocytogenes invasion at MCJs.
130
Figure 4.8: Enhancement of Dynamin-dependent Endocytosis at Multicellular

Junctions by HGF and InlB (Following Page)
(A) Extended focus views of polarized MDCK cells treated with DMSO 30 minutes
prior to and including 1h apical treatment with InlB or HGF for 1h, then apical
treatment with neutral Texas Red 10 kDa dextran for 30 minutes. Scale bar 10 µm. (B)
Quantification of dextran fluorescence in 50 µm X 50 µm regions centered at
multicellular junctions (MCJ) or at regions without multicellular junctions (Non-MCJ)
of DMSO treated monolayers. (C) Quantification of dextran puncta in 50 µm X 50 µm
regions centered at MCJs in DMSO treated monolayers. (D) Quantification of dextran
fluorescence in all puncta at MCJs analyzed. Scale bars 10 µm. (E) Single confocal Z-
plane through polarized E-cadherin-GFP MDCK cells treated apically with neutral
Texan Red 10 kDa dextran for 30 minutes and counterstained for ZO-1 (blue). Scale
bar 10 µm. (F) Extended focus views of polarized MDCK cells treated with Dynasore
30 minutes prior to and including 1h apical treatment with InlB or HGF for 1h, then
apical treatment with neutral Texas Red 10 kDa dextran for 30 minutes. Scale bar 10
µm. (G) Quantification of dextran fluorescence in 50 µm X 50 µm regions centered at
multicellular junctions (MCJ) or at regions without multicellular junctions (Non-MCJ)
of Dynasore treated monolayers. (H) Polarized MDCK cells were pretreated with
DMSO or Dynasore for 30 minutes and then infected with Wt GFP L. monocytogenes
for 1h. To evaluate intracellular versus extracellular bacteria, we performed an outside
staining where extracellular adherent L. monocytogenes were stained before
permeabilization in red. External L. monocytogenes thus appear as a combination of
red/green or yellow. Monolayers were counterstained with antibodies to ZO-1 (blue).
Scale bars 10 µm. (I) Quantification of relative Wt GFP L. monocytogenes invasion of
Polarized MDCK monolayer treated with DMSO or Dynasore.
131
132
DISCUSSION
In this chapter we explored both the bacterial and cellular processes that influence
invasion at multicellular junctions (MCJs). We previously showed that L.
monocytogenes target multicellular junctions of cell extrusion sites to invade polarized
epithelia (Chapter 2) (Pentecost et al., 2006). On the bacterial side of the interaction,
both InlA and InlB were found to be necessary for invasion. InlA promotes attachment
to exposed E-cadherin at multicellular junctions, while InlB is required for efficient
invasion, but not for adhesion (Chapter 2) (Pentecost et al., 2006). InlB binds the
receptor tyrosine kinase c-Met, the natural receptor for HGF (Shen et al., 2000). Using
an inhibitor of c-Met kinase signaling, we showed that InlB activates c-Met during
MDCK cell scattering and also activates c-Met during invasion of polarized MDCK
monolayers by L. monocytogenes expressing InlB.
If InlB binds c-Met, why doesn’t InlB promote cell adhesion of Listeria? In contrast to
InlA, which is covalently linked to peptidoglycan in the Gram positive bacterial cell
wall, InlB is only loosely associated with cell wall lipoteichoic acid via c-terminal GW
domains (Jonquieres et al., 1999). Thus, InlB does not provide adhesive strength
unless it is artificially linked to the bacterial surface (Bierne et al., 2001; Bierne et al.,
2005; Braun et al., 1999; Dramsi and Cossart, 2003; Jonquieres et al., 2001; Khelef et
al., 2006; Seveau et al., 2004; Seveau et al., 2007; Veiga and Cossart, 2005; Veiga et
al., 2007). We find that once Listeria associates with the cell surface through the
interaction of InlA with E-cadherin, InlB triggers c-Met signaling local to the
bacterium because exogenous InlB from coinfected InlB-expressing Listeria is not
sufficient to rescue the invasion of an inlB deletion mutant. Thus, InlB works in
synergy with InlA to promote efficient invasion of MCJs (Bergmann et al., 2002;
Dramsi et al., 1995; Lingnau et al., 1995).
Does InlB function at other stages of the Listeria intracellular life-cycle? We find that
although ΔinlB GFP L. monocytogenes are delayed in invasion, the rates of
intracellular replication and cell-to-cell spread are identical to Wt GFP L.
monocytogenes. These results are consistent with a study in which Caco-2 cells were
133
microinjected with ΔinlAB L. monocytogenes (Goetz et al., 2001). Another study

concluded that InlB was involved in intracellular replication within primary mouse
hepatocytes (Gregory et al., 1997). It is possible that the intracellular function of InlB
is cell-type dependent or species specific. That is, InlB promotes replication within
hepatocytes but not epithelial cells, or InlB promotes replication within murine cells
but not human/canine cells. However, InlB has numerous extracellular binding
partners, but no known intracellular binding partners. Furthermore, Gregory et al. did
not calculate the rates of intracellular replication and an alternate interpretation of their
data is that the inlB mutant is merely delayed in initiation of growth. Thus the most
parsimonious model is that InlB is required for efficient invasion, but does not
participate in intracellular growth or cell-to-cell spread. We note, however, that other
internalins may functions within the cytosol to promote the intracellular lifecycle and
virulence. Although poorly understood, Internalin C is required for full virulence
(Engelbrecht et al., 1996). A recent abstract presented at the 2008 American Society
for Cell Biology general meeting suggests that secreted InlC promotes cell-to-cell
spread by binding junctional components, which reduces cortical tension in the apical
junctions and promotes efficient Listeria membrane protrusion formation (Abstract
678/B641 from the lab of Keith Ireton, University of Toronto) (Rajabian, 2008).
We previously observed that the presence of L. monocytogenes plaques at

multicellular junctions was more frequent than L. monocytogenes adhesion to these
sites, even for an InlB mutant (Chapter 2) (Pentecost et al., 2006). This suggested that
multicellular junctions, although rare, are uniquely permissive for bacterial
internalization after bacterial attachment. What could make multicellular junctions
permissive to Listeria entry? Multicellular junctions form during cell extrusion and
subsequently resolve via junctional reorganization, changes in cell position, and
changes in cell morphology (Figure 2.5, Figure 2.6) (Madara, 1990; Pentecost et al.,
2006). There is increasing evidence that remodeling of adhesive contacts, including
modification of junctional length or cell position within epithelia require endocytosis
of adhesion molecules such as E-cadherin (de Beco et al., 2009; Jarrett et al., 2002; Le
et al., 1999; Shaye et al., 2008; Troyanovsky et al., 2006). Thus, we tested whether
134
multicellular junctions were enhanced for junctional endocytosis and enhanced in the
ability to endocytose material from the apical side. Fluorescent dextran applied only to
the apical side of polarized MDCK monolayers is rapidly internalized with E-
cadherin, the receptor for L. monocytogenes, specifically at multicellular junctions.
We propose that attached bacteria could hijack this intrinsic process as one aspect of
efficient entry.
Interestingly, the tight junction protein ZO-1 colocalized with E-cadherin within
internalized dextran puncta. This observation was unexpected since tight junction and
adherens junction proteins are fully separated in polarized cells. Colocalization of ZO-
1 with E-cadherin has been characterized microscopically and biochemically during
the initiation of cell-cell contacts (Ando-Akatsuka et al., 1999; Rajasekaran et al.,
1996; Vogelmann and Nelson, 2005). Therefore, MCJs may be more analogous to new
cell-cell contacts than to polarized columnar cells.
We hypothesized that InlB, as a molecular mimic of HGF, would increase apical

endocytosis at multicellular junctions. Receptor tyrosine kinases are internalized after
activation (Bryant et al., 2007; Dowrick et al., 1993; Orth et al., 2006; Orth and
McNiven, 2006). c-Met activation by HGF increases E-cadherin endocytosis (Fujita et
al., 2002). E-cadherin and c-Met are coendocytosed in HGF treated cells (Kamei et al.,
1999). InlB mimics HGF for c-Met activation and internalization. Finally, InlB can
promote Clathrin-mediated internalization of Listeria while HGF similarly promotes
Clathrin-mediated internalization of E-cadherin (Izumi et al., 2004; Veiga and Cossart,
2005; Veiga et al., 2007). We found that treatment of polarized cells with either HGF
or InlB increased apical endocytosis of dextran at multicellular junctions.
Interestingly, treatment of polarized monolayers with InlB or HGF did not result in
increased endocytosis at non-multicellular junction regions. This suggests that c-Met,
like E-cadherin, is also transiently exposed and only accessible at multicellular
junctions (Chapter 2) (Pentecost et al., 2006).
InlB mediated Listeria invasion requires molecular machinery associated with Clathrin
based endocytosis, while InlA recruits both Clathrin and Caveolin to Listeria invasion
135
sites (Bonazzi et al., 2008; Pizarro-Cerda et al., 2007; Veiga and Cossart, 2005; Veiga
et al., 2007). It is unclear how L. monocytogenes uses these pathways since bacteria
are significantly larger than Clathrin or Caveolin coated vesicles (Veiga et al., 2007).
Macropinocytosis, defined as the Dynamin-independent closure of cell surface ruffles
to form spacious actin-coated intracellular vesicles, is exploited or induced by a
number of microbes, notably viruses (Amstutz et al., 2008; Bonazzi et al., 2005;
Coyne et al., 2007; Garcia-Perez et al., 2008; Garcia-Perez et al., 2003; Ginocchio et
al., 1994; Ketterer et al., 1999; Liu et al., 2002; Meier et al., 2002; Raghu et al., 2009;
Swanson and Watts, 1995; Watarai et al., 2001; Watarai et al., 2002; Zenni et al.,
2000). Salmonella and Shigella trigger membrane ruffles that internalize the bacteria
in a macropinocytosis-like process (Dehio et al., 1995; Finlay et al., 1989; Finlay et
al., 1991; Francis et al., 1992; Gruenheid and Finlay, 2003). However, L.
monocytogenes utilize a so-called ‘zipper-like’ mechanism of invasion where host cell
plasma membrane is closely opposed to the bacterial surface. Furthermore, Listeria
invasion of MCJs and endocytosis of dextran at multicellular junctions are not
macropinocytic processes since both require functional Dynamin. We found that InlB
promotes endocytosis at the multicellular junctions by increasing both the number of
dextran puncta and the quantity of endocytosed dextran within puncta, some
comparable in volume to a bacterial cell. Thus, Listeria not only hijacks endocytic
machinery, but may also modulate endocytosis. However, it is not clear if the
increased rate of Listeria entry due to InlB is because of the generation of larger
vesicles, a more rapid generation of vesicles, or a combination of both.
In the next chapter, we explore whether InlB functions in vivo to promote the invasion
of multicellular junctions at the intestinal villus tips.
136
CHAPTER 5 : INLB PROMOTES L. MONOCYTOGENES ORAL INFECTION

AND COLONIZATION OF THE VILLUS TIP EXTRUSION ZONE
Mickey Pentecost performed the experiment with assistance from Patrick Eimerman
and Jonathan Hardy (bioluminescence imaging). Portions of this chapter are in
preparation for publication.
INTRODUCTION
Several lines of evidence indicate that gastrointestinal tract is a significant barrier to L.

monocytogenes infection. First, despite wide prevalence of L. monocytogenes in the
environment and in food, there is a low incidence of invasive Listeriosis relative to
other sources of food borne illness (Farber and Peterkin, 1991; Gombas et al., 2003;
Mead et al., 1999). Second, asymptomatic fecal shedding of L. monocytogenes among
healthy humans and animals is high (~1-5%) (Bojsen-Moller, 1972; Gray and
Killinger, 1966; Muller, 1990). Third, L. monocytogenes are ~10,000X more lethal
intravenously than orally in guinea pigs, a susceptible animal model (Lecuit et al.,
2001). Last, loss of inlA, encoding the surface adhesin/invasin Internalin A, abrogates
intestinal invasion of guinea pigs, but has no effect on pathogenesis when mutant
bacteria are administered intravenously (Lecuit et al., 2001).
Internalin A binds the most distal extracellular domain of E-cadherin, a

transmembrane cell-to-cell epithelial junction protein (da Silva Tatley et al., 2003;
Lecuit et al., 1999; Lecuit et al., 1997; Mengaud et al., 1996; Schubert et al., 2002). A
second invasion protein, Internalin B (InlB), binds and activates signaling through c-
Met, a receptor tyrosine kinase and the natural receptor for Hepatocyte Growth Factor
(HGF) and promotes invasion of multiple mammalian cell types (Banerjee et al., 2004;
Copp et al., 2003; Disson et al., 2008; Dramsi et al., 1995; Greiffenberg et al., 1998;
Ireton et al., 1999; Li et al., 2005; Lingnau et al., 1995; Marino et al., 2002; Marino et
al., 1999; Niemann et al., 2007; Parida et al., 1998; Shen et al., 2000). InlB functions
137
synergistically with InlA to promote invasion of epithelial cells in tissue culture

(Bergmann et al., 2002; Disson et al., 2008; Dramsi et al., 1995; Khelef et al., 2006;
Lingnau et al., 1995). However, InlB has not been found to promote infection of the
intestines. Rather, InlB has been implicated in liver and placental infection after
intravenous infection of mice (Dramsi et al., 2004; Gaillard et al., 1996; Khelef et al.,
2006).
We hypothesized that InlB promotes invasion of the intestinal epithelium since inlB,
immediately downstream of InlA, is translated independently and bicistronically with
inlA indicating that InlB is expressed when InlA is expressed (Gaillard et al., 1991;
McGann et al., 2007b). The inlAB operon is upregulated by the stress response sigma
factor σB suggesting that InlA and InlB expression are induced prior to intestinal cell
invasion, for example under stomach acid stress (McGann et al., 2007b; Sue et al.,
2004). InlB promotes infection of cultured epithelial cells, including primary intestinal
epithelial cells from permissive animal models (Disson et al., 2008). Finally, as shown
in Chapters 2 and Chapter 4, InlB promotes internalization through multicellular
junctions of polarized MDCK monolayers, sites analogous to the cell extrusion zone
of intestinal villous tips.
Studying both InlA and InlB in the same host is not trivial since both proteins are
‘species specific’: InlA binds human, canine, rabbit, and guinea pig, but not rat and
mouse E-cadherin, while InlB activates human, dog and mouse c-Met, but not guinea
pig or rabbit (Khelef et al., 2006). Furthermore, as discussed in Chapter 2 and Chapter
4, InlA is covalently attached to the bacterial cell wall peptidoglycan, while InlB is
only loosely associated with cell wall lipoteichoic acid; InlA, but not InlB functions as
an adhesin (Cabanes et al., 2002). Therefore, any roles of InlB that also require
functional adhesion by InlA would not be identified in animal models that are only
permissive for InlB.
It was recently shown that InlB and InlA promote placental invasion in intravenously
infected pregnant in gerbils, which are permissive for InlA and InlB, and pregnant
transgenic mice expressing a ‘humanized’ E-cadherin, (Disson et al., 2008). The
138
authors also showed that InlB promotes invasion of primary intestinal epithelial cells
from these animals but could not establish a role for InlB in the intestine after oral
infection. In this chapter, we developed Listeria strains that express InlAm (‘mouse-
adapted InlA’; Chapter 3) with or without the simultaneous expression of InlB in a
ΔinlAB L. monocytogenes genetic background. Thus, we can dissect the role of InlB
within the context of a functional InlA in a mouse model. Furthermore, we constructed
these strains with or without GFP expression in order to perform co-infection studies
where two strains are differentially marked for immunofluorescence microscopy. We
also made strains bioluminescent to perform non-invasive imaging of infected mice
(Chapter 3). Using these tools, we find that InlB promotes oral infection in mice and
that InlB promotes early colonization of the villous tip extrusion zone.
139

monocytogenes strain, and isogenic mutant strains DP-L4405 (ΔinlA) and DP-L4404
(ΔinlAB) were kindly provided by Dr. Daniel A. Portnoy (University of California,
Berkeley, California) and have been described previously (Bakardjiev et al., 2004).
GFP-expressing 10403S strain DH-L1039 (Wt-GFP) was kindly provided by Dr.
Darren E. Higgins (Harvard University, Boston, Massachusetts) and has been
described in (Agaisse et al., 2005; Shen and Higgins, 2005). Listeria strain 2C
(10403S flaA::Tn4001 luxABCDE kmR) has been described in (Hardy et al., 2004). L.
monocytogenes were grown on BHI-agar or in BHI-broth (BD/Difco, San Jose,
California) supplemented with streptomycin at 200 μg/ml, chloramphenicol at 7.5
μg/ml or erythromycin at 5 μg/ml, when appropriate. One-shot Top10 E. coli
(Invitrogen), used for general cloning steps, was cultured in LB broth and on LB agar
supplemented with kanamycin at 50 μg/ml or choramphenicol at 25 μg/ml, when
appropriate. E. coli strain SM10 (λpir) was kindly provided by Dr. Denise Monack
(Stanford University, Stanford, California). E. coli SM10 (λ pir), as the donor for
bacterial conjugation, was cultured in LB supplemented with kanamycin at 30 μg/ml
and chloramphenicol at 25 μg / ml, when appropriate.
Generation of L. monocytogenes strains expressing InlAm, GFP and luciferase.

