2

israel journal of
Veterinary medicine
Formerly: RefuaH Veterinarith
Published Quarterly:
CONTENTS
VOLUME 65
no. 3
2010
Editor:
T. Waner
Co. Editor:
H. Barak
Associate Editors:
M. Ballaiche
A. Bomzon
J. Brenner
N. Galon
S. Harrus
E. Klement
G. Segev
R. Schahar
A. Steinman
Editorial Board:
G. Dank
D. Elad
S. Freidman
G. Leitner
U. Orgad
E. Pipano
A. Rosner
G. Simon
A. Shimshony
N. Speigel
Z. Trainin
ISRAEL VETERINARY MEDICAL ASSOCIATION

P.O.BOX 22, 43100 Raanana, ISRAEL Tel: 09-7419929 Fax: 09-7431778
E-mail :ivma@zahav.net.il

I. Samina - President
D. Dagan - Secretary
A. Markovitz - Treasurer
Website: www.isrvma.org
AMERICAN VETERINARIANS FOR ISRAEL
EDITORIAL:
Greater visibility
Waner, T.
92
REVIEW
STAPHYLOCOCCUS AUREUS MASTITIS:
WHAT WE NEED TO KNOW TO CONTROL THEM
Zecconi, A.
93
Articles
INTOXICATION OF YOUNG CROCODILES
IN CAPTIVITY DUE TO THE INGESTION OF
DARKLING BEETLES BLAPS NITENS LAPORTEI
ARDOIN (COLEOPTERA; TENEBRIONIDAE)
Perelman, B. and Chikatunov, V.
100
BOVINE UROLITHS ANALYSIS:

A REVIEW OF 30 CASES.
Parrah, J.D., Hussain, S. S., Moulvi, B. A., Singh, M.
and Athar, H.
103
DIAGNOSIS OF MILK FEVER BY A WATER

HARDNESS TEST KIT IN EWES
Aktas, M.S., Kaynar, O, Ozkanlar, S2, Ozkanlar, Y.
108
Canine oral papillomavirus infection:

clinical course, pathology, L1 Gene and
NCR2 gene sequencing
Jun, D., Yi, G., Na, T., Yipeng, J, Rui, Z, Degui, L. and
Guozhong, Z.
111
Cardiology : What is your diagnosis

ECG of the Month
Golani, Y. and Ohad D.
117
Imaging: A DOG WITH ACUTE VOMITING

Bibring, U. and Eizenberg, Z.
121
Toxicology viewpoint
Improved Animal Feed Control
"Farm to Fork"
Shlosberg, A.
123
17 Cottage Lane
Springfield. N.J. USA 07081-2302

B. Bender - President
S. Altman - Vice President
A. Newman - Treasurer
ISSN 0334-9152
Published by:
Giraffica Studio - Graphic design for Magazines
www.giraffica.com
Arabian Horse
(see next page)
ISRAEL JOURNAL OF VETERINARY MEDICINE
INSTRUCTIONS TO AUTHORS
The Israel Journal of Veterinary Medicine is the official publication
of the Israel Veterinary Medical Association. It is published
quarterly and is devoted to all aspects of veterinary medicine
with emphasis on research and events in the Middle East and
Mediterranean Basin. All original articles pertaining to veterinary
medicine and research are welcome and will be considered for
publication.
Manuscripts will be accepted on the clear understanding that their
contents have not been published previously and that they have not
been submitted for publication elsewhere.
Short communications documenting important new findings that
warrant rapid publication will also be considered.
Letters to the editor will be limited to comments on contributions
already published in the journal; if a letter is accepted, a response
for simultaneous publication will be invited from the author of the
original contribution.
Adherence to principles outlined in the Guide for the Care and
Use of Laboratory Animals, National Academy Press, Washington,
D.C. 1996, is implicit in animal experimentation. The journal
requires written author verification of compliance with animal
welfare and ethics policies. All material published in the Israel
Journal of Veterinary Medicine must adhere to high ethical and
animal welfare standards.
Prior to acceptance of a manuscript, to verify compliance with the
above policies, the authors must
1) Sign a covering letter certifying that legal and ethical
requirements have been met with regards to the humane
treatment of animals described in the study;
2) Specify in the covering letter and in Materials and Methods
the international, national, and/or institutional guidelines
followed;
3) Provide evidence, such as a signed animal use form or protocol
number, of compliance with ethical review at the institution
or practice;
The Editor retains the right to reject manuscripts on the basis of
animal ethical or welfare concerns.
Conflict of Interest:
Conflict of Interest: Authors of research articles must disclose
any conflict of interests (e.g. financial arrangements) which they
have with the company whose product features prominently in the
submitted manuscript, or with a company making a competing
product. Such information will be held in confidence.
All manuscripts are subject to editorial review by experts in the

field who advise the editors of the manuscript's scientific quality.
The Editor-in-Chief will make the final decision regarding
acceptability for publication.
Correspondence, exchange journals, books for review, etc. should
be addressed to the Editorial Board, P.O. Box 22, 43100 Raanana,
Israel.
Manuscripts should be submitted by E-mail. E-mail addresses:
ijvm10@gmail.com (Editor). Confirmation of arrival of the
manuscript will be sent to the author within one week.
We do not supply reprints. The author of each article will receive a
copy of the issue in which his article was published.
Manuscripts preparation: The entire manuscript should be
double-spaced on standard A4 or 8 X 11 inch paper, typed on
one side only, with 3 cm margins. The editor reserves the right to
change the style and grammar of the manuscript if necessary.
Page numbers must be included in the upper right-hand corner of
each page.
Manuscripts must be formatted with line numbers in the left hand
margin.
Manuscripts must be submitted in English using English spelling
and must be grammatically correct. Authors whose native language
is not English are advised to seek assistance in manuscript
preparation from someone fluent in written English.
PAPERS SHOULD BE SUBDIVIDED AS FOLLOWS:
Title page: The first page of each paper should contain the title,
in capital letters (short, specific and informative), followed by the
name(s) with initials and affiliation(s) and professional degrees of
the author(s), including address(es). Further, the complete mailing
address of the person to whom correspondence should be sent
(including Phone and Fax numbers, as well as E-mail address).
A short running title of maximum 4 words.
A minimum of 4 Keywords must be provided.
Abstract: the abstract should include a self-contained summary of
the objectives, results and significance of the study. Uninformative
sentences such as the significance of the results is discussed are
not acceptable.
Introduction: A concise and clear statement of the background,
purpose and significance of the work.
Material and Methods: The work and methodology used should
be described and referenced, including the experimental design.
Sufficiently informative protocols should be given to permit
repetition of experimental work. Technical descriptions of methods

should be detailed only when such methods are new. Sub-headings
should be used for clarity.
- Common methods or procedures need not be described in detail,
and where possible citation should be made to techniques that have
been reported elsewhere.
- A statement of animal care must be made.
- A concise description of the statistical methods should be
provided including analytical software and citation of sources for
unusual methods.
Results: The statements should be presented concisely, with the
aid of tables or figures where appropriate. Duplication of the text
of this section and data presented in tables and figures should be
avoided.
Discussion: This section must relate to the significance of the work
to existing knowledge in the field and indicate the importance of
the contribution of this study. Needless recapitulation of the results
must be avoided. A comparison with related published studies
should be made and conclusions drawn.
References: In the text, identify references by Arabic numbers (in
brackets) in sequence of their appearance. Number references in
the order in which they are first mentioned in the text. Material
submitted for publication but not yet accepted should be noted as
unpublished data and not be included in the reference list. The
list of references should include only those publications, which are
cited in the text.
Journal citations: Name(s) and initial(s), Title, Journal,
Vol.,page(s), year.
Example: Goodchild, W. M. and Cooper, D. M.: Oviduct
adenocarcinoma in laying hens. Vet. Rec. 82:389-390, 1968.
Book references: Whole book: Author (or editor), Title, Publisher,

City, Year.
Example: Clarke, E. G. J. and Clarke, M. L.: Veterinary Toxicology,
Bailler Tindal, London, 1975.
Book chapter: Author: chapter title, Editor: book title, Publisher,
City, pages, Year.
Example: Clarkson, T. B., Shively, C. A. and Weingand, K. W.:
Animals models of diet-induced atherosclerosis. In: Beynen, A. C.
and West, C. E. (Eds.): Use of animal models in human nutrition.
Karger, Basel, pp. 56-82, 1998.
Tables and figures: These must be intelligible without reference
to the text and should be planned to fit the page size of the journal.
Tables and figures should be numbered, in Arabic numerals, in the
sequence in which they are mentioned in the text. The same data
may not be reproduced in both table and figure format. Each table
must have a title and on each column there should be a heading
that clearly identifies the data therein. Illustrations and diagrams
should be kept to a minimum; the figure number must appear only
on the reverse side, together with the authors name and an arrow
marking to the top.
Units must conform to the International System of Units and
should be expressed in metric units.
Abbreviations: These should be used sparingly; they should be
defined when first used in the text.
Drugs: When referring to a drug, use the generic name. The trade
name, manufacturer's name, city and state abbreviation should be
provided.
Equipment: When describing products or equipment, the generic
name should be used in the text and the details of the product
(brand name, manufacturer, city and state) should be provided.
Cover image:
Arabian Horse
A breed of long standing, elegant and considered one of the most aristocratic horses among all the breeds of horses. They are used
in shows, racing events and endurance competitions. They are generally very expensive, hot tempered and they have a light step
which is somewhat bouncy. They are considered as very intelligent animals. Arabian horses are highly sought after especially in
the Middle East. An ancient dynasty is attributed to the breed and the value of a horse is judged accordingly. They are characterized
by their medium height, thin strong legs and small head with a depression on their forehead which enhances their aristocratic
appearance.
They are not recommended for long distance riding due to their jerky step but are most impressive in shows.
EDITORIAL
visibility
An important aim which I have set for the Journal is acceptance to the Medline index, the bibliographic database of
the National Library of Medicine for journal articles in life sciences and biomedicine. Medline is the index for about 100
veterinary science journals and is the database of choice by veterinarians. At the moment we are indexed by ISI Web of
Knowledge which also grades our citation index.
Improvement of our citation index will follow our acceptance to Medline. However the road is long and will necessitate
substantial adjusts which we will have to undertake. To understand these adjustments I will review some of the requirements
for our acceptance to Medline.
1. Scope of the Journal: We have now defined the Journal niche as the Middle East and Mediterranean Basin which
to my mind a suitable scope which has not been covered by other veterinary journals.
2. Quality of Content: Here we need to make an effort. We have all the potential. If only members of the academia
would each devote one quality article a year to the effort we would be well on our way. We need to convince them that
their academic careers will not be compromised and may even be enhanced by the fact that they will have in the long
run a journal which is acceptable with a higher citation index. Not that we should only leave the work to the academic
community: All of us must make every effort to improve our national journal.
3. The content of the articles: Here we need the full gamut of articles from both academics and those working in the
field: Original research from experimentation, original clinical observations from both research and the field, critical
reviews from veterinarians from all walks of life, case reports from both veterinary hospitals and clinics are all desirable
and welcome..
4. Quality of editorial work: Every effort is being made to accept only good quality articles and the standard for
acceptance is risings and will rise further with the acceptance of good quality articles. Furthermore the editorial board
has laid emphasis on animal welfare where animal experiments are involved and the consideration of conflict of interests
which must be declared by the authors. The peer review process, which is considered vital to the quality of the journal, is
undergoing improvement and efforts are been made to enhance this aspect.
5. The production quality: The journal is produced both as a printed edition and also online, which is free of charge to
users all over the world. The online version needs a lot of improvement in order to make the journal more visible. At the
moment the articles from the journal can be found via internet search engines, however the site itself is in my opinion not
optimal and requires improvement. The qualities of a good site should be ease of access, ease of use to download articles,
the availability of a search engine within the site and an aesthetic appearance. This is being attended to at the moment. If
anyone has ideas about this project please do not hesitate to contact me. A good internet site will make us more visible
and that will take us a long way towards improving our status.
A special thanks to all those contributing articles. You are making the difference!
Wishing you all Chag Samach and a Happy and Healthy New Year.
Trevor Waner
92
website: www.isrvma.org
Volume 65 (3) 2010
REVIEW
STAPHYLOCOCCUS AUREUS MASTITIS:

