A Tale of Three Tails: Cryptic Speciation in a Globally Distributed Marine Fish of

the Genus Seriola

Author(s): Natalie Martinez-Takeshita, Catherine M. Purcell, Chris L. Chabot, Matthew T. Craig,
Corinne N. Paterson, John R. Hyde, and Larry G. Allen
Source: Copeia, 103(2):357-368.
Published By: The American Society of Ichthyologists and Herpetologists
DOI: http://dx.doi.org/10.1643/CI-124-224
URL: http://www.bioone.org/doi/full/10.1643/CI-124-224

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and
environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published
by nonprofit societies, associations, museums, institutions, and presses.
Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of
BioOnes Terms of Use, available at www.bioone.org/page/terms_of_use.
Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial
inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research
libraries, and research funders in the common goal of maximizing access to critical research.
 Copeia 103, No. 2, 2015, 357368

A Tale of Three Tails: Cryptic Speciation in a Globally Distributed Marine

Fish of the Genus Seriola

Natalie Martinez-Takeshita1, Catherine M. Purcell2, Chris L. Chabot1,

Matthew T. Craig3, Corinne N. Paterson1, John R. Hyde2, and Larry G. Allen1
Genetic data are increasingly being applied to re-evaluate past taxonomic hypotheses and better understand the
evolutionary patterns and connectivity among regional populations of cosmopolitan species. This is of particular
importance for heavily exploited, commercially important species. The phylogenetic structure of the Yellowtail Jack,
Seriola lalandi Valenciennes, 1833, was investigated using genetic data from 42 individuals collected from California, the
Pacific coast of Baja California (Mexico), the Gulf of California (Mexico), New Zealand, Japan, South Africa, and Chile. An
analysis using S. dumerili as an outgroup and combining the sequences of two mitochondrial genes (CR and COI) and
four nuclear genes (RAG2, EHHADH, UBE3A, MLL) was used to determine the level of genetic divergence among samples
from different geographic regions. Bayesian and Maximum Likelihood analyses utilizing combined mitochondrial gene
(mtDNA) or nuclear gene (nucDNA) data supported the existence of multiple regionally restricted clades with mtDNA
analysis identifying four major clades and nucDNA supporting three. Both mtDNA and nucDNA trees were very similar in
topology, which was reflected in the combined total evidence phylogram. These clades were highly supported with
Bayesian posterior and bootstrap probabilities ranging from 90 to 100 percent for the three major clades that were
recovered in both mtDNA and nucDNA trees. These clades represent regionally specific specimens collected from the 1)
Northeast Pacific, 2) Northwest Pacific, and 3) Southern Hemisphere. Morphometric analysis (MDS and ANOSIM) of
available meristic data on the number of soft dorsal-fin rays, anal-fin rays, and total number of gill rakers separated
specimens among the three regions identified by genetic analysis (P = 0.05). Based on the phylogenetic structure within
this taxonomic unit as evidenced by genetic data and significant meristic differences among these regional lineages, we
conclude that three cryptic species currently bear the name Seriola lalandi Valenciennes, 1833. We propose the
resurrection of two currently available names based on nomenclatural priority. The Northwest Pacific species name
should revert to Seriola aureovittata Temminck and Schlegel (1845) (type locality Japan), and the Northeast Pacific
species to Seriola dorsalis Gill (1863) (type locality Cabo San Lucas, Mexico). Seriola lalandi Valenciennes, 1833 (type
locality Brazil) should apply only to the species in the Southern Hemisphere.

I
N the marine environment, many species that were
once considered widespread are now known to consist
of discrete lineages through the extensive use of
molecular genetic techniques (Rocha et al., 2007; Craig et
al., 2009; Lindstrom et al., 2012), and it has become clear
that cryptic species are quite common in nature (Bickford et
al., 2006; Pfenniger and Schwenk, 2007). Strong geographic
population structure was considered rare in marine species,
particularly in pelagic species, due to their unique life-
history traits (e.g., broadcast spawning, planktonic larval
stages, and migratory behavior) and lack of obvious physical
barriers. However, recent studies employing genetic tech-
niques have observed spatial genetic differentiation within
many pelagic species (Graves, 1998). Proposed mechanisms
driving genetic structure in pelagic species include oceano-
graphic barriers (e.g., current patterns, oceanic circulation),
limited larval dispersion, behavioral characteristics, or
selection (Palumbi, 1994). Spatial genetic structure has
now been reported for many widespread, pelagic marine
species such as Bluefin Tuna (Thunnus thynnus thynnus;
Carlsson et al., 2004), Albacore (Thunnus alalunga; Vin as et
al., 2004), Striped Marlin (Kajikia audax; Purcell and
Edmands, 2011), Scalloped Hammerhead Shark (Sphyrna
lewini; Duncan et al., 2006; Daly-Engel et al., 2012), Ocean
Sunfish (Mola mola; Bass et al., 2005), Soupfin Shark
(Galeorhinus galeus; Chabot and Allen, 2009), and coastal
pelagic mackerels (Scomber sp.; Scoles et al., 1998; Catanese
et al., 2010; Cheng et al., 2011). Many demersal species have
also shown similarly high levels of genetic differentiation
such as wreckfish (Polyprion americanus; Sedberry et al.,
1996), rockfishes of the genus Sebastes (Hyde et al., 2008),
goliath groupers (Epinephelus itajara and E. quinquefasciatus;
Craig et al., 2009), and nearshore bonefishes (Albula spp.;
Colborn et al., 2001), where a deep phylogeny of nine
cryptic species has been discovered.
The Yellowtail Jack, Seriola lalandi Valenciennes, 1833
(Carangidae), is a coastal pelagic species that is globally
distributed in subtropical and temperate ocean regions. This
species is highly prized in both recreational and commercial
fisheries throughout its range and is a key aquaculture
species in several locations (e.g., Japan, Australia, New
Zealand, and Chile) and the target of aquaculture expansion
in other areas such as Mexico and California. Cultured
yellowtail are supplied to higher-end markets and are
commonly sold as hamachi or hiramasa in the seafood
industry (Ohara et al., 2005). As a result of the recreational,
commercial, and aquaculture activities for this fish, S.
lalandi is an important species that contributes significantly
to economies throughout its range.
Similar to other pelagic teleosts, the Yellowtail Jack is a
broadcast spawner, releasing large amounts of gametes into
the water column. This species moves offshore and forms
spawning aggregations in the respective spring and summer
months throughout its range (Baxter, 1960; Gillanders et al.,
1999; Moran et al., 2007a), which temporally offsets
spawning seasons between the Northern and Southern

