You are on page 1of 333

CHAPTER I

INTRODUCTION

1. Evolution of fructose consumption through history


Humans have not always been the high sugar-consumers that we are
today. Man's ancestors, the Cro-Magnon men during the Paleolithic,
obtained their food from hunting and gathering, and their diet was mainly
composed of meat. Their nutritional intake was high in protein, moderate
in fat, and low in carbohydrates. At this time, fruit and berries represented
the major source of carbohydrate, while starch consumption was low. It
can be speculated that man's natural taste attraction for sweetness dates
from these ages, when sugar was scarce.
Honey was the main sweetener, used in limited amounts, until the
Crusades, during which time western Europeans got acquainted with
sugar used in the Middle East. Consumption of sugars remained however
quite low until the 18th century, when both the development of
intercontinental trade with distant countries where sugar cane abounded
and technological improvement to extract and refine sugars became
available. Sugar was no longer a luxury product and quickly became

extremely popular. It was initially mostly extracted and refined from cane
and imported to Europe and North America, and later was also prepared
from beets. Sugar was first consumed as a sweetener in tea and coffee,
the new fashionable drinks, but its use was rapidly extended to be
preparation of new tasty and palatable food items such as bakeries and
sweets. In England, sugar consumption increased by 1,500% between the
18th and 19th centuries , and by the turn of the 20th century, sugars had
become one major constituent of our diet.
Sucrose remained the almost exclusive sweetener to be consumed, with
only small amounts of glucose and fructose ingested essentially with
fruits, until the 1960s when the food industry developed and put into use
technologies allowing to extract starch from corn, hydrolyze it to glucose,
and convert part of the glucose into fructose through enzymatic
isomerization. This resulted in the production of corn-derived sweeteners,
among which was high fructose corn syrup (HFCS). The high sweetening
power of HFCS, its organoleptic properties, its ability to confer a long
shelf-life and to maintain a long-lasting moisterization in industrial
bakeries, together with its low cost, contributed to a very rapid increase in
its consumption at the expense of sucrose. HFCS can be produced with
various fructose-to-glucose ratios, with the most commonly used being

HFCS-55, containing 55% fructose and 45% glucose, i.e., a fructose-toglucose ratio close to the 1:1 ratio found in sucrose.
C. Fructose Consumption
1. Methods for assessing fructose consumption
Assessing the fructose intake in a population is not an easy task, since
fructose intake is not specifically recorded as a variable in most surveys
or databases. The two commonly used methods are per capita
disappearance data and individual food intake reports.
Per capita disappearance data in the United States have been reported on
a yearly basis since 1909. Sweetener disappearance data are available for
sucrose, HFCS, and honey. They include both individual consumption
and industrial use for food processing and may thus overestimate real
fructose intake due to losses and waste at the consumer level. They
nonetheless provide useful estimates of trends in added sugar
consumption
Individual food intake records are usually performed over a 1- to 3-day
period. By combining the recorded intake of specific foods with their
fructose content, it is possible to estimate the individual fructose
consumption. This method provides a more accurate view of the fructose

intake at the individual level, but extrapolation to whole populations is


dependent on population sample selection.
2. Fructose intake between 1970 and 2007 in the United States
According to United States Department of Agriculture (USDA) reports,
per capita added sugar consumption amounted to 90 g/day in 1970. By
this time, HFCS consumption was close to zero. Important changes
occurred between 1970 and 1985, when sucrose disappearance
progressively declined by almost 50% . This decrease in sucrose
consumption was mirrored by a sharp increase in HFCS disappearance. In
2007, sucrose represented 45% and HFCS 41% of the total added
sweeteners disappearance, the remaining 14% being accounted for by
glucose syrup, pure glucose, and honey. Per capita disappearance of total
caloric sweeteners increased by 15% between 1970 and 2007.

Sugar was commercially obtained from sucrose (60%) & sugar beat
(40%) till the early 1940s. (Bhosle et al. 1996,) Sucrose production has a
high cost of production and also has adverse effects on health. This
necessitated the search for new acceptable substitute capable of
producing sweetness at a low cost of production with little or no adverse
effects on health. The first step in this direction was towards non4

calorific, non carbohydrate chemical sweeteners such as saccharine,


cyclamate, acesulfame-k, aspartame, thaumatine etc.
Aspartame when used in soft drinks was found to render the soft
drink less sweet on prolonged storage due to slow hydrolysis at low pH.
Thaumatine, an ideal protein sweetener though 2000 times sweeter than
sucrose has a distinct unpleasant flavor. This led to the search for an
alternative source of sweetener.
Fructose is the sweetest naturally occurring nutritional sweetener.
(Doelle H.B., et al 1991, Atiyeh H., et al 2002) It is sweeter than our table
sugar, sucrose. Martin Chaplin and Christopher Bucke, 1990) It is
regarded as a calorie saver as less fructose is required to produce the
same amount of sucrose (Table 1.1). Moreover the stomach very slowly
reabsorbs fructose; it does not therefore affect the glucose level in the
blood. It is useful for diabetics patients also because of its negligible
effects on blood glucose level. It occurs naturally in fruits and is obtained
commercially by enzymatic conversion of starch. (Bhosale et al 1996,
Doelle et al 1991, Nakamura T, et al 1995, Crabb et al 1997, 1999).
Starchy substances constitute primary source of stored energy in
plants. Some plant examples of high starch content are maize (Crabb et al
1999), potato, (Crabb et al 1999) rice, (Bhosale et al 1996), sorghum,

(Chang, 1982) wheat (Bhosale et al 1996,Nakamura T, et al., 1995, Crabb


et al., 1997, 1999) and tapioca (cassava). Hydrolysis with help of
amylolytic enzyme (- amylase and Glucoamylase) yields glucose from
starch. The obtained glucose is isomerised with the help of glucose
isomerase to produce fructose. Enrichment of the fructose to increase its
concentration results in high fructose sugar which is almost double in
sweetness to the commercially available table sugar, sucrose.

TABLE NO. 1.1


THE RELATIVE SWEETNESS OF FOOD INGREDIENTS

Food ingredient

Relative sweetness
(By weight, solid)

Sucrose

1.0

Glucose

0.7

Fructose

1.3

Galactose

0.7
6

Maltose

0.3

Lactose

0.2

Raffinose

0.2

Hydrolyzed sucrose

1.1

Hydrolyzed lactose

0.7

Glucose syrup 11 DE

< 0.1

Glucose syrup 42 DE

0.3

Glucose syrup 97 DE

0.7

Maltose syrup 44 DE

0.3

High conversion syrup 65 DE

0.5

HFCS (42% fructose)

1.0

HFCS (55% fructose)

1.1

Aspartame

180

HFCS- High fructose maize syrup

1.1 HISTORICAL BACK GROUND


Honey was the only source providing sweetness for thousands of
years since the establishment of early civilization by man with the
domestication and cultivation of barley, wheat and rice. India or
Melanesia is thought to have been the original cultivators of sugarcane.
Invasion of countries led to the spread and cultivation of sugarcane in
other parts of the world. Evidence has been found that sugar was very
well known between 11th & 15th centuries but it was scarce and being
expensive was limited to the privileged people. One of its major roles was
to disguise the horrible taste of medicines at that time.
With time the consumption per capita of sugar rose but production
level could not meet the demand. In 1740, Marggaraf developed the
technique for extraction and cultivation of sugar from sugar beet. Sugar
beet, thus become an alternate source of sugar production to sugarcane.
In 1811, Kirchoff discovered a sugar like substance by acid
catalyzed hydrolysis of starch. This was later identified as D-glucose by
Sausaure. The use of mineral acids led to the inclusion of reversion
products and repolymerised polyglucose which limited the maximum
obtainable value of the obtained syrup to DE-55 (dextrose equivalent).
8

Glucose even in its purest form when crystallized was found to be less
sweet than sucrose (obtained from sugarcane & sugar beet). This limited
the use of glucose syrup obtained from starchy products. In comparison
acid hydrolyses of sucrose yielded glucose and fructose in equal
proportion and this was known as invert sugar. Invert sugar had the
physical properties of glucose but was as sweet as sucrose.
In the late 1914s introduction of acceptable fungal glucoamylase
made the process of conversion of starch to glucose much simpler. Now, a
very mild treatment with acid was given which resulted in the syrup of
DE about 12. The liquor was then neutralized to pH 6.0 and dosed with
Glucoamylase, usually obtained from Aspergillus niger. This resulted in
increasing the maximum dextrose equivalent to 93. It significantly raised
the proportion of glucose in the final mixture. Besides this, unwanted
salts in the glucose syrup were very much reduced since very little
mineral acid was used.
The discovery of thermostable alpha amylase from Bacillus
subtilis in the early 1960s resulted in elimination of mineral acids from
the process and extraction of sugar from starch become an all enzymatic
process. Liquefaction of starch by -amylase and its subsequent
saccrification by glucoamylase made it possible to obtain DE value
ranging upto 98. The absence of interfering ions (in the form of salts)
9

made possible the purification of obtained syrup by ion exchange


treatment.
In plants, glucose (aldohexose) is isomerised to fructose
(aldoketose) via phosphorylation to glucose-6-phosphate, isomerisation to
fructose-6-phosphate and dephosphorylation to fructose. Initially, for
commercial purpose glucose was mildly treated with alkali, using the
formation of an endiol in the lobry de brun van ekenstein reaction to
obtain a liquor of glucose with 20% fructose. This product however
contained large quantities of ash (salt) and undesirable colored products.
Refining this to a food grade product was economically not very viable.
Richard O. Marshal made the discovery of the 1st microbial enzyme
capable of converting glucose to fructose in 1956. Inspite of this major
leap in technology several drawbacks limited its commercial use. It was
found that enzyme had very little affinity for glucose limiting the fructose
yield to only about 33%. Beside this, the exposure time to the enzyme
was prolonged and it required arsenate as a catalyst. The presence of
arsenate rendered it unsuitable for use in food products.
The discovery of glucose isomerase from Streptomyces flavoreins
by Takasakiand Tanable yielded isomerisation of glucose to fructose in
the 40-50% range without the use of arsenate. The first commercial high
fructose maize syrup with 42% fructose was manufactured by the use of
10

this enzyme in the brand name isosweet. In 1967, the world 1 st


commercial production of high fructose syrup was started by Sanmatsu
kogyo, using Takasaki and Tanabe technology. (Rita Singh, 2002)

1.2 NEED FOR STUDY


High fructose syrup has immense commercial importance. There
are innumerable source of high naturally occurring plants and their parts,
which have a high content of starch. The extraction of glucose syrup from
the plants parts by using the viable technology of extraction of sugar from
maize would led lead to an increased production of sugar. The
optimization of the process in terms of each starchy material is still
required.

11

1.3 OBJECTIVE OF THE STUDY

The most important aims and objectives of the study are:


1) Standardization of process for the preparation of high Dextrose
Equivalent (DE) liquid glucose from whole grain sorghum and
other cereals of any quality using enzymes.
2) Purification of alpha amylase for use in the process of liquid
glucose production.
3) Subsequent isomerisation of glucose syrup to Fructose

12

4) Cloning and characterization of alpha amylase gene from the


microorganism.
In order to achieve the above aim and objectives, studies were
conducted to standardize the process (pH, temperature, enzyme
concentration and viscosity) for the preparation of high Dextrose
Equivalent (DE) liquid glucose from whole grain sorghum and other
cereals of any quality using enzymes. Liquid glucose obtain was
isomerised to fructose. The partial purification and characterization of
the enzyme - amylase was undertaken and the molecular analysis of amylase gene was also done in an attempt to obtain thermostable
amylase enzyme.

13

CHAPTER II
LITERATURE REVIEW

Glucose is manufactured by the breakdown of starch .Sorghum,


rice and maize cereals have been chosen for this study due to the presence
of high starch content in them. The enzymatic conversion of starch to
glucose is done by two enzymes alpha amylase and glucoamylase. The
isomerisation of glucose to fructose is achieved by using glucose
isomerase enzyme. A thorough literature survey has been done on starch,
the cereals of study, properties of the enzymes used, the effect of the fluid

14

properties of the cereal starch slurry and the concentration of the enzyme
itself. A comparative study of the known nucleotide sequences from
known alpha amylase producing organisms has been done using
ClustalW (version 1.82)

2.1 STARCH
Starch is the primary source of stored energy in cereal grains. The
amount of starch contents varies from grain to grain. It constitutes usually
60-75% the weight of the grain. Irrespective of the botanical source,
starch is basically a polymer of six carbons sugar, D-glucose. The glucose
units are primarily linked by alpha (1-4) glucoside bonds with some
additional alpha (1-6linkage).
An unbranched single chain polymer of 500 to 2000 glucose
subunits with only the alpha 1-4 glucosidic bond is called amylose. The
presence of alpha 1-6 glucosidic linkage results in branched glucose
polymer called amylopectin. The degree of branching in amylopectin is
approximately one per twenty-five glucose units in the unbranched
segments (Cura, J. A, 1985, Hood, L.F. 1982, Hizukuri, S. 1986, Zobel,
H.F. 1988, Hoseney, R.C. 1994) Although amylose and amylopectin are
both glucose polymers however the branching pattern and degree of
15

branching leads to major differences in functional properties of starch.


The differences have been highlighted in the Table 2.1.

TABLE NO. 2.1


CHARACTERISTICS OF AMYLOSE AND AMYLOPECTIN

Characteristic

Amylose

Amylopectin

Shape

Essentially linear

Branched

Linkage

-1,4 (some -1,6)

-1,4

Molecular weight

Typically <0.5 million

50500 million

16

Films

Strong

Weak

Gel formation

Firm

Non-gellitionous

Color with iodine

Blue

Reddish brown

The ratio of amylose to amylopectin within a given type of starch


(irrespective of the source) determines the properties for it. The
packaging of these two polymers in a starch molecule is in a very
organized manner. When heated in the presence of water this order is
broken up. This lose in internal order occurs at different temperature in
different type of starches. The amylose and amylopectin content and their
packaging structure affect the architecture of the starch granule,
gelatinisation and pasting profile and texture attribute (Cura, J. A, 1985,
Hood, L.F. 1982, Hizukuri, S. 1986, Zobel, H.F. 1988, Hoseney, R.C.
1994)
Starch is generally insoluble in water at room temperature due to
formation of hydrogen bonds within the molecule and with the other
neighboring molecules. Starch granules are quite resistant to penetration
both by water and hydrolytic enzymes. An increase in temperature of the

17

starch suspension in water weakens this bond to yield dextrose,


maltotriose, maltose and glucose etc.
Payen and Peroz were the first to discover enzymatic hydrolysis
in 1833. In 1938 Dale and Langtois for the first time employed a fungal
amylase

preparation

for

commercial

syrup

production.

The

depolymerisation of the starch molecules is performed by two types of


enzymes (Amylase and Glucoamylase) in two steps (liquefaction and
saccharification), due to the incompatibility of the amylolytic enzymes
involved as reported by Legin et al, 1998. Karakatanis et al, 1997,
reported several enzymes capable of hydrolyzing starches and found
differences in their properties.

Starch is used in food and non-food

industries; for example, in paper, plastic, pharmaceuticals, diet and


human industries (A. Beaujean, et al.2000 Kennedy, J.F. et al, 1988,
Sathisch P. et. al 1995, Schwardt E., 1990 Van Soest J.J.g. 1997,Whistler
R.L. et al 1984). The demand for starch has increased multifold in the last
decade for production for high fructose syrup (A. Beaujean,et al.,2000).
Commercially starch is extracted from maize, rice, wheat, sorghum,
potato, cassava and tapioca.

2.2 CHOICE OF RAW MATERIAL


18

Starch occurs in leucoplasts tubers, leaves, seeds, and other


portions of plants (htpp://www.sbu.ac.uk/biology/enztech/starch.htm).
Grains with high starch content such as maize, rice, and sorghum have
been chosen for glucose syrup production and subsequent isomerization
into fructose for this study. A comparative analysis of the chemical
analysis of sorghum, rice and maize has been done in Table 2.2.

TABLE NO. 2.2


COMPARISION OF CHEMICAL COMPOSITION OF SORGHUM,
RICE AND MAIZE.

Components

Sorghum

Rice
19

Maize

Starch

63-68

74-78

60-64

Moisture

9-13

11

8-11

Protein

9-11

9-11

Fats & oils

1-1.5

0.4

3-5

Crude fibre

1.5-2

0.6

1.5-2

Ash

1-2

0.7

1-2

Other organics

8-12

9-10

7-9

2.2.1 SORGHUM
Sorghum grains are a rich and cheap source of starch. Grain
sorghum is similar to maize in its chemical composition and properties.
(Kulkarni D.N. et al, 1986) Starch, simple sugar, cellulose and pentosans
comprise approximately 80% of the dry weight of the kernel. P.
Pushpamma et al, 2000, reported that sorghum an important world cereal
was limited in its usage due to low social status and prestige attached to
its quality parameters like color, high fiber contents, more cooking time

20

and poor digestibility. Kulkarni etc. found that the best utilization of
sorghum is by way of producing starch based sweeteners (Chang L.T.
1982)
G. H. Palmer (1991) reported that the pericarp and testa of
sorghum grain are an important parameter in food processing, because of
their variable contents of polyphenols and thickness. Rooney and Miller,
1987, reported that the pericarp of the sorghum grain is multicellular and
unlike other cereals contains significant deposits of small starch granules.
The aleurone layer of sorghum grain is three cells deep, in sharp contrast
to a single layer of cells, as found in rice and maize (Palmer G.H. 1989).
Rooney et al, 1987, Palmer G.H. et al 1989, found that starch granules of
sorghum are about 10m in diameter, contain around 75% amylopectin
and 25% amylase and gelatinize at about 75-80C. In terms of starch
gelatinisation temperature, properties of starch protein and -D-glucan
content, the maizeeous endosperm of sorghum is similar to that of maize.
The major producers of sorghum are India, China, U.S.A., Mexico,
Argentina and Africa. In India it is widely cultivated in Karnataka,
Maharashtra, M.P., Andhra, U.P., Rajasthan, Tamilnadu, Gujarat, Orissa
and Punjab. (Wealth of India: vol 9, 1987). In India it ranks third as a

21

cereal crop and is popularly known as Jowar (Stastical outline of India,


1989-90)
N.G.P. Rao., former V.C. Marathwada Agricultural University, in
his inaugural address in a seminar in 2000 pointed out the potential of
sorghum as a supplementary source of sugar.
Palmer 1972, reported degradation of sorghum starch by enzymatic
attack both inside and outside the granules. Seagram R&D centers, Pune,
Maharashtra and ICRISAT, Hyderabad have been working on
optimization of process of ethanol fermentation and sugar production
from starch.

2.2.2 RICE
Rice is a native of south East Asia and has been cultivated for more
than 7000 years. Rice grains are extensively used as human food and it
constitutes the principle food of nearly half the world population.
Polished rice mostly contains carbohydrates, small amount of iodine,
iron, magnesium and phosphorous. (http://www.starch.dk/isi/starch/htm).
Kempf 1984 reported an annual production of 7000 t of starch from 8800
t of broken rice in European Union. Juliano and Bechtel, 1985 found that
the rice grain was constituted mainly by the starchy endosperm. The
22

endosperm cells are thin walled and packed with amyloplasts containing
starch granules. Rice grain with more than 90% amylopectin content is
known as waxy rice whereas non-waxy rice is one, which contains
amylose in addition to amylopectin.
The rice grain is processed into its various byproducts before it
may be consumed as seen in Figure 2.1.The starch content in rice grain is
very high it is 78% in rough grain and 82% in brown grain (maize is
reported to have a carbohydrate content of 80%). Thus, rice starch, may
be utilized for glucose production by the same technology as used for
maize.
Juliano and Eggum, 1978 and Hanses et al, 1981 produced high
fructose rice syrup and a high protein rice flour from broken rice using
amylase Glucoamylase and glucoisomerase. They obtained an 80%
glucose yield. Chen and Chang in 1984 converted the glucose into HFRS
with a composition of 50% glucose, 42% fructose and 3% maltose.
Maltodextrins were also produced from milled rice flour at 80C
using heat stable alpha amylase (Griffin and brooks, 1989). A recently
developed enzymatic method by Shaw et al. uses thermostable alpha
amylase in combination with amylase to produce high maltose syrup

23

and high protein rice flour simultaneously (Shaw J.F. and J.R, Sheu,
1992, Shaw J.F.1993-94 Shaw J.F.1989, Shaw J.F.et. al.1995)
FIGURE: 2.1

PROPORTION OF BYPRODUCTS FROM PROCESSING RICE


FOR HUMAN CONSUMPTION
WHOLE RICE
100%

HUSK
20%

BROWN RICE
80%

POLLARD
11%
BRAN
3%

POLISHINGS
8%

CRACKED RICE 2%

24

WHITE RICE

2.2.3 MAIZE
Maize (zea mays) is a cereal that was domesticated in
Mesoamerica. It is widely grown for food and livestock fodder. In 1800s
Europe was isolated from the sugarcane growing areas of the world due
to Napoleonic wars. In 1811, German chemists succeeded in producing
sugar by breakdown of starch with acid. This process was widely adopted
by other nations. Since, bulk quantities of maize were and are available at
low costs, maize become the first substrate for production of sugar. Food
and agriculture organization of U.N.O. rates maize as the second most
important

crop

(cereal

grain),

after

wheat

and

before

rice

(www.unece.org/stats/econ/iwg.argri/iwg). In terms of yields, maize out


yields the other two. The only food crop out yielding maize in tones per
hectare is potato in its unprocessed state. The United States of America
produces almost half of the worlds maize crop. The other top maize
producing countries are China, India, Brazil, France, Indonesia and South
Africa.
There are several verities of maize, which are grown through the
world. Some of the widely grown ones are dent or field maize, flint
maize, waxy maize, sweet or green maize, pop maize, soft maize or
square maize etc. Dent maize, zea mays indenta, is called field maize. It
is a maize variety, the kernels of which have both hard and soft starch.
25

The starch becomes indented at maturity and hence the name. Dent maize
is used for making food, animal feed and industrial products. This is only
variety to be considered for maize starch manufacturing.
Maize starch is found in its endosperm and it is usually composed
of

26%

amylase

and

74%

amylopectin

(www.unece.org/stats/econ/iwg.argri/iwg). Some other varieties of maize


contain substantially 100% amylopectin and some have a very high
content (80%-85%) of amylose. In maize the starch granules are irregular
polyhedral of width 10 to 20 m. (Mac Allister, R.V., 1979) One major
advantage of using maize as a starch source over the other raw materials
is that maize has excellent storage characteristics.

2.3 ENZYMES
Starch breakdown to liquid glucose is two step enzymatic process:
Liquefaction by alpha amylase and saccharification by glucoamylase.
Glucose is isomerised to fructose by glucose isomerase enzyme.

26

2.3.1 -AMYLASE
Alpha amylase (E.C.3.2.1.1) hydrolyses starch, glycogen and other
related polysaccharide by randomly cleaving the -1,4 glucosidic
linkage. The utilization of polysaccharide is made possible by its action
on them. It is widely distributed in various bacteria, fungus, plants and
animals. The -amylases is relatively small proteins of molecular weight
50-60 Daltons. Godon, 1994 elucidated the amino acid sequence and 3D
structure of some of these enzymes. The pH and temperature optimum of
the -amylases depends on the origin of the enzyme. Both mesophilic
and thermophilic bacteria produce amylase. The mesophilic -amylase
producing

organisms

are

Bacillus

amylolquefaciens,

Bacillus

lichiniformis, Clostridium thermohydrosulfuricum and Pyrococcus sp


(Shaw et al 1995, Brown et, al 1990, Koch et, al. 1991 Melasniemi H.
1987, Gerhartz N.1990). Bacillus subtilis and Thermus sp are
thermophilic bacteria capable of producing -amylase (Gerhartz 1990).
Amylase (E. C. 3 .2 .1.) From Bacillus subtilis var
amyloliquefaciens is the most widely used amylase (Mac Allister, R.V.,
1979). It is active even at 80C, a temperature at which the starch

27

granules of maize, in presence of water become accessible to enzyme


action. Crabb & Shetty, 1999, have reported amylase from Bacillus
licheniformes. This is an endo acting enzyme with still higher
temperature tolerance (100C) for a short period of time. The enzyme
however, is unable to work below pH 6.3 and also requires high levels of
Ca+2 ions for its proper activity. L. H. Marchal 1999 hydrolyzed the starch
of potato by using amylase derived from Bacillus licheniformis. The
highest rate of hydrolysis was obtained at 90C and pH 6. A requirement
of 5ppm Ca+2 at pH 5.8-6 with a optimum temperature of 110C was
reported for amylase from B. lieheniformis.
A major drawback of this enzyme from this organism is that
although the maize water mixture has an acidic pH (3.2-3.6), this enzyme
functions at a much higher pH rendering it uneconomical for large-scale
operations. Amylase from Bacillus stereothermophilus is capable of
operating at temperature above 100C up to 105C. (Crabb et al 1997),
however, this enzyme too was incapable of working below the pH value
of 5.9. Carroll J.O. and Swanson et al 1990, used a mixture of B
stereothermophilus and B licheniformis in order to operate the process at
lower pH, lower calcium levels with higher temperature tolerance.
http://www.fst.rdg.ac.uk/courses/fs560/topic1.index.htm
28

lists

the

optimum temperature max of 85C and pH optima 6 with 150 ppm Ca ++


requirement for -amylase obtained from Bacillus amyloliquefacians.
Shaw, Chen., 95 isolated from a hot spring in north Taiwan a Thermus sp
capable of producing thermo stable -amylase. The presence of Ca+2 ions
for stimulation of the enzyme was not required here. The enzyme
functioned best at neutral pH and was found to be active at 60C even
when heated for 15 minutes at that temperature. Boiden and Effronts
(1917 a, b) developed thermostable -amylase enzyme in the early
1900s. Schenck, 1992 reported its commercial application since the early
1960s.
Another approach to bringing down the pH for the process of
liquefaction is protein engineering. Mitchenson, 1996, engineered B.
licheniformis alpha amylase to obtain an enzyme, which was able to
operate at lower pH, lower calcium levels and high temperatures.
Declerck et al (1995) were able to increase the thermostability of amylase in low calcium buffers by substituting 133 and ala 209 position
of the protein structure of the enzyme. Gray et al, 1986, have created
hybrid bacteria by gene fusion techniques. B. licheniformes B.
stereothermophilus genes were fused such that alpha amylase enzyme
with characteristic totally different from either parents was obtained.
Bjornvad et al, 1998, have reported that by adding carbohydrate binding
29

domains to -amylase, improved process conditions for liquefaction


could be obtained. By 2005 at least 3-engineered versions of B.
licheniformes -amylase have been commercially exploited for starch
degradation.

2.3.2 GLUCOAMYLASE
Glucoamylase (E.C.3.2.1.3.) is an exoenzyme which cleaves the 1,
4 glucosidic linkage of starch to yield the simple sugar. In 1951,
Glucoamylase from Aspergillus niger (Kerr et al, 1951) Aspergillus
awamori (Crabb et al, 1997) and Rhizopus (Philips and Caldwell, 1951 a,
b) were characterized. The enzyme from the Rhizopus strain was called
Glucoamylase and from Aspergillus species amyloglucosidase. These
enzyme obtained from the fungus have molecular weight ranging from
27-112 kdalton and the amino acid sequence of both are known. In
contrast to amylase the amyloglucosidase may be inactivated by
calcium ions. (Science.ntu.ac/ak/research/bemet/chapter1). Ayenor, et al
(2002) reported amyloglucosidase from Aspergillus niger with activity
6000-units/ml solution in 1 M glucose at pH 4.5 at 55C.

30

Glucoamylase is cheap and reactions are usually carried out in


stirred tanks using soluble enzymes at 55C, pH 4.5 for 48-92 hr. For
most enzymatic reactions the speed of reaction is proportional to the
concentration of the enzyme as reported by Reeds, 1975. The depletion of
substrate is also a major reason for reduction in activity with time. Tucker
and Woods (1991) found decrease in enzyme activity with time due to
saturation of the active sites of the enzyme or product inhibition. The
reaction rate of Glucoamylase was also found to increase with increasing
enzyme concentration as found by G.S.Ayenor, 2002. Tucker and Woods,
1991 also reported that an increase in concentration of enzyme in the
starch syrup leads to higher dextrose equivalent glucose syrup. This is
especially important commercially. It was found experimentally by
Ayenor that though amyloglucosidase has broad pH range, the optima
being between 4and 5 but generally pH 4.3-4.5 was found to be most
suitable. The stability of the enzyme dropped rapidly above 60C. It was
found that though sugar concentration generally increased in curvilinear
manner as temperature and time increased, the rate of decrease in the
yield of sugars seemed much more rapid when the temperature rose
above 60C.The time required for saccharification of raw maize, rice and
potato starch varied between 48-72 hours (Slomiska et al 2003, Banks W.

31

et al 1975, Berkhout F., 1976. Dziedzic S.et al 1984, Guzmn-Maldonado


H.et al, 1995, Pilnik W. et al 1990, Scheck F. W., 2002.)
Lopez Ulbarri, 1997, reported that the stability of the enzyme at
optimum pH 4.5 and temperature 55C was best when the yield of sugar
was in curvilinear manner in the solution. The effect of pH was found to
be much pronounced on activity of the enzyme. Temperature increase
deactivated the enzyme and an increase in time period led to substrate
inhibition byproduct.
The thermal inactivation of Glucoamylase above 60 0C limits the
process of saccharification. Substitution and mutation methods are being
tried to overcome this problem (Allen et al, 1998, Li. et al, 1997). Besides
this the enzyme is also used in immobilized form (Schwardt, 1990). The
enzyme has been immobilized on a variety of different carriers using the
different techniques of entrapment, adsorption, ion exchange and covalent
bonding (Reilly, 1979, Schhafhauser et al, 1992, Schhafhauser et al
1993). Cross linking on organic and inorganic supports, including low
cost magnetic support (Pieters et al, 1992a, Pieters et al, 1992b) in a
series of plug flow reactors has been used most commonly for obtaining
improved thermostability and better efficiency of conversion.

32

Peter Reilly and Clark Ford, 1997, increased the thermal stability,
altered its substrate specificity and modified the pH optima of
Glucoamylase obtained from Aspergillus awamori (Hsiu-mei C. et al
1996, Coutinno P. 1997, Fang T. Y. et al 1998 a, Fang T. Y. et al 1998 b,
Fang T.Y.and Ford C., 1998, Allen M.et al 1998 Li y., 1997, Lui H.S.et
al ,1998). By computer simulation technique they were able to identify
and substitute the amino acid residues in Glucoamylase active sites. The
variant glucose amylase obtained was more substrate specific, had
decreased ability to use maltose as substrate yet retained hydrolytic
activity on maltose.
This inability to hydrolyze the 1, 6 glycoside linkage lessened the
ability of the engineered Glucoamylase to form the isomaltose byproduct
(Fang T. Y. et al a 1998, Fang T. Y. et al b 1998 Lui H.S. et al 1998). This
resulted in an enzyme that can produce higher levels of glucose under
commercial conditions.
A remarkable breakthrough was made by Fang & Ford (1998)
wherein they were able to increase the pH of Glucoamylase such that it
could function in the same range as -amylase (pH 5.5).It was found that
through Glucoamylase was able to rapidly cleave the 1-6 glucosidic
bonds of amylase; it was slower to hydrolyze the 1-6 amylopectin bonds.
The resulted in build up of isomaltose, referred to as reversion products
33

commercially. These byproducts decreased the overall glucose yield and


were unacceptable in the final product of high fructose syrup.
The use of another enzyme pullalanase (E.C.3.2.1.5.) that has the
ability to cleave the 1-6 linkage was found to be a solution to the
problem. However, the key to the success of this solution was to find
pullanase enzyme capable of functioning at the same pH and temperature
optima (pH 5.5, temp. 60C) as Glucoamylase to be commercially
successful. DeWeer and Amory A (1994) were able to isolate from the
soil a novel Bacillus that produced a pullalanase with pH optima of 4.24.5 (compatible with optimum pH of Glucoamylase) and showed thermo
stability under application condition (Crabb et al, 1999). In general it was
found that the use of this enzyme led to increase in glucose yields from
94% to over 95.5% (Crabb et al 1997).
In a different approach to the problem, researches at Gist Brocades
laboratory, United Kingdom demonstrated that by adding a specific acid
stable amylase to the glucose amylase the results obtained were almost
similar to that for pullalanase. In this blended mixture the acid specific
amylase cleaved the 1-6 linked side chains to generate more free nonreducing ends for Glucoamylase action. Results obtained from these
experimental works still leave a lot of gaps for further study.

