See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/281495078

Production of antimicrobial metabolite from a

local Penicillium sp. novel strain

Article September 2015

READS

54

2 authors:

Mohammed Fadhil Mohammad J. Al-Jassani

Ibn hayyan college University of Babylon, DNA Research Center
3 PUBLICATIONS 0 CITATIONS 11 PUBLICATIONS 7 CITATIONS

SEE PROFILE SEE PROFILE

All in-text references underlined in blue are linked to publications on ResearchGate, Available from: Mohammad J. Al-Jassani
letting you access and read them immediately. Retrieved on: 07 August 2016
Current Research in Microbiology and Biotechnology
Vol. 3, No. 5 (2015): 725-732
Research Article
Open Access
ISSN: 2320-2246

Production of antimicrobial metabolite from a local

Penicillium sp. novel strain
Mohammed F. Al-Jawad1, Mohammad J. Al-Jassani2* and Rabab O. Al-Jelawi3

1 Green University of Al Qasim, Babylon, Iraq.

2 DNA research center, University of Babylon, P.O. Box 4, Babylon, Iraq.
3 Department of Biology, College of Science, University of Babylon, P.O. Box 4, Babylon, Iraq.

* Corresponding author: Mohammad J. Al-Jassani; e-mail: pcr2000@yahoo.com

Received: 20 July 2015 Accepted: 16 August 2015 Online: 01 September 2015

ABSTRACT
Fungi were the first producers of antibiotics since 1928. Penicillium is one of the most important antibiotic
producers that need to be thoroughly investigated for antibiotic production. The effect of different pH,
temperature and duration for production of the antimicrobial metabolite were investigated using four natural
liquid media. The mold isolate (P1ROR) was identified morphologically and by sequencing the ITS region as a
novel Penicillium sp. strain. The mold isolate was found active in producing an antibiotic against both pathogenic
penicillin resistant bacteria and pathogenic molds. The potato infusion with added table sugar was the best and
economic liquid medium for antimicrobial metabolite production, while the optimum fermentation conditions
were pH 6.5 at 30C for 5 days. The produced antimicrobial metabolite with its valuable properties is highly
needed especially with the emergence of resistant strains and need to put in practice.

Keywords: Antimicrobial, Penicillium, novel strain, sequencing.

1. INTRODUCTION
The term antibiotic literally means against life, it
defined as secondary metabolites isolated from
microbe exhibit either antimicrobial (antibacterial,
antifungal, antiprotozoal), antitumor and/or antiviral
activities. More than 16500 antibiotics are known up to
date where 29% of them produced by fungi [1]. The
ability to produce antibiotics has been found mainly in
molds of the order Aspergillales [2]. Perhaps one of the
few most important discoveries regarding the
beneficial use of fungi for humans was the
identification in 1928 by Sir Alexander Fleming, that an
isolate of Penicillium notatum produced a substance
capable of killing Gram positive bacteria [3]. From that
time, antibiotics produced by molds are widely used in
current chemotherapy especially the penicillin,
cephalosporin and fusidic acid, which have both
antibacterial and antifungal activity [4]. Different
species or strains of Penicillium is a producer of many
antibiotics including antibacterial, antifungal and
antitumor [5-7]. The internal transcribed spacer (ITS)
region (i.e. ITS1, 5.8S and ITS2) of fungal rRNA genes is
an increasingly used sequence region for fungal
molecular taxonomy studies for its high variability that
yield more resolution [8; 9].
The ability of fungal strains to produce antimicrobial
substances is influenced by different conditions of
nutrition and cultivation significantly. Therefore, the
medium constitution together with the metabolic
capacity of the producing mold are significantly affect
the synthesis of bioactive metabolites. Several
environmental factors, such as temperature, pH, and
incubation period, play the major role in the production
of antimicrobial agent(s) [10].
The emergence of antibiotic resistant pathogenic
strains made an urgent need for a new antibiotic
discovery. The present study is an attempt for a new
antibiotic producing mold screening, and optimization
of culture conditions for production. In addition to,
finding more efficient and economic medium for
production because, cost-effectiveness is a crucial issue
in the industrial field.