1
Department of Biology, California State University, Northridge, California 91330-8303; E-mail: (LGA) larry.allen@csun.edu. Send reprint
requests to LGA.
2
Southwest Fisheries Science Center, National Marine Fisheries Service, La Jolla, California 92037-1023.
3
Department of Environmental and Ocean Sciences, University of San Diego, San Diego, California 92110.
Submitted: 13 October 2014. Accepted: 19 December 2014. Associate Editor: T. J. Near.
F 2015 by the American Society of Ichthyologists and Herpetologists DOI: 10.1643/CI-124-224 Published online: May 20, 2015
358
hemispheres. In the north Pacific, spawning occurs between
April and June near Japan (Shiraishi et al., 2010), March and
May in the Gulf of California (Sala et al., 2003; Erisman et
al., 2010), and July through October in Southern California
and Baja California, Mexico (Sumida et al., 1985). In the
Southern Hemisphere, spawning occurs during the austral
spring and summer seasons, November through February
(Moran et al., 2007a; Dunn, 2014). Following a planktonic
larval stage, settlement occurs between two and 11 months
from the start of the spawning season (Neira et al., 1998)
with development time dependent on a narrow temperature
range (Moran et al., 2007a, 2007b).
Size at sexual maturity is reported to vary by location for
the Yellowtail Jack. In New Zealand, 50% of females and
50% of males reach sexual maturity at 944 mm and 812 mm
fork length (FL), respectively (Poortenaar et al., 2001). In
Australia, 50% of females mature at 834 mm FL (3+ years)
and males at 470 mm FL (0+ years; Gillanders et al., 1999),
while in California females have been reported to first
spawning at 506 mm FL (2+ years) with 100% spawning by
634 mm (3+ years; Baxter, 1960).
Factors such as size at reproductive maturity, temporal
separation of spawning seasons, and significant genetic
differentiation among populations of S. lalandi (Purcell et
al., unpubl.) have recently reignited the question of whether
populations of S. lalandi may actually be distinct species.
Initially, several nominal species names existed in the
literature; Valenciennes (1833) described S. lalandi (type
locality Brazil), and Castelnau (1872) described S. grandis
from Australia, New Zealand, and Chile. Seriola aureovittata
(Temminck and Schlegel, 1845) was described in Japan, and
Gill 1863 described Seriola dorsalis from California. Smith-
Vaniz (1986) and Smith-Vaniz et al. (1990) placed the latter
three names (i.e., S. grandis, S. aureovittata, and S. dorsalis)
into synonymy with S. lalandi based on a lack of morpho-
metric variation throughout their range, and concluded that
previous descriptions of distinct species were due solely to
the disjunct nature of the populations. Currently S. lalandi
Valenciennes, 1833 is considered a single species distributed
throughout the Indian, Atlantic and Pacific oceans.
The goals of the present study were to: 1) conduct a
phylogenetic analysis using multiple mitochondrial and
nuclear genes to investigate the phylogenetic structure of S.
lalandi sensu lato, 2) re-evaluate available meristic data from
identified regional groups, and 3) determine the validity for
the current treatment of the Yellowtail Jack as a single,
globally distributed species.
MATERIALS AND METHODS
Sample acquisition.Samples of S. lalandi were collected
from eight geographic locations between May 2007 and July
2010. Specimens for this phylogenetic analysis were sam-
pled from the following locations: Anacapa, Santa Catalina,
and San Clemente islands off southern California (Califor-
nia; n 5 4); between Punta Colonet and Punta Abreojos off
Baja California, Mexico (Mexico Pacific; n 5 10); the Midriff
Islands and La Paz within the Gulf of California, Mexico
(Mexico Gulf; n 5 8); Fukuoka, Kyushu off Japan (n 5 10);
the Juan Fernandez Islands off Chile (n 5 4); Bay of Islands,
North Island off New Zealand (n 5 2); and Rocky Bank off
South Africa (n 5 4; Fig. 1). Specimens were collected by
spear fishing or by hook-and-line on commercial fishing and
research vessels (FV Toronado, FV Aloha Spirit, FV Cobra,
FV Royal Polaris, and the RV Yellowfin), through private
Copeia 103, No. 2, 2015
sportfishing activities, or from fish markets (Japan). Tissue
samples (gill filaments or fin clips) were collected and placed
in either 100% ethanol or sodium chloride-EDTA buffer (2.5
M NaCl, 0.25 M EDTA, 0.25 M Tris, pH 8.0) and stored at
220uC for long-term storage at the California State Univer-
sity, Northridge.
DNA extraction and amplification.Genomic DNA was
extracted from tissues using the DNeasy Blood and Tissue
Kit (QIAGEN) following the manufacturers protocol. Re-
gions of mitochondrial cytochrome oxidase I (COI) and
control region (CR) as well as nuclear enoyl-CoA, hydratase/
3-hydroxyacyl CoA dehydrogenase (EHHADH), ubiquitin
protein ligase E3A (UBE3A), mixed-lineage leukemia-like
protein (MLL), and recombination activating gene 2 (RAG2)
were amplified by polymerase chain reaction (PCR).
Control region amplification was carried out in 25 mL
volumes containing RT-PCR grade water (Ambion), 12 to
395 ng template DNA, 200 mM dNTPs (QIAGEN dNTP mix
containing 10 mM each of dATP, dCTP, dGTP, and dTTP),
0.48 mM forward (CCR: 59CCTGAAGTAGGAACCAGATG)
and reverse (Trna: 59CACCACTAGCTCCCAAA) oligonucle-
otide primers, 0.5 U HotStar Taq (QIAGEN), and 13 HotStar
Taq buffer + 2.5 mM Mg2+ (QIAGEN). PCR was performed
with an initial denaturing step at 95uC for 5 min followed by
30 cycles of 94uC for 30 s, 48uC for 30 s, 72uC for 30 s, and a
final extension step of 72uC for 10 min.
The RAG2 gene PCR reactions were performed in 25 mL
volumes consisting of 5.5 mL nanopure water, 2.5 mL of 10 mM
forward (RAG2-F2: 59CCTCTGTCTGGAAGCTCACC, Li and
Ort, 2007) and reverse (RAG2-R2: 59ACGGCCTCCCAGA-
GAGTTAT, designed for this study) oligonucleotide primers,
12.5 mL EconoTaq PLUS 2X Master Mix (Lucigen), and 1 mL
(12 to 395 ng) of template DNA. PCR reaction conditions
consisted of an initial denaturing step of 94uC for 5 min
followed by 30 cycles of 94uC for 30 s, 55uC for 30 s, 72uC for
30 s, and a final extension step of 72uC for 10 min.
A portion of the COI gene was amplified using M13 tailed
primer set COI-3 (Ivanova et al., 2007). The EHHADH gene
was amplified using M13 tailed primers Seriola-EHHADH-F
(59TGTAAAACGACGGCCAGT ACCACCTGGCCTCTCAA-
ACTC) and Seriola-EHHADH-R (59CAGGAAACAGCTAT-
GACGCAGCTATTCCATCCTCCAAGATGC). UBE3A was
amplified using M13 tailed primers Seriola-UBE3A-F (59
TGTAAAACGACGGCCAGTGGTCTACCTCTCACCCAACG-
TG) and Seriola-UBE3A-R (59CAGGAAACAGCTATGA-
CATGCGGATGCGGTTGTCGTAG). MLL was amplified
using M13 tailed primers Seriola-MLL-F (59TGTAAAACGA-
CGGCCAGTAATTAGTGCCACAGGAGTGATGGAC) and
Seriola-MLL-R (59CAGGAAACAGCTATGACGATAATAT-
TTGGGACCTTGCGCTGAG). PCR reactions were done in
10 mL volumes using Taq PCR Master Mix (Qiagen)
containing 0.25 mL of each 10 mM primer and 1 mL (12 to
395 ng) of template DNA with an initial denaturing step of
94uC for 2 min followed by 35 cycles of 94uC for 30 s, 55uC
for 60 s, 72uC for 60 s (COI) or 94uC for 30 s, 68uC for 60 s,
72uC for 60 s (EHHADH, UBE3A, MLL), and a final
extension step of 72uC for 5 min.
PCR products for all genes were enzymatically cleaned
using ExoSAP-IT (Affymetrix/USB) following the manufac-
turers protocols. BigDye v3.1 (Applied Biosystems) dye-
terminator cycle sequencing was carried out following
manufacturers protocols. PCR product from CR and RAG2
were cycle sequenced using the same primers used for the
Martinez-Takeshita et al.Cryptic speciation in Seriola
Fig. 1. Sample locations of Seriola lalandi.
initial PCR, product from COI, EHHADH, UBE3A, and MLL
used universal M13 primers (M13F [221]: 59TGTAAAAC-
GACGGCCAGT and M13R [227]: 59CAGGAAACAGCTAT-
GAC). Cycle sequencing reactions were performed using 35
cycles of 90uC for 10 s, 50uC for 10 s, and 60uC for 4 min,
followed by direct sequencing using either an Applied
Biosystems 3130XL Genetic Analyzer or an Applied Biosys-
tems 3730XL Genetic Analyzer. Contigs of sequencing
products were generated using GENEIOUS v4.8.5 (Drum-
mond et al., 2010), validated by eye, edited using SE-
QUENCHER v4.5 (Gene Codes), and aligned with CLUS-
TALW (Thompson et al., 1994).
Phylogenetic analyses.Phylogenetic trees for S. lalandi were
built using maximum likelihood (ML) and Bayesian poste-
rior probability analyses using 42 individuals of S. lalandi
treated as the ingroup and sequences from Seriola dumerili
downloaded from GenBank (COI:KC501452.1, CR:HM131831.1,
EHHADH:JQ938865.1, UBE3A:JQ937894.1, and MLL:JQ939454.
1) and generated for the present study used for outgroup
comparisons. Three strategies were implemented for these
analyses. First, nuclear sequences were concatenated and
trees were generated using a ML optimization algorithm with
the best model of sequence evolution (HKY+I) determined by
the AICc and BIC criteria within JModeltest (Posada, 2008).
MEGA 6.0 (Tamura et al., 2013) was used to produce a single
ML phylogeny with the robustness of the dataset assessed by
1,000 bootstrapped replicates. Second, a mitochondrial
dataset consisting of the concatenated mitochondrial regions
was used to create a mitochondrial phylogenetic hypothesis.
This dataset was analyzed by ML in MEGA 6.0 under the best
model of sequence evolution (HKY+I+G) as determined by
the AICc and BIC criterion within JModeltest. Robustness of
the dataset was determined by 1,000 bootstrapped replicates.
As both datasets produced congruent topologies with
adequate support (.75% for all major clades, Figs. 2, 3), a
359
combined dataset of all genetic markers totaling 3,513 bps
(COI 5 654, CR 5 396, EHHADH 5 604, UBE3A 5 691, MLL
5 550, RAG2 5 618) was used to generate a consensus tree.
Similarly, a Bayesian posterior probability analysis was
performed within MrBayes 3.2 (Huelsenbeck and Ronquist,
2001; Ronquist and Huelsenbeck, 2003; Ronquist et al.,
2012). For this analysis, individual genes were partitioned
and the best model of sequence evolution for each partition
was determined by MrModeltest (Nylander, 2004). For all
markers, the HKY model was chosen with COI and CR
implementing slight modifications of HKY+I and HKY+I+G,
respectively. MCMC parameters for the Bayesian analysis
consisted of two simultaneous runs of 10,000,000 genera-
tions sampled every 1,000 generations with four independent
chains (three heated and one cold) and the first 25% of
generated trees were discarded as burn-in. Three independent
Bayesian analyses with different starting seeds were per-
formed based on the above parameters to ensure convergence
on the joint posterior probability distribution and conver-
gence was assessed by examining the average estimated
sample sizes (ESS) and the potential scale reduction factor
(PSRF) as recommended by Ronquist et al. (2012). Consen-
suses of phylogenetic relationships were viewed within
FIGTREE 1.4 (available at http://tree.bio.ed.ac.uk/software/
figtree/).
Meristic comparison.William Smith-Vaniz (pers. comm.)
graciously provided meristic data given to him by the late
Frank J. Mather, III (19112000) of the Woods Hole Oceano-
graphic Research Institution. Mather, an avid angler of many
saltwater species including Seriola (Mather, 1971) who was best
known for his work on bluefin tuna (e.g., Mather and Schuck,
1974), also collected meristic data from 37 specimens of S.
lalandi collected throughout the world including Australia,
Chile, Brazil, South Africa, California, and Japan. These
meristic data included the number of dorsal and anal soft rays
360 Copeia 103, No. 2, 2015