34

The glucose syrup obtained after saccharification may be purified


by filtration and decolorized with activated carbon. Further, Ion exchange
columns may then be used to remove the salts. This syrup may be
subjected to evaporation to obtain commercial glucose. D-Glucose,
however, has only about 70% of the sweetness of sucrose, on weight
basis, and is relatively insoluble. The commercial product must be kept
warm to prevent crystallization or be diluted to concentrations that are
microbiologically insecure (Chaplin et al, 1990). The syrup therefore is
subjected to isomerisation for fructose production. The low temperature
and acidic conditions of the process stops the production of by-products
and also avoids any caramelisation or color formation.

2.3.3 GLUCOSE ISOMERASE


D- glucose / xylose isomerase (E.C. 5.3.1.5.) catalyses the
isomerisation of D- glucose and D- xylose to D- fructose and D- xylulose
respectively. Glucose isomerase is an industrially important enzyme and
much of the relevant information on it is documented in the form of
patents and some review literature. (Bhosale S. H., et al 1996, Antrim
R.L.et al 1979, Bucke C.a, 1981, Bucke C.b, 1983 Chen W.P., 1980, a, b,
Hemmingsen S. H., 1979, Pedrson S., 1993, Verhoff F.H., et al 1985,

35

Wiseman A. (ed), 1975). A number of microorganisms produce glucose


isomerase as given in Table No.2.3.
Genes from Escherichia (Brownewell C.E., December 1982,)
Bacillus subtilis (Carrell H.L., et al 1989) Clostridium sp (Barker S.A.,
1976, Balt C.A. et al 1986) Streptomyces sp (Barker et al 1983, Batt C.A.,
1985) Ampullariella sp (Saari et al 1987) and Actinoplanes missourensis
and some other species have already been sequenced. On the basis of
deduced amino acid sequence glucose isomerase can be grouped into two
(Vangrysperre W.1988).Bhosle S. et al 1996, review paper states that
glucose isomerase obtained from E.coli and B. subtilis constitutes one
group and the other group includes the enzymes from Actinoplanes,
Ampullariella and Streptomyces sp. The enzymes in the second group are
less similar and lack the stretch of 30 to 40 amino acids, which are
present in the enzymes from the first group.
Koen. Dekker et al 1991, Lehmacher et al a, b, 1990 purified
glucose isomerase from the thermophilic Thermus sp. It was found to be
exceptionally stable at high temperature of 70C. Glucose isomerase
obtained from E.coli, T. thermosulfurogenes and T. neapolitiana. was
found to be thermostable.

36

In 1957, Marshall and Kooi discovered the glucose isomerising


capacity of the enzyme from Pseudomonas hydrophila. This was the first
step for exploitation of the enzyme for the manufacture of HFCS as a
substitute to cane sugar. Takasaki and Tanabe, 1963, 1964 isolated from
Bacillus megatruim a glucose isomerase, which was specific for glucose
substrate. They also isolated glucose isomerase from Paracolobacterium
aerogenoids. (Takasaki and Tanabe, 1964, 1966). This enzyme was
capable of isomerising both glucose and mannose to fructose. Enzymatic
glucose isomerisation was first accomplished on an industrial scale in
1967 by Clinton maize processing co. in U.S.A. (Rita Singh, 2002)
TABLE NO. 2.3
LIST OF GLUCOSE ISOMERASE PRODUCING ORGANISM
Actinomyces livocinereus, A. phaeochromogenes
Actinoplanes missouriensis
Acrobacter aerogenes, A.cloacae, A. levanicum
Achrobacter spp.
Bacillus stereothermophilus, B. megabacterium, B. coagulans
Bacilobacterium spp.
37

Brevibacterium incertum, B. pentosoaminoacidicum


Chainia spp.
Corynebacterium spp.
Cortobacterium helvolum
Escherichia freundii, E. intermedia, E. coli
Flavobacterium arborescens, F. devorans
Lactobacillus brevis, L. bunchneri, L. fermenti, L. mannitopoeus,
L.plantarum, L.lycopersici, L.pentosus
Leuconostoc mesenteroides
Microbispora rosea
Microellobosporia flavea
Micromonospora coerula
Mycobacterium spp.
Nocardia asteroids, N.corallia, N.dassonvillei
Paracolobacterium aerogenoides
Pseudonocardia spp.
38

Pseudomonas hydrophilla
Sarcina spp.
Staphylococcus biblia, S. flovovirens, S. echinatus
Streptococcus

bibila,S.

phaeochromogenes,

S.

fracliae,

S.roseochromogenes, S. olivaceus, S. californicos, S. venuceus, S.


verginial
Streptomyces olivochromogenes, S. venezaelie, S. wedmorensis,
S.griseolus, S. glaucescens, S.bikiniensis, S.rubginosus, S.achinatus,
S.cinnamonensis, S.fradiae, S.albus, S.griseus, S. hivens, S. matensis, S.
nivens, S. platensis
Streptosporangium album, S. oulgare
Thermopolyspora spp.
Thermos spp.
Xanthomonas spp.
Zymomonas mobilis
(`Source: Bhosale et al, microbiological review, 1996)

39

The conversion of glucose to fructose requires pH 7-8.5 and


temperature

of

55-65C. The

obtained

solution

contains

only

approximately 42% fructose (Crabb et al 1997). The final production of


fructose requires large-scale chromatography to purify fructose to 90%
which is then blended back to produce 55% commercial HFCS, (Crabb et
al 1999). The equilibrium ratio of fructose to glucose is dependent on the
reaction temperature and to obtain fructose content of 55% a high
reaction temperature is required (Jorgensen et al 1988, Kurt G.I., Nilsson
et al 1991). However, at high reaction temperature chemical side
reactions (psicose formation, brown color development etc) occur and
interfere with the product of the enzymatic process. Visuri and Kubonov,
1986, obtained 55% fructose by the using 85 to 90% ethanol. However, in
the process stability of the enzyme decreased considerably and room
temperature had to be used. They found that under these conditions the
solubility of glucose was low and the rate of enzymatic reaction was also
very slow. Dekker et al 1991, characterized glucose isomerase from
thermophilic bacteria, Clostridium thermohydrosulfuricum for the
isomerisation of glucose in water ethanol mixture. The temperature for
the optimal activity of the enzyme was found to be 85 0C. This approach
could be used as an alternative to the existing methods for the commercial
production of high fructose maize syrups. (G.I. Nilsson et al 1991).

40

In

enzymatic

bioconversions,

temperature,

pH

and

other

environmental factors frequently affect the activity of the enzyme


(Kulkarni D.N., et al 2000). Direct conversion of the glucose syrup to
55% fructose is possible if isomerisation is done at elevated temperature.
Experimental evidences support this. However, to convert glucose
directly to fructose to a final fructose concentration of 55% the reaction
temperature must be 110C and this temperature has to be maintained for
extended periods of time. While some thermostable enzymes have been
isolated, they have not shown the required stability. Improved thermo
stable glucose isomerase have been isolated and identified from native
sources. Besides this engineering by gene fusion, protein engineering and
recombination of gene improved thermostable glucose isomerase are
being developed. These may prove adaptable to industrial process in the
future.
Glucose isomerases must be thermostable to remain active at
high temperature (80-1000C), required to prevent the conversion of
fructose to glucose (Illanes et al, 1996). However it was observed that the
enzyme was not sufficiently stable to optimize production. Most of the
commercial preparations of glucose isomerase have temperature optima
of 60-650C. Thus, the activity of glucose isomerase declines as a result of
its thermal inactivation (van den Tweel et al, 1993, Collyer et al, 1990,
41

http://fhis.gcal.ac.uk/micro/drjrattray/amb/glc.htm/imm.htm). Due to high


recovery and purification costs, the enzyme cannot be recycled for
subsequent use.
This led to the development of immobilized glucose isomerase
enzyme in the early 1970s. Enzyme immobilization has potentially been
found as the ideal method for retaining enzymes for subsequent reuse and
stabilizing the enzymes for commercial production. The use of
immobilized enzyme allows an unhindered continuous process and
avoids the introduction of enzyme into the product. The design and
operation characteristic of the enzymatic column is done in accordance
with the effect of various variables on the enzyme. Development of
glucose isomerisation columns have been done by many (Hemmingsen S.
H., 1979 Pedrson S., 1993, Verhoff F.H., et al 1985)
In recent years, a great number of techniques for glucose
isomerisation have been developed (Jun Hu, 1986). Columns used for
glucose isomerase may be as simple as glucose isomerase producing cells
cross-linked ton each other with glutaraldehyde or attached to a cellulosic
resin or simply of cross linked glucose isomerase crystals.

Glucose

isomerase from Bacillus coagulans was immobilized by cross-linking the


cells with gluteraldehyde and EPA (epoxy ethylamine) (Chaplin et al,

42

1990). For Actinoplanes missoriensis cells Palazzi et al, 1999, used


polyurethane foam etc.
Initially batch reactors were used for this enzymatic isomerisation
process. This proved to be economically unsound since the relative
reactivity of fructose during the long residence time gives rise to
significant by-product formation. Besides this, problems were also
encountered in the removal of the added Mg2+ and Co2+ and the recovery
of the catalyst (Chaplin et al, 1990). Now, due to high efficiency, ease of
operation and general simplicity there has been a shift towards the use of
packed bed reactors for this industrial scale enzymatic isomerisation.
A comparison of the different reactor types in Table 2.4 highlights
the efficiency of the PBR system over the other two. The enzymatic
activity increased five times whilst its consumption dropped by more than
half (from batch immobilized) in PBR. It is further seen from table 2.4
that the residence time needed for conversion becomes one-fourth and the
necessity of adding initiator ions (Mg2+ and Co2+) became negligible.
From the point of economics, too, the cost of investment decreased four
or five times and the conversion cost reduced by one-sixth.

TABLE NO. 2.4


43

COMPARATIVE ENZYMATIC ISOMERISATION PROCESS

Parameter

Reactor volume (m3)


Enzyme

Batch

Batch

Continuous

(Soluble GI)

(Immobilized)

(PBR)

1100

1100

15

11

consumption 180

(tonnes)
Activity, half life (h)

30

300

1500

Active life, half-lives

0.7

Residence time (h)

20

20

0.5

Co2+ (tonnes)

Mg2+ (tonnes)

40

40

Temperature (c)

65

65

60

pH

6.8

6.8

7.6

formation 0.7

0.2

<0.1

Color
(A420)

Filtration
44

Product refining

C-treatment
Cation

C-treatment
Cation exchange

exchange

Anion exchange

Anion

Ctreatment
-

exchange
Capital,

labour

and 5

30

energy cost, tonne-1


Conversion

cost,

500

tonne-1

It was observed that the high-pressure drop in the packed bed


reactor coupled with the compressibility of the bed led to reduction in
yields. This problem has been alleviated by the use of fluidized bed
reactors. A further advantage of the fluidized system is that the
continuous deactivating catalyst may be withdrawn and replaced
periodically by fresh material without shutting down the reactor (Illanes
et al, 1996). The most important factor for the optimum working of the

45

reactor and subsequent enzymatic reaction is the temperature. It


significantly affects the rates of reaction and enzyme deactivation (Ching
et al, 1984 Anonymous, 1982 Abu-Reesh et al 1996). Park, Lee and Ryu
reported linearly rising temperature control policy for maximizing the
productivity for a short operating period (Abu-Reesh et al 1996). Suga,
Chen and Taguchi (Converti.et al, 1986), reported an alternate
temperature control policy with exponentially rising and constant
temperature profiles for optimal functioning. Temperature and feed flow
rate through a glucose isomerase column is used to control the amount of
fructose produced.
Despite the fact that several methods of immobilizing glucose
isomerase have been described (Antrim et al 1979) only a few are
economically able and suitable for commercial production of HFCS The
glucose isomerase column being used commercially inactivate above
600C and only about 40-42% fructose conversion is obtained as against
the required 55% in standard HFCS. The main requirement of an
industrial process is a methodology capable of ensuring constant fructose
yield (Houng et al, 1993, Yoon et al, 1989, Pederson et al, S., 1993,
Takasaki et al, 1971). Multistage immobilized enzyme reactors have been
reported to yield consistently high product (Bulow et al, 1991). Besides
this, a thermostable enzyme stable at acidic pH would increase the
46

efficiency of the process. Few microorganisms capable of producing such


enzymes have been reported (Ljungcrantz etal, 1989).

2.4 CONCENTRATION/ENRICHMENT
After isomerisation the pH of the syrup is lowered between 4-5. It
is then purified by ion-exchange chromatography to remove the salts. It is
further treated with activated carbon for removal of coloring material. It
is then normally concentrated by evaporation

to about 70% dry solids

(Chaplin et al, 1990).


The normal fructose syrup obtained has 42% relative sweetness as
compared to sucrose. The 42% high fructose sugar is used for the
preparation of canned food, jelly, ketchup and also in baking, dairy and
confectionary industries. However, the scope of its use has become
limited because of its hygroscopic and viscous nature, browning tendency
and inability to crystallize. It also does not meet the requirement of soft
drink manufacturers to replace sucrose. They require at least fructose
with 55% relative sweetness as compared to sucrose.
The earliest method to enrich fructose involved the complexation
of fructose by the addition of borate compounds (Bulow et al, 1991).
However, the cost of removal and recovery of borate prevented the
47

economic success of this process. The best possible method in practice is


the use of zeolite chromatographic columns or calcium salts of cation
exchange resins to further separate fructose from the other components of
the syrup. This fractionate fructose is blended with 42% glucose syrups to
obtain the desired 55% fructose syrup. It has also been observed that 55%
fructose syrup can be directly obtained if the enzyme reactors are
operated at around 950C. The enzymes however, deactivate at this
temperature.
Standard methodology of chromatographic separation which is a
manufacturing process uses ion exchange resins as a selective medium to
a separate one dissolved chemical from another. This is used primarily in
the sugar industry and with compounds related to the sugar industry,
chromatographic sepration happen at a chromatographic packing or
stationary

phase.

Some

example

compounds

purified

by

chromatography are sucrose, glucose, fructose, oligosaccharides,


raffinose, maltose, xylose, sorbitol, and manintol. In addition, this process
has been used in purifying amino acid and various organic acids as well
as to separate salt from glycerol. Most commonly used resins for fructose
separation for 55% HFCS using the ligand exchange chromatography
(LEC) in which the resins used are DOWEX MONOSPHERE 99Ca 320 /
350 resins (Crueger and Crueger, 1989)
48

2.5 ENZYME CONCENTRATION


Reeds,1975 reported that for most enzymatic reactions the speed of
an enzymatic reaction is proportional to the concentration of the enzyme.
The depletion of substrate is a major reason for reduction in activity with
time
G.S. Ayenor, 2002, studied the effect of amylase enzyme of rice
malt on the rate of liquefaction of cassava flour. They found that reaction
rate increased with increase in enzyme concentration. Similarly, in
another set of experiments when saccrification was done by increasing
the enzyme concentration. Ayenor, 2002, reported the same results. This
led to an increase in sugar concentration in the starch slurry. Tucker &
Woods 1991, found decrease in enzyme activity with time due to
saturation of active sets of the enzymes or product inhibition
D.N.Kulkarni et. al processed sorghum for obtaining glucose syrup.
They reported a marked increase in the dextrose equivalent with increase
in enzyme conc. The findings were based on a lecture of Twisk P. V.
1976, on production of glucose from maize grits on commercial scale.

49

Similar, experiments conducted by Ayenor 2002, T. Satyanarayana, 2004,


showed increased sugar content in solution with increase in
Glucoamylase concentration. Immobilization techniques need to be done
for maximum and optimum utilization of the enzymes in the light of the
above studies.

2.6 VISCOSITY
Viscosity is a property also used to define the degree of
gelatinisation. Higher viscous fluids require more force to flow. The
amount of gelatinisation determines the amount of sugar (degradation of
starch) and hence, the fluid characteristics. Heating influences the
dispersion of starch in water and its subsequent degradation to glucose.
Viscosity properties of fluid are determined by the rate at which the
temperature increases. Both are directly proportional to each other. An
increase in agitation rate of the starch slurry was found to increase the
viscosity value of the slurry (A. E. Staley, 2001, 2000).
The proportion of amylase / amylopectin content of the starch
slurry plays an important role in determining the viscosity of the fluid
(Table 2.1). It has been reported that higher the amylopectin content the
more viscous the mixture. However, cereal chemistry reports that there is
50

no substantial effect due to the ratio of amylase or amylopectin in the


starch molecule on the viscosity of the slurry.
An increase in starch concentration increases the viscosity whilst
action of amylases decreases the paste viscosity. Apart from this, it has
been reported that increasing sugar concentration decreases the viscosity
of the slurry.Lipid mono and triglycerides have no direct effect on the
viscosity on the system. However, the presence of lipid monoglycerides
causes a marked increase in temperature at which swelling of starch
particles begins and therefore, causes an increase in viscosity.In
contrast,the presence of lipid triglycerides decreases the temperature of
the starch slurry at which maximum viscosity is attained. Proteins and
surfactants lower the viscosity of the starch slurry. pH does not effect the
viscosity values directly but since the activity of the amylase in enzyme
specific therefore, maximum viscosity levels are obtained at optimum pH
and temperature values.
2.7 MULTIPLE SEQUENCE ALIGNMENT
Various websites were used to identify amylase genes. Genbank
is the database of known gene sequences. It is available and maintained
by the national center for biotechnology information (NCBI) U.S.A. URL
for retrieving gene sequence which encodes amylase protein from
51

Genbank is different tools are used for multiple sequence alignment for
obtaining database. ClustalW sequence alignment tool is most frequently
used. It is a general purpose multiple sequence alignment program for
DNA or proteins. Bhosale et al (1997) used ClustalW (version 1.82) to
identify similarity sequence for glucose amylase genes.

ClustalW

calculates the best matches for the selected sequences, similarities and
differences can be seen at a glance. It uses the multiple sequence
alignment profile to scan databases for new members of the family.

CHAPTER III
EXPERIMENTAL METHODOLOGY

52

Starch from the three-cereal grains sorghum, rice and maize was
converted to liquid glucose .The effect of process parameters were
studied and optimized. The obtained liquid glucose was subsequently
isomerized to fructose and it was concentrated in its pure form. Alpha
amylase genes from known organisms were identified and a comparative
study of its nucleotide sequence was done. The gene was also cloned and
further studies were done.
Different sets of experiments were done to study:
3.1 Standardization of process parameters for production of liquid
glucose
3.1.1 Temperature and pH variation
3.1.2 Enzyme concentration
3.1.3 Viscosity
3.2. Isomerisation
3.3. Concentration
3.4. Recombinant DNA technique for cloning and DNA analysis
3.5. Multiple sequence alignment

53

Sorghum (variety CSH5), rice (variety HMT Sona), maize (variety


Tulsi 369) were obtained from Senior Seed Technology Research unit, of
Dr.Panjabrao Deshmukh Agricultural University and Ms. Tulasi Seeds
Pvt. Ltd, Guntur.
3.1 STANDARDIZATION OF PROCESS PARAMETERS FOR
PRODUCTION OF LIQUID GLUCOSE
3.1.1 TEMPERATURE AND pH VARIATION
The obtained grains were washed with absolute alcohol to remove
any sort of microbial contamination. The grains were then ground to
around 40 mesh size by passing it through a hammer mill with a 40 mesh
screen. The ground grains were then transferred to 24 wide mouthed open
glass bottles each. One-liter of tap water was added to 200gm of ground
grain i.e., in the ratio of 1:5. The pH of 8 bottles of each grain was
adjusted to 4.5, 8 bottles to 5.5, and 8 to 6.5. pH adjustment was done by
placing the bottle on a pH meter and adding dilute hydrochloric acid to it
to obtain the required pH of 4.5, 5.5 and 6.5 in 2 bottles each respectively.
5mg of lime was added to the slurry in each bottle for the thermo stability
of the enzyme. 0.3ml of commercial grade amylase (brand name
termamyl) was then added to the slurry. Each mixture was then heated to
a temperature ranging between 40-50C. The heating of mixture was
54

done in a steel jacketed water bath. The slurry was heated for around 15
minutes before 0.3ml of amylase enzyme was again added in each
experimental set up bottle. (Fig 3.1)
FIGURE: 3.1
EXPERIMENTAL SET UP FOR EXPERIMENTS

Stirrer

Cereal
grain
Water

Here, for this study sorghum, rice and maize have been taken in
their whole grain form to extract sugar, in sharp contract to the available
process in which primarily starch is extracted from the grain. The
55

enzymatic treatment is then given to the starch obtained from the grain.
The enzyme is added in a single dose in the known technology for sugar
extraction from starch. The addition amylase enzyme was done in a
two-phased manner in these experiments.
Heating the slurry after addition of half the dose of required
enzyme leads to the formation of uniform slurry, which facilitates the
action of the second dose of the enzyme. Apart from this the imbibition of
water by the starch grains was found to be expedited at high temperature.
This results in easy penetration of the enzyme in the grain to carry out
liquefaction.
The grain particles in the slurry were continuously stirred with
glass rods to ensure proper mixing of the enzyme and also to prevent the
setting of the grain particles at the bottom of the vessel. The slurry was
heated to 100C, and kept at that temperature for 20-25 minutes. The
obtained starch slurry was then subjected to saccharification by
Glucoamylase.
The temperature of the slurry was then brought down to 40C,
50C, 60C and 70C. Then for 6 vessels of each grain (2 each of each
pH) the pH was again adjusted to 4.5, 5.5 and 6.5 with the help of weak
hydrochloric acid. 0.75 ml of commercial grade Glucoamylase under the
56

brand name A M G was added to each of the 6 vessels for each grain. The
vessels were then transferred to a water bath where the temperature was
maintained at 70C. When the temperature of the remaining vessels came
down to 60C then for 6 vessels of each grain (2 each of each pH value)
again similar process was adopted as for 70C and the vessels were kept
in an oven with temperature maintained at 60C. The same pattern was
followed at 50C and the vessels were transferred to an oven with
temperature maintained at 50C. Similar treatment was done for
remaining vessels and they were transferred to water bath maintained at
40C.
Observations were then made at every 6 hrs interval for the rise in
sugar concentration (Brix) in the slurry. These observations were made
for 48 hrs for rice grain and 66 hrs for both sorghum and maize.
The measurement of sugar concentration was done by refractometer. The
principle of working of refractometer is that when light impinges on the
surface of a material at an angle to the normal to the surface, its direction
is changed upon passing into the surface. Every substance or material has
a point at which light breaks upon passing into the material. It only
requires a small amount (about a millimeter) of the substance in order to

57

get a reading. Refractometer measures in Brix, which is a percent of the


sugar in the solution or grams of sugar per 100 grams of solution.

3.1.2 ENZYME CONCENTRATION


The effect of increase in enzyme concentration was studied after
standardization of optimum pH and temperature for each cereal starch
slurry
Sorghum grain 40 gms was weighed and 200 ml tap water was
added to it in 6, 250 ml bottles. The pH was adjusted to 5.5 each bottle by
adding hydrochloric acid. 60l of amylase was added to the slurry. The
slurry was added to 60C and then 60l enzyme was further added to it. It
was heated till 100C and kept at the temperature for 15 minutes. The
bottle were left to stand till the temperature come down to 60C the pH
was adjusted to 5.5 Glucoamylase, 140l/ml, 150l/ml and 160l/ml was
added in two bottle each respectively. The bottles were then transferred to
a water bath maintained at 60C. The sugar concentration in Brix was
noted at every 6 hrs interval for 60 hours.
Rice grain 30gms was weighed and 150ml tap water was added to it in 6,
250ml bottles. The pH was adjusted to 5.5 each bottle by adding
58

hydrochloric acid. 50l of amylase was added to the slurry. The slurry
was added to 60C and then 50l enzyme was further added to it. It was
heated till 100C and kept at the temperature for 15 minutes. The bottle
were left to stand till the temperature come down to 60C the pH was
adjusted to 5.5 Glucoamylase, 105l/ml, 115l/ml and 125l/ml was
added in two bottle each respectively. The bottles were then transferred to
a water bath maintained at 60C. The sugar concentration in Brix was
noted at every 6 hrs interval for 60 hours.
Maize grain 40gms was weighed and 200ml tap water was added to
it in 6, 250ml bottles. The pH was adjusted to 5.5 each bottle by adding
hydrochloric acid. 60l of amylase was added to the slurry. The slurry
was added to 60C and then 60l enzyme was further added to it. It was
heated till 100C and kept at the temperature for 15 minutes. The bottle
were left to stand till the temperature come down to 60C the pH was
adjusted to 5.5 Glucoamylase, 175l/ml, 185l/ml and 195l/ml was
added in two bottle each respectively. The bottles were then transferred to
a water bath maintained at 60C. The sugar concentration in Brix was
noted at every 6 hrs interval for 60 hours.
3.1.3 VISCOSITY

59

Viscosity of the slurry of each grain (sorghum, rice and maize) at


different pH (4.5, 5.5 and 6.5) combination was measured at every 12 hrs
interval after addition of Glucoamylase. Viscosity measurement was done
by Brookfields RVT viscometer by using spindle number 6 and varying
the spindle speed. 4 spindle speeds of 10, 20, 50 and 100 rpm were used
for this experiment.
40 gms of sorghum grains were taken and 120ml of tap water was
added to it in 6,250ml bottles. pH was adjusted to 4.5, 5.5 and 6.5 in two
bottles each by adding hydrochloric acid. 60l of amylase was added to
the slurry. The slurry was added to 60C and then 60l enzyme was
further added to it. It was heated till 100C and kept at the temperature
for 15 minutes. The bottle were left to stand till the temperature come
down to 60C the pH was adjusted to 5.5 [Glucoamylase 175l/ml,
185l/ml and 195l/ml] added in two bottle each respectively. The bottles
were then transferred to a water bath maintained at 60C. The sugar
concentration in Brix was noted at every 6 hrs interval for 60 hours.
12 gms of rice grains were taken and 60ml of tap water was added
to it in 6 250ml bottles. pH was adjusted to 4.5, 5.5 and 6.5 in two bottles
each by adding hydrochloric acid. 18l of amylase was added to the
slurry. The slurry was added to 60C and then 18l enzyme was further
60

added to it. It was heated till 100C and kept at the temperature for 15
minutes. The bottle were left to stand till the temperature come down to
60C the pH was adjusted to 5.5 [Glucoamylase 45l/ml, 55l/ml and
65l/ml] added in two bottle each respectively. The bottles were then
transferred to a water bath maintained at 60C. The sugar concentration in
Brix was noted at every 6 hrs interval for 60 hours.
40 gms of maize grains were taken and 120ml of tap water was
added to it in 6,250ml bottles. pH was adjusted to 4.5, 5.5 and 6.5 in two
bottles each by adding hydrochloric acid. 18l of amylase was added to
the slurry. The slurry was added to 60C and then 18l enzyme was
further added to it. It was heated till 100C and kept at the temperature
for 15 minutes. The bottle were left to stand till the temperature come
down to 60C the pH was adjusted to 5.5. Glucoamylase, 45l/ml,
55l/ml and 65l/ml were added in two bottle each respectively. The
bottles were then transferred to a water bath maintained at 60C. The
sugar concentration in Brix was noted at every 6 hrs interval for 60 hours.
To measure the viscosity spindle no 6 was attached to the
viscometer and lowered into the bottle of starch slurry, till the meniscus
of the fluid at the center of the emersion groove on the spindles shaft. The
spindle shaft speed was set with the help of a screw on the viscometer. To
61

make the viscosity measurement the motor switch was turned on. This
energized the viscometer drive motor. The reading obtained on the dial
was noted and multiplied by the factor appropriate to the spindle and
speed combination being used. The dial percent scale reading of the
viscometer was thus interpreted in terms of centripoise.

3.2 ISOMERIZATION
The glucose syrup with a dry weight of 40-45% and 93-96%
glucose was subjected to isomerization in a system of three 2.2 m 3
columns connected in series.In order to prevent loss of enzyme activity
during isomerization, the solution was first purified by filtration, carbon
treatment and ion exchange. Magnesium was then added as an activator
and the reaction was run at pH 5.5-9 maintaining a temperature of 60C
for 4 hours. The percent isomerization was checked after every one hour.

3.3 CONCENTRATION
For concentration of fructose chromatographic separation that uses
ion exchange resins as a selective medium to separate one dissolved
chemical from another was used. In this experimentation fructose
62

separation for 55% HFCS using the ligand-exchange chromatography


(LEC) in which DOWEX MONOSPHERE 99Ca 320 / 350 resins were
used.

3.4 RECOMBINANT DNA TECHNIQUES FOR CLONING AND


DNA

ANALYSIS

3.4.1 POLYMERASE CHAIN REACTION


Rapid amplification of the DNA fragments was done using Taq
DNA polymerase and a set of convergent primers. All the PCR reactions
included a denaturation, an annealing and an extension step. The
temperature of denaturation was 94oC, and of extension was 72oC but that
of annealing varied with the Tm of the primers used. The time for which
each step was carried out also varied depending on the size of the
fragment to be amplified. The reaction was carried out for 32 cycles and
the reaction product was electrophoresed on 1% agarose gel to check for
the amplification. For performing colony PCR, a few cells tooth picked
from each of the isolated colonies were resuspended in sterile water and
boiled for 5 min. The lysed cells were centrifuged at 12,000 X g for 5 min
and the supernatant was used as the DNA template for PCR reaction.

63

3.4.2 PURIFICATION OF DNA FRAGMENTS FROM AGAROSE


GEL
Restriction enzyme digested plasmid or PCR amplified products
were electrophoresed on 0.8% agarose gel in TAE buffer (40 mM Trisacetate; 1 mM EDTA). The desired fragment was identified using
standard molecular weight marker (1 kb ladder from MBI Fermentas) and
purified using the QIA quick gel extraction column (Qiagen). The DNA
fragment was excised from the agarose gel and collected in an eppendorf
tube. Three volumes of solubilization buffer (Buffer QG) were added to 1
volume of gel and heating at 55 oC for 20 min dissolved the gel slice. The
mixture was loaded onto QIA quick spin column and centrifuged for 1
min. The flow through was discarded and the bound DNA was washed
with wash buffer (Buffer PE). The bound DNA fragment was eluted with
50 l of elution buffer (Buffer PB: 10 mM Tris-HCl, 1 mM EDTA, pH
8.0). All the buffers used were supplied with QIA quick gel extraction kit.

3.4.3 PREPARATION OF COMPETENT CELLS


E. coli DH5 cells were subcultured in LB medium (50 ml) from
an overnight grown culture and incubated further at 37 oC till the OD600
reached 0.4. Cells were harvested by centrifugation at 2,200 X g for 10
64

min at 4oC. The pellet was resuspended in 20 ml of ice-cold 100 mM


CaCl2 and incubated on ice for 30 min. Cells were collected by
centrifugation at 1,500 X g for 20 min at 4 oC and resuspended gently in
1.5 ml of ice-cold 100 mM CaCl 2. To this cell suspension 100% glycerol
was added to a final concentration of 10%. Cell suspension (0.1 ml) was
aliquoted into eppendorf tubes, frozen immediately in liquid nitrogen and
stored at 80oC.

3.4.4 LIGATION AND TRANSFORMATION


Fragments amplified by PCR were cloned in pGEM-Te vector
carrying 3-T overhangs using pGEM-Te vector system of Promega. The
amplified DNA fragment was ligated to the linearized vector using T4
DNA ligase, the ligation reaction was carried out in water bath set at 15 oC
for 5 hr. After stipulated incubation, the ligation mix was added to 100 l
of competent cells, mixed gently and incubated on ice for 30 min. Cells
were subjected to heat shock at 42oC for 60 sec followed by addition of
900 l of LB medium to the tube and incubated further at 37 oC for 1 hr
with slow shaking. The revived cells were centrifuged at 750 X g for 5
min. After discarding 900 l of LB medium, the cells were resuspended
in the remaining 100 l and plated on luria agar plate containing the
65

suitable antibiotic (depending on the vector used). If the vector allowed


blue/white selection, 100 l of 100

mM IPTG (isopropyl--D-

thiogalactopyranoside) and 20 l of 50 mg/ml X-Gal was spread over the


surface of agar plate before plating. The plates were incubated overnight
at 37oC. In order to subclone an insert from one vector to another, either
suitable restriction sites present in the multiple cloning site (MCS) of
both the vectors were chosen or the restriction sites were included in the
primer itself.
Transformed cells containing recombinant plasmids were identified
by performing colony PCR.