The tRNAARG site-specific shuttle integration vectors pPL3, which confers
chloramphenicol resistance to Listeria, and pPL3e, which confers erythromycin
resistance to Listeria, were the kind gift of Dr. Darren E. Higgins (Harvard University,
Boston, Massachusetts). Listeria strain DH-L1039 expresses GFP under the control of
the Hyper-SPO1 promoter fused to the 5’ UTR of hly (pHyperSPO1-hly5’UTR-GFP).
Genomic DNA was prepared from DH-L1039 using a Qiagen Tissue Kit. Using PFU
Hot-start High Fidelity polymerase and primers 37/33, the pHyperSPO1-hly5’UTR-
GFP construct was PCR amplified, gel purified and ligated into pCR4-BluntTOPO to
generate pMP71. pHyperSPO1-hly5’UTR-GFP from SalI digested pMP71 was ligated
with SalI digested pPL3 and pPL3e to generate pMP74 and pMP76, respectively.
140
The L. monocytogenes inlA and inlAB were PCR amplified from 10403S Genomic
DNA using PFU Hot-start High Fidelity polymerase and primers 1/2 and 1/3,
respectively. Note, these primer pairs have been used previously to amplify and
reconstitute InlA and InlA/InlB expression in Listeria (Bakardjiev et al., 2004). inlA or
inlAB were subcloned into pCR4-BluntTOPO to generate pMP2 and pMP107,
respectively. Two rounds of Quickchange site-directed mutagenesis (Stratagene) were
performed with primer pairs 47/48 and 49/50 to introduce S192N and Y369S
mutations into inlA to generate inlAm or inlAmB (Table 5.1). inlAm or inlAmB were
digested with BamHI and ligated with BamHI digested pPL3, pPL3e, pMP74 or
pMP76. Orientation of inlAm or inlAmB was determined by ClaI diagnostic digest.
These constructs were transformed into SM10 (λpir), and introduced to ΔinlA or
ΔinlAB L. monocytogenes by conjugative mating as described (Table 5.2) (Lauer et al.,
2002). Briefly, recipient L. monocytogenes were grown in BHI overnight at 30˚ C and
donor SM10 (λpir) strains were grown in LB cm 25 µg/ml kan 30 µg/ml overnight at
30˚ C. Strains were back-diluted 1:50 in BHI for Listeria and LB cm 25 µg/ml for E.
coli and grown at 30˚ C for 2h. Swinnex 25 filter holders (Millipore, SX0002500)
were assembled with 25 mm 0.45 µm-pore type HA filters (Millipore, HAWP02500)
and 25 mm silicone gaskets (Millipore, SX0002501) and attached to a Lauer lock 12
cc syringe. The filters were washed with 10 ml BHI and 2.5 ml of each donor and
recipient were mixed and filtered. The filter was washed with 10 ml BHI, removed
from the filter holder and incubated bacterial side up on BHI plates at room
temperature for 45 minutes and then transferred to 30 ˚C for at least 45 minutes.
Bacteria were resuspended from the filter by pipeting with 1 ml BHI. 25 µl of the
resuspended bacterial solution was added to 3 ml of melted top agar (LB 7.5% agar) at
42 ˚C and poured evenly over the surface of BHI-agar cm 7.5 µg/ml sm 200 µg/ml or
BHI em 5 µg/ml sm 200 µg/ml plates and incubated at 37 ˚C for 1-2 days. Genomic
DNA was isolated from all Listeria strains with a Qiagen tissue kit and site specific
vector integration was confirmed by PCR with primers NC16/PL95 as described in
(Lauer et al., 2002). Colonies were verified for GFP expression by fluorescence under
a dissecting microscope with a GFP filter. Listeria strains were made bioluminescent
141
by transduction of flaA::Tn4001 luxABCDE kmR (flaA-Lux) from donor strain 2C as

described in (Hardy et al., 2004).
Western and whole-Listeria blot analysis of InlA and InlB expression. For Western
analysis of Listeria lysates, 2 ml of an overnight culture of Listeria in BHI was
centrifuged and the pellet was boiled in an equal volume of 2X SDS sample buffer,
subjected to SDS PAGE, and resolved proteins were transferred to nitrocellulose by
semi-dry transfer. For whole Listeria blot analysis, bacteria were transferred from BHI
agar plates to nitrocellulose disks and fixed for with 2% paraformaldehyde in 100 mM
phosphate buffer, pH 7.4 for 10 minutes and then rinsed in PBS to remove non-
adhered bacteria. All blots were blocked in 50% Licor blocking solution in PBS
overnight. For primary detection, blots were incubated for 1-2 h with a mouse
monoclonal InlA antibody (CLP011AP; Cedarlane Laboratories, Ontario, Canada;
1:5000 dilution in Licor blocking solution/PBS; (Rafelski and Theriot, 2006)) and a
rabbit polyclonal InlB antibody (4329 immunized with InlB-His6, bleed 2; 1:5000
dilution in Licor blocking solution/PBS). Blots were extensively washed with PBS
0.1% Tween20 and then incubated for 1-2 h with Alexa660 Anti-rabbit (pseudo-
colored red) and anti-mouse800 (pseudo-colored green) secondary antibodies (1:5000
dilution in Licor blocking solution/PBS), extensively washed with PBS 0.1%
Tween20, washed with PBS to remove Tween20, and then scanned on an Odyssey
Licor scanner.
Bioluminescence imaging of orally infected mice. Listeria cultures were grown at 30

˚C overnight without agitation, pelleted and resuspended in PBS at 1010 CFU / ml.
Female 8 week old BALB/c mice were food restricted overnight and inoculated by
gavage with volume of 200 μl. An IVIS Spectrum system (Xenogen Corp., Alameda,
CA) was used for non-invasive bioluminescence imaging of mice according to
instructions of the manufacturer. Briefly, at selected time point after inoculation,
isoflurane gas anesthetic was administered at 2% in oxygen using the Matrix system
(Xenogen Corp.). The images were obtained using an integration time of 5 min and a
binning of 10 pixels.
142
Whole-mount Confocal Microscopic Imaging of Intestinal tissue. Samples were

fixed with 2% paraformaldehyde in 100 mM phosphate buffer, pH 7.4 for 1 hour, and
were permeabilized in phosphate-buffered saline 1% saponin 0.1% Triton-X100 3%
bovine serum albumin. L. monocytogenes were detected by incubation of samples with
biotin rabbit anti-L. monocytogenes (Accurate Chemical & Scientific Corp., Westbury,
NY; 1:100 overnight). Alexa-fluor conjugated streptavidin was used for secondary
detection (Molecular Probes, Eugene, Oregon 1:300, 2h). Actin was visualized by
incubating samples with Alexa-fluor conjugated phalloidins (Molecular Probes, 2h).
Intact tissue blocks were mounted with Vectashield mounting medium without prior
embedding and sectioning (Vector Laboratories, Burlingame, California) and imaged
with a confocal microscope (Bio-Rad, Hercules, CA) where optical sections were
taken at 0.5 µm resolution. Z-stacks were reconstructed into three-dimensions using
Volocity software (Improvision, Lexington, Massachusetts). Figures were assembled
with Photoshop software (Adobe, San Jose, California).
143
T3 attaaccctcactaaaggg Anneals 5' of inserts in pCR4 Blunt-TOPO. Used for sequencing..
Anneals ~700 bp 5' of inlA. Underlined BamHI site. (Bakardjiev et al.,

1 InlA_Coding_Forward cgggatccaacgagccaaccgtgg
2004)
Anneals ~ 180 3' of inlA. Underlined BamHI site. (Bakardjiev et al.,

2 InlA_Coding_Reverse cgggatcctctccgcttgtactttcgcc
2004)
3 InlAB_Coding_Reverse cgggatccttatttctgtgcccttaaattagc Anneals at 3' of inlB. Underlined BamHI site. (Bakardjiev et al., 2004)
4 InlA_seq_Forward ggagtatggattaacacgagcaa Anneals within inlA coding region.
5 InlA_seq_Reverse gtcattctcaaaggttgctgtgta Anneals within inlA coding region.
22 InlA_seq_Forward2 atgatttttcggatgcagg Anneals within inlA coding region.
23 InlA_seq_Forward3 attgactgaaccagctaagcc Anneals within inlA coding region.
47 InlA_S192N gctttcaggtttaactaatctacagcaattaaattttggtaatcaagtgacaga Quickchange mutagenesis of inlA
48 InlA_S192N_antisense tctgtcacttgattaccaaaatttaattgctgtagattagttaaacctgaaagc Quickchange mutagenesis of inlA
49 InlA_Y369S gtttaacaaagcttcaaagattatttttcagtaataacaaggtaagtgacgtaagctcac Quickchange mutagenesis of inlA
50 InlA_Y369S_antisense gtgagcttacgtcacttaccttgttattactgaaaaataatctttgaagctttgttaaac Quickchange mutagenesis of inlA
Anneals 5' to tRNAARG in L. monocytogenes genome. (Lauer et al.,

27 NC16 gtcaaaacatacgctcttatc
2002)
Anneals within PSAint in pPL2, pPL3 and pPL3e. Used with NC16 to
28 PL95 acataatcagtccaaagtagatgc
verify pPL2, pPL3 and pPL3e plasmid integration. (Lauer et al., 2002)
Anneals at 3' of transcriptional stop site of GFP. Used to amplify GFP

33 salI_gfpmut2_reverse aggtcgacttatttgtatagttc expression construct from DH-L1039. Underlined SalI site. (Shen and
Higgins, 2005)
Anneals at 5' of Hyper SPO1 promoter. Used to amplify GFP expression

construct from DH-L1039. (Shen and Higgins, 2005)

144

2C 10403S flaA::Tn4001 luxABCDE kmR (flaA-Lux kmR) (Hardy et al., 2004)
DP-L4404 10403S ∆inlAB (Bakardjiev et al., 2004)
LM 101 ∆inlAB + inlAm, GFP, cmR (this study)
LM 132 ∆inlAB + inlAm, GFP, cmR flaA-Lux kmR (this study)
LM 102 ∆inlAB + inlAm, GFP, emR (this study)
LM 106 ∆inlAB + inlAmB, GFP, cmR (this study)
LM138 ∆inlAB + inlAmB, GFP, cmR flaA-Lux kmR (this study)
LM 111 ∆inlAB + inlAmB, GFP, emR (this study)
LM 159 ∆inlAB + inlAm, emR (this study)
LM 163 ∆inlAB + inlAmB, emR (this study)
chloramphenicol resistant 7.5 µg/ml; emR, erythromycin resistant 5 µg/ml; kmR,
kanamycin resistant 30 µg/ml
145
RESULTS
DEVELOPMENT AND VERIFICATION OF L. MONOCYTOGENES STRAINS EXPRESSING INLAM,

INLB AND GFP
To clone and express transgenes in L. monocytogenes, we utilized constructs based on
a PSA prophage integrase operon. These constructs integrate at and reconstitute the
Listeria tRNAARG locus, and are thus an easy way to introduce trans genes into the
Listeria chromosome without disrupting gene coding regions (Lauer et al., 2002). We
utilized two tRNAARG site-specific shuttle integration vectors: pPL3, which confers
chloramphenicol resistance to Listeria, and pPL3e, which confers erythromycin
resistance. We also adapted the pPL3- and pPL3e-based GFP expression constructs,
pMP74 and pMP76, described in Chapter 4.
To express InlAm or InAm/InlB (InlAmB) in a ΔinlAB background, we first cloned inlA

or inlAB, including ~700bp of the 5’UTR encoding all promoters and the ribosomal
binding site, into TOPO cloning vectors. These constructs were subjected to site-
directed mutagenesis introducing the mouse adapted S192N and Y369S mutations into
inlA or inlAB making inlAm or inlAmB. inlAm or inlAmB were then cloned into the
BamHI site of pPL3, pPL3e, pMP74 and pMP76. The constructs with GFP are shown
in Figure 4.1A and Figure 4.1B. SM10 (λpir) E. coli, which expresses a conjugative
pilus, was transformed with expression constructs and mated with 10403S ΔinlAB.
GFP expression by L. monocytogenes was verified by epifluorescence or by

observation of colonies under a dissecting scope with a GFP filter. Traditional western
blot analysis or whole Listeria blot analysis were used to verify reconstitution of InlA
and InlB (Figure 5.1C, 5.1D, 5.1E). For whole Listeria blot analysis, bacteria are
grown on BHI agar plates. The bacterial cells are transferred to circular nitrocellulose
membranes, fixed, blocked and then probed with primary antibodies. We used a
previously characterized mouse monoclonal InlA antibody (CLP011AP; Cedarlane
Laboratories, Ontario, Canada (Rafelski and Theriot, 2006)) and we developed a
rabbit polyclonal InlB antibody (rabbit 4329, bleed2) from InlB-His6 provided by
146
Partho Ghosh (University of California, San Diego). Bots were probed with Alexa660
Anti-rabbit (pseudo-colored red) and anti-mouse800 (pseudo-colored green)
secondary antibodies were used and then scanned on the Odyssey Licor scanner
(Figure 5.1A, C). This is essentially low-resolution immunofluorescence of
immobilized bacteria; it is a rapid method for screening bacterial protein expression.
147
Figure 5.1: Construction of Expression Constructs and Verification of InlAm and InlB
Expression in
(A) tRNAARG integration constructs for expression of InlAm and GFP. (B)
tRNA ARG
integration constructs for expression of InlAm, InlB and GFP. (C)
Whole Listeria blot analysis of mouse adapted strains expressing GFP. The indicated
strains were transferred onto nitrocellulose and probed with mouse
anti-InlA antibodies and rabbit anti-InlB antibodies. Alexa660 Anti-rabbit (red) and
anti-mouse800 (green) secondary antibodies were used. Where both antibodies stain,
the merge is a combination of green and red, or yellow. (D) Traditional western blot
analysis of selected strains. (E) Whole blot analysis of mouse adapted strains
that do not express GFP
148
INLB PROMOTES ORAL INFECTION OF MICE

We used in vivo bioluminescence imaging (BLI) to assess the ability of InlB co-
expressed with InlAm to promote L. monocytogenes infection of mice via the oral
route. L. monocytogenes expressing the Photorhabdus luminescens lux operon
(luxABCDE) produce light without the addition of exogenous substrate (luciferin) and
bioluminescent L. monocytogenes have been used to visualize infection after
intravenous infection (Francis et al., 2000; Hardy et al., 2004; Hardy et al., 2006;
Riedel et al., 2007). We complemented ΔinlAB L. monocytogenes with either inlAm gfp
or inlAmB gfp (cmR, Figure 5.2) and also made these trains bioluminescent by phage
transduction of flaA::Tn4001 luxABCDE kan (flaA::lux) from donor strain 2C (Hardy
et al., 2004). Strains were grown overnight to stationary phase at 30 ˚C without
agitation in BHI broth, pelleted, resuspended in PBS, and administered to mice by oral
gavage with a feeding needle.
At a sublethal oral dose of 2X109 CFU, bioluminescent L. monocytogenes expressing

InlAm produce an infection originating as a focal signal from the lower abdomen. In
contrast to L. monocytogenes expressing only InlAm (absent InlB), L. monocytogenes
expressing InlAm and InlB have greater, more persistent signal in the abdomen during
the course of infection and develop signal from the spleen and gall bladder. This signal
represents replicative bacteria since BLI signal is maximal from L. monocytogenes in
logarithmic growth and since the BLI signal from orally inoculated mice increases
from day 1 to day 4-post infection (Figure 5.2A) (Hardy et al., 2004). InlB has been
shown to promote infection of the Liver in mice infected intravenously (Gaillard et al.,
1996; Khelef et al., 2006). However, liver infection alone does not account for the
differences in BLI signal between the Listeria strains within the first few days of
infection. As late as 3 days post infection, BLI signal from the liver remains low
(Figure 5.2B, 5.2C), while the majority of BLI signal originates from the
gastrointestinal tract and from the mesenteric lymph notes (Figure 5.2D, 5.2E). Thus,
InlB promotes murine oral infection in the absence of significant liver BLI signal in an
infection model where both InlA and InlB bind their respective receptors.
149
Figure 5.2: Analysis of the role of InlB in Oral Infections by Bioluminescence

Imaging
A) 1-week time course of infection of 8 week old female BALB/c mice infected with 2
X 109 m
(InlAm) or m
, (InlAmB)
. B) A mouse on day 3 post infection with 2 X 10 InlA B
9 m
was subsequently dissected and the organs analyzed: C) liver and

spleen, D) small intestine, cecum and colon, and E) mesenteric lymph nodes, without
and with luminescence overlay. The scale bars indicate pseudocolor representation
photons/second/cm2/steradian from a 5-minute exposure with a binning of 10.
150
INLB PROMOTES COLONIZATION OF THE VILLUS TIP EXTRUSION ZONE