WHAT WE NEED TO KNOW TO CONTROL THEM
Zecconi, A.
Department of Animal Pathology, Hygiene and Health. Universit degli Studi di Milano, Via Celoria 10, 20133 Milano, Italy
INTRODUCTION
Among bacteria causing mastitis, only Streptococcus

agalactiae, Staphylococcus aureus, Mycoplasma species, and
Corynebacterium bovis are considered as fully contagious.
Among these, S.aureus, is currently the most frequently
isolated contagious pathogen in subclinical and chronic bovine
mastitis worldwide (1).
The reasons for the large spread of S.aureus intramammary
infections (IMI) worldwide are obviously related to bacteria
characteristics, but also to a general misunderstanding of the
epidemiology of S.aureus IMI, leading to inefficient control
measures.
The description of all the factors involved in S.aureus IMI
should include many different aspects, and it is not possible to
cover all of them in a single review. Therefore, in this paper
we reviewed the main information useful to develop control
programs for S.aureus IMI under field conditions and it is
focused on the following topics: diagnosis, major risk factors,
therapy, vaccination and control methods.
Bacteria characteristics
S.aureus are described coagulase positive, -haemolytic,
maltose and mannitol fermenting organisms, forming
pigmented colonies (2). Not all strains of S.aureus have
characteristics that are consistent with the previous description.
Indeed, some S.aureus are -haemolytic, -haemolytic, +haemolytic, -haemolytic, non-haemolytic and even coagulase
negative (3).
To cause mastitis S.aureus initially must gain access to
the mammary gland through the teat canal and then has to
avoid removal by the flushing of the fluids during the milking
process. Therefore, the ability to adhere to the epithelial cells
and extracellular matrix (ECM) proteins is instrumental to
colonize the gland and develop the pathologic process. The
adhesion mechanism of S.aureus is complex and includes
multiple proteins able to specifically recognize components of
the microbial surface that recognize adhesive matrix molecules
(MSCRAMM) (4), allowing bacterial anchorage in normal
and inflamed tissues (5). Adhesive molecules are pivotal in
the diffusion of S.aureus within and among herds, but they
are only one of the several virulence factors involved in the
pathogenesis of S.aureus infections. It is out of the scope of
this review to describe all these virulence factors. However,
assessing S.aureus genetic patterns is useful to understand its
epidemiological features.
Several studies (6-8) indicate that virulence of S.aureus
strains differ, an indication that strain typing is important.
Similarly, transmissibility within a herd differs by strain type
Volume 65 (3) 2010
(9). Thus, the importance of evaluating the combination of

S.aureus virulence factors has been recently emphasized both
in human and veterinary medicine (8, 10, 11).
DIAGNOSIS
Several factors have been shown to influence accuracy

for detecting S.aureus IMI using conventional bacteriological
culture: i.e. sample type (quarter or composite), inoculum
volume, sampling time and frequency. Hence, knowledge of
the limits will guide the final decision on the method to be
employed to detect S.aureus IMI at a cow or mammary quarter
level.
It is generally accepted that there is relationship between
bulk tank SCC (somatic cell count) and the proportion of cows
with S.aureus in the herd (12). However, there is increasing
evidence that a large proportion of cows in well-managed herds
could be S.aureus positive, but with low SCC both at cow and
bulk tank level (13, 14). This could be the result of recently
acquired infections, reduced pro-inflammatory activity of
strains or efficient host immune response (8, 15, 16).
Under field conditions, composite or quarter milk sampling
can be applied. However, reliability of culturing composite
milk samples compared with quarter samples for the diagnosis
of S.aureus IMI 0.01 ml as inoculum volume showed a
sensitivity and specificity respectively of 57.9 and 98% (17,
18). While composite milk sampling could be used for routine
testing when the main interest is determining prevalence of
infection at cow level, the use of this test in control programs,
where the proper identification of infected cows is crucial,
should be carefully evaluated.
Methods to increase diagnostic accuracy
One potential source of false positive results is the presence
of irregular shedding of bacteria (19). However, recent studies
suggested that increasing the inoculum volume to 0.1 ml will
significantly reduce the risk of false negative results (20, 21).
These latter observations are supported by the studies
on the accuracy of diagnosis based on different inoculum
volumes. Direct plating of 0.01 ml of milk from established
S.aureus infections failed to detect these organisms in about
10% of the samples, while plating 0.05 resulted in 6% of
false negative samples (22). Further studies, using 0.01 ml
as inoculum volume (23), found a 94.2% agreement between
duplicate quarter milk samples positive for S.aureus. These
results confirmed earlier reports and suggested that the single
quarter sampling method was capable of identifying 82-94%
S.aureus quarter infections (23).
93
REVIEW
To overcome some of the diagnostic problems, augmented
methods have been also proposed. Among them, freezingthawing and centrifugation are considered the most interesting.
Freezing may affect viability of organisms contained in milk
samples taken for bacteriologic culture but it could increase
the sensitivity of the test breaking the clusters. However, (24)
found that the presence of S.aureus in subclinical and clinical
milk samples kept frozen at about -20C for 4, 6 and 16 weeks
did not differ significantly. The centrifugation of milk samples
has been proposed to overcome the low-shedding cases (25).
The results showed that cultures of the sediment significantly
increased the number of positive outcomes, in comparison
with conventional methods.
Analytical Methods
Milk culture could be performed either on blood-agar plate

or using selective media such as Baird-Parker or a modification
of the latter technique. However, the different phenotypes
could cause several problems in diagnostic laboratories when
selective media are applied. In our laboratory for an internal
comparison, 50 confirmed S.aureus strains were tested on 3
different media: (blood-agar, Baird-Parker -BP- and Baird
Parker supplemented with rabbit plasma and fibrinogen-BPRPF). The results showed that 31/50 hadnt any surrounding
clear zone on BP, 17/50 were coagulase negative on BPR-PF
and 10/50 were only weakly positive in this latter medium.
Therefore, milk culture on 5% blood agar plate still is the
recommended method for S.aureus IMI diagnosis, followed
by confirmation of the suspected colonies by other methods
such as coagulase-test and biochemical tests. When selective
media are applied, it is also recommended to confirm all the
suspected colonies by other methods.
Independently from the method applied, identifying a
single colony of S.aureus is enough to define the quarter (cow)
as infected.
Very recently, methods based on Real Time PCR have been
proposed to improve mastitis diagnosis, including for S.aureus
(26). However, data available until now are not sufficient to
evaluate if the molecular approach will be useful to improve
the accuracy of current diagnostic methods for S.aureus IMI.
Risk Factors
Traditionally the prevalence of mastitis in heifers prepartum

has been overlooked given the concept that heifers without a
developed gland are not susceptible to IMI. Fox et al. (27)
reviewed heifer mastitis, estimating prevalence between
1% and 10% of all heifers with S.aureus IMI at parturition.
Therefore, heifers could be important risk factor acting both as
a reservoir and as a vehicle for S.aureus.
Waage et al.(28) found that S.aureus was the major cause
of clinical mastitis in heifers, with clinical mastitis noted
during the first 2 weeks of lactation. Whether the heifer was
raised on the farm or was imported into the herd did not
94
influence the odds of having clinical mastitis in early lactation.

In an extended study by (29), there was a significantly greater
percentage of S.aureus isolated from epidermal and mucosal
sites of heifers in high prevalence herds. Overall, heifers
colonized with S.aureus in the mammary gland area were 3.4
times as likely to calve with S.aureus IMI, and this was the
largest risk factor of disease.
Once S.aureus enters into the herd, the major vehicle of
diffusion among cows is milking machines and improper
milking procedures. Indeed, several studies found that S.aureus
on milking unit liners could have the same fingerprint as the
isolates causing IMI (30-32). Additionally, S.aureus has been
isolated from udder cloths (33), thus implicating their role as a
fomite in the spread of S.aureus mastitis.
Davidson (34) in large study on sites of colonization and
IMI found the udder and teat skin to be an important reservoir
associated with S.aureus mastitis. Zadoks et al. (35) would
suggest that the teat skin is not a likely reservoir for S.aureus
IMI. Such an argument was partially supported by (36), but it
is opposite to that reported by (29, 31, 37).
Matos et al. (38) suggested that there are several other
potential sources of S.aureus in a dairy, as this pathogen could
be isolated from bedding and air of the parlour. Flies were not
a source of S.aureus in this study, which is in contrast to that
reported by (39). Roberson et al. (29) showed that in lowprevalence herds (<3%), bedding, insects, and water did not
yield S.aureus, but high-prevalence herds did have some of
these samples that were positive.
There is not a broad consensus on the role played by
external sources in S.aureus IMI, out of milking machine and,
potentially, by heifers. Therefore, these two factors are the
most important ones we should be considered when we decide
to apply a control program.
Therapy
In practice, the common opinion that S.aureus has a

relatively poor cure rate is based more on clinical impressions
than on scientific evidences. Indeed, the cure rate for lactation
therapy reported in literature has a very broad range (4-92%),
a narrower, but still broad range has been reported also for
dry-cow therapy (40). The recent debate on the increase
in microbial resistance observed in human medicine, and
particularly of methicillin-resistant S.aureus strains, increased
the concerns on the use of antimicrobials for dairy cow therapy,
particularly at drying-off. The discussion is still open, even if
there are increasing evidences that the antibiotic therapy for
mastitis and dry-cow treatment is not associated either with
the development of methicillin-resistant strains or an increase
of resistance (41). Despite this evidence, the application of
antibiotic therapy following the principles of a prudent use
of antibiotics, as proposed by various scientific organizations,
should be recommended. To apply a prudent and efficacious
protocol for mastitis treatment, different factors should
be considered (42): type of pathogen involved, antibiotic
Volume 65 (3) 2010