http://crmb.aizeonpublishers.net/content/2015/5/crmb725-732.pdf 725
 Mohammed F. Al-Jawad et al. / Curr Res Microbiol Biotechnol. 2015, 3(5): 725-732

2. MATERIALS AND METHODS
Pure alkaline (pH8) soil molds isolates, different
pathogenic bacteria and molds (preserved in Amies
transport medium (ATM)) were obtained from the
biotechnology and genetic engineering advanced
research unit, college of science, University of Babylon.
2.1 Screening for antagonistic activity
2.1.1 Primary screening
Preliminary screening for antibacterial activity was
done by the cross-streak method [11], on four
readymade media, potato dextrose agar (PDA),
trypticase soy agar (TSA), nutrient agar (NA) and
Muller Hinton agar (MHA) (HIMEDIA, India), using
phosphate buffer to maintain the pH 7. Purified fungi
isolates from transport swab media were streaked
across one-third of the plates then incubated at 27C
for 10 days. Test pathogenic bacteria (Staphylococcus
aureus, Streptococcus pyogenes, Morganella morganii,
E.coli and Pseudomonas aeruginosa), were streaked
perpendicular to the fungus growth, and the plates
were further incubated at 37C for 24 h. The inhibitory
effect was determined by the failure of the test bacteria
to grow near producing mold.
Crawford method was followed for primary screening
of antifungal activity [12]. On the PDA, the purified
molds isolates from transport swab media were
streaked onto one side of the plates then incubated at
30C for 72 h, or when the colonies are visible. Then, an
agar plug from 10 day old culture of each test
pathogenic mold (Microsporum canis and Trichophyton
mentagrophytes) was transferred onto the opposite
side of growth. Mold plugs were also placed on
uninoculated PDA plates separately as a control. Plates
were incubated at 30C for 5 days. The inhibitory effect
was measured by calculating the difference between
the radius of pathogenic fungus growth (y) in the test
plate and the radius in the control plates (y0), where
y= y0 y.
2.1.2 Secondary screening
The best antimicrobial producing mold isolate (P1ROR)
was selected and appeared belongs to the genus
Penicillium based on the growth color and light
microscopy. Based on the diameter of inhibition zone,
secondary antimicrobial screening was done under
submerged fermentation conditions by agar well
diffusion assay.grown in four liquid media (Table 1)
with pH 8 at 30C for 7 days. The infusion was prepared
by adding 200g of potato or bran to 500ml of distilled
water then boiled for 30 min then filtered used double
layer of gauze. The volume was completed to 500ml
with distilled water then autoclaved. Millipore filtered
sugar solution was added to 1% final concentration.
Potato infusion and wheat bran are very common in
industrial production of antibiotics by mods [13].
In order to obtain the cell-free filtrate, the culture broth
was centrifuged at 8000xg for 10 min then millipore
filtered (0.22m). On the MHA, the test microorganisms
were streaked then wells (8.0 mm diameter, 2.0 cm
apart) were cut using a sterile cork borer and 100 l of
the filtrate were loaded into each well. The plates were
pre-incubated at 4C for 2 h to allow uniform diffusion
into the agar. After pre-incubation, the plates were
incubated at 37C for 24h for bacteria and at 30C for
72 h for fungi. The antimicrobial activity was evaluated
by measuring of inhibition zone diameter.

Table 1: Liquid media used in secondary screening.

