Professional Documents
Culture Documents
discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/264050219
CITATIONS
READS
10
177
5 authors, including:
Mehdi Hassanshahian
Michail M Yakimov
SEE PROFILE
SEE PROFILE
Maria Genovese
Simone Cappello
SEE PROFILE
SEE PROFILE
Department of Biology, Faculty of Sciences, Shahid Bahonar University of Kerman, Kerman, Iran
Istituto per lAmbiente Marino Costiero (IAMC), CNR of Messina, Messina, Italy
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 4 December 2013
Received in revised form
24 April 2014
Accepted 9 June 2014
The real-time polymerase chain reaction (RT-PCR) was used to follow changes in the proportion of
hydrocarbonoclastic bacteria in the marine microbial community in oil polluted mesocosms during
bioremediation eld trial. Assay for alk-B1 of Alcanivorax borkumensis and alk-BT of Thalassolituus oleivorans were validated and found to be both sensitive and reproducible. Quantication of alk-B1 from
A. borkumensis SK2 in mesocosms show that in single bioaugmentation mesocosm (M1) this gene has
high quantity in fth day of sampling but in biostimulating mesocosm (M2) and consortium bioaugmentation mesocosm (M3) the high quantity of this gene was in tenth day of sampling. The comparison between expression of alk-BT and alk-B1 in M3 mesocosm show that alk-B1 copy number was
more than alk-BT. The proportion of alk-B1 or alk-BT containing bacteria was positively correlated to the
concentration of crude oil in the mesocosms. After the concentration of crude oil in the mesocosms
decreased the gene copy number of alkane monooxygenase genes also decreased.
2014 Elsevier Ltd. All rights reserved.
Keywords:
Biodegradation
Crude-oil
Expression
Mesocosm
Quantication
1. Introduction
Oil spills occur frequently and are a major cause of marine
pollution. Crude oil is composed mainly of hydrocarbons, such as
saturated hydrocarbons, aromatics, resins and asphaltenes (Harayama
et al. 1999; Hassanshahian et al., 2013). Saturated hydrocarbons and
aromatics are easily biodegradable; for efcient remediation after
oil spills; we need to understand the behavior of microbial populations responsible for degrading crude oil (Hassanshahian et al.,
2012a, b, 2014a).
In bioremediation studies, the quantitative analysis of functional
genes have provided a valuable tool for studying the relationship
between specic microbial populations and the performance of the
degradation processes (Ringelberg et al., 2001; Piskonen et al.,
2005). In the environment, however, wide ranges of bacteria
participate in the degradation of organic contaminants. Since
diverse bacteria are associated with different phases of pollutant
degradation (Watanabe et al., 2002; Katsivela et al., 2004) better
interpretation of the microbial community dynamics occurring
during the progression of decontamination is important in the
242
243
Fig. 2. Bacterial densities determined by DAPI (cell mL1) staining during mesocosm experiment. Concentration of the cells observed in M1 (Seawater with crude oil and
inorganic nutrients); M2 (seawater with crude oil, inorganic nutrients and a single Alkanivorax borkumensis SK2 inoculum) and M3 (seawater with crude oil, inorganic nutrients and the bacterial consortium Alkanivorax borkumensis SK2 e Thalassolituus oleivorans MIL-1); experiment are depicted as white (M1), gray (M2) and black (M3)
bars respectively.
addition of A. borkumensis SK2T and T. oleivorans MIL-1T was indicated as mesocosm 3 (M3).
2.6. Sampling strategy and parameters assayed
All experimentations have been conducted for 20 days. To
monitor the succession bacterial activity on xed days (0, 3, 5, 10, 15
and 20) from the time zero (T0; introduction of oil, inorganic nutrients and bacteria) sub-volumes of sea-water were collected. Total
microbial abundance (DAPI count), measures of microbial activity
(screening of functional genes and quantication of alkane monooxygenase gene alkB by Real-Time PCR) were carried out from each
collected samples. The composition of total extracted and resolved
hydrocarbons and their derivates (TERHC) were also analyzed.