We infected mice with ΔinlAB L. monocytogenes reconstituted for expression of InlAm
or InlAmB and also expressing GFP and examined infected villous tips within hours of
infection. In Figure 5.3 two separate mice were infected by oral gavage with 1010 L.
monocytogenes. Tissue from the terminal ileum was fixed and counterstained with
phalloidin for F-actin without previous embedding or sectioning and Listeria per
infected villus tip were enumerated (Figure 5.3). Mice infected with an InlAmB-
expressing strain have ~2X more Listeria per villous tip than mice infected with
Listeria expressing only InlAm (Figure 5.3 C).
We were concerned that these results were influenced by mouse-to-mouse variation in

infection or rates of peristalsis. Rather than analyzing tissue from many mice with
single infections, we performed co-infection experiments in which only one strain
expressed GFP and both strains were counterstained with biotin-anti-Listeria
antibodies and Alexa594 strepdavidin (red) (Figure 5.4 Figure 5.5). Thus, the GFP
expressing strain appears yellow (or a combination of red and green) in a merged
image and the non-GFP expressing strain appears red (Figure 5.4B, 5.4C, Figure 5.5B,
5.5C). As shown in figure 5.4, we infected numerous mice with a 1:1 ratio (5X109
each) of L. monocytogenes expressing InlAmB + GFP and of L. monocytogenes
expressing InlAm, but not InlB or GFP. In all coinfections, the villous tips infected
with the L. monocytogenes strain expressing InlB had significantly more intracellular
bacteria than villous tips infected with L. monocytogenes without InlB (Figure 5.4A).
Figure 5.4B and the insets in Figure 5.4C show neighboring villi infected with one or
the other strain. Villi infected with both strains were rare (<1 in 100 infected villi)
suggesting that the majority of bacterial plaques at villus tips arise from a single
invasive bacterium. To control for the efficacy of the antibody staining and for
possible effects of GFP on bacterial viability, we switched the strains in which GFP
was expressed. In Figure 5.5, a mouse was infected with a 1:1 ratio (5X109 each) of L.
monocytogenes expressing InlAm and GFP, but not InlB, and L. monocytogenes
expressing InlAm and InlB, but not GFP. As with the converse experiment, there are
more Listeria per villus tip infected by the InlB-expressing strain.
151
Figure 5.3: Single Infection of Mice with m

or m
A) Top panel, a 3D confocal reconstruction of an ileal villus tip of a Female BALB/c

mouse infected with a 1010 CFU m
for 5h. Bottom panels, z-sections
through the given depths and insets of intracellular associated with F-actin,
red. B) Top panel, a 3D confocal reconstruction of an ileal villus tip of a Female
BALB/c mouse infected with a 1010 CFU m
for 5h. Bottom panels, z-
sections through the given depths and insets of intracellular associated with F-
actin, red. Scale bars, 10 m. C) Quantification of Listeria per infected villus tip from
the single infections in A and B.
152
Figure 5.4: InlB-mediated Invasion of the Intestinal Villus Tips
7-9 week old female BALB/c mice were co-infected with a 1:1 ratio (5X109 CFU
each) m
and m
for 6h. Tissue from the terminal ileum was
stained with antibodies for all in red and with phalloidin for F-actin in blue.
A) Quantification of per infected villus tip for 3 mice. B) 3D confocal
reconstruction of infected villus tips. m
is red, m
appear
yellow or a combination of red/green in the merged image. C) 3D confocal
reconstruction of in large insets in B. D) 3D confocal reconstruction
and F-actin from small insets in B. Scale bars, 10 m.
153
Figure 5.5: Coinfection with m

and m
Tissue from the terminal ileum was stained with antibodies for all in red and
with phalloidin for F-actin in blue. A) Quantification of per infected villus tip.
B) 3D confocal reconstruction of infected villus tips. m
are red,
m
appear yellow or a combination of red/green in the merged image. C) A rare
villus tip infected with both strains. Scale bars, 10 m.
154
DISCUSSION
The murine model of systemic Listeriosis is one of the best-studied bacterial

infections; mice have been used as an important model to study the innate and
adaptive components of immunity that are important in controlling systemic
Listeriosis following intravenous or intraperitoneal inoculation (Pamer, 2004).
However, an understanding of the intestinal phase of invasion has lagged, since mice
infected intragastrically with L. monocytogenes are very resistant to infection (Lecuit
et al., 1999; Lecuit et al., 2001). It was found that a single amino acid in the E-
cadherin molecule of mice and rats renders cells from these species resistant to InlA-
mediated L. monocytogenes invasion (Lecuit et al., 1999). In Chapter 3, we analyzed
the targeting of MCJs and colonization of the villous tips of mice infected orally with
L. monocytogenes expressing an InlA variant that binds murine E-cadherin (InlAm)
(Wollert et al., 2007b). The ability of InlAm to bind murine E-cadherin makes it
possible to examine the role of InlB in oral infection of the mouse.
What is known about the role of InlB in mice? InlB has been implicated in Liver and,
more recently, placental infection after intravenous infection of mice (Dramsi et al.,
2004; Khelef et al., 2006). The current dogma is that InlA and InlB have evolved to
target different tissues at different stages of infection: InlA is required for intestinal
infection and is subsequently dispensable for invasive disease in non-pregnant
animals, while InlB primarily mediates invasion of other tissues, notably the liver
(Ireton, 2007; Schubert and Heinz, 2003). However, this simplistic model does not fit
all of the available data. First, c-Met, the receptor for InlB, is present on epithelia
among many tissues, suggesting that InlB may also promote infection of the
gastrointestinal tract (Di Renzo et al., 1991; Disson et al., 2008; Fukamachi et al.,
1994; Ishikawa et al., 2001; Kato et al., 1997a, b; Neo et al., 2005; Nusrat et al., 1994;
Sunitha et al., 1999; Wormstone et al., 2000). Second, InlB is coexpressed with InlA
in the intestinal tracts and also under the conditions simulating the gastrointestinal
environment (Garner et al., 2006; Kazmierczak et al., 2003; Kim et al., 2005; McGann
et al., 2007b; Sue et al., 2004; Toledo-Arana et al., 2009). Third, there is only in vitro
155
evidence that InlB promotes direct invasion of hepatocytes, while experiments

demonstrating the role of InlB infection of hepatocytes in vivo has relied on
intravenous infection of mice with doses greater than the LD50 resulting in bacteremia
(Dramsi et al., 2004; Gaillard et al., 1996).
Direct invasion of hepatocytes is unlikely since the majority of L. monocytogenes

traffic within cells while in the bloodstream and since free bacteria are taken up by
kupffer cells (tissue macrophages) in the liver (Bakardjiev et al., 2005; Bakardjiev et
al., 2006; Gregory et al., 2002; Mackaness, 1962). Furthermore InlB is dispensable,
while ActA is required, for replication within liver hepatocytes (Appelberg and Leal,
2000; Bakardjiev et al., 2005). Based on these data, a more consistent model is that L.
monocytogenes first invade the liver from within host immune cells by Actin/ActA-
mediated cell-to-cell spread. InlB could then promote reinfection of hepatocytes where
bacteria have caused zones of cell death and ActA-mediated cell-to-cell spread is
unavailable.
The dogma that InlB primarily promotes invasion of the liver and that InlA and InlB
promote different stages and locations of infection was recently challenged. In two
animal models permissive for both Internalins, a gerbil and a ‘humanized’ mouse
expressing mE-cadherinE16P, both InlA and InlB were found to be important for
fetoplacental infection (Disson et al., 2008). These results also highlighted the
importance of InlA mediated adherence for InlB function since a previous study in Wt
mice could not find a role for InlB in fetoplacental infection (Le Monnier et al., 2007).
However, the authors did not formally show that InlA and InlB mediated direct
invasion of syncytiotrophoblast maternal-fetal interface. Furthermore, direct invasion
from the blood is probably not the primary route of invasion of sycytiotrophoblasts
since free (extracellular) bacteria in the blood stream are rare and since an actA
mutants are much more highly attenuated for fetoplacental infection than inlAB
mutants (Bakardjiev et al., 2005; Bakardjiev et al., 2006; Le Monnier et al., 2007).
Even if InlB functions in the liver and placenta during systemic infection, it is
paradoxical that InlB would have evolved for that purpose; invasive disease carries a
156
high mortality rate and inability of L. monocytogenes to disseminate from a dead host
is arguably an evolutionary dead-end (Vazquez-Boland et al., 2001). Rather, it is more
likely that InlB evolved with InlA to promote intestinal infection/colonization. We
show in this chapter that contrary to current dogma, InlB does have a role in the
mammalian intestine. L. monocytogenes expressing InlAm in conjunction with InlB are
significantly more orally infectious to mice and also have higher initial colonization of
intestinal villous tips than L. monocytogenes expressing InlAm absent of InlB. How
does InlB promote colonization? In Chapter 3, we showed that InlA is critical for
targeting the intestinal villus tips. In chapter 4, we showed that InlB promotes invasion
of multicellular junctions but is subsequently dispensable for intracellular colonization
in a polarized MDCK model. We presume that InlB is also required only for invasion
of the epithelium in vivo. This would also imply that the process of cell extrusion from
the villus tips also exposes c-Met to the lumenal compartment.
The increase in invasion of the murine intestine due to InlB is small, but comparable
to the role of InlB for invasion of cultured epithelial cells (2-3X). It is not clear what
the effect of InlB is in other hosts. Although guinea pig and rabbit c-Met is not
activated by InlB, cows and sheep, common hosts for L. monocytogenes, are
permissive for c-Met activation by InlB (Disson et al., 2008). Ruminants are potential
asymptomatic carriers and shedders of L. monocytogenes (Nightingale et al., 2004;
Roberts and Wiedmann, 2003; Vazquez-Boland et al., 2001). To better understand the
natural biology and evolution of Listeria it will be important to determine whether
InlB also promotes the ability of Listeria to return to the environment via fecal
shedding.
157
CHAPTER 6 : QUESTIONS FOR FUTURE RESEARCH
This chapter will not review all of the data presented in this thesis since each result
chapter (Chapters 2-5) contains a discussion. Rather, this chapter will briefly highlight
some of the implications (as well as the shortfalls) of the research by outlining follow-
up studies and suggesting new avenues of research.
DO OTHER ENTERIC BACTERIA UTILIZE CELL EXTRUSION ZONES?
As discussed in the introduction, invasion of M-cells of the Peyer’s patches has been
the accepted model for intestinal barrier breach by a number of enteroinvasive
pathogens. However, if M-cells are naturally phagocytic, why have these pathogens
evolved such an extensive array of mechanisms to promote invasion of nonphagocytic
cells? There is growing evidence of Peyer’s patch independent routes of invasion. For
example, enteroinvasive Yersiniae are generally thought to invade the intestine
through the interaction between the bacterial protein Invasin and β1-integrin receptors
on the apical side of phagocytic M-cells (Autenrieth and Firsching, 1996; Clark et al.,
1998; Isberg and Leong, 1990; Isberg et al., 1987; Marra and Isberg, 1997). However,
this simplistic model is challenged by data showing that there are Invasin-independent
mechanisms of Peyer’s Patch invasion and that there are Peyer’s Patch-independent
routes of invasion of the small intestine (Barnes et al., 2006; Handley et al., 2005;
Marra and Isberg, 1997).
We have identified an alternative entry route across the epithelium that may serve as a
generalized entry point for other gastrointestinal pathogens. The normal
developmental cycle of the gastrointestinal epithelium includes the release of
senescent cells at specialized sites such as the intestinal villus tips (Figure 1.6B). In
order to maintain epithelial continuity the epithelial junctions are remodeled at these
sites, forming a multicellular junction. Basolateral receptors are transiently exposed
during cell extrusion and multicellular junction formation (Chapter 2, Chapter 3). We
158
found that Listeria monocytogenes take advantage of this junctional reorganization to

find basolateral receptors and invade these sites (Figure 2.X, Figure 3.X).
Although cell extrusion occurs within only a small portion of the epithelial surface
area, cell extrusion sites are relatively abundant if you consider the closely spaced
villous tips as an approximate epithelial surface at the interface of the intestinal lumen.
In addition, the villus tips are first site of interaction with the epithelium since they are
at or near the top of the mucus layer, which probably hinders bacterial motility
towards the lateral sides of intestinal villi or the intestinal crypts. In fact, translocation
through the mucus layer may be deadly since crypt Paneth cells produce antimicrobial
compounds that diffuse through the mucus (Ayabe et al., 2004; Cash et al., 2006).
Do other pathogens utilize sites of cell extrusion? At the very least, other microbes
clearly target multicellular junctions in tissue culture. We have observed that Invasin
targets Yersinia pseudotuberculosis and Yersinia enterocolitica to multicellular
junctions (Lee Shaughnessy, Brooke Lane, unpublished data). Furthermore, B. Brett
Finlay noted that numerous species of bacteria also target these sites in tissue culture
(personal conversation, 2006 Bay Area Microbial Pathogenesis Symposium). Do
multicellular junctions in tissue culture translate to the in vivo setting? Rotavirus,
which binds integrins, replicates within intestinal epithelium independent of M-cells
and Peyer’s patches (Ciarlet et al., 2002; Graham et al., 2003; Guerrero et al., 2000;
Hewish et al., 2000; Ijaz et al., 1989). Rotaviruses appear to directly invade the tips of
villi, although multicellular junctions as the subcellular site of invasion have not been
investigated (Ijaz et al., 1989). Additionally, Salmonella enterica serovar
Typhimurium, enterohemorrhagic E. coli and Shigella flexneri have all been observed
to interact with the villus tip epithelium (Meyerholz et al., 2002; Sansonetti and
Arondel, 1989; Tzipori et al., 1989). We propose that cell extrusion zones either at the
villous tips or within the colonic mucosa should be analyzed as a site of early invasion
for other enteric pathogens that utilize basolateral receptors.
159
ARE MULTICELLULAR JUNCTIONS INHERENTLY PERMISSIVE FOR

BACTERIAL UPTAKE IN VIVO?
Another rationale for why microbes might specifically utilize multicellular junctions is
that these sites may be inherently primed for endocytosis. This is especially important
for large particles such as bacteria. We found that multicellular junctions are highly
endocytic and HGF or InlB could modulate endocytosis in tissue culture. Junctional
endocytosis by cells neighboring extruding cells has been observed in vivo at the villus
tips (Madara, 1990). However, It is not known whether multicellular junctions at the
villus tips are also naturally endocytic to fluid phase dyes, soluble E-cadherin, or inert
particles and whether uptake can be modulated by HGF, InlB or inhibitors of
endocytosis. This could be investigated in an ileal loop assay combined with confocal
microscopy analyses.
WHAT ARE THE CELLULAR MOLECULAR MECHANISMS OF LISTERIA

INVASION OR JUNCTIONAL ENDOCYTOSIS AT MULTICELLULAR
JUNCTIONS?
Listeria invasion and junctional endocytosis at multicellular junctions are not

macropinocytic processes since they are both dependent on Dynamin (Swanson and
Watts, 1995). Listeria can be endocytosed through pathways that require Clathrin or
Caveolin (Bonazzi et al., 2008; Veiga and Cossart, 2005). Similarly constituents of the
apical junctional complex can be endocytosed through Clathrin or Caveolin coated
endocytic cups (Ivanov et al., 2004; Shen and Turner, 2005). Therefore, it is not fully
clear that the endocytosis of ZO-1 with E-cadherin at multicellular junctions utilizes
the same endocytic pathway as Listeria-E-cadherin endocytosis (although we expect
this to be the case). Furthermore, Listeria binding of E-cadherin may alter the
interaction of E-cadherin with cytoplasmic proteins since we have never observed
internalized Listeria to co-localize with ZO-1. Additionally, we don’t know which
other junctional proteins may be associated with E-cadherin endocytosis at
multicellular junctions. Of particular interest is whether transmembrane tight junction
proteins are co-internalized with E-cadherin at multicellular junctions. Luckily, it is
160
possible to address all of these issues with available reagents including specific
antibodies to junctional or endocytic components, expression constructs to express
fluorescently tagged junction proteins, fluorescently tagged Wt or dominant negative
variants of Dynamin, Clathrin, Epsin, and also pharmacological inhibitors of endocytic
pathways.
The discovery that Listeria can use Clathrin-mediated endocytosis raised the question
of how the volume of a bacterium is accommodated by endocytic machinery; Clathrin
coated endosomes are generally ~100 nm in diameter while bacteria are roughly 0.5
µm in diameter (Hinrichsen et al., 2006; Veiga and Cossart, 2005). We found that InlB
or HGF can increase the amount of endocytosed dextran in individual puncta at
multicellular junctions, suggesting that Listeria modulate or subvert Clathrin-mediated
endocytosis for efficient invasion. How might this work? There exists a certain
amount of elasticity for deformation within the Clathrin lattice. In addition, recent
work suggests that the relative concentrations of Clathrin and its associated adaptors
or scaffolding proteins can affect the underlying curvature of pits (Ford et al., 2002;
Hinrichsen et al., 2006). Ubiquitination of c-Met or E-cadherin may recruit Epsin,
while phosphoinositides downstream of c-Met phosphorylation and PI3K can recruit
the Clathrin adaptor AP-2 to the membrane (Fujita et al., 2002; Oldham et al., 2002;
Veiga and Cossart, 2005). Thus, InlB might alter the molecular
composition/architecture of the pit lattice. Although there is no experimental evidence,
it is thought that a high local cargo density could trigger invagination of larger coated
patches of membrane (Ungewickell and Hinrichsen, 2007). Thus it would be
interesting to study the protein composition of Listeria endosome with or without InlB
or to study InlB or HGF coated beads of different size and/or different protein density.
In addition to biochemical experiments, immunofluorescence quantification of relative
protein abundances or SEM of the cell cortices of ‘unroofed’ cells would also be
informative (Hinrichsen et al., 2006). How membrane curvature and endosome size
are established is an important question in the study of endocytosis for which Listeria
could provide answers.
161
HOW ARE BASOLATERAL RECEPTORS EXPOSED TO THE LUMENAL