Media Composition
A 1% Table sugar + potato infusion
B 1% Glucose + potato infusion
C 1% Table sugar + bran infusion
D 1% Glucose + bran infusion

2.2 Optimization of pH, temperature and duration
of antibiotic production
One representative microorganism of the sensitive
bacteria and molds were chosen for this experiment.
The pH levels of production media were adjusted from
6 to 9, by using phosphate buffer for pH (6, 6.5,7, 7.5
and 8) and glycine buffer for pH (8.5, 9, 9.5 and 10) to
study the impact of pH. Similarly, the optimum
temperature for bioactive metabolite yield was
measured by incubating the production medium at
temperatures ranging from 10C to 50C. While
maintaining all other conditions at optimum levels,
production media were inoculated with the selected
mold producer and assayed for antibiotic production
daily, for 14 days.
2.3 Molecular Identification of the selected active
isolate
2.3.1 Genomic DNA extraction
The P1ROR isolate was cultured on Luria Bertani (LB)
agar (Sigma-Aldrich, USA) for a week at 30C. Power
Soil DNA isolation Kit (Mo Bio Laboratories, Inc.)
found more effective and it was used for DNA
extraction and purification utilizing the beads power,
that was indicated to be very effective at lysing mold
cells [14]. FastPrep FP120 (Bio101 Savant Instruments,
Inc., Holbrook, NY) device was used at speed 5 for 30
seconds for disruption of cell membrane in the
presence of SDS and PCR inhibitors removals. The
extraction procedure was followed according to the
manufacturer instructions. The concentration of DNA
and purity were measured using the nanodrop ND-

http://crmb.aizeonpublishers.net/content/2015/5/crmb725-732.pdf 726
 Mohammed F. Al-Jawad et al. / Curr Res Microbiol Biotechnol. 2015, 3(5): 725-732

1000 spectrophotometer (Fermentas scientific, Inc.).
The extracted DNA was kept at -20C in aliquots.
2.3.2 Polymerase Chain Reaction (PCR)
PCR reactions were conducted using iCycler Thermal
Cycler (Bio-Rad, USA Laboratories, Inc.). ITS rRNA
genes were amplified using primers ITS1 and ITS4
(Sentromer DNA Technologies LTD., Istanbul, Turkey)
(Table 2), as described previously by [15]. An
optimized recipe was used in the PCR reaction (Table
3). About 500-800 bp of the internal transcribed spacer
(ITS) region of fungal rRNA genes was amplified using
the fungal universal primers ITS1 as a forward primer
and ITS4 as a reverse primer. The cycle conditions, pre-
denaturation at 95C for 10 min.; 35 cycles of
(denaturation at 94 C for 1 min, annealing at 50C for
2 min and extension at 72C for 2 min); final extension
at 72C for 10 min followed by holding at 4C. A 10l
portion of the amplicon was electrophoresed through a
1% agarose gel to check the band size.

Table 2: Primers used in this study.

Primer name Sequence Tm (C)
ITS1 5` TCCGTAGGTGAACCTGCGG 3` 61
ITS4 5` TCCTCCGCTTATTGATATGC 3` 55.3

Table 3: Components of a single 25l PCR master mix.

Reagent Volume (l) Final concentration
Water (sterile, nuclease free) 12.925
10X PCR buffer (Fermentas) 2.5 1X
MgCl2 (25 mM) (Fermentas) 1 1 mM
dNTP mixture (25 mM each) (Fermentas) 0.2 0.2 mM
Primer E8F (10 mM) 0.5 0.2 mM
Primer E939R (10 mM) 0.5 0.2 mM
Taq DNA polymerase (recombinant) (5U/ml) (Fermentas) 0.125 0.03 U/ml
Betaine (12.5 M) (Sigma-Aldrich, USA)a 2 1M
BSA (10 mg/ml) (Sigma-Aldrich, USA)b 0.25 0.1 mg/ml
DNA template (20-40 ng/ml) 5 0.8-1.6
Total 25