2.7. Total bacterial count
After short-time (3000 ) ultrasonic treatment, the total bacterial
cell counts were performed by DAPI (40 ,6-diamidino-2phenylindole 2HCl, SigmaeAldrich, Milan, Italy) staining on
samples xed with formaldehyde (2% nal concentration), according to Porter and Feig (1980). Slides were examined by epiuorescence with an Axioplan 2 Imaging (Zeiss) microscope (Carl
Zeiss, Thornwood, NY, USA). Results were expressed as number
of cells ml1.
2.8. DNA/RNA extraction and crDNA synthesis
Extraction of DNA and RNA from samples in study was performed using a DNA/RNA extraction kit (QIAGEN, Valencia, CA,
USA) according to manufacture instruction. The rRNA-crDNA heteroduplex was synthesized by reverse transcription using the
random primer (hexamer) oligonucleotides and SuperScript II
RNase H-free reverse transcriptase (Life Technologies). RT amplication was realized by using the protocol recommended by the
manufacture with 20 ml reaction mixtures containing 200 mM of
deoxynucleoside triphosphate, 5 mM of hexamer, 50e100 ng of
denatured RNA with a GeneAmp PCR System 2700 (Applied
Length (bp)
Sequence
Alk-b1F
Alk-b1R
Alk-b2F
Alk-b2R
P450F
P450R
Alk-bTF
Alk-bTR
PhnAF
PhnAR
TMOAF
TMOAR
C23OF
C23OR
BPHF
BPHR
24
21
20
20
20
24
18
18
22
21
21
21
21
25
22
23
AATTGGCCTATATCTCGTATGCCA
GCTTAGGAACAACGGATTAGG
CGCCGTGTGAATGACAAGGG
CGACGGTTGGCGTAAGCATG
GTGGGCGGCAACGACACGAC
GCAGCGGTGGATGCCGAAGCCTAA
GACGTCGCCACACCTGCC
GGGCCATACAGAGCAAGC
CGTTGTGCGCATAAAGGTGCGG
CTTGCCCTTTCATACCCCGCC
GCTATGTTACCGAAGAGCAGC
GGAATAGATCCCAGTACCAGG
CAAGGCCCACGACGTGGCNTT
CGGTTACCGGACGGGTCGAAGAAGT
TGCAGCTACCACGGCTGGGCCTA
GCNGCRAAYTTCCARTTRCANGG
150
150
400
200
150
300
270
150
244
3. Results
Real-time PCR analysis was performed using the SYBR Greenbased detection system.
Real-time PCR was run in a 7300 Real-time PCR System
(Applied Biosystems, Foster City, CA) in triplicate. The reaction
mixture was prepared using SYBR Green PCR Master Mix Applied
Biosystems in a total volume of 25 ml containing 12.5 ml of Master
Mix, 0.5 ml of forward and reverse primers (at optimized concentrations), 1 ml of DNA containing 20 ng from pure culture
samples and 50 ng from tissue samples. Sterile MilliQ water was
used to adjust the volume of each reaction to 25 ml. A no-template
control (NTC) and a positive control DNA from pure culture were
included on each plate.
The thermal cycling protocol included an initial denaturation
step at 95 C for 10 min, followed by 38 cycles of denaturation at
95 C for 1 s and annealing/elongation at 57 C for 5 s. A dissociation
step was added to check for primer-dimer formation.
.
E 101 slope1
Table 2
Results of screening of functional genes in DNA and cDNA of mesocosms samples,
Positive amplication is indicated as ; negative amplication is indicated as .
Mesocosm
M1 DNA
M2 DNA
M3 DNA
M1 cDNA
M2 cDNA
M3 cDNA
Gene
alk-B1
alk-B2
cyt-P450
alk-BT
c23O
bpH
tmoA
phnA
e
e
e
e
e
e
e
e
e
e
e
e
e
e
e
e
e
e
e
e
e
e
e
e
e
e
245
Fig. 3. Gel electrophoresis (1.5%, agarose) of real time PCR products of gene alk-B1
(200 bp) and gene alk-BT (150 bp). Lane (L), 100 bp DNA size marker Ladder; lane
(1), positive control (Alkanivorax borkumensis SK2); lanes (2e7), mesocosm samples,
lane (8) negative control (Distill water), lane (9) positive control for alk-BT (Thalassolituus oleivorans MIL-1), lanes (10e15), mesocosm samples, lane (16) negative control.
