Department of Biochemistry and Nutrition

College of Medicine
Pamantasan ng Lungsod ng Maynila
Laboratory Exercise No. 3
(Bioinformatics)
Learning Objectives:
At the end of this laboratory exercise, the student shall be able:
1. To appreciate the application of Bioinformatics tools in the transfer of
information from DNA, RNA and protein.
2. To recognize the gene in a sequence of genomic DNA that is capable of
expressing a gene product.
3. To understand the effect of a mutation in the DNA sequence and its
consequence in gene expression.
4. To appreciate the wealth of information in Bioinformatics using a soft
ware like CLC Sequence Viewer and online sources available on sites
like http://www.ncbi.nlm.nih.gov/.
5. To be familiar with the functionalities available on the website:
http://www.ncbi.nlm.nih.gov/.
This laboratory exercise is an adjunct to the learning process of the medical
students in Biotechnology and Bioinformatics. It also reinforce the students
understanding of genes and gene expression, mutation and genetics.
This is a dry laboratory work for the students. Thus, the students are required
to have the following:
1. A computer access such as a laptop
2. A good internet connection
3. The CLC Sequence Viewer software downloadable free from Mirabio
website or any other online site in various flat forms (Mac, Windows, and
Linux OS)
Course Schedule:
This laboratory exercise will start with 1-hour lecture on Bioinformatics and
followed by the actual performance of the laboratory exercise, which is developed to
attain the above objectives.

Laboratory Exercise No. 3

The clinical case for this particular will not be given in the beginning of the
exercise but at the end after the actual bioinformatics exercises are finished. This is to
preclude identification of the disease from purely clinical grounds.
The blood of the case subject and the normal subject were collected and RNA
isolation was done. The isolated RNA was converted to complementaryDNA (cDNA)
by Reverse Transcription-Polymerase Chain Reaction (RT-PCR) using Iscript . The
target gene was amplified using a forward and reverse primer with using a
conventional PCR. The amplicons were run in a 1% agarose electrophoresis showing
the bands below:
The amplicons were sequenced. The nucleotide sequence of the normal
subject was given below in 5 to 3 direction:
acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgc
atctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtgg
atgaagttggtggtgaggccctgggcaggctgctggtggtctacccttggacccaga
ggttctttgagtcctttggggatctgtccactcctgatgctgttatgggcaacccta
aggtgaaggctcatggcaagaaagtgctcggtgcctttagtgatggcctggctcacc
tggacaacctcaagggcacctttgccacactgagtgagctgcactgtgacaagctgc
acgtggatcctgagaacttcaggctcctgggcaacgtgctggtctgtgtgctggccc
atcactttggcaaagaattcaccccaccagtgcaggctgcctatcagaaagtggtgg
ctggtgtggctaatgccctggcccacaagtatcactaagctcgctttcttgctgtcc
aatttctattaaaggttcctttgttccctaagtccaactactaaactgggggatatt
atgaagggccttgagcatctggattctgcctaataaaaaacatttattttcattgc
Procedure:
1. Examine the above sequence of non-coding strand of the target gene of the normal
subject. Try to find the promoter region of the gene and find the consensus sequences
such as the TATA box (TCAAA) and CAT box (CATT) sequences in the promoter
region. Then, locate the start codon (ATG) and the succeeding termination codons
(TAA, TGA, TAG) to define possible open reading frame/s for this sequence of gene.
Use: command/F and type in the necessary information.
2. Copy the defined open reading frame and save in word or notepad with you
preferred filename.
3. Go to the website: http://www.ncbi.nlm.nih.gov/. Click nucleotide Blast and
copy and paste the nucleotide sequence you saved in number 2. Wait for the result
and screen shot the important page expected from for your report. By this time you
will have an idea of what biomolecule you are working on. You need to screen shot
the first page with gene map, the page with list of possible genes and the page with
translated sequence into protein and the nucleotide sequence of the one most plausible
gene identity.