Fig. 2. Bayesian derived consensus tree of combined mitochondrial DNA sequence data (CR, COI) for Seriola lalandi and rooted with S. dumerili.
Specimen designations are JP 5 Japan; CA 5 California; MP 5 Mexico Pacific; MG 5 Mexico Gulf (Gulf of CA); CH 5 Chile; NZ 5 New Zealand; SA 5
South Africa. Values above nodes reflect Bayesian posterior probabilities, while values below nodes indicate Maximum Likelihood bootstrap support
values; values ,80 are not shown.

and the total number of gill rakers of each specimen. Tests for
significant differences in median counts among yellowtail
from the three geographic regions identified by our genetic
analyses were conducted using a non-parametric, Multidi-
mensional Scaling (MDS) approach followed by analysis of
similarities (ANOSIM; Primer-E, Plymouth, UK).
RESULTS
Sequence data were obtained for all six gene regions from 42
individuals (Table 1). As expected, mitochondrial genes (CR
and COI) had much higher levels of variability than
observed in the nuclear genes (EHHADH, UBE3A, MLL,
RAG2). Control region sequences varied slightly in length,
Martinez-Takeshita et al.Cryptic speciation in Seriola 361

Fig. 3. Bayesian derived consensus tree of combined nuclear DNA sequence data (EHHADH, UBE3A, MLL, RAG2) for Seriola lalandi and rooted with
S. dumerili. Specimen designations are JP 5 Japan; CA 5 California; MP 5 Mexico Pacific; MG 5 Mexico Gulf (Gulf of CA); CH 5 Chile; NZ 5 New
Zealand; SA 5 South Africa. Values above nodes reflect Bayesian posterior probabilities, while values below nodes indicate Maximum Likelihood
bootstrap support values; values ,80 are not shown.