The standard curves for both assays were linear (r2 > 0.95) over
8 orders of magnitude for the alkB and alk-BT genes assay (Fig. 4).
This equated to a lower limit of 3 copies mL1 for the alkB and alk-BT
genes assay. The r2 values were consistently greater than 0.95 and
usually greater than 0.99 for both assays. Once the primer concentration was optimized, the efciency of the reactions was between 0.9 and 1.1 (or 90e110%). Runs that fell outside these
parameters (r2 < 0.95 and efciency < 0.9 or >1.1) were repeated.
There was usually no signal in the no-template control for the alkB
and alk-BT genes assay.
Fig. 4. Real-time PCR alk-B1 Alcanivorax borkumensis SK2 (1) and alk-BT Thalassolituus oleivorans MIL-1 dissociation plot measured during mesocosm experimentations.
246
Fig. 5. Standard curves for quantication, plotted from duplicate samples using Ct
values of tenfold dilutions for alkane monooxygenase gene (alk-B); empty triangle and
squares indicated different replicate.
Fig. 8. Copy number of alk-BT gene from T. oleivorans in three experimental mesocosms (M1, M2 and M3).
Fig. 6. Copy number of alk-B1 gene from A. borkumensis SK2 identied in experimental
mesocosms carried out in this study.
Fig. 9. The comparison between expression of alk-B1 from A. borkumensis SK2 (white
bars) and alk-BT from T. oleivorans (black bars) during M3 experimentation.
247
Fig. 10. Percentage of degradation of crude oil detected in Mesocosm 1 (black squares), Mesocosm 2 (black triangle) and Mesocosm 3 (dark circles) experiments; all data were
expressed as the percentages compared to initial petroleum sample (time zero). Control means the effect of petroleum weathering during mesocosm experiment (empty circles)
monitored in a separated tank lled with sterile seawater and Arabian light oil.
highest degradation of crude oil (~95%); that consortium bioaugmentation mesocosm (M3) and biostimulating mesocosm (M1)
present rate of bioremediation of ~70 and ~80%, respectively.
Effect of petroleum weathering during microcosm experiment
was monitored in separated tank lled with sterile seawater and
Arabian light oil. The obtained results indicated that evaporation of
light petroleum hydrocarbons did occur and resulted in a loss of 5%
of TERHC fraction (data not show).
4. Discussion
Real time PCR (RT-PCR) was mainly used for the detection and
quantication of pathogens such as Salmonella, Vibrio cholerae and
Escherichia coli (Zhang et al., 2006). More recently applications of
RT-PCR were extended to environmental samples analysis (Zhang
et al., 2006). For example Hall et al. (2002) use RT-PCR to monitor
the nitrifying bacteria population dynamics in wastewater treatment plants. Powell et al. (2006) an RT-PCR method for analysis the
changes in hydrocarbon-degrading microbial community in Antarctic soil during bioremediation.
In this study an RT-PCR method were used for understanding
the microbial changes and dynamic during crude oil biodegradation in mesocosms. The results of this study conrmed that the
alkane monooxygenase gene (alk-B1 and alk-BT) expressed in the
mesocosms until the crude oil was present and after biodegradation of crude oil the level of expression of these genes decreased but
the patterns in different mesocosms were variable.