SURFACE AT MULTICELLULAR JUNCTIONS?
E-cadherin is exposed at multicellular junctions and can be detected with an E-

cadherin antibody or InlA expressing Listeria. In addition, c-Met is also exposed at
multicellular junctions since addition of HGF or InlB to the apical side of polarized
MDCK monolayers results in increased endocytosis specifically at these sites. How
are these basolateral receptors localized at Multicellular junctions? Junction
remodeling could results in a loss of the tight junction fence function that restricts
mixing of apical and basolateral membrane constituents. However, unless E-cadherin
is specifically targeted to the apical surface (e.g. by expressing E-cadherin-Fc-GPI), L.
monocytogenes do not attach to the apical surface. Rather, Listeria target the
apicolateral surface closely associated with tight junctions. Therefore, an alternate
hypothesis for how basolateral proteins become exposed is that the process of tight
junction remodeling and reformation may involve interactions between tight junction
proteins, the scaffolding protein ZO-1 and E-cadherin that could result in E-cadherin
exposure on the apicolateral surface (Ando-Akatsuka et al., 1999; Rajasekaran et al.,
1996; Vogelmann and Nelson, 2005). The colocalization of ZO-1 and E-cadherin in
endocytic puncta originating at multicellular junctions also suggests that these proteins
were spatially close at the membrane. It would be interesting to determine the relative
subcellular locations and possible interactions of Tight and Adherens Junctions,
perhaps through Immuno-EM, FRET, or FRAP-based analyses.
Could Listeria also disrupt the apical junctions to gain access to basolateral receptors?
It has been suggested that Listeria target E-cadherin by disrupting the junctions with
InlB since c-Met activation can dismantle the epithelial junctions and alter cell
polarity (Balkovetz et al., 1997; Kamei et al., 1999). We did not find this to be the
case since adherence was rapid and independent of InlB. Furthermore, InlB promotion
of invasion is local to the bacterium after adherence. Additionally it would not make
much sense to target c-Met prior to E-cadherin binding since c-Met activation would
remove receptors by causing E-cadherin internalization (Chapter 4) (Fujita et al.,
2002; Kamei et al., 1999). Rather, we wonder whether the converse could be true:
162
InlA binding to E-cadherin exposes c-Met. InlA has a stronger binding affinity for E-
cadherin than other E-cadherin molecules and bacterial binding might locally unzip
the epithelial junction (Figure 1.6D). It would be interesting to determine whether
soluble InlA works like an E-cadherin function-blocking antibody to open intercellular
junctions (e.g. function blocking antibody rr1, which also competes for InlA binding
of E-cadherin) and whether treatment of polarized MDCK monolayers with soluble
InlA promotes internalization of ΔinlA L. monocytogenes or InlB coated beads.
HOW DO LISTERIA AND HOST CELLS INTERACT AT THE VILLOUS TIPS?
We used InlAm to target L. monocytogenes to the small intestinal villous tips of mice.
The ability of L. monocytogenes to carry out it’s entire intracellular infectious cycle
within the villus tip epithelium provides a great system for specifically analyzing the
interaction of Listeria with host cells in vivo. It is now possible to analyze the cell
biology of Listeria actin-based motility including the geometry of ‘comet tails’ or the
function of InlC in promoting cell-to cell spread in vivo (Engelbrecht et al., 1996;
Lacayo and Theriot, 2004; Rajabian, 2008; Shenoy et al., 2007). Local immune
responses to Listeria within the epithelium and cross talk between the epithelium and
the lamina propria could be addressed through laser-capture micro-dissection and
microarrays, or immunological techniques. Cell-to-cell spread of Listeria from the
epithelium to other cell types within the villus and also the translocation of Listeria
infected cells from the lamina propria to the bloodstream or lymphatics could be
studied with the 3D confocal microscopy techniques that we have pioneered.
ARE THE VILLUS TIPS A SITE OF COLONIZATION OR ASYMPTOMATIC

CARRIAGE?
On the one hand, L. monocytogenes is a formidable and prevalent invasive organism

that spreads from the intestine to distant tissues and is able to cross multiple epithelial
and endothelial barriers to reach the central nervous system or the placenta of pregnant
women. On the other hand, L. monocytogenes causes invasive disease in
163
immunocompetent individuals only rarely, after ingestion of very high numbers of

bacteria, and instead is shed asymptomatically by at least 1% of healthy humans
(Bojsen-Moller, 1972; Muller, 1990; Vazquez-Boland et al., 2001). Furthermore,
Listeria is thought to be a major cause of previously undiagnosed low-level
gastroenteritis and febrile enteritis. Listeria is also harbored in and shed from the
gastrointestinal tracts of many asymptomatic animals. Therefore, most of its
transmission occurs independently of invasive disease. It could be argued that invasive
disease is actually a dead-end in terms of transmission for this organism, unless
carcasses of infected animals serve as a significant source of L. monocytogenes
dissemination. Put another way, what is the evolutionary advantage of a deadly
intracellular pathogenic strategy?
Asymptomatic carriage of Listeria has only recently been given direct experimental
attention. One study in a murine model of infection found that L. monocytogenes
survive extracellularly in the lumen of the gall bladder (Hardy et al., 2004). Since
colonization of this anatomic site did not involve any of the known L. monocytogenes
adaptations for intracellular survival, our model of L. monocytogenes infection of the
cell extrusion zone may have more explanatory power. L. monocytogenes invasion of
the villous tips suggest that bacteria can chronically colonize these renewing sites and
can be shed into the lumen as the infected cells are extruded. The ability of Listeria to
spread from cell-to-cell using actin-based motility may be required and may have
evolved to maintain a balance between transmission within extruded cells and
expansion of the intracellular population within the live epithelium. In order to test
this model and to better understand the natural biology of Listeria infection and
transmission, it is critical to answer the following questions: How long does Listeria
colonize the villous tips? Does intestinal colonization occur in the absence of invasive
disease? Do the number of infected villi change over the course of colonization? Do
Listeria plaques at villus tips arise from single invasive bacteria (clonality and
stochasticity of infection)? Do infected animals shed Listeria in feces during infection,
asymptomatic or otherwise? Do specific bacterial factors, such as InlB or InlC,
contribute to the level or duration of intestinal colonization or shedding? All of these
164
questions are answerable using the techniques and technologies described in this
thesis.
165
BIBLIOGRAPHY
Agaisse, H., Burrack, L.S., Philips, J.A., Rubin, E.J., Perrimon, N., and Higgins, D.E.
(2005). Genome-wide RNAi screen for host factors required for intracellular
bacterial infection. Science 309, 1248-1251.
Amieva, M.R., Salama, N.R., Tompkins, L.S., and Falkow, S. (2002). Helicobacter
pylori enter and survive within multivesicular vacuoles of epithelial cells. Cell
Microbiol 4, 677-690.
Amieva, M.R., Vogelmann, R., Covacci, A., Tompkins, L.S., Nelson, W.J., and
Falkow, S. (2003). Disruption of the epithelial apical-junctional complex by
Helicobacter pylori CagA. Science 300, 1430-1434.
Amstutz, B., Gastaldelli, M., Kalin, S., Imelli, N., Boucke, K., Wandeler, E., Mercer,
J., Hemmi, S., and Greber, U.F. (2008). Subversion of CtBP1-controlled
macropinocytosis by human adenovirus serotype 3. Embo J 27, 956-969.
Anderson, J.M., Van Itallie, C.M., and Fanning, A.S. (2004). Setting up a selective
barrier at the apical junction complex. Curr Opin Cell Biol 16, 140-145.
Ando-Akatsuka, Y., Yonemura, S., Itoh, M., Furuse, M., and Tsukita, S. (1999).
Differential behavior of E-cadherin and occludin in their colocalization with ZO-1
during the establishment of epithelial cell polarity. J Cell Physiol 179, 115-125.
Appelberg, R., and Leal, I.S. (2000). Mutants of Listeria monocytogenes defective in
In vitro invasion and cell-to-cell spreading still invade and proliferate in hepatocytes
of neutropenic mice. Infect Immun 68, 912-914.
Auerbuch, V., Loureiro, J.J., Gertler, F.B., Theriot, J.A., and Portnoy, D.A. (2003).
Ena/VASP proteins contribute to Listeria monocytogenes pathogenesis by
controlling temporal and spatial persistence of bacterial actin-based motility. Mol
Microbiol 49, 1361-1375.
Austen, I. (2008). Canada Expands Recall of Cold Cuts and Raises Death Toll. In New
York Times.
Autenrieth, I.B., and Firsching, R. (1996). Penetration of M cells and destruction of
Peyer's patches by Yersinia enterocolitica: an ultrastructural and histological study. J
Med Microbiol 44, 285-294.
Ayabe, T., Ashida, T., Kohgo, Y., and Kono, T. (2004). The role of Paneth cells and
their antimicrobial peptides in innate host defense. Trends Microbiol 12, 394-398.
Babyatsky, M.W., and Podolsky, D.K. (2003). Growth and Development of the
Gastrointestinal Tract. In Textbook of Gastroenterology, T. Yamada, ed.
(Philadelphia, Lippincott Williams & Wilkins), pp. 521-556.
166
Bagnoli, F., Buti, L., Tompkins, L., Covacci, A., and Amieva, M.R. (2005).
Helicobacter pylori CagA induces a transition from polarized to invasive phenotypes
in MDCK cells. Proc Natl Acad Sci U S A 102, 16339-16344.
Bakardjiev, A.I., Stacy, B.A., Fisher, S.J., and Portnoy, D.A. (2004). Listeriosis in the
pregnant guinea pig: a model of vertical transmission. Infect Immun 72, 489-497.
Bakardjiev, A.I., Stacy, B.A., and Portnoy, D.A. (2005). Growth of Listeria
monocytogenes in the Guinea Pig Placenta and Role of Cell-to-Cell Spread in Fetal
Infection. J Infect Dis 191, 1889-1897.
Bakardjiev, A.I., Theriot, J.A., and Portnoy, D.A. (2006). Listeria monocytogenes
traffics from maternal organs to the placenta and back. PLoS Pathog 2, e66.
Balda, M.S., and Matter, K. (1998). Tight junctions. J Cell Sci 111 ( Pt 5), 541-547.
Balkovetz, D.F., Pollack, A.L., and Mostov, K.E. (1997). Hepatocyte growth factor
alters the polarity of Madin-Darby canine kidney cell monolayers. J Biol Chem 272,
3471-3477.
Banerjee, M., Copp, J., Vuga, D., Marino, M., Chapman, T., van der Geer, P., and
Ghosh, P. (2004). GW domains of the Listeria monocytogenes invasion protein InlB
are required for potentiation of Met activation. Mol Microbiol 52, 257-271.
Barnes, P.D., Bergman, M.A., Mecsas, J., and Isberg, R.R. (2006). Yersinia
pseudotuberculosis disseminates directly from a replicating bacterial pool in the
intestine. J Exp Med 203, 1591-1601.
Barragan, A., Brossier, F., and Sibley, L.D. (2005). Transepithelial migration of
Toxoplasma gondii involves an interaction of intercellular adhesion molecule 1
(ICAM-1) with the parasite adhesin MIC2. Cell Microbiol 7, 561-568.
Beauregard, K.E., Lee, K.D., Collier, R.J., and Swanson, J.A. (1997). pH-dependent
perforation of macrophage phagosomes by listeriolysin O from Listeria
monocytogenes. J Exp Med 186, 1159-1163.
Bergmann, B., Raffelsbauer, D., Kuhn, M., Goetz, M., Hom, S., and Goebel, W.
(2002). InlA- but not InlB-mediated internalization of Listeria monocytogenes by
non-phagocytic mammalian cells needs the support of other internalins. Mol
Bielecki, J., Youngman, P., Connelly, P., and Portnoy, D.A. (1990). Bacillus subtilis
expressing a haemolysin gene from Listeria monocytogenes can grow in mammalian
cells. Nature 345, 175-176.
Bierne, H., and Cossart, P. (2002). InlB, a surface protein of Listeria monocytogenes
that behaves as an invasin and a growth factor. J Cell Sci 115, 3357-3367.
Bierne, H., and Cossart, P. (2007). Listeria monocytogenes surface proteins: from
genome predictions to function. Microbiol Mol Biol Rev 71, 377-397.
Bierne, H., Gouin, E., Roux, P., Caroni, P., Yin, H.L., and Cossart, P. (2001). A role
for cofilin and LIM kinase in Listeria-induced phagocytosis. J Cell Biol 155, 101-
112.
167
Bierne, H., Miki, H., Innocenti, M., Scita, G., Gertler, F.B., Takenawa, T., and
Cossart, P. (2005). WASP-related proteins, Abi1 and Ena/VASP are required for
Listeria invasion induced by the Met receptor. J Cell Sci 118, 1537-1547.
Bierne, H., Sabet, C., Personnic, N., and Cossart, P. (2007). Internalins: a complex
family of leucine-rich repeat-containing proteins in Listeria monocytogenes.
Microbes Infect 9, 1156-1166.
Bojarski, C., Weiske, J., Schoneberg, T., Schroder, W., Mankertz, J., Schulzke, J.D.,
Florian, P., Fromm, M., Tauber, R., and Huber, O. (2004). The specific fates of tight
junction proteins in apoptotic epithelial cells. J Cell Sci 117, 2097-2107.
Bojsen-Moller, J. (1972). Human listeriosis. Diagnostic, epidemiological and clinical
studies. Acta Pathol Microbiol Scand [B] Microbiol Immunol Suppl 229, 1-157.
Boller, K., Vestweber, D., and Kemler, R. (1985). Cell-adhesion molecule uvomorulin
is localized in the intermediate junctions of adult intestinal epithelial cells. J Cell
Biol 100, 327-332.
Bonazzi, M., Spano, S., Turacchio, G., Cericola, C., Valente, C., Colanzi, A., Kweon,
H.S., Hsu, V.W., Polishchuck, E.V., Polishchuck, R.S., et al. (2005). CtBP3/BARS
drives membrane fission in dynamin-independent transport pathways. Nat Cell Biol
7, 570-580.
Bonazzi, M., Veiga, E., Pizarro-Cerda, J., and Cossart, P. (2008). Successive post-
translational modifications of E-cadherin are required for InlA-mediated
internalization of Listeria monocytogenes. Cell Microbiol 10, 2208-2222.
Bortolussi, R. (2008). Listeriosis: a primer. Cmaj 179, 795-797.
Botham, C.M., Wandler, A.M., and Guillemin, K. (2008). A transgenic Drosophila
model demonstrates that the Helicobacter pylori CagA protein functions as a
eukaryotic Gab adaptor. PLoS Pathog 4, e1000064.
Boyle, E.C., and Finlay, B.B. (2003). Bacterial pathogenesis: exploiting cellular
adherence. Curr Opin Cell Biol 15, 633-639.
Braun, L., Ghebrehiwet, B., and Cossart, P. (2000). gC1q-R/p32, a C1q-binding
protein, is a receptor for the InlB invasion protein of Listeria monocytogenes. Embo
J 19, 1458-1466.
Braun, L., Nato, F., Payrastre, B., Mazie, J.C., and Cossart, P. (1999). The 213-amino-
acid leucine-rich repeat region of the listeria monocytogenes InlB protein is
sufficient for entry into mammalian cells, stimulation of PI 3-kinase and membrane
ruffling. Mol Microbiol 34, 10-23.
Brundage, R.A., Smith, G.A., Camilli, A., Theriot, J.A., and Portnoy, D.A. (1993).
Expression and phosphorylation of the Listeria monocytogenes ActA protein in
mammalian cells. Proc Natl Acad Sci U S A 90, 11890-11894.
Bryant, D.M., Kerr, M.C., Hammond, L.A., Joseph, S.R., Mostov, K.E., Teasdale,
R.D., and Stow, J.L. (2007). EGF induces macropinocytosis and SNX1-modulated
recycling of E-cadherin. J Cell Sci 120, 1818-1828.
168
Bullen, T.F., Forrest, S., Campbell, F., Dodson, A.R., Hershman, M.J., Pritchard,
D.M., Turner, J.R., Montrose, M.H., and Watson, A.J. (2006). Characterization of
epithelial cell shedding from human small intestine. Lab Invest 86, 1052-1063.
Burrows, W., and Musteikis, G.M. (1966). Cholera infection and toxin in the rabbit
ileal loop. J Infect Dis 116, 183-190.
Cabanes, D., Dehoux, P., Dussurget, O., Frangeul, L., and Cossart, P. (2002). Surface
proteins and the pathogenic potential of Listeria monocytogenes. Trends Microbiol
10, 238-245.
Cabanes, D., Sousa, S., Cebria, A., Lecuit, M., Garcia-Del Portillo, F., and Cossart, P.
(2005). Gp96 is a receptor for a novel Listeria monocytogenes virulence factor, Vip,
a surface protein. Embo J.
Cameron, L.A., Giardini, P.A., Soo, F.S., and Theriot, J.A. (2000). Secrets of actin-
based motility revealed by a bacterial pathogen. Nat Rev Mol Cell Biol 1, 110-119.
Camilli, A., Tilney, L.G., and Portnoy, D.A. (1993). Dual roles of plcA in Listeria
monocytogenes pathogenesis. Mol Microbiol 8, 143-157.
Canada, P.H.A.o. (2009). Listeria monocytogenes outbreak. Final update: April 17,
2009.
Cash, H.L., Whitham, C.V., Behrendt, C.L., and Hooper, L.V. (2006). Symbiotic
bacteria direct expression of an intestinal bactericidal lectin. Science 313, 1126-
1130.
Cerny, A., Hugin, A.W., Bazin, H., Sutter, S., Hengartner, H., and Zinkernagel, R.M.
(1988). Anti-Listeria monocytogenes immunity in mu-suppressed mice: a
comparison of treatment with conventional hyperimmune rabbit anti-mouse IgM and
affinity-purified, monoclonal rat anti-mouse IgM. Med Microbiol Immunol 177,
123-131.
Chakraborty, T., Ebel, F., Domann, E., Niebuhr, K., Gerstel, B., Pistor, S., Temm-
Grove, C.J., Jockusch, B.M., Reinhard, M., Walter, U., et al. (1995). A focal
adhesion factor directly linking intracellularly motile Listeria monocytogenes and
Listeria ivanovii to the actin-based cytoskeleton of mammalian cells. Embo J 14,
1314-1321.
Chakraborty, T., Leimeister-Wachter, M., Domann, E., Hartl, M., Goebel, W.,
Nichterlein, T., and Notermans, S. (1992). Coordinate regulation of virulence genes
in Listeria monocytogenes requires the product of the prfA gene. J Bacteriol 174,
568-574.
Chico-Calero, I., Suarez, M., Gonzalez-Zorn, B., Scortti, M., Slaghuis, J., Goebel, W.,
and Vazquez-Boland, J.A. (2002). Hpt, a bacterial homolog of the microsomal
glucose- 6-phosphate translocase, mediates rapid intracellular proliferation in
Listeria. Proc Natl Acad Sci U S A 99, 431-436.
Ciarlet, M., Crawford, S.E., Cheng, E., Blutt, S.E., Rice, D.A., Bergelson, J.M., and
Estes, M.K. (2002). VLA-2 (alpha2beta1) integrin promotes rotavirus entry into
cells but is not necessary for rotavirus attachment. J Virol 76, 1109-1123.
169
Clark, M.A., Hirst, B.H., and Jepson, M.A. (1998). M-cell surface beta1 integrin
expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse
Peyer's patch M cells. Infect Immun 66, 1237-1243.
Clark, M.A., and Jepson, M.A. (2003). Intestinal M cells and their role in bacterial
infection. Int J Med Microbiol 293, 17-39.
Copp, J., Marino, M., Banerjee, M., Ghosh, P., and van der Geer, P. (2003). Multiple
regions of internalin B contribute to its ability to turn on the Ras-mitogen-activated
protein kinase pathway. J Biol Chem 278, 7783-7789.
Corfe, B.M., Dive, C., and Garrod, D.R. (2000). Changes in intercellular junctions
during apoptosis precede nuclear condensation or phosphatidylserine exposure on
the cell surface. Cell Death Differ 7, 234-235.
Cossart, P., Pizarro-Cerda, J., and Lecuit, M. (2003). Invasion of mammalian cells by
Listeria monocytogenes: functional mimicry to subvert cellular functions. Trends
Cell Biol 13, 23-31.
Coyne, C.B., Shen, L., Turner, J.R., and Bergelson, J.M. (2007). Coxsackievirus entry
across epithelial tight junctions requires occludin and the small GTPases Rab34 and
Rab5. Cell Host Microbe 2, 181-192.
Cozzolino, M., Stagni, V., Spinardi, L., Campioni, N., Fiorentini, C., Salvati, E.,
Alema, S., and Salvatore, A.M. (2003). p120 Catenin is required for growth factor-
dependent cell motility and scattering in epithelial cells. Mol Biol Cell 14, 1964-
1977.
Crepaldi, T., Pollack, A.L., Prat, M., Zborek, A., Mostov, K., and Comoglio, P.M.
(1994). Targeting of the SF/HGF receptor to the basolateral domain of polarized
epithelial cells. J Cell Biol 125, 313-320.
Cudmore, S., Cossart, P., Griffiths, G., and Way, M. (1995). Actin-based motility of
vaccinia virus. Nature 378, 636-638.
D'Souza-Schorey, C. (2005). Disassembling adherens junctions: breaking up is hard to
do. Trends Cell Biol 15, 19-26.
da Silva Tatley, F., Aldwell, F.E., Dunbier, A.K., and Guilford, P.J. (2003). N-
terminal E-cadherin peptides act as decoy receptors for Listeria monocytogenes.
Infect Immun 71, 1580-1583.
Dabiri, G.A., Sanger, J.M., Portnoy, D.A., and Southwick, F.S. (1990). Listeria
monocytogenes moves rapidly through the host-cell cytoplasm by inducing
directional actin assembly. Proc Natl Acad Sci U S A 87, 6068-6072.
de Beco, S., Gueudry, C., Amblard, F., and Coscoy, S. (2009). Endocytosis is required
for E-cadherin redistribution at mature adherens junctions. Proc Natl Acad Sci U S
A.
De, S.N., and Chatterje, D.N. (1953). An experimental study of the mechanism of
action of Vibriod cholerae on the intestinal mucous membrane. J Pathol Bacteriol
66, 559-562.
170
Dean, P., and Kenny, B. (2004). Intestinal barrier dysfunction by enteropathogenic

