You are on page 1of 48

Vo l u m e 27, N u m b e r 2, 2011

Immunohematology
Volume 27, Number 2, 2011
CONTENTS

41

Review

58

Case Report

Scianna: the lucky 13th blood group system


P.A.R. Brunker and W.A. Flegel

Possible suppression of fetal erythropoiesis by the Kell blood


group antibody anti-Kpa
M. Tuson, K. Hue-Roye, K. Koval, S. Imlay, R. Desai, G. Garg, E.
Kazem, D. Stockman, J. Hamilton, and M.E. Reid

61

Report

Challenging dogma: group A donors as universal plasma donors


in massive transfusion protocols
E.J. Isaak, K.M. Tchorz, N. Lang, L. Kalal, C. Slapak, G. Khalife, D. Smith,
and M.C. McCarthy

66

Report

68

Review

72

C o m m u n i c at i o n

73

Announcements

75

A dv ertisements

79

Instructions

Prevalence of RHD*DOL and RHDCE*ce(818T) in two populations


C. Halter Hipsky, D.C. Costa, R. Omoto, A. Zanette, L. Castilho, and M.E. Reid

XG: the forgotten blood group system


N.C. Johnson

Erratum

Vol. 27, No. 1, 2011, pp. 14, 16, and 18

for

Authors

Editor-in- C hief

Sandra Nance, MS, MT(ASCP)SBB

Ed i torial Board

Philadelphia, Pennsylvania

Patricia Arndt, MT(ASCP)SBB

Paul M. Ness, MD

Managing Ed i tor

James P. AuBuchon, MD

Joyce Poole, FIBMS

Martha R. Combs, MT(ASCP)SBB

Mark Popovsky, MD

Geoffrey Daniels, PhD

Marion E. Reid, PhD, FIBMS

Anne F. Eder, MD

S. Gerald Sandler, MD

George Garratty, PhD, FRCPath

Jill R. Storry, PhD

Brenda J. Grossman, MD

David F. Stroncek, MD

Cynthia Flickinger, MT(ASCP)SBB


Philadelphia, Pennsylvania

Pomona, California

Baltimore, Maryland

Seattle, Washington

Bristol, United Kingdom

Durham, North Carolina


Seni or M edi cal Editor

Geralyn M. Meny, MD
Philadelphia, Pennsylvania

Bristol, United Kingdom

New York City, New York

Washington, District of Columbia


Te c h n i c a l E d i t o r s

Christine Lomas-Francis, MSc


New York City, New York

Dawn M. Rumsey, ART (CSMLT)


Glen Allen, Virginia

Washington, District of Columbia

Pomona, California

Lund, Sweden

St. Louis, Missouri

Bethesda, Maryland

Christine Lomas-Francis, MSc


New York City, New York

A s s o c i at e M e d i c a l E d i t o r s

David Moolten, MD

Braintree, Massachusetts

Emeritus Editor

Delores Mallory, MT(ASCP) SBB

Gary Moroff, PhD

Supply, North Carolina

Rockville, Maryland

Philadelphia, Pennsylvania

Ralph R. Vassallo, MD
Philadelphia, Pennsylvania
E d i t o r i a l A s s i s ta n t

Sheetal Patel

Immunohematology is published quarterly (March, June, September, and December) by the


American Red Cross, National Headquarters, Washington, DC 20006.

C opy Editor

Immunohematology is indexed and included in Index Medicus and MEDLINE on the


MEDLARS system. The contents are also cited in the EBASE/Excerpta Medica and Elsevier
BIOBASE/Current Awareness in Biological Sciences (CABS) databases.

Mary L. Tod
Proofreader

Lucy Oppenheim

The subscription price is $40.00 (U.S.) and $50.00 (foreign) per year.
Subscriptions, Change of Address, and Extra Copies:
Immunohematology, P.O. Box 40325
Philadelphia, PA 19106

P r o d u c t i o n A s s i s ta n t

Or call (215) 451-4902

Marge Manigly

Web site: www.redcross.org/immunohematology


Electroni c Publisher

Copyright 2011 by The American National Red Cross


ISSN 0894-203X

Paul Duquette

O n O ur C ov er
Ophelia by John William Waterhouse
Ophelia is a favorite subject of the pre-Raphaelites and, in particular, John William Waterhouse. The
painting, completed in 1910, is one of his more famous. It depicts the doomed daughter of Polonius picking
flowers near the river in the moments before she drowns. The red and white blossoms represent both the
vitality and the transience of life, as well the curse and fate of lost innocence. The scene is pastoral, but the
darker hues and the intensity in her gaze and in how tightly she clutches the flowers and her dress betray
her true state of mind. Ophelia mirrors Hamlet in her brooding over the moral collapse around her but is
unable to resist the descent into madness.
Like sweet bells jangled, out of tune and harsh;
That unmatchd form and feature of blown youth
Blasted with ecstasy: O, woe is me,
To have seen what I have seen, see what I see!
The XG blood group, reviewed in this issue, has been investigated in genetic marker studies suggesting
possible linkage with manic-depressive illness.

D av id M oolt e n , MD

Review

Scianna: the lucky 13th blood group system


P.A.R. Brunker and W.A. Flegel

The Scianna system was named in 1974 when it was appreciated


that two antibodies described in 1962 in fact identified antithetical
antigens. However, it was not until 2003 that the protein on
which antigens of this system are found and the first molecular
variants were described. Scianna was the last previously
serologically defined, protein-based blood group system to be
characterized at the molecular level, marking the end of an era
in immunohematology. This story highlights the critical role
that availability of laboratory reagents for serologic testing has
played in the initial characterization of a blood group and sets the
stage for the development of new reagents, such as recombinant
proteins, to assist in this process. The central role that genetics
has played, both by classical pedigree analysis and by molecular
techniques, in the discovery and characterization of this blood
group is reviewed. Immunohematology 2011;27:4157.

The high- and low-prevalence antigens that constitute


the Scianna (SC) blood group system are caused by
variants in the erythroid membraneassociated protein
(ERMAP).1 SC was initially identified by serologic methods;
the clinical significance of antibodies specific to SC is
uncertain, although case reports demonstrating rare cases
of hemolytic disease attributed to SC variants exist. Genetic
analyses in both the classical and molecular approaches,
have been central to the discovery and elaboration of the
SC system. This article reviews the story of the SC blood
group from a genetic point of view, emphasizing the way it
has been brought into focus thanks to genetic tools ranging
from pedigree analysis to physical mapping.
History
Nomenclature: Sc1, Sc2, Sc3, and Sc4
The story of the 13th International Society of Blood
Transfusion (ISBT) blood group system began in 1962,
when a new high-prevalence antigen was reported alongside
a coexisting anti-D in a 25-year-old, multiparous woman
of Italian descent in Miami, Florida, who experienced
several fetal deaths as a result of hemolytic disease of the
fetus and newborn (HDFN).2 She came to clinical attention
because of difficulty obtaining compatible blood. Her ABO
and Rh typings were O ccddee, and her husbands were O
CCDee. After an unremarkable first pregnancy and birth,
she experienced three subsequent and progressively earlier
fetal demisesat term, at 7, and at 6 months gestation
in the late 1950s. After her second fetal death, her anti-D

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

titer was demonstrated at 256, and the new antibody to a


high-prevalence antigen, originally named anti-Sm, was
demonstrated at a titer of 16. An informative family study
revealed three antigen-negative siblings with a likely
autosomal dominant mode of antigen inheritance, and no
unrelated antigen-negative specimens were identified in a
population survey of 600 D random individuals. A clue
to the genetic position of the responsible locus was present
even in this defining family: based on the pedigree, it could
not be determined whether the new antigen was part of the
Rh system as it was in linkage disequilibrium with cc in
that kindred.
In spite of this very dramatic introduction, the clinical
importance of the new antigen was uncertain, as the
concurrent anti-D clearly could account for the probands
unfortunate obstetric history. While the work of the Miami
group was in the pipeline for publication, the Winnipeg Rh
Laboratory, in Manitoba, reported an antibody to a new
low-prevalence antigen arising in a 50-year-old man with
stomach cancer.3 In this patient, the antibody originally
named anti-Bua, found in serum Char., was identified during
a routine pretransfusion crossmatch. As the patient had
been transfused with three units of blood 14 days earlier,
this delayed serologic transfusion reaction was investigated,
which revealed that although his serum was crossmatchcompatible with all three donor samples before transfusion,
it reacted with one of the three samples after transfusion.
A follow-up survey of 18 panel red blood cells (RBCs)
demonstrated one reactive cell, suggesting a relatively high
prevalence for this new antigen; however, this proved not to
be the case, as only one of the next 1,000 donors was positive.
The families of all three of these probands took part in
pedigree analysis, one of which was extremely informative,
with a kindred of both parents and nine offspring. These
studies in classical genetics demonstrated that the new
locus segregated independently from ABO, MNSs, P, Rh,
Kell, Kidd, Duffy, and X-chromosome.
Genetics and Inheritance
It did not take long for the relationship between the Sm
and Bua to be postulated, tested, and proven. In 1964, the
anti-Bua serum was used to type the available members of
the index Sm family (Fig. 1). The importance of using this

41

P.A.R. Brunker and W.A. Flegel

Fig. 1 Index family in the characterization of the Sm antigen and


demonstration of the antithetical relationship between Sm and Bua
antigens. The proband (patient Ms. Scianna) is indicated by the
arrow. Solid color represents Sm+ (Sc:1+) antigen test. Striped fill
represents Bua+ (Sc:2+) antigen test. Inferred genotype is shown
below the symbol for each family member. The probands parents
were deceased at the time of Bua testing, so are inferred to be
heterozygotes, indicated by the interrupted stripes and parentheses
in their genotype designation. The combination of Sm and Bua typing
confirms that subject AM is a heterozygote, which was suggested
by observations of dosage effects in serologic testing. (Redrawn
with data from references 2 and 4.)

serum as a typing reagent is underscored by


the fact that it was required to demonstrate
that the parent generation consists of
a mating of two Sm/Bua heterozygotes
(parents PM Sr. and RM): the F1 generation
consists of four Sm homozygotes, one
Sm/Bua heterozygote (individual AM),
and one Bua/Bua homozygote (individual
CS). Without it, the zygosities of AM
and CS could not be determined. This is
the only outbred family in the Sm/Bua
literature in which both parents are Sm/
Bua heterozygotes.
Concurrent with their suggestion
that Sm and Bua were the result of a
biallelic polymorphism, the Winnipeg Rh
Laboratory also reported an extensive
study of a Mennonite population in whom
the Bua antigen had a considerably higher
frequency of 5 in 348 samples than the
1 in 1,000 prevalence observed in other
Caucasian populations.4,5 Although they
tested 145 Caucasian families for Bua and

42

rigorously examined 19 based on the presence of Bua, it was


not until additional reagent serum was available in 1966
that definitive proof of this relationship was found.
Further examples of anti-Bua were discovered in a
group of individuals from Poland and the United Kingdom
(particularly the strongest serum Soch.) who had produced
anti-Bua after having been artificially immunized with D+
cells to stimulate the production of Rh antibodies.6 Through
a careful study of the donors used for these stimulations,
three additional subjects who were also stimulated with
these cells were found to have created an anti-Bua, although
it was much weaker than that in the Soch. serum. The
prevalence of the Bua allele was determined as 0.88 percent
in a Warsaw and 0.67 percent in a London cohort.
Using this reagent after adsorption to remove the
iatrogenically generated anti-D also present in the serum,
the Winnipeg Rh Laboratory identified a large, sixgeneration Mennonite kindred that included two cousin
matings of Sm/Bua heterozygotes, which produced 20
offspring.7 Through a methodical review of the serologic
data from samples from the kindred, which showed the
effects of antibody dosage on antigen expression, this report
confirmed and expanded the definition of the new system
to exclude all blood groups reported before 1962 (except
Diego, Yt, and Auberger) and Doa and Csa. Independence
from Yt was established in two British families.8,9 Finally,
the currently accepted nomenclature (Table 1) was proposed
in 1974 to reflect the surname of the index family in the

Table 1. Alleles, encoded antigens, and ISBT terminology of the Scianna blood group
system
Wild-type

Antigen

Trivial name

Allele

Genotype

Sc1

Sca (Sm)

SC*01

169g

Sc2

Variant
Highprevalence
antigen

Lowprevalence
antigen

Allele

Genotype

Scb (Bua)

SC*02

169a

57Arg
Sc2

Sc3

Sc null

SC*03N.01

307D2

Frameshift:
null

Sc3

Sc null

994c

332Arg

SC*03N.02

994t

332Stop:
null

Sc4

Rd

178c

60Pro
Rd

SC*04

178g

60Ala
Rd+

Sc5

STAR

139g

47Glu
STAR+

SC*05

139a

47Lys
STAR

Sc6

SCER

242g

81Arg
SCER+

SC*06

242a

81Gln
SCER

Sc7

SCAN

103g

35Gly
SCAN+

SC*07

103a

35Ser
SCAN

57Gly
Sc1

Provisional name suggested by the International Society of Blood Transfusion (ISBT) Working
Party on Red Cell Immunogenetics and Blood Group Terminology

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Scianna blood group system: a review

discovery of anti-Sm, Scianna,10 such that Sm was renamed


Sc1 and Bua was renamed Sc2.
The SC Gene Lies on Chromosome 1
The focus then shifted from definition of the system
to characterization of the locus responsible for the antigen
at a chromosomal level. Much of this seminal work was
performed in the Winnipeg Rh Laboratory. So it is not
surprising that their detailed investigations of the genetic
mapping of chromosome 1 contributed significantly to
the progress on SC. Their unique access to informative
kindreds certainly hastened this process, and in a series
of reports from 1976 to 1978, linkage between RH and SC
was established, showing a logarithm of the odds ratio
(LOD score) of 5.34 at a recombination fraction, = 0.10 if
paternally segregated,11 and the relative position of SC was
determined1214 and refined.15
A Third Antigen in the System: Sc3 or Scianna Null
Alleles
The appearance of minus-minus phenotypes, i.e.,
individuals whose RBCs tested negative for both Sc1 and the
antithetical Sc2 antigen (Sc:1,2), was first documented
in 1973 and demonstrated the existence of apparent SC
null alleles.16 However, the term Sc3 was not coined until
1980 when an antibody from an Sc:1,2 individual
demonstrated no evidence of a separable anti-Sc1 or antiSc2.17 The index patient examined in 1973 was a female
surgical patient from the Likiep Atoll in the Marshall
Islands, who had been transfused 7 months earlier without
crossmatching difficulty. Her cells phenotyped as Sc:1,
2 as did those from one cousin, but both womens RBCs
could still adsorb anti-Sc2. Despite four pregnancies with
an Sc:1,2 husband, the probands cousin had a negative
antibody screen. Because these RBCs reduced the titer of
anti-Sc2, but not anti-Sc1, they may have had some weak
Sc2 expression, and a new antigen was not definitively
characterized at that time.
However, in 1980, a 67-year-old man in New York being
treated with chemoradiotherapy for metastasis to the throat
of a carcinoma of unknown origin required a preoperative
transfusion, and demonstrated a positive antibody screen.17
He had been transfused 4 years earlier without event.
Unlike the Likiepian Sc:1,2 erythrocytes, RBCs from this
patient did not reduce the titer of either anti-Sc1 or antiSc2. When tested against the Likiepian Sc:1,2 cells, the
New York serum did not agglutinate the RBCs. No other
Sc:1,2 cells were found in a family study. No separable
anti-Sc1 was present in this patients serum, which is
somewhat unusual because patients who completely lack all
known antigens for a blood group and have been transfused

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

typically make a polyclonal mixture of antibodies directed


at the common epitopes of that system.18
The next report of a null phenotype for SC was described
in 1986, in another Pacific Islander.19 This patient was a
4-year-old girl from Papua New Guinea with thalassemia
major who had been transfused many times. Anti-Sc3 was
demonstrated. Erythrocytes from the patients mother
were compatible, and both mother and daughter were
found to have the Sc:1,2 phenotype. In this community,
the Sc:1,2 phenotype was surprisingly common: A survey
of 29 family members and apparently unrelated villagers
revealed 6 others (2 of whom had no obvious relationship
to the patient) who were also Sc:1,2. This very high
phenotype prevalence (20.6%) makes heterozygosity for
a putative recessive Sc3 allele in the patients father quite
likely (although his RBC phenotype is not reported in the
short abstract), as well as explaining the homozygosity for
the same allele observed in her mother.
Additional Sc:1,2 individuals have been reported
(including a patient who experienced an apparent delayed
hemolytic transfusion reaction), some of whom have also
lacked several other high-prevalence antigens.18 Evidence
that each patient in their series produced antibodies with
different specificities is discussed in Antibodies section.
Radin: A New Low-Prevalence Antigen Is Linked to
Scianna (via RH)
When Radin was first described, in 1967,20 the
relationship between Radin and Scianna was not
appreciated. Although the clinical significance of antibodies
generated to antigens within the SC system in general
is controversial, the analysis of the antibodies that led to
the discovery of the Radin antigen is based on its clinical
importance, with the initial description encompassing
five cases of mild to moderate hemolytic disease of the
newborn, of which one required exchange transfusion and
one appeared in the first pregnancy.20 Additional cases
and confirmation of the low general frequency (1 in 205)
appeared shortly thereafter.21
Once again, it was the unique analysis performed by
the Winnipeg Rh Laboratory that elucidated the putative
connection between Radin and SC. Linkage analysis
of eight propositi in ten nuclear families demonstrated
linkage between Rd and RH.22 Similar to the Sc1/Sc2
linkage analysis in the present dataset, the Winnipeg
analysis demonstrated heterochiasmy, with the paternal
LOD score exceeding 3 at a recombination fraction, =
0.10, whereas the corresponding maternal LOD neither
suggests nor refutes linkage (LOD = 0.41 at = 0.10 ).
This finding was only sufficient to propose the connection
between SC and Rd, as heterozygotes at both of these (i.e.,

43

P.A.R. Brunker and W.A. Flegel

double recombinants) had not been found. Incorporation of


the gene encoding the Rd antigen into the bigger picture of
chromosome 1 mapping placed it so close to SC that it was
proposed even at that time that the gene encoding Rd is
either very closely linked to or identical with SC.23
There were few additional reports on the SC blood group
system for more than 20 years until its molecular basis was
finally resolved in 2003.1 Since then, molecular analysis
has identified the three additional alleles underpinning
the three antibodies described by Devine and coworkers in
1988.18
Molecular Basis
The ERMAP Expresses the SC Antigens
The molecular basis of the SC blood group system was
identified in 2003 by merging the genetic mapping data
with protein chemistry showing that the SC antigens were
on a single glycoprotein of approximately 60 to 68 kDa
that must be expressed by RBCs.24,25 The SC gene had been
mapped to chromosome 1, and based on its linkage to the
RH genes, the chromosomal location had been further
refined to 1p34 to 1p36. This led to the identification of a
strong candidate gene.1
The ERMAP is a 475-amino acid, type 1 single-pass
membrane glycoprotein that is a member of the butyrophilin
(BTN) family and is encoded by the ERMAP gene.26,27 It
consists of a predicted signal sequence of 29 amino acids
at the NH3 terminus, an extracellular immunoglobulin
V domain (amino acids 50126), a short transmembrane
domain spanning amino acids 157 through 176, and an
intracellular carboxyl terminus encompassing a B30.2
domain from amino acids 238 through 395.1
The nomenclature for the transcripts of ERMAP is
complicated and has been revised many times. At least
two transcript variants have been described, which
result from use of an alternative upstream promoter
and alternative splicing.28 The longer variant is 3,423
bp and is designated as transcript 1, or as transcript b
by GenBank curators,29 as it was the second transcript
variant identified, and it includes an additional upstream
exon (GenBank NM_001017922.1). The shorter variant is
designated as transcript 2 or as transcript a, is 3,369 bp,
excludes this upstream exon (GenBank NM_018538.3),
begins transcription 45 bp upstream from the start of exon
2, and was the first variant discovered; thus, early reports
describe this gene as consisting of 11 exons. However, the
revised current nomenclature for this gene is based on the
presence of 12 exons spanning approximately 28 kb. The
relative production of these two mRNAs is not known, nor
has it been determined whether the use of either promoter

44

is favored in some tissue types or physiologic conditions.