3.4.5 ISOLATION OF PLASMID DNA


Plasmid DNA was isolated by alkaline lysis method as described in
Sambrook et al. (1989). Bacterial cells containing the desired clone were
grown overnight at 37oC in LB medium containing suitable antibiotic
depending upon the vector and the host strain used [ampicillin (100
g/ml) or kanamycin (20 g/ml) or both]. The cells were harvested by
centrifugation at 5,000 X g for 5 min at room temperature. The pellet was
resuspended in 200 l of solution I (25 mM Tris-HCl, pH 8.0, 10 mM

66

EDTA, pH 8.0 and 50 mM glucose) and subsequently 400 l of freshly


prepared solution II (0.2 N NaOH, 1% SDS) was added and mixed by
inversion. To the lysed cells, 300 l of ice-cold solution III (7.5 M
ammonium acetate) was added mixed vigorously by inversion and
incubated on ice for 20 min. The mixture was centrifuged at 22,000 X g
for 15 min at 4oC. Supernatant (650 l) was collected in a fresh tube and
centrifuged again at 12,000 X g for 5 min at room temperature to remove
any bacterial debris. Again, supernatant (550 l) was collected in a fresh
tube, to which 450 l of isopropanol was added and mixed by inversion.
The mixture was incubated at room temperature for 5 min and
centrifuged at 12,000 X g to pellet the DNA. The pellet was washed with
70% ethanol and then air-dried. The pellet of nucleic acid was then
dissolved in Tris-EDTA (TE) buffer (10 mM Tris-HCl, 1 mM EDTA, pH
8.0) containing 50 g/ml RNase A and incubated at 37oC for 30 min.

3.4.6 DNA SEQUENCING


The sequencing of the insert cloned in pGEM-Te vector was
carried out by Sangers dideoxy termination method (Sanger et al., 1977)
with the help of T7 sequencing kit (Amersham). Vector specific or gene
specific primers were used for sequencing depending upon the
67

requirement. Briefly, 2 g of the double-stranded DNA was denatured by


heating (65oC) and using alkali (NaOH) and the primer was annealed to
the template DNA by quick annealing method. The sequencing reaction
was carried out in the presence of 35S-dATP at 21oC and then terminated
as described in the protocol. The samples were boiled for 5 min and
cooled on ice before loading. The labeled fragments were separated on a
6% polyacrylamide gel containing 8 M urea. Electrophoresis was carried
out at constant power (40 watts) using 1X TBE buffer (90 mM Trisborate, 2 mM EDTA) and the temperature of the gel was maintained at
50oC. Three loadings were done to resolve maximum nucleotide
sequence. After completion of the run, the gel was transferred to
whatmann 3M paper, dried and autoradiographed. The nucleotide
sequence was read manually and analyzed by computer using Mac Vector
version 7.0 software

3.4.7 SPECTROPHOTOMETRIC ESTIMATION OF NUCLEIC


ACIDS
Quantity and purity of nucleic acids in solution was determined by
measuring the absorbance at 260 and 280 nm. Concentration of DNA was
calculated by taking A260 = 50 g/ml for DNA and 40 g/ml for RNA.
68

The purity of nucleic acid solutions was checked by taking the A260/A280
ratio.
3.4.8 DETECTION AND ANALYSIS OF PROTEINS EXPRESSED
FROM CLONED GENES
3.4.8.1

POLYACRYLAMIDE GEL ELECTROPHORESIS (PAGE)


OF PROTEINS
Polyacrylamide Gel Electrophoresis (PAGE) was performed

according to the protocol of Laemmli (1970). Gels were prepared and


electrophoresed in the presence of 0.1% SDS (denaturing). The
composition of the separating and stacking gel mixtures are given in
Table 3.1. Protein samples were prepared by adding 4 X SDS sample
buffer (100 mM Tris-HCl pH 6.8, 4% SDS, 20% glycerol, 4% mercaptoethanol, 0.01% bromophenol blue). Samples were boiled for 5
min, centrifuged at 12,000 X g and loaded on the gel. Gels were
electrophoresed at 100 V till the proteins were stacked properly and
thereafter gels were electrophoresed at a constant voltage of 180 V. Gels
were stained with Coomassie Brilliant Blue (CBB) (0.05% Coomassie
blue R-250, 25% isopropanol and 10% acetic acid) and destained with
10% acetic acid as described by Laemmli (1970).

69

TABLE NO. 3.1


COMPOSITION FOR 7.5% RESOLVING AND 5% STACKING
GEL

REAGENTS

RESOLVING GEL STACKING


(6 ml)

Acryl

amide

Stock

Solution 1.5 ml

GEL (1.5 ml)

0.25 ml

(30%)
4X Resolving Gel buffer

1.5 ml

0.375 ml

Water

2.875 ml

1.1 ml

SDS (10%)

0.06 ml

0.015 ml

Ammonium persulphate (10%)

0.06 ml

0.015 ml

TEMED

0.005 ml

0.0025 ml

(1.5 M Tris-HCl, pH 8.8)


4X Stacking Gel buffer
(0.5 M Tris-HCl, pH 6.8)

70

3.4.8.2

WESTERN BLOTTING
Western blotting was done according to the method described by

Towbin et al. (1979). Mini Trans-blot Electrophoretic Cell (Bio-Rad) was


used to transfer the proteins from the gel to the nitrocellulose membrane
(Hybond-C, Amersham, England). The apparatus for electroblotting was
assembled according to the manufacturers instructions. For western
analysis, the proteins were electrophoresed in SDS-PAGE along with
prestained marker (low molecular weight or high molecular weight; BioRad)

and

then

transferred

to

the

nitrocellulose

membrane

electrophoretically in transfer buffer (39 mM glycine, 48 mM Tris base,


and 20% methanol) at a constant current of 100 mA for 2 hr at 4 oC. The
membrane was rinsed briefly in Tris-buffered saline containing Tween-20
(TBST) (10 mM Tris-HCl, pH 7.5, 150 mM NaCl and 0.05% Tween-20)
and then incubated in blocking solution (3% BSA in TBST) for 1 hr with
gentle shaking at room temperature. The membrane was washed twice for
5 min each with TBST. The washing was followed by 1 hr incubation with
primary antibodies [anti-APN antibody (1:5,000) or anti-His antibodies
(1:10,000) (Clontech) in TBST containing 0.5% BSA] at room
temperature with gentle shaking. Thereafter, the blots were washed thrice
with TBST for 5 min each. After washing, blots were transferred to
71

alkaline-phosphatase conjugated secondary antibody (Sigma) solution


[goat anti-rabbit (1:5,000) or goat anti-mouse (1:10,000) in TBST
containing 0.5% BSA] and further incubated for 1 hr. The blots were
washed again as described above. The protein-antibody complex was
developed with alkaline phosphatase buffer (0.1 M Tris-HCl, pH 9.5, 0.1
M NaCl, 5 mM MgCl2) containing 150 g/ml of p-nitroblue tetrazolium
chloride (NBT) and 75 g/ml 5-bromo-4-chloro-3-indolyl phosphate
toluidine (BCIP) (Life Technologies). The reaction was stopped by rinsing
the blot with distilled water.

3.5 MULTIPLE SEQUENCE ALIGNMENT


A 32-nucleotide set was identified to be the conserved domain of
the amylase gene. This set was subjected to homology database search
through BLAST version 2.2.10

72

TABLE NO. 3.2


ALPHA AMYLASE PRODUCING BACTERIA (GENETIC
IDENTIFICATION OF AMYLASE PRODUCING GENES)

Accession GI

Organism

Definition

Length

Aspergillus niger

A.niger amyA gene for 2520bp

no.
X52755

2323

alpha-amylase
D83540

159585

Cryptococcus sp. Cryptococcus

S-2

sp.

S-2 3160bp

DNA for alpha-amylase


complete cds

M79444

142434

Bacillus subtilis

Bacillus subtilis alpha 1959bp


amylase gene, complete
cds.

J01542

142428

Bacillus

Bacillus

amyloliqusfaciens amyloliqusfaciens alpha


amylase gene, complete
cds.

73

2084bp

Y17557

8250114 Geobacillus

Geobacillus

2146bp

streothermopliliu

streothermoplilius Gene

encoding maltohexaose
producing alpha amylase

M34957

153152

Streptomyces

Streptomyces

1712bp

thermoviolaceus

thermoviolaceus

alpha

amylase gene complete


cds.
AJ

975601

Actinoplanes

Actinoplanes sp. 50/110 5979bp

293424

sp.50/110

acb E gene for alpha


amylase and acb D gene
for

acarviose

transferase
M25263

153158

Streptomyces

Streptomyces venezuelae 2192bp

venezuelae

alpha

amylase

complete cds

74

gene,

Y13601

Z85949

M15540

4151100 Streptomyces

Streptomyces

lividans

aml gene

183523

Streptomyces

Streptomyces

lividans

aml-B gene

153154

Streptomyces

Streptomyces

hygroscopicus

hygroscopicus

lividans 3484bp

lividans 2040bp

1842bp
alpha

amylase gene, complete


cds

75

CHAPTER IV
RESULT AND DISCUSSION

4.1. LIQUEFACTION
The process of breaking of 1,6 glucosidic linkage of starch polymer
i.e., the amylose component, by amylase enzyme is known as
liquefaction.
Various factors effect the functioning of amylase. The
environmental factors like pH, temperature etc. effect the working of the
enzyme beside this, some operational factors like increase in enzyme
concentration, viscosity or fluid characteristics, time the presence of
interfering ions etc. Some factors like pH, temperature and increase in
enzyme concentration, influence the process of liquifaction most
significantly.

76

4.1.1 EFFECT OF TEMPERATURE


The starch slurry of sorghum, rice and maize were subjected to
heating. The concentration of glucose in the starch syrup (Brix) was 0 at
the initiation of the reaction. The starch slurry on heating was kept
constant at 50-60C for 15 minutes. It was noted that amylase began its
activity at this temperature. It showed a value of 0.2 on the refractometer
for all the cereals, thus proving that the optimum temperature for
activating of enzyme was between 50-60C. Most scientists have reported
optimum temperature of 60C for working of amylase enzyme.
The temperature of the slurry of the three grains was raised to
100C an increase in sugar concentration was found when the
temperature was raised from 60-100C. The enzyme though sensitive to
temperature did not deactivate. It remained thermostable at 100C. It has
been tabulated in table 4.1,4.2,4.3. and represented graphically in graphs
4.1,4.2,4.3.

77

TABLE NO. 4.1 (1, 2, 3)


LIQUEFACTION
EFFECT OF TEMPERATURE AND Ph

1. SORGHUM

Temperature

pH 4.5

pH 5.5

pH 6.5

40C

50C

12

13

12

60C

16

18

17

70C

17

18

17

78

2. RICE

Temperature

pH 4.5

pH 5.5

pH 6.5

40C

50C

11

10

10

60C

12

14

13

70C

13

14

13

3. MAIZE

Temperature

pH 4.5

pH 5.5

pH 6.5

40C

50C

10

11

10

60C

12

16

15

70C

15

16

16

79

GRAPH 4.1.1
SORGHUM
EFFECT OF INCREASE IN TEMPERATURE AND pH ON
SUGAR CONCENTRATION

liquefaction
20
18
16
14
12
sugar conc

10

pH 4.5

pH 5.5

pH 6.5

8
6
4
2
0
40c

50c

60c

70c

temperature

GRAPH 4.1.2
RICE
EFFECT OF INCREASE IN TEMPERATURE AND pH ON
SUGAR CONCENTRATION

80

liquefaction
20
18
16
14
12
sugar conc.

10

pH 4.5

pH 5.5

pH 6.5

8
6
4
2
0
40c

50c

60c

70c

temperature

GRAPH 4.13

MAIZE
EFFECT OF INCREASE IN TEMPERATURE AND pH ON
SUGAR CONCENTRATION

81

liquefaction
18
16
14
12
10
sugar conc.

pH 4.5

pH 5.5

pH 6.5

6
4
2
0
40c

50c

60c

70c

temperature

There is difference in the starch content and linkage type present in


the three cereal grains. This is due to the differences of starch content and
linkage type present in them. Though both sorghum and maize have
nearly the same amount of the starch present in them (63-68% in sorghum
and 60-64% in maize) the amylose content (1-4 linkage of glucose
polymer) is more in sorghum than in maize therefore liquefaction in
sorghum was found to be more in sorghum than in maize. The maximum
values of sugar concentration obtained were 18 for sorghum, 16 for maize
and 14 for rice. (Table 4.1.1, 2, 3. Graph 4.1.1, 4.1.2, 4.1.3). Maximum
value of sugar was obtained for sorghum due to higher amylase content in
comparison to maize.

82

Although, rice has a high amylose content starch however, after the
removal of the outer layers of rice grain and its breakage into small
pieces, the starch component reduces to a large extent .The starch content
present in the rice used for this study was therefore less in comparison to
sorghum and maize. The sugar concentration value obtained after
liquefaction in rice was therefore less than for both sorghum and maize.

4.1.2. EFFECT OF pH
Simple experiments (to study the effect of increase in
concentration of enzyme in the starch slurry) were carried out to find out
the working pH for amylase enzyme. It was found that although the
enzyme worked in the range of 4.5-6.5 however, best results were
obtained at pH 5.5 at minimum enzyme concentration. For sorghum, the
values obtained for different pH 4.5, 5.5 and 6.5 were 10, 10 and 8 Brix
respectively. (Table 4.2.1, 2, 3. Graph 4.2.1, 2, 3).

TABLE NO. 4.2 (1, 2, 3)


LIQUEFACTION-SORGHUM

83

CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN


TEMPERATURE

AND

ENZYME

CONCENTRATION

DIFFERENT pH VALUES

1. pH- 4.5

Enzyme conc.

Initial

1st heating

Final

60l/g

0.2

10

70l/g

0.2

11

80l/g

0.2

14

Enzyme conc.

Initial

1st heating

Final

60l/g

0.2

12

70l/g

0.2

13

80l/g

0.2

12

2. pH-5.5

84

AT

3. pH-6.5

Enzyme conc.

Initial

1st heating

Final

60l/g

0.2

70l/g

0.2

10

80l/g

0.2

11

GRAPH 4.2.1
SORGHUM
EFFECT OF INCREASE IN ENZYME CONCENTRATION AND
TEMPERATURE ON SUGAR CONCENTRATION AT pH-4.5

Liquefaction
16
14
12
10
60ml/g

sugar conc

70ml/g

80ml/g

6
4
2
0
initial

1s t heating

85

final

GRAPH 4.2.2
SORGHUM
EFFECT OF INCREASE IN ENZYME CONCENTRATION AND
TEMPERATURE ON SUGAR CONCENTRATION AT pH-5.5

liquefaction
16

14

12

10

sugar conc

60ml/g

70ml/g

80ml/g

0
initial

1s t heating

GRAPH 4.2.3

86

final

SORGHUM
EFFECT OF INCREASE IN ENZYME CONCENTRATION AND
TEMPERATURE ON SUGAR CONCENTRATION AT pH-6.5

liquefaction
16

14

12

10

sugar conc

60ml/g

70ml/g

80ml/g

0
initial

1s t heating

Sugar concentration of 10 and 10 were obtained at pH 4.5 and 5.5


while it decreased to 8 at pH 6.5. The enzyme was more active slightly
below 5.5 pH than above it. For rice 10, 10 and 8 were the sugar
87

final

concentration values obtained at pH 4.5, 5.5 and 6.5. (Table 4.3.1, 2, 3


Graph 4.3.1, 2, 3).

TABLE NO. 4.3 (1, 2, 3)


LIQUEFACTION-RICE
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TEMPERATURE

AND

ENZYME

CONCENTRATION

DIFFERENT pH VALUES

1. pH- 4.5

Enzyme conc.

Initial

1st heating

Final

60l/g

0.2

10

70l/g

0.2

11

80l/g

0.2

11.5

2. pH-5.5
88

AT

Enzyme conc.

Initial

1st heating

Final

60l/g

0.2

10

70l/g

0.2

11

80l/g

0.2

12

Enzyme conc.

Initial

1st heating

Final

60l/g

0.2

70l/g

0.2

10

80l/g

0.2

10.5

3. pH-6.5

GRAPH 4.3.1
RICE
EFFECT OF INCREASE IN ENZYME CONCENTRATION AND
TEMPERATURE ON SUGAR CONCENTRATION AT pH-4.5

89

liquefaction
16
14
12
10

sugar conc

60ml/g

70ml/g

80ml/g

6
4
2
0
initial

1s t heating

final

GRAPH 4.3.2
RICE
EFFECT OF INCREASE IN ENZYME CONCENTRATION AND
TEMPERATURE ON SUGAR CONCENTRATION AT pH-5.5

90

liquefaction
16
14
12
10

sugar conc.

60ml/g

70ml/g

80ml/g

6
4
2
0
initial

1s t heating

GRAPH 4.3.3
RICE
EFFECT OF INCREASE IN ENZYME CONCENTRATION AND
TEMPERATURE ON SUGAR CONCENTRATION AT pH-6.5

91

final

liquefaction
16

14

12

10

sugar conc.

60ml/g

70ml/g

80ml/g

0
initial

1st heating

The value found at pH 4.5 and 5.5 were similar but decreased on
increase of pH. The value of pH must therefore, should not exceed 5.5. At
liquefaction of maize at different pH 4.5, 5.5, and 6.5 sugar concentration
values of 11, 12 and 12 were obtained. (Table 4.4.1, 2, 3. Graph 4.4.1, 2,
3).
Table No. 4.4 (1, 2, 3)

92

final

LIQUEFACTION-MAIZE
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TEMPERATURE

AND

ENZYME

CONCENTRATION

DIFFERENT pH VALUES

1. pH- 4.5

Enzyme conc.

Initial

1st heating

final

60l/g

0.2

11

70l/g

0.2

12

80l/g

0.2

15

Enzyme conc.

Initial

1st heating

Final

60l/g

0.2

12

2. pH- 5.5

93

AT

70l/g

0.2

13

80l/g

0.2

16

Enzyme conc.

Initial

1st heating

Final

60l/g

0.2

12

70l/g

0.2

14

80l/g

0.2

15

3. pH- 6.5

94

GRAPH 4.4.1
MAIZE
EFFECT OF INCREASE IN ENZYME CONCENTRATION
AND TEMPERATURE ON SUGAR CONCENTRATION AT pH-4.5

liquefaction
16
14
12
10

sugar conc.

60ml/g

70ml/g

80ml/g

6
4
2
0
initial

1s t heating

95

final

GRAPH 4.4.2
MAIZE
EFFECT OF INCREASE IN ENZYME CONCENTRATION AND
TEMPERATURE ON SUGAR CONCENTRATION AT pH-5.5

liquefaction
18
16
14
12
10
sugar conc.

60ml/g

70ml/g

80ml/g

8
6
4
2
0
initial

1s t heating

96

final

GRAPH 4.4.3
MAIZE
EFFECT OF INCREASE IN ENZYME CONCENTRATION AND
TEMPERATURE ON SUGAR CONCENTRATION AT pH-6.5

liquifaction
16
14
12
10
60ml/g

sugar conc.

70ml/g

80ml/g

6
4
2
0
initial

1st heating

97

final

Sugar values were found to be similar at pH 5.5 and 6.5 care must
be taken that the pH of the starch slurry should not be below 5.5.
Therefore, in each case pH 5.5 was found to be the most suitable. The
values of sugar for sorghum and maize were almost similar while slightly
less value was obtained for rice. The starch content of the cereal itself and
the linkage type determines the amount of starch liquefied for each grain.
The reason for this is as has been explained in effect of temperature.

4.1.3. EFFECT OF INCREASE IN ENZYME CONCENTRATION.


The amount of enzyme required for the breakdown of any substrate
is determined by the enzyme activity [units ml -1]. As we know an increase
of enzyme concentration in the system increases the product formation till
either / or all the active sets of the enzyme are blocked, substrate is totally
consumed or there is product inhibition (Lehninger A L, 1993, Principles
of Biochemistry, 2nd Edn., Worth publishers, Inc.,U.S.A,P p 400-445).
When the enzyme concentration was increased then irrespective of the pH
and the grain the results obtained for all the three cereal starch slurries
were the same. There was an increase in the amount of sugar liquefied
with every extra dose of amylase enzyme. Sugar concentration was
found to be 10,11 and 14 at 60,70 and 80l/g concentration of enzyme at
98

pH 4.5,12,13and 12 at 60, 70 and 80l/g concentration of enzyme at pH


5.5 and 9,10 and 11 at 60, 70 and 80l/g concentration of enzyme at pH
6.5 for sorghum. 10,11 and 14.5 values of sugar concentration after
liquefaction were obtained when enzyme concentration was 60,70 and
80l/g at pH 4.5,10,11 and 12 at pH 5.5 and 8, 10 and 10.5 at pH 6.5 for
rice starch slurry. Similarly, in maize at enzyme concentration 60,70 and
80l/g the value of sugar concentration obtained were 11,12 and 15 at pH
4.5, 12, 13 and 16 at pH 5.5 and 12, 14 and 15 at pH 6.5. The amount of
sugar liquefied was found to be maximum for sorghum, followed by
maize and rice. {Table: 4.2.4.3.4.4, Graph 4.2., 4.3, 4.4(1, 2, 3)}
The reason for this is that the amount of amylase present in
sorghum starch is more than in maize and therefore more liquefaction.
The amount of starch content is less than for sorghum and maize and
hence the value was lesser.

4.2 SACCHARIFICATION
The process of breakage of 1,4 glucosidic linkage of starch in
addition to the 1,6 linkage i.e., the breakdown of amylopectin content of
starch is known as saccharification. This is done by Glucoamylase
enzyme. Several environmental and operational parameters have to be
99

optimized for the process to occur. The environmental factors like pH and
temperature have a significant effect on the activity of the enzymes.
Several operational factors like viscosity of the fluid, effect of increase in
enzyme concentration, time of exposure of enzyme to starch are also
important parameters of study.

4.2.1 EFFECT OF TEMPERATURE


Tables 4.5,4.6 and 4.7 (1,2,3) depict increasing sugar concentration
(C in Brix) with time (t in hrs) for various temperatures at 3 different pH
values of 4.5, 5.5 and 6.5 respectively. The activity of the enzyme was
monitored by noting the amount of saccharification of sorghum, rice and
maize i.e. the amount of increase in sugar concentration with time. There
is very little activity of the enzyme at 40 0C and 700C while maximum
activity is always achieved at 600C at any pH. Activity of the enzyme
amyloglucosidase begins at 500C. Lopez (1997) reported highest stability
of the enzyme at 550C. Crabb, W.D., Shetty, (1999), J.K, Ayenor,
Hammond and Graffham (2002), Martin Chaplin (2002) and others have
reported to have optima of 600C for amyloglucosidase. The activity of the
enzyme was monitored by

the amount of saccharification of rice i.e.,

the amount of increase in sugar concentration with time at different


temperature.
100

TABLE NO.4.5 (1, 2, 3)


SACCHARIFICATION-SORGHUM
COMPARATIVE ANALYSIS OF SUGAR SACCHARIFICATION
AT DIFFERENT TIME INTERVALS AT DIFFERENT pH VALUES

1. pH-4.5

Temp.

6hrs 12hrs18hrs24hrs30hrs36hrs42hrs48hrs52hrs60hrs 66hrs

40C

18

18.5 18.5 18.5 18.5 19

19

19

19

19

19

50C

18

20

20

21

21

24

24

24

25

25.5

25.5

60C

18

21

21

22

23

25.5 25.5 26

26.5 29.5

29.5

70C

18

20

20.5 21

21

21

21

21

2. pH-5.5

101

21

21

21

6hr
Temp. s

12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs 52hrs 60hrs 66hrs

40C 18 18.5 18.5 18.5 18.5 18.5 19

19

19.5 19.5 19.5

50C 18 22

23

23.5 24

24.5 25

26

26.5 26.5 26.5

60C 18 22

23

24

26

29

29.5 29.5

30

30.5 30.5

70C 18 20

20

20

20

20

20

20

20

20

20

3. pH-6.5

30hr 36hr

52hr

Temp.6hrs12hrs18hrs 24hrs s

42hrs 48hrs s

40C 18 18

18

18

18

18

18

18.5

18.5 18.5

18.5

50C 18 18

18

19

19.5 22

22

22

22

22.5

22.5

60C 18 20

21

24

25

26

26

26

28

29

29

70C 18 19

19

20

20

21

21

21

21

21

21

102

60hrs 66hrs

TABLE NO.4.6 (1, 2, 3)


SACCHARIFICATION-RICE
COMPARATIVE ANALYSIS OF SUGAR SACCHARIFICATION
AT DIFFERENT TIME INTERVALS AT DIFFERENT pH VALUES

1. pH-4.5

Temp. 6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs 52hrs 60hrs
40C

14

14

14

14

14

14

14

14

14

14

50C

14

14

16

16

16.5

16.5

16.5

16.5

16.5

16.5

60C

14

14

16

16.5

17

18

21

22

22

22

103

70C

14

14

14

14.5

15

15

15.5

15.5

15.5

15.5

2. pH-5.5

Temp. 6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs 52hrs 60hrs
40C

14

14

14

14

14

14

14

14

14

14

50C

14

16

16

16

16

16.5

16.5

17

17

17

60C

14

16.5

17

18

18

19.5

22

24

24

24

70C

14

15

15

15

15

15

15

15

15

15

3. pH-6.5
104

Temp. 6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs 52hrs 60hrs
40C 14

14

14

14

14

14

14

14

14

14

50C 14

14.5

14.5

15

15

16

16.5

16.5

16.5

16.5

60C 14

16.5

17

17.5

18

19

21

22

22

22

70C 14

14

14

14

14

14.5

14.5

15

15

15

TABLE NO.4.7 (1, 2, 3)


SACCHARIFICATION-MAIZE
COMPARATIVE ANALYSIS OF SUGAR SACCHARIFICATION
AT DIFFERENT TIME INTERVALS AT DIFFERENT pH VALUES

1. pH-4.5

105

Temp. 6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs 52hrs 60hrs 66hrs
40C 16

16

16

16

16

16

16

16

16

16

16

50C 16

19

19

20

21

23

23

25

27

28.5 28.5

60C 16

18

19

20

21

23

23

25

26

29.5 29.5

70C 16

19

19

20

21

23

23

25

26

27

27

2. pH-5.5

6hr
Temp. s

24hr 30hr 36hr 42hr 48hr 52hr 60hr 66hr


12hrs 18hrs s

40C

16 16

16

16

16

16

16

16.5 16.5 16.5 16.5

50C

16 18

18

19

19

20

20

21

106

21.5 24

24

60C

16 20

21

22

23

25

25

26

28

29

29

70C

16 20

21

22

22

24

24

24.5 24.5 24.5 24.5

3. pH-6.5

Temp.

6hrs 12hrs 18hrs 24hrs30hrs36hrs42hrs48hrs52hrs60hrs66hrs

40C

16

16

16

16

16

16

16

16.5 16.5 16.5 16.5

50C

16

18

18

18.5 19

20

20

21

21.5 24

24

60C

16

20

21

22

23

25

25

26

28

29

70C

16

20

21

21.5 22

24

24

24.5 24.5 24.5 24.5

29

4.2.1.1 SORGHUM
This variation found to be identical in nature at all temperatures has
been modeled through the regression of the relevant data taken from

107

Graph 4.5.1. at pH 4.5, the resultant equations are presented as C=12.66+1.803t-0.0216t2,


0.0212t2

C=-12+1.88t-0.0213t2,

and C=-12.71+1.920t-0.0230t2

C=-12.40+1.934t-

manifesting correlation

coefficients of 0.8916, 0.9286, 0.9403 and 0.8971 respectively in respect


of 400C, 500C, 600C and 700C temperatures respectively.

GRAPH 4.5.1
EFFECT OF TEMPERATURE ON SUGAR CONCENTRATION
WITH INCREASE IN TIME PERIOD AT pH 4.5
108

50c

60c

70c

6h
rs
12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
52
hr
s
60
hr
s
66
hr
s

32
30
28
26
24
22
20
SUGAR CONC(BRIX)
18
40c
16
14
12
10

TIME

The variation found to be identical in nature at all temperatures at


pH 5.5 similarly has been modeled through the regression of the relevant
data taken from Graph 4.5.2
The resultant equations are presented as C=-12.82+1.799t-0.014t 2,
C=-12.53+2.036t-0.0235t2, C=-11.20+2.030t-0.0225t2 and C=-13+1.898t0.0229t2 at 400C, 500C, 600C and 700C respectively, manifesting
correlation coefficients of 0.8957, 0.9227, 0.9413 and 0.8910
respectively.

109

GRAPH 4.5.2
EFFECT OF TEMPERATURE ON SUGAR CONCENTRATION
WITH INCREASE IN TIME PERIOD AT pH 5.5

32
30
28
26
24
22
SUGAR CONC(BRIX) 20
18
40c

50c

60c

70c

16
14
12
66
hr
s

52
hr
s

42
hr
s

30
hr
s

18
hr
s

6h
rs

10

TIME

Likewise at pH 6.5 this variation found to be identical in nature at


all temperatures modeled through the regression of the relevant data taken
from Graph 4.5.3.yield the
12.76+1.742t+0.012t2,

resultant

C=-11.54+1.768t-0.0204t2,

equations as C=C=-11.51+1.943t-

0.0216t2 and C=-12.20+1.842t-0.0218t2 for 400C, 500C, 600C and 700C


110

respectively with the correlation coefficients of 0.8897, 0.9206, 0.9387


and 0.9047 respectively.

GRAPH 4.5.3
SORGHUM
EFFECT OF TEMPERATURE ON SUGAR CONCENTRATION
WITH INCREASE IN TIME PERIOD AT pH 6.5

35
30
25
20
SUGAR CONC(BRIX) 15
40c
50c
10

60c

70c

6h
12 rs
h
18 rs
h
24 rs
h
30 rs
h
36 rs
h
42 rs
h
48 rs
h
52 rs
h
60 rs
h
66 rs
hr
s

TIME

4.2.1.2

RICE

111

This variation has been modeled through the regression of the


relevant data taken from Graph 4.6.1. at pH 4.5, the resultant equations
are

presented

as

C=14,

C=12.76+0.188t-0.0023t2,

C=13.01+0.124t2+0.0010t2 and C=13.57+0.052t-0.003t2 at 400C, 500C,


600C and 700C respectively, manifesting correlation coefficients of
0.8885, 0.9104, 09490 and 0.9051 respectively.