Escherichia coli is mediated by two effector molecules and a bacterial surface
protein. Mol Microbiol 54, 665-675.
Dehio, C., Prevost, M.C., and Sansonetti, P.J. (1995). Invasion of epithelial cells by
Shigella flexneri induces tyrosine phosphorylation of cortactin by a pp60c-src-
mediated signalling pathway. Embo J 14, 2471-2482.
Di Renzo, M.F., Narsimhan, R.P., Olivero, M., Bretti, S., Giordano, S., Medico, E.,
Gaglia, P., Zara, P., and Comoglio, P.M. (1991). Expression of the Met/HGF
receptor in normal and neoplastic human tissues. Oncogene 6, 1997-2003.
Disson, O., Grayo, S., Huillet, E., Nikitas, G., Langa-Vives, F., Dussurget, O., Ragon,
M., Le Monnier, A., Babinet, C., Cossart, P., et al. (2008). Conjugated action of two
species-specific invasion proteins for fetoplacental listeriosis. Nature 455, 1114-
1118.
Domann, E., Wehland, J., Rohde, M., Pistor, S., Hartl, M., Goebel, W., Leimeister-
Wachter, M., Wuenscher, M., and Chakraborty, T. (1992). A novel bacterial
virulence gene in Listeria monocytogenes required for host cell microfilament
interaction with homology to the proline-rich region of vinculin. Embo J 11, 1981-
1990.
Domann, E., Zechel, S., Lingnau, A., Hain, T., Darji, A., Nichterlein, T., Wehland, J.,
and Chakraborty, T. (1997). Identification and characterization of a novel PrfA-
regulated gene in Listeria monocytogenes whose product, IrpA, is highly
homologous to internalin proteins, which contain leucine-rich repeats. Infect Immun
65, 101-109.
Dowrick, P., Kenworthy, P., McCann, B., and Warn, R. (1993). Circular ruffle
formation and closure lead to macropinocytosis in hepatocyte growth factor/scatter
factor-treated cells. Eur J Cell Biol 61, 44-53.
Dramsi, S., Biswas, I., Maguin, E., Braun, L., Mastroeni, P., and Cossart, P. (1995).
Entry of Listeria monocytogenes into hepatocytes requires expression of inIB, a
surface protein of the internalin multigene family. Mol Microbiol 16, 251-261.
Dramsi, S., Bourdichon, F., Cabanes, D., Lecuit, M., Fsihi, H., and Cossart, P. (2004).
FbpA, a novel multifunctional Listeria monocytogenes virulence factor. Mol
Dramsi, S., and Cossart, P. (2003). Listeriolysin O-mediated calcium influx
potentiates entry of Listeria monocytogenes into the human Hep-2 epithelial cell
line. Infect Immun 71, 3614-3618.
Dramsi, S., Dehoux, P., Lebrun, M., Goossens, P.L., and Cossart, P. (1997).
Identification of four new members of the internalin multigene family of Listeria
monocytogenes EGD. Infect Immun 65, 1615-1625.
Drees, F., Pokutta, S., Yamada, S., Nelson, W.J., and Weis, W.I. (2005). Alpha-
catenin is a molecular switch that binds E-cadherin-beta-catenin and regulates actin-
filament assembly. Cell 123, 903-915.
171
Dussurget, O., Cabanes, D., Dehoux, P., Lecuit, M., Buchrieser, C., Glaser, P., and
Cossart, P. (2002). Listeria monocytogenes bile salt hydrolase is a PrfA-regulated
virulence factor involved in the intestinal and hepatic phases of listeriosis. Mol
Microbiol 45, 1095-1106.
Engelbrecht, F., Chun, S.K., Ochs, C., Hess, J., Lottspeich, F., Goebel, W., and
Sokolovic, Z. (1996). A new PrfA-regulated gene of Listeria monocytogenes
encoding a small, secreted protein which belongs to the family of internalins. Mol
Esteban, J.I., Oporto, B., Aduriz, G., Juste, R.A., and Hurtado, A. (2009). Faecal
shedding and strain diversity of Listeria monocytogenes in healthy ruminants and
swine in Northern Spain. BMC Vet Res 5, 2.
Farber, J.M., and Peterkin, P.I. (1991). Listeria monocytogenes, a food-borne
pathogen. Microbiol Rev 55, 476-511.
Fenlon, D.R. (1985). Wild birds and silage as reservoirs of Listeria in the agricultural
environment. J Appl Bacteriol 59, 537-543.
Fenlon, D.R. (1986). Rapid quantitative assessment of the distribution of Listeria in
silage implicated in a suspected outbreak of listeriosis in calves. Vet Rec 118, 240-
242.
Finlay, B.B., Fry, J., Rock, E.P., and Falkow, S. (1989). Passage of Salmonella
through polarized epithelial cells: role of the host and bacterium. J Cell Sci Suppl
11, 99-107.
Finlay, B.B., Ruschkowski, S., and Dedhar, S. (1991). Cytoskeletal rearrangements
accompanying salmonella entry into epithelial cells. J Cell Sci 99 ( Pt 2), 283-296.
Ford, M.G., Mills, I.G., Peter, B.J., Vallis, Y., Praefcke, G.J., Evans, P.R., and
McMahon, H.T. (2002). Curvature of clathrin-coated pits driven by epsin. Nature
419, 361-366.
Francis, C.L., Starnbach, M.N., and Falkow, S. (1992). Morphological and
cytoskeletal changes in epithelial cells occur immediately upon interaction with
Salmonella typhimurium grown under low-oxygen conditions. Mol Microbiol 6,
3077-3087.
Francis, K.P., Joh, D., Bellinger-Kawahara, C., Hawkinson, M.J., Purchio, T.F., and
Contag, P.R. (2000). Monitoring bioluminescent Staphylococcus aureus infections
in living mice using a novel luxABCDE construct. Infect Immun 68, 3594-3600.
Freitag, N.E., and Jacobs, K.E. (1999). Examination of Listeria monocytogenes
intracellular gene expression by using the green fluorescent protein of Aequorea
victoria. Infect Immun 67, 1844-1852.
Fujita, Y., Krause, G., Scheffner, M., Zechner, D., Leddy, H.E., Behrens, J., Sommer,
T., and Birchmeier, W. (2002). Hakai, a c-Cbl-like protein, ubiquitinates and
induces endocytosis of the E-cadherin complex. Nat Cell Biol 4, 222-231.
Fukamachi, H., Ichinose, M., Tsukada, S., Kakei, N., Suzuki, T., Miki, K., Kurokawa,
K., and Masui, T. (1994). Hepatocyte growth factor region specifically stimulates
172
gastro-intestinal epithelial growth in primary culture. Biochem Biophys Res

Commun 205, 1445-1451.
Gaillard, J.L., Berche, P., Frehel, C., Gouin, E., and Cossart, P. (1991). Entry of L.
monocytogenes into cells is mediated by internalin, a repeat protein reminiscent of
surface antigens from gram-positive cocci. Cell 65, 1127-1141.
Gaillard, J.L., and Finlay, B.B. (1996). Effect of cell polarization and differentiation
on entry of Listeria monocytogenes into the enterocyte-like Caco-2 cell line. Infect
Immun 64, 1299-1308.
Gaillard, J.L., Jaubert, F., and Berche, P. (1996). The inlAB locus mediates the entry
of Listeria monocytogenes into hepatocytes in vivo. J Exp Med 183, 359-369.
Galan, J.E. (2000). Alternative strategies for becoming an insider: lessons from the
bacterial world. Cell 103, 363-366.
Garcia-Perez, B.E., Hernandez-Gonzalez, J.C., Garcia-Nieto, S., and Luna-Herrera, J.
(2008). Internalization of a non-pathogenic mycobacteria by macropinocytosis in
human alveolar epithelial A549 cells. Microb Pathog 45, 1-6.
Garcia-Perez, B.E., Mondragon-Flores, R., and Luna-Herrera, J. (2003).
Internalization of Mycobacterium tuberculosis by macropinocytosis in non-
phagocytic cells. Microb Pathog 35, 49-55.
Garner, M.R., Njaa, B.L., Wiedmann, M., and Boor, K.J. (2006). Sigma B contributes
to Listeria monocytogenes gastrointestinal infection but not to systemic spread in the
guinea pig infection model. Infect Immun 74, 876-886.
Ginocchio, C.C., Olmsted, S.B., Wells, C.L., and Galan, J.E. (1994). Contact with
epithelial cells induces the formation of surface appendages on Salmonella
typhimurium. Cell 76, 717-724.
Gitter, A.H., Bendfeldt, K., Schulzke, J.D., and Fromm, M. (2000). Leaks in the
epithelial barrier caused by spontaneous and TNF-alpha-induced single-cell
apoptosis. Faseb J 14, 1749-1753.
Glomski, I.J., Decatur, A.L., and Portnoy, D.A. (2003). Listeria monocytogenes
mutants that fail to compartmentalize listerolysin O activity are cytotoxic, avirulent,
and unable to evade host extracellular defenses. Infect Immun 71, 6754-6765.
Glomski, I.J., Gedde, M.M., Tsang, A.W., Swanson, J.A., and Portnoy, D.A. (2002).
The Listeria monocytogenes hemolysin has an acidic pH optimum to
compartmentalize activity and prevent damage to infected host cells. J Cell Biol 156,
1029-1038.
Goetz, M., Bubert, A., Wang, G., Chico-Calero, I., Vazquez-Boland, J.A., Beck, M.,
Slaghuis, J., Szalay, A.A., and Goebel, W. (2001). Microinjection and growth of
bacteria in the cytosol of mammalian host cells. Proc Natl Acad Sci U S A 98,
12221-12226.
Gombas, D.E., Chen, Y., Clavero, R.S., and Scott, V.N. (2003). Survey of Listeria
monocytogenes in ready-to-eat foods. J Food Prot 66, 559-569.
173
Gordon, J.I., and Hermiston, M.L. (1994). Differentiation and self-renewal in the
mouse gastrointestinal epithelium. Curr Opin Cell Biol 6, 795-803.
Gottlieb, S.L., Newbern, E.C., Griffin, P.M., Graves, L.M., Hoekstra, R.M., Baker,
N.L., Hunter, S.B., Holt, K.G., Ramsey, F., Head, M., et al. (2006). Multistate
outbreak of Listeriosis linked to turkey deli meat and subsequent changes in US
regulatory policy. Clin Infect Dis 42, 29-36.
Graham, K.L., Halasz, P., Tan, Y., Hewish, M.J., Takada, Y., Mackow, E.R.,
Robinson, M.K., and Coulson, B.S. (2003). Integrin-using rotaviruses bind
alpha2beta1 integrin alpha2 I domain via VP4 DGE sequence and recognize
alphaXbeta2 and alphaVbeta3 by using VP7 during cell entry. J Virol 77, 9969-
9978.
Gray, M.L., and Killinger, A.H. (1966). Listeria monocytogenes and listeric
infections. Bacteriol Rev 30, 309-382.
Gregory, S.H., Cousens, L.P., van Rooijen, N., Dopp, E.A., Carlos, T.M., and Wing,
E.J. (2002). Complementary adhesion molecules promote neutrophil-Kupffer cell
interaction and the elimination of bacteria taken up by the liver. J Immunol 168,
308-315.
Gregory, S.H., Sagnimeni, A.J., and Wing, E.J. (1997). Internalin B promotes the
replication of Listeria monocytogenes in mouse hepatocytes. Infect Immun 65,
5137-5141.
Greiffenberg, L., Goebel, W., Kim, K.S., Weiglein, I., Bubert, A., Engelbrecht, F.,
Stins, M., and Kuhn, M. (1998). Interaction of Listeria monocytogenes with human
brain microvascular endothelial cells: InlB-dependent invasion, long-term
intracellular growth, and spread from macrophages to endothelial cells. Infect
Immun 66, 5260-5267.
Grisendi, S., Arpin, M., and Crepaldi, T. (1998). Effect of hepatocyte growth factor on
assembly of zonula occludens-1 protein at the plasma membrane. J Cell Physiol 176,
465-471.
Grossmann, J., Walther, K., Artinger, M., Rummele, P., Woenckhaus, M., and
Scholmerich, J. (2002). Induction of apoptosis before shedding of human intestinal
epithelial cells. Am J Gastroenterol 97, 1421-1428.
Gruenheid, S., and Finlay, B.B. (2003). Microbial pathogenesis and cytoskeletal
function. Nature 422, 775-781.
Guerrero, C.A., Mendez, E., Zarate, S., Isa, P., Lopez, S., and Arias, C.F. (2000).
Integrin alpha(v)beta(3) mediates rotavirus cell entry. Proc Natl Acad Sci U S A 97,
14644-14649.
Gumbiner, B., and Simons, K. (1986). A functional assay for proteins involved in
establishing an epithelial occluding barrier: identification of a uvomorulin-like
polypeptide. J Cell Biol 102, 457-468.
Gumbiner, B., and Simons, K. (1987). The role of uvomorulin in the formation of
epithelial occluding junctions. Ciba Found Symp 125, 168-186.
174
Hamon, M., Bierne, H., and Cossart, P. (2006). Listeria monocytogenes: a