4. Again perform this procedure using the CLC Sequence Viewer.

5. Open the CLC Sequence Viewer , create a file with target gene using your
filename preference.
6. Click the open reading frame and open the filename of your target gene. The ORF
will be displayed. Compare it with what you have done in the first three steps. Are
they the same?
7. Save the nucleotide sequence of the ORF in a new filename in the CLC Sequence
Viewer program. Perform step no. 3. Compare your result. Are they the same?
8. Using this ORF from CLC Sequence Viewer , click the translate to protein
button and save the amino acid sequence in a new filename in the CLC Sequence
Viewer program. Perform a protein Blast as in step no. 3. This time your query is an
amino acid sequence. This time you should be able to identify the normal protein you
are working on.
This amino acid sequence follows genetic code and can be seen in the Table 1
below:

9. Now that you know the identity of the normal target protein from the normal
subject, the result of the normal subject and the case subject showed the same position
of the bands on gel electrophoresis. The case subject band was excised and isolated
from the gel and subjected to nucleotide sequencing. The nucleotide sequence of the
case subject was given below (5 to 3):

acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgc
atctgactcctgtggagaagtctgccgttactgccctgtggggcaaggtgaacgtgg
atgaagttggtggtgaggccctgggcaggctgctggtggtctacccttggacccaga
ggttctttgagtcctttggggatctgtccactcctgatgctgttatgggcaacccta
aggtgaaggctcatggcaagaaagtgctgcctgcctttagtgatggcctggctcacc
tggacaacctcaagggcacctttgccacactgagtgagctgcactgtgacaagctgc
acgtggatcctgagaacttcaggctcctgggcaacgtgctggtctgtgtgctggccc
atcactttggcaaagaattcaccccaccagtgcaggctgcctatcagaaagtggtgg
ctggtgtggctaatgccctggcccacaagtatcactaagctcgctttcttgctgtcc
aatttctattaaaggttcctttgttccctaagtccaactactaaactgggggatatt
aatttctattaaaggttcctttgttccctaagtccaactactaaactgggggatatt
atgaagggccttgagcatctggattctgcctaataaaaaacatttattttcattgc

10. Using the case subject nucleotide sequence, perform the similar procedure done
on the normal subject. If you cannot save the electronic output, you may take a screen
shot of each crucial step for your paper to be submitted as laboratory conference
output.
11. Compare the nucleotide sequence of the target gene of the normal and case
subjects. Identify the disparity. Translate it into its protein product and compare the
amino acid sequence of the normal and case subject.
12. Having known the molecular basis of the disease of the case subject, construct the
case scenario of the case subject. Instead of the usual presenting the case to you, we
have identified the molecular basis of the disease. Together with the result output of
the above procedures, you should be able to provide the salient features of this case.
Follow this in your report:
A.
B.
C.
D.
E.
F.

Demographics
History of Present Illness
Symptomatology
Physical Findings
Diagnosis
Treatment

Questions:
1. Why is the target gene contains a longer sequence of nucleotide base pairs?
2. What is the importance of open reading frames? Does it correspond to exons in
eukaryotic genes?
3. In doing the blast n or p, what is the importance of the e value?
4. What kind of mutation is present in this case?

5. If this mutation occurs in the intron of the eukaryotic gene, what do you expect
to happen to the gene expression of the mutated gene?
6. Do you expect to have a conformational change in the mutated gene product of
the target gene?
7. If you are going insert the target gene in a plasmid, what is/are the possible
restriction enzyme possible? Use the manual method first before you use the
available software like CLC Sequence Viewer . Document you computer
output by screen shot. Include this in your report.
8. In a very short yet concise manner, explain the molecular basis of this genetic
disorder.
9. Following the parameters in No. 12, create a hypothetical case of this patient
with this genetic disorder.
10. Challenge Point: Since you were able to translate the amino acid sequence of
both the normal and abnormal protein, try to create the tertiary structure of
these protein using the graphics function of the Blast in either Jmol format or
PBD format and compare the conformational similarities/differences. Include
the pictures of such computer output.