GRAPH 4.6.1
EFFECT OF TEMPERATURE ON SUGAR CONCENTRATION
WITH INCREASE IN TIME PERIOD AT pH 4.5

60c

70c

6h
12 rs
h
18 rs
h
24 rs
h
30 rs
h
36 rs
h
42 rs
h
48 rs
h
52 rs
h
60 rs
hr
s

26
24
22
20
18
SUGAR CONC(BRIX) 16
40c
50c
14
12
10

TIME

The variation at pH 5.5 similarly has been modeled through the


regression of the relevant data taken from Graph 4.6.2. The resultant
112

equations

are

presented

as

C=14,

C=14.07+0.106t-0.001t2,

C=13.81+0.137t+0.0011t2 and C=14.00+0.062t-0.008t2 at 400C, 500C,


600C and 700C respectively ,manifesting correlation coefficients of
0.8885, 0.9075, 0.9509 and 0.8936 respectively.
GRAPH 4.6.2
EFFECT OF TEMPERATURE ON SUGAR CONCENTRATION WITH
INCREASE IN TIME PERIOD AT pH 5.5

26
24
22
20
18
40c

16

50c

60c

70c

14
12
10
6h
rs
12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
52
hr
s
60
hr
s

SUGAR CONC(BRIX)

TIME

113

Likewise at pH 6.5 the variation modeled through the regression of


the relevant data taken from Graph 4.6.3c. Yield the resultant equations
as

C=14,

C=13.56+0.066t-0.001t2,

C=13.58+0.174t-0.0002t2

and

C=14.07-0.017t+0.0007t2 for 400C, 500C, 600C and 700C respectively


with the correlation coefficients of 0.8885, 0.9137, 0.9413 and 0.8998
respectively
GRAPH 4.6.3
RICE
EFFECT OF TEMPERATURE ON SUGAR CONCENTRATION
WITH INCREASE IN TIME PERIOD AT pH 6.5

26
24
22
20
18
SUGAR CONC(BRIX) 16

50c

60c

14

70c

12
10
6h
r
12 s
hr
18 s
hr
24 s
hr
30 s
hr
36 s
hr
42 s
hr
48 s
hr
52 s
hr
60 s
hr
s

40c

TIME

114

MAIZE
This variation found to be identical in nature at all temperatures has
been modeled through the regression of the relevant data taken from
Graph 4.7.1. at pH 4.5, the resultant equations are presented as C=11.33+1.79t-0.1191t2,
0.0177t2

and

C=-11.05+1.722t-0.0183t2,

C=-10.77+1.720t-0.0188t2

C=-11.00+1.694t-

manifesting

correlation

coefficients of 0.8846, 0.9507, 0.9544 and 0.9450 respectively in respect


of 400C, 500C, 600C and 700C temperatures respectively.
GRAPH 4.7.1
EFFECT OF TEMPERATURE ON SUGAR CONCENTRATION

40c

50c

60c

70c

14

SUGAR CONC(BRIX)

18

22

26

30

WITH INCREASE IN TIME PERIOD AT pH 4.5

6h 10
12 rs
h
18 rs
h
24 rs
h
30 rs
h
36 rs
h
42 rs
h
48 rs
h
52 rs
h
60 rs
h
66 rs
hr
s

4.2.1.3

TIME

115

The variation found to be identical in nature at all temperatures at


pH 5.5 similarly has been modeled through the regression of the relevant
data taken from Graph 4.7.2
The resultant equations are presented as C=-11.34+1.575t0.0189t2, C=-11.59+1.685t-0.0188t2, C=-10.82+1.825t-0.0198t2 and
C=-10.66+1.846t-0.0213t2 at 400C, 500C, 600C and 700C respectively,
manifesting correlation coefficients of 0.8903, 0.9313, 0.9460 and
0.9252 respectively.
GRAPH 4.7
EFFECT OF TEMPERATURE ON SUGAR CONCENTRATION
WITH INCREASE IN TIME PERIOD AT pH 4.5

32
30
28
26
24
22
20
SUGAR CONC(BRIX)
18
40c
50c
16
14
12
10

70c

6h
12 rs
h
18 rs
h
24 rs
h
30 rs
h
36 rs
h
42 rs
h
48 rs
h
52 rs
h
60 rs
h
66 rs
hr
s

60c

TIME

116

Likewise at pH 6.5 this variation found to be identical in nature at


all temperatures modeled through the regression of the relevant data taken
from Graph 4.7.3. Yield the resultant equations as
C=-11.34+1.575t-0.0189t2,

C=-11.58+1.679t-0.0187t2,

C=-

10.82+1.825t-0.0198t2
and C=-10.65+1.840t-0.0212t2 for 400C, 500C, 600C and 700C
respectively with the correlation coefficients of 0.8903, 0.9320, 0.9460
and 0.9258 respectively.
GRAPH 4.7.3
EFFECT OF TEMPERATURE ON SUGAR CONCENTRATION

60c

70c

14

50c

6h 10
12 rs
h
18 rs
h
24 rs
h
30 rs
h
36 rs
h
42 rs
h
48 rs
h
52 rs
h
60 rs
h
66 rs
hr
s

SUGAR CONC(BRIX)
40c

18

22

26

30

WITH INCREASE IN TIME PERIOD AT pH 4.5

TIME

117

4.2.1.4 DISCUSSION
The saccharification results show that for all the three grains
sorghum, rice and maize, the temperature at which the activity of the
enzyme was initiated was 50C. Absolutely no activity of the enzyme was
found at 40C. At 50C there is low activity and there is rapid decrease in
the enzyme activity when the temperature of the starch slurry was raised
to 70C. The maximum activity of enzyme was found to be 60 0C. The
maximum values of sugar were obtained at temperature 60 0C at optimum
pH 5.5. The values obtained were for sorghum, rice and maize
respectively.
It is noteworthy that with regard to the temperature variation the
rate of decrease in enzyme activity due to rising temperature is more
rapid than the rate of its increase. This decreasing trend is supported also
by the findings of Ayenor and Grahham, (2002). It is very evident from
these results that the enzyme is extremely temperature sensitive. Its
activity begins at 50C, peaks at 600C and is totally deactivated when
subjected to temperatures above that. Therefore, extreme care is needed
to maintain the temperature at 600 C.
The sugar concentration (Brix) obtained in each of the grains was
however different, maximum sugar was obtained from sorghum followed
118

by maize and rice. The enzyme activity was found to be best at 60C for
all the three grain starch slurries. The content of starch in sorghum and
maize is nearly same (63-68% in sorghum and 60-64% in maize). This is
the reason for almost similar amount of sugar obtained from the starch
slurry of these cereals. The starch content of whole grain rice is much
higher (82%) than either maize or sorghum. However, for this study
broken rice pieces have been used in which the starch content in roughly
(55%) therefore, the amount of sugar concentration obtained from rice
starch slurry is least in comparison to the other two.

4.2.2 EFFECT OF pH
Table 4.5, 4.6, 4.7 and Graphs 4.8, 4.9, and 4.10 depict the
interaction between time (t in hrs) and sugar concentration (C in Brix) at
different pH in respect of 400C, 500C, 600C and 700C temperatures
respectively. The pH optima of amyloglucosidase has been reported near
4.2 by Nakamura, T, Ogata, Y., Shitara, A., Nakamura, A., Ohta, K Crabb,
W.D., Shetty, J.K and others. However, these tables and graphs depict
maximum activity at pH 5.5.

119

4.2.2.1 SORGHUM
Variations have been studied by Graph no.4.8.1,4.8.2,4.8.3 and
4.8.4. This variation found to be identical at all pH at temperature 400C
has been modeled through the regression of the relevant data taken from
Graph no. 4.8.1

as C=-12.66+1.803t-0.0216t2, C=-12.82+1.799t-

0.014t2, and C=-12.76+1.742t+0.012t2 for pH values of 4.5,5.5,and 6.5


respectively which respectively manifest correlation coefficients of
0.8916, 0.8957 and 0.8897.
GRAPH 4.8.1
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT DIFFERENT pH AT 40C

pH 5.5

pH 6.5

6h
12 rs
h
18 rs
h
24 rs
h
30 rs
h
36 rs
h
42 rs
h
48 rs
h
52 rs
h
60 rs
h
66 rs
hr
s

32
30
28
26
24
22
20
SUGAR CONC(BRIX)
18
pH 4.5
16
14
12
10

TIME

120

Likewise, the variation found to be identical at all pH at


temperature 500 Chas been modeled through the regression of the
relevant data taken from Graph no. 4.8.2, as C=-12+1.88t-0.0213t2, C=12.53+2.036t-0.0235t2, and C=-11.54+1.768t-0.0204t2 for pH values of
4.5, 5.5, 6.5 respectively manifesting the correlation coefficients 0.9286,
0.9227 and 0.9206.
GRAPH 4.8.2
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT DIFFERENT pH AT 50C

pH 5.5

pH 6.5

6h
12 rs
h
18 rs
h
24 rs
h
30 rs
h
36 rs
h
42 rs
h
48 rs
h
52 rs
h
60 rs
h
66 rs
hr
s

32
30
28
26
24
22
20
SUGAR CONC(BRIX)
18
pH 4.5
16
14
12
10

TIME

121

At temperature 600C this variation found to be identical at all pH


when modeled through the regression of the relevant data taken from
Graph no. 4.8.3. Yield equations as C=-12.40+1.934t-0.0212t2, C=11.20+2.030t-0.0225t2 and C=-11.51+1.943t-0.0216t2 for pH values of
4.5, 5.5, 6.5 respectively with the correlation coefficients of 0.9403,
0.9413 and 0.9387
GRAPH 4.8.3
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT DIFFERENT AT 60C

pH 5.5

pH 6.5

6h
r
12 s
hr
18 s
hr
24 s
hr
30 s
hr
36 s
hr
42 s
hr
48 s
hr
52 s
hr
60 s
hr
66 s
hr
s

32
30
28
26
24
22
20
SUGAR CONC(BRIX)
18
pH 4.5
16
14
12
10

TIME

122

At temperature 700C the variation found to be identical at all pH


has been modeled through the regression of the relevant data taken from
Graph no. 4.8.4 and the resultant models are presented as C=12.71+1.920t-0.0230t2, C=-13+1.898t-0.0229t2 and C=-12.20+1.842t0.0218t for pH values of 4.5,5.5,6.5 respectively yielding correlation
coefficients of 0.8971, 0.8910 and 0.9047
GRAPH 4.8.4
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT DIFFERENT pH AT 70C

32
30
28
26
24
22
SUGAR CONC(BRIX)

20

pH 4.518

pH 5.5

pH 6.5

16
14
12
6h
rs
12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
52
hr
s
60
hr
s
66
hr
s

10

TIME

123

4.2.2.2 RICE
Variations have been studied by Graph no.4.9.1,4.9.2,4.9.3 and
4.9.4. This variation found to be identical at all pH at temperature 400C
has been modeled through the regression of the relevant data taken from
Graph no. 4.9.1, as C=14, C=14, and C=14 for pH values of 4.5, 5.5, and
6.5 respectively which respectively manifest correlation coefficients of
0.8885, 0.8885 and 0.8885.
GRAPH 4.9.1
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT DIFFERENT pH AT 40C

26
24
22
20
18
pH 4.5

16

pH 5.5

pH 6.5

14
12
10
6h
rs
12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
52
hr
s
60
hr
s

SUGAR CONC(BRIX)

TIME

124

Likewise, the variation found to be identical at all pH at


temperature 500C Chas been modeled through the regression of the
relevant data taken from Graph no. 4.9.2, as C=12.76+0.188t-0.0023t2,
C=14.07+0.106t-0.001t2, and C=13.56+0.066t-0.001t2 for pH values of
4.5, 5.5, 6.5 respectively manifesting the correlation coefficients 0.9104,
0.9075 and 0.9137.
GRAPH 4.9.2
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT DIFFERENT pH AT 50C

26
24
22
20
18
pH 4.5

16

pH 5.5

pH 6.5

14
12
10
6h
rs
12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
52
hr
s
60
hr
s

SUGAR CONC(BRIX)

TIME

125

At temperature 600C this variation found to be identical at all pH


when modeled through the regression of the relevant data taken from
Graph no. 4.9.3, yield equations as C=13.01+0.124t2+0.0010t2,
C=13.81+0.137t+0.0011t2 and C=13.58+0.174t-0.0002t2 for pH values
of 4.5,5.5,6.5 respectively with the correlation coefficients of 0.9490,
0.9509 and 0.9413
GRAPH 4.9.3
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT DIFFERENT pH AT 60C

26
24
22
20
18
pH 4.5

16

pH 5.5

pH 6.5

14
12
10
6h
rs
12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
52
hr
s
60
hr
s

SUGAR CONC(BRIX)

TIME

126

At temperature 700C the variation found to be identical at all pH


has been modeled through the regression of the relevant data taken from
Graph

no. 4.9.4

and the

C=13.57+0.052t-0.003t2,

resultant

models

C=14.00+0.062t-0.008t2

are

presented

and

as

C=14.07-

0.017t+0.0007t2 for pH values of 4.5,5.5,6.5 respectively yielding


correlation coefficients of 0.9051, 0.8936 and 0.8998

127

GRAPH 4.9.4
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT DIFFERENT pH AT 70C

26
24
22
20
18
SUGAR CONC(BRIX)
pH 4.5

16

pH 5.5

pH 6.5

14
12

hr
s
52

hr
s
48

hr
s
42

hr
s
36

hr
s
30

hr
s
24

hr
s
18

hr
s
12

6h
rs

10

TIME

4.2.2.3 MAIZE
Variations have been studied by Graph no.4.10.1,4.10.2,4.10.3 and
4.10.4. This variation found to be identical at all pH at temperature 400C
has been modeled through the regression of the relevant data taken from
128

Graph no.4.10.1, as C=-11.33+1.79t-0.1191t2, C=-11.34+1.575t-0.0189t2


and C=-11.34+1.575t-0.0189t2 for pH values of 4.5,5.5,and 6.5
respectively which respectively manifest correlation coefficients of
0.8846, 0.8903 and 0.8903.
GRAPH 4.10.1
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT DIFFERENT pH AT 40C

pH 5.5

pH 6.5

6h
r
12 s
hr
18 s
hr
24 s
hr
30 s
hr
36 s
hr
42 s
hr
48 s
hr
52 s
hr
60 s
hr
66 s
hr
s

32
30
28
26
24
22
20
SUGAR CONC(BRIX)
18
pH 4.5
16
14
12
10

TIME

Likewise, the variation found to be identical at all pH at


temperature 500 C has been modeled through the regression of the
relevant data taken from Graph no.4.10.2, as C=-11.05+1.722t-0.0183t2,
C=-11.59+1.685t-0.0188t2 and C=-11.58+1.679t-0.0187t2 for pH values
129

of 4.5, 5.5, 6.5 respectively manifesting the correlation coefficients


0.9507, 0.9313 and 0.9320.
GRAPH 4.10.2
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT DIFFERENT pH AT 50C

32
30
28
26
24
22
SUGAR CONC(BRIX)
pH 4.5

20
18

pH 5.5

pH 6.5

16
14
12
6h
rs
12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
52
hr
s
60
hr
s
66
hr
s

10

TIME

At temperature 600C this variation found to be identical at all pH


when modeled through the regression of the relevant data taken from
Graph no.4.10.3, yield equations as C=-11.00+1.694t-0.0177t2, C=-

130

10.82+1.825t-0.0198t2 and C=-10.82+1.825t-0.0198t2 for pH values of


4.5,5.5,6.5 respectively with the correlation coefficients of 0.9544, 0.9460
and 0.9460.
GRAPH 4.10.3
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT DIFFERENT pH AT 60C

32
30
28
26
24
22
SUGAR CONC(BRIX) 20
18
pH 4.5

pH 5.5

pH 6.5

16
14
12
6h
rs
12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
52
hr
s
60
hr
s
66
hr
s

10

TIME

At temperature 700C the variation found to be identical at all pH


has been modeled through the regression of the relevant data taken from
131

Graph no.4.10.4, and the resultant models are presented as C=10.77+1.720t-0.0188t2,

C=-10.66+1.846t-0.0213t2

and

C=-

10.65+1.840t-0.0212t2 for pH values of 4.5,5.5,6.5 respectively yielding


correlation coefficients of 0.9450, 0.9252 and 0.9258.
GRAPH 4.10.4
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT DIFFERENT pH AT 70C

32
30
28
26
24
22
SUGAR CONC(BRIX) 20
18
pH 4.5

pH 5.5

pH 6.5

16
14
12
6h
rs
12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
52
hr
s
60
hr
s
66
hr
s

10

TIME

4.2.2.4 DISCUSSION
132

The results of this study show that for the activity of Glucoamylase
to carry out saccharification, pH 5.5 was found to be optimum for all the
3 grains: sorghum, rice and maize. The activities at pH values of 4.5,5.5
and 6.5 are not very different from each other. For sorghum, 29.5,30.5
and 29 were the Brix values obtained at pH 4.5,5.5 and 6.5 respectively at
optimum temperature 600C. As in liquefaction pH values above 5.5 are
not suitable for the activity of the enzyme. Rice saccharification yields
sugar concentration values of 22, 24 and 22 at pH 4.5,5.5 and 6.5
respectively at temperature optima of 600C.
The best results were very evidently found at 5.5 pH. Similarly, at
the different pH 4.5, 5.5 and 6.5 for, maize 29.5, 29, 29 sugar
concentration values were found at 600C. As found for liquefaction, a
slightly higher pH is detrimental for the activity of the enzyme on maize.
Care must be taken to maintain the pH of the starch cereal slurry at
around 5.5.
In this study, pH value of 5.5 has been found to best. The pH optima
found is higher than reported by workers earlier. A possible reason for
this difference in result could be the use of open wide mouthed vessels in
the experiment. The use of these bottles with constant agitation led to
some amount of evaporation from the vessels (Although, the water level
in the vessels was constantly maintained). This could be a very strong
133

reason for the starch slurry to have become more alkaline. The enzyme
thus gave better results at pH 5.5. The use of commercial grade enzyme
could also have lead to the variation of difference in pH between the
previously conducted studies by various scientists and the experiments of
this study.
Besides this the water used in making the starch slurry is simple tap
water. The interaction with some free ions in the water with the enzyme
or enzyme substrate complex could be a plausible reason for this rise in
pH of the enzyme activity. Commercially, this is an advantageous
achievement since in this study the optimum pH for both processes
liquefaction

and

saccharification

(enzymes

Amylase

and

Glucoamylase) was found to be same pH 5.5. This is of economic


importance since no adjustment of the system would be needed from the
liquifaction to the saccharification stage. Besides this, similar working pH
for both the processes would eliminate the probability of any microbial
contamination.

4.2.3 EFFECT OF TIME PERIOD

134

There is no direct relationship between the activity of any enzyme


and time required for the activity to begin or end. The amount of time
required to complete an enzymatic process depends on the amount of
enzyme and substrate present .In case of the presence of a hard covering
or any sort of inhibitory material present around the substrate there is
delay in the interaction of the enzyme with the substrate. In such cases
certain amount of time is required for penetration of the enzyme till the
substrate for initiation of the enzymatic activity.
In this study the activity of the enzyme apparently peaks after 30 to 40
hours of incubation of the cereal.
However, some reports indicate of lesser time for the optimum activity
of Glucoamylase on starch. A plausible reason could be the use of whole
grain (in the present study) instead of pure starch. There is thus resistance
offered by the outer layers of the grain surrounding the mesocarp region
of the grain where starch is stored in the cereal. The softening or
breakdown of tissue for total penetration of the enzyme into the grain
requires around 30 to 40 hours for enzyme grain interaction. . Further,
about 30 hours is also the time requirement for acclimatization of the
enzyme and the formation of an effective concentration gradient of the
enzyme in the cereal starch slurry .In this study results were obtained in
50 to 60 hours. The results have been tabulated in Table no.4.8,4.9and
135

4.10 and represented in Graphs 4.8, 4.9and 4.10 for sorghum, rice and
maize respectively

4.2.3.1 SORGHUM
This variation found to be identical in nature at all temperatures has
been modelled through the regression of the relevant data taken from
Graph 4.11.1 At pH4.5, the resultant equations are presented as
C=0.02+0.740t-0.0074t2,
0.0060t2,

C=-0.02+0.704t-0.0060t2,

=-0.01+0.700t-0.0057t2,

0.11+0.757t-0.0061t2,

C=0.01+0.704t-

C=-0.02+0.701t-0.0056t2,

C=-0.11+0.757t-0.0061t2,

C=-

C=-0.11+0.758t-

0.0061t2, C=-0.14+0.773t-0.0063t2, C=-0.18+0.782t-0.0061t2 and C=0.18+0.782t-0.0061t2 manifesting correlation coefficients of 0.9693,


0.9793, 0.9793, 0.9826, 0.98307, 0.9796, 0.9796, 0.9795, 0.9780, 0.9754
and 0.9754 respectively in respect of 6, 12, 18, 24, 30, 36, 42, 48, 54, 60
and 66hrs time respectively.

136

GRAPH 4.11.1
VARIATION OF SUGAR CONCENTRATION WITH RESPECT
TO TEMPERATURE WITH INCREASE IN TIME PERIOD AT pH
4.5

32
30
28
26

6hrs

12hrs 24

18hrs

24hrs

30hrs

36hrs

42hrs

48hrs

22
SUGAR CONC(BRIX)

20
18
16

52hrs

60hrs

14

66hrs

12
10
40c

50c

60c
TEMPERATURE

137

70c

The variation found to be identical in nature at all temperatures at


pH 5.5 similarly has been modeled through the regression of the relevant
data taken from Graph 4.11.2.
The resultant equations are presented as C=0.02+0.740t-0.0074t2,
C=-0.04+0.723t-0.0061t2,
0.0064t2,

C=-0.13+0.766t-0.0064t2,

0.19+0.794t-0.0065t2,
0.0069t2,

C=-0.07+0.749t-0.0064t2,

=-0.09+0.757t-

C=-0.02+0.580t-0.0020t2,

C=-0.21+0.809t-0.0067t2,

C=-0.23+0.828t-0.0068t2

and

C=-

C=-0.23+0.828t-

C=-0.23+0.828t-0.0068t2

manifesting correlation coefficients of 0.9969, 0.9786, 0.9774, 0.9770,


0.9761, 0.9977, 0.9718, 0.9706, 0.9692, 0.9687 and 0.9687 respectively
in respect of 6, 12, 18, 24, 30, 36, 42, 48, 54, 60 and 66hrs time
respectively.

138

GRAPH 4.11.2
VARIATION OF SUGAR CONCENTRATION WITH RESPECT
TO TEMPERATURE WITH INCREASE IN TIME PERIOD AT pH
5.5

32
30
28
26
6hrs

12hrs

24
18hrs

24hrs

30hrs

36hrs

42hrs

48hrs

22
SUGAR CONC(BRIX) 20
18
16
52hrs

60hrs

14
66hrs
12
10
40c

50c

60c

70c

TEMPERATURE

Likewise at pH 6.5 this variation found to be identical in nature at


all temperatures modeled through the regression of the relevant data taken
from Graph 4.11.3. Yield The resultant equations are presented as
C=0.02+0.740t-0.0074t2,

C=0.05+0.683t-0.0059t2,

139

C=0.03+0.683t-

0.0059t2,

=0.00+0.681t-0.0054t2,

0.07+0.706t-0.0050t2,

C=-0.03+0.689t-0.0054t2,

C=-0.07+0.706t-0.005t2,

C=-

C=-0.07+0.707t-

0.0056t2, C=-0.10+0.719t-0.0054t2, C=-0.12+0.727t-0.0055t2 and C=0.12+0.727t-0.0055t2 manifesting correlation coefficients of 0.9690,


0.9765, 0.9772, 0.9808, 0.9830, 0.9822, 0.9822, 0.9818, 0.9801, 0.9786
and 0.9786 respectively in respect of 6, 12, 18, 24, 30, 36, 42, 48, 54, 60
and 66hrs time respectively
GRAPH 4.11.3
VARIATION OF SUGAR CONCENTRATION WITH RESPECT
TO TEMPERATURE WITH INCREASE IN TIME PERIOD AT pH
6.5

35
30
25
6hrs

12hrs

18hrs

24hrs

30hrs

36hrs

42hrs

48hrs

20
SUGAR CONC(BRIX)

15
10

52hrs

60hrs

66hrs

5
0
40c

50c
TEMPERATURE

140

60c

70c

4.2.3.2 RICE
This variation found to be identical in nature at all temperatures has
been modeled through the regression of the relevant data taken from
Graph 4.12.1. At pH4.5, the resultant equations are presented as
C=0.14+0.629t-0.0064t2,
0.0066t2,

C=0.08+0.650t-0.0064t2,

C=0.06+0.649t-0.0062t2,
0.0057t2

C=0.14+0.629t-0.0064t2,

and

C=0.07+0.648t-0.0062t2,

C=0.03+0.641t-0.0057t2,

C=0.02+0.642t-0.0057t2

C=0.08+0.660t-

C=0.02+0.642t-

manifesting

correlation

coefficients of 0.9500, 0.9500, 0.9553, 0.9591, 0.9624 0.9635, 0.9664,


0.9656 and 0.9656 respectively in respect of 6, 12, 18, 24, 30, 36, 42, 48
and 54hrs time respectively.

141

GRAPH 4.12.1
VARIATION OF SUGAR CONCENTRATION WITH RESPECT
TO TEMPERATURE WITH INCREASE IN TIME PERIOD AT pH
4.5

26
24
22
6hrs

12hrs

SUGAR CONC(BRIX)

20 18hrs

24hrs

30hrs

36hrs

42hrs

48hrs

52hrs

18
16
14

60hrs

12
10
40c

50c

60c

70c

TEMPERATURE

The variation found to be identical in nature at all temperatures at


pH 5.5 similarly has been modeled through the regression of the relevant
data taken from Graph 4.12.2.

142

The resultant equations are presented as C=0.14+0.629t-0.0064t2,


C=0.09+0.640t-0.0062t2,
0.0061t2,

C=0.08+0.641t-0.0061t2,

C=0.07+0.641t-0.0061t2,

C=0.07+0.641t-

C=0.04+0.650t-0.0061t2,

C=0.01+0.651t-0.0059t2, C=-0.02+0.660t-0.0058t2 and C=-0.02+0.660t0.0058t2 manifesting correlation coefficients of 0.9500, 0.9618, 0.9626,
0.9637, 0.9637, 0.9642, 0.9627, 0.9590 and 0.9590 respectively in
respect of 6, 12, 18, 24, 30, 36, 42, 48 and 54hrs time respectively.

143

GRAPH 4.12.2
VARIATION OF SUGAR CONCENTRATION WITH RESPECT
TO TEMPERATURE WITH INCREASE IN TIME PERIOD AT pH
5.5

26
24
22
6hrs

12hrs

18hrs
20

SUGAR CONC(BRIX)

24hrs

30hrs

36hrs

42hrs

48hrs

18
16
14

52hrs

60hrs

12
10
40c

50c

60c

70c

TEMPERATUTE

Likewise at pH 6.5 this variation found to be identical in nature at


all temperatures modeled through the regression of the relevant data taken
from Graph 4.12.3.yield The resultant equations are presented as
C=0.14+0.629t-0.0064t2,

C=0.10+0.638t-0.0063t2,

144

C=0.10+0.638t-

0.0063t2,

C=0.08+0.634t-0.0063t2,

C=0.05+0.652t-0.0062t2,
0.0059t2

and

C=0.07+0.646t-0.0063t2,

C=0.02+0.661t-0.0062t2,

C=0.01+0.015t-0.0059t2

C=0.01+0.015t-

manifesting

correlation

coefficients of 0.9500, 0.9560, 0.9566, 0.9579, 0.9577, 0.9613, 0.9607,


0.9627 and 0.9627 respectively in respect of 6, 12, 18, 24, 30, 36, 42, 48
and 54hrs time respectively

145

GRAPH 4.12.3
VARIATION OF SUGAR CONCENTRATION WITH RESPECT
TO TEMPERATURE WITH INCREASE IN TIME PERIOD AT pH
6.5

26
24
22
6hrs

12hrs

SUGAR CONC(BRIX)

18hrs
20

24hrs

30hrs

36hrs

42hrs

48hrs

18
16
14

52hrs

60hrs

12
10
40c

50c

60c

70c

TEMPERATURE

4.2.3.3 MAIZE
This variation found to be identical in nature at all temperatures has been
modeled through the regression of the relevant data taken from Graph
4.13.1, 4.13.2 and 4.13.3.At pH4.5 (Graph 4.13.1), the resultant
equations are presented as C=0.10+0.665t-0.0065t2, C=0.06+0.651t146

0.0056t2,

C=0.05+0.652t-0.0055t2,

C=0.02+0.644t-0.0049t2,
0.0043t2,

C=-0.01+0.635t-0.0043t2,

C=-0.04+0.627t-0.0037t2,

0.13+0.642t-0.0031t2

C=0.04+0.648t-0.0052t2,

and

C=-0.01+0.635t-

C=-0.08+0.637t-0.0035t2,

C=-0.13+0.642t-0.0031t2

C=-

manifesting

correlation coefficients of 0.9622, 0.9768, 0.9783, 0.9818, 0.9844,


0.9881, 0.9881, 0.9900, 0.9887 0.9876 and 0.9876 respectively in respect
of 6, 12, 18, 24, 30, 36, 42, 48, 54, 60 and 66hrs time respectively

147

GRAPH 4.13.1
VARIATION OF SUGAR CONCENTRATION WITH RESPECT
TO TEMPERATURE WITH INCREASE IN TIME PERIOD AT pH
4.5

32
30
28
26
6hrs

12hrs

24 18hrs

24hrs

30hrs

36hrs

42hrs

48hrs

52hrs

22
SUGAR CONC(BRIX)

20
18
16

60hrs

66hrs

14
12
10
40c

50c

60c

70c

TEMPERATURE

The variation found to be identical in nature at all temperatures at


pH 5.5 similarly has been modeled through the regression of the relevant
data taken from Graph 4.13.2

148

The resultant equations are presented as C=0.10+0.665t-0.0065t2,


C=0.07+0.619t-0.0048t2,
0.0040t2,

C=0.05+0.596t-0.0040t2,

C=0.04+0.570t-0.0032t2,
0.0032t2,

C=0.08+0.600t-0.0043t2,

C=0.04+0.570t-0.0032t2,

C=0.01+0.590t-0.0032t2,

C=-0.08+0.636t-0.0036t2

and

C=0.06+0.596t-

C=-0.02+0.598t-

C=-0.08+0.636t-0.0036t2

manifesting correlation coefficients of 0.9622, 0.9830, 0.9863, 0.9886,


0.9889, 0.9923, 0.9923, 0.9925, 0.9908, 0.9885 and 0.9885 respectively
in respect of 6, 12, 18, 24, 30, 36, 42, 48, 54, 60 and 66hrs time
respectively.

149

GRAPH 4.13.2

VARIATION OF SUGAR CONCENTRATION WITH RESPECT


TO TEMPERATURE WITH INCREASE IN TIME PERIOD AT pH
5.5

150

32
30
28
26
6hrs

12hrs

24 18hrs

24hrs

30hrs

36hrs

42hrs

48hrs

52hrs

22
SUGAR CONC(BRIX)

20
18
16

60hrs

66hrs

14
12
10
40c

50c

60c
TEMPERATURE

151

70c

Likewise at pH 6.5 this variation found to be identical in nature at


all temperatures modeled through the regression of the relevant data taken
from Graph 4.13.3 yield The resultant equations are presented as
C=0.10+0.665t-0.0065t2,
0.0043t2,

C=0.07+0.619t-0.0048t2,

C=0.07+0.591t-0.0041t2,

C=0.04+0.573t-0.0032t2,

C=0.08+0.600t-

C=0.05+0.596t-0.0040t2,

C=0.04+0.573t-0.0032t2,

C=0.01+0.590t-

0.0032t2, C=-0.02+0.598t-0.0032t2, C=-0.08+0.636t-0.0036t2 and C=0.08+0.636t-0.0036t2 manifesting correlation coefficients of 0.9622,


0.9830, 0.9863, 0.9877, 0.9889, 0.9923, 0.9923, 0.9925, 0.9908, 0.9885
and 0.9885 respectively in respect of 6, 12, 18, 24, 30, 36, 42, 48, 54, 60
and 66hrs time respectively

152

GRAPH 4.13.3

VARIATION OF SUGAR CONCENTRATION WITH RESPECT


TO TEMPERATURE WITH INCREASE IN TIME PERIOD AT pH
6.5

32
30
28
26
6hrs

12hrs

24 18hrs

24hrs

30hrs

36hrs

42hrs

48hrs

52hrs

22
SUGAR CONC(BRIX)

20
18
16

60hrs

66hrs

14
12
10
40c

50c

60c
TEMPERATURE

4.2.3.4 DISCUSSION

153

70c

The basic deviation in this study has been the change in the
raw material. For production of glucose syrup everywhere starch is first
extracted from the grain and then subjected to liquefaction and
saccharification. Here, grains have been used as raw material (without
extracting starch from them) to obtained liquid glucose by enzymatic
hydrolysis of the starch present in them. The time period required for
production of glucose from starch in this study is 24-36 hrs more than
what has been reported in the starch to glucose conversion processes
earlier. The total time required for saccharification is 60 hours for maize
and sorghum. For rice, the results were obtained in 48 hours. This
deviation in the total time required for starch saccharification is because
of the difference in raw material from the traditional processes.
The maximum values of sugar concentration obtained at optimum
pH 5.5 and temperature 600C were 29, 24 and 29 for sorghum, rice and
maize respectively. The sugar concentration becomes steady after 60, 60
and 48 hours in sorghum, maize and rice respectively. This variation of
time period could probably be due to the differences in the time required
for penetration of the enzyme into the grain. This is in accordance with
the basic anatomy of each grain. The sorghum and maize grains used for
this study have an extremely hard outer covering which needs more time
154

for penetration of the enzyme within the grain by softening of the outer
texture. In sharp contrast, the broken rice pieces from the rice mills have
no outer covering of any tissue on the grain and are basically only the
endosperm. Thus the time required for interaction of the enzyme with the
starch within the grain varies. Hence the time required for
saccharification of each whole grain varies
It becomes uneconomical to carry out the process beyond 60, 48 and
60 hours for sorghum, rice and maize respectively since the values of
sugar concentration do not show any changes beyond these time periods.
This could be because of two reasons first, the amount of the enzyme is
insufficient to carry out the total reduction of the starch slurry or that total
saccharification of the present starch in the slurry was done. The reason
could also be both. Besides, this production of reversion products, if the
process is carried out further could diminish the amount of sugar
concentration achieved for each cereal starch slurry. Thus, it is
uneconomical to carry out the process beyond 50 to 60 hrs.

4.2.4 EFFECT OF INCREASE IN ENZYME CONCENTRATION


There was found to be an increase in the saccharification of the starch
in all the three starch slurries with addition of enzyme. This resulted in
155

increase in the sugar concentration obtained. . In 1975, Reed had reported


that for most enzymatic reactions the speed of the reaction is proportional
to the concentration of the enzyme. This is possibly because either the
amount of enzyme used is insufficient to carry out the total reduction or
because already there has been total saccharification of the grain or both.
Ayenor, 2002, also found that increase in the concentration of enzyme
increases the level of sugar concentration in the system. This is in
corroboration with the first reasoning. Tuker, 1991, reported reduction in
activity of enzyme due to limitation of reaction mixture, which becomes
saturated at higher concentration or inhibition by products. This supports
the second possible reason for both stationary and diminishing values of
sugar in the experiment. It is hypothesized that in this study, the substrate
was totally and optimally used. Therefore, the enzyme required for total
saccharification is more than what is used in the experiments. Additional
cost of enzyme would make the process uneconomical unless
immobilization techniques are used.