multifaceted model. Nat Rev Microbiol 4, 423-434.
Handley, S.A., Newberry, R.D., and Miller, V.L. (2005). Yersinia enterocolitica
invasin-dependent and invasin-independent mechanisms of systemic dissemination.
Hardy, J., Francis, K.P., DeBoer, M., Chu, P., Gibbs, K., and Contag, C.H. (2004).
Extracellular replication of Listeria monocytogenes in the murine gall bladder.
Science 303, 851-853.
Hardy, J., Margolis, J.J., and Contag, C.H. (2006). Induced biliary excretion of
Listeria monocytogenes. Infect Immun 74, 1819-1827.
Hartsock, A., and Nelson, W.J. (2008). Adherens and tight junctions: structure,
function and connections to the actin cytoskeleton. Biochim Biophys Acta 1778,
660-669.
Hatakeyama, M. (2003a). Helicobacter pylori CagA as a potential bacterial
oncoprotein in gastric carcinogenesis. Pathol Biol (Paris) 51, 393-394.
Hatakeyama, M. (2003b). Helicobacter pylori CagA--a potential bacterial oncoprotein
that functionally mimics the mammalian Gab family of adaptor proteins. Microbes
Infect 5, 143-150.
Haussinger, D., Ahrens, T., Aberle, T., Engel, J., Stetefeld, J., and Grzesiek, S. (2004).
Proteolytic E-cadherin activation followed by solution NMR and X-ray
crystallography. Embo J 23, 1699-1708.
Henry, R., Shaughnessy, L., Loessner, M.J., Alberti-Segui, C., Higgins, D.E., and
Swanson, J.A. (2006). Cytolysin-dependent delay of vacuole maturation in
macrophages infected with Listeria monocytogenes. Cell Microbiol 8, 107-119.
Hewish, M.J., Takada, Y., and Coulson, B.S. (2000). Integrins alpha2beta1 and
alpha4beta1 can mediate SA11 rotavirus attachment and entry into cells. J Virol 74,
228-236.
Hinrichsen, L., Meyerholz, A., Groos, S., and Ungewickell, E.J. (2006). Bending a
membrane: how clathrin affects budding. Proc Natl Acad Sci U S A 103, 8715-8720.
Huleatt, J.W., Pilip, I., Kerksiek, K., and Pamer, E.G. (2001). Intestinal and splenic T
cell responses to enteric Listeria monocytogenes infection: distinct repertoires of
responding CD8 T lymphocytes. J Immunol 166, 4065-4073.
Husu, J.R. (1990). Epidemiological studies on the occurrence of Listeria
monocytogenes in the feces of dairy cattle. Zentralbl Veterinarmed B 37, 276-282.
Ijaz, M.K., Dent, D., Haines, D., and Babiuk, L.A. (1989). Development of a murine
model to study the pathogenesis of rotavirus infection. Exp Mol Pathol 51, 186-204.
Ireton, K. (2007). Entry of the bacterial pathogen Listeria monocytogenes into
mammalian cells. Cell Microbiol 9, 1365-1375.
175
Ireton, K., Payrastre, B., Chap, H., Ogawa, W., Sakaue, H., Kasuga, M., and Cossart,
P. (1996). A role for phosphoinositide 3-kinase in bacterial invasion. Science 274,
780-782.
Ireton, K., Payrastre, B., and Cossart, P. (1999). The Listeria monocytogenes protein
InlB is an agonist of mammalian phosphoinositide 3-kinase. J Biol Chem 274,
17025-17032.
Isberg, R.R., and Leong, J.M. (1990). Multiple beta 1 chain integrins are receptors for
invasin, a protein that promotes bacterial penetration into mammalian cells. Cell 60,
861-871.
Isberg, R.R., Voorhis, D.L., and Falkow, S. (1987). Identification of invasin: a protein
that allows enteric bacteria to penetrate cultured mammalian cells. Cell 50, 769-778.
Ishikawa, K.S., Masui, T., Ishikawa, K., and Shiojiri, N. (2001). Immunolocalization
of hepatocyte growth factor and its receptor (c-Met) during mouse liver
development. Histochem Cell Biol 116, 453-462.
Ivanov, A.I., Nusrat, A., and Parkos, C.A. (2004). Endocytosis of epithelial apical
junctional proteins by a clathrin-mediated pathway into a unique storage
compartment. Mol Biol Cell 15, 176-188.
Izumi, G., Sakisaka, T., Baba, T., Tanaka, S., Morimoto, K., and Takai, Y. (2004).
Endocytosis of E-cadherin regulated by Rac and Cdc42 small G proteins through
IQGAP1 and actin filaments. J Cell Biol 166, 237-248.
Jaradat, Z.W., Wampler, J.W., and Bhunia, A.W. (2003). A Listeria adhesion protein-
deficient Listeria monocytogenes strain shows reduced adhesion primarily to
intestinal cell lines. Med Microbiol Immunol (Berl) 192, 85-91.
Jarrett, O., Stow, J.L., Yap, A.S., and Key, B. (2002). Dynamin-dependent
endocytosis is necessary for convergent-extension movements in Xenopus animal
cap explants. Int J Dev Biol 46, 467-473.
Jensen, V.B., Harty, J.T., and Jones, B.D. (1998). Interactions of the invasive
pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri
with M cells and murine Peyer's patches. Infect Immun 66, 3758-3766.
Jones, B.D., Ghori, N., and Falkow, S. (1994). Salmonella typhimurium initiates
murine infection by penetrating and destroying the specialized epithelial M cells of
the Peyer's patches. J Exp Med 180, 15-23.
Jonquieres, R., Bierne, H., Fiedler, F., Gounon, P., and Cossart, P. (1999). Interaction
between the protein InlB of Listeria monocytogenes and lipoteichoic acid: a novel
mechanism of protein association at the surface of gram-positive bacteria. Mol
Jonquieres, R., Pizarro-Cerda, J., and Cossart, P. (2001). Synergy between the N- and
C-terminal domains of InlB for efficient invasion of non-phagocytic cells by Listeria
monocytogenes. Mol Microbiol 42, 955-965.
Kamei, T., Matozaki, T., Sakisaka, T., Kodama, A., Yokoyama, S., Peng, Y.F.,
Nakano, K., Takaishi, K., and Takai, Y. (1999). Coendocytosis of cadherin and c-
176
Met coupled to disruption of cell-cell adhesion in MDCK cells--regulation by Rho,

Rac and Rab small G proteins. Oncogene 18, 6776-6784.
Karunasagar, I., Senghaas, B., Krohne, G., and Goebel, W. (1994). Ultrastructural
study of Listeria monocytogenes entry into cultured human colonic epithelial cells.
Kato, Y., Yu, D., Lukish, J.R., and Schwartz, M.Z. (1997a). Hepatocyte growth factor
enhances intestinal mucosal cell function and mass in vivo. J Pediatr Surg 32, 991-
994.
Kato, Y., Yu, D., Lukish, J.R., and Schwartz, M.Z. (1997b). Influence of luminal
hepatocyte growth factor on small intestine mucosa in vivo. J Surg Res 71, 49-53.
Kazmierczak, M.J., Mithoe, S.C., Boor, K.J., and Wiedmann, M. (2003). Listeria
monocytogenes sigma B regulates stress response and virulence functions. J
Bacteriol 185, 5722-5734.
Keller, S.H., and Nigam, S.K. (2003). Biochemical processing of E-cadherin under
cellular stress. Biochem Biophys Res Commun 307, 215-223.
Ketterer, M.R., Shao, J.Q., Hornick, D.B., Buscher, B., Bandi, V.K., and Apicella,
M.A. (1999). Infection of primary human bronchial epithelial cells by Haemophilus
influenzae: macropinocytosis as a mechanism of airway epithelial cell entry. Infect
Immun 67, 4161-4170.
Khelef, N., Lecuit, M., Bierne, H., and Cossart, P. (2006). Species specificity of the
Listeria monocytogenes InlB protein. Cell Microbiol 8, 457-470.
Kim, H., Boor, K.J., and Marquis, H. (2004). Listeria monocytogenes sigmaB
contributes to invasion of human intestinal epithelial cells. Infect Immun 72, 7374-
7378.
Kim, H., Marquis, H., and Boor, K.J. (2005). SigmaB contributes to Listeria
monocytogenes invasion by controlling expression of inlA and inlB. Microbiology
151, 3215-3222.
Kocks, C., and Cossart, P. (1993). Directional actin assembly by Listeria
monocytogenes at the site of polar surface expression of the actA gene product
involving the actin-bundling protein plastin (fimbrin). Infect Agents Dis 2, 207-209.
Kocks, C., Gouin, E., Tabouret, M., Berche, P., Ohayon, H., and Cossart, P. (1992). L.
monocytogenes-induced actin assembly requires the actA gene product, a surface
protein. Cell 68, 521-531.
Kocks, C., Hellio, R., Gounon, P., Ohayon, H., and Cossart, P. (1993). Polarized
distribution of Listeria monocytogenes surface protein ActA at the site of directional
actin assembly. J Cell Sci 105 ( Pt 3), 699-710.
Lacayo, C.I., and Theriot, J.A. (2004). Listeria monocytogenes actin-based motility
varies depending on subcellular location: a kinematic probe for cytoarchitecture.
Mol Biol Cell 15, 2164-2175.
177
Lang, L.H. (2006). FDA approves use of bacteriophages to be added to meat and
poultry products. Gastroenterology 131, 1370.
Lauer, P., Chow, M.Y., Loessner, M.J., Portnoy, D.A., and Calendar, R. (2002).
Construction, characterization, and use of two Listeria monocytogenes site-specific
phage integration vectors. J Bacteriol 184, 4177-4186.
Laukoetter, M.G., Bruewer, M., and Nusrat, A. (2006). Regulation of the intestinal
epithelial barrier by the apical junctional complex. Curr Opin Gastroenterol 22, 85-
89.
Le Monnier, A., Autret, N., Join-Lambert, O.F., Jaubert, F., Charbit, A., Berche, P.,
and Kayal, S. (2007). ActA is required for crossing of the fetoplacental barrier by
Listeria monocytogenes. Infect Immun 75, 950-957.
Le, T.L., Yap, A.S., and Stow, J.L. (1999). Recycling of E-cadherin: a potential
mechanism for regulating cadherin dynamics. J Cell Biol 146, 219-232.
Lebrun, M., Mengaud, J., Ohayon, H., Nato, F., and Cossart, P. (1996). Internalin
must be on the bacterial surface to mediate entry of Listeria monocytogenes into
epithelial cells. Mol Microbiol 21, 579-592.
Lecuit, M., Dramsi, S., Gottardi, C., Fedor-Chaiken, M., Gumbiner, B., and Cossart,
P. (1999). A single amino acid in E-cadherin responsible for host specificity towards
the human pathogen Listeria monocytogenes. Embo J 18, 3956-3963.
Lecuit, M., Hurme, R., Pizarro-Cerda, J., Ohayon, H., Geiger, B., and Cossart, P.
(2000). A role for alpha-and beta-catenins in bacterial uptake. Proc Natl Acad Sci U
S A 97, 10008-10013.
Lecuit, M., Ohayon, H., Braun, L., Mengaud, J., and Cossart, P. (1997). Internalin of
Listeria monocytogenes with an intact leucine-rich repeat region is sufficient to
promote internalization. Infect Immun 65, 5309-5319.
Lecuit, M., Vandormael-Pournin, S., Lefort, J., Huerre, M., Gounon, P., Dupuy, C.,
Babinet, C., and Cossart, P. (2001). A transgenic model for listeriosis: role of
internalin in crossing the intestinal barrier. Science 292, 1722-1725.
Li, N., Xiang, G.S., Dokainish, H., Ireton, K., and Elferink, L.A. (2005). The listeria
protein internalin B mimics hepatocyte growth factor-induced receptor trafficking.
Traffic 6, 459-473.
Lingnau, A., Chakraborty, T., Niebuhr, K., Domann, E., and Wehland, J. (1996).
Identification and purification of novel internalin-related proteins in Listeria
monocytogenes and Listeria ivanovii. Infect Immun 64, 1002-1006.
Lingnau, A., Domann, E., Hudel, M., Bock, M., Nichterlein, T., Wehland, J., and
Chakraborty, T. (1995). Expression of the Listeria monocytogenes EGD inlA and
inlB genes, whose products mediate bacterial entry into tissue culture cell lines, by
PrfA-dependent and -independent mechanisms. Infect Immun 63, 3896-3903.
Lisanti, M.P., Caras, I.W., Gilbert, T., Hanzel, D., and Rodriguez-Boulan, E. (1990).
Vectorial apical delivery and slow endocytosis of a glycolipid-anchored fusion
protein in transfected MDCK cells. Proc Natl Acad Sci U S A 87, 7419-7423.
178
Lisanti, M.P., Tang, Z.L., and Sargiacomo, M. (1993). Caveolin forms a hetero-
oligomeric protein complex that interacts with an apical GPI-linked protein:
implications for the biogenesis of caveolae. J Cell Biol 123, 595-604.
Liu, N.Q., Lossinsky, A.S., Popik, W., Li, X., Gujuluva, C., Kriederman, B., Roberts,
J., Pushkarsky, T., Bukrinsky, M., Witte, M., et al. (2002). Human
immunodeficiency virus type 1 enters brain microvascular endothelia by
macropinocytosis dependent on lipid rafts and the mitogen-activated protein kinase
signaling pathway. J Virol 76, 6689-6700.
MacDonald, T.T., and Carter, P.B. (1980). Cell-mediated immunity to intestinal
infection. Infect Immun 28, 516-523.
Machner, M.P., Frese, S., Schubert, W.D., Orian-Rousseau, V., Gherardi, E.,
Wehland, J., Niemann, H.H., and Heinz, D.W. (2003). Aromatic amino acids at the
surface of InlB are essential for host cell invasion by Listeria monocytogenes. Mol
Microbiol 48, 1525-1536.
Mackaness, G.B. (1962). Cellular resistance to infection. J Exp Med 116, 381-406.
Mackaness, G.B. (1969). The influence of immunologically committed lymphoid cells
on macrophage activity in vivo. J Exp Med 129, 973-992.
Madara, J.L. (1990). Maintenance of the macromolecular barrier at cell extrusion sites
in intestinal epithelium: physiological rearrangement of tight junctions. J Membr
Biol 116, 177-184.
Marco, A.J., Altimira, J., Prats, N., Lopez, S., Dominguez, L., Domingo, M., and
Briones, V. (1997). Penetration of Listeria monocytogenes in mice infected by the
oral route. Microb Pathog 23, 255-263.
Marco, A.J., Prats, N., Ramos, J.A., Briones, V., Blanco, M., Dominguez, L., and
Domingo, M. (1992). A microbiological, histopathological and immunohistological
study of the intragastric inoculation of Listeria monocytogenes in mice. J Comp
Pathol 107, 1-9.
Marino, M., Banerjee, M., Jonquieres, R., Cossart, P., and Ghosh, P. (2002). GW
domains of the Listeria monocytogenes invasion protein InlB are SH3-like and
mediate binding to host ligands. Embo J 21, 5623-5634.
Marino, M., Braun, L., Cossart, P., and Ghosh, P. (1999). Structure of the lnlB
leucine-rich repeats, a domain that triggers host cell invasion by the bacterial
pathogen L. monocytogenes. Mol Cell 4, 1063-1072.
Marino, M., Braun, L., Cossart, P., and Ghosh, P. (2000). A framework for
interpreting the leucine-rich repeats of the Listeria internalins. Proc Natl Acad Sci U
S A 97, 8784-8788.
Marquis, H., Goldfine, H., and Portnoy, D.A. (1997). Proteolytic pathways of
activation and degradation of a bacterial phospholipase C during intracellular
infection by Listeria monocytogenes. J Cell Biol 137, 1381-1392.
179
Marquis, H., and Hager, E.J. (2000). pH-regulated activation and release of a bacteria-
associated phospholipase C during intracellular infection by Listeria
Marra, A., and Isberg, R.R. (1997). Invasin-dependent and invasin-independent
pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch
intestinal epithelium. Infect Immun 65, 3412-3421.
Mayhew, T.M., Myklebust, R., Whybrow, A., and Jenkins, R. (1999). Epithelial
integrity, cell death and cell loss in mammalian small intestine. Histol Histopathol
14, 257-267.
McGann, P., Ivanek, R., Wiedmann, M., and Boor, K.J. (2007a). Temperature-
dependent expression of Listeria monocytogenes internalin and internalin-like genes
suggests functional diversity of these proteins among the listeriae. Appl Environ
Microbiol 73, 2806-2814.
McGann, P., Raengpradub, S., Ivanek, R., Wiedmann, M., and Boor, K.J. (2008).
Differential regulation of Listeria monocytogenes internalin and internalin-like
genes by sigmaB and PrfA as revealed by subgenomic microarray analyses.
Foodborne Pathog Dis 5, 417-435.
McGann, P., Wiedmann, M., and Boor, K.J. (2007b). The alternative sigma factor
sigma B and the virulence gene regulator PrfA both regulate transcription of Listeria
monocytogenes internalins. Appl Environ Microbiol 73, 2919-2930.
Mead, P.S., Slutsker, L., Dietz, V., McCaig, L.F., Bresee, J.S., Shapiro, C., Griffin,
P.M., and Tauxe, R.V. (1999). Food-related illness and death in the United States.
Emerg Infect Dis 5, 607-625.
Meier, O., Boucke, K., Hammer, S.V., Keller, S., Stidwill, R.P., Hemmi, S., and
Greber, U.F. (2002). Adenovirus triggers macropinocytosis and endosomal leakage
together with its clathrin-mediated uptake. J Cell Biol 158, 1119-1131.
Mengaud, J., Ohayon, H., Gounon, P., Mege, R.M., and Cossart, P. (1996). E-cadherin
is the receptor for internalin, a surface protein required for entry of L.
monocytogenes into epithelial cells. Cell 84, 923-932.
Meyerholz, D.K., Stabel, T.J., Ackermann, M.R., Carlson, S.A., Jones, B.D., and
Pohlenz, J. (2002). Early epithelial invasion by Salmonella enterica serovar
Typhimurium DT104 in the swine ileum. Vet Pathol 39, 712-720.
Miki, K., and Mackaness, G.B. (1964). The Passive Transfer Of Acquired Resistance
To Listeria Monocytogenes. J Exp Med 120, 93-103.
Milohanic, E., Jonquieres, R., Cossart, P., Berche, P., and Gaillard, J.L. (2001). The
autolysin Ami contributes to the adhesion of Listeria monocytogenes to eukaryotic
cells via its cell wall anchor. Mol Microbiol 39, 1212-1224.
Moors, M.A., Levitt, B., Youngman, P., and Portnoy, D.A. (1999). Expression of
listeriolysin O and ActA by intracellular and extracellular Listeria monocytogenes.
180
Mounier, J., Vasselon, T., Hellio, R., Lesourd, M., and Sansonetti, P.J. (1992).
Shigella flexneri enters human colonic Caco-2 epithelial cells through the
basolateral pole. Infect Immun 60, 237-248.
Muller, H.E. (1990). Listeria isolations from feces of patients with diarrhea and from
healthy food handlers. Infection 18, 97-99.
Murray, E.D.G., Webb, R.A., and Swann, M.B.R. (1926). A disease of rabbits
characterized by a large mononuclear leukocytosis, caused by a hitherto undescribed
bacillus Bacterium monocytogenes (n. sp.). J Pathol Bacteriol 29, 407-439.
Murray, E.G. (1955). A characterization of listeriosis in man and other animals. Can
Med Assoc J 72, 99-103.
Nelson, W.J. (2003). Adaptation of core mechanisms to generate cell polarity. Nature
422, 766-774.
Neo, S., Kansaku, N., Furuichi, M., Watanabe, M., Hisamatsu, S., Ohno, K., Hisasue,
M., Tsuchiya, R., and Yamada, T. (2005). Molecular cloning of the canine c-
Met/HGF receptor and its expression in normal and regenerated liver. J Vet Med Sci
67, 525-529.
Niebuhr, K., Ebel, F., Frank, R., Reinhard, M., Domann, E., Carl, U.D., Walter, U.,
Gertler, F.B., Wehland, J., and Chakraborty, T. (1997). A novel proline-rich motif
present in ActA of Listeria monocytogenes and cytoskeletal proteins is the ligand for
the EVH1 domain, a protein module present in the Ena/VASP family. Embo J 16,
5433-5444.
Niemann, H.H., Jager, V., Butler, P.J., van den Heuvel, J., Schmidt, S., Ferraris, D.,
Gherardi, E., and Heinz, D.W. (2007). Structure of the human receptor tyrosine
kinase met in complex with the Listeria invasion protein InlB. Cell 130, 235-246.
Nightingale, K.K., Fortes, E.D., Ho, A.J., Schukken, Y.H., Grohn, Y.T., and
Wiedmann, M. (2005). Evaluation of farm management practices as risk factors for
clinical listeriosis and fecal shedding of Listeria monocytogenes in ruminants. J Am
Vet Med Assoc 227, 1808-1814.
Nightingale, K.K., Schukken, Y.H., Nightingale, C.R., Fortes, E.D., Ho, A.J., Her, Z.,
Grohn, Y.T., McDonough, P.L., and Wiedmann, M. (2004). Ecology and
transmission of Listeria monocytogenes infecting ruminants and in the farm
environment. Appl Environ Microbiol 70, 4458-4467.
North, R.J. (1970). The relative importance of blood monocytes and fixed
macrophages to the expression of cell-mediated immunity to infection. J Exp Med
132, 521-534.
North, R.J. (1978). The concept of the activated macrophage. J Immunol 121, 806-
809.
Nusrat, A., Parkos, C.A., Bacarra, A.E., Godowski, P.J., Delp-Archer, C., Rosen,
E.M., and Madara, J.L. (1994). Hepatocyte growth factor/scatter factor effects on
epithelia. Regulation of intercellular junctions in transformed and nontransformed
cell lines, basolateral polarization of c-met receptor in transformed and natural
181
intestinal epithelia, and induction of rapid wound repair in a transformed model