susceptibility patterns, severity of inflammatory response,
duration of infection, stage of lactation and age of the cow.
Probably the most comprehensive analysis of the different
factors affecting cure rate for clinical, subclinical mastitis and
dry-cow therapy for S.aureus has been proposed by Sol and
co-workers (43-45). Among the different factors, SCC showed
to influence S.aureus cure rate after treatment of clinical and
subclinical mastitis and at drying-off with lower cure rate
when SCC were > 106/ml. Hind quarters showed a lower cure
rate (subclinical and drying-off therapy), age and number of
infected quarters showed to be significant only for drying-off
therapy, with a decrease of the cure rate as age and number of
infected quarters increased.
When the factors affecting cure rate are considered (i.e.
age, SCC), the therapy is applied selecting molecules after
susceptibility test and with a rational and efficient protocol, the
cure rate could be higher than 75 % both for dry cow-therapy
and for treatment of cows after calving (43-45).
Vaccination
Much interest has been devoted to the development of

a vaccine against bovine mastitis caused by S.aureus, but
to date the results have not been fully convincing. Indeed,
vaccination against S.aureus mastitis must take into account
a large number of possible antigens and related interactions
with the immune system. These different potential targets for
an immune response are reviewed by (46) and these targets
include capsules, adhesions, surface proteins and toxins.
Early vaccine formulations were composed of
microorganisms that were cultured in vitro, killed, and injected
systemically with or without toxoids and immunologic
adjuvants as reviewed by (47, 48). Several such formulations
were shown to increase the spontaneous cure rates of S.aureus
IMI as well as to lessen the severity of infection but did not
prevent new cases of mastitis, but none of them was broadly
and consistently applied in dairy herds.
Heifer Vaccination
Nickerson et.al. (49) evaluated a polyvalent S.aureus
vaccine in heifers beginning at 6 months of age (with periodic
6-month boosters) to determine if vaccination reduced
prevalence of S.aureus mastitis during pregnancy and at
calving. Results demonstrated that the percentage of new
S.aureus infections during pregnancy was lower in vaccinates
than controls (14.3 vs. 25.9%), the percentage of quarters
showing chronic S.aureus infection was lower in vaccinates than
controls (10.7 vs. 18.8%), and at freshening, the percentage of
quarters infected, with S.aureus was lower in vaccinates than
controls (8.9 vs. 16.1%). The data demonstrated a positive
effect of vaccination in increasing antistaphylococcal antibody
titers and in preventing new S.aureus infections when the
program was initiated at an early age in heifers raised in a herd
with high exposure to this mastitis pathogen.
Edinger et al. (50) developed a herd-specific vaccine based
on two strains of S.aureus previously isolated from cases of
Volume 65 (3) 2010
clinical mastitis in the herd. Results showed that prevalence

of S.aureus in quarter milk samples taken at calving and three
to four weeks post partum did not differ significantly between
the vaccine and control group. Regarding the development of
clinical mastitis during the first three months after calving and
the prevalence of S.aureus in quarter milk samples taken before
the onset of treatment, there were no significant differences
between the groups. The SCC was lower in vaccinated than in
control heifers. However, the difference was only significant
on the third milk test day.
Cow Vaccination
In dairy cows, one of the first vaccines developed was
a heat-killed capsular type A and B S. aureus strains and
capsular polysaccharide, and it was used in two herds. The
results showed that the vaccinated animals had a decrease
in mastitis incidence and higher milk yield in comparison
with unvaccinated herd-mates (51). A vaccine containing
whole inactivated bacteria with pseudocapsule and - toxoid
was used in a field trial in Norway (52). The study showed
that a significant increase in antibody was observed only for
pseudocapsule and toxoid. Moreover, vaccinated heifers
showed a prevalence of S.aureus mastitis of 8.6%, while in
control heifers it was of 16%.
One of the largest field trials on S.aureus vaccine efficacy
was reported by (53). Results showed no overall reduction
in the incidence of clinical mastitis, even though differences
were observed within individual herds. Overall, the known
commercially available S.aureus vaccines have shown limited
efficacy under field conditions. A vaccine which would
prevent the occurrence of bovine mastitis caused by S.aureus
or a vaccine that would augment S.aureus control would be
of benefit. More recently, two vaccines were commercially
available in some countries, but only for one of these two data
are available (54-56). This patented vaccine is derived from
3 field strains of S.aureus which contain a broad spectrum
of antigenic and immunogenic properties. The composition
enables the vaccine to induce a strong homologous as well as
heterologous immune response. The results of the field trials
showed a 70% specific protection from infection and almost
complete protection from udder inflammation expressed by
the low SCC (100x103 cell/ml) of the vaccinated cows. The
effect of vaccination on subclinical udder infection revealed a
significant clearance of S.aureus udder infection in comparison
to the control, which was expressed also by a reduction in SCC
to normal range. Because of low rate of spontaneous infection
among the heifers in the field trial, no specific protection could
be evaluated. However, a significant difference in SCC between
the vaccinated and nonvaccinated heifers was found (108x103
and 178x103 cell/ml respectively). A significant difference in
milk production (0.5 Kg per cow per day) was found as well.
Innovative vaccines developed by the means of molecular
methods have been investigated by several research groups
(57-60). Results are very encouraging, but none of these
vaccines is available in dairy field.
Thus, even if S.aureus vaccine was the object of a large
95
REVIEW
number of studies, still a vaccine with proven efficacy in
commercial dairy herds and in different areas is not available.
Control Program
Environmental sources and non-dairy animals do not

appear to be significant reservoirs and vectors for the disease.
Therefore, a control/eradication program for this pathogen
could be hypothesized. The frequency of infected herds and
cows, and the high cost of the disease represent the reason
to develop control programs. Moreover, the availability of
accurate diagnostic procedures and efficacious therapeutical
protocols allow for their implementation.
To develop a strategy to control the infection, the approaches
currently applied are the test-and-cull strategy and control
programs based on segregation. Culling is often suggested
as the only way to control S.aureus (61, 62). However, there
is poor scientific evidence either on the efficacy or on the
economic return of this approach. Indeed, (63) showed that at
the end of a program based on test-and-cull strategies applied
in three herds, all the three herds had a very similar culling
rate, but only the third one, applying a well-managed program
in addition, achieved the control of S.aureus IMI. Therefore,
culling could be a component of a control program, mainly as
the most efficient way to remove the chronic S.aureus cows.
However, as a main method of control it showed to be poorly
efficient and with a negative economic impact.
Control programs based on segregation followed the
general principles of contagious mastitis control (64) and was
based on precise diagnostic procedures and strict control of
segregation of infected cows.
We reported the epidemiologic pattern IMI in 9 commercial
dairy herds after establishment of a standardized and detailed
mastitis control program (65).
The main steps in the control program are (Figure 1):
1. Application of a precise and consistent milking procedure
that included use of a single-service towel to clean the teat,
forestripping, and use of postmilking teat disinfectants of
known efficacy.
2. Establishment of a milking sequence to reduce infection
risk, by milking healthy cows first, then cows and heifers
that had recently entered the herd either through purchase or
freshening, and then milking cows with S.aureus IMI last.
3. After the first sampling of all lactating cows at the time
of enrolment to segregate infected cows, a precise sampling
schedule is used. Purchased cows are sampled 5-7 and 1014 days after entry into the herd, and cows that had recently
calved are sampled 5-7 and 10-14 days after calving. Cows
with S.aureus IMI are segregated and are not sampled again
until they have calved. Non-infected cows are sampled again
2, 4, 7, 10, 14 and 18 months after the first sampling.
4. Diagnosis of S.aureus IMI is performed with mammary
quarter milk samples by bacteriologic culture on 5% bloodagar media. Quarter samples are collected to increase the
sensitivity of detection. Recovery of a single colony of
S.aureus is considered a positive result indicating an IMI. All
96
mammary quarters of all cows are treated at drying-off with a

commercial antimicrobial treatment. Choice of the product is
based on the susceptibility of the S.aureus strains isolated in
the herd as determined by use of the disc diffusion method.
5. Treatment of infected lactating cows without clinical
signs is restricted to those with 3 lactations and in their first
30 days of lactation, to avoid treatments with a poor cure rate.
These cows are moved to a hospital pen to be sampled 5-7
and 10-14 days after the end of the antimicrobial withdrawal
period. Only cows that are judged cured because of negative
results of 2 consecutive bacteriologic cultures of milk samples
are allowed to leave the hospital pen.
6. Antimicrobial and anti-inflammatory treatments
are administered to cows that developed clinical mastitis,
independently of their S.aureus infection status, and these
cows are moved to the hospital pen to be sampled 7 and 14
days after the end of the withdrawal period. Only cows that
were judged cured are allowed to leave the hospital pen to
come back to the group of origin.
7. At the herd level, farm managers are advised to improve
and keep proper bedding hygiene.
8. The control program is monitored directly by means
of monthly visits by a trained practitioner and discussion of
analysis results, and indirectly by a weekly check of samples
sent to the laboratory, to ensure compliance.
Results of this field study suggested that a very low
incidence rate can be achieved after about 10 months of the
control program. Young cows and freshening cows are the
most likely to develop new IMI among uninfected cows
when segregation of infected cattle is used; uninfected cattle
should be carefully checked and specific procedures should be
applied to reduced the risk of infection. It could be suggested
that heifers should be housed separately from older cows for
at least 2 weeks before calving, to reduce the risk of becoming
infected from older cows during periparturient period.
The proposed control/eradication program based on
segregation showed, on average, to reduce the incidence rate of
S.aureus IMI below 2% in 10 months and <1% in 18 months.
Cost/benefit analysis showed that a positive economic return
could be achieved even when starting prevalence of S.aureus
IMI are in the range 10-20% (66).
CONCLUSIONS
Programs based on segregation has been applied, but on

a smaller scale when compared to Str.agalactiae. Diagnostic
problems, poor cure rate, and unknown sources of infection
are often the arguments advocated to refute the application of
a control program. Moreover, the presence of intramammary
infections, without large increase of SCC induces many
practitioner and farmers to underestimate the impact on milk
quality and yield.
However, based on the available scientific and practical
evidences we can reasonably affirm that:
S.aureus has a variable, but large economic impact on
Volume 65 (3) 2010

dairy herd;
Diagnosis of S.aureus IMI is feasible with conventional
methods by experienced laboratories;
Well-designed S.aureus therapy protocols have a curerate not inferior to the one observed against other
intramammary pathogens;
S.aureus is not an obligate parasite of the mammary gland,
but the importance of potential reservoirs on other body
sites or in the environment significantly decreases as the
prevalence of IMI decreases in the herd. Therefore, they
will not affect the control programs.
Therefore, when control programs are based on few important
points such as the isolation or removal of reservoirs, the
avoidance of S.aureus transmission during milking, a careful
monitoring by a trained practitioner, they will be successful
with positive economic returns for both the farmer and the
practitioner.
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
Zecconi, A. Contagious mastitis control program: the