156

2.2.4.1 SORGHUM
The variations of change in sugar concentration with increase in
time period at 60C with increase in enzyme concentration has been
modeled at different pH values (Table 4.8)
TABLE NO. 4.8 (1, 2, 3)
SACCHARIFICATION-SORGHUM
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT 60C ON INCREASING THE ENZYME
CONCENTRATION AT DIFFERENT pH VALUES.

1. pH-4.5

Enzyme
conc.

6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs 54hrs 60hrs

140l\ml

10

10

12

20

20

25

25

26

28

28

150l\ml

11

11

15

20

24

28

32

30

29

29

157

160l\ml

14

14

16

22

27

30

35

34

30

30

2. pH-5.5

Enzyme
conc.

6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs 54hrs 60hrs

140l\ml

10

12

12

20

20

24

25

32

27

27

150l\ml

11

13

14

22

24

28

27

34

27

28

160l\ml

12

14

16

24

28

32

30

36

27

28

3. pH-6.5

158

Enzyme
conc.

6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs 54hrs 60hrs

140l\ml

11

20

24

30

24

28

27

27

150l\ml

10

10

12

21

25

31

30

32

27

27

160l\ml

11

11

15

23

28

35

36

34

28

27

At pH 4.5 (Graph 4.14.1), the resultant equations are presented as


C=-9.70+1.570t-0.0164t2,

C=-5.34+1.493t-0.0156t2,

and

C=-

10.91+2.020t-0.0228t2, manifesting correlation coefficients of 0.9810,


0.9749, and 0.9664 respectively in respect of 140l/g, 150l/g and
160l/g enzyme concentration respectively.

GRAPH 4.14.1
INCREASE IN SUGAR CONCENTRATION WITH INCREASE IN
ENZYME

CONCENTRATION

INTERVALS (TEMP. 60C, pH 4.5)

159

AT

DIFFERENT

TIME

38
36
34
32
30
28
26
24
SUGAR CONC.(BRIX)

22

140ul\ml

150ul\ml

20

160ul\ml

18
16
14
12

s
60

hr

s
hr
54

s
hr
48

s
hr
42

s
36

hr

s
30

hr

s
24

hr

s
hr
18

s
hr
12

6h

rs

10

TIME

At pH5.5 (Graph 4.14.2), the resultant equations are presented as


C=-9.73+1.619t-0.0171t2,

C=-7.96+1.688t-0.0186t2,

and

C=-

5.57+1.696t-0.082t2, manifesting correlation coefficients of 0.9770,


0.9601, and 0.9685 respectively in respect of 140l/g, 150l/g and
160l/g enzyme concentration respectively.

160

GRAPH 4.14.2
INCREASE IN SUGAR CONCENTRATION WITH INCREASE IN
ENZYME

CONCENTRATION

AT

DIFFERENT

TIME

SUGAR CONC.(BRIX)

22

26

30

34

38

INTERVALS (TEMP. 60C, pH 5.5)

150ul\ml

160ul\ml

6h 10
rs
12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
54
hr
s
60
hr
s

14

18

140ul\ml

TIME

GRAPH 4.14.3
SORGHUM
INCREASE IN SUGAR CONCENTRATION WITH INCREASE IN
ENZYME

CONCENTRATION

INTERVALS (TEMP. 60C, pH 6.5)

161

AT

DIFFERENT

TIME

36
32
28
24

150ul\ml

160ul\ml

6h 8
rs
12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
54
hr
s
60
hr
s

12

16

140ul\ml

20

SUGAR CONC.(BRIX)

TIME

Similarly, the resultant equations C=1+0.995t-0.0093t2,


C=3.70+0.954t-0.0089t2,

and

C=7.83+0.918t-0.0090t2,

manifesting

correlation coefficients of 0.9716, 0.9675, and 0.9559 respectively in


respect of 140l/g, 150l/g and 160l/g enzyme concentration
respectively, at pH 6.5. (Graph 4.14.3)

162

4.2.4.2 RICE
The variations of change in sugar concentration with increase in
time period at 60C with increase in enzyme concentration has been
modeled at different pH values (Table 4.9).
TABLE NO. 4.9(TABLE 1, 2, 3)
SACCHARIFICATION-RICE
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT 60C ON INCREASING THE ENZYME
CONCENTRATION AT DIFFERENT pH VALUES.

1. pH-4.5

Enzyme conc. 6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs
105l\ml

10

14

12

15

15

17

19

18

115l\ml

11

15.5

13.5

17

16

19

21

20

125l\ml

12.5 15

14

18

19

23

24

22

163

2. pH-5.5

Enzyme conc. 6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs
105l\ml

12

15.5

16.5

16

17

17

16.5

17.5

115l\ml

13

16

17

18

19

20

18

21

125l\ml

14

16

18

18

19

20

21

22

3. pH-6.5

Enzyme conc. 6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs
105l\ml

11.5 12

12.5

14

15

17.5

17.5

18

115l\ml

14

16

15

18

17

20

18

21

125l\ml

12

16.5

16

20

19

21

22

22.5

At pH4.5 (Graph 4.15.1), the resultant equations are presented as


C=3.10+0.733t-0.0090t2, C=3.44+0.813t-0.0100t2, and C=3.25+0.909t0.0106t2, manifesting correlation coefficients of 0.9535, 0.9530, and
164

0.9617 respectively in respect of 105l/g, 115l/g and 125l/g enzyme


concentration respectively.

GRAPH 4.15.1
INCREASE IN SUGAR CONCENTRATION WITH INCREASE IN
ENZYME

CONCENTRATION

AT

DIFFERENT

TIME

INTERVALS (TEMP. 60C, pH 4.5)

26
24
22
20
SUGAR CONC.(BRIX)
105ul\ml

18
16

115ul\ml

125ul\ml

14
12
10
6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs
TIME

165

At pH5.5 (Graph 4.15.2), the resultant equations are presented as


C=3.78+0.905t-0.0138t2, C=3.92+0.959t-0.017t2, and C=4.38+0.928t0.0125t2, manifesting correlation coefficients of 0.9220, 0.9360, and
0.9417 respectively in respect of 105l/g, 115l/g and 125l/g enzyme
concentration respectively.

GRAPH 4.15.2
INCREASE IN SUGAR CONCENTRATION WITH INCREASE IN
ENZYME

CONCENTRATION

INTERVALS (TEMP. 60C, pH 5.5)

166

AT

DIFFERENT

TIME

26
24
22
20
18

SUGAR CONC.(BRIX)
105ul\ml

16

115ul\ml

125ul\ml

14
12
10
6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs
TIME

Similarly,

the

resultant

C=4.54+0.843t-0.0114t2,

and

equations

C=3.42+0.686t-0.0083t2,

C=3.44+0.983t-0.0128t2,

manifesting

correlation coefficients of 0.9523, 0.9354, and 0.9523 respectively in


respect of 105l/g, 115l/g and 125l/g enzyme concentration
respectively at pH 6.5. (Graph 4.15.3)
GRAPH 4.15.3
INCREASE IN SUGAR CONCENTRATION WITH INCREASE IN
ENZYME

CONCENTRATION

INTERVALS (TEMP. 60C, pH 6.5)

167

AT

DIFFERENT

TIME

26
24
22
20
SUGAR CONC.(BRIX)
105ul\ml

18
16

115ul\ml

125ul\ml

14
12
10
6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs
TIME

4.2.4.3 MAIZE
The variations of change in sugar concentration with increase in
time period at 60C with increase in enzyme concentration has been
modeled at different pH values (Table 4.10).
TABLE NO. 4.10 (1, 2, 3)
SACCHARIFICATION-MAIZE
CHANGE IN SUGAR CONCENTRATION WITH INCREASE IN
TIME PERIOD AT 60C ON INCREASING THE ENZYME
CONCENTRATION AT DIFFERENT pH VALUES.

168

1. pH-4.5

Enzyme
conc.

6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs 54hrs 60hrs

175l\ml

16

14

20

20

22

19

23

26

27

23

185l\ml

18

16

18

15

17

17

21.5 28

25

21.5

195l\ml

19

17

14.5 19.5 28

24

20

30

20

30

2. pH-5.5

Enzyme
conc.

6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs 54hrs 60hrs

175l\ml

14

14

15

17

19

19

22

28

24

25

185l\ml

18

16

17

21

23

22

24

24

26

27

195l\ml

17

17

19

15

17

13

27

20

25

23

169

3. pH-6.5

Enzyme
conc.

6hrs 12hrs 18hrs 24hrs 30hrs 36hrs 42hrs 48hrs 54hrs 60hrs

175l\ml

15

15

16

15

15.5 17.5 19.5 21.5 21.5 23.5

185l\ml

15

17

14

17

17.5 18.5 34

23

24

36

195l\ml

16

18

12

21

22

25

27

30

24

23

At pH 4.5 (Graph 4.16.1), the resultant equations are presented as


C=-33.62+3.262t-0.0409t2,

C=-43.11+3.747t-0.0470t2,

and

C=-

33.35+3.393t-0.0434t2, manifesting correlation coefficients of 0.9434,


0.9344, and 0.9247 respectively in respect of 175l/g, 185l/g and
195l/g enzyme concentration respectively.
GRAPH 4.16.1
INCREASE IN SUGAR CONCENTRATION WITH INCREASE IN
ENZYME

CONCENTRATION

INTERVALS (TEMP. 60C, pH 4.5)

170

AT

DIFFERENT

TIME

185ul\ml

195ul\ml

12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
54
hr
s
60
hr
s

6h
rs

32
30
28
26
24
22
20
SUGAR CONC.(BRIX)
175ul\ml 18
16
14
12
10

TIME

At pH5.5 (Graph 4.16.2), the resultant equations are presented as


C=-29.30+2.830t-0.0341t2,
46.04+3.906t-0.0492t2

C=-39.57+3.672t-0.046t2,

and

C=-

manifesting correlation coefficients of 0.9618,

0.9455, and 0.9256 respectively in respect of 175l/g, 185l/g and


195l/g enzyme concentration respectively.

GRAPH 4.16.2
INCREASE IN SUGAR CONCENTRATION WITH INCREASE IN
ENZYME

CONCENTRATION

INTERVALS (TEMP. 60C, pH 5.5)

171

AT

DIFFERENT

TIME

30
28
26
24
22
20
SUGAR CONC.(BRIX) 18
175ul\ml

185ul\ml

16

195ul\ml

14
12
12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
54
hr
s
60
hr
s

6h
rs

10

TIME

Similarly, the resultant equations C=-39.35+3.394t-0.0423t2, C=38.96+3.72t-0.0394t2,

and

C=-36.91+3.304t-0.0414t2,

manifesting

correlation coefficients of 0.9465, 0.9579, and 0.9578 respectively in


respect of 175l/g, 185l/g and 195l/g enzyme concentration
respectively. At pH 6.5 (Graph 4.16.3).

GRAPH 4.16.3
INCREASE IN SUGAR CONCENTRATION WITH INCREASE IN
ENZYME

CONCENTRATION

INTERVALS (TEMP. 60C, pH 6.5)


172

AT

DIFFERENT

TIME

38
34
30
26
22

185ul\ml

195ul\ml

12
hr
s
18
hr
s
24
hr
s
30
hr
s
36
hr
s
42
hr
s
48
hr
s
54
hr
s
60
hr
s

6h 10
rs

14

18

SUGAR CONC.(BRIX)
175ul\ml

TIME

4.2.4.4 DISCUSSION
As shown in table (4.8) and graph (4.14.1,2,3) irrespective of the
pH there was trend of increase in enzyme concentration. At optimum pH
5.5 on enzyme dosage of 140l/ml, 150l/ml and 160l/ml sugar
concentration values of 32, 34 and 36 were obtained for sorghum..
Irrespective of the pH there was trend of increase in enzyme
concentration as shown in table (4.9) and graph (4.15.1,2,3). At optimum
pH 5.5 on enzyme dosage of 105l/ml, 115l/ml and 125l/ml sugar
concentration values of 17.5, 21 and 22 were obtained for rice.

173

For maize, there was trend of increase in enzyme concentration


irrespective of the pH as shown in table (4.10) and graph (4.16.1,2,3). At
optimum pH 5.5 on enzyme dosage of 175l/ml, 185l/ml and 195l/ml
sugar concentration values of 25, 27 and 28 were obtained.
In accordance with the amount of enzyme added there was a
steady increase in the sugar concentration in sorghum, rice and maize.
This is in accordance with the hypothesis that there is an increase in
product till the enzyme or their product inhibition consumes the entire
substrate. The differences in results obtained for sorgum, rice and maize
are because of different amount of substrates taken for each set of
experiments due to certain experimental limitations.
Immobilization of the enzyme was also tried to conserve the
enzyme and for optimal utilization of the enzyme. However, though
positive results were obtained they have not been optimized in this study.

4.2.5 VISCOSITY MEASUREMENT


Viscosity is the measure of the internal friction of a fluid caused by
molecular attraction, which makes it resist a tendency to flow. Higher
viscous fluid therefore require more force to move than less viscous
materials
174

The viscosity of the starch slurry of the sorghum, rice and maize
cereals have been observed in this study. Glucoamylase gelatinized the
starch slurry of the cereals and the effect on viscosity of the slurry by
changing shear rate was studied in the time-coursed manner. Beside this,
the effect of increased enzyme in the system on viscosity was also
studied.

4.2.5.1. EFFECT OF TEMPERATURE


It has been seen that the granular structure of the cereal grain
changes with rise in temperature. At 60C there is a slight change in the
appearance of the grain. As the temperature increases the intra and inter
hydrogen bonds in the cereal grain water dispersion are weakened. The
viscosity is found to increase sharply after 60C. There is breakdown of
chemical structure within the cereal grain. Beside this, due to loosening
of the bonds of the granules with water the grain dispersion changes into
slurry. It has been reported that grains which imbibe water and swell at a
lower temperature are less viscous than grains, which have a thick outer
covering. When the grain swell at a low temperature the change in fluid
characteristic i.e., from dispersion to slurry is faster. In case of grains,
which have a thick outer covering, higher temperature is required for
175

breakdown of the outer layers.The rate at which the temperature


increased in the system determined the rates of increase in viscosity. Both
are directly proportional to each other. The effect of temperature on
viscosity has not been studied directly in this thesis. However, 60C was
found to be best temperature for activity of Glucoamylase enzyme used
for gelatinisation. All viscosity studies were done at 60C temperature.

4.2.5.2 EFFECT OF pH
Viscosity studies were done on saccharification of grain no direct
relationship of viscosity and pH was found for all the three starch slurry
pastes. pH was not found to effect the fluid characteristics. In this study
viscosity was measured at three different pH values of 4.5, 5.5 and 6.5 A
comparison was made on the effect of pH of the starch slurry at different
enzyme concentrations. The starch slurry was subjected to different
agitation speeds also and the effect of in the system was studied. The
viscosity values obtained for different enzyme concentrations at optimum
stress rate of 50 rpm for different time intervals have been tabulated in
Table no.4.11-4.19.

176

4.2.5.2.1 SORGHUM
At addition of 140l/g of enzyme at a constant agitator speed of 50
rpm at 60 hrs. The values of 3000, 4000, 4000 cP for viscosity were
obtained at pH 4.5, 5.5, and 6.5 respectively. At a concentration of
150l/g of enzyme (agitator speed 50rpm, 60 hrs) at pH 4.5, 5.5 and 6.5
the viscosity values obtained were 4000, 4500 and 5000cP respectively
Similarly, on increasing the pH from 4.5 to 5.5 and 6.5 the viscosity
values obtained were, 4500, 5000 and 5500cP respectively at enzyme
concentration of 160l/g and agitator speed 50rpm. Variations have been
studied by table no.4.11, 4.12 and 4.13.

TABLE NO. 4.11 (1, 2, 3)


SORGHUM (pH- 4.5)
EFFECT

OF

INCREASE

IN

AGITATOR

SPEED

WITH

INCREASE IN TIME PERIOD AT DIFFERENT ENZYME


CONCENTRATION
177

1. 140l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

1000

1500

2000

2500

20rpm

500

500

1000

1750

2500

2500

50rpm

500

500

1500

2000

3500

3000

100rpm

500

1000

1500

2000

3000

3000

2. 150l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

1000

1500

2000

2000

20rpm

500

1000

1000

1750

2000

2500

50rpm

1000

1000

1500

2000

4000

4000

100rpm

1000

1000

2000

2000

3500

3000

178

3. 160l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

1000

1000

2000

2000

20rpm

500

500

1000

1500

2500

2500

50rpm

1000

1500

2000

2500

3500

4500

100rpm

1000

2000

2500

2500

3500

4000

IN

AGITATOR

TABLE NO.4.12 (1, 2, 3)


SORGHUM (pH- 5.5)
EFFECT

OF

INCREASE

SPEED

WITH

INCREASE IN TIME PERIOD AT DIFFERENT ENZYME


CONCENTRATION

179

1. 140l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

1000

1000

1000

2000

2000

20rpm

500

1000

1000

1500

2500

2500

50rpm

500

1500

1500

2000

3750

4000

100rpm

500

1500

1500

2000

3500

3500

2. 150l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

1000

1500

1500

2500

20rpm

500

500

1000

1500

2000

2500

50rpm

500

500

1500

2500

4500

4500

100rpm

500

1000

1500

2500

3500

3500

180

3. 160l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

500

500

2500

2500

20rpm

500

500

1000

1500

2000

2500

50rpm

500

1500

1500

2500

5000

5000

100rpm

500

1000

1000

2500

4000

4000

IN

AGITATOR

TABLE NO. 4.13 (1, 2, 3)


SORGHUM (pH- 6.5)
EFFECT

OF

INCREASE

SPEED

WITH

INCREASE IN TIME PERIOD AT DIFFERENT ENZYME


CONCENTRATION
181

1. 140l/

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10

500

500

1000

1500

1500

2500

20

500

500

1000

2000

2500

2500

50

500

500

1000

2500

4500

4000

100

500

1000

1000

2500

3500

3500

2. 150l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10

150l/g 500

500

1000

2000

2000

2000

20

500

500

500

1500

2500

3000

50

500

1000

1500

2500

5000

5000

100

500

1000

1500

2500

5000

4500

182

3. 160l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10

500

500

1000

1500

2000

2000

20

500

500

1000

1000

1500

2500

50

500

1500

1500

3000

3500

5500

100

500

1500

1500

3000

4500

5500

4.2.5.2.2 RICE
On addition of 45l/g of enzyme at a constant agitator speed of 50
rpm. The values of 3000, 4000, 4000 cP for viscosity were obtained at pH
4.5, 5.5, and 6.5 respectively. At a concentration of 55l/g of enzyme
(agitator speed 50rpm, 60 hrs) at pH 4.5, 5.5 and 6.5 the viscosity values
obtained were 4000, 4500 and 5500cP respectively similarly, on
increasing the pH from 4.5 to 5.5 and 6.5 the viscosity values obtained
were, 4000, 5500 and 6000cP respectively at enzyme concentration of
65l/g and agitator speed 50rpm. Variations have been studied by table
no. 4.14,4.15 and 4.16.
TABLE NO. 4.14 (1, 2, 3)
183

RICE (pH- 4.5)


EFFECT

OF

INCREASE

IN

AGITATOR

SPEED

WITH

INCREASE IN TIME PERIOD AT DIFFERENT ENZYME


CONCENTRATION
1. 45l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

1000

1500

2000

2000

20rpm

500

500

1000

2000

3000

3000

50rpm

500

500

1500

2500

3000

3000

100rpm

500

500

1000

3000

3500

3000

speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

1000

2500

2500

2000

2. 55l/g

Agitator

184

20rpm

500

500

1500

3000

2000

2500

50rpm

500

500

1500

3500

3500

4000

100rpm

500

500

1500

3500

4000

3500

speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

500

2000

2500

2000

20rpm

500

500

500

3000

3000

3500

50rpm

500

1000

1000

3000

4000

4000

100rpm

500

1000

1000

2500

3500

3500

3. 65l/g

Agitator

TABLE NO. 4.15 (1, 2, 3)


RICE (pH- 5.5)

185

EFFECT

OF

INCREASE

IN

AGITATOR

SPEED

WITH

INCREASE IN TIME PERIOD AT DIFFERENT ENZYME


CONCENTRATION

1. 45l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

1000

1500

2500

2500

20rpm

500

500

1000

2500

2500

2500

50rpm

500

1500

1500

3000

4000

4000

100rpm

500

500

1500

3500

4000

4000

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

2. 55l/g

Agitator
speed

186

10rpm

500

500

1000

1500

2000

3000

20rpm

500

500

1000

2000

2500

3000

50rpm

500

500

1500

3500

4000

4500

100rpm

500

500

2000

4000

4500

4500

speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

500

500

1000

2000

20rpm

500

500

1500

2500

3000

3000

50rpm

500

1000

1500

2500

5500

5500

100rpm

500

1000

2000

3000

4500

4000

3. 65l/g

Agitator

187

TABLE NO. 4.16


RICE (pH- 6.5)
EFFECT

OF

INCREASE

IN

AGITATOR

SPEED

WITH

INCREASE IN TIME PERIOD AT DIFFERENT ENZYME


CONCENTRATION

1. 45l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

1000

1500

2500

2500

20rpm

500

500

1500

2500

3000

3000

50rpm

500

1000

1500

3000

4000

4000

100rpm 500

1000

2000

3000

3500

3500

12hrs

24hrs

36hrs

48hrs

60hrs

2. 55l/g

Agitator 0hrs

188

speed
10rpm

500

500

1000

1500

2000

2500

20rpm

500

1000

1000

2000

2500

3000

50rpm

500

1500

2500

3500

5500

5500

100rpm 500

1500

2500

3500

4500

4500

3. 65l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

1000

1000

1500

2500

2500

20rpm

500

1000

1500

2500

3000

3000

50rpm

500

1000

3500

3500

6000

6000

100rpm 500

1500

3500

3500

5500

5000

4.2.5.2.3 MAIZE

189

On addition of 165l/g of enzyme at a constant agitator speed of 50


rpm. The values of 4000, 4000, 4000cP for viscosity were obtained at pH
4.5, 5.5, and 6.5 respectively. At a concentration of 175l/g of enzyme
(agitator speed 50rpm 60 hrs) at pH 4.5, 5.5 and 6.5 the viscosity values
obtained were 4000, 4000 and 4500cP respectively similarly, on
increasing the pH from 4.5 to 5.5 and 6.5 the viscosity values obtained
were, 4000, 4500 and 4000cP respectively at enzyme concentration of
185l/g and agitator speed 50rpm. Variations have been studied by table
no. 4.17,4.18, and 4.19.
TABLE NO. 4.17 (1, 2, 3)
MAIZE (pH- 4.5)
EFFECT

OF

INCREASE

IN

AGITATOR

SPEED

WITH

INCREASE IN TIME PERIOD AT DIFFERENT ENZYME


CONCENTRATION
1. 165l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

1000

3000

2100

2100

190

20rpm

1000

1500

1500

2000

2500

2500

50rpm

1500

1500

1500

1500

4000

4000

100rpm

1500

1500

1500

1500

3000

3000

2. 175l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

500

500

2500

2500

20rpm

500

500

500

500

3000

3000

50rpm

500

500

500

500

3500

3500

100rpm

500

1000

1000

1500

3000

3000

3. 185l/g

191

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

500

1000

2000

2000

20rpm

500

500

500

1000

2500

2000

50rpm

500

500

500

2000

3000

3100

100rpm

500

500

500

1500

2500

2000

TABLE NO.4.18 (1, 2, 3)


MAIZE (pH- 5.5)
EFFECT

OF

INCREASE

IN

AGITATOR

SPEED

WITH

INCREASE IN TIME PERIOD AT DIFFERENT ENZYME


CONCENTRATION
1. 165l/g

Agitator 0hrs

12hrs

24hrs
192

36hrs

48hrs

60hrs

speed
10rpm

500

1000

2500

3000

3500

3500

20rpm

500

1500

1500

1750

3000

3500

50rpm

500

1500

1500

2000

4000

4000

100rpm 500

1000

1000

2000

2500

3000

2. 175l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

1000

2000

2000

2500

3000

20rpm

500

1500

1500

1500

3000

3500

50rpm

500

1500

2000

2000

4500

4000

100rpm 500

1000

2000

2000

3000

3000

3. 185l/g

193

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

750

1000

2000

2000

20rpm

500

1000

1000

1000

2500

2500

50rpm

500

1000

2000

2500

4500

4500

100rpm 500

1000

2000

2000

3500

3500

TABLE NO. 4.19 (1, 2, 3)


MAIZE (pH- 6.5)
EFFECT

OF

INCREASE

IN

AGITATOR

SPEED

WITH

INCREASE IN TIME PERIOD AT DIFFERENT ENZYME


CONCENTRATION
1. 165l/g

Agitator
speed

0hrs

12hrs

24hrs
194

36hrs

48hrs

60hrs

10rpm

1000

1000

1000

1000

2500

2500

20rpm

500

1000

2000

1500

2500

3000

50rpm

1000

1000

1500

2500

3500

4000

100rpm 1000

1000

1500

2000

3000

4000

2. 175l/g

Agitator
speed

0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

10rpm

500

500

500

1000

2500

2500

20rpm

500

500

1000

1500

3000

3000

50rpm

1000

1000

2000

2000

2500

4500

100rpm 1000

1000

2000

2000

3000

4000

12hrs

24hrs

36hrs

48hrs

60hrs

3. 185l/g

Agitator 0hrs

195

speed
10rpm

1000

1000

1000

1500

2500

2500

20rpm

1000

1000

1500

2000

3000

3000

50rpm

1000

1500

1500

2500

4000

4000

100rpm 1000

1500

1500

1500

3000

3000

4.2.5.2.4 DISCUSSION
Viscosity values for each grain the values remained constant or
increased slightly with increase in pH value of the system. The change in
viscosity found shows that with an increase in pH the fluid characteristics
change. Studies done for optimization of pH value for saccharification
yielded 5.5 as the optimum pH Therefore it can be clearly reasoned that
since the enzyme was works best at 5.5, values of pH below or above this
effect the process of saccharification itself. Sugar concentration values in
the starch slurry are affected. Due to presence of less sugar in the slurry,
the slurry remains thick and therefore offers more resistance flow. This
leads to increase in viscosity values at both lower and higher pH.
Therefore, since pH 5.5 is best for the optimum activity of the enzyme,

196

hence some differences can be seen in the readings. However, no effect of


pH has been reported on the viscosity properties of any fluid.

4.2.5.3 EFFECT OF TIME PERIOD


Viscosity of any fluid does not change with time. However, if there are
any changes in the fluid characteristics itself due to any reason, which
tend to thin or thicken the fluid it leads to change in viscosity. The change
in fluid properties due to increase in enzyme concentration and agitation
speeds during saccharification of each cereal grain have been studied at
different time intervals.

4.2.5.3.1 SORGHUM
At pH 4.5 and enzyme concentration 140l/g at agitator speed 50
rpm the viscosity reading changed from 2000 to 3500 & 3000cP at 36, 48
and 60 hrs respectively (Graph no.4.17.1).

197

GRAPH 4.17.1
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 4.5,
ENZYME CONCENTRATION 140L/G)

4000
3500
3000
2500
VISCOSITY (cp)
10rpm

2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

On increasing the enzyme concentration to 150l/g the reading of


viscosity were found to be 2000, 4000 & 4000cP at 36, 48 & 60hrs
respectively (Graph no.4.17.2).

198

GRAPH 4.17.2
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 4.5,
ENZYME CONCENTRATION 150L/G)

4500
4000
3500
3000
VISCOSITY(cp)
10rpm

2500
2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs
TIME

199

36hrs

48hrs

60hrs

Viscosity readings of 2000, 3000 & 3000cP were obtained at 36,


48 & 60hrs respectively, enzyme concentration 160l/g and agitator
speed 50rpm (Graph no.4.17.3).

GRAPH 4.17.3
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 4.5,
ENZYME CONCENTRATION 160L/G)

5000
4500
4000
3500
3000
VISCOSITY(cp) 2500
10rpm

2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs
TIME

200

36hrs

48hrs

60hrs

At pH 5.5 and enzyme concentration 140l/g at agitator speed 50


rpm the viscosity reading changed from 2000 to 3750 & 4000cP at 36, 48
and 60 hrs respectively (Graph no.4.18.1)

GRAPH 4.18.1
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 5.5,
ENZYME CONCENTRATION 140l/g)

4500
4000
3500
3000
VISCOSITY(cp)
10rpm

2500
2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs
TIME

201

36hrs

48hrs

60hrs

On increasing the enzyme concentration to 150l/g the reading of


viscosity were found to be 2500, 4500 & 4500cP at 36, 48 & 60hrs
respectively (Graph no.4.18.2).

GRAPH 4.18.2
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 5.5,
ENZYME CONCENTRATION 150l/g)

202

5000
4500
4000
3500
3000
VISCOSITY(cp) 2500
10rpm

20rpm

50rpm

100rpm

2000
1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

Viscosity readings of 2500, 5000 & 5000cP were obtained at 36, 48


& 60hrs respectively, enzyme concentration 160l/g and agitator speed
50rpm (Graph no.4.18.3).

GRAPH 4.18.3
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 5.5,
ENZYME CONCENTRATION 160L/G)

203

5500
5000
4500
4000
3500
VISCOSITY(cp)
10rpm

3000
2500

20rpm

50rpm

100rpm

2000
1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

At pH 6.5 and enzyme concentration 140l/g at agitator speed 50


rpm the viscosity reading changed from 2500 to 4500 & 4000cP at 36, 48
and 60 hrs respectively (Graph no.4.19.1).

GRAPH 4.19.1
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 6.5,
ENZYME CONCENTRATION 140l/g)

204

5000
4500
4000
3500
3000
VISCOSITY(cp) 2500
10rpm

20rpm

50rpm

100rpm

2000
1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

On increasing the enzyme concentration to 150l/g the reading of


viscosity were found to be 2500, 5000 & 5000cP at 36, 48 & 60hrs
respectively (Graph no 4.19.2).

GRAPH 4.19.2
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 6.5,
ENZYME CONCENTRATION 150L/G)
205

5500
5000
4500
4000
3500
VISCOSITY(cp)
10rpm

3000
2500

20rpm

50rpm

100rpm

2000
1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

Viscosity readings of 3000, 3500 & 5500cP were obtained at 36,


48 & 60hrs respectively, enzyme concentration 160l/g and agitator
speed 50rpm (Graph no.4.19.3).
GRAPH 4.19.3
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 6.5,
ENZYME CONCENTRATION 160l/g)

206

6000
5500
5000
4500
4000
3500
VISCOSITY(cp) 3000
10rpm

2500

20rpm

50rpm

100rpm

2000
1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

4.2.5.3.2 RICE
At pH 4.5 and enzyme concentration 45l/g at agitator speed
50rpm the viscosity reading changed from 2000 to 3000 & 3000cP at 36,
48 and 60 hrs respectively.
GRAPH 4.20.1
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 4.5,
ENZYME CONCENTRATION 45L/G)
207

4000
3500
3000
2500
VISCOSITY(cp)
10rpm

2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

On increasing the enzyme concentration to 55l/g the reading of


viscosity were found to be 3500, 3500 & 4000cP at 36, 48 & 60hrs
respectively (Graph no.4.20.2).

GRAPH 4.20.2
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 4.5,
ENZYME CONCENTRATION 55L/G)
208

4500
4000
3500
3000
VISCOSITY(cp)
10rpm

2500
2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

Viscosity readings of 3000, 4000 & 4000cP were obtained at 36, 48


& 60hrs respectively, enzyme concentration 65l/g and agitator speed
50rpm (Graph no 4.20.3)

GRAPH 4.20.3
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 4.5,
ENZYME CONCENTRATION 65L/G)
209

4500
4000
3500
3000
VISCOSITY(cp)
10rpm

2500
2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

At pH 5.5 and enzyme concentration 45l/g at agitator speed 50


rpm the viscosity reading changed from 3000 to 4000 & 4000cP at 36, 48
and 60 hrs respectively (Graph no.4.21.1).

GRAPH 4.21.1

210

EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY


WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 5.5,
ENZYME CONCENTRATION 45L/G)

4500
4000
3500
3000
VISCOSITY(cp)
10rpm

2500
2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

On increasing the enzyme concentration to 55l/g the reading of


viscosity were found to be 3500, 4000 & 4500cP at 36, 48 & 60hrs
respectively (Graph no.4.21.2).

211

GRAPH 4.21.2
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 5.5,
ENZYME CONCENTRATION 55L/G)

5000
4500
4000
3500
3000
VISCOSITY(cp) 2500
10rpm

2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

Viscosity readings of 2500, 5500 & 5500cP were obtained at 36,


48 & 60hrs respectively, enzyme concentration 65l/g and agitator speed
50rpm(Graph no 4.21.3).