and after alignment with CLUSTALW, a 396 bp segment
containing 11 indels was obtained. No indels were found
among samples within regions (NEP, NWP, S. Hemisphere),
with the 11 indels representing fixed differences between
regions. This gene segment contained 76 variable and 60
parsimony informative sites, not including the indels. The
barcode region of the 59 end of the COI gene produced a
654 bp segment containing 28 variable and 22 parsimony
informative sites.
Nuclear genes had markedly lower variability than the
mitochondrial genes. The 604 bp segment of the EHHADH
gene contained five variable and five parsimony informative
362
Table 1. Nucleotide composition for sequences of Seriola lalandi generated in this study by gene. Length of analyzed sequence (bp), percent
nucleotide composition, number of variable sites (v), number of parsimony informative sites (p), number of indels (i), and GenBank accession
numbers.
Gene bp %A %G %T
CR 396 29.4 19 37
COI 654 22.8 19.8 28.4
EHHADH 604 19.9 33.4 21.6
RAG2 618 23.6 28.5 20.1
UBE3A 691 24.5 28.3 16.6
MLL 550 23.1 35.5 21.4
Overall 3513 23.6 27.7 23.3
sites. These five sites for EHHADH clearly separated samples
by region with the exception that samples MP21 and MP37
were heterozygous for one or two sites, respectively, that
differentiated the NEP and NWP regions. The 618 bp
segment of the RAG2 gene contained five variable and three
parsimony informative sites. A single site separated North
Pacific and Southern Hemisphere samples. The 691 bp
segment of the UBE3A gene contained three variable sites
and only one parsimony-informative site with no clear
geographic signal. The 550 bp segment of the MLL gene
contained only a single variable and parsimony-informative
site. This single variable site uniquely separated the NWP
samples from the others.
Both Bayesian and Maximum Likelihood analyses using
combined mitochondrial sequences (CR and COI) produced
trees with four strongly supported clades that conformed to
regional groups of samples from the NWP, NEP, South
Pacific, and South Atlantic (Fig. 2). For all parameters of the
Bayesian posterior probability analysis, ESS values were
.200 and PSRF values were equal to 1, indicating that all
parameters were well sampled and that runs likely reached
convergence (Ronquist et al., 2012). Posterior probability
and Maximum Likelihood bootstrap values were high and
ranged between 99% to 100% and 91% to 99%, respectively,
for each of the clades. Individual trees constructed for the
mtDNA CR and COI genes (data not shown) were in
agreement; however, the greater number of variable sites
within the CR led to higher support values and better
resolution than was observed from COI.
Analyses using combined nuclear gene data (RAG2,
EHHADH, UBE3A, and MLL) produced trees with three
distinct clades (Fig. 3). Overall, tree topology was highly
similar to the mitochondrial data with the exception that
samples from the Southern Hemisphere formed a single
clade rather than the two clades observed from the CR and
COI data. Posterior probability support of the three clades
was high, ranging between 93% (NEP and Southern
Hemisphere) and 99% (NWP). Individual gene trees were
mostly in agreement, though resolution for individual genes
was limited given the low variability of these genes
(Table 1). The RAG2, EHHADH, and MLL genes all produced
between one to three regionally distinct clades with the
EHHADH gene showing the greatest resolution of the
nuclear markers while the UBE3A data showed no clear
pattern (individual trees not shown).
Combined mitochondrial and nuclear gene data produced
a tree (Fig. 4) with very high support for three separate
regionally specific clades (NWP, NEP, and S. Hemisphere).
Both Bayesian posterior and Maximum Likelihood bootstrap
Copeia 103, No. 2, 2015
%C v p i Accession #
14.6 76 60 11 KC241994KC242111
29 28 22 0 KM877615KM877656
25 5 5 0 KM877657KM877698
27.8 5 3 0 KM877783KM877824
30.6 3 1 0 KM877699KM877740
20 1 1 0 KM877741KM877782
25.4 118 92 11
support these clades at 95100%. Similar to the mtDNA
analyses, within the Southern Hemisphere, samples from
Chile and New Zealand formed a clade separate from the
South African samples with high support (90% and 100%).
Given the lack of resolution in this region using nuclear data
alone (Fig. 3), this additional partitioning is due to the
mitochondrial data.
Overall mean pairwise nucleotide distances between the
three regional clades (NEP, NWP, and S. Hemisphere) were
1.41.6% (Table 2) while within regional clade mean
distances were 0.20.3%. For the mitochondrial gene
partition, the mean pairwise differences between regional
clades were 4.34.6% while intraclade distances remained
low at 0.60.8% (Table 3).
Analysis of the meristic data among the three clades
(Table 4, Fig. 5) identified by the genetic analyses yielded
significant differences (ANOSIM; R 5 0.275; P 5 0.05) in the
number of dorsal- and anal-fin rays and counts of gill rakers
among the three regions. Most notably, individuals from
California-Mexico (median 5 25) and Japan (median 5
26.5) had higher total gill raker counts than those from the
Southern Hemisphere (Australia-New Zealand-Chile-South
Africa-Brazil; median 5 22).
DISCUSSION
Genetic differences among lineages.Phylogenetic and mor-
phological data on the present study of the cosmopolitan
Yellowtail Jack, strongly support three clades corresponding
to the Northeast Pacific, the Northwest Pacific, and the
Southern Hemisphere (Fig. 6). These findings are consistent
with population genetic analyses of the species based on
mitochondrial sequence data and nuclear microsatellite
markers that have identified genetically distinct stocks in
the NW and NE Pacific (Purcell et al., unpubl.) and
significant divergence between Northern and Southern
hemispheres (Nugroho et al., 2001; Purcell et al., unpubl.).
The highly variable mitochondrial data identify additional
separation of the South Pacific from the South Atlantic;
however, in this study, the nuclear markers did not reveal
that level of resolution. While spatial population analyses
using both mitochondrial and nuclear data also support
differentiation between these regions (Purcell et al., un-
publ.), the scale of this divergence (evolutionarily and
spatially) needs to be investigated in greater depth within
the Southern Hemisphere. In several marine taxa that were
considered globally distributed cosmopolitan species, their
discontinuous distributions and likely reduced connectivity
among populations led to the evolution of distinct genetic
Martinez-Takeshita et al.Cryptic speciation in Seriola 363

Fig. 4. Bayesian derived consensus tree of combined mitochondrial and nuclear DNA sequence data (CR, COI, EHHADH, UBE3A, MLL, RAG2) for
Seriola lalandi and rooted with S. dumerili. Specimen designations are JP 5 Japan; CA 5 California; MP 5 Mexico Pacific; MG 5 Mexico Gulf (Gulf of
CA); CH 5 Chile; NZ 5 New Zealand; SA 5 South Africa. Values above nodes reflect Bayesian posterior probabilities, while values below nodes
indicate Maximum Likelihood bootstrap support values; values ,80 are not shown.

lineages within these taxa (Sedberry et al., 1996; Colborn et
al., 2001; Carlsson et al., 2004; Castro et al., 2007; Chabot
and Allen, 2009). We assert that similar mechanisms have
led to at least three cryptic species from the taxon currently
referred to as Yellowtail Jack.
Table 2. Average pairwise genetic distance between four regional
sampling areas with mtDNA gene distance below the diagonal and
nuclear gene distance above. CH/NZ = Chile, New Zealand; NWP =
Japan; NEP = California, Mexico Pacific, Mexico Gulf; SA = South Africa.
Genetic divergence within genera ranges widely among
organisms; in fish, Ward et al. (2005) found mitochondrial
divergence ranging from 1.11% in pelagic tuna (species of
Thunnus) to 15.55% in bottom-dwelling flatheads (species of
Platycephalus, Neoplatycephalus, Cymbacephalus). Mitochon-
drial divergence among the three Seriola clades ranged
between 4.24% and 4.63% (Table 2), which corresponds to
Table 3. Average pairwise genetic distance within regional sampling
areas for mtDNA and nuclear genes. CH/NZ = Chile, New Zealand; NWP
= Japan; NEP = California, Mexico Pacific, Mexico Gulf; SA = South Africa.