Both transcripts share the common ATG start codon in
exon 3; thus, there is no predicted difference in the protein
product of the two transcripts. They differ in both the
transcript initiation site and the DNA stretch of exon 2 that
becomes part of the final transcript; consequently, there are
two alternative exon 2s, named exon 2a and exon 2b. The
longer transcript 1 comprises exon 1, exon 2b, and exons
3 through 12, whereas the shorter transcript 2 starts with
exon 2a and also includes exons 3 through 12 (Fig. 2).
The Ensembl genome browser curators have delineated
five transcripts in ERMAP,30,31 three of which are protein
coding and two of which generate a processed transcript only.
Two of the Ensembl transcripts correspond to GenBanks
transcripts 1 and 2; however, unique to the Ensembl
database is a 3,949-bp transcript (named ERMAP-002),31
which is reported as protein coding and generates a short
protein encoding 385 amino acids rather than the usual
475. However, only the two transcripts that encode the
475amino acid protein are included in the Consensus
Coding Sequence Project (CCDS; both with identification
number CCDS475), so the biological significance of the
3,949-bp transcript is unclear.
In addition to explaining the Sc1/Sc2 biallelic
single nucleotide polymorphism (SNP) at Gly57Arg, a
binucleotide GA deletion was identified at nt307 (now
known as SC*03N.01, provisional name suggested by
the ISBT Working Party on Red Cell Immunogenetics
and Blood Group Terminology). This deletion causes a
frameshift and premature stop codon, which explain the
SC null phenotype.1 The Rd antigen (Sc4) was defined as
the Pro60Ala variation, and two other variants in the
presumed leader signal peptide (54C>T and 76C>T) were
described in the original study elucidating the molecular
basis by Wagner and colleagues1 (Table 2).
Understanding the Variants Discovered in the PostERMAP Era
The knowledge of the gene responsible for the antigens
of this blood group protein opened the floodgates through
which variant descriptions of unknown, unresolved serologic cases promptly flow. This was clearly the case for SC, for
which three new variants were discovered within just a few
years after the characterization of ERMAP as the SC gene.
Careful molecular follow-up of the three patients described
by Devine and coworkers18 in 1988 revealed three distinct
ERMAP/SC variants, demonstrating the importance of
molecular testing in the resolution of serologic SC mysteries.
The success of these investigations depended not only on
the cooperation among an international collaborative, but
also on the supportive participation of two patients and

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Scianna blood group system: a review

Fig. 2 Transcripts, exon structure, and variants of erythroid membrane-associated protein (ERMAP). Codon numbers are indicated above
amino acids involved in described variants. The immunoglobulin variable domain is underlined. Exon 4 is expanded to the nucleotide level
in the gray box to show the locations of most ISBT-recognized Scianna polymorphisms. The wild-type reference sequence is under the
corresponding amino acid and is the chromosome 1 reference sequence GenBank NC_000001.10. * = nucleotide deletion.

a family who kindly released two autologous RBC units.


It was appreciated in the initial case reports in 1988 that
the SC protein carried multiple high-prevalence antigens
other than Sc1/2.18 Sera or eluates from these three Sc:1,2
patients who had developed high-prevalence antibodies did
not react with the Sc:1,2 null RBCs, but the samples were
not mutually compatible.
Sc5 (STAR)
In 1982, a 65-year-old man with a history of transfusion
of three units of crossmatch-compatible whole blood
before presentation underwent routine preoperative blood
bank testing, demonstrating anti-C and anti-e. He was
transfused with another three units of Ce RBCs, and 1
week later, a new anti-Jkb and an antibody against a highprevalence antigen were detected. Because his serum
reacted with all cells except his own (phenotyped as Sc:1,
2), those of a sibling, and Sc:1,2 RBCs, it was suspected
that he had developed an antibody to another antigen on
the SC protein.35 Blood needs for the patient were met with
autologous units. Blood samples from the proband and 16
family members had been frozen. Sequencing of the exons
encoding the extracellular and transmembrane domains

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

demonstrated homozygosity at a new nonsynonymous


polymorphism at amino acid 47 (glutamic acid to lysine),
which is in the N-terminal domain.36 This variation is
catalogued as rs56047316 in the SNP database (dbSNP), and
it results from the guanineadenine transition at nucleotide
139 in the complementary DNA (cDNA). Frequencies of this
allele in population studies have not been reported, nor
have additional cases of this antibody.
Sc6 (SCER) and Sc7 (SCAN)
The remaining two antibody cases described by Devine
and colleagues18 were concomitantly resolved using the
same approach as for the Sc5 antigen.37 These investigators
sequenced all 11 exons of ERMAP known at the time,
which encompasses all cDNA. They also solicited others to
submit suspected SC variants and the eight other orphan
low-prevalence antigens By, Toa, Pta, Rea, Jea, Lia, SARA,
and Ska. The proband for case 1 reported by Devine and
colleagues18 demonstrated homozygosity for a guanine
adenine transition at cDNA nucleotide 242, predicted to
cause an amino acid change at position 81 (from arginine
to glutamine), which is in the immunoglobulin V loop.18
The case 2 proband demonstrated a new homozygous,

45

P.A.R. Brunker and W.A. Flegel

Table 2. Erythroid membraneassociated protein polymorphisms in the coding region and global population frequencies

Sc name

Descriptive name

Sc7

SCAN

Sc5

STAR

Sc1 vs. Sc2


Sc4

Sc6

Rd

dbSNP ID:

cDNA nt

mRNA*

Wild-type (WT)

Variant

Protein effect

Amino acid (aa)


codon

rs35757049

11

281

nonsynonymous substitution

rs33950227

54

324

silent

18

rs33953680

76

346

nonsynonymous substitution

26

103

373

nonsynonymous substitution

35

rs56047316

139

409

nonsynonymous substitution

47

rs56025238

169

439

g (Sc1)

a
(Sc2)

nonsynonymous substitution

57

rs56136737

178

448

nonsynonymous substitution

60

rs33954154

219

489

silent

73

242

512

nonsynonymous substitution

81

SCER
Sc null (D ga together)

rs55695242

307

577

del 1

frameshift

103

Sc null (D ga together)

rs56151267

308

578

del 1

frameshift

103

rs35147822

775

1045

nonsynonymous substitution

259

rs34441268

788

1058

nonsynonymous substitution

263

rs35972628

888

1158

silent

296

994

1264

nonsense (STOP)

332

Sc null
rs55773259

1227

1497

silent

409

rs55872827

1324

1594

nonsynonymous substitution

442

rs56405033

1355

1625

nonsynonymous substitution

452

rs55677363

1356

1626

silent

452

*NCBI Reference Sequence Position: NM_001017922.1

Minor allele frequencies for some populations are determined by reports of serologic phenotype and assuming individuals positive for a rare antigen are
heterozygotes.
cDNA = complementary DNA; dbSNP = single nucleotide polymorphism database; IgV = immunoglobulin V; mRNA = messenger RNA; nt = nucleotide.

nonsynonymous variant at cDNA nucleotide position 103


(again a guanineadenine transition), corresponding to
a glycine to serine change at amino acid 35 in the NH3
terminus. This specimen also demonstrated two other SNPs
(at cDNA nucleotides 54C>T and 76C>T), which had been
previously reported, are common in Caucasian populations,
and are in tight linkage disequilibrium (LD).1 Because these
variants are both in the predicted leader sequence (and the
54C>T is a silent mutation), they are not predicted to directly
impact on ERMAP structure. This report also excluded the
eight orphan low-prevalence antigens from the SC system
because the only variants found were in the leader sequence
or in introns.
Molecular Basis of SC Null Phenotypes
Central to the set of specimens originally reported with
the discovery of ERMAP as SC was an Sc:1,2 sample

46

from a Saudi Arabian pedigree,1 which demonstrated


homozygosity at three SNPs: the common 54C>T and
76C>T (described in an earlier section) as well as a 2-bp
deletion starting at cDNA nucleotide 307 (307ga) that
is predicted to cause a frameshift mutation and early
termination codon after 113 amino acids. The nt54 and nt76
SNPs were genotyped in an additional 111 European blood
donors and were found in tight LD. The frameshift would
account for a complete lack of an intact ERMAP protein in
the cell membrane.
Two Sc:1,2 individuals from northern and southern
California were then sequenced in a follow-up study,37 and
both shared a new SC null allele formed by a nonsense
mutation at codon 332. This is the first report of a variant
in the B30.2 intracellular domain in a patient immunized
to SC. It is not, however, the only variant in the B30.2
domain (Table 2), because three others have been described

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Scianna blood group system: a review

WT aa

Variant aa

Exon

Protein domain

Minor allele frequency in blood donors

Ala

Val

Leader

0.054 (dbSNP)

Leu

Leu

Leader

0.28 (German1), 0.1 (dbSNP)

His

Tyr

Leader

0.33 (German1), 0.25 (Caucasian North American32), 0.1 (dbSNP),


0.05 (African-American32)

Gly

Ser

NH3-terminus

Glu

Lys

NH3-terminus

Gly

Arg

IgV loop

0.01 (Caucasian North American,33 Brazilian34), 0.008 (German1),


0.005 (Hispanic American33 ), 0.002 (African-American33 ), 0 (Asian American33 )

Pro

Ala

IgV loop

0.003 (Slavs33 ), 0.002 (Caucasian North American,33 Danish,21 German,1


New York Jewish20 )

Arg

Arg

IgV loop

0.017 (dbSNP)

Arg

Gln

IgV loop

Asp

frameshift

IgV loop

Asp

frameshift

IgV loop

Cys

Arg

12

B30.2 domain

0.022 (dbSNP)

Gly

Glu

12

B30.2 domain

0.011 (dbSNP)

Glu

Glu

12

B30.2 domain

0.011 (dbSNP)

Arg

STOP

12

B30.2 domain

Leu

Leu

12

C-terminus

Ser

Pro

12

C-terminus

Leu

Pro

12

C-terminus at a 3 dileucine (LL)


phosphorylation motif

Leu

Leu

12

C-terminus at a 3 dileucine (LL)


phosphorylation motif

in dbSNP, two of which are nonsynonymous amino acid


changes (C259R and G263E) and one of which is silent
(E296E). This result suggests that an early translation
termination, even as late as at codon 332 of the expected
475, sufficiently interferes with correct protein trafficking,
membrane insertion, or stability so as to render the
individual susceptible to alloimmunization at the Sc1/2 site
(codon 57).
Other Variants in ERMAP: Using dbSNP and HapMap
Variants in the coding region, particularly those in the
extracellular domain of transmembrane proteins, are of
particular clinical interest in transfusion medicine, as their
location provides an obvious mechanism for putative clinical
significance by alloimmunization. However, much variation
in the human genome is found outside of coding regions,
and ERMAP is no exception. Studies of this variation are a

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

0.054 (dbSNP)

critical tool in the investigation of human disease and basic


sciences. Several collaborative projects in human genomics
focus on gathering, sharing, and interpreting human
genetic variation, and although a full cataloguing of these is
beyond the scope of this review, we will present variants in
ERMAP that are part of two such projects: dbSNP38 and the
International HapMap Project.39 Table 2 integrates some of
these variants (identified by their rs numbers) with those
described in the transfusion medicine literature. These
data allow informative LD studies of ERMAP (Fig. 3). This
LD map shows two distinct LD blocks that correspond to
the exons encoding the extracellular immunoglobulin-like
domains and the intracellular B30.2 domains of ERMAP.
The importance of this pattern of LD is that it reveals a
possible evolutionary vestige of the modular nature of the
butyrophilin-like (BTNL) protein family and is even more
pronounced in the Nigerian population. Long stretches of

47

P.A.R. Brunker and W.A. Flegel

Fig. 3 Pairwise linkage disequilibrium (LD) heat plot of the logarithmic odds ratio (LOD) score for single nucleotide polymorphisms in
erythroid membraneassociated protein (ERMAP) in a Nigerian population. Darker shades (black) = areas of high LD, lighter shades (light
gray) = areas of lower LD. The areas of tightest LD correspond to the extracellular domains of ERMAP, on the left-hand side of the figure.
Increased LD is also seen in the intracellular domains, at the right side. This segmental pattern of LD reveals a possible evolutionary vestige
of the modular nature of the butyrophilin-like protein family. YRI = Yoruba in Ibadan, Nigeria. (Source: Haploview software run at http://
hapmap.ncbi.nlm.nih.gov/cgi-perl/gbrowse/hapmap3r2_B36/#search; accessed April 27, 2010.)

LD such as that illustrated in the extracellular domain of


ERMAP, where all of the SC antigens are encoded, raise the
possibility that a selective advantage by genetic hitchhiking
may be operating at ERMAP.40

calling platform, and additional population studies will


continue to be reported.33

Global Variation
Some ethnographic trends have already been
historically appreciated with SC variants during the early
years of their investigation (Table 2). For instance, Sc4 has
been identified most often in Ashkenazi Jews and Slavic
populations, and the few Sc:1,2 phenotypes have been
reported particularly in populations from Oceania. Sc2
appears to be more common in a consanguineous Canadian
Mennonite population (derived from a small region in
Eastern Europe),5 but it remains very rare in or absent from
populations of African5,33 or Native American10 descent.
However, it is not sufficient to rely on case reports to
propose generalizations regarding population frequencies.
Fortunately, recent technologies are available to rapidly
genotype ERMAP variants using an automated genotype-

ERMAP Is a Member of the Butyrophilin-like Family of


the Immunoglobulin Superfamily
By virtue of its extracellular immunoglobulin V and
the intracellular B30.2 domains, ERMAP is a member
of the BTNL protein family, which is a subset of the
immunoglobulin superfamily.41 The compact, globular
110amino acid immunoglobulin domain defines this
superfamily and is found in three operational domain
subclasses: variable (immunoglobulin V), intermediate
(immunoglobulin I), or constant (immunoglobulin C). 42,43
These proteins are central to many immunologic processes,
especially cell adhesion, costimulation, and signalling.44,45
The immunoglobulin superfamily is one of the largest in
all eukaryotic organisms.46 Other members of this family
well known to the transfusion medicine community

48

Biochemistry and Physiology

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Scianna blood group system: a review

Fig. 4 The organization of the butyrophilin-like (BTNL) family in


comparison to the butyrophilin (BTN) and B7 families. The B7
branch of the immunoglobulin superfamily is characterized by
variable (IgV) and constant (IgC) immunoglobulin domains. The
BTN subfamily includes the B30.2 intracellular domain. The BTNL
proteins exhibit various combinations of these features. MOG =
myelin oligodendrocyte glycoprotein, an autoantigen implicated in
multiple sclerosis. (Modified from reference 52.)

Fig.5 On the left, blood from a fish of the genus Notothenia (with
hemoglobin-containing erythrocytes) and on the right is blood
from Chaenocephalus aceratus. Icefish transport oxygen strictly in
physical solution, without a carrier molecule. The recent discovery
that bloodthirsty (bty), a B30.2-domaincontaining protein like
ERMAP, has dramatically decreased expression in hemoglobinless
icefish provides a fascinating link between this protein domain and
erythropoiesis. Courtesy of Professor Guillaume Lecointre.

include the Lutheran, LW, OK, JMH, and Indian blood


groups, which are found on the B-CAM, ICAM4, CD147,
CD108, and CD44 molecules, respectively.47 BTN proteins
are within the B7-CD28-like branch of this superfamily48
and have been extensively studied in cows. 49 The prototype
of the human BTN family of proteins is BTN1A1, which is
primarily expressed in the lactating breast, where it makes
up 20 percent of the protein in the membrane of milk
fat globules. The name derives from the Greek butyros
and philos, meaning having an affinity for butterfat.
Although ERMAP is carried on chromosome 1, the genes
for many members of this family are located in the major
histocompatibility complex (MHC) on chromosome 6.50
The lactational and immunologic functions of BTNs
as a part of the secretory granule-to-plasma membrane
zipper complex and as an inhibitor of T-cell activation are
only recently described,51,52 and even less is known about
the BTNL proteins. There are six known human BTNL
proteins, which are defined by their homology to BTN
proteins (Fig. 4). The most extensively studied of these is
BTNL2, the gene for which is located in the MHC class II
cluster at 6p21.3. A truncating splice site mutation in BTNL2
has been associated with sarcoidosis,53 and although this
SNP has been investigated in many other infectious and
autoimmune diseases, some of these associations have
been attributable to LD with the MHC.54 BTNL2 inhibits

T-cell activation by inhibiting proliferation in response to


the stimulatory T-cell receptor signal.55 This inability for
BTNL2 to propagate a cell signal has led some investigators
to propose its role as decoy receptor because it lacks the
B30.2 intracellular domain present in most other BTN and
BTNL proteins.54

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

The B30.2 Cytoplasmic Domain: A Role in


Erythropoiesis?
The B30.2 (or PRYSPRY) domain was described in 1993
with the discovery of an exon in the MHC class I region
showing similarity to other mammalian and amphibian
proteins, which have since been termed the tripartite
motif family.56,57 Such a domain was demonstrated in
bovine BTN58 and in human BTN proteins.59 The B30.2
domain is proposed to be a recent evolutionary adaptation
in the immune system of mammals as a fusion of two
ancient domains (PRY and SPRY), which are found in
all eukaryotes.50 The genes for proteins in this family
have a modular structure, suggesting that they arose
by duplication.56 Mutations in the B30.2 domain in the
tripartite motifbranch of the B30.2 proteins have been
associated with Opitz syndrome (MID1 protein) and
familial Mediterranean fever (pyrin protein). However,
human syndromes have not been associated with mutations
in the B30.2 domain of the BTN or BTNL families.

49

P.A.R. Brunker and W.A. Flegel

The crystal structure of the B30.2 domain of pyrin was


recently elucidated. A -barrel consisting of two antiparallel
-sheets has been described, forming a central cavity.60 The
ligand(s) that interact with the B30.2 domain have yet to be
described, although binding analyses suggest that it is the
site of proteinprotein interactions.61 The crystal structure
of one other B30.2 domain interacting with a peptide has
shown that there is a conformationally rigid peptide binding
pocket (consisting of a core -sandwich around variable
loops) binding to a short-sequence motif, which may allow
multiple intracellular targets to bind.62 Recently, BTN1A1
has been shown to bind xanthine oxidoreductase via B30.2,
apparently stabilizing the milk fat globule membrane in
mammary tissue, but it is also hypothesized to function
as a novel signaling pathway in nonmammary tissues or
perhaps in the innate immune system via generation of
reactive oxygen species.63
A role for B30.2 domains in erythropoiesis has been
revealed through study of an unlikely model organism:
Antarctic icefish. These animals are the only vertebrate
taxon that fails to produce RBCs (Fig. 5), and as such
have been studied in a hunt for genes important in
erythropoiesis and cardiovascular biology.64 Using
this approach, a new B30.2-containing protein, called
bloodthirsty (bty), was identified in the pronephric kidney
of a red-blooded Antarctic rockcod (Notothenia coriiceps),
which was present at levels tenfold higher than those in
an icefish (Chaenocephalus aceratus).65 Interestingly,
disruption of bty synthesis in zebrafish suppressed both
erythrocyte production and hemoglobin synthesis, and
although interactions between bty and ERMAP have been
hypothesized, they have not been empirically demonstrated
(H. William Detrich, personal communication, January
20, 2010).
Functional Studies of ERMAP
The function of ERMAP itself, however, is not well
understood. The murine homolog, Ermap, was described
first and named as such because it was found to be produced
exclusively in erythroid cells.66 The human homolog was
characterized shortly thereafter, and Northern blots
demonstrated high expression in hematopoietic tissues,
such as fetal liver and bone marrow, with weaker expression
in peripheral blood leukocytes, thymus, lymph node,
and spleen.26 Sc1 has been demonstrated on phagocytic
leukocytes using an antibody absorption technique.67
Recent RNA array expression analysis supports this
finding, having detected low levels of ERMAP transcripts
in leukocytes, especially monocytes; however, quantitative
protein expression remains to be assessed.54 An in silico
analysis of nucleotide database searches of human

50

expressed-sequence tags using the ERMAP transcript 1


(GenBank NM_001017922.1) as the probe detected the
transcript in cDNA libraries from hematogenous tissues,
such as bone marrow, a chronic myeloid leukemia cell line,
peripheral blood pool, thymus, spleen, and fetal liver, as well
as in neural tissues.68 However, it is difficult to definitively
ascribe transcript production to the nonerythroid cells in
the neural tissues, as contamination from the vasculature
cannot be completely eliminated. ERMAP mRNA reaches
peak levels in fetal liver in the 18th through 20th weeks,
and it is present from the 15th through 32nd weeks in fetal
bone marrow, suggesting that ERMAP may be related
to the migration of erythroid cells to these sites during
hematopoietic development.69
Additional evidence that ERMAP may be involved in
erythroid differentiation has been put forward, although
only abstracts of these reports are available in the English
literature. Using fluorescent quantitative polymerase
chain reaction,70 ERMAP expression has been found in
the K562 cell line, which is derived from chronic myeloid
leukemia and is of undifferentiated granulocytic lineage.71
To test the degree of erythroid-specificity of ERMAP
in hematopoiesis, this group used cytarabine (Ara-C)
to induce these cells toward erythroid differentiation
and 12-O-tetradecanoylphorbol-13-acetate to induce
development toward the macrophage lineage, but found
an increase in ERMAP mRNA after an Ara-C stimulation
only.72 This finding suggests that although ERMAP may be
present on cells of the monocyte/macrophage lineage, its
functional importance may be limited in these cell types.
RNA silencing experiments using an ERMAP shRNA/K562
cell line also reported by this group showed decreased
ERMAP expression and morphologic features, including
the relative amounts of surface erythrocyte maturation
markers, leading the authors to conclude that ERMAP
shRNA inhibited Ara-Cinduced erythroid differentiation.73
A second model of erythroid differentiation using umbilical
cord blood with two naturally occurring hormones (namely
stem cell factor and IL-3) and erythropoietin to provoke
differentiation also showed a concurrent rise in ERMAP
mRNA with erythrocyte maturation.74
Many structural features of ERMAP point toward a
putative role in immunity, perhaps by adhering to other
cells or pathogens via its extracellular immunoglobulin V
domain, or by immunoregulatory mechanisms such as the
modulation of cellular activation signals via B30.2 as is
observed in its BTN family members.52 Much work is needed
in this area to better characterize the proteins that interact
with ERMAP, both extracellularly and intracellularly,
and to determine whether ERMAP has a central role in
erythropoiesis itself.