Staphylococcus aureus case. Cattle Practice 14, 67-76.2006.
Carter, G.R., Cole, J.R. Diagnostic procedures in veterinary
bacteriology and mycology, 5th Edition. Academic Press,
London, 1990.
Fox, L.K., Besser, T.E., Jackson, S.M. Evaluation of a
coagulase-negative variant of Staphylococcus aureus as a cause
of intramammary infections in a herd of dairy cattle. JAVMA
209, 1143-1146.1996.
Patti, J., Bremell, T., Krajewska-Pietrasik, D., Abdelnour, A.,
Tarkowski, A., Ryden, C., Hook, M. The Staphylococcus aureus
collagen adhesin is a virulence determinant in experimental
septic arthritis. Infect. Immun. 62, 152-161.1994.
Foster, T., Hook, M. Surface protein adhesins of Staphylococcus
aureus. Trends Microbiol. 6, 484-488.1998.
Younis, A., Krifucks, O., Fleminger, G., Heller, E.D., Gollop,
N., Saran, A., Leitner, G. Staphylococcus aureus leucocidin,
a virulence factor in bovine mastitis. J. Dairy. Res. 72, 188194.2005.
Younis, A., Krifucks, O., Heller, E., Samra, Z., Glickman, A.,
Saran, A., Leitner, G. Staphylococcus aureus exosecretions and
bovine mastitis. J. Vet. Med. B Infect. Dis. Vet. Public Health
50, 1-7.2003.
Zecconi, A., Cesaris, L., Liandris, E., Dapr, V., Piccinini, R.
Role of several Staphylococcus aureus virulence factors on the
inflammatory response in bovine mammary gland. Microbial
Pathogenesis 40, 177-183.2006.
Sommerhauser, J., Kloppert, D., Wolter, W., Zschock, M.,
Sobiraj, A., Failing, K. The epidemiology of Staphylococcus
aureus infections from subclinical mastitis in dairy cows during
a control programme. Vet. Microbiol. 96, 91-102.2003.
Peacock, S.J., Moore, C.E., Justice, A., Kantzanou, M., Story,
L., Mackie, K., ONeill, G., Day, N.P.J. Virulent Combinations
of Adhesin and Toxin Genes in Natural Populations of
Staphylococcus aureus. Infect. Immun. 70, 4987-4996.2002.
von Eiff, C., Friedrich, A.W., Peters, G., Becker, K. Prevalence
of genes encoding for members of the staphylococcal leukotoxin
family among clinical isolates of Staphylococcus aureus. Diagn.
Microbiol. Inf. Dis. 49, 157-162.2004.
Volume 65 (3) 2010
12. Gonzalez, R.N., Jasper, D.E., Farver, T.B., Bushnell, R.B.,

Franti, C.E. Prevalence of udder infections and mastitis in 50
California dairy herds, In: JAVMA, pp. 323-328 1988.
13. Zecconi, A., Piccinini, R. Intramammary infections:
epidemiology and diagnosis. In: XXII World Buiatric Congress
- Recent developments and perspectives in bovine medicine,
Hannover 18-23/08/2002, pp. 346-359, 2002.
14. Zecconi, A., Piccinini, R., Fox, L.K. Epidemiologic study of
intramammary infections with Staphylococcus aureus during a
control program in nine commercial dairy herds. JAVMA 223,
684-688.2003.
15. Zecconi, A., Binda, E., Borromeo, V., Piccinini, R. Relationship
between some Staphylococcus aureus pathogenic factors and
growth rates or somatic cell counts. J. Dairy Res. 72, 203208.2005.
16. Middleton, J.R., Fox, L.K., Gay, J.M., Tyler, J.W., Besser,
T.E. Influence of Staphylococcus aureus strain-type on
mammary quarter milk somatic cell count and N-acetyl-beta-Dglucosaminidase activity in cattle from eight dairies. J. Dairy
Sci. 85, 1133-1140.2002.
17. Morselt, M.L., Lam, T., Vanwuijckhuise, L.A., Franken, P.,
Hartman, E.G., Schukken, Y.H. The reliability of bacteriological
culturing of composite milk samples in the diagnosis of sublinical
udeder infections in dairy cattle. Tijdschr. Diergeneeskd. 120,
426-430.1995.
18. Lam, T., vanWuijckhuise, L.A., Franken, P., Morselt, M.L.,
Hartman, E.G., Schukken, Y.H. Use of composite milk samples
for diagnosis of Staphylococcus aureus mastitis in dairy cattle.
JAVMA 208, 1705-&.1996.
19. Sears, P.M., Smith, B.S., English, P.B., Herrer, P.S., R.N.,
G. Shedding pattern of Staphylococcus aureus from bovine
intramammary infections. J. Dairy Sci. 73, 2785-2789.1990.
20. Walker, J., Rajala-Schultz, P.J., DeGraves, F.J. The Effects of
Inoculum Volume and Extended Sampling on the Microbiological
Detection of Naturally Occurring Staphylococcus aureus
Intramammary Infections In: 49th NMC Annual Meeting,
Albuqyerque NM, pp. 230-231, 2010.
21. Torres, A.H., Rajala-Schultz, P.J., DeGraves, F.J. Diagnosis of
intramammary infections at dry-off based on sampling strategy,
epidemiology of pathogens, and agreement beyond chance. J.
Vet. Diagn. Investig. 21, 427-436.2009.
22. Neave, F.K. Diagnosis of mastitis by bacteriological methods
alone. In: IDF Seminar on the Control of Mastitis, Reading (710/4/1975), pp. 19-36, 1975.
23. Erskine, R.J., Eberhart, R.J., Hutchinson, L.J., Spencer, S.B.,
Campbell, M.A. Incidence and types of clinical mastitis in dairy
herds with high and low somatic cell counts. JAVMA 192, 761765.1988.
24. Schukken, Y.H., Smit, J.A.H., Grommers, F.J., Vandegeer, D.,
Brand, A. Effect of Freezing on Bacteriologic Culturing of
Mastitis Milk Samples. J. Dairy Sci. 72, 1900-1906.1989.
25. Zecconi, A., Piccinini, R., Zepponi, A., Ruffo, G. Recovery of
Staphylococcus aureus from centrifuged quarter milk samples.
J. Dairy Sci. 80, 3058-3063.1997.
26. Koskinen, M.T., Holopainen, J., Pyorala, S., Bredbacka, P.,
Pitkala, A., Barkema, H.W., Bexiga, R., Roberson, J., Solverod,
L., Piccinini, R., Kelton, D., Lehmusto, H., Niskala, S.,
Salmikivi, L. Analytical specificity and sensitivity of a real-time
polymerase chain reaction assay for identification of bovine
mastitis pathogens. J. Dairy Sci. 92, 952-959.2009.
27. Fox, L.K., Chester, S.T., Hallberg, J.W., Nickerson, S.C.,
97
REVIEW
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
98
Pankey, J.W., Weaver, L.D. Survey of intramammary infections

in dairy heifers at breeding age and first parturition. J. Dairy Sci.
78, 1619-1628.1995.
Waage, S., Odegaard, S.A., Lund, A., Brattgjerd, S., Rothe,
T. Case-control study of risk factors for clinical mastitis in
postpartum heifers. J. Dairy Sci. 84, 392-399.2001.
Roberson, J.R., Fox, K.L., Hancock, D.D., Gay, J.M., Besser,
T.E. Ecology of Staphylococcus aureus isolated from various
sites of dairy farms. J. Dairy Sci. 77, 3354-3364.1994.
Smith, T., Fox, L., Middleton, J. Outbreak of mastitis caused
by one strain of Staphylococcus aureus in a closed dairy herd.
JAVMA. 212, 553-556.1998.
Fox, L.K., Gershman, M., Hancock, D.D., Hutton, C.T. Fomites
and reservoirs of Staphylococcus aureus causing intramammary
infections as determined by phage typing: the effect of milking
time hygiene practices. Cornell Veterinarian 81, 183-193.1991.
Zadoks, R.N. 2002. Molecular and mathematical epidemiology
of Staphylococcus aureus. Utrech University, Utrecht NL.
Fox, K.L. Recovery of mastitis pathogens from udder cloths
following several laundering methods. Dairy Food and
Environmental Sanitation 17, 14-19.1997.
Davidson, I. Observation on the pathogenic staphylococci in
a dairy herd during a period of six years. Res Vet. Sci. 2, 2240.1961.
Zadoks, R.N., Van Leeuwen, W.B., Kreft, D., Fox, K.L.,
Barkema, H.W., Schukken, Y.H., Belkum, A. Comparison of
Staphylococcus aureus isolates from bovine and human skin,
milk equipment, and bovine milk by phage typing, pulsed-field
gel electrophoresis, and binary typing. J. Clin. Microbiol. 40,
3894-3902.2002.
Piccinini, R., Cesaris, L., Dapr, V., Borromeo, V., Picozzi, C.,
Secchi, C., Zecconi, A. The role of teat skin contamination in
the epidemiology of Staphylococcus aureus intramammary
infections. J.Dairy Res. 76, 36-41.2008.
Larsen, H.D., Sloth, K.H., Elsberg, C., Enevoldsen, C., Pedersen,
L.H., Eriksen, N.H.R., Aarestrup, F.M., Jensen, N.E. The
dynamics of Staphylococcus aureus intramamammary infections
in nine Danish dairy herds. Vet. Microbiol. 71, 89-101.2000.
Matos, J.S., White, D.G., Harmon, R.J., Langlois, B.E.
Staphylococcus aureus from sites other than the lactating
mammary gland. J Dairy Sci 74, 1544-1549.1991.
Owens, W.E., Nickerson, S.C. Role of horn flies (Haematobia
irritans) in Staphylococcus aureus-induced mastitis in dairy
heifers. Am. J. Vet. Res. 59, 1122-1124.1998.
Leslie, K.E., Dingwell, R.T. Background to dry cow therapy:
what, where, why - is it still relevant ? In: NMC Annual Meeting
Fort Worth (TX) 26-29/01/03, pp. 5-17, 2003.
Erskine, R.J., Cullor, J., Schaellibaum, M., Yancey, B., Zecconi,
A. Bovine mastitis pathogens and trends in resistance to
antibacterial drugs. In: 43rd NMC annual meeting, Charlotte
(1-4/02/2004), pp. 400-414, 2004.
Radostits, S.M. Herd Health: food animal production medicine,
3rd Edition. W.B.Saunders Co., Philadelphia, 2001.
Sol, J., Sampimon, O.C., Barkema, H.W., Schukken, Y. Factors
associated with cure after therapy of clinical mastitis caused by
Staphylococcus aureus. J. Dairy. Sci. 83, 278-284.2000.
Sol, J., Sampimon, O.C., Snoep, J.J., Schukken, Y. Factors
associated with bacteriological cure during lactation after therapy
for subclinical mastitis caused by Staphylococcus aureus. J.
Dairy. Sci. 80, 2803-2808.1997.
Sol, J., Sampimon, O.C., Snoep, J.J., Schukken, Y.H. Factors
associated with bacteriological cure after dry cow treatment of
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
subclinical staphylococcal mastitis with antibiotics. J. Dairy.