212

GRAPH 4.21.3
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 5.5,
ENZYME CONCENTRATION 65l/g)

6000
5500
5000
4500
4000
3500
VISCOSITY(cp) 3000
10rpm

2500

20rpm

50rpm

100rpm

2000
1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

At pH 6.5 and enzyme concentration 45l/g at agitator speed 50


rpm the viscosity reading changed from 3000 to 4000 & 4000cP at 36, 48
and 60 hrs respectively (Graph no.4.22.1).

213

GRAPH 4.22.1
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 6.5,
ENZYME CONCENTRATION 45l/g)

4500
4000
3500
3000
VISCOSITY(cp)
10rpm

2500
2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

On increasing the enzyme concentration to 55l/g the reading of


viscosity were found to be 3500, 5500 & 5500cP at 36, 48 & 60hrs
respectively (Graph no.4.22.2).

214

GRAPH 4.22.2
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 6.5,
ENZYME CONCENTRATION 55L/G)

6000
5500
5000
4500
4000
3500
VISCOSITY(cp) 3000
10rpm

2500

20rpm

50rpm

100rpm

2000
1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

Viscosity readings of 3500, 6000 & 6000cP were obtained at 36, 48


& 60hrs respectively, enzyme concentration 65l/g and agitator speed
50rpm(Graph no.4.22.3).

215

GRAPH 4.22.3
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 6.5,
ENZYME CONCENTRATION 65L/G)

6500
6000
5500
5000
4500
4000
VISCOSITY(cp)
10rpm

3500
3000

20rpm

50rpm

100rpm

2500
2000
1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

4.2.5.3.3MAIZE
At pH 4.5 and enzyme concentration 165l/g at agitator speed 50
rpm the viscosity reading changed from 1500 to 4000 & 4000cP at 36, 48
and 60 hrs respectively (Graph no.4.23.1).
216

GRAPH 4.23.1
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 4.5,
ENZYME CONCENTRATION 165l/g)

4500
4000
3500
3000
VISCOSITY(cp)
10rpm

2500
2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

On increasing the enzyme concentration to 175l/g the reading of


viscosity were found to be 1500, 3500 & 3500cP at 36, 48 & 60hrs
respectively (Graph no.4.23.2).

217

GRAPH 4.23.2
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 4.5,
ENZYME CONCENTRATION 175l/g)

4000
3500
3000
2500
VISCOSITY(cp)
10rpm

2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

Viscosity readings of 2000, 4000 & 4000cP were obtained at 36,


48 & 60hrs respectively, enzyme concentration 185l/g and agitator
speed 50 rpm (Graph no.4.23.3).

218

GRAPH 4.23.3
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 4.5,
ENZYME CONCENTRATION 185l/g)

3500
3000
2500

VISCOSITY(cp)

2000

10rpm

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

At pH 5.5 and enzyme concentration 165l/g at agitator speed 50


rpm the viscosity reading changed from 2000 to 4000 & 4000cP at 36, 48
and 60 hrs respectively (Graph no.4.24.1).

219

GRAPH 4.24.1
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 5.5,
ENZYME CONCENTRATION 165L/G)

4500
4000
3500
3000
VISCOSITY(cp)
10rpm

2500
2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

On increasing the enzyme concentration to 175l/g the reading of


viscosity were found to be 2000, 4500 & 4000cP at 36, 48 & 60hrs
respectively (Graph no.4.24.2).

220

GRAPH 4.24.2
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 5.5,
ENZYME CONCENTRATION 175l/g)

5000
4500
4000
3500
3000
VISCOSITY(cp)
10rpm

2500

20rpm

50rpm

100rpm

2000
1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

Viscosity readings of 2500, 4500 & 4500cP were obtained at 36, 48


& 60hrs respectively, enzyme concentration 185l/g and agitator speed
50rpm (Graph no.4.24.3).

221

GRAPH 4.24.3
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 5.5,
ENZYME CONCENTRATION 185l/g)

5000
4500
4000
3500
3000
VISCOSITY(cp)
10rpm

2500

20rpm

50rpm

100rpm

2000
1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

At pH 6.5 and enzyme concentration 165l/g at agitator speed 50


rpm the viscosity reading changed from 2500 to 3500 & 4000cP at 36, 48
and 60 hrs respectively (Graph no.4.25.1).

222

GRAPH 4.25.1
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 6.5,
ENZYME CONCENTRATION 165l/g)

4500
4000
3500
3000
VISCOSITY(cp)
10rpm

2500
2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

On increasing the enzyme concentration to 175l/g the reading of


viscosity were found to be 2000, 3500 & 4500cP at 36, 48 & 60hrs
respectively (Graph no.4.25.2).

223

GRAPH 4.25.2
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 6.5,
ENZYME CONCENTRATION 175l/g)

5000
4500
4000
3500
3000
VISCOSITY(cp) 2500
10rpm

20rpm

50rpm

100rpm

2000
1500
1000
500
0hrs

12hrs

24hrs
TIME

224

36hrs

48hrs

60hrs

Viscosity readings of 2500, 4000 & 4000cP were obtained at 36,


48 & 60hrs respectively, enzyme concentration 185l/g and agitator
speed 50 rpm (Graph no.4.25.3).

GRAPH 4.25.3
EFFECT OF INCREASE IN AGITATOR SPEED ON VISCOSITY
WITH INCREASE IN TIME PERIOD (TEMP. 60C, pH 6.5,
ENZYME CONCENTRATION 185l/g)

4500
4000
3500
3000
VISCOSITY(cp)
10rpm

2500
2000

20rpm

50rpm

100rpm

1500
1000
500
0hrs

12hrs

24hrs
TIME

225

36hrs

48hrs

60hrs

4.2.5.3.4 DISCUSSION
The amount of time required for gelatinisation of the starch
slurry of all the three grains was studied. It was found that irrespective of
the agitator speed, type of cereal and amount of enzyme present the
viscosity of the starch slurry remained almost constant or negligible
changes were noted till 36 hrs. This is in accordance with the findings in
this saccharification.The time period required for incubation of the starch
slurry with the enzyme before the enzyme was imbibed by the starch and
gelatinisation

occurred in all the three cereal grains was 36 hrs.

Variations have been studied in sorghum, rice and maize by Graph no.
(4.26, 4.27, 4.28) (4.29, 4.30, 4.31) and (4.32, 4.33, 4.34) respectively.

226

GRAPH 4.26
EFFECT OF CHANGE IN AGITATOR SPEED,
ENZYMECONCENTRATION AND TIME PERIOD AT 60C AND
pH 4.5

5000
4500
4000
10rpm 140ul/g

20rpm

3500

50rpm

100rpm

10rpm 150ul/g

100rpm

10rpm 160ul/g

20rpm

3000
VISCOSITY(cp)
20rpm

2500
2000
50rpm
1500
1000

50rpm

500

100rpm

0
0hrs

12hrs

24hrs
TIME

227

36hrs

48hrs

60hrs

GRAPH 4.27
EFFECT OF CHANGE IN AGITATOR SPEED, ENZYME
CONCENTRATION AND TIME PERIOD AT 60C AND pH 5.5

5500
5000
4500
10rpm 140ul/g 4000
20rpm

50rpm

100rpm

10rpm 150ul/g

100rpm

10rpm 16ul/g

20rpm

3500
3000
VISCOSITY(cp) 2500
20rpm

200050rpm
1500
1000

50rpm

500

100rpm

0
0hrs

12hrs

24hrs
TIME

228

36hrs

48hrs

60hrs

GRAPH 4.28
EFFECT OF CHANGE IN AGITATOR SPEED, ENZYME
CONCENTRATION AND TIME PERIOD AT 60C AND pH 6.5

6000
5500
5000
10rpm 140ul/g

4500
20rpm

50rpm

100rpm

10rpm 150ul/g

100rpm

10rpm 160ul/g

20rpm

4000
3500
VISCOSITY(cp)
20rpm

3000
2500
50rpm
2000
1500
1000

50rpm

500
100rpm
0
0hrs

12hrs

24hrs
TIME

229

36hrs

48hrs

60hrs

GRAPH 4.29
EFFECT OF CHANGE IN AGITATOR SPEED, ENZYME
CONCENTRATION AND TIME PERIOD AT 60C AND pH 4.5

4500
4000
10rpm 45ul/g

3500

20rpm

50rpm

100rpm

10rpm 55ul/g

100rpm

10rpm 65ul/g

20rpm

3000
2500
VISCOSITY(cp) 2000
20rpm

50rpm

1500
1000
500
50rpm

100rpm

0
0hrs

12hrs

24hrs
TIME

230

36hrs

48hrs

60hrs

GRAPH 4.30
EFFECT OF CHANGE IN AGITATOR SPEED, ENZYME
CONCENTRATION AND TIME PERIOD AT 60C AND pH 5.5

6000
5500
5000
10rpm 45ul/g

4500
20rpm

50rpm

100rpm

10rpm 55ul/g

100rpm

10rpm 65ul/g

20rpm

4000
3500
VISCOSITY(cp)
20rpm

3000
2500
50rpm
2000
1500
1000

50rpm

500
100rpm
0
0hrs

12hrs

24hrs
TIME

GRAPH 4.31

231

36hrs

48hrs

60hrs

EFFECT OF CHANGE IN AGITATOR SPEED, ENZYME


CONCENTRATION AND TIME PERIOD AT 60C AND pH 6.5

6500
6000
5500
10rpm 45ul/g

5000
20rpm
4500

50rpm

100rpm

10rpm 55ul/g

100rpm

10rpm 65ul/g

20rpm

4000
3500
VISCOSITY(cp) 3000
20rpm

50rpm
2500

2000
1500
1000
50rpm

500
100rpm
0
0hrs

12hrs

24hrs
TIME

232

36hrs

48hrs

60hrs

GRAPH 4.32

EFFECT OF CHANGE IN AGITATOR SPEED, ENZYME


CONCENTRATION AND TIME PERIOD AT 60C AND pH 4.5

4500
4000
10rpm 165ul/g

3500

20rpm

50rpm

100rpm

10rpm 175ul/g

100rpm

10rpm 185ul/g

20rpm

3000
2500
VISCOSITY(cp) 2000
20rpm

50rpm

1500
1000
500
50rpm

100rpm

0
0hrs

12hrs

24hrs
TIME

233

36hrs

48hrs

60hrs

GRAPH 4.33
EFFECT OF CHANGE IN AGITATOR SPEED, ENZYME
CONCENTRATION AND TIME PERIOD AT 60C AND pH 5.5

234

5000
4500
4000
10rpm 165ul/g

20rpm

3500

50rpm

100rpm

10rpm 175ul/g

100rpm

10rpm 185ul/g

20rpm

3000
VISCOSITY(cp)
20rpm

2500
2000
50rpm
1500
1000

50rpm

500

100rpm

0
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

GRAPH 4.34

EFFECT OF CHANGE IN AGITATOR SPEED, ENZYME


CONCENTRATION AND TIME PERIOD AT 60C AND pH 6.5
235

5000
4500
4000
10rpm 165ul/g

20rpm

3500

50rpm

100rpm

10rpm 175ul/g

100rpm

10rpm 185ul/g

20rpm

3000
VISCOSITY(cp)
20rpm

2500
2000
50rpm
1500
1000

50rpm

500

100rpm

0
0hrs

12hrs

24hrs

36hrs

48hrs

60hrs

TIME

In accordance with these findings it was found that the viscosity of


the all three grains changed very slowly till 36C. These changes
occurred because of the uniform dispersion of cereal granules in water to
form starch slurry. Between 36C to 48C initiation of enzyme activity
leads to further dispersion of the granules leading to thickening of slurry
and hence viscosity. The viscosity values stabilize with onset of
saccharification and at times were seen to show a decreasing trend after
48hrs. Increase of sugar content in the slurry leads to thinning of the fluid
and hence a decrease in its viscosity.
236

4.2.5.4 EFFECT OF ENZYME CONCENTRATION


The saccharification of the starch slurry results in increased sugar
concentration in the system when the amount of enzyme is increase then
the amount of starch saccharified to obtain glucose from the starch slurry
also increases this is very evident from the tables.
When experiments were conducted by increasing the enzyme
concentration at an optimum pH of 5.5 time and 60hrs at agitation rate
50rpm and 100rpm the following results were obtained

4.2.5.4.1 SORGHUM
At 140l/g conc. of enzyme viscosity was found to be 4000cP, at
150l/g

it was 4500cP and at 160l/g it was 5000cP at 50rpm. At

140l/g conc. of enzyme viscosity was found to be 3500cP, at 150l/g it


was 3500cP and at 160l/g it was 4000cP at 100rpm. (Table no.4.12.1, 2,
3 and Graph no.4.21.1,2,3).

4.2.5.4.2 RICE
237

Viscosity values were found to be 4000cP, 4500cP and 5500cP for


enzyme concentration of 45l/g, 55l/g and 65l/g respectively at 50rpm.
Viscosity value was found to be 4000cP, 4500cP and 4000cP for enzyme
concentration of 45l/g, 55l/g and 65l/g respectively at 100rpm. (Table
no.4.15.1,2,3 and Graph no.4.22.1,2,3).

4.2.5.4.3 MAIZE
At enzyme concentration of 165l/g, 175l/g and 185l/g viscosity
values of 4000, 4000, and 4500 were obtained at 50rpm. At enzyme
concentration of 165l/g, 175l/g and 185l/g viscosity values of 3000,
3000, and 3500 were obtained at 100rpm. (Table no.4.18.1, 2, 3 and
Graph no. 4.23, 1, 2, 3).

4.2.5.4.4 DISCUSSION
As can be clearly seen the viscosity increased with increased
enzyme concentration for all the three grains. It has been reported that
increase in amylase content and also an increase in sugar concentration
decreases viscosity of starch slurry. The values obtained in each case,
sorghum, rice and maize showed increase in viscosity value till 48 hrs
238

after which it remained stationary or decreased. The increase found was


due to increased saccharification in the system with increased enzyme
content. The decrease in value was because as stated before the increase
in amount of sugar thins the slurry and this leads to decrease in viscosity.
However, the differences achieved in viscosity on increase in enzyme
concentration were much more prominent than the decrease due to
accumulation of sugar in the slurry.

4.2.5.5 EFFECT OF AGITATION RATE


The viscosity of the starch slurry of all the three cereal grains was
studied at four different agitation speeds of the mixing rod or agitator.
The speeds of 10, 20, 50 and 100rpm were selected. The results have
been tabulated in the table nos.4.11-4.19(1, 2, 3) given above.

4.2.5.5.1 SORGHUM
4.2.5.5.1A pH 4.5
At an enzyme concentration of 140l/g at time period of 48hrs the
viscosity values of 2000, 2500, 3500 and 3000 were obtained at 10, 20,
50 and 100rpm respectively. Similar values were obtained at 60hrs.
239

At enzyme concentration 150l/g at time period 48hrs the


viscosity value of 2000, 2000, 4000 and 3500cP were obtained at 10, 20,
50 and 100rpm respectively. At the same agitation rate at 60hrs viscosity
values of 2000, 2500, 4000 and 3000 were obtained.
At time period 48hrs and enzyme conc. 160l/g at agitation speed
of 10, 20, 50 and 100rpm, viscosity values of 2000, 2500, 3500 and
3500cP were obtained under similar condition at time period 60hrs the
viscosity value were 2000, 2500, 4500 and 4000cP
These results can be seen from (Graph no.4.26).
4.2.5.5.1B pH 5.5
At an enzyme concentration of 140l/g at time period of 48hrs the
viscosity values of 2000, 2500, 3700 and 3500 were obtained at 10, 20,
50 and 100rpm respectively. Under similar condition at time period 60hrs
the viscosity value were 2000, 2500, 4000 and 3500cP.
At enzyme concentration 150l/g at time period 48hrs the viscosity
value of 1500, 2000, 4500 and 3500cP were obtained at 10, 20, 50 and
100rpm respectively. At the same agitation rate at 60hrs viscosity values
of 2500, 2500, 4500 and 3500 were obtained.

240

At time period 48hrs and enzyme conc. 160l/g at agitation speed of 10,
20, 50 and 100rpm, viscosity values of 2500, 2000, 5000and 4000cP were
obtained under similar condition at time period 60hrs the viscosity value
were 2500, 2500, 5000 and 4000cP
These results can be seen from (Graph no.4.27).
4.2.5.5.1C pH 6.5
At an enzyme concentration of 140l/g at time period of 48hrs the
viscosity values of 1500, 2500, 4500 and 3500 were obtained at 10, 20,
50 and 100rpm respectively. Under similar condition at time period 60hrs
the viscosity value were 2500, 2500, 4000 and 3500cP.
At enzyme concentration 150l/g at time period 48hrs the viscosity value
of 2000, 2500, 5000 and 5000cP were obtained at 10, 20, 50 and 100rpm
respectively. At the same agitation rate at 60hrs viscosity values of 2000,
3000, 5000 and 4500 were obtained.
At time period 48hrs and enzyme conc. 160l/g at agitation speed of 10,
20, 50 and 100rpm, viscosity values of 2000, 1500, 3500 and 4500cP
were obtained under similar condition at time period 60hrs the viscosity
value were 2000, 2500, 5500 and 5500cP (Graph no.4.28).
4.2.5.5.2 RICE
241

4.2.5.5.2A pH 4.5
At an enzyme concentration of 45l/g at time period of 48hrs the
viscosity values of 2000, 3000, 3000 and 3500 were obtained at 10, 20,
50 and 100rpm respectively. At the same agitation rate at 60hrs viscosity
values of 3000, 3000, 3000 and 3000 were obtained.
At enzyme concentration 55l/g at time period 48hrs the viscosity
value of 2500, 2000, 3500 and 4000cP were obtained at 10, 20, 50 and
100rpm respectively. At the same agitation rate at 60hrs viscosity values
of 2000, 2500, 4000 and 3500 were obtained.
At time period 48hrs and enzyme conc. 65l/g at agitation speed of
10, 20, 50 and 100rpm, viscosity values of 2500, 3000, 4000 and 3500cP
were obtained under similar condition at time period 60hrs the viscosity
value were 2000, 3500, 4000 and 3500cP (Graph no.4.29).
4.2.4.5.2B pH 5.5
At an enzyme concentration of 45l/g at time period of 48hrs the
viscosity values of 2500, 2500, 4000 and 4000 were obtained at 10, 20,
50 and 100rpm respectively. At the same agitation rate at 60hrs viscosity
values of 2500, 2500, 4000 and 4000 were obtained.

242

At enzyme concentration 55l/g at time period 48hrs the viscosity


value of 2000, 2500, 4000 and 4500cP were obtained at 10, 20, 50 and
100rpm respectively. At the same agitation rate at 60hrs viscosity values
of 3000, 3000, 4500 and 4500 were obtained (Graph no.4.30).
At time period 48hrs and enzyme conc. 65l/g at agitation speed of
10,20,50 and 100rpm, viscosity values of 2000, 3000, 5500 and 4500cP
were obtained under similar condition at time period 60hrs the viscosity
value were 2000, 3000, 5500 and 4000cP.
4.2.4.5.2C pH 6.5
At an enzyme concentration of 45l/g at time period of 48hrs the
viscosity values of 2500, 3000, 4000 and 3500 were obtained at 10, 20,
50 and 100rpm respectively. Under similar condition at time period 60hrs
the viscosity value were 2500, 3000, 4000 and 3500cP.
At enzyme concentration 55l/g at time period 48hrs the viscosity
value of 2000, 2500, 5500 and 4500cP were obtained at 10, 20, 50 and
100rpm respectively. At the same agitation rate at 60hrs viscosity values
of 2500, 3000, 5500 and 4500 were obtained.
At time period 48hrs and enzyme conc. 65l/g at agitation speed of
10, 20, 50 and 100rpm, viscosity values of 2500, 3000, 6000and 5500cP
243

were obtained under similar condition at time period 60hrs the viscosity
value were 2500, 3000, 6000 and 5000cP.
These results can be seen from Graph no.4.31.
4.2.4.5.3 MAIZE
4.2.4.5.3A pH 4.5
At an enzyme concentration of 165l/g at time period of 48hrs the
viscosity values of 2100, 2500, 4000 and 3100 were obtained at 10, 20,
50 and 100rpm respectively. At the same agitation rate at 60hrs viscosity
values of 2100, 2500, 4000 and 3000 were obtained.
At enzyme concentration 175l/g at time period 48hrs the viscosity
value of 2500, 3000, 3500 and 3000cP were obtained at 10, 20, 50 and
100rpm respectively. At the same agitation rate at 60hrs viscosity values
of 2500, 3000, 3500 and 3000 were obtained.
At time period 48hrs and enzyme conc. 1855l/g at agitation speed
of 10, 20, 50 and 100rpm, viscosity values of 2000, 2500, 4000and
2500cP were obtained under similar condition at time period 60hrs the
viscosity value were 2500, 2500, 4000 and 2500cP These results can be
seen from Graph no.4.32

244

4.2.4.5.3B pH 5.5
At an enzyme concentration of 1655l/g at time period of 48hrs the
viscosity values of 3500, 3000, 4000 and 2500 were obtained at 10, 20,
50 and 100rpm respectively. At the same agitation rate at 60hrs viscosity
values of 3500, 3500, 4000 and 3000 were obtained.
At enzyme concentration 175l/g at time period 48hrs the viscosity
value of 2500, 3000, 4500 and 3000cP were obtained at 10, 20, 50 and
100rpm respectively. At the same agitation rate at 60hrs viscosity values
of 3000, 3500, 4000 and 3000 were obtained.
At time period 48hrs and enzyme conc. 185l/g at agitation speed
of 10, 20, 50 and 100rpm, viscosity values of 2000, 2500, 4500and
3500cP were obtained under similar condition at time period 60hrs the
viscosity value were 2000, 2500, 4500 and 3500cP (Graph no.4.33).
4.2.4.5.3C pH 6.5
At an enzyme concentration of 165l/g at time period of 48hrs the
viscosity values of 2500, 2500, 3500 and 3000 were obtained at 10, 20,
50 and 100rpm respectively. Under similar condition at time period 60hrs
the viscosity value were 2500, 3000, 4000 and 4000cP.

245

At enzyme concentration 175l/g at time period 48hrs the viscosity


value of 2500, 3000, 3500 and 3000cP were obtained at 10, 20, 50 and
100rpm respectively. At the same agitation rate at 60hrs viscosity values
of 2500, 3000, 4500 and 4000 were obtained.
At time period 48hrs and enzyme conc. 185l/g at agitation speed
of 10, 20, 50 and 100rpm, viscosity values of 2500, 3000, 4000and
3000cP were obtained under similar condition at time period 60hrs the
viscosity value were 2500, 3000, 4000 and 3000cP(Graph no.4.34).

4.2.4.5.4 DISCUSSION
There was found to be no dramatic change in viscosity till 36hrs of
incubation of the starch slurry of all the three cereal grains at different
agitation speeds of 10, 20, 50 and 100rpm. When the process of
saccrification began after 36hrs, there was a spurt in viscosity value as
can be seen at a glance from the graph no.4.26-4.34.The value of
viscosity increased till 48hrs for all the three grains. After 48hrs the value
become steady or decreased when seen for a range of experiments on
different pH value and enzyme concentrations. This is possible because of

246

either total consumption of substrate in case of stationary values or


production of reversion products where decreased viscosity values were
obtained.
4.3 RECOMBINANT DNA CLONING AND ANALYSIS
Plasmid DNA extracted from B.subtilis ( DSM No.3628) was
transformed in

cells of E.coli.

The transformed cells containing

recombinant plasmids were identified by PCR (Figure 4.1). The alpha


amylase obtained from the transformed cells was purified by FPLC as
shown in Figure 4.2.The quantity and purity of the nucleic acid of the
transformed cells was done at 260 and 280 nm wavelength against
standard BSA as shown in Figure 4.3 and4.4.The nucleotide sequencing
of the inserted clone was also done (Fig 4.4).
FIGURE: 4.1
CLONING OF -AMYLASE cDNA FROM Bacillus subtilis
SEQUENCE DETAILS

NUMBER OF SEQUENCES: 8
LENGTH: 3139 base pairs
TYPE: nucleic acid
STRANDEDNESS: single
TOPOLOGY: linear
MOLECULE TYPE: DNA
(genomic)
247

FIGURE: 4.2
BSA STANDARD CURVE

Gel filtration005:1_UV

Gel filtration005:1_Inject

Gel filtration005:1_Logbook

mAU
1200

1000

800

600

400

200

0
0.0

5.0

10.0

248

15.0

20.0

ml

No
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20

Retention (min)
Area ( mAU*min) Height ( mAU)
-0.11
0.0043 0.265
0.20
0.8751 2.507
21.27
263.8895 136.269
23.81
2218.8794
1302.766
31.79
5.3323 3.999
45.81
0.0038 0.019
46.19
0.0069 0.026
46.42
0.0046 0.024
46.56
0.0030 0.027
46.85
0.0072 0.027
46.97
0.0061 0.027
47.27
0.0053 0.030
47.50
0.0099 0.033
48.00
0.0246 0.036
48.44
0.0024 0.026
48.54
0.0032 0.026
48.67
0.0113 0.023
49.35
0.0060 0.021
49.69
0.0080 0.022
50.03
0.0049 0.017
Total number of detected peaks
22
Total area ( mAU*min)
2489.0909
Area in evaluated peaks ( mAU*min)
2489.0877
Ratio peak area / total area
0.999999
Total peak width (min)
24.26
Column height (cm)
30.00
Column V0 (ml)
7.77
Calculated from
Gel filtration005:1_UV
Baseline
Gel filtration005:1_UV@01,BASEM
Peak rejection on
Maximum number of peaks ()
20
249
Current peak filter settings
Maximum number of peaks ()
20

FIGURE: 4.3
-AMYLASE PURIFICATION BY FPLC

Gel filtration004:1_UV

Gel filtration004:1_Inject

Gel filtration004:1_Logbook

21.03

mAU
100

80

60

40
14.75
20

29.81
27.16
0.20

0
0

57.83
46.62

9.26

20

65.27

40

60

250

77.63

92.69 96.57

80

102.66

min

No
1 0.20
2 9.26
3 14.75
4 21.03
5 27.16
6 29.81
7 46.62
8 57.83
9 65.27
10
11
12
13
14
15
16
17
18
19
20

Retention (min) Area ( mAU*min)


41.967610.396
2.2666 2.015
45.079725.304
246.4844
106.029
9.3438 5.772
28.994812.091
0.0496 0.235
38.91916.754
0.0270 0.081
77.63 0.0088 0.022
78.10 0.0139 0.020
92.69 0.0072 0.015
93.12 0.0055 0.015
94.22 0.0074 0.015
95.32 0.0059 0.020
96.57 0.0545 0.048
97.26 0.0292 0.036
102.66 0.0067 0.034
103.86 0.0077 0.019
104.13 0.0053 0.020

Height ( mAU)

Total number of detected peaks


32
Total area ( mAU*min)
413.3099
Area in evaluated peaks ( mAU*min)
413.2846
Ratio peak area / total area
0.999939
Total peak width (min)
59.75
Column height (cm)
30.00
Column V0 (ml)
7.77
Calculated from
Gel filtration004:1_UV
Baseline
Gel filtration004:1_UV@01,BASEM
Peak rejection on
251 20
Maximum number of peaks ()
Current peak filter settings
Maximum number of peaks ()
20

SEQUENCE DESCRIPTION: SEQ ID NO: 1


CTGCAGG
GGAGTTTGCAAAGCTAATAACTTCAGTAGCTGGTGGAGGAGGC
GGAGGAAGAA 60
AAGAACTAGCTCAAGGTAAGATAAGAGACATAGAAAAAGCAA
AAGAGGCAATAGAAAAAG120
TTAAGGGCTCTCTATAGCTTTCTACTCTCCTTCTTTTGGAATCAG
AAATATT TCATATTC

180

TGATCTCCAGAATGGGAGCTTGTTCATCTTTATTTTTATATAATAC
TCGGTGCTTTTCTC

240
252


TCTGTATATTTTCTCCACTACTTCCTGGGGCAGTTGGAACTGAAC
TATAATTTCAGCATC 300

CTCTGATACCTTTGTTTCAAATTTTGAAGT

ACCCTTGTAATCCTTTCCATTTACCTTTAT

360

GAGATAATTTGTGCCCTCTGGAAATTCTATTTCGAAGTTGAAATC
TGAGACAATTTTTTC 420

CACTTTTAGCGTAAATAACCCCCAACCGTCTTTTTCAACTATTGT
AACTGTCCTGTTTTC 480

CTTATAG

AATATCTCACTTGATTCTTTTTCATTAATGGTTGCAGGAGGCATT
TTTGCCGT

540

TCTCATGGCAAGCACTAGAAGGACTATAAAAATTATTGCTACAG
CTGTTATTTTCTTGTC 600

CATGCTAACACCCTGTAATGAGATTTGGATTTTCCTATATAAAAA
GCCTTAG TTATTTTT 660

GAGCCATTAAATATATAAGGAAGTATCACTCTTAGTGATTAATGG
GTGGACGGAAGTGGG

720

253


AGATAAAATTAACTTCATATTTGGAATTCACAACCATCAGCCCCT
GGGCAACTTTGGATG 780

GGTGTTTGAGGAGGCTTATGAAAAGTGTTA

CTGGCCGTTTCTGGAGACTCTGGAGGAATA 840

TCCAAACATGAAGGTTGCCATTCATACAAGTGGCCCCCTCATTG
AGTGGCTCCAAGATAA

900

TAGACCCGAATACATAGACTTGCTTAGAAGTCTAGTGAAAAGAG
GACAGGTGGAGATAGT

960

CGTTGCT

GGGTTCTACGAGCCTGTGCTAGCATCAATCCCAAAGGAAGATAG
AATAGAGCA

1020

GATAAGGTTAATGAAAGAGTGGGCTAAGAGTATTGGATTTGATG
CTAGGGGAGTTTGGCT

1080

AACTGAAAGAGTATGGCAACCAGAGCTCGTAAAGACCCTTAAG
GAGAGCGGA ATAGATTA

1140

TGTAATAGTTGACGATTACCACTTCATGAGTGCGGGATTAAGTA
AAGAGGAGCTGTACTG

1200

254


GCCATATTATACGGAAGATGGTGGGGAAGTTATAGCTGTTTTCCC
GATAGATGAGAAGTT 1260

GAGATATTTGATTCCCTTTAGACCCGTTGA

TAAGGTCTTAGAATACCTGCATTCTCTCAT

1320

AGATGGTGATGAGAGCAAAGTTGCAGTATTTCATGACGATGGTG
AGAAGTTTGGAATCTG

1380

GCCTGGAACTTATGAGTGGGTGTATGAAAAGGGATGGTTAAGA
GAATTCTTTGATAGAAT

1440

TTCAAGT

GATGAAAAGATAAACTTAATGCTTTACACTGAATACTTAGAAAA
ATATAAGCC

1500

TAGAGGTCTTGTTTATCTTCCAATAGCTTCATATTTTGAGATGAG
CGAATGGTCATTGCC 1560

AGCAAAGCAGGCAAGGCTCTTTGTGGAGTTCGTCAATGAGCTT
AAAGTTAAA GGTATATT

1620

TGAAAAGTACAGGGTATTTGTTAGGGGAGGAATTTGGAAGAAT
TTCTTCTATAAATACCC

1680

255


AGAGAGCAACTACATGCACAAGAGAATGCTAATGGTAAGTAAG
TTAGTGAGAAACAATCC

1740

TGAGGCCAGGAAGTATCTGCTGAGAGCACA

ATGTAACGATGCTTATTGGCACGGCCTCTT 1800

CGGTGGAGTATATTTACCCCATCTTAGGAGGGCCATCTGGAACA
ATTTAATCAAGGCCAA

1860

CAGCTATGTAAGCCTTGGAAAGGTCATAAGGGATATCGACTACG
ATGGCTTTGAGGAAGT

1920

TCTCATA

GAGAATGACAACTTTTATGCAGTGTTTAAACCCTCTTACGGTGG
TTCCTTGGT

1980

GGAGTTTTCATCAAAGAATAGACTCGTGAATTATGTAGATGTTCT
GGCAAGAAGGTGGGA

2040

ACACTATCATGGCTATGTGGAAAGTCAATTTGATGGAGTAGCCA
GCATTCAT GAGCTCGA

2100

GAAAAAGATACCAGATGAAATAAGAAAAGAAGTTGCTTACGAC
AAGTACAGAAGGTTCAT

2160

256


GCTTCAAGATCACGTAGTCCCCCTGGGAACAACTCTGGAAGAC
TTCATGTTCTCAAGACA

2220

ACAGGAGATCGGAGAGTTTCCTAGGGTTCC

ATACTCATATGAACTACTAGATGGAGGAAT 2280

AAGGCTGAAGAGGGAACACTTGGGAATAGAAGTTGAAAAAAC
AGTGAAGTTAGTGAATGA 2340

TGGATTTGAGGTGGAGTATATAGTGAACAACAAGACAGGAAAT
CCTGTATTGTTCGCAGT

2400

GGAACTT

AACGTTGCAGTTCAGAGCATAATGGAGAGCCCAGGAGTTCTAA
GGGGGAAAGA 2460

AATTGTCGTTGATGACAAGTATGCAGTTGGGAAGTTTGCACTGA
AGTTTGAAGACGAAAT

2520

GGAAGTCTGGAAGTATCCAGTAAAGACTCTCAGTCAAAGTGAA
AGTGGCTGG GATCTAAT

2580

CCAGCAGGGTGTCAGCTACATAGTTCCAATAAGGTTGGAGGATA
AAATAAGGTTTAAGCT

2640

257


AAAATTTGAGGAAGCCTCGGGATAGGGAGGCCCTCATCACCAA
TCAGGGCCCGAAAGACT

2700

CCCTCATCGGCCCTTCTATTTTATTTTAAA

CGTCAATGGTTTACCAAGTTTCCAAAACTT 2760

ACAAAATGAACAAATCTCTCCACTTGCGGGCATTCCACATATCT
TGCACTCTTTGAGGTC

2820

TTTCCCCTTCACTTCTGGCTCGAAAAGTTTTTTCTTTCTTAGGAA
TCCTCTCACGAAGTT 2880

GAACTTT

GTTCCAGGCCTTTTTTCCTCCAATTCATTGAGAACTTCCTTCATG
TCAAGAGT

2940

TGTCGCACCTCTTGCATAAGGACACTCCTCTACTATGTACTCCAA
TCCAACGGCAATGGC3000

ATAGGCAACAACTTCCCTCTCAGTTAATTCGTAGAGAGGTTTGA
TCTTCTTT ACGAACTT

3060

TCCTTCCCCTGGGAGCAGAGGACCTCCCTTAGCCAGGTACTCTG
TATTCCAGTGGAGTAA

3120

258

GTTGTTCATGAGAAAGCTT
3139
The alpha amylase prepared by this method was a homodimer

with a molecular weight of 130 kdaltons. The enzyme has a pH optimum


within the range of 6-8 at 900 C and displays significant activity and
stability independent of calcium ions. Following incubation at 100 0 C for
3 hours,the enzyme retains over 80% of its original activity.