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Scianna blood group system: a review

Antibodies in the System


The discovery of the SC blood group system began
with and has relied on the detection and investigation of
alloantibodies. The effects of enzymes and chemicals and
the in vitro characteristics of SC antibodies were recently
reported elsewhere.75 In general, SC antigens are resistant
to ficin plus papain, trypsin, -chymotrypsin, sialidase,
and 50 mM dithiothreitol (DTT), and they are sensitive to
pronase and 200 mM DTT. The exception to this trend is the
variable sensitivity of Sc4 to trypsin and -chymotrypsin.
Enzymatic properties of anti-SCER and anti-SCAN are only
described in the initial case report as showing no change
in the strength of antibody activity when tested with RBCs
that had been treated with ficin, papain, trypsin, ZZAP
(mixture of 0.1 M DTT plus 0.1% cysteine-activated papain),
or chloroquine diphosphate.18 Anti-STAR demonstrated
enhanced reactivity with enzyme-treated RBCs.36 Patients
or donors in whom an antibody to an SC antigen has been
reported (Table 3) have been thoroughly reviewed recently.76
Thirteen of the 19 reports of alloantibodies to SC system
antigens listed in Table 3 have occurred in cases in which
they do not appear to manifest a major clinical significance.
All six of the reports with clinical significance occurred in
cases of HDFN. All six of the reported autoantibodies to SC
system antigens in patients were in the context of clinically
significant autoimmune hemolytic anemia, although five
of these cases were presented as an abstract only, without
the full clinical details. Alleles Sc47 were not tested in
any of these cases. Such an investigation is warranted
because heterozygosity for alleles with weak expression
in the Rh blood group system has been associated with D
autoantibodies.86
Clinically important reactions to an erythrocyte
antibody typically result from significant RBC destruction
and usually manifest in the patient as a hemolytic anemia or
HDFN. In the SC system, significant HDFN defined the blood
group in a patient named Ms. Scianna; however, she also
had anti-D to account for her severe obstetric complications
in addition to the anti-Sc1.2 Anti-Sc2 has been reported in
a case of HDFN requiring simple transfusion in a 20-dayold infant.83 Importantly, the search for antibodies to lowprevalence antigens in this patient was only performed
because the neonate and the mother were ABO-compatible:
had they been ABO-incompatible, the HDFN would likely
have been attributed to this, and the anti-Sc2 antibody may
not have been detected.
The recent availability of recombinant reagents to
assist in the detection of SC antibodies87 may bring this
ability into the wider immunohematology arena. This novel
technique will allow one to appraise the relevance of SC

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

antibodies in conjunction with other antibodies and tease


out their relative clinical importance, which may have been
previously underestimated. The ERMAP protein has been
expressed in its native form in a eukaryotic system,87 and
so although the initial report describes the utility of this
reagent for detecting the high-prevalence SC antigens, a
screening protein for low-prevalence antigens Sc2 and Sc4
would also be feasible.
Some SC alloantibodies (Table 3) resulted in delayed
serologic transfusion reactions without associated
hemolysis, including a so-called naturally occurring antiSc4 described in a 55-year-old man without a transfusion
history.21 Many of these patients were transfused with
crossmatch-compatible blood without incident. However,
some surgeries were delayed owing to lack of availability
of crossmatch-compatible units, and other patients
were transfused with autologous products in nonurgent
scenarios.18
The remaining reports of important reactions involving
SC antibodies are in cases of autoimmune hemolytic
anemia. Auto-anti-Sc1 and -Sc3 have been eluted from
direct antiglobulin testpositive RBCs of these patients. In
many cases, these antibodies were transient and associated
with decreased expression of SC antigens.79,84 Several
patients underwent splenectomy in addition to treatment
with many types of immunosuppressant medications. One
patient with erythroid hypoplasia and diagnosed with an
Evans-like syndrome even underwent a total of 20 plasma
exchanges over the course of 11 weeks.82 After the ninth
exchange, the antibody was no longer detectable, although
it reappeared 1 week later. He was finally transfused after 16
exchanges, despite the continued presence of the antibody,
with a resultant rise in his hematocrit from 14% to 30%.
Clinical Significance
Is It Worth Phenotype or Genotype Matching?
Of the 23 cases of SC alloantibodies catalogued here
(Table 3), one case of HDFN83 and one delayed hemolytic
transfusion reaction (case 2)18 relate sufficient information
in their reports to convincingly attribute clinical relevance
to SC antibodies. The HDFN cases described in the initial
report of the Radin antigen also speak to the potential
importance of antibodies to Sc4 (especially the case that
required exchange transfusion); however, these cases are
not reported in sufficient detail to definitively implicate
anti-Sc4 to the exclusion of all other causes.20 Even the
very dramatic presentation of Ms. Sciannas antibody does
not incriminate anti-Sc1 as the cause of her poor obstetric
outcomes, as an anti-D of a higher titer was also found.2
The fundamental question of when and whether antibodies

51

P.A.R. Brunker and W.A. Flegel

Table 3. Published reports of antibodies to antigens in the Scianna blood group system
Antibody

Allo or
auto?

Authors

Year

Case
identifier

Scianna
phenotype

Age
(years)

Sex

Ethnicity

Important
reactions?

Other
antibodies

anti-Sc1

Allo

Schmidt et al.2

1962

Mrs. N.S.

Sc:1,2

25

Caucasian

HDFN

anti-D

Kaye et al.77

1990

Sc:1,2

28

Indian

No HDFN

Tregellas et al.78

1979

Sc:1, 2

49

McDowell et al.79

1986

Case 1

McDowell et al.79

1986

Case 2

Owen et al.80

1992

Ramsey and
Williams81

2010

Auto

anti-Sc2

anti-Sc3

anti-Sc4
(anti-Rd)

Sc:1,2
(1+, but 3+ 2
years later)
Sc:1,2
10 months

Hemolytic anemia

West Indies

Hemolytic anemia

20

Caucasian

Hemolytic anemia,
acute hemolysis

22

Caucasian

15 units RBC 3 years earlier


during chemotherapy, previously
negative Ab screen.
Not reported.

Sc:1,2

50

Caucasian

DSTR vs. DHTR

3 units RBC transfused 2 weeks


earlier.

29

Caucasian

HDFN

Sc:1

1963

Seyfried et al.6

1966

Four donors

DeMarco et al.83

1995

Sc:1,2

McCreary et al.16

1973

Sc:1,2

Nason et al.17

1980

Sc:1,2

67

Likiep Atoll, Marshall


Islands
Caucasian

Woodfield et al.19

1986

Sc:1,2

Papua New Guinea

Peloquin et al.84

1989

Peloquin et al.84

1989

Rausen et al.20

1967

weak Sc1 and


Sc3
Case 2
weak Sc1 and
Sc3
Family 1 Rd Sc:4 (Rd+)

Rausen et al.20

1967

Rausen et al.20

Allo

Case 1

54

Hemolytic anemia

4 units RBCs transfused earlier.


Newborn with hemolytic
disease in 1st and 3rd children.
Newborn with hemolytic
disease in 7th and 9th children.
Newborn with hemolytic
disease in 4th child.

Family 2 Fl Sc:4 (Rd+)

African American

HDFN severe

1967

Family 3 Ha Sc:4 (Rd+)

Northern European

HDFN

Rausen et al.20

1967

Family 4 We Sc:4 (Rd+)

Native American

HDFN

Rausen et al.20

1967

Family 5 Gr Sc:4 (Rd+)

German Jewish or
Scotch-Irish

HDFN

Lundsgaard and
Jensen21

1968

Mrs. J.P.

Sc:4 (Rd+)

47

Lundsgaard and
Jensen21
Winn et al.85

1968

Mr. L.C.

Sc:4 (Rd+)

55

19

Caucasian

1988

Case 3

Sc:1,2

65

Irish and English

DSTR: No clinical
evidence of
hemolysis
DSTR

1988

Case 1

Sc:1,2

76

German

DSTR

1988

Case 2

Sc:1,2

50

German, English, and


Native American

DHTR

anti-Sc6
(anti-SCER)
anti-Sc7
(anti-SCAN)

Allo

Devine et al.18
and Skradski
et al.35
Devine et al.18

Allo

Devine et al.18

Transfused 7 months earlier


without difficulty.
Transfused 4 years earlier
without incident.
Many transfusions.

Hemolytic anemia

HDFN

Allo

G0, no transfusion history.

64

Russian Jewish

1976

Negative maternal
Ab screen

DSTR

anti-Sc5
(anti-STAR)

4 units RBC transfused earlier.

Case 2: pt
C.D.
Mr. Char.

Auto

Multiparous, after 1st baby with


HDFN.
Excluded all except G2, 1st was uncomplicated with
E and Lu(a)
negative Ab screen.

Hemolytic anemia

Auto vs. Allo Steane et al.82


not resolved
Allo
Anderson et al.3

Allo

1982

Sc:1,2

Transfusion/pregnancy
history

DSTR: No clinical
evidence of
hemolysis

Had a 9-year-old child.


2 units blood transfused during
gynecologic operation.
Never transfused or hospitalized.
anti-Vw

Negative DAT, negative Ab screen


before transfusion.

anti-C
anti-e
anti-Jk b

3 units RBC 3 years earlier.

anti-D

3 units RBC 12 years earlier; 3


units RBC 6 years earlier.
3 units RBC 8 years earlier;
2 units RBC 3 years earlier.

Ab = antibody; ADCC = antibody-dependent cell-mediated cytotoxicity; AHG = antihuman globulin; AIHA = autoimmune hemolytic anemia; CHF = congestive
heart failure; DAT = direct antiglobulin test; DHTR = delayed hemolytic transfusion reaction; DOL = day of life; DSTR = delayed serologic transfusion reaction;

52

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Scianna blood group system: a Review

Clinical synopsis

Other laboratory data

Impossible to distinguish role of anti-Sc1 in presence of anti-D.


Neonate with 3+ DAT, eluted anti-Sc1, but Hgb = 13.5 g/dL and no HDFN. Mother B, R1r;
infant B, rr; husband Sc:1,2.
Healthy blood donor.

IgG3 subclass; steady rise in ADCC despite constant titer throughout pregnancy; 9 weeks postpartum ADCC
increased 4 and titer doubled (16 to 32).
Antibody demonstrated in serum, not in plasma, suggesting autoantibody is only seen when it reacts with a
coagulation factor; IgG3; very weak DAT (both IgG and C3b), weak anti-Sc1 eluted.
3+ DAT and anti-Sc1 in IAT. Eluates by heat, ether, and glycine acid were nonreactive, but xylene eluate showed
anti-Sc1.
Transient Sc antigen weakening: serum from initial presentation reacted 3+ with patients RBCs 2 years later.

Sudden-onset jaundice, pallor, fever with hepatomegaly, Hgb = 4.1 g/dL. AIHA diagnosed,
treated with steroids and IVIG, transfusion, urgent splenectomy. Transfusion-dependent for
4 weeks, then steroids stopped 7 months after splenectomy.
Hodgkin disease in remission, presented with 3 weeks of fatigue, 2-day Hgb decrease (9.1
to 5.7 g/dL). Gross hematuria and Tbili = 5.5 mg/dL during 3 units RBC transfusion.

DAT+ (IgG and C3d), elevated unconjugated bilirubin, reduced haptoglobin, hemoglobinuria. DAT negative with
follow-up. Serum and eluate demonstrated anti-Sc1.

Evans-like syndrome with anemia during a lung infection, 2 years of hospitalizations,


steroids, splenectomy, immune suppressants. Transfused safely after 16 plasma exchanges.
Carcinoma of the stomach, pretransfusion antibody screen positive. Hemolysis could be the
reason for the 2nd blood request, but this is not stated.
Healthy donors iatrogenically immunized for anti-D production.

Reported DAT+ , but presence of an antibody in his plasma which reacted with all erythrocytes tested except his
own. Antibody undetectable after the 9th exchange, but it reappeared, then disappeared after 4 more exchanges.
Whether the patient was hemolyzing and thus required the pretransfusion testing is not stated; therefore, we cannot
distinguish a DSTR from a DHTR as described in this paper.

Jaundice in infant (Tbili = 14.3 mg/dL) on DOL2, postphototherapy discharged Hct = 45%,
DOL20 Tbili = 6.5 mg/dL, Hct 17.3% with pallor, tachypnea, tachycardia; transfused 45 mL;
Hct 4 months later = 36.3% Mother B+; infant B-.
Preoperative testing.

Maternal serum 3+ against paternal RBCs (titer of 64) and Sc:1,2 RBCs; Paternal RBCs Sc:1,2. Neonate cord blood
DAT macroscopically + IgG; Neonate peripheral venous blood 2+; Readmission on DOL20 DAT 2+ (polyspec, IgG, and
C3); Eluate + on paternal and Sc:1,2 RBCs.
Antibody dropped to below detectable levels shortly after discovery.

Preoperative positive antibody screen for metastatic carcinoma surgery. Not transfused
owing to deteriorating clinical condition and lack of compatible blood.
Thalassemic with new IgG Ab, mother used as only available donor (also Sc:1,2). Patient
underwent splenectomy.
Lymphoma patient with severe anemia; 5 units incompatible RBCs transfused without
difficulty.
Hodgkin disease, CHF, moderate anemia; 6 units incompatible blood transfused without
difficulty.
2 children Rd+, both had HDFN; 1 child Rd, did not have HDFN.

Negative DAT, did not adsorb anti-Sc1 or anti-Sc2.

10 children in pedigree: 5 Rd with no HDFN; 1st 3 Rd+ without HDFN, last 2 Rd+ with
HDFN (1st of these requiring exchange transfusion).
4 children in family: 1 Rd with no HDFN; 1st 2 Rd+ without HDFN, last 1 Rd+ with HDFN.

Ab screen 12+ in all cells (anti-Sc1 identified). DAT (hospital), w+ (ref. lab; negative eluate). Posttransfusion
Hgb = 9.2 g/dL. Anti-Sc1 reacted w+ to patients cells. Genotyped SC1/SC1. Patient group O.

Antibody was undetectable after splenectomy and not stimulated by use of XM-compatible blood.
DAT weak with IgG and C3d, eluates negative. Antibody disappeared within 70 days.
DAT 3+ with C3d, negative with IgG, eluate negative. Serum antibody weaker after transfusion; additional follow-up
not possible.
Presumably very mild HDFN, as case detected by routine anti-globulin testing of cord blood.

In the same pedigree, Rd grandmother of HDN proband had 2 children, 1st Rd+ and 2nd Rd, neither had HDFN.

4 children in family: 1 Rd with no HDFN; 1st 2 Rd+ without HDFN, last 1 Rd+ with HDFN.
5 children in family: 3 Rd with no HDFN; 1 stillborn (3rd in birth order) followed by 1 Rd+
with HDFN.
Moderately strong DAT (polyspecific and IgG-eluate showed anti-Rd), weakened with time.
Negative Ab screen preoperatively.
Preoperative positive antibody screen for atoxic goiter surgery. Considered as a naturally
occurring antibody.
11 units RBC on 3 dates for gunshot wound surgery (7/5, 7/17, and 8/5). 1 unit found
incompatible on crossmatch (RT, 37C, and AHG) but screening RBCs still negative.
1 week after transfusion of 3 units RBC, Ab screen showed new anti-Jk b and a highfrequency antigen. DAT, patient eventually diagnosed with lymphoma and transfused with
autologous units.
Preoperative positive Ab screen for revision of right total hip arthroplasty, procedure
delayed until autologous units could be collected.
12 days after transfusion of 2 units RBC after orthopedic surgery, patient had decrease in
hematocrit, pretransfusion Ab screen positive, weakly DAT+ (IgG and C3).

No description of pathology of the stillborn fetus.


Patient is O+; 2 weeks after transfusion, strongly reactive antibody screen at new hospital. Her childs RBCs do not
react with patients posttransfusion plasma.

anti-Vw accounts for incompatible RT crossmatch.

Serum reacted with all cells except Sc:1,2, autologous, and the patients sibling (phenotype Sc:1,2). Identity of
antigen discovered with molecular testing years afterward.
Identity of antigen discovered with molecular testing years afterward.
Eluate reacted with all cells except Sc:1,2. Antibody no longer detected within 9 months. Identity of antigen
discovered with molecular testing years afterward.

Hct = hematocrit; HDFN = hemolytic disease of the fetus and newborn; Hgb = hemoglobin; IAT = indirect antiglobulin test; IgG = immunoglobulin G; IVIG =
intravenous immunoglobulin; RBCs = red blood cells; RT = room temperature; Tbili = total bilirubin; XM = crossmatch.