Sci. 77, 75-79.1994.
Foster, T. Potential for vaccination against infections caused by
Staphylococcus aureus. Vaccine 9, 221-227.1991.
Zecconi, A., Smith, K.L. Ruminant Mammary Gland Immunity.
FIL-IDF, Bruxelles, 2003.
Middleton, J.R., Luby, C.D., Adams, D.S. Efficacy of vaccination
against staphylococcal mastitis: A review and new data. Vet.
Microbiol. 134, 192-198.2009.
Nickerson, S.C., Owens, W.E., Boddie, N.T. Efficacy of a
Staph.aureus mastitis vaccine in dairy heifers. In: International
Symposium on Immunology of Ruminant Mammary Gland,
Stresa IT 11-14 June 2000, pp. 426-431, 2000.
Edinger, D., Tenhagen, B.A., Baumgartner, B., Heuwieser, W.
Efficacy of a herd vaccine against Staphylococcus aureus in
dairy heifers. In: International Symposium on Immunology of
Ruminant Mammary Gland, Stresa IT 11-14 June 2000, pp. 410417, 2000.
Yoshida, K., Ichiman, Y., Narikawa, S., Evans, W. Staphylococcal
capsular vaccine for preventing mastitis in two herds in Georgia.
J. Dairy Sci. 1984. 67, 3, 620-627.1984.
Nordhaug, M., Nesse, L., Norcross, N., Gudding, R. A field trial
with an experimental vaccine against Staphylococcus aureus
mastitis in cattle. 1. Clinical parameters. J. Dairy Sci. 77, 12671275.1994.
Watson, D., McColl, M., Davies, H. Field trial of a staphylococcal
mastitis vaccine in dairy herds: clinical, subclinical and
microbiological assessments. Australian Vet. Journal 1996. 74,
6, 447-450.1996.
Leitner, G., Yadlin, N., Lubashevsy, E., Ezra, E., Glickman, A.,
Chaffer, M., Winkler, M., Saran, A., Trainin, Z. Development of
a Staphylococcus aureus vaccine against mastitis in dairy cows.
II. Field trial. Vet. Immunol. Immunopathol. 93, 153-158.2003.
Leitner, G., Lubashevsky, E., Trainin, Z. Staphylococcus
aureus vaccine against mastitis in dairy cows, composition
and evaluation of its immunogenicity in a mouse model. Vet.
Immunol. Immunopathol. 93, 159-167.2003.
Leitner, G., Lubashevsky, E., Glickman, A., Winkler, M., Saran,
A., Trainin, Z. Development of a Staphylococcus aureus vaccine
against mastitis in dairy cows I. Challenge trials. Vet. Immunol.
Immunopathol. 93, 31-38.2003.
Kerro-Dego, O., Prysliak, T., Potter, A.A., Perez-Casal, J. DNAprotein immunization against the GapB and GapC proteins
of a mastitis isolate of Staphylococcus aureus. Vet. Immunol.
Immunopathol. 113, 125-138.2006.
Shkreta, L., Talbot, B.G., Diarra, M.S., Lacasse, P. Immune
responses to a DNA/protein vaccination strategy against
Staphylococcus aureus induced mastitis in dairy cows. Vaccine
23, 114-126.2004.
Yin, R.L., Li, C., Yang, Z.T., Zhang, Y.J., Bai, W.L., Li, X.,
Yin, R.H., Liu, H., Liu, S., Yang, Q., Cao, Y.G., Zhang, N.S.
Construction and immunogenicity of a DNA vaccine containing
clumping factor A of Staphylococcus aureus and bovine IL18.
Vet. Immunol. Immunopathol. 132, 270-274.2009.
Castagliuolo, I., Piccinini, R., Beggiao, E., Pal, G.,
Mengoli, C., Ditadi, F., Vicenzoni, G., Zecconi, A. Mucosal
genetic immunization against four adhesins protects against
Staphylococcus aureus-induced mastitis. Vaccine 24, 4393-4402
2006.
Saperstein, G., Hinckley, L.S., Post, J.E. Taking the team
approach to solving Staphylococcal mastitis infection. Vet. Med.
83, 939-947.1988.
Volume 65 (3) 2010

62. Stott, A.W., Jones, G.M., Gunn, G.J. Chase-Topping, M.,
Humphry, R.W., Richardson, H., Logue, D.N., Optimum
replacement policies for the control of subclinical mastitis due
to S. aureus in dairy cows. J. Agric. Econ. 53, 627-644.2002.
63. Hoblet, K.H., Miller, G.Y. Use of partial budgeting to determine
the economic outcome of Staphylococcus aureus intramammary
infection reduction strategies in three Ohio diary herds. JAVMA
199, 714-720.1991.
64. White, G. An attempt to control the spread of staphylococcal
mastitis by segregation and culling. Vet.Rec. 77, 13841386.1965.
65. Zecconi, A., Piccinini, R., Fox, K.L. Epidemiologic study of

intramammary infections with Staphylococcus aureus during a
control program in nine commercial dairy herds. JAVMA 223,
684-688.2003.
66. Zecconi, A., Piccinini, R., Romani, S. Results and cost-benefit
analysis of a Staph.aureus control program in commercial dairy
herds. In: 2nd International Symp. on Mastitis and Milk Quality,
Vancouver (13-15 sep 2001), pp. 311-315, 2001.
FIGURE
Figure 1 - Control program scheme
Volume 65 (3) 2010
99
ARTICLES
INTOXICATION OF YOUNG CROCODILES IN CAPTIVITY DUE

TO THE INGESTION OF DARKLING BEETLES BLAPS NITENS
LAPORTEI ARDOIN (COLEOPTERA; TENEBRIONIDAE)
Perelman, B1*. and Chikatunov V2.
D.N.Negev P.O.Box 38, Beit Kama,Israel.
2
Department of Zoology, The George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv 69978, Israel
*Corresponding author:
Dr. Benzion Perelman
D.N.Negev P.O.Box 38
Beit Kama, Israel
Email: benyperelman@gmail.com
1
Abstract
A sharp increase of mortality was reported among young crocodiles on a rearing farm in the south of Israel during the
summer months. Clinical inspection of the animals in the rearing rooms revealed that about 20% of the young crocodiles,
suffered from severely swollen expanded abdomens with clinical signs of dyspnea. Post mortem examination of affected
animals revealed severe expansion of the stomach and extensive damage to the mucosa with the presence of partly digested
traces of black beetles. Visual inspection of the premises revealed very large numbers of black beetles. A tentative diagnosis
of a potential poisoning or intoxication related to the ingestion of the beetles by the young crocodiles was suggested.
Beetles were identified as Blaps nitens laportei belonging to the Tenebrionidae family. Within a few days after the pens
were cleaned from dead and live beetles and the windows covered with a nylon mesh, the morbidity and mortality began to
decline strongly suggesting that the etiology was related to the ingestion of beetles by the young crocodiles. To the best of
the knowledge of the authors this is the first case report on the potential poisoning of young crocodiles by the ingestion of
the darkling beetle Blaps nitens laportei
Introduction
Since the late 80s, some attempts have been carried in

Israel to develop a crocodile farming industry. At present
there is only one small crocodile farm in the area of Fazael
e Dead Sea where a small breeding colony with several adult
crocodiles (Crocodylus niloticus) is maintained. The eggs are
incubated using artificial incubation and the young hatchlings
transported and reared in another farm located in the area
of the Negev. Young crocodiles are reared under intensive
conditions in small greenhouse buildings in separated rooms
with concrete pools and temperature controlled water. Every
hatch of crocodiles is located in a different pool in groups
containing 100 to 200 crocodiles per room. The rearing farm
had a capacity to rear about 2000 young crocodiles up to the
age of about 2 years.
During the summer season, large numbers of darkling
beetles where observed in the surroundings and inside the
crocodile rearing facilities. A sudden increase in mortality
among the youngest crocodiles was tentatively related to a
possible intoxication due to the ingestion of darkling beetles.
In this case report we describe the clinical and pathological
findings of the intoxication of young crocodiles after ingestion
of darkling beetles Blaps nitens laportei (1).
100
Case report
Young crocodile hatchlings (Crocodylus niloticus) where

transported from the hatchery to the rearing farm in the area
of the Negev in Israel. The facilities at the farm include two
green-houses like buildings with concrete walls and floor and
green polycarbonate ceilings that enables light to enter the
building. Each building is separated into 5 rooms by concrete
walls of about 1.2 meters high, the concrete floor has a slope
that allows for filling with water for about 50% of the area of
the floor, creating a pool for the crocodiles as well as a dry
area to rest.
The young crocodiles were fed with minced fresh ostrich
meat from a nearby ostrich slaughter house, the meat was
mixed with a special premix containing calcium, vitamins and
microelements in order to provide a balanced diet to the young
crocodiles.
The temperature of the water in the pools was controlled to
avoid hypothermia of the young reptiles, and changed every 3
days to avoid excessive contamination of the water.
A sharp increase of mortality was reported among the
youngest crocodiles in some of the rooms in one of the rearing
houses.
Clinical inspection of the animals in the rearing rooms
revealed that about 20% of the young crocodiles in some of the
rooms suffered from severely swollen expanded abdomens;
the affected animals held their heads high and the mouths open
Volume 65 (3) 2010

indicative of dyspnea (Fig 1).
Post mortem examination of affected animals revealed
severe expansion of the stomach (Fig. 2). Opening of the
stomach revealed extensive damage to the mucosa with traces
of ostrich meat, a gelatinous content and partly digested traces
of black beetles (Fig. 3).
Visual inspection of the premises revealed very large
numbers of black beetles all over the facility including on
the floor of the rearing areas (Fig 4). Young crocodiles were
observed to feed on live beetles falling on the water of the
pools or crawling on the floor while the older one year old
crocodiles did not appear to touch the live or dead beetles.
A tentative diagnosis of a potential poisoning or
intoxication related to the ingestion of the beetles by the young
crocodiles was suggested as other etiologies were discarded
such as addition of water treatments, use of disinfectants or
any other toxic product used accidentally. The measures taken
to reduce the presence of black beetles inside the rearing areas
included physical cleaning of the rearing areas from any dead
or live beetle and location of a nylon mesh on the windows
of the buildings to avoid further entrance of the beetles to the
rearing areas. Within a ten days period, all the affected young
crocodiles showing bloated bellies died and general mortality
within the affected groups started to reduce, but many of the
less affected animals showed apathy and reluctance to eat.
Pathologic examination of some of these crocodiles, revealed
extensive damage of the mucosa of the stomach and secondary
development of some fungal infection probably due to the
extensive primary damage to the epithelium of the stomach,
and the accumulation of organic debris due to stomach stasis.
Treatment with copper sulphate at kg /1000 liters
of water was added to the ponds. Within a week, mortality
decreased significantly and no new cases of bloated bellies
were observed.
glands able to produce a mixture of p-benzoquinones and