epithelium. J Clin Invest 93, 2056-2065.
Ojakian, G.K., and Schwimmer, R. (1988). The polarized distribution of an apical cell
surface glycoprotein is maintained by interactions with the cytoskeleton of Madin-
Darby canine kidney cells. J Cell Biol 107, 2377-2387.
Oldham, C.E., Mohney, R.P., Miller, S.L., Hanes, R.N., and O'Bryan, J.P. (2002). The
ubiquitin-interacting motifs target the endocytic adaptor protein epsin for
ubiquitination. Curr Biol 12, 1112-1116.
Ollinger, J., Bowen, B., Wiedmann, M., Boor, K.J., and Bergholz, T.M. (2009).
Listeria monocytogenes sigmaB modulates PrfA-mediated virulence factor
expression. Infect Immun 77, 2113-2124.
Ollinger, J., Wiedmann, M., and Boor, K.J. (2008). SigmaB- and PrfA-dependent
transcription of genes previously classified as putative constituents of the Listeria
monocytogenes PrfA regulon. Foodborne Pathog Dis 5, 281-293.
Orth, J.D., Krueger, E.W., Weller, S.G., and McNiven, M.A. (2006). A novel
endocytic mechanism of epidermal growth factor receptor sequestration and
internalization. Cancer Res 66, 3603-3610.
Orth, J.D., and McNiven, M.A. (2006). Get off my back! Rapid receptor
internalization through circular dorsal ruffles. Cancer Res 66, 11094-11096.
Pamer, E.G. (2004). Immune responses to Listeria monocytogenes. Nat Rev Immunol
4, 812-823.
Parida, S.K., Domann, E., Rohde, M., Muller, S., Darji, A., Hain, T., Wehland, J., and
Chakraborty, T. (1998). Internalin B is essential for adhesion and mediates the
invasion of Listeria monocytogenes into human endothelial cells. Mol Microbiol 28,
81-93.
Pentecost, M., Otto, G., Theriot, J.A., and Amieva, M.R. (2006). Listeria
monocytogenes invades the epithelial junctions at sites of cell extrusion. PLoS
Pathog 2, e3.
Perez, T.D., Nelson, W.J., Boxer, S.G., and Kam, L. (2005). E-cadherin tethered to
micropatterned supported lipid bilayers as a model for cell adhesion. Langmuir 21,
11963-11968.
Pilgrim, S., Kolb-Maurer, A., Gentschev, I., Goebel, W., and Kuhn, M. (2003).
Deletion of the gene encoding p60 in Listeria monocytogenes leads to abnormal cell
division and loss of actin-based motility. Infect Immun 71, 3473-3484.
Pinner, R.W., Schuchat, A., Swaminathan, B., Hayes, P.S., Deaver, K.A., Weaver,
R.E., Plikaytis, B.D., Reeves, M., Broome, C.V., and Wenger, J.D. (1992). Role of
foods in sporadic listeriosis. II. Microbiologic and epidemiologic investigation. The
Listeria Study Group. Jama 267, 2046-2050.
Pirie, J.H. (1940). The Genus Listerella Pirie. Science 91, 383.
182
Pirie, J.H.H. (1927). A New Disease of Veld Rodents. Tiger River Disease. Publ
South African Inst Med Res 3, 163-186.
Pizarro-Cerda, J., Payrastre, B., Wang, Y.J., Veiga, E., Yin, H.L., and Cossart, P.
(2007). Type II phosphatidylinositol 4-kinases promote Listeria monocytogenes
entry into target cells. Cell Microbiol 9, 2381-2390.
Portnoy, D.A., Auerbuch, V., and Glomski, I.J. (2002). The cell biology of Listeria
monocytogenes infection: the intersection of bacterial pathogenesis and cell-
mediated immunity. J Cell Biol 158, 409-414.
Portnoy, D.A., Jacks, P.S., and Hinrichs, D.J. (1988). Role of hemolysin for the
intracellular growth of Listeria monocytogenes. J Exp Med 167, 1459-1471.
Portnoy, D.A., Smith, G.A., and Goldfine, H. (1994). Phospholipases C and the
pathogenesis of Listeria. Braz J Med Biol Res 27, 357-361.
Portnoy, D.A., Tweten, R.K., Kehoe, M., and Bielecki, J. (1992). Capacity of
listeriolysin O, streptolysin O, and perfringolysin O to mediate growth of Bacillus
subtilis within mammalian cells. Infect Immun 60, 2710-2717.
Prats, N., Lopez, S., Domingo, M., Briones, V., Garcia, J.A., Dominguez, L., and
Marco, A.J. (1997). Prolonged persistence of Listeria monocytogenes after
intragastric infection in corticosteroid-treated mice. Vet Microbiol 58, 79-85.
Pron, B., Boumaila, C., Jaubert, F., Sarnacki, S., Monnet, J.P., Berche, P., and
Gaillard, J.L. (1998). Comprehensive study of the intestinal stage of listeriosis in a
rat ligated ileal loop system. Infect Immun 66, 747-755.
Racz, P., Tenner, K., and Mero, E. (1972). Experimental Listeria enteritis. I. An
electron microscopic study of the epithelial phase in experimental listeria infection.
Lab Invest 26, 694-700.
Rafelski, S.M., and Theriot, J.A. (2002). A hitchhiker's guide to cell biology:
exploitation of host-cell functions by intracellular pathogens. Genome Biol 3,
REPORTS4006.
Rafelski, S.M., and Theriot, J.A. (2004). Crawling toward a unified model of cell
mobility: spatial and temporal regulation of actin dynamics. Annu Rev Biochem 73,
209-239.
Rafelski, S.M., and Theriot, J.A. (2005). Bacterial shape and ActA distribution affect
initiation of Listeria monocytogenes actin-based motility. Biophys J.
Rafelski, S.M., and Theriot, J.A. (2006). Mechanism of polarization of Listeria
monocytogenes surface protein ActA. Mol Microbiol 59, 1262-1279.
Raffelsbauer, D., Bubert, A., Engelbrecht, F., Scheinpflug, J., Simm, A., Hess, J.,
Kaufmann, S.H., and Goebel, W. (1998). The gene cluster inlC2DE of Listeria
monocytogenes contains additional new internalin genes and is important for
virulence in mice. Mol Gen Genet 260, 144-158.
Raghu, H., Sharma-Walia, N., Veettil, M.V., Sadagopan, S., and Chandran, B. (2009).
Kaposi's sarcoma-associated herpesvirus utilizes an actin polymerization-dependent
183
macropinocytic pathway to enter human dermal microvascular endothelial and

human umbilical vein endothelial cells. J Virol 83, 4895-4911.
Rajabian, T., Müller-Altrock, S. Goebel, W. Gray-Owen, S. Ireton, K. (2008). The
Bacterial Virulence Factor InlC Perturbs Apical Cell Junctions and Promotes Cell-
cell Spread of Listeria. American Society for Cell Biology Abstract.
Rajasekaran, A.K., Hojo, M., Huima, T., and Rodriguez-Boulan, E. (1996). Catenins
and zonula occludens-1 form a complex during early stages in the assembly of tight
junctions. J Cell Biol 132, 451-463.
Ray, K., Marteyn, B., Sansonetti, P.J., and Tang, C.M. (2009). Life on the inside: the
intracellular lifestyle of cytosolic bacteria. Nat Rev Microbiol 7, 333-340.
Riedel, C.U., Monk, I.R., Casey, P.G., Morrissey, D., O'Sullivan, G.C., Tangney, M.,
Hill, C., and Gahan, C.G. (2007). Improved luciferase tagging system for Listeria
monocytogenes allows real-time monitoring in vivo and in vitro. Appl Environ
Microbiol 73, 3091-3094.
Robbins, J.R., Barth, A.I., Marquis, H., de Hostos, E.L., Nelson, W.J., and Theriot,
J.A. (1999). Listeria monocytogenes exploits normal host cell processes to spread
from cell to cell. J Cell Biol 146, 1333-1350.
Roberts, A.J., and Wiedmann, M. (2003). Pathogen, host and environmental factors
contributing to the pathogenesis of listeriosis. Cell Mol Life Sci 60, 904-918.
Roll, J.T., and Czuprynski, C.J. (1990). Hemolysin is required for extraintestinal
dissemination of Listeria monocytogenes in intragastrically inoculated mice. Infect
Immun 58, 3147-3150.
Rosenblatt, J., Raff, M.C., and Cramer, L.P. (2001). An epithelial cell destined for
apoptosis signals its neighbors to extrude it by an actin- and myosin-dependent
mechanism. Curr Biol 11, 1847-1857.
Sabet, C., Lecuit, M., Cabanes, D., Cossart, P., and Bierne, H. (2005). LPXTG protein
InlJ, a newly identified internalin involved in Listeria monocytogenes virulence.
Sabet, C., Toledo-Arana, A., Personnic, N., Lecuit, M., Dubrac, S., Poupel, O., Gouin,
E., Nahori, M.A., Cossart, P., and Bierne, H. (2008). The Listeria monocytogenes
virulence factor InlJ is specifically expressed in vivo and behaves as an adhesin.
Sancho, E., Batlle, E., and Clevers, H. (2004). Signaling pathways in intestinal
development and cancer. Annu Rev Cell Dev Biol 20, 695-723.
Sansonetti, P.J., and Arondel, J. (1989). Construction and evaluation of a double
mutant of Shigella flexneri as a candidate for oral vaccination against shigellosis.
Vaccine 7, 443-450.
Schlech, W.F., 3rd, Lavigne, P.M., Bortolussi, R.A., Allen, A.C., Haldane, E.V.,
Wort, A.J., Hightower, A.W., Johnson, S.E., King, S.H., Nicholls, E.S., et al.
(1983). Epidemic listeriosis--evidence for transmission by food. N Engl J Med 308,
203-206.
184
Schmeiser, K., and Grand, R.J. (1999). The fate of E- and P-cadherin during the early
stages of apoptosis. Cell Death Differ 6, 377-386.
Schnupf, P., Hofmann, J., Norseen, J., Glomski, I.J., Schwartzstein, H., and Decatur,
A.L. (2006). Regulated translation of listeriolysin O controls virulence of Listeria
Schnupf, P., and Portnoy, D.A. (2007). Listeriolysin O: a phagosome-specific lysin.
Microbes Infect 9, 1176-1187.
Schnupf, P., Zhou, J., Varshavsky, A., and Portnoy, D.A. (2007). Listeriolysin O
secreted by Listeria monocytogenes into the host cell cytosol is degraded by the N-
end rule pathway. Infect Immun 75, 5135-5147.
Schubert, W.D., Gobel, G., Diepholz, M., Darji, A., Kloer, D., Hain, T., Chakraborty,
T., Wehland, J., Domann, E., and Heinz, D.W. (2001). Internalins from the human
pathogen Listeria monocytogenes combine three distinct folds into a contiguous
internalin domain. J Mol Biol 312, 783-794.
Schubert, W.D., and Heinz, D.W. (2003). Structural aspects of adhesion to and
invasion of host cells by the human pathogen Listeria monocytogenes.
Chembiochem 4, 1285-1291.
Schubert, W.D., Urbanke, C., Ziehm, T., Beier, V., Machner, M.P., Domann, E.,
Wehland, J., Chakraborty, T., and Heinz, D.W. (2002). Structure of internalin, a
major invasion protein of Listeria monocytogenes, in complex with its human
receptor E-cadherin. Cell 111, 825-836.
Schultz, E.W. (1945). Listerella Infections: A Review. Stanford Medical Bulletin 3,
135-151.
Scortti, M., Monzo, H.J., Lacharme-Lora, L., Lewis, D.A., and Vazquez-Boland, J.A.
(2007). The PrfA virulence regulon. Microbes Infect 9, 1196-1207.
Seveau, S., Bierne, H., Giroux, S., Prevost, M.C., and Cossart, P. (2004). Role of lipid
rafts in E-cadherin-- and HGF-R/Met--mediated entry of Listeria monocytogenes
into host cells. J Cell Biol 166, 743-753.
Seveau, S., Tham, T.N., Payrastre, B., Hoppe, A.D., Swanson, J.A., and Cossart, P.
(2007). A FRET analysis to unravel the role of cholesterol in Rac1 and PI 3-kinase
activation in the InlB/Met signalling pathway. Cell Microbiol 9, 790-803.
Shaughnessy, L.M., Hoppe, A.D., Christensen, K.A., and Swanson, J.A. (2006).
Membrane perforations inhibit lysosome fusion by altering pH and calcium in
Listeria monocytogenes vacuoles. Cell Microbiol 8, 781-792.
Shaughnessy, L.M., Lipp, P., Lee, K.D., and Swanson, J.A. (2007). Localization of
protein kinase C epsilon to macrophage vacuoles perforated by Listeria
monocytogenes cytolysin. Cell Microbiol 9, 1695-1704.
Shaughnessy, L.M., and Swanson, J.A. (2007). The role of the activated macrophage
in clearing Listeria monocytogenes infection. Front Biosci 12, 2683-2692.
185
Shaye, D.D., Casanova, J., and Llimargas, M. (2008). Modulation of intracellular