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

53

P.A.R. Brunker and W.A. Flegel

to SC system antigens are of clinical importance remains


unresolved because these antibodies are not routinely
characterized, especially if they are detected along with
other, better-understood alloantibodies that can account
for a clinical presentation.
On the Detection of SC System Antibodies in Routine
Pretransfusion Testing
The most important obstacle to understanding the
clinical consequences of transfusing across SC antigens is
that serologic reagents to simply define these antigens in
both patients and test RBCs have not been widely available.
As they do for the Dombrock blood group system,88
molecular approaches help resolve these situations. It
has been estimated that approximately 13 percent of the
transfused population are immunologic responders capable
of creating alloantibodies,89 but unless RBC reagents with
SC antigens are included in the routine laboratory workup,
these antibodies may go unnoticed. It is also problematic
if an antibody to one of the high-prevalence SC antigens is
in fact detected because the mere presence of the antibody
does not necessarily correspond to clinical importance.
Such a qualitative assay is insufficient. The quantitative
characterization of the antibody, such as by titer, has
only been performed in a few SC antibody cases, and we
recommend that this parameter be more routinely evaluated
in cases of possible hemolysis caused by antibodies in the SC
system and in most other blood group systems. Especially
because HDFN has been reported, establishing a better
understanding of antibody potency as detected by the titer
would help inform practice guidelines.
An economic and rational approach would be
the routine use of recombinant SC protein during
pretransfusion testing before titration to effectively screen
only for antibodies present above a threshold titer.87 In
this way, nuisance antibodies (akin to the low-titer cold
autoantibodies detected before routine testing at higher
temperatures) would fall under the radar as desired and
precious laboratory resources would not be spent working
up these most likely incidental findings. Only higher titer
antibodies would be detected, focusing the laboratory
investigation on cases more likely to be of consequence to
the patient. If these laboratory techniques do lead to the
increased identification of SC system alloantibodies, the
medical importance of respecting them in a particular
patients transfusion recommendation remains debatable.
Should We Genotype for SC Alleles?
The integration of molecular diagnostics with transfusion medicine has been a slow, but steady, process, with
applications ranging from individual patient prenatal

54

diagnosis to routine high-throughput donor testing.90,91


Although the rate of implementation of these technologies
varies among nations92 and local transfusion services,93 it is
expanding.94 The transfusion community should move these
procedures from potentially inaccessible research laboratories
to standard clinical practice.95 For optimal performance of
such an approach toward personalized medicine, ideally all
donors and all recipients should be evaluated at a molecular
level. Economic barriers to this strategy are falling as highthroughput and multiplexed assays are achieved, because
the incremental cost of adding a handful of additional SNPs
when designing a DNA microarray is negligible. Consequently,
molecular testing strategies are shifting from decisions about
which variants to include in a genotyping system that force the
prioritization of well-studied variants already known to have
medical importance, to finding effective platforms to analyze
data derived from genotyping as many known variants as
possible, regardless of their allele frequencies or uncertain
clinical effects.
The most compelling reason to genotype SC variants in
greater depth, both by increasing the number of donors and
patients and also by including more variants regardless of
their prevalence, is that such data are necessary to clarify
the presently ambiguous role of SC in clinical transfusion
practice. At the same time, valuable data for research into
ERMAP biology are accrued without added costs. Inclusion
of the SC*01 to SC*07 alleles in high-throughput assays
would be a move in the right direction, and in cases of
unresolved serology, a referral to the molecular laboratory
for an in-depth investigation may be desirable. By using
a high-throughput genetic test to determine the potential
for alloimmunization by a variant homozygote, we can
collect such genetic data almost for free. The pursuit of
alloantibodies in such variant homozygous patients is
a feasible strategy to achieve complete resolution of all
alloantibodies in a posttransfusion sample submitted as a
transfusion reaction investigation. Consequently, knowing
these genetic data gives us the opportunity to better define
which antibodies are of clinical importance.
Conclusion
The SC story is an excellent example of the essential
roles that classical genetics played in the original physical
mapping of a blood group system and is an exceptional
illustration of transfusion laboratories that were in the right
place at the right time to finally identify the responsible
locus in the era of whole genome analysis. Parsing out the
meaning of global polymorphism frequency distributions
in light of founder effects or selection pressures would be
a useful adjunct to in vitro studies of transcript utilization

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Scianna blood group system: a review

and protein expression and function. The continued


study of ERMAP homologues, such as the BTNL family of
proteins in general, and their physiologic interactions in
other species, such as the B30.2-containing bloodthirsty
gene in Antarctic icefishes, is a promising avenue to explore
fundamental insights into erythropoiesis. Investigators
in transfusion medicine are uniquely poised not only to
carry out this work but also to lead the way toward a more
comprehensive understanding of the lucky 13th blood
group, SC, making us the lucky ones indeed.
Acknowledgment
We gratefully acknowledge Professor Guillaume
Lecointre for kindly providing the photograph of blood
from the Antarctic icefish (Fig. 5).
References

1. Wagner FF, Poole J, Flegel WA. Scianna antigens including


Rd are expressed by ERMAP. Blood 2003;101:7527.
2. Schmidt RP, Griffitts JJ, Northman FF. A new antibody,
anti-Sm, reacting with a high incidence antigen. Transfusion
1962;2:33840.
3. Anderson C, Hunter J, Zipursky A, Lewis M, Chown B.
An antibody defining a new blood group antigen, Bu-a.
Transfusion 1963;3:303.
4. Lewis M, Chown B, Schmidt RP, Griffitts JJ. A possible
relationship between the blood group antigens Sm and
Bu-a. Am J Hum Genet 1964;16:2545.
5. Lewis M, Chown B, Kaita H, Philipps S. Further
observations on the blood group antigen Bu-a. Am J Hum
Genet 1964;16:25660.
6. Seyfried H, Frankowska K, Giles CM. Further examples
of anti-bu-a found in immunized donors. Vox Sang 1966;
11:51216.
7. Lewis M, Chown B, Kaita H. On the blood group antigens
Bua and Sm. Transfusion 1967;7:924.
8. Giles CM, Bevan B, Hughes RM. A family showing
independent segregation of Bua and Ytb. Vox Sang 1970;
18:2656.
9. Rowe GP. A second family showing independent segregation
of Sc 2(Bua) and Ytb. Vox Sang 1986;50:191.
10. Lewis M, Kaita H, Chown B. Scianna blood group system.
Vox Sang 1974;27:2614.
11. Lewis M, Kaita H, Chown B. Genetic linkage between the
human blood group loci Rh and Sc (Scianna). Am J Hum
Genet 1976;28:61920.
12. Lewis M, Kaita H, Ct GB, Chown B, Giblett ER, Anderson
JA. Chromosome 1: lods on linkage among eight loci: Do,
ENO1, Fy, PGM1, Rh, UMPK, Sc, and PGD. Birth Defects
Orig Artic Ser 1976;12:3225.
13. Lewis M, Kaita H, Chown B. Relative positions of
chromosome 1 loci Fy, PGM1, Sc, UMPK, Rh, PGD and
ENO1 in man. Can J Genet Cytol 1977;19:695709.

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

14. Lewis M, Kaita H, Giblett ER, Anderson JE. Data on


chromosome 1 loci Fy, PGM1, Sc, UMPK, Rh, PGD, and
ENO1: two-point lods, R:NR counts, multipoint information,
and map. Cytogenet Cell Genet 1978;22:3925.
15. Noades JE, Corney G, Cook PJ, et al. The Scianna blood
group lies distal to uridine monophosphate kinase on
chromosome 1p. Ann Hum Genet 1979;43:12132.
16. McCreary J, Vogler AL, Sabo B, Eckstein EG, Smith TR.
Another minus-minus phenotype: Bu(a-)Sm-, two examples
in one family [abstract]. Transfusion 1973;13:350.
17. Nason SG, Vengelen-Tyler V, Cohen N, Best M, Quirk J. A
high incidence antibody (anti-Sc3) in the serum of a Sc:-1,-2
patient. Transfusion 1980;20:5315.
18. Devine P, Dawson FE, Motschman TL, et al. Serologic
evidence that Scianna null (Sc:-1,-2) red cells lack multiple
high-frequency antigens. Transfusion 1988;28:3469.
19. Woodfield DG, Giles C, Poole J, Oraka R, Tolanu T. A further
null phenotype (Sc-1-2) in Papua New Guinea [Abstract].
21st Congress of the Int Soc Haem and 19th Congress of the
ISBT, Sydney, Australia, May 1986; 651.
20. Rausen AR, Rosenfield RE, Alter AA, et al. A new infrequent
red cell antigen, Rd (radin). Transfusion 1967;7:33642.
21. Lundsgaard A, Jensen KG. Two new examples of anti-Rd.
A preliminary report on the frequency of the Rd (Radin)
antigen in the Danish population. Vox Sang 1968;14:4527.
22. Lewis M, Kaita H. Genetic linkage between the Radin and
Rh blood group loci. Vox Sang 1979;37:2869.
23. Lewis M, Kaita H, Philipps S, et al. The position of the Radin
blood group locus in relation to other chromosome l loci.
Ann Hum Genet 1980;44(Pt 2):17984.
24. Spring FA, Herron R, Rowe G. An erythrocyte glycoprotein
of apparent Mr 60,000 expresses the Sc1 and Sc2 antigens.
Vox Sang 1990;58:1225.

25.
Spring FA. Characterization of blood-group-active
erythrocyte membrane glycoproteins with human antiseras.
Transfus Med 1993;3:16778.
26. Su YY, Gordon CT, Ye TZ, Perkins AC, Chui DH. Human
ERMAP: an erythroid adhesion/receptor transmembrane
protein. Blood Cells Mol Dis 2001;27:93849.
27. Xu H, Foltz L, Sha Y, et al. Cloning and characterization of
human erythroid membrane-associated protein, human
ERMAP. Genomics 2001;76:24.
28. Ensembl entry for ERMAP, number ENSG00000164010
2010. http://www.ensembl.org/Homo_sapiens/Location/
View?db=core;r=1:43276635-43326634. Accessed July 14,
2010.
29. Entrez Gene entry for ERMAP. http://www.ncbi.nlm.nih.
gov/gene/114625. Accessed July 14, 2010.

30.
Havana entry for ERMAP, transcript numbers
OTTHUMT00000020180
through
OTTHUMT
00000020184 2010. http://vega.sanger.ac.uk/Homo_
sapiens/Gene/Summary?g=OTTHUMG00000007619.
Accessed July 14, 2010.
31. Ensembl Transcript View, ERMAPs 5 listed transcripts
2010.
http://www.ensembl.org/Homo_sapiens/Gene/Su
mmary?db=core;g=ENSG00000164010;r=1:4327663543326634;t=ENST00000470938. Accessed July 14, 2010.

55

P.A.R. Brunker and W.A. Flegel

32. Fuchisawa A, Lomas-Francis C, Hue-Roye K, Reid ME. The


polymorphism nt 76 in exon 2 of SC is more frequent in
whites than in blacks. Immunohematology 2009;25:1819.
33. Hashmi G, Shariff T, Zhang Y, et al. Determination of 24
minor red blood cell antigens for more than 2000 blood
donors by high-throughput DNA analysis [published
correction appears in Transfusion 2007;47:952].
Transfusion 2007;47:73647.
34. Ribeiro KR, Guarnieri MH, da Costa DC, Costa FF,
Pellegrino J Jr, Castilho L. DNA array analysis for red
blood cell antigens facilitates the transfusion support with
antigen-matched blood in patients with sickle cell disease.
Vox Sang 2009;97:14752.
35. Skradski KJ, McCreary J, Sabo B, Polesky HF. An antibody
against a high frequency antigen absent on red cells of
the Scianna:-2,-2 phenotype [abstract]. Transfusion 1982
(22):406.
36. Hue-Roye K, Chaudhuri A, Velliquette RW, et al. STAR: a
novel high-prevalence antigen in the Scianna blood group
system. Transfusion 2005;45:2457.
37. Flegel WA, Chen Q, Reid ME, et al. SCER and SCAN: two
novel high-prevalence antigens in the Scianna blood group
system. Transfusion 2005;45:19404.
38. Smigielski EM, Sirotkin K, Ward M, Sherry ST. dbSNP: a
database of single nucleotide polymorphisms. Nucleic Acids
Res 2000;28:3525.
39. The International HapMap Project Homepage 2010. http://
hapmap.ncbi.nlm.nih.gov/. Accessed July 14, 2010.
40.
Stephan W. Genetic hitchhiking versus background
selection: the controversy and its implications. Philos Trans
R Soc Lond B Biol Sci 2010;365:124553.
41. Williams AF, Barclay AN. The immunoglobulin superfamilydomains for cell surface recognition. Annu Rev
Immunol 1988;6:381405.
42. Cannon JP. Plasticity of the immunoglobulin domain in the
evolution of immunity. Integr Comp Biol 2009;49:18796.
43. Harpaz Y, Chothia C. Many of the immunoglobulin
superfamily domains in cell adhesion molecules and surface
receptors belong to a new structural set which is close to
that containing variable domains. J Mol Biol 1994;238:
52839.
44. Aricescu AR, Jones EY. Immunoglobulin superfamily cell
adhesion molecules: zippers and signals. Curr Opin Cell Biol
2007;19:54350.
45.
Peggs KS, Allison JP. Co-stimulatory pathways in
lymphocyte regulation: the immunoglobulin superfamily.
Br J Haematol 2005;130:80924.
46. Vogel C, Chothia C. Protein family expansions and biological
complexity. PLoS Comput Biol 2006;2:e48.
47. Simon TL, Dzik WH, Snyder EL, Stowell CP, Strauss RG,
eds. Rossis Principles of Transfusion Medicine. 3rd ed.
Philadelphia, PA: Lippincott Williams & Wilkins, 2002.
48. Sharpe AH, Freeman GJ. The B7-CD28 superfamily. Nat
Rev Immunol 2002;2:11626.
49. Mather IH, Jack LJ. A review of the molecular and cellular
biology of butyrophilin, the major protein of bovine milk fat
globule membrane. J Dairy Sci 1993;76:383250.

56

50. Rhodes DA, Stammers M, Malcherek G, Beck S, Trowsdale


J. The cluster of BTN genes in the extended major
histocompatibility complex. Genomics 2001;71:35162.
51. Robenek H, Hofnagel O, Buers I, et al. Butyrophilin
controls milk fat globule secretion. Proc Natl Acad Sci U S A
2006;103:1038590.
52. Smith IA, Knezevic BR, Ammann JU, et al. BTN1A1, the
mammary gland butyrophilin, and BTN2A2 are both
inhibitors of T cell activation. J Immunol 2010;184:
351425.
53. Valentonyte R, Hampe J, Huse K, et al. Sarcoidosis is
associated with a truncating splice site mutation in BTNL2
[published correction appears in Nat Genet 2005;37:652].
Nat Genet 2005;37:35764.
54.
Arnett HA, Escobar SS, Viney JL. Regulation of
costimulation in the era of butyrophilins. Cytokine 2009;
46:3705.
55. Nguyen T, Liu XK, Zhang Y, Dong C. BTNL2, a butyrophilinlike molecule that functions to inhibit T cell activation. J
Immunol 2006;176:735460.
56. Meyer M, Gaudieri S, Rhodes DA, Trowsdale J. Cluster of
TRIM genes in the human MHC class I region sharing the
B30.2 domain. Tissue Antigens 2003;61:6371.
57. Vernet C, Boretto J, Mattei MG, et al. Evolutionary study of
multigenic families mapping close to the human MHC class
I region. J Mol Evol 1993;37:60012.
58. Jack LJ, Mather IH. Cloning and analysis of cDNA encoding
bovine butyrophilin, an apical glycoprotein expressed in
mammary tissue and secreted in association with the milkfat globule membrane during lactation. J Biol Chem 1990;
265:144816.
59. Tazi-Ahnini R, Henry J, Offer C, Bouissou-Bouchouata
C, Mather IH, Pontarotti P. Cloning, localization, and
structure of new members of the butyrophilin gene family in
the juxta-telomeric region of the major histocompatibility
complex. Immunogenetics 1997;47:5563.
60. Weinert C, Grtter C, Roschitzki-Voser H, Mittl PR,
Grtter MG. The crystal structure of human pyrin b30.2
domain: implications for mutations associated with familial
Mediterranean fever. J Mol Biol 2009;394:22636.
61. Woo JS, Imm JH, Min CK, Kim KJ, Cha SS, Oh BH.
Structural and functional insights into the B30.2/SPRY
domain. EMBO J 2006;25:135363.
62. Woo JS, Suh HY, Park SY, Oh BH. Structural basis for
protein recognition by B30.2/SPRY domains. Mol Cell
2006;24:96776.
63. Jeong J, Rao AU, Xu J, et al. The PRY/SPRY/B30.2
domain of butyrophilin 1A1 (BTN1A1) binds to xanthine
oxidoreductase: implications for the function of BTN1A1 in
the mammary gland and other tissues. J Biol Chem 2009;
284:2244456.
64. Garofalo F, Pellegrino D, Amelio D, Tota B. The Antarctic
hemoglobinless icefish, fifty five years later: a unique
cardiocirculatory interplay of disaptation and phenotypic
plasticity. Comp Biochem Physiol A Mol Integr Physiol
2009;154:1028.
65. Yergeau DA, Cornell CN, Parker SK, Zhou Y, Detrich HW
3rd. bloodthirsty, an RBCC/TRIM gene required for
erythropoiesis in zebrafish. Dev Biol 2005;283:97112.

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Scianna blood group system: a review

66. Ye TZ, Gordon CT, Lai YH, et al. Ermap, a gene coding for
a novel erythroid specific adhesion/receptor membrane
protein. Gene 2000;242:33745.
67. Kuriyan MA, Oyen RE, Marsh WL. Demonstration of Diego
(Dib) and Scianna (Scl) antigens on phagocytic leukocytes
of the blood. Transfusion 1978;18:3614.
68. Rojewski MT, Schrezenmeier H, Flegel WA. Tissue
distribution of blood group membrane proteins beyond red
cells: evidence from cDNA libraries. Transfus Apher Sci
2006;35:7182.
69. He XR, He YY, Chen Y, Ye TZ. Expression of human ERMAP
gene in fetal tissues [in Chinese]. Zhongguo Shi Yan Xue Ye
Xue Za Zhi 2006;14:9725.
70. Zhang XH, Ye TZ, Hu B, Si WZ. Quantification of human
ERMAP by using real-time FQ-PCR [in Chinese]. Zhongguo
Shi Yan Xue Ye Xue Za Zhi 2005;13:1547.
71. He YY, Zhang XH, Ye TZ, Wu ZL. Study on the expression
of human ERMAP gene in erythropoietic and macrophage
differentiation of K562 cells [in Chinese]. Zhongguo Shi Yan
Xue Ye Xue Za Zhi 2005;13:5536.
72. He YY, Zhang XH, Ye TZ, Wu ZL. Expression of human
ERMAP gene in different cell lines [in Chinese]. Zhongguo
Shi Yan Xue Ye Xue Za Zhi 2005;13:81922.
73. Liang JF, Chen Y, Ye TZ, et al. Effects of human ERMAPsiRNA on erythroid differentiation of K562 cells induced by
Ara-C [in Chinese]. Zhongguo Shi Yan Xue Ye Xue Za Zhi
2009;17:4953.
74. Lin LD, He XR, Ye TZ, et al. Expression of human ERMAP
gene in umbilical cord blood mononuclear cells during
differentiation and development towards erythroid
lineage [in Chinese]. Zhongguo Shi Yan Xue Ye Xue Za Zhi
2008;16:32832.
75. Reid ME, Lomas-Francis C. The blood group antigen
factsbook. 2nd ed. San Diego, CA: Academic Press; 2004.
76. Velliquette RW. Review: the Scianna blood group system.
Immunohematology 2005;21:706.
77. Kaye T, Williams EM, Garner SF, Leak MR, Lumley H. AntiSc1 in pregnancy. Transfusion 1990;30:43940.
78. Tregellas WM, Holub MP, Moulds JJ, Lacey PA. An example
of autoanti-Sc1 demonstrable in serum but not in plasma
[abstract]. Transfusion 1979;19:650.
79. McDowell MA, Stocker I, Nance S, Garratty G. Auto anti-Sc1
associated with autoimmune hemolytic anemia [abstract].
Transfusion 1986;26:578.
80. Owen I, Chowdhury V, Reid ME, Poole J, Marsh JC, Hows
JM. Autoimmune hemolytic anemia associated with antiSc1. Transfusion 1992;32:1736.
81.
Ramsey G, Williams LM. Autoimmune hemolytic
anemia with auto-anti-Sc1, weakened Sc:1 antigen, and
superimposed transfusion-associated acute hemolysis
[abstract]. Transfusion 2010;50(2S):156A.

82. Steane EA, Sheehan RG, Brooks BD, Frenkel EP.


Therapeutic plasmapheresis in patients with antibodies to
high-frequency red cell antigens. Prog Clin Biol Res 1982;
106:34753.
83. DeMarco M, Uhl L, Fields L, Pacini D, Gorlin JB, Kruskall
MS. Hemolytic disease of the newborn due to the Scianna
antibody, anti-Sc2. Transfusion 1995;35:5860.
84. Peloquin P, Moulds M, Keenan J, Kennedy M. Anti-Sc3
as an apparent autoantibody in two patients [abstract].
Transfusion 1989;29(Suppl):49S.
85. Winn LC, Eska PL, Grindon AJ. Anti-Rd (Radin) following
the transfusion of a Radin positive unit of blood. Transfusion
1976;16:3512.
86. Wagner FF, Frohmajer A, Ladewig B, et al. Weak D alleles
express distinct phenotypes. Blood 2000;95:2699708.
87. Seltsam A, Grueger D, Blasczyk R, Flegel WA. Easy
identification of antibodies to high-prevalence Scianna
antigens and detection of admixed alloantibodies using
soluble recombinant Scianna protein. Transfusion 2009;
49:20906.
88. Reid ME. Complexities of the Dombrock blood group system
revealed. Transfusion 2005;45(2 Suppl):92S9S.
89. Higgins JM, Sloan SR. Stochastic modeling of human RBC
alloimmunization: evidence for a distinct population of
immunologic responders. Blood 2008;112:254653.
90. Reid ME. Transfusion in the age of molecular diagnostics.
Hematology Am Soc Hematol Educ Program 2009:1717.
91. Veldhuisen B, van der Schoot CE, de Haas M. Blood
group genotyping: from patient to high-throughput donor
screening. Vox Sang 2009;97:198206.
92. Flegel WA. Blood group genotyping in Germany. Transfusion
2007;47(1 Suppl):47S53S.
93. Hillyer CD, Shaz BH, Winkler AM, Reid M. Integrating
molecular technologies for red blood cell typing and
compatibility testing into blood centers and transfusion
services. Transfus Med Rev 2008;22:11732.
94. Garraty G, Reid M, Westhoff C, eds. A Workshop on
Methods in Molecular Immunohematology. Transfusion
2010;47:1S100S.
95. Denomme GA, Flegel WA. Applying molecular immunohematology discoveries to standards of practice in blood
banks: now is the time. Transfusion 2008;48:246175.
Patricia A.R. Brunker, MD, DPhil, and Willy A. Flegel,
MD (corresponding author), Laboratory Services Section,
Department of Transfusion Medicine, Clinical Center, National
Institutes of Health, Bethesda, MD 20892.