2.4 Sequencing Sequencing results were analyzed for chimeras using

The purified PCR product of the mold isolate was
subjected to the sequencing reaction following the
manufacturers recommendation using the BigDye
Terminator v3.1 sequencing reaction Kit (Applied
Biosystems, Foster City, CA, USA). The reaction mix was
set up in 10l final reaction (Table 4). ITS4 primer was
used for partial ITS region sequencing of the selected
mold isolate. The reaction tubes then transferred to the
BioRad C1000 thermal cycler (BioRad Laboratories,
Inc.). The sequencing reaction and cycle conditions
were optimized and as the following: Pre-denaturation
at 98C for 5min; 30 cycles of (denaturation at 96C for
20sec., annealing at 56C for10 sec., extension at 60C
for 4min.); final extension at 60C for 5min then hold at
4C. The BigDye terminator ready reaction mix was
added after the pre-denaturation step.
The sequencing product was purified using Sephadex
G-50 (Sigma-Aldrich, USA) with a spin column. The
collected DNA was transferred to the ABI prism 3130XL
genetic analyzer (Applied Biosystems, Foster City, CA,
USA) for sequence recording.
Bellerophon program [16]. Sequence similarity was
accomplished through sequence alignment to the
existing relevant sequences available in the database at
National Center for Biotechnology Information (NCBl)
using the BLAST (Basic Local Alignment Search Tool)
program: BLASTN 2.2.27+ [17] Biotechnology
Information (www.ncbi.nlm.nih.gov) online gene
database to determine taxonomic classification.
A Phylogenetic neighbor-joining tree was constructed
by MEGA version 5 software [18] using the method of
Saitou and Nei [19].
3. RESULTS AND DISCUSSION
3.1 Antibacterial primary screening
The results showed that S. aureus and S. pyogenes were
inhibited on PDA by the isolate P1ROR, whilst other
media (TSA, NA and MHA) did not prompt the isolate to
produce antibiotics (Figure 1) which agrees with what
previously found that PDA is the best medium for mold
antibiotic primary screening [20]. In contrast, the
isolate did not show any antagonistic activity against
the rest of pathogenic bacteria (M. morganii, E. coli and
P. aeruginosa) on all four media.

Table 4: BigDye terminator Cycle Sequencing Reaction Sequencing components.

Reagent Volume (l)
Purified PCR product (~25 ng) 4
Primer (3.2 pmol/l) 1
(5X) BigDye Sequencing Buffer 1
BigDye Terminator v3.1 ready reaction mix 4
Total 10

http://crmb.aizeonpublishers.net/content/2015/5/crmb725-732.pdf 727
 Mohammed F. Al-Jawad et al. / Curr Res Microbiol Biotechnol. 2015, 3(5): 725-732

A B

Figure 1: The primary screening of the isolate P1ROR against S. aureus (left) andS. pyogenes (right). A: The isolate P1ROR with
the pathogenic bacteria. B: Control (without producer).

A B

Figure 2: The secondary screening of the isolate P1ROR against M. canis (left) and T. mentagrophytes (right). A: The isolate
P1ROR with the pathogenic fungi. B: Control (without producer).

3.2 Antifungal primary screening
Antifungal primary screening assays revealed that M.
canis and T. mentagrophytes strongly inhibited by the
isolate P1ROR on PDA (Figure 2), the inhibition zone
(y) value of pathogenic fungi was more than 2 cm.
3.3 Antibacterial secondary screening
The results showed that filtered supernatant of media
had no antagonistic activity against M. morganii, E. coli
and P. aeruginosa. While other tested microorganisms
showed variable sensitivity (Figure 3). The pathogenic
molds, M canis. and T. mentagrophytes, were inhibited
only by filtered supernatant of media A (table sugar +
potato infusion) with inhibition zone 2.5 cm for both
(Figure 4). At the same time, the media A gave the
highest antimicrobial activity against S. aureus and S.
pyogenes with inhibition zone 3.3 and 2.8 cm
respectively (Figure 5). This medium is more economic
than potato dextrose broth that was used for antibiotics
production by (15). In contrast, the lowest
antimicrobial activity value against all pathogenic
microorganisms was obtained at the media type D.

http://crmb.aizeonpublishers.net/content/2015/5/crmb725-732.pdf 728
 Mohammed F. Al-Jawad et al. / Curr Res Microbiol Biotechnol. 2015, 3(5): 725-732

Figure 3: Antimicrobial secondary screening test for P1ROR isolate.