The

nucleotide sequence of the cloned gene (Fig.4.5) matched closely with the
known sequences.Further the improved thermostability of alpha amylase
obtained from it gives scope for its commercial use

4.4 MULTIPLE SEQUENCE ALIGNMENT FOR AMYLASE


GENE
Gene sequences were subjected to Clustal W (1.82) in different
sets of 3, 4, 5, 6, and 9 bacterial sets randomly (Table 4.20). The multiple
sequence alignment results of these sets are shown in figure 4.6a, 4.7a,
4.8a, 4.9a, 4.10a, 4.11a, and 4.12a. The identical nucleotide sequences in
these sets have been depicted by a

*.

The Phylogram`s of above sets are

shown in figure 4.6b, 4.7b, 4.8b, 4.9b, 4.10b, 4.11b and 4.12b..

259

A conserved region of nucleotides was found in 9 different bacterial


species out of the 11 randomly selected bacterial sequences (Table no
3.2).
A 32 base pair nucleotide was identified as the conserved domain
of the amylase gene through multiple sequence alignment tool Clustal
W (1.82). A Homology database search tool BLAST (2.2.10) was done
on this 32 base pair nucleotide sequence and the result have been shown
in figure 4.13.
From the obtained results it can be said that by running the
conserved sequence with any unknown or new sequence of a gene it can
be determined whether it has capability to produce amylase.
The best alignment region are shown below

X52755

TGGCTGATCGA--

TGATACTTACGAAATCAGTTGACGGCCTCCGTATCGACACAGTA
AAA 1225

260

D83540
TGGATCAGCAACTTGATCCAGACGTACAACATTGACGGCCTGC
GAATCGACTCGCTCCAG 1666
M79444

ACGGTTTTCGATTTGATGC---

CGCCAAACATATAGAGCTTCCGGAT-GAT-------GG 998
* * * * **** * **

* * ** * ** ** **

X52755
CACGTCCAGAAGGACTTCTGGCCCGGGTACAACAAAGCCGCAG
GCG---TGTACTGTATC 1282
D83540
CAGTCCGGCTCCTTCTTCTTCCCGGGTTTCAACCAGGCCGCAGG
TGGCATGTACATGGTC 1726
M79444
GAGTTACGGCAGTCAATTTTGGCCGAATATCACAAATACATCTG
CAG--AGTTCCAATAC 1056
*

* * * * * ** * *

FIGURE: 4.6 (A)


261

** *

BEST ALIGNMENT REGIONS OF THREE BACTERIA

262

X52755
GGAAT
CCCCA
TCATC
TACGC
CGGC
CAAG
AACA
GCACT
ACGC
CGGC
GGAA
ACGA
CCCCG
CG
1754
D83540
GGTAT
CCCCA
TCACC
TACTA
CGGTC
AGGA
GCAG
CACCT

263

* * * **
X52755

** **

** * * * *

AACCGCGAAGCAACCTGGCTCTCGGGCTACC-

CGAC-CGACAGCGA-GCTGTACAAGTTA 1811
D83540
AACCGAGAGGCACTGTGGACGTCGGGCGGGTACGACACCTCGT
CGCCGCTGTACGAGATG 2230
M79444

AACAACCAGATATTTATGAATCAGCGCGGCT--

CACATGGCGTTGT-GCTGGCAAATGCA 1566
***

* *

* **

**

* * ****

X52755
ATTGCCTCCCGGAACGCAATCCGGAACTATGCCATTAGCAAAGA
TACAGGATTCGTGACC 1871
D83540
ATCACGACCGTGAACCAGCTGAGGACGCTCGCGATCAAGCAGA
ACGGGGGCTTTGTGACC 2290

264

M79444
GGTTCATCCTCTGTTTCTATCAATACGCCAACAAAATTGCCTGAT
GGCAGGT--ATGACA 1624
* **

**

Figure: 4.6 (B)


PHYLOGRAM OF THREE BACTERIA

265

* * ****

FIGURE: 4.7 (A)

BEST ALIGNMENT REGIONS OF FOUR BACTERIA

Accession no.

J01542,
Y17557,

Number Sequence

Sequenc

Clusta Alignme

of

e type

lW

format

sequenc

versio

es

Pearson
(Fasta)

M34957,
AJ293724

266

nt

1.82

nt score

25785

The best alignment region are shown below

J01542
GTATGCTGATGTTGACTACGACCACCCTGATGTCGTGGCAGAGA
CAAAAAAATGGGGTAT 992
Y17557
GTATGCCGACCTTGATATGGATCATCCCGAAGTCGTGACCGAGC
TGAAAAACTGGGGGAA 958
M34957

CCTCGCCGACCTCGACACCGGTGAG---

GAGTACGTGCGACAGACGATCGCCGGCTACAT 789
AJ293724

CATCGCCGACCTCGAC-CAGCAGAACCCGCGG--

GTCGACCAGCTGCTCAAGGACGACGC 4247
** ** * **

* *

**

J01542

**

CTGGTATGCGAATG-

AACTGTCATTAGACGGCTTCCGTATTGATGCCGCCAAACATATTA
1051
Y17557

ATGGTATGTCAACACAACGAACATT267

FIGURE: 4.7 (B)


PHYLOGRAM OF FOUR BACTERIA

FIGURE: 4.8 (A)

BEST ALIGNMENT REGIONS OF FIVE BACTERIA

Accession no.

M34957,
M25263,

Number

of Sequence

Sequence

ClustalW

Alignm

sequences

format

type

version

score

Pearson

nt

1.82

46948

(fasta)

J01542,
Y17557,
AJ293724

268

The best alignment region are shown below

M34957

CTGCTCTCCCTCGGC

GACGGCTTCCGCATCGACGCGGCCACGCACATCCCCGCCGA 855
M25263

CTGGCGTCGCTGGGC

GACGGCTTCCGGATCGACGCCGCCAAGCACATGCCGGCCGC 1007
J01542

GCGA

AACTGTCATTAGACGGCTTCCGTATTGATGCCGCCAAACATAT-TAAATTTT 10
Y17557

GTCAACACAACGAA

GATGGGTTCCGGCTTGATGCCGTCAAGCATAT-TAAGTTCA 1023
AJ293724

TGGATGGACCGCGGG

GACGGCATCCGGGTCGACGCCGTCAAGCACAT----GCCGC 4309
* ** ** **** * ** ** * ** ** **

M34957

TGAGCAGCACGAC-GGC

GGTCTTCGTCGACAACCACGACACCGAGCGCAACGGCTC 1122
M25263

269

TGCCCTCCGGCCA-GTC

Figure: 4.8 (B)


PHYLOGRAM OF FIVE BACTERIA

270

FIGURE: 4.9 (A)

Accession

Number

no.

sequences

M34957,

M25263,

of Sequence

Sequence

ClustalW

format

type

version

Pearson

nt

1.82

(Fasta)

Y13601,
Z85949,
M15540,
AJ293724

271

Align

12971

The best alignment region are shown below

M34957

CTT

GACTACGTCTCCGTGGCCAAGGAGTGCACCAGCACCCTCGGCCCGGCCG 39
M25263

GTT

AACTTCGCCTCGGTGGCCCGGGAGTGCACCGACCGCCTCGGCCCCGCCG 54
Y13601

GTT

AAGTTCACCTCCGTCGCCCAGGCCTGCACCGACACCCTCGGCCCGGCCG 10
Z85949

GTT

AAGTTCACCTCCGTCGGCCAGGCCTGCACCGACACCCTCGGCCCGGCCG 42
M15540

CTTC

AAGTACGTCGACGTCGCCAAGGCCTGCACCGACCAACTGGGCCCGGCCG 4
AJ293724

ACATGGGAGGTGACTTCGCCGGCATC

CGGATGGAGTACCTCAAGAACCTGG 3835
* * ** * * * *

M34957

* * *

**

**

GCTACGGCTACGTGCAGGTCTCCCCGCCCGCCGAGCACAT

CTCCCAGTGGTG 453

272

M34957

ACCGCCGAGATCACCGACTACCAGGACCGCTGGAACGTCCAGCACTGCGAA
GGC 733
M25263

CGCGCCACGATCTCCAACTACCAGGATCGCGCCAACGTCCAGAACTGCGAG
AG 885
Y13601

ACCTCGCAGATAAACAACTACGGCGACCGCTTCAACGTCCAGGAGTGCGAA
GC 1359
Z85949

ACCTCGCAGATAAACAACTACGGCGACCGCTTCAACGTCCAGGAGTGCGAA
GC 760
M15540

CGCAAGAGCATCTCCGACTACACCAACCGCGACGACGTCCAGACCTGCGAA
GAC 779
AJ293724

GGCCCGGCGATCGGCGACTTCAACGATCGCTACCAGGACCAGTACTACAGC
AC 4191

273

** * *** *

* ***

* * **** * * ** *

M34957

CTCGCCGACCTCGACACCGGTGAGGAGTACGTGCGACAGACGATCGCCGGC
AC 793
M25263

CTGCCGGACCTCGACACGGGCGAGGACCACGTCCGCGGGAAGATAGCCGG
AAC 945
Y13601

CTCGCGGACCTGGACACCGGCGAGGACTACGTACGGGGGAAGATCGCCGG
AAC 1419
Z85949

CTCGCGGACCTGGACACCGGCGAGGCCTACGTCCGGGGGAAGATCGCCGG
CC 820
M15540

CTCGCCGACCTCGGCACCGGCAGTGACTACGTCCGCACCACCATCGCCGGC
836
AJ293724
274

ATCGCCGACCTCGACCAGCAGAACCCGCGGGTCGACCAGCTGCTCAAGGAC
AAC 4251
* * ***** * *

**

* * **

M34957

GACCTGCTCTCCCTCGGCGTCGACGGCTTCCGCATCGACGCGGCCACGCAC
850
M25263

GACCTGGCGTCGCTGGGCGTCGACGGCTTCCGGATCGACGCCGCCAAGCAC
- 1002
Y13601

GACCTGCTCTCCCTCGGCGTCGACGGCTTCCGCATCGACGCGGCCAAGCAC
1476
Z85949

GACCTGCTCTCCCTCGGCGTCGACGGCTTCCGCATCGACGCGGCCAAGCAC
877
M15540

GGCCTGCGGTCGCTGGGCGTGGACGGCTTCCGGATCGACGCCGCCAAACAC
275

- 893
AJ293724

TACTGGATGGACCGCGGGGTCGACGGCATCCGGGTCGACGCCGTCAAGCAC
TG 4311
* *

* ** ** ****** **** ******* * ** ***** *

M34957

-----GCCG

CGCGAACATCAAGTCCCGCCTGAGCAACCCGAACGCCTACTGG 904
M25263

-----GCCG

CGCGAACATCAAGTCCCGGCTGACGAACCCGAACGTCTTCTGG 1056
Y13601

-----GCGC

GGCCGCCATCAAGTCCAGGCTCAGCAACCCGAACGTCTACTGG 1530
Z85949

-----GCCG

GGCCGCCATCAAGTCCAGGCTCAGCAACCCGAACGTCTACTGG 931
M15540

-----GCCACCGACCT-TGCCGCCGTCAAGGGCAAGATGAA

CGGCTTCTGG 944
AJ293724

276

AGCTGGCAGCGGTCCTTCGCCGACGCGGTCACCTCGCACAAGAGCGCGGCC
GC 4371
**

* *** ** *

M34957

* * * ** * *

AAGCAGGAGGTCATCTACGGCGCCGGC

CCCAAGCCCGGCGAGTACACCGGC 961
M25263

AAGCTGGAGGCCATCCACGGCGCCGGC

GTCTCCCCGAGCGAGTACCTCGGC 1113
Y13601

AAGCACGAGGCGATCTACGGCTCGGGC

GTGTCCCCGACCGAGTACGTCGGC 1587
Z85949

AAGCACGAGGCGATCTACGGCGCGGGC

GTGTCCCCGACCGAGTACGTCGGC 988
M15540

GTGCAGGAGGTCATCTACGGCGCCGGCG

GTCCGGCCCGACGAGTACACCGGC 1001
AJ293724

GAGTGGTACATGGGCGACCAGTCCGATCCGCTCTACGCCGACCAGGTCAAG
AC 4431

277

M34957

* **

**

* *** * * *

ACCGGCGACGTCCAGGAGTT---CCGCTACGCCTACGACCTCAA

TCTTCACC 1015
M25263

AGCGGAGACGTCCAGGAGTT---CCGCTACGCCCGCGACCTCA

TCCTCCAG 1167
Y13601

TGCGGCGACGTACAGGAGTT---CCGCTACGCACGCGACCTCA

TCCTTCAA 1641
Z85949

AGCGGCGACGTACAGGAGTT---CCGCTACGCACGCGACCTCA

TCTTCAAC 1042
M15540

ATCGGCGACGTCGACGAATT---CCGCTACGGCACCCATCTCAA

CCTTCCAG 1055
AJ293724

ACCAGCGGCATCGCGGCCATGGACTTCTACACCAACCGCTCGATCCGCGAC
CC 4491
*****

* * * ****

278

* **

**

M34957

CA

GCACCTCGCCTACCTGAAGAACTACGGCGAGGACTGGGGCTACCTG 1066
M25263

GG

GAAGCTCTCCTACCTGAAGAACTTCGGCGAGGCCTGGGGCCACATG 1218
Y13601

GG

GAACCTCGCGTACCTGAAGAACTTCGGCGAGGCCTGGGGCCACCTG 1692
Z85949

GG

GAACCTCGCGTACCTGAAGAACTTCGGCGAGGCCTGGGGCCACCTG 1093
M15540

AGCGG---------CAACATCGCCCAGCTGAAG---TCCGTC

GGCAAGCTC 1100
AJ293724

GGCGCCGGCTCGATGAAGTCCCTGGACGCGGCGATCACCAAGACCAACCGG
CTC 4551
*

* *

* * *

279

* *** *

contd..

BEST ALIGNMENT REGIONS OF SIX BACTERIA

M34957
AGCAGCACGACGGCCGGGGTCTTCGTCGACAACCACGACACCGAGC
GCAACGGCTCCACG 1126
M25263
CCCTCCGGCCAGTCCGGCGTCTTCGTCGACAACCACGACACCGAGC
GCGGCGGCGACACC 1278
Y13601
CCCTCGGACGAGGCCGCCGTCTTCGTCACCAACCACGACACCGAGC
GCAACGGCGAGACC 1752
Z85949
CCCTCGGACGAGGCCGCCGTCTTCGTCACCAACCACGACACCGAGC
GCAACGGCGAGACC 1153
M15540

280

TGGCAGCGACAGGCCCGCACCTTCGTCGACAACTGGGACACCGAAC
GCAACGGCTCCACG 1160
AJ293724
TACGAGCAGGATCTGATCACGTTCCTGGACAACCAGGACACCCGGCG
CTTCGG---GACG 4608
*** * **** ****** *** ***

**

M34957
CTGAACTACAAGAACGACGCCACCTACACCCTGGCCAACGTCTTCAT
GCTGGCTTGGCCC 1186
M25263
CTGTCCTACAAGGACGGCGCGAACTACACCCTCGCCTCCGTCTTCAT
GCTCGCCTGGCCC 1338
Y13601
CTCACCTACAAGGACGGCGCCACCTACACCCTGGCGCACGTCTTCAT
GCTGGCCTGGCCG 1812
Z85949
CTCACCTACAAGGACGGCGCCACCTACACCCTGGCGCACGTCTTCAT
281

GCTGGCCTGGCCG 1213
M15540
CTCACCTACAAGGACGGCGCCGCCTACACCCTCGCCAACGTCTTCAT
GCTCGCCTCGCCC 1220
AJ293724

CTCAACAGCGATC-CGGCGGC-CCTGCACCG-

GGCGCTCGCCTTCCTGCTCACCA---CC 4662
** * * * ** **

** **** ** ** **** **** *

M34957
TACGGCGCCCCCGACATCAATTCCGGCTACGAGTGGTCCG--ACCCGGACGCCCGGCCG 1243
M25263
TACGGCTCCCCGGACGTCCACTCCGGCTACGAGTGGACCG--ACAAGGACGCCGGACCG 1395
Y13601
TACGGCAGCCCCGACGTCCACTCCGGCTACGAGTTCACCG--ACCACGACGCCGGGCCG 1869
Z85949
282

TACGGCAGCCCCGACGTCCACTCCGGCTACGAGTTCACCG--ACCACGACGCCGGGCCG 1270
M15540
TACGGCTCACCCAACGTCTACTCCGGCTACGAGTGGACCG--ACAAGGACGCC--GCCG 1275
AJ293724
CGGGGTACGCCGTGCCTGTTCTACGGCACCGAGCAGTACCTGCACAA
CGACACCGGTGAG 4722
**

M34957

** * *

* **** ****

** *** **

CCCGACGGCGGCCACGTCGACGCCTGCTGGCA-----

GAACGGCTGGA---AGTGCCAGC 1295
M25263

CCCAACAACGGCCAGGTCAACGCCTGCTACAC-----

CGACGGCTGGA---AGTGCCAGC 1447
Y13601

CCGAACGGCGTCCAGGTGAACGCCTGCTACAG-----

CGACGGATGGA---AGTGCCAGC 1921
Z85949

CCGAACGGCGGTCAGGTGAACGCCTGCTACAG-----

283

CGACGGATGGA---AGTGCCAGC 1322
M15540

CC----GGCGG------GAGCACCGGCTGGAC-----

CGACGAC--------GCGGCGA- 1311
AJ293724
GGCAGCAACAAGGGCAAGGACCCGTACAACCGGCCCCCGATGGCCA
GTTTCGACACCGAC 4782
*

** *

**

M34957

ACA----AGTGGCCCGAGATC-

GCCTCCATGGTCGCCTTCCGC------AACGCCACCCG 1344
M25263

ACG----CCTGGCGCGAGATC-

TCCTCCATGGTGGCCTTCCGC------AACACCGCCCG 1496
Y13601

ACG----CCTGGTGCGAGATC-

TCCTCCATGGTCGCTTTCCGC------AACACCGCACG 1970
Z85949

ACG----CCTGGCGCGAGATC-

TCCTCCATGGTCGCTTTCCGC------AACACCGCACG 1371
M15540

----------AGCGGGAGATC-

284

ACCGGCATGGTCGGCTTCCGC------AACGCGGTGGG 1354
AJ293724
ACGGTCGCCTACCGGGAGATCCGGCGCCCTCTCCGACCTGCGCCGGT
CGAACCCCGCGGT 4842
****** * * *

* * ***

M34957

*** *

CGGCGAGCCGGTCACCGAC--

TGGTGGGACGACGGCGCGG---ACGCCATCGCCTTCGGC 1399
M25263

CGGACAGGCCGTCACGAAC--

TGGTGGGACAACGGCAACA---ACGCGATCGCGTTCGGC 1551
Y13601

CGGCCAGGGGGTGACCGAC--

TGGTGGGACAACGGCGGCG---ACCAGATCGCCTTCGGC 2025
Z85949

CGGCCAGGGGGTGACCGAC--

TGGTGGGACAACGGCGGCG---ACCAGATCGCCTTCGGC 1426
M15540

ATCCGCCGAGCTGACCAAC--

TGGTGGGACAACGGCGGCA---GGCCCCTCGCCTTCGCC 1409
AJ293724

285

GGCTACGGGGACCACCAGCAGCGGTGGATCAACGACGACGTGTACG
TCTACGAGCGCCGG 4902
** * ***** * *** *

**

M34957
CGGGGCAGCAAGGGCTTCGTGGCCATCAACCACGAGTCCGCCACC----GTCCAGCGCA 1454
M25263
CGCGGCTCCAAGGCCTACGTGGCCATCAACCACGAGACCTCCGCG----CTCACCCGCA 1606
Y13601
CGCGGCTCCAAGGCGTACGTCGCCATCAACCACGAGGGCACCTCG----CTGACCCGTA 2080
Z85949
CGCGGCTCCAAGGCGTACGTCGCCATCAACCACGAGGGCACCTCG----CTGACCCGTA 1481
M15540
CGCAGCGACAAGGGCTTCGTCGCCCTCAACAACGGGGACGCCGCG----CTGACCCAGA 1464

286

AJ293724
TTCGGCGACAACGTGCTGCTGACCGCCATCAACAAGGGCTCGCACG
AGTACCGGCTCGAA 4962
** *** *

* ** ** * ** * * * * *

M34957

* *

CCTACCAG-

ACCTCCCTGCCCGCCGGCACCTACTGCGACGTGCAGAGCAACACC---AC 1509
M25263

CCTTCCAG-

ACCTCGCTGCCCGCCGGCTCCTACTGCGACGTCCAGTCCAACACC---CC 1661
Y13601

CGTTCCAG-

ACGTCGCTGCCCGCGGGGGACTACTGCGACGTCCAGACGGGCAAG---GG 2135
Z85949

CGTTCCAG-

ACGTCGCTGCCCGCGGGGGACTACTGCGACGTCCAGACGGGCAAG---GG 1536
M15540

CCTTCGCG287

ACCTCCCTGCCCGCCGGGACGTACTGCGACGTGGTGCACGCCGCGTC
CTCC 1523
AJ293724
CGGGCTGGCACCGCGCTGCCGGCCGGCACCTATCGCGACGTGCTCGG
CGGCACCTTCGGC 5022
* * * ** * ***** ** **

** *******

FIGURE: 4.9 (B)

PHYLOGRAM OF SIX BACTERIA

288

FIGURE: 4.10 (A)

BEST ALIGNMENT REGIONS OF SIX BACTERIA

Accession

Number

no.

sequences

of Sequence
format

Sequence

ClustalW

Align

type

version

ment

score
Y13601,
Z85949,

Pearson(Fast nt
a)

1.82

1152
2

M25263,
M34957,
M15540,
J01542

289

The best alignment region are shown below

Y13601

CCACCCG

GAGACAAGGACGTCACCGCGGTGATGTTCGAGTGGAAG--TTCA-CCTCCGT
986
Z85949

CCACCCG

GAGACAAGGACGTCACCGCGGTGATGTTCGAGTGGAAG--TTCA-CCTCCGT
387
M25263

CCGCCCG

GCGAGAAGGACGTCACCGCGGTGATGTTCGAGTGGAAC--TTCG-CCTCGGT
512
M34957

CCGCCCG

GCACCAAGGACGTCACCGCCGTCCTCTTCGAGTGGGAC--TACG-TCTCCGT
360
M15540

CCGCCCG

GCCAGAAGACCGTCACCGCCACGCTCTTCGAGCGGAAG--TACG-TCGACGT
412
J01542

CCTCCCGCATACAAAGGATTGAGCCAATCCGATAACGGATACGGACCTTATG
290

FIGURE: 4.10 (B)

PHYLOGRAM OF SIX BACTERIA

291

FIGURE: 4.11 (A)

BEST ALIGNMENT REGIONS OF SIX BACTERIA

Accession no.

Number of Sequence

Sequen

Clustal

Alig

sequences

ce type

nme

format

version nt
score
J01542, Y17557, 6

Pearson(Fasta)

M34957,

nt

1.82

5833
2

M25263,
AJ293724,
M79444

292

The best alignment region are shown below

J01542

TATGCGAATG-AACTG-

TCATTAGACGGCTTCCGTATTGATGCCGCCAAACATAT-TAAA 1053
Y17557

TATGTCAACACAACGA-ACATT-

GATGGGTTCCGGCTTGATGCCGTCAAGCATAT-TAAG 1019
M34957

GACCTGCTCTCCCTCG-GCGTC-

GACGGCTTCCGCATCGACGCGGCCACGCACATCCCCG 851
M25263

GACCTGGCGTCGCTGG-GCGTC-

GACGGCTTCCGGATCGACGCCGCCAAGCACATGCCGG 1003
AJ293724

TACTGGATGGACCGCG-GGGTC-

GACGGCATCCGGGTCGACGCCGTCAAGCACAT----G 4305
M79444
AAAGGGCATTGAATGACGGGGCAGACGGTTTTCGATTTGATGCCGCC
AAACATATAGAGC 985
*

** ** * ** * ** ** * ** ** **

293

FIGURE: 4.11 (B)

PHYLOGRAM OF SIX BACTERIA

FIGURE: 4.12 (A)


BEST ALIGNMENT REGIONS OF NINE BACTERIA

Accession

Number Sequence

Sequence Clustal

Alignment

no.

of

type

score

format

sequenc

W
version

es
M34957,
M25263,

Pearson(Fa nt
sta)

Y13601,
Z85949,
M15540,
294

1.82

185069

AJ293724,
J01542,
Y17557,
M79444

295

The best alignment region are shown below

M34957
GACAGACGATCGCCGGCTACATGAACGACCTGCTCTCCC--TCGGCGTC-GACGGCTTC 823
M25263
GCGGGAAGATAGCCGGCTACCTCAACGACCTGGCGTCGC--TGGGCGTC-GACGGCTTC 975
Y13601
GGGGGAAGATCGCCGGCTACCTCAACGACCTGCTCTCCC--TCGGCGTC-GACGGCTTC 1449
Z85949
GGGGGAAGATCGCCGGCTACCTCACCGACCTGCTCTCCC--TCGGCGTC-GACGGCTTC 850
M15540

GCACCACCATCGCCGGCTACCT---

CGGCCTGCGGTCGC---TGGGCGTG-GACGGCTTC 866
AJ293724
296
ACCAGCTGCTCAAGGACGACGCCAACTACTGGATGGACC---

FIGURE: 4.12 (B)

PHYLOGRAM OF NINE BACTERIA

FIGURE: 4.13
BLASTN 2.2.10 RESULTS Query= seq (32 letters)

>gi|153152|gb|M34957.1|STMAMY

Streptomyces thermoviolaceus

alpha- a amylase (amy) gene, complete cds


Length=1712 Score = 63.9 bits (32), Expect = 9e-10

297

Identities = 32/32 (100%), Gaps = 0/32 (0%)


Query 1

GACGGCTTCCGCATCGACGCGGCCACGCACAT 32

||||||||||||||||||||||||||||||||
Sbjct 815 GACGGCTTCCGCATCGACGCGGCCACGCACAT 846

>gi|1835231|emb|Z85949.1|SLAMLB S.lividans amlB gene


Length=2040 Score = 56.0 bits (28), Expect = 2e-07
Identities = 31/32 (96%), Gaps = 0/32 (0%)
Query 1

GACGGCTTCCGCATCGACGCGGCCACGCACAT 32

||||||||||||||||||||||||| ||||||
Sbjct 842 GACGGCTTCCGCATCGACGCGGCCAAGCACAT 873

>gi|4151100|emb|Y13601.1|SLAML Streptomyces lividans aml gene


Length=3484 Score = 56.0 bits (28), Expect = 2e-07
Identities = 31/32 (96%), Gaps = 0/32 (0%)

298

Query 1

GACGGCTTCCGCATCGACGCGGCCACGCACAT 32

||||||||||||||||||||||||| ||||||
Sbjct 1441 GACGGCTTCCGCATCGACGCGGCCAAGCACAT 1472

>gi|24413917|emb|AL939130.1|SCO939130

Streptomyces

coelicolor

A3(2) complete genome; segment 27/29


Length=303450 Features in this part of subject sequence:
Score = 56.0 bits (28), Expect = 2e-07
Identities = 31/32 (96%), Gaps = 0/32 (0%)
Query 1

GACGGCTTCCGCATCGACGCGGCCACGCACAT 32
||||||||||||||||||||||||| ||||||

Sbjct

47136

GACGGCTTCCGCATCGACGCGGCCAAGCACAT

47167

>gi|1256425|gb|U51129.1|SAU51129 Stretomyces albus amylase (amy)


gene, complete cds

299

Length=1832 Score = 56.0 bits (28), Expect = 2e-07


Identities = 31/32 (96%), Gaps = 0/32 (0%)
Query 1

GACGGCTTCCGCATCGACGCGGCCACGCACAT 32

||||||||||||||||||||||||| ||||||
Sbjct 816 GACGGCTTCCGCATCGACGCGGCCAAGCACAT 847

>gi|2960347|emb|Y13332.1|SSTO1AMY Streptomyces sp. TO1 amy


gene
Length=1860 Score = 48.1 bits (24), Expect = 5e-05
Identities = 30/32 (93%), Gaps = 0/32 (0%)
Query 1

GACGGCTTCCGCATCGACGCGGCCACGCACAT 32

|||||||||||||||||||| |||| ||||||


Sbjct 877 GACGGCTTCCGCATCGACGCCGCCAAGCACAT 908

>gi|47074|emb|X57568.1|SGAMYLASE
amylase gene amy
300

S.griseus

DNA for

alpha

Length=2271 Score = 48.1 bits (24), Expect = 5e-05


Identities = 30/32 (93%), Gaps = 0/32 (0%
Query 1

GACGGCTTCCGCATCGACGCGGCCACGCACAT 32

|||||||||||||||||||| |||| ||||||


Sbjct 915 GACGGCTTCCGCATCGACGCCGCCAAGCACAT 946

4.5 CONCLUSION

301

1. Sorghum, Rice and Maize grains in their coarse form were used for
production of High Fructose Syrup bypassing the conventional
method wherein whole grains were used without primarily
extracting starch from it.
2. The temperature of the enzyme (amylase and glucoamylase) for
liquid glucose production form the grain by liquefaction and
saccharification was optimized. 6OOC was found to be the most
suitable temperature for both the processes for all the three grains.
3. Similarly, the optimum pH for the activity of the enzymes,
amylase and glucoamylase for the three grains was studied. It was
found that 5.5 pH values were most suitable for efficient
liquefaction and saccharification for all the three stated grains.
4. The time required for conversion of starch to liquid glucose was
also studied and optimized. It was found to be 54, 48 and 60 hrs for
Sorghum, rice and maize respectively.
5. Viscosity measurement at optimum pH and temperature of
glucoamylase was also studied. It was found that increase in the
rate of agitation in the slurry increased the value of viscosity till
36hrs after which stable value were obtained for all the three
grains. It was found that 36 hrs were required for enzyme starch
302

interaction and penetration of the enzyme in all the three grains for
starch breakdown to glucose.
6. Besides this, it was found that stepping up of the agitator speed
after 36hrs from 50-100 rpm led to decrease in the values of
viscosity for all the three grains during saccharification because,
the mass of the grains from which glucose had been extracted tend
to accumulate at the bottom of the vessel.
7. The effect of increase in glucoamylase for saccharification was
also studied. It was found that for all the three grains as increase in
enzyme concentration led to as increase in glucose production in
all three grains.
8. Stastical analysis of the parameter was done for obtaining
theoretical models

for liquid glucose production from

Sorghum, Rice and Maize.