Immunohematology is on the Web!


Important Notice About Manuscripts for
Immunohematology
Please e-mail all manuscripts to immuno@usa.redcross.org

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

www.redcross.org/immunohematology
For more information, send an e-mail to
immuno@usa.redcross.org

57

Case R ep ort

Possible suppression of fetal erythropoiesis by


the Kell blood group antibody anti-Kpa
M. Tuson, K. Hue-Roye, K. Koval, S. Imlay, R. Desai, G. Garg, E. Kazem, D. Stockman, J. Hamilton, and M.E. Reid

Antibodies to antigens in the Kell blood group system are usually


immunoglobulin G, and, notoriously, anti-K, anti-k, and anti-Kpa
can cause severe hemolytic transfusion reactions, as well as severe
hemolytic disease of the fetus and newborn (HDFN). It has been
shown that the titer of anti-K does not correlate with the severity
of HDFN because, in addition to immune destruction of red
blood cells (RBCs), anti-K causes suppression of erythropoiesis
in the fetus, which can result in severe anemia. We report a case
involving anti-Kpa in which one twin was anemic and the other
was not. Standard hemagglutination and polymerase chain
reaction (PCR)-based tests were used. At delivery, anti-Kpa was
identified in serum from the mother and twin A, and in the eluate
prepared from the babys RBCs. PCR-based assays showed twin
A (boy) was KEL*841T/C (KEL*03/KEL*04), which is predicted
to encode Kp(a+b+). Twin B (girl) was KEL*841C/C (KEL*04/
KEL*04), which is predicted to encode Kp(ab+). We describe
the first reported case of probable suppression of erythropoiesis
attributable to anti-Kpa. One twin born to a woman whose serum
contained anti-Kpa experienced HDFN while the other did not.
Based on DNA analysis, the predicted blood type of the affected
twin was Kp(a+b+) and that of the unaffected twin was Kp(ab+).
The laboratory findings and clinical course of the affected twin
were consistent with suppression of erythropoiesis in addition
to immune RBC destruction. Immunohematology 2011;27:
5860.

Key words: erythropoiesissuppression, Kell blood


group system, hemolytic disease of the newborn, Kpa
The first antigen in the Kell blood group system, K, was
discovered in 1946 as the result of hemolytic disease of the
newborn. The system now includes 31 antigens. Antibodies
to K, k, Kpa, Kpb, Kpc, Jsa, and Jsb are the most clinically
important.1 Next to anti-A, anti-B, and anti-D, anti-K is
the most common immune RBC antibody.2 Antibodies to
antigens in the Kell blood group system are usually IgG,
and, notoriously, anti-K, anti-k, and anti-Kpa cause severe
hemolytic transfusion reactions, as well as severe hemolytic
disease of the fetus and newborn (HDFN).3,4
It is well known that the titer of anti-K does not correlate
with the severity of HDFN; indeed, severe HDFN caused
by anti-K has been associated with lower antibody titers,
bilirubin levels, and reticulocytosis than has hemolytic
disease of the newborn caused by anti-D.2,3 The anemia
seen in these infants is caused by a combination of immune
destruction and suppression of erythropoiesis in the
fetus.5,6 Vaughan et al. demonstrated experimentally that

58

proliferation of K+ erythroid progenitors was inhibited by


anti-K, and suggested that the K glycoprotein plays a role in
erythropoiesis.5
Cases of HDFN involving antibodies to other antigens
in the Kell system of antibodies are rare. We retrospectively
report a case of HDFN in twins of a mother whose serum
contained anti-Kpa. The Kp(a+) twin was anemic, and the
Kp(a) twin was not.
Case History
A 31-year-old gravida 3, para 2 woman with a history
of a negative antibody screen delivered ABO-identical, Rhcompatible fraternal twins at full term (37 weeks gestation).
The mother had two previous pregnancies delivered by
cesarean section; no problems were noted in the medical
record. At delivery, the cord hemoglobin (Hb) for twin A
(male) was 10.2 g/dL and for twin B (female) was 17.0 g/dL.
Unfortunately, there were no cord bilirubin or reticulocyte
counts done for either twin.
Because of anemia, shortly after birth twin A received
a single-aliquot RBC transfusion that was compatible with
the maternal serum. On day 1, he received an additional
single-aliquot transfusion with RBCs and was discharged
on day 5 with a Hb of 15.1 g/dL and an absolute reticulocyte
count of 0.16 109/L (normal range of 0.1250.325
109/L). Transfusion was again required on day 25 when the
Hb reached a nadir of 7.5 g/dL with a decreased absolute
reticulocyte count of 0.007 m/L. Additional transfusions
were given on days 30 and 39 to maintain a Hb level above
9.0 g/dL. After transfusion of two aliquots on day 39, the
Hb of twin A was 9.6 g/dL and on day 43 and 52 it was 9.3
g/dL and 9.5 g/dL, respectively. Two weeks later the Hb was
10.3 g/dL, and 6 months later it was 12.6 g/dL. The infants
bilirubin peaked at 5 mg/dL on day 1 and fell steadily during
the monitoring period. White blood cell and platelet counts
remained normal.
Materials and Methods
Hemagglutination
Standard hemagglutination tests were used throughout.
The cord blood samples were tested by tube method for

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Suppression of fetal erythropoiesis by anti-Kpa

ABO, Rh, and direct antiglobulin test (DAT). The maternal


and paternal samples were tested by MTS gel cards (Ortho
Clinical Diagnostics, Raritan, NJ).
Polymerase Chain ReactionRestriction Fragment
Length Polymorphism Analysis for KEL*03/KEL*04
Genomic DNA was isolated from epithelial cells
captured by the buccal swabs obtained from the twins
using a DNA kit (QIAamp DNA Blood Mini Kit, QIAGEN,
Inc., Valencia, CA). Exon 8 of KEL was amplified using
a forward oligonucleotide primer (Life Technologies,
Inc., Gaithersburg, MD) designed within exon 8
(TACCTGACTTACCTGAATCAGCTGGGAACC)
and
a
reverse oligonucleotide primer designed at the 3 end of
exon 8 and into intron 8 (tcttctggcccccagttccaggcacCATGA).
Five microliters of DNA per reaction was amplified by 5
units of Taq DNA polymerase (HotStarTaq, QIAGEN Inc.,
Valencia, CA) in a 50-L reaction mixture containing
2.5 mM MgCl2, 1 PCR buffer, 0.2 mM dNTPs, and 100
ng of forward and reverse primer. The PCR amplification
was achieved in 35 cycles with a final extension time of 10
minutes, using 62C as the annealing temperature. The
PCR 202-bp products were digested using the restriction
enzyme NlaIII. A restriction enzyme site for this restriction
enzyme is present in the KEL*03 variant (841T) but not in
the wild-type (841C).
Results
Hemagglutination
At the time of delivery, anti-Kpa was identified in the
maternal serum. No other unexpected antibodies were
present in the maternal serum. Tests using the serum
from twin A and an eluate prepared from his RBCs also
contained anti-Kpa (Table 1). Antibody testing on days 25,
30, and 39 demonstrated the persistence of anti-Kpa in the
babys serum.
Polymerase Chain ReactionRestriction Fragment
Length Polymorphism Analysis for KEL*03/KEL*04
Twin A (boy) was KEL*841T/C (KEL*03/KEL*04),
which is predicted to encode Kp(a+b+). Twin B (girl) was
KEL*841C/C (KEL*04/KEL*04), which is predicted to
encode Kp(ab+).
Conclusions
We describe the first reported case of possible
suppression of erythropoiesis attributable to anti-Kpa. One
twin born to a woman whose serum contained anti-Kpa
experienced HDFN and anemia, while the other did not.

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Table 1. Results of hemagglutination tests


Mother

Twin A

Twin B

Father

ABO/Rh

A+

A+

A+

A+

Not tested

DAT

Not tested

4+

IAT with
maternal serum

Not tested

Not tested

Other studies

Anti-Kpa

Anti-Kpa in
serum and
eluate

DNA from
buccal smear

Not tested

KEL*03/
KEL*04

Compatible Incompatible
Kp(a+)

KEL*04/
KEL*04

Not tested

DAT = direct antiglobulin test; IAT = indirect antiglobulin test.

Based on DNA analysis, the predicted blood type of the


affected twin was Kp(a+b+) and that of the unaffected twin
was Kp(ab+). The laboratory findings and clinical course
of the affected twin were consistent with suppression of
erythropoiesis in addition to immune RBC destruction. The
steadily declining bilirubin levels concurrent with a declining
hemoglobin level and decreased absolute reticulocyte
count provide supportive evidence for this interpretation.
It is possible that the change in the reticulocyte count was
induced, or exacerbated, by transfusion. Although this was
a retrospective study and not all data were available to us, it
is worth documenting, especially because one twin was an
antigen-negative twin and served as a control.
Antigens in the Kell blood group system appear on
erythroid progenitor cells early in erythropoiesis.7,8 Because
erythroid progenitor cells do not contain hemoglobin,
immune destruction of these cells by anti-Kpa could
explain the absence of hyperbilirubinemia in our patient.
The restriction of Kell messenger RNA and protein to
erythroid precursors explains why white blood cell and
platelet counts remained normal in the affected twin.9,10
The anemia of the affected twin resolved after 3 months,
and his Hb has remained within the normal range. Twin B
had no postdelivery complications and provides a biologic
control for factors other than maternal alloantibody as a
cause of the anemia. Although anti-K is most commonly
associated with erythropoietic suppression, twin A shows
that antibodies to other antigens in the Kell blood group
system can also have this capability.
Acknowledgments
We thank Yaddanapudi Ravindranath, MD, for followup information after the twins were discharged from
the hospital and Robert Ratner for help in preparing the
manuscript.

59

M. Tuson et al.

References
1. Reid ME, Lomas-Francis C. Blood Group Antigens and
Antibodies: A guide to clinical relevance and technical tips.
New York, NY: Star Bright Books, 2007.
2. Klein HG, Anstee DJ. Mollisons blood transfusion in clinical
medicine. 11th ed. Oxford: Wiley-Blackwell, 2006.
3. Roback JD, Combs MR, Grossman BJ, et al. Technical
manual. 16th ed. Bethesda, MD: American Association of
Blood Banks, 2008.
4. Costamagna L, Barbarini M, Viarengo GL, Pagani A, Isernia
D, Salvaneschi L. A case of hemolytic disease of the newborn
due to anti-Kpa. Immunohematology 1997;13:612.
5. Vaughan JI, Manning M, Warwick RM, Letsky EA, Murray
NA, Roberts IA. Inhibition of erythroid progenitor cells by
anti-Kell antibodies in fetal alloimmune anemia. N Engl J
Med 1998;338:798803.
6. Daniels G, Hadley A, Green CA. Causes of fetal anemia in
hemolytic disease due to anti-K. Transfusion 2003;43:115
16.
7. Southcott MJG, Tanner MJ, Anstee DJ. The expression of
human blood group antigens during erythropoiesis in a cell
culture system. Blood 1999;93:442535.

8. Daniels G, Green C. Expression of red cell surface antigens


during erythropoiesis. Vox Sang 2000;78(Suppl 2):14953.
9. Jaber A, Loirat MJ, Willem C, Bloy C, Cartron JP, Blanchard
D. Characterization of murine monoclonal antibodies
directed against the Kell blood group glycoprotein. Br J
Haematol 1991;79:31115.
10. McGinniss MH, Dean A. Expression of red cell antigens by
K562 human leukemia cells before and after induction of
hemoglobin synthesis by hemin. Transfusion 1985;25:105
9.
Michelle Tuson, MT(ASCP)SBB, Trinity Health, Farmington Hills,
MI; Kim Hue-Roye, BSc, Laboratory of Immunochemistry, New
York Blood Center, New York, NY; Karen Koval, MT, Sherwin
Imlay, MD, Rajendra Desai, MD, Gayatri Garg, MD, and Esam
Kazem, MD, St. Joseph Mercy HospitalOakland, Pontiac, MI;
Diane Stockman, MT(ASCP), and Janis S. Hamilton, MT(ASCP)
SBB, American Red Cross, Southeastern Michigan Region,
Detroit, MI; and Marion E. Reid, PhD (corresponding author),
Laboratory of Immunochemistry, New York Blood Center, 310
East 67th Street, New York, NY 10065.

Attention: SBB and BB Students


You are eligible for a free 1-year subscription to
For information concerning the National Reference
Laboratory for Blood Group Serology, including the American
Rare Donor Program, contact Sandra Nance, by phone at
(215) 451-4362, by fax at (215) 451-2538, or by e-mail at
snance@usa.redcross.org

Notice to Readers
All articles published, including communications and book
reviews, reflect the opinions of the authors and do not
necessarily reflect the official policy of the American Red
Cross.

60

Immunohematology.
Ask your education supervisor to submit the name and
complete address for each student and the inclusive dates
of the training period to immuno@usa.redcross.org

Attention:
State Blood Bank Meeting Organizers
If you are planning a state meeting and would like copies
of Immunohematology for distribution, please send request,
4 months in advance, to immuno@usa.redcross.org

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Report

Challenging dogma: group A donors as


universal plasma donors in massive
transfusion protocols
E.J. Isaak, K.M. Tchorz, N. Lang, L. Kalal, C. Slapak, G. Khalife, D. Smith, and M.C. McCarthy

The use of massive transfusion protocols (MTPs) in


trauma patients presenting with near-exsanguinating
injuries has increased in the past several years. This is
largely a result of the increasing evidence suggesting that
transfusion of blood components in ratios more closely
approximating the composition of whole blood may reduce
mortality.14 Inherent in the design of these protocols
is the necessity for the timely transfusion of plasma.
Unfortunately, the need for plasma often precedes the
determination of blood group.
Group AB plasma is commonly used in MTP when
the patients blood type has not yet been determined. The
foundation for this practice is rooted in the theory that
group AB plasma is universal because of the absence of
anti-A and anti-B hemagglutinins. Likewise, it is analogous
to the belief that group O red blood cells (RBCs) are
universal and may be transfused to all patients, regardless
of blood type. This universal blood component practice
continues to this day, based on concerns that infusion of
incompatible plasma may produce hemolysis, a potentially
fatal complication. Unfortunately, in the United States the
availability of group AB plasma is limited because only 4
percent of all blood donors in North America are group
AB.5 Therefore, plasma from group AB donors may not be
available in sufficient quantities to satisfy the requirements
for an MTP in all trauma settings.
Historically, this risk of hemolysis has outweighed
concerns about the potential risks associated with
compatible but nonidentical plasma. Although experience
in populations receiving apheresis platelets has proved that
the concern about intravascular hemolysis is warranted,618
the belief that group AB plasma is universal plasma has
been repeatedly challenged in several patient populations,
including those undergoing cardiac surgery,19 receiving
treatment for hematologic malignancies,20 or receiving
stem cell transplants.21 For patients in whom a hemolytic
reaction may occur, there are three important observations
to consider. First, minor incompatibilities appear to be
rare events, with one study suggesting an incidence of 1 in
9000.22 Second, in these anecdotal case reports in which

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

hemolytic reactions occurred, the suspected components


contained plasma from group O donors.8,23,24 After careful
review of these case reports, no patient belonging to group
B or group AB was found to have experienced a hemolytic
event after transfusion with group A plasma. Third, and
most interestingly, it appears that correlations between
these hemolytic episodes and agglutinin titers exist.17,2527
If the level of anti-A and anti-B agglutinin titers could
be quantified in compatible but nonidentical plasma units,
perhaps a novel approach to a plasma substitution could
be made for MTPs. For example, if group AB plasma is
not available or is in short supply from local blood bank
sources, it may be feasible and preferable to use group A
plasma. Because approximately 15 percent of the North
American population are group B or group AB, the use of
group A plasma is already acceptable for approximately 85
percent of the general population. Published experience
from different institutions indicates that transfusion of 300
to 500 mL of incompatible plasma in 1 day and transfusion
of 1 L of incompatible plasma in 1 week have been practiced
without significant clinical sequelae in adult patients. In
addition, many institutions use a critical titer of 64 or higher
as the cutoff when saline solution is used for labeling a unit
as high-titer.24 Therefore, it would be logical to conclude
that it may be safe to transfuse 1 L of group A plasma to a
group B or group AB patient as long as the anti-B agglutinin
titer is less than 16.
The goal of this study is to identify acceptable group A
plasma units that could theoretically be safely transfused as
universal plasma to any patient during MTP. To determine
concept feasibility, we propose classifying group A plasma
donors into those with low titers (LT) of anti-B agglutinins
( 64 but > 16) and those with very low titers (VLT) of anti-B
agglutinins ( 16). In the trauma setting, while a blood
group determination is being performed, it may be possible
to transfuse more than 1 unit of group A plasma during the
initial MTP shipments if group AB plasma is unavailable.
Group A plasma meeting these specifications could be
used to supplement the group AB plasma inventory in the
treatment of trauma patients requiring MTP. The solution

61

E.J. Isaak et al.

proposed in this pilot study assumes established criteria


supported by the currently documented literature.
Materials and Methods
Fresh plasma (less than 48 hours old) was obtained
from the pilot tubes of 100 consecutive group A blood
donors during December 2008. All donors consented to
research-related activities as part of the general consent
procedure at the Community Blood Center/Community
Tissue Services (CBC/CTS), Dayton, Ohio, and all were
eligible donors based on an approved donor health
questionnaire. These documents were reviewed by the
Food and Drug Administration and are on file at the Center
for Biologics Evaluation and Research as required by the
Code of Federal Regulations. Demographic data including
sex, age, and history of previous pregnancy were recorded
from the information on the questionnaire.
The plasma from each of these donors was diluted with
0.85 percent saline solution (Blood Bank Saline, Fisher
Scientific USA, Pittsburgh, PA) to prepare dilutions of 1:16
(1 part plasma and 15 parts saline) and 1:64 (1 part plasma
and 63 parts saline) in sufficient quantities for testing. A
freshly collected random group B donor unit was selected
as the testing RBCs. The group B RBCs were washed and
prepared as a 4% concentration in saline. One drop of the
4% group B RBCs was added to 0.2 mL of each of the 1:16
dilutions of the group A plasmas and mixed well at room
temperature (27C). The mixtures were centrifuged and
read macroscopically for agglutination; reactions were
recorded as either negative (no agglutination observed)
or positive (any macroscopic agglutination observed,
regardless of strength). All tubes were then transferred
to a 37C dry heat incubator and were allowed to incubate
for 30 minutes. The tubes were again centrifuged and read
macroscopically for agglutination with the same criteria
used for recording as negative or positive.
Similarly, one drop of the 4% group B RBCs was
added to 0.2 mL of each of the 1:64 dilutions of the group
A plasmas and mixed well at room temperature. These
mixtures were also centrifuged and read macroscopically
for agglutination, and recorded as either negative or
positive using the criteria previously established. All tubes
were then transferred to a 37C dry heat incubator and
were allowed to incubate for 30 minutes. The tubes were
centrifuged and read macroscopically for agglutination,
and recorded as either negative or positive using the criteria
previously established.
All dilutions and testing were performed by one of
two experienced CBC/CTS immunohematology reference
laboratory technologists. The resulting patterns of

62

reactivity were analyzed for correlation with age, sex, and


history of pregnancy. Statistical analysis with the Pearson
chi-square test was then used to determine any correlation
between the patterns and age. Significance was determined
at = 0.05.
Results
Among the 100 plasma samples, seven different
patterns of reactivity were noted. Sixty three percent of
donor samples were negative at a titer of 64 both at room
temperature and at 37C. These donor samples can be
classified as LT. Fifteen percent of donor samples were
negative at titers of 64 and 16 both at room temperature
and at 37C and can be classified as VLT (Table 1).
Table 1. Donor sample demographic data and agglutinin titer
Mean age,
y (range)

Male:
female

23

39
(1775)

4:19

13/19

11

47
(1971)

7:4

4/4

39

51
(2072)

19:20

15/20

48
(4351)

2:3

3/3

53
(5056)

0:3

3/3

53
(4659)

4:0

0/0

15

54
(3877)

8:7

7/7

Pregnancies RT(VLT)

RT(LT) 37C(VLT) 37C(LT)

LT = low titer 64; RT = room temperature 27C; VLT = very low titer 16.