A B

Figure 4: The antifungal activity of medium A extract. A: M canis. B: T. mentagrophytes.

A B

Figure 5: The effect of medium A extract on A: S. aureus and B: S. pyogenes.

3.4 Optimization of production period fermentation, the highest antimicrobial activity was
There was no production on the first two days but the achieved with inhibition zone diameter of 3.3 cm for S.
antibiotic was produced on the third day with aureus and 2.5 for M. canis and this continued till the
moderate antimicrobial activity. On the fifth day of fourteenth day (Figure 6).

Figure 6: Antibiotic production at different incubation time.

3.5 Optimization of temperature
The lowest activity of antibiotic was recorded at 40C,
while the optimum activity was determined at 30C
where the inhibition zone diameter was 3.3 cm for S.
aureus and 2.5 for M. canis. while there was no
production at 10C and 50C (Figure 7).
3.6 Optimization of pH
The antimicrobial activity ranged from pH 6-8 and the
highest activity was recorded at pH 6.5 with inhibition

http://crmb.aizeonpublishers.net/content/2015/5/crmb725-732.pdf 729
 Mohammed F. Al-Jawad et al. / Curr Res Microbiol Biotechnol. 2015, 3(5): 725-732

zone 3.5cm for S. aureus and 2.8cm for M. canis, but the activity was found with alkaline conditions (Figure 8).
activity decreased with high neutral conditions and no

Figure 7: Antibiotic production at different temperatures.

Figure 8: Antibiotic production at different pH.

3.7 Molecular Identification of the P1ROR isolate
A 418 bp of a good sequence was obtained for internal
transcribed spacer 1 (partial sequence, 5.8S ribosomal
RNA gene (complete sequence) and internal
transcribed spacer 2 (partial sequence) of the P1ROR
isolate that aligned to get the nearest relative with the
highest similarity and the Neighbor-joining (NJ) tree
was generated (Figure 9). No chimeric sequences
detected. Sequence have been deposited and registered
in the GenBank database under the accession number
KC702801.1.
The P1ROR isolate was identified as Penicillium sp. and
showed 99% similarity with the nearest neighbor
Penicillium chrysogenum. Add to that, the NJ tree
showed that the P1ROR isolate appeared in a separate
cluster (dark dot) which indicates that it is a novel
strain.
4. CONCLUSION
The results revealed that this novel mold is very active
in antibiotic(s) production on a very economic medium
and under moderate conditions which are very
valuable industrially. The produced antibiotic(s) need
further prospective purification and characterization
studies in order to be put in practice. Add to that, more
productive microbes worth to be mined.

http://crmb.aizeonpublishers.net/content/2015/5/crmb725-732.pdf 730
 Mohammed F. Al-Jawad et al. / Curr Res Microbiol Biotechnol. 2015, 3(5): 725-732

Figure 9: Neighbor-joining tree of the P1ROR isolate. The species from which strains were isolated, strain number and GenBank
accession numbers are mentioned.

5. REFERENCES fermentation and isolation, physicochemical properties and

biological activities. J. Antibiotics. 41: 1525-1532,
1. Brdy J (2005). Bioactive Microbial Metabolites. J. Antibiot.
5. Rifkind D, Freeman G (2005). The Nobel Prize Winning
58(1): 126.
Discoveries in Infectious Diseases. London, UK: Academic
2. Schlegel HG. (2003). General Microbiology, 7th ed. Cambridge
Press. pp. 4346.
University Press, Cambridge, pp. 370.
6. De Carli L, Larizza L (1988). Griseofulvin. Mutation research
3. Dutta AC (2005). Botany for Degree Students 18th ed. Oxford
195(2): 91126.
University Press, New York, pp. 448-449.
7. Nicoletti R, Buommino E, De Filippis A et. al. (2009).
4. Dobashi K, Matsuda N, Hamada M, et. al. (1998). Novel
Bioprospecting for antagonistic Penicillium strains as a
antifungal antibiotics octacosamicins A and B: Taxonomy,