CH/NZ NWP NEP SA Mitochondrial Nuclear

CH/NZ * 0.0029 0.0031 0.0006 CH/NZ 0.0028 0.0005
NWP 0.0434 * 0.0015 0.0027 NWP 0.0059 0
NEP 0.045 0.0424 * 0.0029 NEP 0.0081 0.0002
SA 0.0119 0.0424 0.0463 * SA 0.0076 0.0005
364 Copeia 103, No. 2, 2015

Table 4. Summary of meristic counts (number of dorsal-fin rays, anal-fin rays, and total gill rakers) is presented for specimens of Seriola lalandi from
the three regions identified by phylogenetic analysis.

Dorsal-fin rays
Region 31 32 33 34 35 36 37 38 Median
So. Hem 4 5 4 10 2 1 33.5
NE Pac 1 6 34
NW Pac 1 1 2 32.5

Anal-fin rays
Region 17 18 19 20 21 22 23 24 Median
So. Hem 4 8 10 4 21
NE Pac 4 3 20
NW Pac 1 1 2 21.5

Total gill rakers

Region 20 21 22 23 24 25 26 28 Median
So. Hem 1 7 6 9 1 1 1 22
NE Pac 2 2 3 25
NW Pac 1 1 2 26.5

2.1 to 2.3 million years of separation among these lineages
using the mitochondrial divergence estimate of 2% per
million years (Brown et al., 1979; Bowen et al., 2001). In the
Southern Hemisphere, mitochondrial divergence was much
lower between the S. Pacific and South Africa (1.19%); by the
same calculation, this corresponds to a separation of only
595,000 years. Although mitochondrial markers are often
used to assign phylogenetic relationships, these estimates
can be heavily influenced by sex-biased dispersal or other
maternal behaviors, and may not accurately represent
divergence for the population or species as a whole. To
account for that bias, nuclear markers were also used to
examine divergence among the clades. Estimates of genetic
divergence were much lower, 0.15% to 0.31% (Table 2);
however, Bayesian posterior and Maximum Likelihood
bootstrap values showed strong (9395%) support of the
three lineages (Fig. 3). There were no fixed sequence
differences between specimens collected in the S. Pacific
and South Africa using the nuclear genes (Fig. 3), and while
the pattern varies slightly between the mitochondrial and
nuclear genes, given the low divergence (0.06%) and lack of
fixed differences in the nuclear markers, there is inadequate