9. amylase producing cDNA from Bacillus subtilis was cloned in
the E.coli cells. The enzyme obtained from the transformed cells
was purified and characterized by FPLC (Fast Protein Liquid
Chromatography).It was found that the amylase obtained was a
homodimer with a molecular weight of 130 K Dalton.

303

10.The amylase enzyme obtained was found to have a pH optimum


in the 5.5 to 8 range at 90 OC and it displayed significant actively
and stability independent of Ca+2 ion.
11.Identification of identical gene sequence in amylase producing
organism was also done. It may be hypothesized that the presence
of the sequence in any known or unknown organism may ensure its
capacity to produce amylase enzyme.
The work done in the thesis still leaves some leads into direction in
which

further

work may be done:


The

effect

of

increase

in

enzyme

concentration

(glucoamylase) in saccharification has been studied but has


not been optimized. Immobilization of the enzyme may also
be attempted.
Optimum viscosity values at optimum pH and temperature
condition for saccharification have been studied. Theoretical
stastical models for optimum viscosity value need be
developed.

304

E.coli cells capable of producing thermostable amylases


have been developed .These transformed cells need to be
tested experimentally at the optimized value of different
parameters.
An algorithm based on the identified gene sequence for
amylase production can be developed.
Similarly, molecular studies can be done for glucoamylase
producing microorganisms also.
The technology developed for high fructose production from
these grains may be used for other high content starch
products.

305

LIST OF PUBLICATIONS
I. Two published papers in Indian Journals:
1. Liquid glucose production from corn-optimization and modeling
of control parametersInstitute of Engineers, Chemical Engineering
Division, Vol 86, Sept 2005.by Ritu Srivastava, B, N, Mishra,
D.S.Bhargava, N.G.V.Rao and Rahul Kumar
2. High Fructose Syrup: production and Potential, Crop protection and
production, Vol II,

No 2, Dec, 2005. .by Ritu Srivastava, B, N,

Mishra, D.S.Bhargava, N.G.V.Rao and Rahul Kumar Two submitted


paper in International Journals
1. Liquid glucose production from sorghum-optimization and modeling
of

control

parameters.

.by

Ritu

D.S.Bhargava,N.G.V.Rao and Rahul Kumar


306

Srivastava

B,N,Mishra,

Submitted in Journal of food and Agricultural Chemistry


,September,2006
2.Optimisation of control parmeters for liquid glucose production
from rice .by Ritu Srivastava,B,N,Mishra,D.S.Bhargava,N.G.V.Rao
and Rahul Kumar
Submitted in African Jounal of Biotechnology,September 2006

III. Patent Application:


1. The procees for production of Liquid Glucose Production
Process from Cereals-The

patent Application No. is

789/DEL/2005.
4

Sequence Description
Sequence has been submitted for thermostable alpha amylase
producing gene at NCBI

307

REFERENCES
1. E. Staley, General method for testing starch in the rapid viscoTM
Analyses 2001, RVATM

viscosity of cationic starches, 2001,

RVA world 1-2.


2. A E Staley, RVATM viscosity of cationic starches, 2000, 16, RVA
world 1-2.
3. Abu-Reesh, I M & Faqir N M 1996. Simulation of glucose
isomerase reactor. Bioproc Eng., 14,205-210.
4. Allen M., Coutinho P., Ford C.F., 1998, Stabilization of Aspergillus
awamori Glucoamylase by protein substitution and combining
stabilizing mutations. Protein engg, 11: 783-788.

308

5. Amory, R.and Hollenberg, C. P., 1989. Xylose isomerase from


Actinoplanes missouriensis: primary structure of the gene and
protein, Nucleic Acids Res, 17:515.
6. Anonymous, 1982, Optimization of operating temperature for
continuous glucose isomerase reactor system. Biotech & Bioengg.,
24:1889-1896.
7. Antrim R.L., W. Colilla and B. J. Schnyder, 1979, Glucose
isomerase production of high fructose syrups. Appl.
Biochem.Bioeng, 2: 97-155.
8. Applied microbiology and biotechnology, Enzymes in
biotechnology, 24/11/99, irattray@gralo.uk.
9. Atiyeh H., Duvnjak Z., 2002, Production of fructose and ethanol
from sugar beet molasses using Sacchromyces cervisiae ATCC
36858, Biotechnology Progress, 18: 134-139.
10.Ayenor G.S., Hammond T.K. and Graffham A., 2002, The
production of rice malt and amyloglucosidase for production of
sugar syrup from Cassava flour, African journal of science and
technology., 3,1: 10-17.
11.b.bg.ac.yu/~tondorom/tutorials/rad36.html.
309

12.Balt C.A., E. ONeill, S.R. Novak, J. Ko and A.Sinskey, 1986. Hyper


expression of E.coli xylose isomerase. Biotechol. Prog. 2: 140-144.
13.Banks W., Greenwood C. T., 1975 Starch and its components.
Edinburg University Press, Edinburg.
14.Barker S.A., 1976, Pure fructose syrups., Process Biochem., 11: 2025.
15.Barker S.A., H.Pelmore and P.J.Somers, 1983, Effect of oxyanions
on the D-glucose isomerase catalysed equilbrium. 2. Effect of
germanate on the equilbrium of D-glucose and D- fructose with
immobilized D-glucose isomerase enzyme Microb. Technol. 5: 121124.
16.Barker. S.A., Somers, P.J., Hatt, B.W., December 1973. Fructose.
U.S. Patent 3,875:140.
17.Batt C.A., M.S.Bodis, S.K. Picataggio, M.C. Claps, S.Jamas and A.J.
Sinskey, 1985, Analysis of xylose operon regulation by mud (apr,
lac) fusion: trans effect of plasmid cooled xylose operon. Can J.
Microbiol., 31: 930-933.
18.Beaujean, C. Ducrocq Assaf, R.S. Sangwan, G. Lilius, L.Bulow,
B.S. Sangwan Norreel, 2000, Engineering direct fructose
310

production in processed potato tubers by expressing a bifunctional


alpha amylase / Glucose isomerase gene complex, Biotech and
bioengg, 70, 1: 9 16.
19.Berkhout F., 1976. Starch production technology. London.
20.Beynum G. M. A., Roels J. A., 1985. Starch conversion technology.
Marcel Dekker, New York..
21.Bhosale, S. H., Rao M. B. and V.V. Deshpandey, 1996, Molecular
and industrial aspects of glucose isomerase, Microbiological review,
60, 3: 280-300.
22.Bjornvad M. Pedersen S. Schulein M., Bisgard-Frantzen H: Alpha
amylase fused to cellulose binding domain, for starch degradation.
1998 World patent application, #wo98/16633.
23.Boidin A., Effront .A. J., Process of manufacturing diastases and
toxins by oxidizing fragments. United States patent. 1,227,525.,
1917,a.
24.Boidon A., Effront A. .J., Process for treating amylaceous
substances. United States patent 1, 227, 374. 1917, b.
25.Brown S.H., H.R. Costantino and R. H. Kelly, 1990, characterization
of the amylolytic enzyme activities associated with the hyper
311

thermophylic archaebacterium Pyrococcus furtosis, Appl. Environ.


Microbial. 56: 1985-1991.
26.Brownewell C.E., December 1982, Process for producing glucose
isomerase, U.S. Patent 4, 348, 480.
27.Bucke C 1977. in Topics in Enzyme and Fermentation
Biotechnology, Vol.1, Edited by A. Wiseman, Ellis Horwood,
Chichester, Academic Press ,New York, Pp.147-171.
28.Bucke C., 1981, Industrial glucose isomerase, In A. Wiseman(ed)
Topic in enzyme and fermentation biotechnology, vol 1, industrial
glucose isomerase, 141-171, Ellis Horwood, Chichester, United
Kingdom.
29.Bucke C., 1983, glucose transforming enzymes 93-127, in W.
Fogasty (ed) Topics in enzyme and fermentation biotechnology,
Applied science publishers, London.
30.Bulow L & Mosbach K 1991. Multienzyme systems obtained by
gene fusion. Trends Biotechnol., 9:225-231.
31.Cabalda V.M., White C. A., 1988, Enzyme starch utilization and
genetic engineering, Trends in Biotechnology, 6:184-189.

312

32.Carell H L et al 1984. X-ray crystal structure of D-Xylose isomerase


at 4 A0 resolutions. , J.Biol.Chem, 259:3230-3236.
33.Carrell H.L., J.P. Glusker, V. Burger, F. Manfre, D. Tritsch and J.F.
Biellman, 1989, X-ray analysis of D-xylose isomerase at 1.9A: A
native enzyme in complex with substrate and with a mechanism
designed inactivator, Proc. Natt. Acad. Ci., U.S.A. , 86: 4440-4444.
34.Carroll J.O., Swanson T.R. and Trackman P.c., 1990, US patent US
4933279.
35.Chang L.T., Exploring new sources of sugar.1982, The rapid
development of fructose production, J. Fd. Sci, tecr. (China), 7, 8.
36.Chen W P 1980 a. Glucose isomerase. , Process Biochem, Aug/Sep,
36-41.
37.Chen W P 1980 b. Glucose isomerase. Process Biochem,
June/July,30-35.
38.Chen W.P. and Chang Y.C., 1984, Production of high fructose rice
syrup and high protein rice flour from broken rice. J.Sci.Food. Agri,
35: 1128-1135.
39.Chen W.P., 1980, Glucose isomerase. Process Biochem, 15: 30-35, a.

313

40.Chen W.P., 1980, Glucose isomerase. Process Biochem, 15: 36-41, b.


41.Ching C. B. et al, 1984, Isomerisation of glucose to fructose in
fluidized bed bioreactor, Biotech. & Bioeng, 26:820-823.
42.Collyer C A et al, 1990. Mechanism for aldose-ketose
interconversion by D-Xylose isomerase involving ring opening
followed by a 1, 2 hybrid shift. J.Mol.Biol, 212:211-235.
43.Converti A & Chang C M, 1984. Simultaneous effects of
immobilization and substrate protection on the thermodynamics of
glucose isomerase activity and inactivation. Enzyme
Microb.Technol, 21 :511-517.
44.Coutinno P., Reilly P.J., 1997, Glucoamylase structural, functional
and evolutionary relationships, Protein, 334-347.
45.Crabb W.D. and Mitchinson C., Enzymes involved in the processing
of starch to sugars. 1997, Trends in Biotech.15, 349-353.
46.Crabb W.D. and Shetty J.K., Commodity scale production of sugars
from starches, Current opinion in microbiology, 1999, 2:252-256.
47.Cura, J. A., Jansson, P.E., and C.R. Krisman, 1995, Amylose is not
strictly linear, Starch / Staerke, 47:207-209.

314

48.Dale, J. K., Langlois, D.P., 1940, sirup and method of making the
same, United States patent 2, 201: 609.
49.Declerck N,. Jiyet D., Trosset J.Y., Garnier J., Gawllardin C., 1995,
Hyperthemostable mutants of Bacillus lichoniformis amylase:
multiple amino acid replacements and molecular modeling, Protein
Eng, 8, 1029-1037.
50.Deewer P., Amory a., 1994, Pullalanase, Microorganism producing
the same, method for preparation there of as well as its use.
European Patent Application # EP0605040.
51.Dekker K.A., Yamagata H. Sakaguchi K. and Udaka S., 1991,
Xylose (glucose) isomerase gene from the thermophile Clostridium
thermohydrosulphuricum: cloning, sequencing and expression in
E.coli.Agric.Biol.Chem., 55: 221-227.
52.Doelle M.B & Doelle H W, 1991.High fructose formation from
sugarcane syrup and molasses using Zymomonas mobilis mutants.
Biotechnol.Lett, 13 :875-878.
53.Dziedzic S. Z., Kearsley M. W., 1984. Glucose syrups: science and
technology. Elsevier Applied Science Publishers Ltd., London.

315

54.Fang T. Y., Coutinho P., Reilly P. J., Ford C., 1998, Mutations to alter
Aspergillus awamori Glucoamylase selectively, 1998, protein Engg.
11: 119-126.
55.Fang T. Y., Honzatko R.B., Reilly P. J., Ford C., 1998, Mutations to
alter Aspergillus awamori Glucoamylase selectively, 11, Protein
Engg., 11: 127-133.
56.Fang T.Y., Ford C., 1998, Protein engineering of Aspergillus
awamori, Glucoamylase to increase its pH optimum, Protein engg,
11: 383-388.
57.Farber G K, 1987, the 3.0A0 structure of Xylose isomerase and
xylokinase from Streptomyces olivochromogenes, Protein Eng., 1:
459-466.
58.Gerhartz N., 1990, Enzymes in industry, VCH, Weinheim.
59.Glasfeld, A, 1988, Characterization of crystals of Xylose isomerase
from Streptomyces violaceoniger. J.Biol.Chem. ,263:14612-14613.
60.Gray G.L., Mainzer S.E., Rey M.W., Lamsa M.H., Kindle K,
Carmona C, Reqvadt C., 1986, Structural genes encoding the
thermophilic amylase of Bacillus stereothermophilus and Bacillus
licheniformes, J.Bacteriol, 635-643.
316

61.Griffin V.K. and Brooks J.R., 1989, An update on the processing of


high protein rice products. Food Science , 54: 190-193.
62.Guzmn-Maldonado H., Parades-Lpez O., 1995. Amylolytic
enzymes and products derived from starch: a Review, Crit. Rev.
Food Sci. Nutr. 35, 5:373-403.
63.Hansen, L.P., Hosek, R., Callon, M., F.T.Jones, 1981, The
development of high protein rice flour for early childhood feeding,
Food Technol., 35, 1:38-42.
64.Hemmingsen S. H., 1979, Development of an immobilized glucose
isomerase producer, U.S. patent, 4,532,208.
65.Hizukuri, S. 1986, Polymodal distribution of the chain lengths of
amylopectins and its significance, Carbohydr. Res., 147: 342- 347.
66.Hood, L.F. 1982, Current concepts of starch structure., In
Carbohydrates, D.R. Lineback and G.E. Ingleu, Eds. AV1.218 224.
Westport C.T.
67.Hoseney, R.C. 1994, Principals of cereal science and technology,
American association of Cereal Chemists, St. Paul. M.N.

317

68.Houng, J. Y., 1993 Analysis of substrate production of high maltose


syrup using an immobilized glucose isomerase reactor, Biotechnol.
Bioeng., 41:451-458.
69.Hsiu-mei C., Li y., Panda T., Buehler Fu, Ford C., Reilly P., 1996,
Effect of replacing helical glycine residues with alanines on
reversible and irreversible stability and production of Aspergillus
awamori Glucoamylase protein eng, 9: 499-505.
70.htpp://www.ftns.wau.nl/prock/Research/Rik/maltodextrins/marchal.3
htm
71.htpp://www.sbu.ac.uk/biology/enztech/starch.htm
72.http:// bcs.whfreeman.com/lehninger.htm
73.http://en.wikipedia.org/wiki/sugar
74.http://foodoregonstate.edu/starch.htm
75.http://foodoregonstate.edu/starch/factor. htm
76.http://www.maize.org/cgi-bin/clickgo.pl
77.http://www.foodesource.org/content/pdf/starches/ch1.paf
78.http://www.fst.rdg.ac.uk/courses/fs560/topic1.index.htm

318

79.http://www.habibarkady.com/HAL/glucose.htm
80.http://www.orst.edu/instruct/nfm236/sugar/index.cfm
81.http://www.starch.dk/isi/starch/htm
82.Illanes A, 1996, Thermal inactivation of immobilized penicillin
acylase in the presence of substrate and products, Biotechnol.
Bioeng., 50:609-616.
83.Jei-Fu Shaw, Fu-pang-lin, Su- chin-chen, Hsing-chen Chen, 1995,
Purification and properties of an extra cellular amylase from
Thermus sp., 36: 195-200.
84.Jenkins J, 1992. Protein engineering of xylose (glucose) isomerase
from Actinoplanes missouriensis I. Crystallography and site directed
mutagensis of metal binding sites, Biochemistry, 31:5449-5458.
85.Jorgensen O.B., Karlsen L.G., Nielson N.B., Pedersen S. and Rugh
S., 1988, Starch/ Starke 40: 307-313.
86.Juliano and Bechtel, 1985, The rice grain and its gross composition,
Rice chemistry and technology,2nd edition, p1757,St.paul,MN,USA,AmAssoc.Cereal.Chem.

319

87.Juliano and Eggum, 1978,The rice caryopsis and its composition, In


D.F.Housten, ed, Rice Chemistry and Technology 1674,St.Paul, MN,
USA, Am.Assoc.Cereal Chem.
88.Jun Hu, 1986. Immobilization of cells containing glucose isomerase
using a multifunctional cross-linking reagent. Biotech.Lett., 2: 127130.
89.Karakatsanis A., Liakopoolou-Kyriakides.M.and Staunatoudis.M.,
1997, Hydrolysis

of various starches by the synergistic action of

Glucoamylase in aqueous two phase impeller agitated system. Starch


/ Starke, Nr: 5.7, S194-199.
90.Kemph, 1984, Recent trends in European community and West
German Starch industries, Starch, 36:333-341.
91.Kennedy J F., Cabalda, V.M., White, C. A., 1988, Enzymatic Starch
Utilization and genetic engineering, Tibtech, 6: 184-189.
92.Kerr R.W., Cleveland F.C., Katzbeck W.J., 1951, The action of
amyloglucosidase I on amylose and amylopectin, J. Am. Chem. Soc.
73 : 3916-3921.
93.Ketosis@group

320

94.Kikuchi T, 1990., Molecular cloning of the xyl A gene encoding


xylose isomerase from Streptomyces griseofucus S-41: primary
structure of the gene and its product. Agri.Biol.Chem, 54:2469-2472.
95.Koch R.A., Spreinat K., Lemke G., Antranikian, 1991, Purification
and properties of a thermoactive amylase from the
archarbacterium pyrococcus woeset. ,Arch. Microbial. 155: 572-578.
96.Koen. Dekker, Hideo Yamagata, Kenji Sakaguchi and Shigezo
Udaka, 1991, Xylose (glucose) isomerase gene from the
thermophilic, Thermus thermophilus: Cloning, sequencing and
comparison with other thermostable xylose isomerases., Journal of
Biotechnology, 173, 10:3078-3083.
97.Kulkarni D.N., Kshirsagar S.S. and U. M. Ingle, 2000, Processing of
sorghum grain for starch and glucose syrup, Maharashtra Agriculture
University, Parbani, Unpublished Work.
98.Kulkarni D.N., Mrs. Kulkarni K.D., Satwadhar P.N.and Miss
Tasneem Naheed, 1986, Study of causal factors for low shelf life of
hybrid Sorghum., Agresco report submitted to M.A.U. Parbani.
99.Kurt G.I. Nilsson, Klaus Mosbach and Kenji Sakaguchi, 1991,
Increased yield of fructose from glucose employing thermophilic

321

xylose isomerase in water- ethanol mixture, Biotech. Letters. 13,


11:787-792.
100.

Lee C, 1990, Catalytic mechanism of xylose (glucose)

isomerase from Clostridium thermosulfurogenes. J.Biol.Chem,


265:19082-19090.
101.

Legin E., Copinet A. and Duchiron F., 1998, A single step

high temperature hydrolysis of wheat starch / starke 50Nr, 2-3, S:


84-89.
102.

Lehmacher A. and H. Bisswanger, 1990, Comparative

kinetics of D-xylose and D-glucose isomerase activities of the Dxylose isomerase from Thermus aquaticus HB8. Biot. Chem.,
Hoppe- Seyler, 371: 527-536.
103.

Lehmacher A. and H. Bisswanger, 1990, Isolation and

characterization of an extremely thermostable D- xylose isomerase


from Thermus aquaticus HB8. J of Gen. Microbiology, 136: 679686.
104.

Lehninger A L, 1993, Principles of Biochemistry, 2nd Edn.,

Worth publishers, Inc., U.S.A,Pp 400-445.

322

105.

Li y., Reilly P.J., Ford C., 1997, Effect of introducing proline

residues on the stability of Aspergillus awamori, protein engg.10:


1199-1204.
106.

Ljungcrantz P, 1989. Construction of an artificial

bifunctional enzyme, -galactosidase/galactose dehydrogenase,


exhibiting efficient galactose channeling. , Biochem., 28:8786-8792.
107.

Lopez- Ulibarri R., Hall G.M., 1997, Saccharification of

cassava flour starch in a hollow fibre membrane reactor, Enzyme and


microbial tech., 21: 398-404.
108.

Lui H.S., Coutinho P., Ford C., Reilly P.J., Mutations to alter

Aspergillus awamori Glucoamylase selectively, 1998, Protein engg:


389-398.
109.

Mac Allister, R.V., Nutritive sweeteners made from starch, In

Advances in Carbohydrates, Academic Press Publisher, New York,


1979,Vol. 35,p 15-56.
110.

Marchal L. M., J. Jonker, G.T. Francke, C.D. de Gooljer and

J. Trampr, 1999, Process conditions as amylolytic hydrolysis of


amylose potato starch: experimented design, Biotechnol.
Bioengg.62: 348- 357.

323

111.

Marchal L.M., A.M.J.Vander Laar, E. Goetheer, E.B.

Schimmelpennink, J. Bergsma, Effect of temperature saccharide,


composition upon amylase of starch. Biotechnol. Bioenergy.
1999:944-999.
112.

Marshall R.O., and E.R. Kooi, 1957, Enzymatic conversion

of D-glucose to D-fructose, Science, 125: 648-649.


113.

Martin Chaplin and Christopher Bucke, 1990 in enzyme

technology, Cambridge University Press (updated on internet 20 Feb.


2005).
114.

Melasniemi H., 1987, Characterization of amylase and

pullalanase activities of Clostridium thermohydrosulfuricam,


Biochem. J. 246: 193-197.
115.

Mitchinson, C., Requadt, C., Ropp, T.H., and Solheim, L.P.

(1996) PCT Patent Application WO 96/39528.


116.

Nakamura T., Ogata Y., Shitara A., Nakamura A., Onta K,

1995, Continuous production of fructose syrups from inulin by


immobilization from Aspergillus niger mutant, Journal of
fermentation and bioengineering, 80, 2: 164-169.

324

117.

Nilsson, K .G. I., 1991, Increased yield of fructose from

glucose employing thermophilic xylose isomerase in water-ethanol


mixtures, Biotechnol.Letters., 13:787-792.
118.

Nixon A E, 1998, Hybrid enzymes: manipulating enzyme

design, Trends Biotechnol, 16:258-264.


119.

Palazzi, E. and Converti, A., 1999, Generalized linearization

of kinetics of glucose isomerisation to fructose by immobilized


glucose isomerase,Biotech.Bioengg., 63:273-284.
120.

Palazzi ,E.and Converti, A., 2001, Evaluation of diffusional

resistances in the process of glucose isomerisation to fructose by


immobilized glucose isomerase. Enzyme and microbial technol.,
28:246-252.
121.

Palmer G.H., Etokakpan O.U., Igyor M.A., Sorghum and

brewing material, MIRCEN Jour of appl. Microbial and biotechnol.,


1989, 5: 265-275.
122.

Palmer G.H., J. lnst.Brewing, 1972, 78:326-332.

123.

Palmer, G.H., 1989, Cereals in malting and brewing. In the

cereal science and technology, ed. Palmer, G.H. pp. 61-142.


Aberdeen: Aberdeen university press.
325

124.

Paperloop.com-leading the pulp paper. Packaging and

printing industry. htm


125.

Payen, A., Persoz, J.F., 1833, Memoire surla diastaste, Ies

principaux produits de ses reactions, et leurs applications aux arts


industriels, Ann, Chim (phy) 53: 73 92.
126.

Pederson, S., 1993, Industrial aspects of immobilized

glucose isomerase, Bioprocess technol., 16:185-208.


127.

Phillips L.L., Caldwell M. L., 1951, A study of the action of

Glucoamylase, a glucose producing amylase, formed by the mold,


Rhizopus delemar., J.Am.Chem.Soc. 73: 3563-3568, a.
128.

Phillips L.L., Caldwell M.L., 1995, A study of the

purification and properties of a glucose forming amylase from


Rhizopus delamar glucose amylase, J. Am. Chem. Soc. 73: 35593563,b.
129.

Pieters, B. R., and Bardetteli, G., 1992, Enzyme

immobilization on low cost magnetic support: Kinetic studies on


immobilized and Co-immobilized glucose oxidase and
glucoamylase. Enzyme Microb.Technol., 14:361-370,a.

326

130.

Pieters, B. R., and Bardetteli, G., 1992,. Glucose

immobilization on a magnetic micro particle for the continuous


hydrolysis of maltodextrins in a fluidised bed reactor,
Appl.Biochem.Biotech, .32: 37-53.
131.

Pilnik W., Voragen, A.G., 1990, Use of enzymes in food

processing, Food Biotechnol., 4: 319-321.


132.

Puspamma P., Chittemma Rao, K. Kamini Devi and

Manorma, 2000, Unpublished work, A.P. Agricultural university,


Hyderabad.
133.

Rasmussen H. 1994. Sect. D., Crystallization and

preliminary investigation of Xylose isomerase from Bacillus


coagulans. , Acta. Crystallogr, 50 : 269-272.
134.

Reed G., 1975, Enzyme in food processing. Academic Press

New York and London, 5-15.


135.

Reilly P J 1979. Starch hydrolysis with soluble and

immobilized Glucoamylase and glucose isomerase in Applied


Biochem and Bioengg. Vol.2, edited by Wingard L B KatchalskiKatzir E Goldstein. L, Academic Press, New York, Pp 185-227.

327

136.

Rey F, 1988. Structural analysis of the 2.8A0 model of xylose

isomerase from Actinoplanes Missouriensis. Proteins


Struct.Funct.Genet., 4: 165-172.
137.

Rita Singh, 2002, Introduction of biotechnology, principle

and applications, vol 2, global version publishing house, Delhi,


India.
138.

Rooney L.W., Miller F.R., 1987, Variation in the structure

and internal characteristics of sorghum in the international


symposium on sorghum grain quality, ICRISAT, Pantancharu, India,
eds, L.W. Rooney, D.S.Murthy and J.V.Martin, 143-173.
139.

Rose I A, 1969, Stereochemical evidence for a cis-enadiol

intermediate in Mn- dependent isomerases, Biochim.Biophs.Acta.,


178:376.
140.

Saari, G.C., A.A. Kumar, G.H.Hamasaki, M.Y.Insley and

P.J.OHara, 1987, Sequence of the of Ampullariella sp. Strain 3876


gene coding for xylose isomerase, J., Bactoriol.,169 : 612-618.
141.

Sathisch, P., Sun, C., Lonneforg, A., Jansson, C., 1995,

Mutation: Modified starch metabolism in mutant and transgenic


plants, Prog Botany 56: 301-318.

328

142.

Scheck, F. W., 2002. Starch hydrolysates An overview. Int.

Sugar Jnl. 104:1238, 82-89.


143.

Schellenberg, G. D., 1984. Xylose isomerase from E.coli.

J.Biol.Chem, 259:6826-6832.
144.

Schenck F.W., Starch hydrolysis products; An introduction

and history, 1-22, In: Schenck F.W. and Hebeda R.E. (eds), Starch
hydrolysis products; Worldwide technology, production and
applications, VCH Publishers, New York, 1992.
145.

Schhafhauser, D. Y. and Storey, K. B., 1993, Co-

immobilization of amyloglucosidase and pullalanase onto granular


chicken bone for enhanced starch degradation.
Appl.Biochem.Biotech, 17 :103-113.
146.

Schhafhauser D Y& Storey K B 1992. Immobilization of

amyloglucosidase onto granular chicken bone.


Appl.Biochem.Biotech., 32 :89-109.
147.

Schwardt, E., 1990, Production and use of enzyme degrading

starch and some other polysaccharides, Food Biotechol., 4:337-351.


148.

www.Science.ntu.ac/ak/research/bemet/chapter1

329

149.

Shaw, J.F., and J.R, Sheu, 1992, Production of high maltose

syrup and high protein flour from rice by an enzymatic method.


Biosci. Biotech Biochem, 56:1071-1073.
150.

Shaw J.F., U.S. patent, 5,312, 739 and Chinese patent 60191,

Production of high maltose syrup and high protein by product from


materials that contain starch and protein by enzymatic process,
1994,1993.
151.

Shaw J.F., R.S. Pan and W.H. Hso, 1989, Influence of pH on

the inactivation of isoamylase, Bot. Bull. Acad Sin. , 30: 91-95.


152.

Shaw Jei-Fu, Lin, Fu-Pang, Chen, Su, Chiu, Chen Hsing,

Chen Chen, 1995, Purification and properties of an extra cellular


alpha amylase from Thermus sp., Bot, Bull, Acad. Sin.36: 195-200.
153.

Slominska L., Krisowska M.and A. Grzeskowiak, 2003,

Degradation of starch granules by amylase, vol 6, 2.


154.

Stastical outline of India, 1989-90, Tata services Ltd.,

Department of Economics and statistics edn. , July 1989, 50.


155.

T. Satyanarayana, S.M. Noorwez, S. Kumar, J. Lumrao, M.

Ezhilvannar, P. Kaur, 2004, Biochem. Soc. Trans. 32: 276-278.

330

156.

Takasaki, Y., 1971, Studies on sugar isomerizing enzymes.

Effects of borate on glucose-fructose isomerization catalyzed by


glucose isomerase, Agric.Biol.Chem., 35:1371-1375.
157.

Takasaki Y. and O. Tanabe, 1962, Formation of fructose

from glucose by bacteria I, Properties of glucose isomerase. Hakko


Kyokaiahi, 20: 449-455.
158.

Takasaki Y. and O. Tanabe, 1963, Isomerization of sugar by

bacteria, I, cultural condition for glucose isomerising bacteria.


Kogyo Gijutsu-in Hakko Kenkyusho Kenkyu, 23: 41-47.
159.

Takasaki Y. and O. Tanabe, 1964, NAD linked D-glucose

isomerising and D-mannose isomerising enzyme from


Paracolobacterium aerogenoides, Agric. Biol. Chem., 28: 740-741.
160.

Takasaki Y. and O. Tanabe, 1966, Studies on isomerisation

of sugars by bacteria, IX. NAD- linked D-glucose isomerising and


D-mannose isomerising enzyme from Paracolobacterium
aerogenoides, Agric, Biol. Chem. 30: 220-225.
161.

Tucker G.A. and Woods, L.F.J., 1991, Enzyme in food

processing, Blackie and Son limited, U.S., pp 16-101, 174.

331

162.

Twisk P.U. and Keltzer B.W., 1976, Production of glucose

from maize grits on commercial scale, Stark, 28:23.


163.

van den, Tweel W J, 1993 In Stability and stabilization of

enzymes, Elsevier Amsterdam, Pp 78.


164.

Van Soest, J.J., G. Vuegenthart, J.F.G., 1997, Cristallinity in

starch plastics, Consequences for material properties, Tibtech,


15:208-213.
165.

Vangrysperre W., M. Callens, H. Kersters-Hilderson and

C.K. Bruyne., 1988, Evidence for an essential histidine residue in Dxylose isomerases, Biochem. J., 250: 153-160.
166.

Verhoff F.H., G. Boguslawski, O.J. Lantero, s.t. Schlages and

Y.C. Jan, 1985, Glucose isomerase. 837-859, In M. Moo-Young(ed),


Comprehensive Biotechnology, vol 3, Pergamon Press, New York.
167.

Visuri K. and Klibanov A., 1986, Enzymic products of high

fructose maize syrup (HFCS) containing 55%fructose in aqueous


ethanol,Biotechnol. Bioeng. 30:917-920.
168.

Wealth of India: vol 9, Raw materials, publications and

information directorate CSIR, New Delhi, 1972, 450.

332

169.

Whistler, R.L., Bemiller, J.N. and Paschall, E.F., 1984,

Starch chemistry and technology, 2nd : Academic press, Orlando.


170.

Wilhelm, M., and Hollenberg, C. P., 1985, Nucleotide

sequence of the Bacillus subtilis, xylose isomerase gene: Extensive


homology between the Bacillus and E.coli enzyme. Nucleic Acids
Res., 13:5717-5722.
171.

Wiseman A. (ed), 1975, Hand book on enzyme

biotechnology, Ellis Horwood ltd., Chichester, United Kingdom.


172.

www.brookfieldengeneering.com

173.

www.genecor.com

174.

www.unece.org/stats/econ/iwg.argri/iwg

175.

Yoon, S. K., 1989, Optimal temperature control in a multi-

stage immobilized enzyme reactor system, J. Fermen. Bioeng., 68:


136-140.
176.

Zobel, H.F., 1988, Molecules to granules. A comprehensive

starch review, starch / Staerke 40: 44 50.

333