hydrocarbons such as 1,4-benzoquinone, 2-methyl-1,4benzoquinone and2-ethyl-1,4-benzoquinone (3, 4, 5). These
toxic products are produced and contained in small glands
in the abdominal cavity of the insects and are released from
small openings at the tip of the abdomen when the beetles are
threatened. Some Tenebrionid beetles posses special glands
able to produce at least three types of 1,4-benzoquinones (5, 6)
and hydrocarbons (4). One of the most effective mechanisms
of protection among some insects is the production of caustic
or toxic repellent products against predators.
Another possibility, quinones which are very reactive and
toxic compounds are able to cause severe membrane damage,
enzyme destruction and cell death, and are mutagenic and
carcinogenic (Ollinger and Brunmark 1991). The toxicity of
the benzoquinones is related to their capacity to produce free
oxygen radicals able to severely affect cellular components.
The fact that the number of new cases of bloating among
the young crocodiles started to decrease within a few days
after the pens were cleaned from dead and live beetles and
the windows covered with a nylon mesh, strongly suggest
that the bloating and severe damage observed was related to
the ingestion of beetles by the young crocodiles. For ethical
reasons we did not try to reproduce the clinical signs and
pathology of the intoxication by artificially feeding healthy
young crocodiles, but the clinical and pathological picture
are highly suggestive of an intoxication caused by the toxic
benzoquinones contained in the poison glands of the beetles
released in the stomach of the young crocodiles.
To the best of our knowledge this is the first case report on
the potential poisoning or young crocodiles by the ingestion of
the darkling beetle Blaps nitens laportei
REFERENCES
1.
Discussion
Distention of the stomach or bloating has been reported

in crocodiles by Huchzermeyer as result of over feeding (2).
Crocodiles feed after long periods of food withdrawal may eat
large quantities of meat and develop stomach stasis, bacterial
decomposition of the stomach content that may cause toxemia
and mortality.
In this case the young crocodiles where fed every second
day just enough meat to feed all the crocodiles in the pen. The
development of bloating and mortality was acute and many of
the affected crocodiles had only some residues of meat from
their last meal. All the crocodiles in this case report examined
showed swollen bellies and had residues of black beetles in
their stomachs. The internal mucosa of the stomach was eroded
and severe desquamation of the epithelium was observed in all
the affected crocodiles.
Beetles were identified by Dr. V. Chikatunov from the
University of Tel Aviv as Blaps nitens laportei belonging to
the Tenebrionidae family (1) (Fig 5). It has been reported
that some members of tenebrionid beetles, have defensive
Volume 65 (3) 2010
2.
3.
4.
5.
6.
7.
Ardoin, P. Contribution ltude des Tenebrionidae (Coleoptera)

de Sardaigne. Ann. de la Soc. Ent. de France (N.S.) 9: 257-307,
1973.
Huchzermeyer, F.W. Crocodiles: Biology, Husbandry and
Diseases. CABI Publishing, Oxon, United Kingdom. 2003.
Eisner, T., Mc Henry, F., and Salpeter, M.M. Defense
mechanisms of arthropods-XV. Morphology of the quinineproducing glands of a tenebrionid beetle (Eleodes longicollis
lec.) J.Morphology.115,355-399, 1964.
Happ M G. Quinone and Hydrocarbon production in the
defensive glands of Eleodes longicollis and Tribolium castaneum
(coleopteran), tenebrionidae. J. Insect Physiology. 14:18211837, 1968.
Eisner, T., Eisner M., and Siegler M. Secret Weapons: Defenses
of Insects, Spiders, Scorpions and Other Many-Legged creatures.
Harvard University Press, Cambridge. 2005
Eisner, T . and Meinwald, J. 1966. Defensive secretions of
arthropods. Science, N.Y. 153, 1341-1350, 1966.
Ollinger, K., and Brunmark, A. Effect of hydroxyl substituents
position on 1,4-naphtoquinone toxicity to rat hepatocytes.
J..Biol.Chem. 266:21496-21503, 1991.
101
ARTICLES
Legends for figures

Figure 1 - A young crocodile showing extensive distention of the
abdominal cavity bloating.
Figure 4 - Large quantities of black beetles were found covering the

floor of the crocodile rearing pens
Figure 2 - Post mortem examination of a young affected crocodile

showing severe distention of the stomach.
Figure 5 - Blaps nitens laportei 1973 - darkling beetle, Negev, Israel
Figure 3 - Open stomach showing bleeding and desquamation of the

epithelium of the stomach, a large amount of a gelatin like content
and semi-digested parts of the black beetles.
102
Volume 65 (3) 2010
BOVINE UROLITHS ANALYSIS: A REVIEW OF 30 CASES.

Parrah, J.D., Hussain, S. S., Moulvi, B. A., Singh, M. and Athar, H
Division of Veterinary Surgery and Radiology
Faculty of Veterinary Sciences and Animal Husbandry, SKUAST K Shuhama Aulsteng, Kashmir, India .
Corresponding author:
Dr. J.D. Parrah
drjdparrah@yahoo.co.in
Abstract
Calculi obtained from 30 clinical cases of obstructive urolithiasis in male calves during surgery were subjected to
complete analysis including physical, microscopic and chemical examination. Cystic lumen and neck, jointly, were the
commonest site of calculi retrieval (47%) cases, followed by cystic neck (33%) cases and cystic lumen (20%) cases.
In majority (90%) of the cases small multiple calculi were retrieved. The calculi retrieved were usually as free sandy
material mixed with blood and other tissue debris but in 3 cases a mass comprising of calculi embedded in blood clot and
tissue debris was retrieved from cystic lumen. The urethral calculi were either loop shaped or impacted sandy material.
Microscopic examination revealed that one or more well defined nuclei (nidus) were found in each concretion. The
nuclei and the surrounding concentric layers of laminae were enclosed by a single capsule. The calculi were composed of
magnesium ammonium phosphate, calcium phosphate, calcium carbonate, calcium oxalate, hippuric acid, tyrosine and uric
acid. Twenty three (77%) calculi samples were composed of magnesium ammonium phosphate only.
Key words: Urolithiasis, Calculi, Calf
Introduction
Urolithiasis in countries like India presents an important

economic repercussion where cattle - based agriculture is
strongly linked with the livelihood of an important segment
of the population. The primary objective of urinary calculus
analysis was to determine the qualitative composition, as
the prevention of urolithiasis and its treatment depends on a
detailed knowledge of the composition and structure of the
calculi (1). For complete analysis of calculi, a combination of
methods was adopted: Microscopic, spectroscopic, chemical
and X-ray diffractometry are complementary for the analysis
of calculi and no one method is sufficient, as quantitative
analysis are best obtained by X-ray diffractometry, while
qualitative identification of depositional sequence and the
quantitative determination of minor constituents can be
determined by microscopic and chemical methods (2). The
chemical composition of urinary calculi varies and depends
largely on the dietary composition of individual elements,
the geographical location and local management practices
(3). Obstructive urolithiasis is very common in ruminants of
Kashmir valley, however the highest incidence is found in
calves. No report is available about the chemical composition
of uroliths retrieved from the obstructive urolithiasis cases
in the valley of Jammu and Kashmir state. This study was
thus undertaken to understand the chemical composition of
the uroliths retrieved from clinical cases so as to suggest the
remedial measures for preventing the disease and its effective
treatment.
Volume 65 (3) 2010
Materials and methods
Thirty male cattle calves, suffering from complete retention

of urine, presented for treatment at Teaching Veterinary
Clinical Services Complex, Faculty of Veterinary Sciences
and Animal Husbandry (F. V. Sc & A. H.), Sher-e-Kashmir
University of Agricultural Sciences and Technology of Kashmir
(SKUAST-K), Srinagar, formed the material of the study. Ten
bovine clinical cases of obstructive urolithiasis each were
subjected to tube cystostomy using polyvinylchloride urinary
catheter, tube cystostomy using Foleys catheter and cystotomy
and normograde cystourethral catheterization (cystotomy with
indwelling urethral catheterization).
Every effort was made to retrieve all the uroliths from cystic
lumen in a sterile jar containing dextrose saline solution. For
this purpose, bladder and its neck were irrigated many times to
collect all the uroliths. The uroliths were cleaned and cleared
of all tissue and blood, and dried in an incubator at 45oC
for 24 hours. The uroliths were preserved at 4oC for further
examination. During the operation, calculi were removed from
urethra and/or bladder for re-establishing the patency of the
urinary tract using different surgical techniques. These calculi
were subjected to following examinations:
1. Physical characteristics
Calculi removed from the urethra and/or bladders were
observed for their types (hard/pasty/sandy), shapes (round/
irregular etc.), number and anatomical position. After washing
the calculi and drying, the calculus mass was weighed and the
largest ones measured.
2. Microscopic examination
The representative calculi were examined under dissection
microscope. The number and geometrical location of the nidus
103
ARTICLES
within the calculus was recorded.
3. Chemical analysis
After recording physical characteristics, the calculi were
stored at 4oC in the refrigerator untill further analysis of their
composition. The chemical composition of the calculi was
determined by the standard procedures (4).
Results
1. Urolith analysis
Calculi of different number, shape and size were
retrieved from various locations in the urinary tract of all the
animals subjected to various surgical techniques including
tube cystostomy and cystotomy with indwelling urethral
catheterisation for correction of obstructive urolithiasis. These
calculi were observed for their location, number, shape and
composition (Table 1).
1.1 Location of calculi
Almost in all the cases calculi were retrieved simultaneously
from multiple sites. Cystic lumen and neck jointly was the
commonest site of calculi retrieval {14/30 (47%)} cases,
followed by cystic neck {10/30 (33%)} cases and cystic lumen
6/30 (20%) cases. Calculi were retrieved from urethra from one
site only in 8/10 (80%) cases and from 2 sites simultaneously
i.e. pre- and post-scrotal region in 2/10 (20%) cases only.
1.2 Number of calculi
In one case only a single calculus (Fig 1) was retrieved
from cystic lumen, and only two calculi were retrieved from
cystic neck in 2 cases. Among the remaining 27/30 (90%)
cases multiple small calculi (Fig 2) were retrieved from the
cystic lumen (5), cystic neck (8) and cystic lumen and neck
jointly in 14 cases.
1.3 Gross morphology of calculi
The calculi retrieved from the cystic lumen and neck were
usually in the form of free sandy material (Fig 2) mixed with
blood and other tissue debris but in 3 cases a mass comprising
of calculi embedded in blood clot and tissue debris was
retrieved from the cystic lumen. These masses measured from
3.7 5.9 cm and weighed between 35 to 65 gm (Fig 3). On
ultrasonographic examination these calculus masses yielded
acoustic shadows typical for sonographic evaluation of bladder
stones.
Calculi from most of the cases {20/30 (67%)} were sandy,
irregular in shape with smooth surfaces and edges. Of these,
calculi were creamy white in 17 cases and off-white in 3 cases
(Fig 2). All these calculi were soft and easily broken. Calculi
from seven cases were pasty in nature and dark brown in
colour. The individual calculi (Fig 1) single or double obtained
from 3 cases were dendritic in shape, white in colour and hard
to break.
The urethral calculi were either loop shaped (Fig 5) or
impacted sandy material (Fig 4). These calculi were yellow in
colour and easy to break.
1.4 Microscopic examination of calculi
Surface morphology of intact representative calculi was
studied under dissection microscope. One or more well defined
nuclei (nidus) were found in each concretion. The nidus
appeared dense and homogenous, and was not necessarily in the
geometrical centre of the uroliths. The nidus was surrounded
by concentric layers of crystals from precipitating minerals
without clear demarcation between the adjacent layers of
104
concentric laminae. The nuclei and the surrounding concentric

layers of laminae were enclosed by a single capsule (Fig 6).
1.5 Chemical composition of calculi
The calculi were composed of magnesium ammonium
phosphate, calcium phosphate, calcium carbonate, calcium
oxalate, hippuric acid, tyrosine and uric acid. Twenty three
(77%) calculi samples were composed of magnesium
ammonium phosphate only; while in other (23%) samples
magnesium ammonium phosphate (major component) was
accompanied by any one of the other chemical components
listed above.
Discussion
1.1 Location of calculi