Fig. 5. MDS representation of meristic differences (# gill rakers, # dorsal-fin rays, # anal-fin rays). nMDS plot and ANOSIM results of meristic counts
(number of dorsal-fin rays, anal-fin rays, and total gill rakers) and ellipses enclose specimens of Seriola lalandi from the three geographic regions
identified by genetic analysis.
Martinez-Takeshita et al.Cryptic speciation in Seriola
Fig. 6. Distributions of proposed species of Seriola formerly referred to as S. lalandi.
evidence to support these regions as separate species. Gene
flow may intermittently connect these Southern Hemi-
sphere locations, or the small amount of divergence may
indicate much more recent divergence between S. lalandi in
the S. Pacific and South Africa, as has been reported in other
fish species (Zemlak et al., 2009).
Several mechanisms may lead to genetic divergences
within these taxa. One of the more prominent ways that
this occurs is through reduced dispersal, which may be
much lower than the expected migratory capacity of the
organism. In the present study, the hemispheric divergence
observed in S. lalandi is likely attributed to the equatorial
region acting as a dispersal boundary for this fish. As a
subtropical and temperate species, Seriola lalandi are most
often found in waters that range in sea surface temperature
between 18u and 24uC (Fielder and Heasman, 2011). The
tropical equatorial regions reach higher surface water
temperatures than the known thermal range preferred or
tolerated by larval and adult S. lalandi (Heemstra and
Heemstra, 2004; Moran et al., 2007a, 2007b; Garrison,
2010; National Oceanic and Atmospheric Administration,
2011), which likely limits movement between the hemi-
spheres. Biological thermal constraints (e.g., warm equatorial
waters) may serve as a barrier to dispersal for many temperate
and subtropical marine species (Chabot and Allen, 2009). The
genetic divergence observed between S. lalandi in the
Northern and Southern hemispheres is similar to several
cosmopolitan taxa such as the soupfin shark, Galeorhinus
galeus, and the wreckfish, Polyprion americanus, which have
also demonstrated significant divergences between hemi-
spheres (Sedberry et al., 1996; Chabot and Allen, 2009).
Global circulation patterns also likely limit dispersal despite
extended pelagic juvenile stages in these species (Sedberry et
al., 1996). These, and other oceanographic and geological
boundaries, help drive allopatric speciation among discon-
tinuous populations (Colborn et al., 2001).
365
In the North Pacific, two genetically distinct lineages were
identified, the Northeast and Northwest Pacific. Isolation of
these lineages in the northern hemisphere may be due to a
combination of behavioral characteristics, thermal prefer-
ences, and major oceanic circulation patterns. While
Yellowtail Jack are considered a coastal pelagic fish,
migratory movements in mature fish occur on a more
regional scale rather than at the ocean basin-wide scale
(Baxter, 1960; Miller et al., 2011). Therefore, it is expected
that trans-Pacific migrations would be very uncommon in
this species. In addition to limited migratory behavior in
mature fish, major current patterns and thermal preferences
also limit dispersal within the North Pacific. The major
currents fueling the North Pacific Gyre occur over a great
range of temperatures as they traverse from tropical to
temperate and boreal latitudes. Water temperatures in the
North Equatorial Current and Kuroshio Current are higher
than the range of temperatures that mature or larval S.
lalandi can withstand. Conversely, the North Pacific Current
water temperatures are generally lower than the thermal
range of this species (Heemstra and Heemstra, 2004; Moran
et al., 2007a, 2007b; Garrison, 2010; National Oceanic and
Atmospheric Administration, 2011). As a result, thermal
restraints limit the feasibility of passive dispersal of either
larval or adult Yellowtail Jack around the North Pacific.
Within the Southern Hemisphere, a combination of
dynamics in the sub-tropical and temperate regions permits
a low-level of connectivity among S. lalandi sampled in
South Africa, New Zealand, and Chile. The presence of
stepping-stone oceanic islands, current circulation pat-
terns, and a general lack of geographic barriers (with the
exception of the southern reach of South America) have
likely led to less divergence among these areas. The southern
Pacific Ocean basin, in particular, contains numerous
islands including Rapa, Pitcairn, and Easter islands where
the presence of S. lalandi has been recorded (Smith-Vaniz et
366
al., 1990). Island distributions, such as these, likely promote
gene flow through the dispersal phenomenon of island
hopping, and this dispersal may be further aided by
oceanographic circulation patterns in the South Indian
and Pacific gyres. Larval and juvenile Seriola may be
transported around the Southern Hemisphere by the East
Australian Current, which flows into the South Pacific
Current and later crosses into the Peru Current. Unlike the
North Pacific Gyre where unsuitable temperature regimes
may be encountered (.45uN), currents in the southern gyres
(that could promote connectivity between South Africa and
Chile) do not exhibit such extreme temperatures (Garrison,
2010). Within these three currents, temperatures remain
within the thermal preferences for both the adult and larval
stages of Yellowtail Jack (Heemstra and Heemstra, 2004;
Moran et al., 2007a, 2007b). This eastward dispersal and
island hopping pattern across the Pacific has been observed
in other fish species (Burridge et al., 2006) and supports
McDowalls assertion that some dispersal events may be
surprisingly regular and enduring across the Southern
Hemisphere in source, direction, and target area (McDowall,
2004). This may be especially true for a species such as S.
lalandi that has both a planktonic larval stage and an affinity
to associate with floating objects (e.g., drifting kelp
assemblages) in the juvenile stage (Cowen et al., 2006;
Purcell et al., 2006).
Meristic differences among regions.Smith-Vaniz (1986)
concluded that regional groups of Seriola lalandi showed
little to no morphological distinctiveness based on type
specimens and placed all nominal species into synonymy.
However, based on our analysis of the raw meristic data
provided by Smith-Vaniz, significant differences in the
combination of dorsal and anal soft ray counts and, in
particular, the total number of gill rakers was observed
among the three regional groups distinguished by the
genetic data. These, albeit subtle, meristic differences
coupled with additional recorded differences in life-history
parameters (e.g., maximum size and age, age at maturity,
Baxter, 1960; Gillanders et al., 1999) among regions lend
support to the evolutionary distinctiveness of Seriola from
the three major regions of the worlds temperate-subtropical
seas proposed herein.
Conclusions.This study has demonstrated that three dis-
tinct genetic lineages exist within the currently recognized
Seriola lalandi Valenciennes, 1833 species occurring in the
NW Pacific, the NE Pacific, and the Southern Hemisphere.
Based on the strong phylogenetic structure and significant
meristic differences among these same groups, we conclude
that three cryptic species currently bear the name Seriola
lalandi Valenciennes, 1833. Therefore, we propose the
resurrection of the currently available names for these
species in each region based on nomenclatural priority:
Seriola lalandi Valenciennes 1833 in Brazil, South Africa,
Australia, New Zealand, and Chile; Seriola aureovittata