http://crmb.aizeonpublishers.net/content/2015/5/crmb725-732.pdf 731
 Mohammed F. Al-Jawad et al. / Curr Res Microbiol Biotechnol. 2015, 3(5): 725-732
resource of new antitumor compounds". World Journal of
Microbiology. 24 (2): 18595.
8. Torzilli AP, Sikaroodi M, Chalkley D, Gillevet PM (2006). A
comparison of fungal communities from four salt marsh
plants using automated ribosomal intergenic spacer analysis
(ARISA). Mycologia, 98: 690-698.
9. Midgley DJ, Saleeba J A; Stewart MI et. al (2007). Molecular
diversity of soil basidiomycete communities in northern-
central New South Wales, Australia. Myco. Res., 111: 370-
378.
10. Iwai Y and Omura S (1982). Culture conditions for screening
of new antibiotics. J Antibiot (Tokyo). 35(2):123-41,
11. Madigan MT, Martinko JM, Stahl DA, Clark DP (2012).
Commercial Products and Biotechnology. In Brock biology of
microorganisms. 13th ed. Benjamin cumings.pp. 415-416,
12. Crawford DL, Lynch JM, Whipps JM, Ousley MA (1993).
Isolation and characterization of actinomycete antagonists of
a fungal root pathogen. Appl Environ Microbiol., 59:3899
3905
13. Jain P, Pundir RK (2011). Effect of fermentation medium, pH
and temperature variations on antibacterial soil fungal
metabolite production. J. of Agri. Tech., 2011 Vol. 7(2): 247-
269.
14. Schloss PD, Hay GA, Wilson DB et. al. (2005). Quantifying
bacterial population dynamics in compost using 16S rRNA
gene probes. Appl. Microbiol. Biotechnol., 66: 457-463.
15. White TJ, Bruns T; Lee S, Taylor JW (1990). Amplification
and direct sequencing of fungal ribosomal RNA genes for
*****
http://crmb.aizeonpublishers.net/content/2015/5/crmb725-732.pdf
phylogenetics. In: PCR Protocols: A Guide to Methods and
Applications, eds. Innis, M. A.; Gelfand, D. H.; Sninsky, J. J.
and White, T. J. Academic Press Inc., New York. pp. 315-322.
16. Huber T, Faulkner G, Hugenholtz P (2004). Bellerophon: a
program to detect chimeric sequences in multiple sequence
alignments, Bioinformatics., 20: 2317-2319.
17. Zheng Z, Scott S, Lukas W, Webb M (2000). A greedy
algorithm for aligning DNA sequences. J. Comput., Biol., 7(1-
2): 203-214.
18. Tamura K, Peterson D, Peterson N et. al. (2011). MEGA5:
Molecular Evolutionary Genetics Analysis using Maximum
Likelihood, Evolutionary Distance, and Maximum
Parsimony Methods. Mol. Biol. Evol., 28: 2731-2739.
19. Saitou N, Nei M (1987). The neighbor-joining method: A
new method for reconstructing phylogenetic trees. Mol. Biol.
Evol., 4: 406-425.
20. Pereira E, Santos A, Reis F et. al. (2013). A new effective assay
to detect antimicrobial activity of filamentous fungi.
Microbiol Res.; 168(1):1-5.
2015; AIZEON Publishers; All Rights Reserved
This is an Open Access article distributed under the terms of
the Creative Commons Attribution License which permits
unrestricted use, distribution, and reproduction in any
medium, provided the original work is properly cited.
732