Although low titers and very low titers occur in both


sexes and across all age ranges, some general patterns do
emerge. The three most commonly observed patterns of
reactivity are (1) positivity at titers of 16 and 64 at room
temperature and 37C (pattern A), (2) positivity at a titer of
16 at room temperature and 37C but negativity at a titer of
64 at both temperatures (pattern B), and (3) negativity at
both titers at both temperatures (pattern C).
The ratio of men to women within pattern A is 4:19;
the ratio is more evenly balanced within patterns B and C.
The relationship of these three patterns of reactivity with
regard to age is noted in Table 2. There is a statistically
significant difference (p < 0.029) in the prevalence of
patterns A and C in donors younger than 50 years of age
compared with donors who are older than 50 years. Pattern
A is more common in younger donors, whereas pattern C is
more common in older donors.

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Group A as universal plasma donors in massive transfusion protocols

Table 2. Donor sample age group with agglutinin titer pattern


association
Pattern
Age Group

< 50 years Count


% within age group
50 years

Count
% within age group

Total

Count
% within age group

Total

17

18

40

42.5%

45.0%

12.5%

100.0%

21

10

37

16.2%

56.8%

27.0%

100.0%

23

39

15

77

29.9%

50.6%

19.5%

100.0%

Discussion
The results of this laboratory study demonstrate that
evaluation of anti-B agglutinin titers in group A plasma as
VLT may serve to identify acceptable group A plasma units
that may be substituted in MTP when blood type has not yet
been determined.
As the demand for plasma resuscitation increases,
transfusion services are developing algorithms for
maintaining an inventory of thawed plasma. Because of the
relative scarcity of group AB plasma, in general, it is simply
not practical to maintain thawed group AB plasma. This
translates into a delay in plasma distribution because the
process of obtaining a blood bank specimen, determining
a blood type, and issuing the plasma can be challenging.
In addition, group AB plasma may involve additional risks
because of the formation of circulating immune complexes,28
especially when transfused to group O patients. In fact, in
one large study mortality was increased whenever typecompatible but not type-specific plasma was transfused.
However, statistical significance was reached only when
group AB plasma was given to group O patients, and in
this case when more than five units of group AB plasma
were transfused to a group O patient, the relative risk of
increased mortality was 1.26 (p = 0.004).29 Thus, even if
group AB plasma were available in sufficient amounts, it
might not be ideal. A possible solution to this dilemma is
to identify a type of plasma that is present in abundance
and can be safely transfused to any trauma patient, at least
up to a certain volume, thus allowing sufficient time for a
blood group determination to be made. Group A plasma
is relatively abundant, and because nearly 85 percent of
trauma patients are group A or group O, they can safely
receive group A plasma. For the 15 percent of patients for
whom the transfusion of group A plasma creates a minor
incompatibility, published experience has demonstrated
that reactions caused by minor incompatibilities are
extremely rare.

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Multiple reviews in the published literature have


provided details about the anecdotal cases in which a
minor incompatibility has resulted in a serious adverse
outcome. The overwhelming majority of these cases involve
group O plasma transfused to a group A patient, although
there are sporadic instances in which group O plasma was
transfused to a group B patient.8,23,24 The reports warn
that the issue may be underreported and that physicians
should be vigilant when transfusing incompatible plasma.
Nonetheless, the preponderance of the published clinical
experience seems to indicate that the transfusion of
incompatible group A plasma appears to be safe.
Despite the lack of a reported problem with the
transfusion of group A plasma to either a group B or a
group AB patient, additional factors support using group A
plasma. There appears to be a correlation between adverse
clinical consequences and high ABO agglutinin titers, which
provides an avenue for interventions to deal with the issue of
the rare but potentially significant minor incompatibilities.
Some transfusion services are identifying agglutinin titers
before issuing platelet components containing incompatible
plasma.23,26 Evaluation of anti-B agglutinin titers in group
A plasma may serve to identify acceptable group A plasma
units that could theoretically be safely transfused to any
patient. In determining these titers, the laboratory method
is important, and various laboratories have used tube
agglutination, gel technology, or microtiter plates in these
determinations.30 In our pilot study, agglutination titers
were determined using tube agglutination, and the titers
we used as thresholds were based on relatively conservative
values from reports in the platelet literature in which
tube agglutination was used. A recent review containing
an extensive summary of hemolytic reactions associated
with minor incompatibility in patients transfused with
platelets indicated that the range of titers fell between 128
as a minimum in saline up to 32,000 using antiglobulin
reagent.24 The rationale for the use of titers in our study was
to base our proposed solution on conservative assumptions
with the use of available platelet transfusion data. It may
turn out that these assumptions are overly conservative.
Another element that is important in the laboratory
method is the choice of RBCs used to perform the titer.
We used RBCs from a random group B whole blood donor.
Because of variation in antigen sites in group A RBCs, titers
are best performed using blended pools of group A RBCs;
it is not clear that the same issue exists in group B RBCs,
although further investigation of this open question may be
warranted.
In the preceding paragraph, the conservative
assumptions are as follows: (1) group A plasma will be
statistically compatible with 85 percent of patients, (2)

63

E.J. Isaak et al.

minor incompatibilities are extremely rare, (3) there has


been no reported case of a minor reaction with group A
plasma in either a group B or group AB patient, (4) serious
adverse reactions can be associated with certain threshold
agglutinin levels, and (5) conservative values from evidencebased publications were used to set an acceptable agglutinin
titer threshold level. Based on these assumptions, our study
showed that 63 percent of our donors could safely donate
one unit of incompatible plasma and that 15 percent could
safely donate up to 1 L of incompatible plasma to any patient.
Furthermore, we found that the VLT donors are more
common in donors older than 50 years of age. Therefore,
a possible recruitment strategy in our donor population
would involve screening donors older than 50 years of age
to establish a dedicated group of VLT donors for MTP.
With regard to the limitations of this pilot study, there
are several. First, the donor sample size is only 100. This
number was selected because the purpose of the study
was merely to test for feasibility of the proposed approach.
Second, the donor population is a midwest population,
and therefore these results may not extrapolate to other
donor populations. The determinants of agglutinin
levels appear to be largely determined by geography and
environmental factors,31,32 and one study of populations in
Asia found higher agglutinin levels in donors older than
50 years of age.33 Although it is well known that immune
function deteriorates with increasing age, this population
had increased agglutinin titers. Our results of a midwest
North American population demonstrated the opposite.
Surprisingly, our population showed titer levels that appear
to be independent of history of pregnancy. The significance
of these findings remains to be determined.
Because populations of blood donors will have different
patterns of agglutinin titers based on ethnicity and age,
select blood centers could develop specific recruitment
strategies to provide these VLT universal plasma products
to meet local and regional needs. Finally, and most
importantly, this new concept of VLT group A plasma as
universal plasma in MTP has not been studied in trauma
patients requiring MTP and will require thoughtful study
design to test the hypothesis.
Conclusions
The results of this study suggest a fresh perspective
on resuscitation in trauma patients. When a massively
injured trauma patient arrives at the trauma center, it is
theoretically possible to initiate MTP with thawed VLT
group A plasma instead of thawed group AB plasma.
Because MTP suggests a ratio of one RBC unit to one
plasma unit during acute hemorrhage, the time required to

64

transfuse the initial MTP shipment of four RBC units and


four plasma units (essentially equivalent to 1 L of plasma)
would provide transfusion services with ample time to
determine blood type and then issue the appropriate typespecific blood components. When handled in this fashion,
group AB plasma may remain frozen and only be thawed
for use in those patients with group AB blood.
References
1. Borgman MA, Spinella PC, Perkins JG, et al. The ratio of
blood products transfused affects mortality in patients
receiving massive transfusions at a combat support hospital.
J Trauma 2007;63:80513.
2. Bormanis J. Development of a massive transfusion protocol.
Transfus Apher Sci 2008;38:5763.
3. Gonzalez EA, Moore FA, Holcomb JB, et al. Fresh frozen
plasma should be given earlier to patients requiring massive
transfusion. J Trauma 2007;62:11219.
4. Huber-Wagner S, Qvick M, Mussack T, et al. Massive blood
transfusion and outcome in 1062 polytrauma patients: a
prospective study based on the Trauma Registry of the
German Trauma Society. Vox Sang 2007;92:6978.
5. Roback JD, Combs MR, Grossman BJ, et al (eds). Technical
manual. 16th ed. Arlington, VA: American Association of
Blood Banks, 2008.
6. McLeod BC, Sassetti RJ, Weens JH, Vaithianathan T.
Haemolytic transfusion reaction due to ABO incompatible
plasma in a platelet concentrate. Scand J Haematol 1982;
28:1936.
7. Larsson LG, Welsh VJ, Ladd DJ. Acute intravascular
hemolysis secondary to out-of-group platelet transfusion.
Transfusion 2000;40:9026.
8. McManigal S, Sims KL. Intravascular hemolysis secondary
to ABO incompatible platelet products. An underrecognized
transfusion reaction. Am J Clin Pathol 1999;111:2026.
9. Murphy MF, Hook S, Waters AH, et al. Acute haemolysis
after ABO-incompatible platelet transfusions. Lancet 1990;
335:9745.
10. Pierce RN, Reich LM, Mayer K. Hemolysis following platelet
transfusions from ABO-incompatible donors. Transfusion
1985;25:602.
11. Sadani DT, Urbaniak SJ, Bruce M, Tighe JE. Repeat ABOincompatible platelet transfusions leading to haemolytic
transfusion reaction. Transfus Med 2006;16:3759.
12. Sapatnekar S, Sharma G, Downes KA, Wiersma S, McGrath
C, Yomtovan R. Acute hemolytic transfusion reaction
in a pediatric patient following transfusion of apheresis
platelets. J Clin Apher 2005;20:2259.
13. Oztrk A, Trken O, Sayan O, Atasoyu EM. Acute
intravascular hemolysis due to ABO-incompatible platelet
transfusion. Acta Haematol 2003;110:21112.
14. Barjas-Castro ML, Locatelli MF, Carvalho MA, Gilli SO,
Castro V. Severe immune haemolysis in a group A recipient
of a group O red blood cell unit. Transfus Med 2003;13:
23941.

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Group A as universal plasma donors in massive transfusion protocols

15. Chow MP, Yung CH, Hu HY, Tzeng CH. Hemolysis after
ABO-incompatible platelet transfusions. Zhonghua Yi Xue
Za Zhi (Taipei) 1991;48:1314.
16. Ferguson DJ. Acute intravascular hemolysis after a platelet
transfusion. CMAJ 1988;138:5234.
17. Harris SB, Josephson CD, Kost CB, Hillyer CD. Nonfatal
intravascular hemolysis in a pediatric patient after
transfusion of a platelet unit with high-titer anti-A.
Transfusion 2007;47:141217.
18. Valbonesi M, De Luigi MC, Lercari G, et al. Acute
intravascular hemolysis in two patients transfused with
dry-platelet units obtained from the same ABO incompatible
donor. Int J Artif Organs 2000;23:6426.
19. Blumberg N, Heal JM, Hicks GL Jr, Risher WH. Association
of ABO-mismatched platelet transfusions with morbidity
and mortality in cardiac surgery. Transfusion 2001;41:
7903.
20. Heal JM, Kenmotsu N, Rowe JM, Blumberg N. A possible
survival advantage in adults with acute leukemia receiving
ABO-identical platelet transfusions. Am J Hematol 1994;45:
18990.
21. Heal JM, Liesveld JL, Phillips GL, Blumberg N. What would
Karl Landsteiner do? the ABO blood group and stem cell
transplantation. Bone Marrow Transplant 2005;36:74755.
22. Mair B, Benson K. Evaluation of changes in hemoglobin
levels associated with ABO-incompatible plasma in
apheresis platelets. Transfusion 1998;38:515.
23. Fung MK, Downes KA, Shulman IA. Transfusion of
platelets containing ABO-incompatible plasma: a survey of
3156 North American laboratories. Arch Pathol Lab Med
2007;131:90916.
24.
Cooling L. ABO and platelet transfusion therapy.
Immunohematology 2007;23:2033.
25. Eder AF, Chambers LA. Noninfectious complications of
blood transfusion. Arch Pathol Lab Med 2007;131:70818.
26. Josephson CD, Mullis NC, Van Demark C, Hillyer CD.
Significant numbers of apheresis-derived group O platelet
units have high-titer anti-A/A,B: implications for
transfusion policy. Transfusion 2004;44:8058.
27. Reesink HW, van der Hart M, van Loghem JJ. Evaluation of
a simple method for determination of IgG titre anti-A or -B
in cases of possible ABO blood group incompatibility. Vox
Sang 1972;22:397407.

28. Heal JM, Masel D, Rowe JM, Blumberg N. Circulating


immune complexes involving the ABO system after platelet
transfusion. Br J Haematol 1993;85:56672.
29. Shanwell A, Andersson TM, Rostgaard K, et al. Posttransfusion mortality among recipients of ABO-compatible
but non-identical plasma. Vox Sang 2009;96:31623.
30. Cooling LL, Downs TA, Butch SH, Davenport RD. Anti-A
and anti-B titers in pooled group O platelets are comparable
to apheresis platelets. Transfusion 2008;48:210613.
31. Redman M, Malde R, Contreras M. Comparison of IgM
and IgG anti-A and anti-B levels in Asian, Caucasian and
Negro donors in the North West Thames Region. Vox Sang
1990;59:8991.
32. Toy PT, Reid ME, Papenfus L, Yeap HH, Black D. Prevalence
of ABO maternal-infant incompatibility in Asians, Blacks,
Hispanics and Caucasians. Vox Sang 1988;54:1813.
33. Mazda T, Yabe R, NaThalang O, Thammavong T, Tadokoro
K. Differences in ABO antibody levels among blood donors:
a comparison between past and present Japanese, Laotian,
and Thai populations. Immunohematology 2007;23:3841.
Edahn J. Isaak, MD, FACP, Director of Transfusion Medicine,
Staten Island University Hospital, Staten Island, NY; Kathryn M.
Tchorz, MD, FACS (corresponding author), Associate Professor,
Department of Surgery-Division of Trauma/Critical Care,
Wright State University-Boonshoft School of Medicine, Miami
Valley Hospital, One Wyoming Street, 7th Floor CHE Building,
Dayton, OH 45409; Nancy Lang, SBB, Immunohematology
Reference Technologist, Lawrence Kalal, MT, Immunohematology Reference Technologist, Colleen Slapak, MS, Transfusion
Safety Director, Ghada Khalife, MD, Medical Director, David
Smith, MD, CEO, Community Blood Center/Community Tissue
Services, Dayton, OH; and Mary C. McCarthy, MD, FACS,
Professor, Department of Surgery, Chief, Trauma/Critical Care,
Wright State University-Boonshoft School of Medicine, Miami
Valley Hospital, Dayton, OH.

Manuscripts
The editorial staff of Immunohematology welcomes manuscripts
pertaining to blood group serology and education for consideration
for publication. We are especially interested in case reports,
papers on platelet and white cell serology, scientific articles
covering original investigations, and papers on new methods for
use in the blood bank. Deadlines for receipt of manuscripts for
consideration for the March, June, September, and December

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

issues are the first weeks in November, February, May, and


August, respectively. For instructions for scientific articles, case
reports, and review articles, see Instructions for Authors in every
issue of Immunohematology or on the Web at www.redcross.org/
immunohematology. Include fax and phone numbers and
e-mail address with all manuscripts and correspondence.
E-mail all manuscripts to immuno@usa.redcross.org

65

Report

Prevalence of RHD*DOL and RHCE*ce(818T)


in two populations
C. Halter Hipsky, D.C. da Costa, R. Omoto, A. Zanette, L. Castilho, and M.E. Reid

The alleles RHCE*ceBI (RHCE*ce 48C, 712G, 818T, 1132G)


and RHCE*ceSM (RHCE*ce 48C, 712G, 818T) encode the lowprevalence Rh antigen STEM. These alleles frequently travel in
cis with RHD*DOL. To estimate the frequency of these alleles, we
tested a total of more than 700 samples in two populations. Blood
samples were obtained from patients with sickle cell disease
and from blood donors of African descent. DNA extractions and
analyses were performed by standard methods. In the United
States, none of 70 patient samples had the RHCE*818 nucleotide
change. Two of 220 donors (frequency of 0.009) were heterozygous
for RHCE*818C/T (RHCE*ceBI). One of these samples had
RHD/RHD*DOL and the other had RHD/RHD*DOL-2. In these
290 samples, no other RHD*DOL alleles were found. In Brazil,
1 of 244 patients with sickle cell disease (frequency of 0.004)
and 1 of 171 donors (frequency of 0.006) were heterozygous for
RHCE*818C/T (RHCE*ceBI). Testing of more than 500 additional
samples from people of African descent, selected because they
had a diverse range of common and variant RHCE alleles, did
not reveal a sample with RHD*DOL or RHD/RHD*DOL-2 in the
absence of RHCE*ce(818T). Although the numbers are small,
our study shows that in the United States, the frequency of
RHCE*818T is 0.007 (2 in 290 samples) and in Brazil it is 0.004
(2 in 515 samples). The four RHCE*818T alleles were RHCE*ceBI.
Immunohematology 2011;27:6667.

Key words: blood groups, Rh alleles, low-prevalence


antigens, population study
The low-prevalence Rh antigen STEM (RH49) was
reported in 1993. The antigen was serologically shown
to be associated with an altered e phenotype because
approximately 65 percent of hrS and 30 percent of hrB
red blood cells (RBCs) from South African donors were
reported to be STEM+. STEM has a variable expression,
which is an inherited characteristic. Anti-STEM has
induced mild hemolytic disease of the fetus and newborn.1
Owing to the paucity of anti-STEM and typed RBCs, little
further work has been done and no other serologic reports
have appeared in the literature.
The STEM antigen is encoded by two RHCE alleles:
RHCE*ceBI (RHCE*ce 48C, 712G, 818T, 1132G) and
RHCE*ceSM (RHCE*ce 48C, 712G, 818T) (Fig. 1A). The
nucleotide (nt) 818C>T change is believed to be associated
with expression of STEM, because the other nucleotide

66

changes occur in other alleles.2 In analyzing DNA from


samples known to be STEM+ or DAK+, it was revealed
that these variant RHCE are usually in cis to RHD*DOL or
RHD*DOL-2 (Fig. 1B).3 We tested more than 700 samples
in New York and in Brazil to estimate the frequency of
RHCE*ce818C>T and to investigate RHD in these samples.

A. RHCE alleles

B. RHD alleles

Figure 1. Diagram of selected RHCE (A) and RHD (B) alleles. The
10 exons are numbered. Nucleotide changes are indicated in italics
and amino acids are given in parentheses below the exon in which
they are found. Changes from the wild-type nucleotides and amino
acids are written in bold.

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Prevalence of RHD*DOL and RHDCE*ce(818T)

Materials and Methods


Blood samples were obtained from patients with sickle
cell disease and from blood donors who self-identified as
being of African descent. Genomic DNA was isolated from
the whole blood samples using the QIAamp DNA Blood
Mini Kit (QIAGEN, Inc., Valencia, CA). Initial screening of
samples was carried out by sequencing RHCE- and RHDreverse transcriptasepolymerase chain reaction (PCR)
products, as described previously, 4 or analyzing RHCE*818
and RHCE*1132 by standard PCR products generated with
genomic DNA using RHCE-specific primers, followed by
restriction fragment length polymorphism (RFLP) using,
respectively, MwoI and Tsp45I restriction enzymes.
Genomic DNA was amplified using RHD-specific primers
flanking exon 4 and exon 8, and products were submitted
for sequencing to determine the presence of RHD*DOL (nt
509T>C in exon 4) and RHD*DOL-2 (nt 509T>C in exon 4
and nt 1132C>G in exon 8). PCR products were sequenced
in both directions.
Results
In the United States, none of 70 patient samples had
the RHCE*818 nucleotide change. Two of 220 donors
(frequency of 0.009) were heterozygous for RHCE*818C/T.
Both samples had the change at RHCE*ce1132C>G and,
thus, are RHCE*ceBI. One sample had RHD/RHD*DOL
and the other had RHD/RHD*DOL-2. No homozygous
RHCE*818T sample was found. In these 290 samples, no
other RHD*DOL alleles were found.
In Brazil, 1 of 244 patients with sickle cell disease
(frequency of 0.004) and 1 of 171 donors (frequency of
0.006) were heterozygous for RHCE*818C/T and for
RHCE*ce1132C/G and, thus, are also RHCE*ceBI. The
samples were not analyzed for RHD.
Taking the combined data, 4 samples in a total of 705
tested had RHCE*818C/T (all 4 were RHCE*ceBI), which
gives an allele frequency of 0.006.