Various studies have shown that the addition of fertilizer (biostimulation) or external bacteria (bioaugmentation) to oil contaminated seawater increased oil biodegradation (Hassanshahian et al.,
2012b). However, few studies have followed the microbial population dynamics in any detail, often only showing an increase in the
number of total or hydrocarbon-degrading bacteria. Here we
showed that there is a link between the decrease in the amount of
alkanes present with the number of alk-B and changes in the microbial community structure as shown in Fig. 5. The highest copy
number of this genes is on fth day of sampling and in the end of
experiment (T15 and T20) the quantity of this genes decreased that
this correlated to increment in biodegradation of crude oil in the
mesocosms that shown in Fig. 10. Similar patterns were seen for
alk-BT of Thalassolituus (Fig. 8). Thus the low quantity of alk-B1 in
T15 and T20 may be attributed to biodegradation of major fraction of
5. Conclusion
Real-time PCR is an ideal technique for ecological studies as a
single DNA extract can be analyzed for many genes, allowing a
quantitative approach to analyzing both community structure
and function. In this study, we found that Real-time PCR
was more reproducible, less labor-intensive, and quicker techniques for the study of dynamic of the microbial community in
the contaminated seawater mesocosms and data obtained
revealed that bioremediation actions (biostimulation and bioaugmentation) stimulated crude oil degrading bacteria than
other genus in the marine microbial community. However, it is
important that Real-time PCR assays are tested thoroughly for
specicity and reproducibility and that the limitations of the
method are recognized.
Acknowledgment
This work was supported by grants of Shahid Bahonar University
of Kerman and by National Counsel of Research (CNR) of Italy.
248
References
Beller, H.R., Kane, S.R., Legler, T.C., Alvarez, P.J.J., 2002. A real-time polymerase chain
reaction method for monitoring anaerobic, hydrocarbon degrading bacteria
based on a catabolic gene. Environ. Sci. Technol. 36, 3977e3984.
Cappello, S., Crisari, A., Hassanshahian, M., Genovese, M., Santisi, S.,
Yakimov, M.M., 2012. Effect of a bioemulsicant exopolysaccharide (EPS2003)
on abundance and vitality of marine bacteria. Water. Air. Soil. Pollut. 233 (6),
3219e3226.
Cappello, S., Denaro, R., Genovese, M., Giuliano, L., Yakimov, M.M., 2006. Predominant growth of Alcanivorax during experiments on oil spill bioremediation in
mesocosms. Microbiol. Res. 162 (2), 185e190.
Chandler, D.P., Brockman, F.J., 1996. Estimating biodegradative gene numbers
at a JP-5 contaminated site using PCR. Appl. Biochem. Biotechnol. 57/58,
971e982.
Crisa, F., Denaro, R., Genovese, M., Cappello, S., Mancuso, M., Genovese, L., 2011.
Comparison of 16SrDNA and toxR genes as targets for detection of Vibrio
anguillarum in Dicentrarchus labrax kidney and liver. Res. Microbiol. 162 (3),
223e230.
Devers, M., Soulas, G., Martin-Laurent, F., 2004. Real-time reverse transcription PCR
analysis of expression of atrazine catabolism genes in two bacterial strains
isolated from soil. J. Microbiol. Methods 56, 3e15.
Dutta, T.K., Harayama, S., 2001. Analysis of long-side chain alkylaromatics in crude
oil for evaluation of their fate in the environment. Environ. Sci. Technol. 35,
102e107.
Dyksterhouse, S.E., Gray, J.P., Herwig, R.P., Lara, J.C., Staley, J.T., 1995. Cycloclasticus
pugetii gen. nov., sp. nov., an aromatic hydrocarbon-degrading bacterium from
marine sediments. Int. J. Syst. Bacteriol. 45, 116e123.
Golyshin, P.N., Werner, J., Chernikova, T.N., Tran, H., Ferrer, M., Yakimov, M.M.,
Teeling, H., Golyshina, O.V., MAMBA Scientic Consortium, 2013. Genome
sequence of Thalassolituus oleivorans MIL-1 (DSM 14913T). Genome Announc. 1
(2z), 1e2. http://dx.doi.org/10.1128/genomeA.00141-13.
Hall, S.J., Hugenholtz, P., Siyambalapitiya, N., Keller, J., Blackall, L.L., 2002. The
development and use of real-time PCR for the quantication of nitriers in
activated sludge. Water Sci. Technol. 46, 267e272.
Harayama, S., Kishira, H., Kasai, Y., Syutsubo, K., 1999. Petroleum biodegradation in
marine environments. J. Mol. Microbiol. Biotechnol. 1, 63e70.
Hasanshahian, M., Emtiazi, G., 2008. Investigation of alkane biodegradation using
the microtiter plate method and correlation between biolm formation, biosurfactant production and crude oil biodegradation. Int. Biodeter. Biodegr. 62,
170e178.