The calculi may be lodged in any part of the urinary
tract i.e., starting from renal pelvis to glans penis. But the
lodgement of the urolith in the bladder neck and urethra may
lead to complete obstruction to urine flow thereby enhancing
the acuteness and severity of the condition. The longer length
of urethra and presence of sigmoid flexure make the urethra
more prone to the lodgement of calculi as compared to other
parts of the urinary tract in ruminants. In this study cystic
lumen and neck jointly was the commonest site of calculi
retrieval, followed by the cystic neck. Calculi were retrieved
from the sigmoid flexure of urethra in 60% cases of animals
where cystotomy with indwelling urethral catheterization
was performed. The findings are in agreement with those of
other researchers (5) who recovered about 68% of calculi in
the sigmoid flexure of the bovines. In another study (6) a high
incidence of bovine urinary calculi were found in the distal
portion of the sigmoid flexure. Distal sigmoid flexure in cattle
and the urethral process in sheep are the commonest sites of
urethral obstruction by urolith, as the diameter of lumens at
these sites are the narrowest in the urethral canal, thus calculi
could easily be trapped at these sites (7).
1.2 Number of calculi
In most of the cases (90%) multiple small calculi without
any distinct morphology were seen, while in 3.3% cases single
and in 6.6% cases two distinct calculi were found. Generally a
single distinct calculus is responsible for urethral obstruction
in cattle (8), which is in agreement with the findings of the
present study.
1.3 Gross morphology of calculi
Physical characteristics, including size, shape, colour and
texture of uroliths, may serve as a preliminary and tentative
indicator of the composition of the calculi and thereby assist
in establishing the aetiological factors (9). Calculi may be
of varying sizes, commonly described as sand, gravel or
stone. Most common type of calculi was sandy (66%), pasty
(23%) or assuming the shape of urethra. These findings are
in accordance with those of other researchers, who reported
that phosphate calculi e.g. calcium phosphate and triple
phosphate are usually white, smooth, numerous, chalky and
friable (6). Hard and discrete uroliths in cattle but friable
and sandy masses in fattening lambs are usually present (10).
The individual single or double struvite calculi retrieved from
the clinical cases of obstructive urolithiasis in calves were
usually white but dendritic in shape. These findings are in total
consonance with those of the previous studies, who reported
that struvite may also occur as a single urocystolith with sharp
Volume 65 (3) 2010

facets traumatizing the bladder wall and causing the marked
haematuria (11).
1.4 Microscopic view of calculi
Microscopic examination clearly showed a central
homogenous nidus easily differentiated from the outer
concentric laminae. Formation of nidus is usually the first phase
in the formation of the urolith. Any foreign material or cellular
debris may act as nidus, however the nidus may be formed
spontaneously due to supersaturation and oversaturation of the
urine with lithogenic crystalloids (12). Further precipitation of
crystalloids around the central nidus lead to the formation of
concentric laminae. There were no clear demarcations between
adjacent layers as also reported by other researchers (13, 14).
Slight eccentric location of the nidus suggested that the
calculus was not equally accessible to precipitating minerals
from all sides so that the growth proceeded at variable rates
around the calculus. The nucleus represents the starting point
of the stone and it need not be in its geometrical centre (15).
Moreover, after formation of the nidus, calculi may grow
into a urolith of same or different composition depending on
the condition of urine saturation. The presence of a second
eccentric nidus might be due to abrupt changes in the conditions
of supersaturation of the urine thus resulting in precipitation of
another nidus.
1.5 Chemical composition of calculi
Magnesium ammonium phosphate was present in
every urinary calculus either alone or with other chemicals.
Magnesium ammonium phosphate was alone in 77% of cases
and as major component in combination with other chemicals
in 23% of cases. The findings seem to fall in line with those of
previous studies, who reported 61% of calculi were composed
of a single mineral substance (16).
Calculi composition is affected by the factors like
geography, species, age, sex, composition of feed, pH of urine,
urinary tract infection, etc. During this study, composition of
feed and urine pH seemed to be the profound predisposing
factors, as wheat bran alone or in combination with other
feeding stuffs was given to the maximum number of calves
(77%). Rations high in grain but with limited amount of
roughage leads to ammonium phosphate urolithiasis in feedlot
cattle. Considering the feeding habits of calves of this study
mostly phosphate calculi observed, were as expected. The
findings are in agreement with those of previous studies, who
reported that highly digestible, low roughage ration having
more phosphorus than calcium (i.e. high grain feeding) leads
to the formation of insoluble struvite calculi (17, 18, 19). These
observations also in agreement with those of other workers,
who observed that diet having more wheat bran, predisposed
animals to phosphate stones (20, 21).
Phosphate calculi are formed rapidly in alkaline urine but
are more soluble in acidic urine (22). In the present study,
base values of urine pH were alkaline in all the groups, so the
formation of phosphate calculi was to be expected. The findings
substantiate the observations of previous researchers who
found the most common pH for precipitation of magnesium
ammonium phosphate, calcium phosphate and ammonium
urate crystals to be 7 (13, 23).
Presence of calcium phosphate deposits between the struvite
crystals represented the epitaxial growth, which signifies the
growth of one type of crystal upon another type (24). Chances
of occurrence of struvite and calcium phosphate occurring
Volume 65 (3) 2010
together is more likely as both types of crystals are formed

and precipitated at alkaline urine pH (25). Epitaxial growth of
calculus may provide a plausible explanation of why uroliths
are frequently of mixed composition. It could also explain a
heterogenous form of nucleation.
Conclusions

From the findings of the present study, it is evident
that gross morphology besides chemical and microscopical
examination aids in the identification of calculi, thereby
assisting in the establishment of the etiological factors.
Furthermore, the feeding habits have been found to have a
profound predisposing effect on the development of particular
calculi. The incidence of obstructive urolithiasis, is mostly
found in winter under temperate conditions, pointing towards
the inadequate water intake as another predisposing factor for
the development of disease. Obstructive urolithiasis, a dreadful
disease in ruminants especially in cattle, can therefore be
prevented if precautionary measures like balanced feeding and
encouraging the animals to take adequate amounts of water
in order to induce diuresis, by addition of sodium chloride to
their feed especially during the chilly winter season.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Ulrich, L.K., Kathleen, A.B., Koehler, L.A. and Swanson, L.

Urolith analysis. Submission, methods and interpretation. Vet.
Clin. North Amer. Small Anim. Pract. 26:393-400. 1996.
Otnes, B. and Montgomery, O. Method and reliability of
crystallographic stone analysis. Invest. Urol. 17: 314-319.
1980.
Singh, J. and Singh, K. Obstructive urolithiasis and uraemia in
cattle and buffalo-a review. Indian J. Vet. Surg. 11: 1-20. 1990.
Varley, H. Practical clinical biochemistry. CBS Publishers and
distributors. 1988.
Gera, K.L. and Nigam, J.M. Urolithiasis in bovines (a report of
193 clinical cases). Indian Vet. Journal. 56: 417-423. 1979.
Loretti, A.P., Oliveira-Lo,de., Cruz, C.E.F., Driemeier, D. and
de-Oliveira, Lo. Clinical and pathological study of an outbreak
of obstructive urolithiasis in feedlot cattle in southern Brazil.
Pesquisa Veterinaria-Brasileira. 23:61-64. 2003.
Tiruneh, R. A retrospective study on ruminant urethral obstruction
in Debre Zeit area, Ethiopia. Revue-de-Medecine-Veterinaire.
151: 855-860. 2000.
Radostits, O.M., Blood, D.C., Gay, C.C. and Hinchcliff, K.W.
Veterinary Medicine: A Textbook of the Diseases of Cattle,
Sheep, Pigs, Goats and Horses. Bailliere Tindall, London. pp.
493-498. 2000.
Lavania, J.P. and Angelo, S.J. Studies on the physical analysis
of bovine nephroliths. Indian Vet. Med. Journal. 1: 35-37. 1977.
Hawkins, W.W. Experimental production and control of
urolithiasis. JAVMA. 147 1321-1323. 1965.
Guthrie, S. Cystic calculi in cats. Vet. Rec.120:416-417. 1987.
Osborne, C.A., Lulich, J.P., Bartges, J.W., Unger, L.K.,
Thumchai, R., Koehler, L.A., Bird, K.A., and Felice, L.J.
Canine and feline urolithiasis: relationship of aetiopathogenesis
to treatment and prevention In: Canine and Feline nephrology
and urology by Osborne, C. A. and Finco, D.R. Williams and
Wilkins. pp. 798-888. 1995.
Osborne, C.A., Clinton, C.W., Moran, H.C. and Bailie, N.C.
105
ARTICLES
14.
15.
16.
17.
18.
Comparison of qualitative and quantitative analyses of canine

uroliths. Vet. Clin. North Amer. Small Anim. Pract. 16:317-323.
1986.
Osborne, C.A., Lulich, J.P., Polzin, D.J., Sanderson, S.L., Koehler,
L.A., Ulrich, L.K., Bird, K.A., Swanson, L.L., Pederson, L.A.
and Sudo, S.Z. Analysis of 77,000 canine uroliths. Perspectives
from the urolith centre. Vet. Clin. North Amer. Small Anim.
Pract. 29:17-38. 1999.
Khan, S.R. and Hackett, R.L. Role of organic matrix in urinary
stone formation: an ultrastructural study of crystal matrix
interface of calcium oxalate monohydrate stones. J. Urol.
150:239-245. 1993.
Ling, G.V., Franti, C.E., Johnson, D.L. and Ruby, A.L.
Urolithiasis in dogs. IV: Survey of interrelations among breed,
mineral composition, and anatomic location of calculi, and
presence of urinary tract infection. Amer.J.Vet. Res. 59: 650660. 1998.
Munakata, K., Ikeda, K., Tanaka, K. and Suda, H. Urolithiasis
syndrome in beef cattle in Japan. National Institute of Animal
Health, Quarterly, Japan. 14: 17-28. 1974.
Munakata, K., Suda, H. and Ikeda, K. Induction of urolithiasis
19.
20.
21.
22.
23.
24.
25.
syndrome in cattle. National Institute of Animal Health,