Temminck and Schlegel, 1845 in Japan; and Seriola dorsalis
(Gill, 1863) in California, Pacific Baja, and the Gulf of
California, Mexico.
ACKNOWLEDGMENTS
Yellowtail Jack specimens for this study from southern and
Baja California were collected by the authors via hook and
line sampling, and by M. Steele (CSUN) spear-fishing aboard
Copeia 103, No. 2, 2015
various vessels (under the scientific collecting permit
#000032 from the California Department of Fish and Game)
including the FV Toronado, FV Aloha Spirit, FV Cobra, RV
Yellowfin, FV Royal Polaris, various pangas, and from private
sport fishermen. Specimens of Yellowtail Jack from Japan
were collected by commercial fishermen and obtained
through Naigai Foods, Inc. from Fukuoka, Kyushu, Japan
and from Dr. K. Saitoh, National Research Institute of
Fisheries Science (Aquatic Genomics Research Center),
Tokyo. Specimens from Chile were generously provided by
the Museo Nacional de Historia Natural, Gobierno de Chile
(MNHNC). Specimens from New Zealand were also collected
by the senior author via hook and line sampling aboard the
FV Pursuit and FV Earl Grey, while those from South Africa
were again obtained from R. Roodt-Wildings Laboratory at
Stellenbosch University (SUM), South Africa. Finally, K.
Zilberberg and P. Coelhinho (Universidad Federal do Rio de
Janeiro [MNRJ]) obtained a single specimen each of S.
dumerili for us from off Brazil from a fish market in Rio de
Janeiro. Also, we are greatly indebted to W. Smith-Vaniz
(U.S. Geological Survey, retired) who generously provided
advice, publications, and morphometric data from many
individuals throughout the world including holotypes from
the Southern Hemisphere and the data collected by F.
Mather, III. Finally, the authors wish to thank M. Franklin
for his special contributions to this work since its inception.
Funds for this work were provided by the NIH MBRS RISE
program (#2R25GM063787), M. Takeshita, the Nearshore
Marine Fish Research Program, Department of Biology,
California State University, Northridge, and the Southwest
Fisheries Science Center, National Marine Fisheries Service,
La Jolla, California.
LITERATURE CITED
Bass, A. L., H. Dewar, T. Thys, J. T. Streelman, and S. A.
Karl. 2005. Evolutionary divergence among lineages of
the ocean sunfish family, Molidae (Tetraodontiformes).
Marine Biology 148:405414.
Baxter, J. L. 1960. A study of the Yellowtail, Seriola dorsalis
(Gill). California Department of Fish and Game, Fishery
Bulletin 110.
Bickford, D., D. J. Lohman, N. S. Sodhi, P. K. L. Ng, R.
Meier, K. Winkler, K. K. Ingram, and I. Das. 2006.
Cryptic species as a window on diversity and conserva-
tion. Trends in Ecology & Evolution 22:149155.
Bowen, B. W., A. L. Bass, L. A. Rocha, W. S. Grant, and
D. R. Robertson. 2001. Phylogeography of the trumpet-
fishes (Aulostomus): ring species complex on a global scale.
Evolution 55:10291039.
Brown, W. M., M. George, Jr., and A. C. Wilson. 1979.
Rapid evolution of animal mitochondrial DNA. Proceed-
ings of the National Academy of Sciences of the United
States of America 76:19671971.
Burridge, C. P., M. C. Roberto, and B. S. Dyer. 2006.
Multiple origins of the Juan Fernandez kelpfish fauna and
evidence for frequent and unidirectional dispersal of
cirrhitoid fishes across the South Pacific. Systematic
Biology 55:566578.
Carlsson, J., J. R. McDowell, P. Diaz-Jaimes, and J. E. L.
Carlsson. 2004. Microsatellite and mitochondrial DNA
analyses of Atlantic bluefin tuna (Thunnus thynnus
thynnus) population structure in the Mediterranean Sea.
Molecular Ecology 13:33453356.
Martinez-Takeshita et al.Cryptic speciation in Seriola
Castelnau, F. L. 1872. Contribution to the ichthyology of
Australia. No. 1. The Melbourne fish market, p. 29242.
No. II. Note on some South Australian fishes, p. 243247.
Proceedings of the Zoological and Acclimatisation Society
of Victoria 1:29247.
Castro, A. L. F., B. S. Stewart, S. G. Wilson, R. E. Hueter,
M. G. Meekan, P. J. Motta, B. W. Bowen, and S. A. Karl.
2007. Population genetic structure of Earths largest fish,
the whale shark (Rhincodon typus). Molecular Ecology
16:51835192.
Catanese, G., M. Manchado, and C. Infante. 2010.
Evolutionary relatedness of mackerels of the genus
Scomber based on complete mitochondrial genomes:
strong support to the recognition of Atlantic Scomber
colias and Pacific Scomber japonicus as distinct species.
Gene 452:3543.
Chabot, C. L., and L. G. Allen. 2009. Global population
structure of the tope (Galeorhinus galeus) inferred by
mitochondrial control region sequence data. Molecular
Ecology 18:545552.
Cheng, J., T. Gao, Z. Miao, and T. Yanagimoto. 2011.
Molecular phylogeny and evolution of Scomber (Teleostei:
Scombridae) based on mitochondrial and nuclear DNA
sequences. Chinese Journal of Oceanology and Limnology
29:297310.
Colborn, J., R. E. Crabtree, J. B. Shaklee, E. Pfeiler, and
B. W. Bowen. 2001. The evolutionary enigma of bone-
fishes (Albula spp.): cryptic species and ancient separa-
tions in a globally distributed shorefish. Evolution
55:807820.
Cowen, R. K., C. B. Paris, and A. Srinivasan. 2006. Scaling
of connectivity in marine populations. Science 311:
522527.
Craig, M. T., R. T. Graham, R. A. Torres, J. R. Hyde, M. O.
Frietas, B. P. Ferreira, M. Hostim-Silva, L. C. Gerhar-
dinger, A. A. Bertoncini, and D. R. Robertson. 2009.
How many species of goliath grouper are there? Cryptic
genetic divergence in a threatened marine fish and the
resurrection of a geopolitical species. Endangered Species
Research 7:167174.
Daly-Engel, T. S., K. D. Seraphin, K. N. Holland, J. P.
Coffey, H. A. Nance, R. J. Toonen, and B. W. Bowen.
2012. Global phylogeography and mixed-marker analysis
reveals male-mediated dispersal in the endangered scal-
loped hammerhead shark (Sphyrna lewini). PLoS ONE
7:e29986.
Drummond, A. J., B. Ashton, S. Buxton, M. Cheung, A.
Cooper, C. Duran, M. Field, J. Heled, M. Kearse, S.
Markowitz, R. Moir, S. Stones-Havas, S. Sturrock, T.
Thierer, and A. Wilson. 2010. Geneious v5.5. http://
www.geneious.com
Duncan, K. M., A. P. Martin, B. W. Bowen, and H. G.
DeCouet. 2006. Global phylogeography of the scalloped
hammerhead shark (Sphyrna lewini). Molecular Ecology
15:22392251.
Dunn, K. 2014. The diet, reproductive biology, age and
growth of yellowtail, Seriola lalandi, in South Africa.
Unpubl. Masters thesis, University of Cape Town, Cape
Town, South Africa.
Erisman, B., I. Mascarenas, G. Paredes, Y. Sadovy de
Mitcheson, O. Aburto-Oropeza, and P. Hastings. 2010.
Seasonal, annual, and long-term trends in commercial
fisheries for aggregating reef fishes in the Gulf of
California, Mexico. Fisheries Research 106:279288.
367
Fielder, D. S., and M. P. Heasman. 2011. Hatchery manual
for the production of Australian bass, mulloway and
yellowtail kingfish. New South Wales Department of
Industry and Investment, Fisheries and Research Devel-
opment Corporation, Australia.
Garrison, T. 2010. Oceanography: An Invitation to Marine
Science. Seventh edition. Cengage Learning, Brooks/Cole,
Belmont, California.
Gill, T. N. 1863. Catalogue of the fishes of Lower California,
in the Smithsonian Institution, collected by Mr. J. Xantus.
Part IV. Proceedings of the Academy of Natural Sciences of
Philadelphia 15:8088.
Gillanders, B. M., D. J. Ferrell, and N. L. Andrew. 1999.
Size at maturity and seasonal changes in gonad activity of
yellowtail kingfish (Seriola lalandi; Carangidae) in New
South Wales, Australia. New Zealand Journal of Marine
and Freshwater Research 33:457468.
Graves, J. 1998. Molecular insights into the population
structures of cosmopolitan marine fishes. Journal of
Heredity 89:427437.
Heemstra, P. C., and E. Heemstra. 2004. Coastal fishes of