Hassanshahian, M., Emtiazi, G., Kermanshahi, R., Cappello, S., 2010. Comparison of
oil degrading microbial communities in sediments from the Persian Gulf and
Caspian Sea. Soil. Sediment. Contam. 19 (3), 277e291.
Hassanshahian, M., Emtiazi, G., Cappello, S., 2012a. Isolation and characterization of
crude-oil-degrading bacteria from the Persian Gulf and the Caspian Sea. Mar.
Pollut. Bull. 64, 7e12.
Hassanshahian, M., Tebyanian, H., Cappello, S., 2012b. Isolation and characterization
of two crude-oil degrading yeast strains, Yarrowia lipolytica PG-20 and PG-32
from Persian Gulf. Mar. Pollut. Bull. 64, 1389e1391.
Hassanshahian, M., Ahmadinejad, M., Tebyanian, H., Kariminik, A., 2013. Isolation
and characterization of alkane degrading bacteria from petroleum reservoir
waste water in Iran (Kerman and Tehran provenances). Mar. Pollut. Bull. 73,
300e305.
Hassanshahian, M., Emtiazi, G., Caruso, G., Cappello, S., 2014a. Bioremediation
(bioaugmentation/biostimulation) trials of oil polluted seawater: a mesocosm
simulation study. Mar. Environ. Res. 95, 28e38.
Hassanshahian, M., Zeynalipour, M.S., Hosseinzadeh, Musa F., 2014b. Isolation and
characterization of crude oil degrading bacteria from the Persian Gulf (Khorramshahr provenance). Mar. Pollut. Bull. 82, 39e44.
Heid, C.A., Stevens, J., Livak, K.J., Williams, P.M., 1996. Real time quantitative PCR.
Genome Res. 6, 986e994.
Heiss-Blanquet, S., Benoit, Y., Marechaux, C., Monot, F., 2005. Assessing the role of
alkane hydroxylase genotypes in environmental samples by competitive PCR.
J. Appl. Microbiol. 99, 1392e1403.
Joshi, B., Walia, S., 1996. PCR amplication of catechol 2,3-dioxygenase gene sequences from naturally occurring hydrocarbon degrading bacteria isolated from
petroleum hydrocarbon contaminated groundwater. FEMS Microbiol. Ecol. 19,
5e15.
Katsivela, E., Moore, E.R.B., Kalogerakis, N., 2004. Monitoring of the microbial activities and the diversity of the microbial community degrading renery waste
sludge. Water. Air. Soil. Pollut. 4, 75e85.
Kazunari, S., Sugimoto, Y., Kazuhiro, M., Hideaki, H., Kohno, T., 2003. Monitoring of
alkane-degrading bacteria in a sea-water microcosm during crude oil degradation by polymerase chain reaction based on alkane-catabolic genes. Environ.
Microbiol. 6, 517e522.
MacKay, I.M., 2004. Real-time PCR in the microbiology laboratory. Clin. Microbiol.
Infect. 10, 190e212.
nen, M., Rajam
vaara, M., 2005. Monitoring of accelPiskonen, R., Nyysso
aki, T., Ita
erated naphthalene-biodegradation in a bioaugmented soil slurry. Biodegradation 16, 127e134.
Porter, K.G., Feig, Y.S., 1980. The use of DAPI for identifying and counting aquatic
microora. Limnol. Oceanogr. 25, 943e948.
Powell, M., Ferguson, H., Bowman, J., Snape, I., 2006. Using real-time pcr to assess
changes in the hydrocarbon-degrading microbial community in antarctic soil
during bioremediation. Microbiol. Ecol. 52, 523e532.
Rasmussen, S., 2001. Quantication on the light cycler. In: Meuer, S., Wittwer, C.,
Nagakawara, K. (Eds.), Rapid Cycle Real-time PCR, Methods and Applications.
Springer Press, Heidelberg, pp. 21e34.