(RHCE*ceBI) is 0.007 (2 in 290 samples; 580 alleles),


and in Brazil it is 0.004 (2 in 415 samples; 830 alleles).
Our findings show that RHCE*818T, which encodes the
STEM antigen, is not as rare as previously thought. This
raises the question as to whether anti-STEM is also more
prevalent but not identified. In the cohort of samples tested,
the RHD*DOL or RHD*DOL-2 alleles were in cis with the
RHCE*ce(818T) allele; no RHD*DOL or RHD*DOL-2 was
found in the absence of RHCE*ce(818T).
Acknowledgments
This study was supported in part by grant NIH
HL091030 (CHH, MER) and INCTS-CNPQ/MCT/FAPESP
(LC). We thank Robert Ratner for help in preparing this
manuscript.
References
1. Marais I, Moores P, Smart E, Martell R. STEM, a new
low-frequency Rh antigen associated with the e-variant
phenotypes hrS-(Rh: -18, -19) and hrB-(Rh: -31, -34).
Transfus Med 1993;3:3541.
2. Halter-Hipsky C, Hue-Roye K, Coghlan G, Lomas-Francis
C, Reid ME. Two alleles with RHCE*nt818C>T change
encode the low prevalence Rh antigen STEM [abstract].
Blood 2009;114(Suppl):12267.
3. Halter Hipsky C, Hue-Roye K, Lomas-Francis C, Reid ME.
RHD*DOL travels with RHCE*ce(818C>T), which encodes
a partial e, hrS, hrB+, STEM+ phenotype [abstract].
Transfusion 2010;50(Suppl):48A.
4. Halter Hipsky C, Lomas-Francis C, Fuchisawa A, et al.
RHCE*ceCF encodes partial c and partial e but not CELO, an
antigen antithetical to Crawford. Transfusion 2011;51:25-31
Christine Halter Hipsky, Laboratory of Immunochemistry, New
York Blood Center, New York, NY; Daiane Cobianchi da Costa,
MS, Ricardo Omoto, MS, Angela Zanette, MD, Lilian Castilho,
PhD,
Hemocentro-Unicamp-Campinas-Brazil,
Campinas,
SP, Brazil; and Marion E. Reid, PhD (corresponding author),
Laboratory of Immunochemistry, New York Blood Center, 310
East 67th Street, New York, NY 10065.

Conclusions
Although the numbers are small, our study shows
that in the United States, the frequency of RHCE*818T

Notice to Readers
Immunohematology is printed on acid-free paper.

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

For information concerning Immunohematology or the


Immunohematology Methods and Procedures manual,
contact us by e-mail at immuno@usa.redcross.org

67

Review

XG: the forgotten blood group system


N.C. Johnson

The XG blood group system is best known for its contributions


to the fields of genetics and chromosome mapping. This system
comprises two antigens, Xga and CD99, that are not antithetical
but that demonstrate a unique phenotypic relationship. XG is
located on the tip of the short arm of the X chromosome with
exons 1 to 3 present in the pseudoautosomal region of the X
(and Y) chromosome(s) and exons 4 to 10 located only on the
X chromosome. Xga demonstrates a clear X-linked pattern of
inheritance. MIC2, the gene encoding the CD99 antigen, is found
in the pseudoautosomal region of both the X and Y chromosomes.
Anti-Xga is comparatively rare, and only two examples of antiCD99 have ever been identified. Alloanti-Xga is considered
clinically insignificant; only one example of autoanti-Xga has been
reported, but it resulted in severe hemolytic anemia. Insufficient
data exist to determine the clinical significance of anti-CD99.
Linkage of XG to several X-borne genes encoding inherited
disorders has been demonstrated. CD99 is an adhesion molecule,
and high levels are associated with some types of cancer.
Immunohematology 2011;27:6871.

Key Words: Xga, X-linked, CD99, XG, MIC2, PBDX, 12E7,


Lyonization, qualitative polymorphism, pseudoautosomal
History
The XG blood group system is not revered for its
antigens and antibodies, but is instead respected for its
contributions to the fields of genetics and chromosome
mapping. XG is the first, and so far the only, blood group
system to be assigned to the X chromosome.1 There are
only two antigens in the system: Xga and CD99. Xga may be
expressed only on red blood cells (RBCs), whereas CD99 is
expressed on many tissue cells. Anti-Xga can be naturally
occurring and is not considered clinically significant. Only
two examples of alloanti-CD99 have ever been reported; its
clinical significance is unknown.2
The first example of anti-Xga was reported in 1961 in
the serum of a man who had been multiply transfused for
severe nosebleeds as a result of familial telangiectasia.3
Shortly thereafter, in 1962, Mann et al. characterized Xga
as originating from a locus on the X chromosome.1 Xga is
named after the X chromosome and Grand Rapids, where
the first-reported patient to have the antibody (Mr. And) was
treated.4 It was later discovered that PBDX, a gene found to
span the pseudoautosomal boundary on the X chromosome,
is the gene that encodes Xga (see Molecular Basis section).5
The function of the Xga protein is not known.6

68

Two decades after the first example of anti-Xga was


reported, Goodfellow and Tippett observed a mouse
monoclonal antibody, 12E7, which recognized another
determinant that appeared to be controlled by a gene also
found on the X chromosome.7 This gene, MIC2, is located
in the pseudoautosomal region of both the X and the Y
chromosomes and encodes CD99. CD99 is an adhesion
molecule,5,8 and high levels are associated with some
types of cancer. Xga and CD99 enjoy a unique phenotypic
relationship, which will be discussed in further detail in
the Genetics and Inheritance section. Fourteen years later,
in 1995, Uchikawa et al. reported the only examples of
alloanti-CD99, detected in two unrelated, healthy Japanese
blood donors.2 CD99, became part of the XG blood group
system officially in 2000 when it was confirmed that MIC2
and XG are adjacent, homologous genes. 4
Because of its location in the pseudoautosomal boundary
region of the sex chromosome, study of the inheritance of
Xga has helped to define the mechanisms responsible for
Turner, Klinefelter, and other syndromes resulting from an
abnormal number of sex chromosomes. Sex chromosome
aneuploidies are commonly associated with infertility.
Nomenclature
The XG blood group system has been assigned the
ISBT symbol and number XG and 012, respectively. The
ISBT terminology for the two antigens in the system, Xga
and CD99, is listed in Table 1. No antithetical counterpart
to the Xga antigen has been discovered, so the failure of
RBCs to react with anti-Xga defines the silent allele, Xg, or
an absence of Xga.
Table 1. Nomenclature
Xga

CD99

ISBT symbol

XG1

XG2

ISBT number

012001

012002

Genetics and Inheritance


Xga is inherited as an X-linked, dominant trait, and
the pattern of inheritance is as expected for an X-borne
characteristic.1,8 If Xga is present, it is expressed on RBCs.

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

XG blood group system: a review

The Xg(a+) phenotype is found in 88.7 percent of females


and 65.6 percent of males. (Table 2.) Females can have a
single (Xga/Xg) or a double dose (Xga/Xga) of Xga. Having
only one X chromosome, males can be hemizygous for Xga
(Xga/Y) or be Xg/Y and not express the antigen at all.6

Table 3. Relationship of Xga, Yga , and CD99


Females

Males

Table 2. Phenotype prevalence and genotype frequencies


Male (%)

Female (%)

Xg(a+)

65.6

88.7

Xg(a)

34.4

11.3

Xg(a+)

CD99 high

Xg(a+ w)

CD99 high

Xg(a)

CD99 low

Xg(a+)

CD99 high

Xg(a) Yga

CD99 high

Xg(a) Yg

CD99 low

Phenotype

Genotype
Xga /Xga

0.434

Xg /Xg

0.450

Xg/Xg

0.116

Xg /Xg

0.656

Xg/Xg

0.344

Lyonization is a process by which one X chromosome


is inactivated early in somatic cell development in XX
females.9 The process is random in each cell, ensuring
that all genes on the two X chromosomes are found at the
phenotypic level. By studying RBCs of Xga/Xg women it can
be shown that all cells carry Xga, proving that Xga is not
subject to inactivation or Lyonization. XG was the first X
chromosome locus proven to escape this process.10 It was
later shown that MIC2 is not subject to Lyonization either.11
New Guineans, Australian aborigines, Navajo Indians,
and Sardinians are reported to have the highest prevalence
of Xga. On the other hand, native Taiwanese; Chinese in
Singapore, Hong Kong, Taiwan, and Hakka; and Malays in
Singapore are observed to have the lowest incidence.3,1214
Interestingly, Asian populations with a higher prevalence of
Xg(a) phenotypes do not have a higher incidence of antiXga.6
Using monoclonal antibodies, it has been shown that
CD99 is present on all tissue cells tested15; however, the
expression of the adhesion molecule on RBCs is unique.
CD99 is expressed at different levels on RBCs, and this
expression is directly related to the presence or absence of
Xga .16 In females, the Xg(a) phenotype is always associated
with low expression of CD99. (Table 3.) Curiously, among
Xg(a) males, 74 percent are high expressors of CD99.17
To explain this quantitative polymorphism, Goodfellow
and Tippett proposed the existence of a locus on the Y
chromosome, YG, analogous to XG on the X chromosome.
Like XG, YG would have two alleles, Yga and Yg. In Xg(a)
males, the presence of Yga would result in high expression
of CD99, and the absence of Yga (Yg) would result in low
expression of CD99.7,16

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

The presence of YG has been substantiated by family


studies,17 but to date, there has been no Yga antigen
identified. It is important to note that MIC2 is responsible
for expression of CD99 on all tissue cells, but XG and YG
create the CD99 quantitative polymorphism observed on
RBCs.8
Molecular Basis
Sex chromosomes have two genetically distinct regions:
sex chromosomespecific sequences and pseudoautosomal
sequences. Pseudoautosomal refers to a structurally
homologous region on sex chromosomes, the function
of which is to facilitate pairing during male meiosis.8 XG
spans the pseudoautosomal boundary between the two
regions of the X chromosome at Xp22.3; exons 1 to 3 are
located in the pseudoautosomal region (PAR) and exons 4
to 10 are found in the sex chromosomespecific region. 46
MIC2, the closest neighbor to XG, is located in the PAR at
position Xp22.2. An identical copy of MIC2 is found in the
PAR region of the Y chromosome at Yp11.2. 4 Almost half
(48%) of the predicted amino acid sequences of XG and
MIC2 are identical.18
Biochemistry
Immunoblotting of immunoprecipitates confirmed that
CD99 and Xga antigens are located on different structures,
later confirmed to be sialoglycoproteins.18,19 CD99 and Xga
are associated in the membrane, possibly in the form of a
heterodimer.7,18
The RBC membrane molecule expressing Xga was first
identified in 1989 by Herron and Smith, by immunoblotting
and electropheresis.19 Several years later, Petty and Tippett
used immunoblotting and immunoprecipitation to show that
Xga is carried on a broad band of apparent molecular weight
24.5 to 29.5 kDa, consisting of a darkly stained component
at 24.5 kDa and a more diffusely stained component
between 26.5 and 29.5 kDa.18 No bands are observed with
protease-treated cells, and the apparent molecular weight
of Xga is decreased after treatment with neuraminidase,
suggesting that Xga resides on a sialoglycoprotein.

69

N.C. Johnson

Xga is sensitive to treatment with ficin, papain, trypsin,


bromelin, -chymotrypsin, and pronase, and is resistant to
sialidase, 0.2 M dithiothreitol (DTT), neuraminidase, and
2-aminoethylisothiouronium bromide.4,13,20 The effects of
acid are unknown. The expression of the antigen decreases
as the RBC ages and it has been shown by indirect
radioimmunoassay to have an in vivo half-life of 47 days.21
Early experiments using a microcomplement fixation
method and indirect radioimmunoassay suggested that
Xga might be present on other cell lines and tissues,22 but
subsequent testing was unable to duplicate these results.
XG is expressed on hematopoietic tissues8 and is strongly
expressed as mRNA in fibroblasts.20
Apart from humans, the only animals found to have
Xga on their RBCs are one species of gibbons. Of 52 gibbons
tested, 30 percent of males and 53 percent of females were
Xg(a+). Chimpanzees (67); gorillas (2); orangutans (20);
another species of gibbons (5); various monkeys, including
60 baboons; and a few nonprimates, including mice and
dogs, were all Xg(a).3,4
Monoclonal anti-CD99 identify a protein of apparent
molecular weight of 32 kDa.5,8 Immunoblotting and
immunoprecipitate studies suggest the CD99 protein is
composed of two polypeptides, a 32-kDa surface component, and a 30-kDa intracellular polypeptide.18 CD99
is sensitive to treatment with trypsin, -chymotrypsin,
ficin, papain, and pronase15 and, like Xga, is carried on a
sialoglycoprotein. CD99 is resistant to 0.2 M DTT and is
usually resistant to neuraminidase treatment; results vary
with sialidase treatment.
CD99 is present on all human cell types and tissues
tested.15 High levels of CD99 are a tumor marker in Ewing
sarcoma, some neuroectodermal tumors, lymphoblastic
lymphoma, and acute lymphoblastic leukemia.8 CD99 was
not detected on the RBCs or peripheral blood lymphocytes
of 10 gibbons, regardless of their Xga phenotype. CD99
was detected on RBCs and fibroblasts of chimpanzees and
gorillas, but not of orangutans or any of the other mammals
tested.23
Antibodies in the System
Anti-Xga is comparatively rare; most immunohematologists will never see anti-Xga in their careers. When
identified, it is usually found as a lone antibody specificity.
Some examples of anti-Xga are naturally occurring, yet
are more frequently IgG than IgM. 4 Optimal methods for
identification include room temperature incubation (even
when they are IgG in composition3), indirect antiglobulin
test (IAT), and capillary testing.4 One IAT-reactive antiXga was shown to have IgG1 and IgG2 subclasses.24 Some

70

examples of anti-Xga have been shown to fix complement.1


The only reported example of autoanti-Xga was found in
a pregnant woman. The antibody appears to have caused
significant hemolytic anemia, but the possibility that the
hemolytic anemia was exacerbated by the pregnancy was
not ruled out.25
As a result of the sex-related frequency differences of
a
Xg , it is expected that men would make more examples of
anti-Xga. Although this is true, it is striking that greater
than 85 percent of antibody makers are men when the
incidence of the Xg(a) phenotype is only 23 percent higher
in men than in women. It has been postulated, although
not studied, that this higher than expected prevalence
of anti-Xga in men may be associated with the expression
of CD99.6
The first example of anti-CD99 ever made was a mouse
monoclonal antibody called 12E7, which was generated to
screen for antigen differences in human acute lymphocytic
leukemia.26 The only two examples of anti-CD99 ever
detected were found in two unrelated, healthy Japanese
blood donors. One antibody was reported to react with
variable strength with different RBC samples. The second
blood donor had a history of pregnancy. One of the two
siblings of the second blood donor was determined to be
CD99 negative also.2 The antibodies were determined to
be IgG in nature and reacted optimally by the IAT.5 It is
not known whether the antibodies were capable of binding
complement.
Clinical Significance
Alloanti-Xga has never been reported to cause
hemolytic disease of the fetus or newborn or a hemolytic
transfusion reaction.4 One patient received six units of
antigen-positive blood with no signs of a reaction.27 A
chromium survival study on another patient showed normal
survival of Xg(a+) RBCs and no posttransfusion increase
in antibody strength.28 One male Japanese patient had a
slight temperature elevation and exhibited urticaria when
transfused with Xg(a+) blood. Subsequent transfusions
with Xg(a) blood were tolerated with no symptoms.29
The one example of autoanti-Xga reported was
identified in a pregnant female. The antibody was IgG in
nature, activated complement, and caused severe hemolytic
anemia. The infant was Xg(a+) and demonstrated a strongly
positive direct antiglobulin test at birth, and anti-Xga was
eluted from the infants cells. The clinical course was
remarkable only for a mild rise in bilirubin after birth.25
Because the only two examples of anti-CD99 were
found in healthy blood donors, information on the clinical
significance of this antibody is not known.

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

XG blood group system: a review

XG is linked to genes responsible for several genetic


disorders.3,4 Ichthyosis is a disorder in which the skin
resembles scales on a fish. Ocular albinism is unique in that
only the eyes lack pigment. Retinoschisis is a sex-linked
form of macular degeneration affecting only men. High
levels of CD99 have been reported in Ewing sarcoma, some
neuroectodermal tumors, lymphoblastic lymphoma, and
acute lymphoblastic leukemia.8
Summary and Future Perspectives
The XG blood group system is most important for the
insight it has provided into the study and understanding of
meiotic errors that lead to sex chromosome aneuploidies. As
the roles of Xga and CD99 become more clearly delineated,
knowledge of the forgotten blood group system may aid in
the development of cures for certain genetic disorders and
types of cancers.
References

1. Mann JD, Cahan A, Gelb AG, et al. A sex-linked blood group.


Lancet 1962;1:810.
2. Uchikawa M, Tsuneyama H, Tadokoro K, Juji T, Yamada
M, Maeda Y. An alloantibody to 12E7 antigen detected in 2
healthy donors [abstract]. Transfusion 1995;35:23S.
3. Race RR, Sanger R. The Xg blood groups. In: Blood groups
in man. 6th ed. Oxford, PA: Blackwell Scientific Publication,
1975:578635.
4. Reid ME, Lomas-Francis C. The blood group antigen
factsbook. 2nd ed. San Diego, CA: Academic Press, 2004:
33843.
5. Ellis N, Tippett P, Petty A, et al. PBDX is the XG blood group
gene. Nat Genet 1994;8:28590.
6. Issitt PD, Anstee DJ. Applied blood group serology. 4th ed.
Durham, NC: Montgomery Scientific Publications, 1998.
7. Daniels G. Xg blood group system. In: Human blood groups.
2nd ed. Malden, MA: Blackwell Science, 2002:37486.
8. Tippett P, Ellis NA. The Xg blood group system: a review.
Transfus Med Rev 1998;12:23357.
9. Lyon MF. Gene action in the X-chromosome of the mouse
(Mus musculus L.). Nature 1961;190:3723.
10. Lawler SD, Sanger R. Xg blood-groups and clonal-origin
theory of chronic myeloid leukaemia. Lancet 1970;1:5845.
11. Goodfellow P, Pym B, Mohandas T, Shapiro LJ. The cell
surface antigen locus, MIC2X, escapes X-inactivation. Am J
Hum Genet 1984;36:77782.
12. Dewey WJ, Mann JD. Xg blood group frequencies in some
further populations. J Med Genet 1967;4:1215.