trafficking regulates cell intercalation in the Drosophila trachea. Nat Cell Biol 10,
964-970.
Shen, A., and Higgins, D.E. (2005). The 5' untranslated region-mediated enhancement
of intracellular listeriolysin O production is required for Listeria monocytogenes
pathogenicity. Mol Microbiol 57, 1460-1473.
Shen, L., and Turner, J.R. (2005). Actin depolymerization disrupts tight junctions via
caveolae-mediated endocytosis. Mol Biol Cell 16, 3919-3936.
Shen, Y., Naujokas, M., Park, M., and Ireton, K. (2000). InIB-dependent
internalization of Listeria is mediated by the Met receptor tyrosine kinase. Cell 103,
501-510.
Shenoy, V.B., Tambe, D.T., Prasad, A., and Theriot, J.A. (2007). A kinematic
description of the trajectories of Listeria monocytogenes propelled by actin comet
tails. Proc Natl Acad Sci U S A 104, 8229-8234.
Shetron-Rama, L.M., Marquis, H., Bouwer, H.G., and Freitag, N.E. (2002).
Intracellular induction of Listeria monocytogenes actA expression. Infect Immun 70,
1087-1096.
Shurety, W., Stewart, N.L., and Stow, J.L. (1998). Fluid-phase markers in the
basolateral endocytic pathway accumulate in response to the actin assembly-
promoting drug Jasplakinolide. Mol Biol Cell 9, 957-975.
Singh, R., Jamieson, A., and Cresswell, P. (2008). GILT is a critical host factor for
Listeria monocytogenes infection. Nature 455, 1244-1247.
Skoble, J., Portnoy, D.A., and Welch, M.D. (2000). Three regions within ActA
promote Arp2/3 complex-mediated actin nucleation and Listeria monocytogenes
motility. J Cell Biol 150, 527-538.
Smith, G.A., Marquis, H., Jones, S., Johnston, N.C., Portnoy, D.A., and Goldfine, H.
(1995a). The two distinct phospholipases C of Listeria monocytogenes have
overlapping roles in escape from a vacuole and cell-to-cell spread. Infect Immun 63,
4231-4237.
Smith, G.A., and Portnoy, D.A. (1993). The role of two phospholipases in the
pathogenicity of Listeria monocytogenes. Infect Agents Dis 2, 183-185.
Smith, G.A., Portnoy, D.A., and Theriot, J.A. (1995b). Asymmetric distribution of the
Listeria monocytogenes ActA protein is required and sufficient to direct actin-based
motility. Mol Microbiol 17, 945-951.
Sousa, S., Cabanes, D., Archambaud, C., Colland, F., Lemichez, E., Popoff, M.,
Boisson-Dupuis, S., Gouin, E., Lecuit, M., Legrain, P., et al. (2005a). ARHGAP10
is necessary for alpha-catenin recruitment at adherens junctions and for Listeria
invasion. Nat Cell Biol 7, 954-960.
Sousa, S., Cabanes, D., El-Amraoui, A., Petit, C., Lecuit, M., and Cossart, P. (2004).
Unconventional myosin VIIa and vezatin, two proteins crucial for Listeria entry into
epithelial cells. J Cell Sci 117, 2121-2130.
186
Sousa, S., Lecuit, M., and Cossart, P. (2005b). Microbial strategies to target, cross or
disrupt epithelia. Curr Opin Cell Biol.
Stamm, L.M., Morisaki, J.H., Gao, L.Y., Jeng, R.L., McDonald, K.L., Roth, R.,
Takeshita, S., Heuser, J., Welch, M.D., and Brown, E.J. (2003). Mycobacterium
marinum escapes from phagosomes and is propelled by actin-based motility. J Exp
Med 198, 1361-1368.
Steinhusen, U., Weiske, J., Badock, V., Tauber, R., Bommert, K., and Huber, O.
(2001). Cleavage and shedding of E-cadherin after induction of apoptosis. J Biol
Chem 276, 4972-4980.
Suarez, M., Gonzalez-Zorn, B., Vega, Y., Chico-Calero, I., and Vazquez-Boland, J.A.
(2001). A role for ActA in epithelial cell invasion by Listeria monocytogenes. Cell
Sue, D., Fink, D., Wiedmann, M., and Boor, K.J. (2004). sigmaB-dependent gene
induction and expression in Listeria monocytogenes during osmotic and acid stress
conditions simulating the intestinal environment. Microbiology 150, 3843-3855.
Sunitha, I., Shen, R., McKillop, I.H., Lee, J.H., Resau, J., and Avigan, M. (1999). A
src-related kinase in the brush border membranes of gastrointestinal cells is
regulated by c-met. Exp Cell Res 250, 86-98.
Swanson, J.A., and Watts, C. (1995). Macropinocytosis. Trends Cell Biol 5, 424-428.
Temm-Grove, C.J., Jockusch, B.M., Rohde, M., Niebuhr, K., Chakraborty, T., and
Wehland, J. (1994). Exploitation of microfilament proteins by Listeria
monocytogenes: microvillus-like composition of the comet tails and vectorial
spreading in polarized epithelial sheets. J Cell Sci 107 ( Pt 10), 2951-2960.
Theriot, J.A., Mitchison, T.J., Tilney, L.G., and Portnoy, D.A. (1992). The rate of
actin-based motility of intracellular Listeria monocytogenes equals the rate of actin
polymerization. Nature 357, 257-260.
Tilney, L.G., and Portnoy, D.A. (1989). Actin filaments and the growth, movement,
and spread of the intracellular bacterial parasite, Listeria monocytogenes. J Cell Biol
109, 1597-1608.
Toledo-Arana, A., Dussurget, O., Nikitas, G., Sesto, N., Guet-Revillet, H., Balestrino,
D., Loh, E., Gripenland, J., Tiensuu, T., Vaitkevicius, K., et al. (2009). The Listeria
transcriptional landscape from saprophytism to virulence. Nature 459, 950-956.
Troyanovsky, R.B., Sokolov, E.P., and Troyanovsky, S.M. (2006). Endocytosis of
cadherin from intracellular junctions is the driving force for cadherin adhesive dimer
disassembly. Mol Biol Cell 17, 3484-3493.
Tzipori, S., Gibson, R., and Montanaro, J. (1989). Nature and distribution of mucosal
lesions associated with enteropathogenic and enterohemorrhagic Escherichia coli in
piglets and the role of plasmid-mediated factors. Infect Immun 57, 1142-1150.
Ungewickell, E.J., and Hinrichsen, L. (2007). Endocytosis: clathrin-mediated
membrane budding. Curr Opin Cell Biol 19, 417-425.
187
Unnerstad, H., Romell, A., Ericsson, H., Danielsson-Tham, M.L., and Tham, W.
(2000). Listeria monocytogenes in faeces from clinically healthy dairy cows in
Sweden. Acta Vet Scand 41, 167-171.
van Schaik, W., and Abee, T. (2005). The role of sigmaB in the stress response of
Gram-positive bacteria -- targets for food preservation and safety. Curr Opin
Biotechnol 16, 218-224.
Vazquez-Boland, J.A., Kuhn, M., Berche, P., Chakraborty, T., Dominguez-Bernal, G.,
Goebel, W., Gonzalez-Zorn, B., Wehland, J., and Kreft, J. (2001). Listeria
pathogenesis and molecular virulence determinants. Clin Microbiol Rev 14, 584-
640.
Vazquez-Torres, A., Jones-Carson, J., Baumler, A.J., Falkow, S., Valdivia, R., Brown,
W., Le, M., Berggren, R., Parks, W.T., and Fang, F.C. (1999). Extraintestinal
dissemination of Salmonella by CD18-expressing phagocytes. Nature 401, 804-808.
Veiga, E., and Cossart, P. (2005). Listeria hijacks the clathrin-dependent endocytic
machinery to invade mammalian cells. Nat Cell Biol.
Veiga, E., and Cossart, P. (2007). Listeria InlB takes a different route to met. Cell 130,
218-219.
Veiga, E., Guttman, J.A., Bonazzi, M., Boucrot, E., Toledo-Arana, A., Lin, A.E.,
Enninga, J., Pizarro-Cerda, J., Finlay, B.B., Kirchhausen, T., et al. (2007). Invasive
and adherent bacterial pathogens co-Opt host clathrin for infection. Cell Host
Microbe 2, 340-351.
Vogelmann, R., Amieva, M.R., Falkow, S., and Nelson, W.J. (2004). Breaking into
the epithelial apical-junctional complex--news from pathogen hackers. Curr Opin
Cell Biol 16, 86-93.
Vogelmann, R., and Nelson, W.J. (2005). Fractionation of the epithelial apical
junctional complex: reassessment of protein distributions in different substructures.
Mol Biol Cell 16, 701-716.
Wampler, J.L., Kim, K.P., Jaradat, Z., and Bhunia, A.K. (2004). Heat shock protein 60
acts as a receptor for the Listeria adhesion protein in Caco-2 cells. Infect Immun 72,
931-936.
Watarai, M., Derre, I., Kirby, J., Growney, J.D., Dietrich, W.F., and Isberg, R.R.
(2001). Legionella pneumophila is internalized by a macropinocytotic uptake
pathway controlled by the Dot/Icm system and the mouse Lgn1 locus. J Exp Med
194, 1081-1096.
Watarai, M., Funato, S., and Sasakawa, C. (1996). Interaction of Ipa proteins of
Shigella flexneri with alpha5beta1 integrin promotes entry of the bacteria into
mammalian cells. J Exp Med 183, 991-999.
Watarai, M., Makino, S., Fujii, Y., Okamoto, K., and Shirahata, T. (2002). Modulation
of Brucella-induced macropinocytosis by lipid rafts mediates intracellular
replication. Cell Microbiol 4, 341-355.
188
Wells, C.L., van de Westerlo, E.M., Jechorek, R.P., Haines, H.M., and Erlandsen, S.L.
(1998). Cytochalasin-induced actin disruption of polarized enterocytes can augment
internalization of bacteria. Infect Immun 66, 2410-2419.
Wollert, T., Heinz, D.W., and Schubert, W.D. (2007a). Thermodynamically
reengineering the listerial invasion complex InlA/E-cadherin. Proc Natl Acad Sci U
S A 104, 13960-13965.
Wollert, T., Pasche, B., Rochon, M., Deppenmeier, S., van den Heuvel, J., Gruber,
A.D., Heinz, D.W., Lengeling, A., and Schubert, W.D. (2007b). Extending the host
range of Listeria monocytogenes by rational protein design. Cell 129, 891-902.
Wormstone, I.M., Tamiya, S., Marcantonio, J.M., and Reddan, J.R. (2000).
Hepatocyte growth factor function and c-Met expression in human lens epithelial
cells. Invest Ophthalmol Vis Sci 41, 4216-4222.
Wu, Z., Nybom, P., and Magnusson, K.E. (2000). Distinct effects of Vibrio cholerae
haemagglutinin/protease on the structure and localization of the tight junction-
associated proteins occludin and ZO-1. Cell Microbiol 2, 11-17.
Yamada, S., Pokutta, S., Drees, F., Weis, W.I., and Nelson, W.J. (2005).
Deconstructing the cadherin-catenin-actin complex. Cell 123, 889-901.
Zachar, Z., and Savage, D.C. (1979). Microbial interference and colonization of the
murine gastrointestinal tract by Listeria monocytogenes. Infect Immun 23, 168-174.
Zeile, W.L., Zhang, F., Dickinson, R.B., and Purich, D.L. (2005). Listeria's right-
handed helical rocket-tail trajectories: mechanistic implications for force generation
in actin-based motility. Cell Motil Cytoskeleton 60, 121-128.
Zenni, M.K., Giardina, P.C., Harvey, H.A., Shao, J., Ketterer, M.R., Lubaroff, D.M.,
Williams, R.D., and Apicella, M.A. (2000). Macropinocytosis as a mechanism of
entry into primary human urethral epithelial cells by Neisseria gonorrhoeae. Infect
Immun 68, 1696-1699.
Zychlinsky, A., Perdomo, J.J., and Sansonetti, P.J. (1994). Molecular and cellular
mechanisms of tissue invasion by Shigella flexneri. Ann N Y Acad Sci 730, 197-
208.

Pentecost Ph.D. Thesis

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Pentecost Ph.D. Thesis

Uploaded by

Copyright:

Available Formats

MOLECULAR MECHANISMS OF LISTERIA MONOCYTOGENES

INVASION OF THE INTESTINAL EPITHELIUM

SUBMITTED TO THE DEPARTMENT OF MICROBIOLOGY & IMMUNOLOGY

AND THE COMMITTEE ON GRADUATE STUDIES

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS

FOR THE DEGREE OF

Mickey Joseph Pentecost

© Copyright by Mickey Joseph Pentecost 2009

I certify that I have read this dissertation and that, in my opinion, it is

I certify that I have read this dissertation and that, in my opinion, it is

I certify that I have read this dissertation and that, in my opinion, it is

I certify that I have read this dissertation and that, in my opinion, it is

Approved for the Stanford University Committee on Graduate Studies.

Listeria monocytogenes causes invasive disease by crossing the intestinal epithelial

We used polarized MDCK cells as a model epithelium to determine how L.

We hypothesized that L. monocytogenes utilize analogous extrusion sites for epithelial

We investigated the mechanism by which InlB mediates Listeria invasion at MCJs

Thus, L. monocytogenes exploit the dynamic nature of junctional remodeling and

The author wishes to dedicate this dissertation to Grandma Sally.

List of Tables ............................................................................................................... xiii

Chapter 2 : Internalin A Targets Listeria monocytogenes to Epithelial Junctions at

Are Multicellular Junctions Inherently Permissive for Bacterial Uptake In

Figure 3.1: L. monocytogenes Invasion of the Intestinal Epithelium at the Villus-

Figure 5.2: Analysis of the role of InlB in Listeria Oral Infections by

CHAPTER 1 : INTRODUCTION AND LITERATURE REVIEW

, AN ENTEROINVASIVE BACTERIAL PATHOGEN

Figure 1.1: Schematic Representation of the Pathophysiology of Infection

Figure from (Vazquez-Boland et al., 2001).

Although the gastrointestinal tract would not be recognized as a site of L.

Without knowledge of Bacterium monocytogenes, in 1927 Pirie identified the

In retrospect, L. monocytogenes was probably identified a number of times prior to

LISTERIOSIS: A DISEASE OF HUMANS AND ANIMALS

PATHOGENESIS AND EPIDEMIOLOGY

Factors contributing to the increase in Listeriosis include industrialized farming and

monocytogenes in the farm environment, leading to new or sustained infections and

More recently, an outbreak of Listeriosis in Canada in the summer of 2008 resulted in

LISTERIA IN BASIC BIOLOGICAL RESEARCH

of InlA/InlB mediated Listeria invasion will provide a fuller understanding of how

STAGES AND MECHANISMS OF LISTERIA’S INTRACELLULAR LIFE-CYCLE

Some cytosolic bacteria like Listeria monocytogenes, Shigella flexneri, Burkholderia

GENETIC REGULATION OF INTRACELLULAR INFECTION

2007). In addition, translation of prfA is temperature-dependent since a transition to

INVASION OF NONPHAGOCYTIC CELLS

ADHERENCE TO THE CELL SURFACE

INTERNALIN A, INTERNALIN B AND THE INTERNALIN FAMILY

The defining characteristic of Internalins is a leucine rich repeat (LRR) domain of 3 to

Figure 1.3: Domain Organization of Internalins and Sequence Alignments of

INTERNALIN A CO-OPTS THE EPITHELIAL JUNCTIONS

Figure 1.4: Structural and Molecular Aspects of InlA/E-cadherin–mediated Listeria

INTERNALIN B CO-OPTS GROWTH FACTOR SIGNALING

c-Met is a disulfide-linked two-chain heterodimer that is initially translated as a 1390

Figure 1.5: Structural Aspects of InlB/c-Met-mediated Listeria Invasion (Following

SYNERGY BETWEEN INTERNALIN A AND INTERNALIN B

SPECIES SPECIFICITIES OF INTERNALIN A AND INTERNALIN B

Internalin A Does Not Bind Murine E-cadherin

Internalin B Does Not Activate Guinea Pig or Rabbit c-Met

ANIMAL MODELS PERMISSIVE FOR INTERNALIN A AND INTERNALIN B

Rather than making permissive mice, we were interested in generating L.

TISSUE SPECIFICITIES OF INTERNALIN A AND INTERNALIN B

CHALLENGING THE INTERNALIN TISSUE SPECIFICITY DOGMA

ANATOMICAL AND SUBCELLULAR SITE OF EPITHELIAL INVASION: THE

THE EPITHELIAL BARRIER, CELL RENEWAL AND GASTROINTESTINAL PATHOGENS

E-CADHERIN AND C-MET ARE BASOLATERAL RECEPTORS