Ringelberg, D.B., Talley, J.W., Perkins, E.J., Tucker, S.G., Luthy, R.G., Bouwer, E.J.,
Fredrickson, H.L., 2001. Succession of phenotypic, genotypic, and metabolic community characteristics during in vitro bioslurry treatment of polycyclic aromatic
hydrocarbon contaminated sediments. Appl. Environ. Microbiol. 67, 1542e1550.
Rodkhum, C., Hirono, I., Stork, M., Di Lorenzo, M., Crosa, J.H., Aoki, T., 2006. Putative
virulence-related genes in Vibrio anguillarum identied by random genome
sequencing. J. Fish. Dis. 29, 157e166.
Schneiker, S., Martins dos Santos, V.A., Bartels, D., Bekel, T., Brecht, M., Buhrmester, J.,
Chernikova, T.N., Denaro, R., Ferrer, M., Gertler, C., Goesmann, A., Golyshina, O.V.,
Kaminski, F., Khachane, A.N., Lang, S., Linke, B., McHardy, A.C., Meyer, F.,
Nechitaylo, T., Phler, A., Regenhardt, D., Rupp, O., Sabirova, J.S., Selbitschka, W.,
lter, F.J., Weidner, S., Kaiser, O., Golyshin, P.N.,
Yakimov, M.M., Timmis, K.N., Vorho
2006. Genome sequence of the ubiquitous hydrocarbon-degrading marine bacterium Alcanivorax borkumensis. Nat. Biotechnol. 24 (8), 997e1004.
Sei, K., Sugimoto, Y., Mori, K., Maki, H., Kohno, T., 2003. Monitoring of alkanedegrading bacteria in a sea-water microcosm during crude oil degradation by
polymerase chain reaction based on alkane-catabolic genes. Environ. Microbiol.
5, 517e522.
Smits, T.H.M., Devenoges, C., Szynalski, K., Maillard, J., Holliger, C., 2004. Development of a real-time PCR method for quantication of the three genera Dehalobacter, Dehalococcoides and Desultobacterium in microbial communities.
J. Microbiol. Methods 57, 369e378.
Tebyanian, H., Hassanshahian, M., Kariminik, A., 2013. Hexadecane-degradation by
Teskumurella and Stenotrophomonas strains iso-lated from hydrocarbon
contaminated soils. Jundishapur J.Microbiol. 26 (7), e9182.
Van Beilen, J.B., Funhoff, E.G., van Loon, A., Just, A., Kaysser, L., Bouza, M.,
Holtackers, R., Rothlisberger, M., Li, Z., Witholt, B., 2006. Cytochrome P450
alkane hydroxylases of the CYP153 family are common in alkane-degrading
eubacteria lacking integral membrane alkane hydroxylases. Appl. Environ.
Microbiol. 72, 59e65.
Van Beilen, J.B., Panke, S., Lucchini, S., Franchini, A.G., Rothlisberger, M., Withholt, B.,
2001. Analysis of Pseudomonas putida alkane degradation gene clusters and
anking insertion sequences: evolution and regulation of the alk genes.
Microbiology 147, 1621e1630.
Watanabe, K., Futamata, H., Harayama, S., 2002. Understanding the diversity in
catabolic potential of microorganisms for the development of bioremediation
strategies. Ant. Van Leeuwenhoek 81, 655e663.
Yakimov, M.M., Gentile, G., Bruni, V., Cappello, S., DAuria, G., Golyshin, P.N.,
Giuliano, L., 2004. Crude oil induced structural shift of coastal bacterial communities of Rod Bay (Terra Nova Bay, Ross Sea, Antarctica) and characterization of
cultured cold-adapted hydrocarbonoclastic bacteria. FEMS Microbiol. Ecol. 49,
419e432.
Yakimov, M.M., Golyshin, P.N., Lang, S., Moore, E.R.B., Abraham, W.R., Lunsdorf, H.,
Timmis, K.N., 1998. Alcanivorax borkumensis gen. nov., sp. nov., a new,
hydrocarbon-degrading and surfactant-producing marine bacterium. Int. J. Syst.
Bacteriol. 48, 339e348.
Zhang, T., Herbert, H., Fang, P., 2006. Application of real-time polymerase chain
reaction for quantication of microorganisms in environmental samples. Appl.
Microbiol. Biotechnol. 70, 281e289.