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

13. Siniscalco M, Filippi G, Latte B, et al. Failure to detect


linkage between Xg and other X-borne loci in Sardinians.
Ann Hum Genet 1966;29:23152.
14. Simmons RT. X-linked blood groups, Xg, in Australian
Aborigines and New Guineans. Nature 1970;227:1363.
15. Goodfellow P. Expression of the 12E7 antigen is controlled
independently by genes on the human X and Y chromosomes.
Differentiation 1983;23(Suppl):S359.
16. Goodfellow PN, Tippett P. A human quantitative polymorphism related to Xg blood groups. Nature 1981;289:
4045.
17. Tippett P, Shaw M-A, Green CA, Daniels GL. The 12E7 red
cell quantitative polymorphism: control by the Y-borne
locus, Yg. Ann Hum Genet 1986;50(Pt 4):33947.
18. Petty AC, Tippett P. Investigation of the biochemical
relationship of the blood group antigens Xga and CD99
(12E7 antigen) on red cells. Vox Sang 1995;69:2315.
19. Herron R, Smith GA. Identification and immunochemical
characterization of the human erythrocyte membrane
glycoproteins that carry the Xga antigen. Biochem J 1989;
262:36971.
20. Ellis NA, Ye T-Z, Patton S, German J, Goodfellow PN, Weller
P. Cloning of PBDX, and MIC2-related gene that spans the
pseudoautosomal boundary on chromosome Xp. Nat Genet
1994;6:394400.
21. Campana T, Szabo P, Piomelli S, Siniscalco M. The Xga
antigen on red cells and fibroblasts. Cytogenet Cell Genet
1978;22:5246.
22. Fellous M, Bengtsson B, Finnegan D, Bodmer WF. Expression
of the Xga antigen on cells in culture and its segregation in
somatic cell hybrids. Ann Hum Genet 1974;37:42130.
23. Shaw MA, Tippet P, Delhanty JD, Andrews M, Goodfellow
P. Expression of Xg and the 12E7 antigen in primates. J
Immunogenet 1985;12:11518.
24. Devenish A, Burslem MF, Morris R, Contreras M. Serologic
characteristics of a further example of anti-Xga in North
London blood donors. Transfusion 1986;26:4267.
25. Yokoyama M, McCoy JE Jr. Further studies on auto-antiXga antibody. Vox Sang 1967;13:1517.
26. Levy R, Dilley J, Fox RI, Warnke R. A human thymusleukemia antigen defined by hybridoma monoclonal
antibodies. Proc Natl Acad Sci U S A 1979;76:65526.
27. Cook IA, Polley MJ, Mollison PL. A second example of antiXga. Lancet 1963;1:8579.
28. Sausais L, Krevans JR, Townes AS. Characteristics of a third
example of anti-Xga [abstract]. Transfusion 1964;4:312.
29. Azar PM, Saji H, Yamanaka R, Hosoi T. Anti-Xga suspected
of causing a transfusion reaction. Transfusion 1982;22:
3401.
Nanette C. Johnson, MT(ASCP)SBB, Director, Immunohematology Reference Laboratory, Greater Chesapeake and Potomac
Region, 4700 Mt. Hope Drive, Baltimore, MD 21215.

71

C o m m u n i c at i o n

Erratum

V o l . 27, N o . 1, 2 011,

p p.

14, 16,

and

18

Red blood cell phenotype matching for various ethnic groups


The author has informed the editors of Immunohematology that there is an error on pages 14, 16, and 18. The running head
should appear as K.S.W. Badjie et al.

Free Classified Ads and Announcements


Immunohematology will publish classified ads and announcements (SBB schools, meetings, symposia, etc.) without charge.
Deadlines for receipt of these items are as follows:

Deadlines

1st week in January for the March issue

1st week in April for the June issue

1st week in July for the September issue


1st week in October for the December issue

E-mail or fax information to immuno@usa.redcross.org or phone (215) 451-2538

72

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Announcements

Monoclonal antibodies available at no charge:


The New York Blood Center has developed a wide range of
monoclonal antibodies (both murine and humanized) that
are useful for donor screening and for typing RBCs with a
positive DAT. These include anti-A1, -M, -s, -U, -D, -Rh17,
-K, -k, -Kpa, -Jsb, -Fya, -Fy3, -Fy6, -Wrb, -Xga, -CD99, -Dob,
-H, -Ge2, -Ge3, -CD55 (both SCR2/3 and SCR4), -Oka, -I,
and anti-CD59. Most of the antibodies are murine IgG and
require the use of anti-mouse IgG for detection (Anti-K,
-k, and -Kpa). Some are directly agglutinating (Anti-A1, -M,
-Wrb, and -Rh17) and a few have been humanized into the
IgM isoform (Anti-Jsb). The antibodies are available at no
charge to anyone who requests them. Please visit our Web
site for a complete list of available monoclonal antibodies
and the procedure for obtaining them.

Specialist in Blood Bank (SBB) Program


The Department of Transfusion Medicine, National
Institutes of Health, is accepting applications for its 1-year
Specialist in Blood Bank Technology Program. Students are
federal employees who work 32 hours/week. This program
introduces students to all areas of transfusion medicine
including reference serology, cell processing, HLA, and
infectious disease testing. Students also design and
conduct a research project. NIH is an Equal Opportunity
Organization. Application deadline is December 31, 2011,
for the July 2012 class. See www.cc.nih.gov/dtm > education
for brochure and application. For further information
contact Karen M. Byrne at (301) 451-8645 or KByrne@
mail.cc.nih.gov

For additional information, contact: Gregory Halverson,


New York Blood Center, 310 East 67th Street, New York,
NY 10021/e-mail: ghalverson@nybloodcenter.org, phone:
(212) 570-3026, FAX: (212) 737-4935, or visit the Web
site at www.nybloodcenter.org >research >laboratories
>immunochemistry >current list of monoclonal antibodies
available.

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

73

Announcements, cont.

74

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

A dv e rtise m e nts

Masters (MSc) in Transfusion and Transplantation Sciences


at
The University of Bristol, England
Applications are invited from medical or science graduates for the Master of Science (MSc) degree
in Transfusion and Transplantation Sciences at the University of Bristol. The course starts in
October 2011 and will last for 1 year. A part-time option lasting 2 or 3 years is also available. There
may also be opportunities to continue studies for PhD or MD following the MSc. The syllabus is
organized jointly by The Bristol Institute for Transfusion Sciences and the University of Bristol,
Department of Pathology and Microbiology. It includes:
Scientific principles of transfusion and transplantation
Clinical applications of these principles
Practical techniques in transfusion and transplantation
Principles of study design and biostatistics
An original research project
Application can also be made for Diploma in Transfusion and Transplantation Science or a
Certificate in Transfusion and Transplantation Science.
The course is accredited by the Institute of Biomedical Sciences.
Further information can be obtained from the Web site:
http://ibgrl.blood.co.uk/MSc/MscHome.htm
For further details and application forms please contact:
Dr Patricia Denning-Kendall
University of Bristol
Paul OGorman Lifeline Centre
Department of Pathology and Microbiology
Southmead Hospital
Westbury-on-Trym, Bristol BS10 5NB, England
Fax +44 1179 595 342, Telephone +44 1779 595 455, e-mail: p.a.denning-kendall@bristol.ac.uk.

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

75

Advertisements, cont.

National Platelet Serology Reference Laboratory


Diagnostic testing for:




Neonatal alloimmune thrombocytopenia (NAIT)


Posttransfusion purpura (PTP)
Refractoriness to platelet transfusion
Heparin-induced thrombocytopenia (HIT)
Alloimmune idiopathic thrombocytopenia purpura (AITP)

Medical consultation available


Test methods:






GTI systems tests


detection of glycoprotein-specific platelet antibodies
detection of heparin-induced antibodies (PF4 ELISA)
Platelet suspension immunofluorescence test (PSIFT)
Solid phase red cell adherence (SPRCA) assay
Monoclonal immobilization of platelet antigens (MAIPA)
Molecular analysis for HPA-1a/1b
For

further information, contact:

Platelet Serology Laboratory (215) 451-4205

Our laboratory specializes in granulocyte antibody detection


and granulocyte antigen typing.

Indications for granulocyte serology testing


include:
Alloimmune neonatal neutropenia (ANN)
Autoimmune neutropenia (AIN)
Transfusion-related acute lung injury (TRALI)

Methodologies employed:
Granulocyte agglutination (GA)
Granulocyte immunofluorescence by flow cytometry (GIF)
Monoclonal antibody immobilization of neutrophil antigens
(MAINA)

TRALI investigations also include:


HLA (PRA) Class I and Class II antibody detection
For

further information, contact:

Janet Demcoe (215) 451-4914


demcoej@usa.redcross.org

Neutrophil Serology Laboratory (651) 291-6797

Sandra Nance (215) 451-4362


snance@usa.redcross.org

Randy Schuller (651) 291-6758


schullerr@usa.redcross.org

American Red Cross Biomedical Services


Musser Blood Center
700 Spring Garden Street
Philadelphia, PA 19123-3594
CLIA licensed

76

National Neutrophil Serology Reference Laboratory

American Red Cross Biomedical Services


Neutrophil Serology Laboratory
100 South Robert Street
St. Paul, MN 55107
CLIA licensed

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Advertisements, cont.

Reference and Consultation Services


Antibody identification and problem resolution
HLA-A, B, C, and DR typing
HLA-disease association typing
Paternity testing/DNA

IgA/Anti-IgA Testing
IgA and anti-IgA testing are available to do the
following:
Identify IgA-deficient patients
Investigate anaphylactic reactions
Confirm IgA-deficient donors

F or

information , c ontac t :

Mehdizadeh Kashi
at (503) 280-0210

Our ELISA for IgA detects protein to 0.05 mg/dL.


F or

additional information c ontac t :

Janet Demcoe at (215) 451-4914,


or e-mail:

or write to:

demcoej@usa.redcross.org,

Tissue Typing Laboratory

or write to:

American Red Cross Biomedical Services

American Red Cross Biomedical Services

Pacific Northwest Region

Musser Blood Center


700 Spring Garden Street

3131 North Vancouver


Portland, OR 97227

Philadelphia, PA 19123-3594
ATTN: Janet Demcoe

CLIA licensed, ASHI accredited

CLIA licensed

Donor IgA Screening

National Reference Laboratory


for Blood Group Serology

Effective tool for screening large volumes of donors


Immunohematology Reference Laboratory
AABB, ARC, New York State, and CLIA licensed
24-hour phone number:
(215) 451-4901
Fax:
(215) 451-2538
American Rare Donor Program
24-hour phone number:
(215) 451-4900
Fax:
(215) 451-2538
ardp@usa.redcross.org
Immunohematology
Phone, business hours:
(215) 451-4902
Fax:
(215) 451-2538
immuno@usa.redcross.org
Quality Control of CryoprecipitatedAHF
Phone, business hours:
(215) 451-4903
Fax:
(215) 451-2538

Gel diffusion test that has a 15-year proven track record:


Approximately 90 percent of all donors identified as
IgA deficient by this method are confirmed by the more
sensitive testing methods
F or

additional information :

Kathy Kaherl
at (860) 678-2764
e-mail:
kaherlk@usa.redcross.org
or write to:
Reference Laboratory
American Red Cross Biomedical Services
Connecticut Region
209 Farmington Ave.
Farmington, CT 06032
CLIA licensed

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

77

Advertisements, cont.

Becoming a Specialist in Blood Banking (SBB)


What is a certified Specialist in Blood Banking (SBB)?
Someone with educational and work experience qualifications that successfully passes the American Society for Clinical Pathology (ASCP)
board of certification (BOC) examination for the Specialist in Blood Banking.
This person will have advanced knowledge, skills, and abilities in the field of transfusion medicine and blood banking.
Individuals who have an SBB certification serve in many areas of transfusion medicine:
Serve as regulatory, technical, procedural, and research advisors
Perform and direct administrative functions
Develop, validate, implement, and perform laboratory procedures
Analyze quality issues preparing and implementing corrective actions to prevent and document nonconformances
Design and present educational programs
Provide technical and scientific training in transfusion medicine
Conduct research in transfusion medicine
Who are SBBs?
Supervisors of Transfusion Services
Supervisors of Reference Laboratories
Quality Assurance Officers
Why become an SBB?
Professional growth

Executives and Managers of Blood Centers


Research Scientists
Technical Representatives

Job placement

LIS Coordinators
Consumer Safety Officers
Reference Lab Specialists

Job satisfaction

Educators

Career advancement

How does one become an SBB?


CAAHEP-accredited SBB Technology program or grandfather the exam based on ASCP education and experience criteria.
Fact: In recent years, a greater percentage of individuals who graduate from CAAHEP-accredited programs pass the SBB exam compared
to individuals who grandfather the exam. The BEST route for obtaining an SBB certification is to attend a CAAHEP-accredited Specialist in
Blood Bank Technology Program.
Which approach are you more compatible with?
Contact the following programs for more information:
Additional information can be found by visiting the following Web sites: www.ascp.org, www.caahep.org, and www.aabb.org
Program

Contact Name

Phone Contact

Email Contact

Website

Onsite or
Online Program

Walter Reed Army Medical Center

William Turcan

202-782-6210

William.Turcan@amedd.army.mil

www.militaryblood.dod.mil/fellow

Onsite

American Red Cross, Southern California Region

Michael Coover

909-859-7496

CooverM@usa.redcross.org

none

Onsite

ARC-Central OH Region

Joanne Kosanke

614-253-2740 x 2270

kosankej@usa.redcross.org

none

Onsite

Blood Center of Wisconsin

Lynne LeMense

414-937-6403

Lynne.Lemense@bcw.edu

www.bcw.edu

Onsite

Community Blood Center/CTS Dayton, Ohio

Nancy Lang

937-461-3293

nlang@cbccts.org

www.cbccts.org/education/sbb.html

Online

Gulf Coast School of Blood Bank Technology

Clare Wong

713-791-6201

cwong@giveblood.org

http://giveblood.org/index.php?page=sbb-distance-program

Online

Hoxworth Blood Center/University of Cincinnati

Susan Wilkinson

513-558-1275

Pamela.inglish@us.edu
Susan.wilkinson@uc.edu

www.hoxworth.org

Onsite

Indiana Blood Center

Jayanna Slayten

317-916-5186

jslayten@indianablood.org

www.indianablood.org

Online

Johns Hopkins Hospital

Lorraine Blagg

410-502-9584

Lblagg1@jhmi.edu

http://pathology.jhu.edu/department/divisions/tranfusion/
sbb2.cfm

Onsite

Medical Center of Louisiana

Karen Kirkley

504-903-3954

kkirkl@lsuhsc.edu

none

Onsite

NIH Clinical Center Department of Transfusion Medicine

Karen Byrne

301-496-8335

Kbyrne@mail.cc.nih.gov

www.cc.nih.gov/dtm/research/sbb.html

Onsite

Rush University

Veronica Lewis

312-942-2402

Veronica_Lewis@rush.edu

www.rushu.rush.edu/catalog/acadprograms/chs/cls/
clssbbcert.html

Online

Transfusion Medicine Academic Center at Florida Blood


Services

Marjorie Doty

727-568-5433 x 1514

mdoty@fbsblood.org

www.fbsblood.org

Online

University Health System and Affiliates, San Antonio

Linda Myers

210-731-5526

lmyers@bloodntissue.org

www.sbbofsa.org

Onsite

University of Texas Medical Branch at Galveston

Janet Vincent

409-772-3055

jvincent@utmb.edu

www.utmb.edu/sbb

Online

University of Texas SW Medical Center

LeAnne Hutson

214-648-1780

mls.sshp@utsouthwestern.edu

http://utsouthwestern.edu/mls

Online
Revised August 2009

78

I M M U N O H EM ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

Immunohematology

Journal of Blood Group Serology and Education


Instructions for Authors
I. GENERAL INSTRUCTIONS

Before submitting a manuscript, consult current issues of


Immunohematology for style. Double-space throughout the manuscript.
Number the pages consecutively in the upper right-hand corner, beginning
with the title page.

II. SCIENTIFIC ARTICLE, REVIEW, OR CASE REPORT WITH


LITERATURE REVIEW
A. Each component of the manuscript must start on a new page in the
following order:
1. Title page
2. Abstract
3. Text
4. Acknowledgments
5. References
6. Author information
7. Tables
8. Figures
B. Preparation of manuscript
1. Title page
a. Full title of manuscript with only first letter of first word
capitalized (bold title)
b. Initials and last name of each author (no degrees; all CAPS), e.g.,
M.T. JONES, J.H. BROWN, AND S.R. SMITH
c. Running title of 40 characters, including spaces
d. Three to ten key words
2. Abstract
a. One paragraph, no longer than 300 words
b. Purpose, methods, findings, and conclusion of study
3. Key words
a. List under abstract
4. Text (serial pages): Most manuscripts can usually, but not
necessarily, be divided into sections (as described below). Survey
results and review papers may need individualized sections
a. Introduction Purpose and rationale for study, including
pertinent background references
b. Case Report (if indicated by study) Clinical and/or hematologic
data and background serology/molecular
c. Materials and Methods Selection and number of subjects,
samples, items, etc. studied and description of appropriate
controls, procedures, methods, equipment, reagents, etc.
Equipment and reagents should be identified in parentheses by
model or lot and manufacturers name, city, and state. Do not
use patients names or hospital numbers.
d. Results Presentation of concise and sequential results,
referring to pertinent tables and/or figures, if applicable
e. Discussion Implication and limitations of the study, links to
other studies; if appropriate, link conclusions to purpose of study
as stated in introduction
5. Acknowledgments: Acknowledge those who have made substantial
contributions to the study, including secretarial assistance; list any
grants.
6. References
a. In text, use superscript, Arabic numbers.
b. Number references consecutively in the order they occur in the
text.
7. Tables
a. Head each with a brief title; capitalize the first letter of first word
(e.g., Table 1. Results of . . .) use no punctuation at the end of
the title.
b. Use short headings for each column needed and capitalize first
letter of first word. Omit vertical lines.

I M M U N O H E M ATO LO GY, Vo l u m e 27, N u m b e r 2, 2 011

c. Place explanation in footnotes (sequence: *, , , , , **, ).


8. Figures
a. Figures can be submitted either by e-mail or as photographs
(57 glossy).
b. Place caption for a figure on a separate page (e.g. Fig. 1 Results
of...), ending with a period. If figure is submitted as a glossy,
place first authors name and figure number on back of each
glossy submitted.
c. When plotting points on a figure, use the following symbols if
possible: l l s s n n.
9. Author information
a. List first name, middle initial, last name, highest degree,
position held, institution and department, and complete address
(including ZIP code) for all authors. List country when applicable.

III. EDUCATIONAL FORUM


A. All submitted manuscripts should be approximately 2000 to 2500 words
with pertinent references. Submissions may include:
1. An immunohematologic case that illustrates a sound investigative
approach with clinical correlation, reflecting appropriate
collaboration to sharpen problem solving skills
2. Annotated conference proceedings
B. Preparation of manuscript
1. Title page
a. Capitalize first word of title.
b. Initials and last name of each author (no degrees; all CAPs)
2. Text
a. Case should be written as progressive disclosure and may
include the following headings, as appropriate
i. Clinical Case Presentation: Clinical information and
differential diagnosis
ii. Immunohematologic Evaluation and Results: Serology and
molecular testing
iii. Interpretation: Include interpretation of laboratory results,
correlating with clinical findings
iv. Recommended Therapy: Include both transfusion and
nontransfusion-based therapies
v. Discussion: Brief review of literature with unique features of
this case
vi. Reference: Limited to those directly pertinent
vii. Author information (see II.B.9.)
viii. Tables (see II.B.7.)

IV. LETTER TO THE EDITOR


A. Preparation
1. Heading (To the Editor)
2. Title (first word capitalized)
3. Text (written in letter [paragraph] format)
4. Author(s) (type flush right; for first author: name, degree, institution,
address [including city, state, Zip code and country]; for other
authors: name, degree, institution, city and state)
5. References (limited to ten)
6. Table or figure (limited to one)
Send all manuscripts by e-mail to immuno@usa.redcross.org

79

Blood Group
Antigens &
Antibodies
A guide to clinical relevance
& technical tips
by Marion E. Reid & Christine Lomas-Francis
This compact pocketbook from the authors of the Blood
Group Antigen FactsBook is a must for anyone who is involved
in the laboratory or bedside care of patients with blood
group alloantibodies.
The book contains clinical and technical information about
the nearly 300 ISBT recognized blood group antigens and
their corresponding antibodies. The information is listed in
alphabetical order for ease of findingeven in the middle of
the night. Included in the book is information relating to:
Clinical significance of antibodies in transfusion and HDN.
Number of compatible donors that would be expected
to be found in testing 100 donors. Variations in different
ethnic groups are given.
Characteristics of the antibodies and optimal technique(s)
for their detection.
Technical tips to aid their identification.
Whether the antibody has been found as an autoantibody.

Pocketbook Education Fund


The authors are using royalties generated from the sale of
this pocketbook for educational purposes to mentor people
in the joys of immunohematology as a career. They will
accomplish this in the following ways:
Sponsor workshops, seminars, and lectures
Sponsor students to attend a meeting
Provide copies of the pocketbook
(See www.sbbpocketbook.com for details to apply for funds)

Ordering Information
The book, which costs $25, can be
ordered in two ways:
Order online from the publisher
at: www.sbbpocketbook.com
Order from the authors, who
will sign the book. Send a check,
made payable to New York Blood
Center and indicate Pocket
book on the memo line, to:
Marion Reid
Laboratory of Immunochemistry
New York Blood Center
310 East 67th Street
New York, NY 10065
Please include the recipients
complete mailing address.

FIRST CLASS
U.S. POSTAGE

PAID

SOUTHERN MD
PERMIT NO. 4144

Musser Blood Center


700 Spring Garden Street
Philadelphia, PA 19123-3594

(Place Label Here)