Southern Africa. South African Institute for Aquatic
Biodiversity and National Inquiry Service Centre, Gra-
hamstown, South Africa.
Huelsenbeck, J. P., and F. Ronquist. 2001. MRBAYES:
Bayesian inference of phylogenetic trees. Bioinformatics
17:754755.
Hyde, J. R., C. A. Kimbrell, J. E. Budrick, E. A. Lynn, and
R. D. Vetter. 2008. Cryptic speciation in the vermilion
rockfish (Sebastes minatus) and the role of bathymetry in
the speciation process. Molecular Ecology 17:11221136.
Ivanova, N. V., T. S. Zemlak, R. H. Hanner, and P. D. N.
Hebert. 2007. Universal primer cocktails for fish DNA
barcoding. Molecular Ecology Notes 7:544548.
Li, C. H., and G. Ort. 2007. Molecular phylogeny of
Clupeiformes (Actinopterygii) inferred from nuclear and
mitochondrial DNA sequences. Molecular Phylogenetics
and Evolution 44:386398.
Lindstrom, D. P., M. J. Blum, R. P. Walter, R. B. Gagne,
and J. F. Gilliam. 2012. Molecular and morphological
evidence of distinct evolutionary lineages of Awaous
guamensis in Hawaii and Guam. Copeia 2012:293300.
Mather, F. J., III. 1971. Seriola carpenteri, a new species of
amberjack (Pisces, Carangidae) from tropical western
Africa. Proceedings of the Biological Society of Washing-
ton 84:177188.
Mather, F. J., III, and H. A. Schuck. 1974. Growth of bluefin
tuna of the Western North Atlantic. U.S. Fish and Wildlife
Service, Fishery Bulletin 179:139152.
McDowall, R. M. 2004. What biogeography is: a place for
process. Journal of Biogeography 31:345351.
Miller, P. A., A. J. Fitch, M. Gardner, K. S. Hutson, and G.
Mair. 2011. Genetic population structure of Yellowtail
Kingfish (Seriola lalandi) in temperate Australasian waters
inferred from microsatellite markers and mitochondrial
DNA. Aquaculture 319:328336.
Moran, D., B. Gara, and R. M. G. Wells. 2007b. Energetics
and metabolism of yellowtail kingfish (Seriola lalandi
Valenciennes 1833) during embryogenesis. Aquaculture
265:359369.
Moran, D., C. K. Smith, B. Gara, and C. W. Poortenaar.
2007a. Reproductive behaviour and early development in
yellowtail kingfish (Seriola lalandi Valenciennes 1833).
Aquaculture 262:95104.
368
National Oceanic and Atmospheric Administration.
2011. NOAA Optimum Interpolation Sea Surface Temper-
ature Analysis. NOAA/OAR/ESRL PSD (United States
Department of Commerce), Boulder, Colorado.
Neira, F. J., A. G. Miskiewicz, and T. Trnski. 1998. Larvae of
Temperate Australian Fishes. University of Western Aus-
tralia Press, Perth.
Nugroho, E., D. J. Ferrell, P. Smith, and N. Taniguchi.
2001. Genetic divergence of kingfish from Japan, Australia
and New Zealand inferred by microsatellite DNA and
mitochondrial DNA control region markers. Fisheries
Science 67:843850.
Nylander, J. A. A. 2004. MrModeltest v2. Program distrib-
uted by the author. Evolutionary Biology Centre, Uppsala
University.
Ohara, E., T. Nishimura, Y. Nagakura, T. Sakamoto, K.
Mushiake, and N. Okamoto. 2005. Genetic linkage maps
of two yellowtails (Seriola quinqueradiata and Seriola
lalandi). Aquaculture 244:4148.
Palumbi, S. R. 1994. Genetic divergence, reproductive
isolation, and marine speciation. Annual Review of
Ecology and Systematics 25:547572.
Pfenniger, M., and K. Schwenk. 2007. Cryptic animal
species are homogeneously distributed among taxa and
biogeographical regions. BMC Evolutionary Biology
7:121.
Poortenaar, C. W., S. H. Hooker, and N. Sharp. 2001.
Assessment of yellowtail kingfish (Seriola lalandi) repro-
ductive physiology, as a basis for aquaculture develop-
ment. Aquaculture 201:271286.
Posada, D. 2008. jModelTest: phylogenetic model averag-
ing. Molecular Biology and Evolution 25:12531256.
Purcell, C. M., and S. Edmands. 2011. Resolving the
genetic structure of striped marlin, Kajikia audax, in the
Pacific Ocean through spatial and temporal sampling of
adult and immature fish. Canadian Journal of Fisheries
and Aquatic Sciences 68:18611875.
Purcell, J. F. H., R. K. Cowen, C. R. Hughes, and D. A.
Williams. 2006. Weak genetic structure indicates strong
dispersal limits: a tale of two coral reef fish. Proceedings of
the Royal Society: Biological Sciences 273:14831490.
Rocha, L. A., M. T. Craig, and B. W. Bowen. 2007.
Phylogeography and the conservation of coral reef fishes.
Coral Reefs 26:501512.
Ronquist, F., and J. P. Huelsenbeck. 2003. MrBayes 3:
Bayesian phylogenetic inference under mixed models.
Bioinformatics 19:15721574.
Ronquist, F., M. Teslenko, P. van der Mark, D. L. Ayres, A.
Darling, S. Ho hna, B. Larget, L. Liu, M. A. Suchard, and
J. P. Huelsenbeck. 2012. MrBayes 3.2: efficient Bayesian
phylogenetic inference and model choice across a large
model space. Systematic Biology 61:539542.
Sala, E., O. Aburto-Oropeza, G. Paredes, and G. Thomp-
son. 2003. Spawning aggregations and reproductive
behavior of reef fishes in the Gulf of California. Bulletin
of Marine Science 72:103121.
Copeia 103, No. 2, 2015
Scoles, D. R., B. B. Collette, and J. E. Graves. 1998. Global
phylogeography of mackerels of the genus Scomber.
United States Fishery Bulletin 96:823824.
Sedberry, G. R., J. L. Carlin, R. W. Chapman, and B. Eleby.
1996. Population structure in the pan-oceanic wreckfish,
Polyprion americanus (Teleostei: Polyprionidae), as indicat-
ed by mtDNA variation. Journal of Fish Biology 49:
318329.
Shiraishi, T., S. Ohshimo, and R. Yukami. 2010. Age,
growth and reproductive characteristics of gold striped
amberjack 1 Seriola lalandi in the waters off western
Kyushu, Japan, New Zealand. Journal of Marine and
Freshwater Research 44:117127.
Smith-Vaniz, W. F. 1986. Carangidae, p. 638661. In:
Smiths Sea Fishes. M. M. Smith and P. Heemstra (eds.).
Springer-Verlag, Berlin.
Smith-Vaniz, W. F., J.-C. Quero, and M. Desoutter. 1990.
Carangidae, p. 729755. In: Check-list of the Fishes of the
Eastern Tropical Atlantic (CLOFETA). Vol. 2. J. C. Quero,
J. C. Hureau, C. Karrer, A. Post, and L. Saldanha (eds.).
JNICT, Lisbon; SEI, Paris; and UNESCO, Paris.
Sumida, B. Y., H. G. Moser, and E. Hahlstrom. 1985.
Descriptions of larvae of California yellowtail, Seriola
lalandi, and three other carangids from the eastern
tropical Pacific: Chloroscombrus orquna, Caranx caballus,
and Caranx sexfasciatus. CalCOFI Report XXVI:139159.
Tamura, K., G. Stecher, D. Peterson, A. Filipski, and S.
Kumar. 2013. MEGA6: molecular evolutionary genetics
analysis version 6.0. Molecular Biology and Evolution
30:27252729.
Temminck, C. J., and H. Schlegel. 1845. In: Temminck and
Schlegel 1843. Fauna Japonica, sive description animal-
ium quae in itinere per Japoniam. Parts 79:113172.
Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994.
CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weight-
ing, position-specific gap penalties and weight matrix
choice. Nucleic Acids Research 22:46734680.
Valenciennes, A. 1833. In: G. Cuvier and A. Valenciennes
1833. Histoire naturelle des poissons. Tome neuvie`me.
Suite du livre neuvie`me. Des Scomberodes. Histoire
naturelle des poissons v. 9:ixxix+3 pp. +1512, Pls. 246
279. (Cuvier authored p. 1198, 330359, 372427;
Valenciennes the balance. ixxiv+1379 in Strasbourg
edition. p. 429512 contains additions and corrections
for vols. 2 through 5.)
Vin
as, L., J. R. Alvarado Bremer, and C. Pla. 2004.
Interoceanic genetic differentiation among albacore (Thun-
nus alalunga) populations. Marine Biology 145:225232.
Ward, R. D., T. S. Zemlak, B. H. Innes, P. R. Last, and
P. D. N. Hebert. 2005. DNA barcoding Australias fish
species. Philosophical Transactions of the Royal Society B
360:18471857.
Zemlak, T. S., R. D. Ward, A. D. Connell, B. H. Holmes,
and P. D. N. Hebert. 2009. DNA barcoding reveals
overlooked marine fishes. Molecular Ecology Resources
9:237242.