Quarterly, Japan14: 31 -32. 1974.
Ahmed, A. S., Amer, H.A. and Ibrahim, I.M. Influence of dietary
mineral imbalance on the incidence of urolithiasis in Egyptian
calves. Arch. Exp. Veterinarmed. 43: 73-77. 1989.
Anjaria, J.V. Observations on bovine urethral calculosis. Indian
Vet. Journal. 46: 449-453. 1969.
Kataria, R.S. and Rao, U.R.K. Chemical composition of some
bovine nephroliths with special reference to silica nephroliths.
Indian Vet. Journal. 46: 848-854. 1969.
Prien, E.L. and Prien, E.L. Composition and structure of urinary
stone. Amer. J. Med. 45(5): 654-672. 1968.
Osborne, C.A., O, Brien, T.D., Ghobrial, H.K., Meihak, L. and
Stevens, J.B. Crystalluria, observations, interpretations and
misinterpretations. Vet. Clin. North Amer. Small Anim. Pract.
16:45-65. 1986.
Finlayson, B. Symposium on renal lithiasis. Urol. Clin. North
Am. 1: 181-0212. 1974.
Klausner, J.S. and Osborne, C.A. Canine calcium phosphate
uroliths. Vet. Clin. North Amer. Large Anim. Pract. 16:171-184.
1986.
Table and Figures

Table 1: Distribution of urinary calculi in calves of different groups
Group AI
Location of calculi
Group AII
Group B
Total
%age
6/30
20
11/30
37
14/30
47
10
10/10
100
4/10
40
2/10
20
2/10
20
2/10
20
No. of
animals
No. of
calculi
No. of
animals
No. of
calculi
No. of
animals
No. of
calculi
Cystic lumen and

neck
Urethral lumen
DSF
PSF
Pre and post

scrotal region
Between DSF
& Glans penis
Cystic lumen
Cystic neck
DSF = distal sigmoid flexure, PSF = proximal sigmoid flexure
106
Volume 65 (3) 2010

Figure 1 - Single dendritic calculus
Figure 5 - Single calculus mass
Figure 2 - Off white multiple concretionsFigure 3 -
Figure 6 - Single loop shaped calculus in urethra
Figure 3 - Single calculus mass
Figure 5 - Calculi showing nidus in the centre
Volume 65 (3) 2010
107
ARTICLES
DIAGNOSIS OF MILK FEVER BY A WATER HARDNESS

TEST KIT IN EWES
1
Aktas, M.S1., Kaynar, O2, Ozkanlar, S2., Ozkanlar, Y1.

Department of Internal Medicine, Faculty of Veterinary Medicine, Ataturk University, Erzurum/Turkey
2
Departments of Biochemistry, Faculty of Veterinary Medicine, Ataturk University, Erzurum/Turkey
Corresponding author:
Dr. Mustafa Sinan Aktas
Ataturk University
Faculty of Veterinary Medicine
Department of Internal Medicine
Erzurum/Turkey
E-mail: sinanaktas@atauni.edu.tr
Tel: 0904422315530
ABSTRACT
The aim of the study was to evaluate the measurement of total calcium levels in sera of sheep with and without milk
fever by using a commercial water hardness test kit. Thirty sheep with findings of milk fever from 9 different farms were
used in the present study. Total serum calcium concentrations were determined by using a commercial water hardness test
kit and a laboratory automated biochemical analyzer. Results of the test kit and laboratory methods were significantly (P <
0.001) correlated (Spearmans p = 0.896). In conclusion, it has been determined that total calcium levels in sheep sera may
be determined with a water hardness test kit as used in this study, and that data are in concordance with the clinical findings
and the other laboratory results.
Key words: diagnostic, milk fever, sheep, water hardness test kit.
was to measure the total calcium levels in sheep sera with and
INTRODUCTION
Milk fever - parturient paresis or hypocalcaemia - is a without milk fever using a commercial water hardness test kit
metabolic disorder that occurs around the time of parturition (WHTK) compared to a routine laboratory method.
or during early lactation in sheep (1). The disease commonly
occurs in outbreaks, in groups of ewes exposed to forced MATERIAL AND METHODS
exercise, long-distance transport, and sudden deprivation of Animals
Thirty ewes were used in this study had at least one clinical
food and grazing on oxalate-containing plants or green cereal
crops (2). Although it is may be seen occasionally as epidemic findings of milk fever such as depression, increased respiration,
in the herd where up to 25% of the herd may be affected, its muscular tremor, weakness, sternal recumbence and extended
course is mostly sporadic and generally affects less than 5% of or twisted head. Clinical examinations were made by the same
veterinarian. The sheep were 3.31 years of age (range 2 and
the herd (1, 2, 3, 4).
The disease is characterized by a low serum calcium (Ca) 5 years) were taken from 9 different farms. Fifteen sheep were
level (2, 5, 6). As a result of inadequate calcium intake during pregnant and 15 sheep were lactating.
Approximately 20 ml blood was collected from the jugular
the last periods of pregnancy or first periods of lactation,
the body may meet the required need of calcium through vein. Blood samples were allowed to clot for minimum 30
calcium mobilization from bones. If hormonal mechanisms minutes at ambient temperature. The samples were then
are inadequate, for example in the case of an inactive centrifuged and sera were collected. The sera were kept at
parathyroid gland, mobilization is delayed and blood calcium -20C until the analysis was performed. All samples were
concentration is reduced with the resultant development of analyzed within 4 weeks.
milk fever. In small ruminants, hypocalcaemia may develop Serum calcium analyses
Total serum calcium concentrations were determined by
secondarily during the course of other periparturient diseases,
particularly in pregnancy toxemia (7). The diagnosis of the spectrophotometric method using an automatic biochemical
disease is based on clinical or laboratory methods or based analyzer (Cobas 6000 analyzer, Roche, Switzerland). All
on the presence of risk factors which have been reported samples were analyzed at the same time. Based on the results
(8). Therefore, monitoring the calcium level in sheep during obtained with the automatic chemical analyzer the values were
periparturient period may be useful for the identification of the found to be in the range of 6.1 to 10.1 mg/dl.
Total calcium concentrations in the sera samples of all
development risk of both milk fever and other hypocalcaemia
related periparturient diseases. The definitive diagnosis is made sheep were determined using a commercial WHTK which was
through measurement of total and /or ionized serum calcium designed for measurement of calcium carbonate concentrations
concentration (7). Serum total or ionized calcium levels in water samples (CHEMetrics. Inc Cat. No: K-1705. Calverton,
may be measured by laboratory and/or portable biochemical VA, USA). The test was carried out as follows: Calcium in
analyzers. In veterinary practice chemistry analyzers are often the test sample was allowed to react with a zinc salt in the
unavailable in the field. Therefore, the aim of the present study presence of a color indicator. The determined blue and blue108
Volume 65 (3) 2010

green color of the resulting zinc-zincon complex was assigned
as the endpoint of the reaction. According to the manufacturer
the test range for the kit was between 2 to 20 mg/dl. Briefly,
all samples were thawed at room temperature (approx. 20C)
during the test period. In order to achieve proper concentration,
1 drop of indicator solution were dropped in 6.7 ml of sera
sample and mixed. The content turned an orange color.
This sample was drawn into an ampoule by using a titrator
apparatus and the content of the ampoule was shaken gently
back and forth. This application was performed until the orange
color of the ampoule content was transformed into blue or bluegreen color. The calcium carbonate concentration (ppm) was
inversely correlated to volume of sera reaching the endpoint
titration on the scale of the ampoule. The result was further
multiplied by 0.04 to calculate total calcium concentration in
mg/dl. The samples were assayed with the WHTK in a blind
manner without prior knowledge of the laboratory results.
Statistical analyses
Linear regression test was performed in order to determine
the relationship between the sera total calcium levels obtained
from the laboratory versus the WHTK analyses. Spermans rank
correlation test was applied to calculate the correlation between
the results obtained by these two methods. Two samples were
excluded from statistical analysis due to hemolysis.
In order to evaluate the WHTK capacity to diagnose
milk fever, calcium concentrations of less than 8 mg/dl was
determined as a laboratory-derived value for defining milk
fever. The cutoff reference value was used according to results
of Bickhardt et al. (9).
Sensitivity and specificity were calculated on the basis
of actual test kit measurements using the defined total Ca
concentration for milk fever, the cutoff value and predicted
total Ca concentrations, derived from the regression equation.
All statistical analyses were performed with computer based
software for statistics (Sigma Stat).
RESULTS
Based on the results obtained in the laboratory, sera total

calcium values were between 6.1 mg/dl and 10.1 mg/dl
(median, 8.5 mg/dl) and the concentration in 6 of 30 samples
was below 8.0 mg/dl.
There was a significant relationship between the laboratory
results and WHTK results in the 28 samples tested (R2= 0.7743;
Figure). The regression formula was: laboratory value = 0.4324
+ (0.953 x test kit value). The 95% confidence intervals for the
regression equation were 0.4 to 1.6, the intercept and slope and
0.8 to 1, respectively. Results of the WHTK and laboratory
methods were found to be significantly (P < 0.001) correlated
(Spearmans p = 0.896).
Figure Linear regression of total

serum Ca concentrations
derived by use of a
laboratory based-method
and by use of WHTK for
28 sheep.
Volume 65 (3) 2010
When comparing the two methods, 6 samples of the

laboratory results were evaluated to fall into the range
designated for the diagnosis of milk fever (Ca< 8 mg/dl), while
only 5 samples analyzed by the WHTK method were found to
fall into this range (sensitivity = 83.3%). Laboratory results
showed that when 22 samples which were found to be greater
than 8 mg/dl sera total calcium concentration were compared
to the WHTK method results, all samples were found to be
above the cutoff value of 8 mg/dl, therefore giving a specificity
of 100% for this range. Thus, predictive value of a negative
test result was 100% (22/22) and predictive value of a positive
test result was 83% (5/6). The accuracy of WHTK to indicate
the diagnosis of milk fever was verified by the predicted total
calcium concentration of < 8 mg/dl and the regression equation
results.
Analysis of two the hemolyzed serum samples did not
react with the WHTK giving no color change where laboratory
method was able to calculate a calcium value.
DISCUSSION
Milk fever in sheep develops mostly in the last 4-6 weeks

of pregnancy and the first 6 weeks of lactation (2, 4). The most
frequently observed clinical findings of the disease involve
ataxia, tremor, tetania, constipation and reduced ruminal
motility, increased respiration and pulsation, regurgitation,
tympani, depression, sternal recumbency and extended or
twisted head (2, 5). In the study presented, 30 sheep, with at
least one clinical finding of milk fever, were tested during the
periods between the last 4 weeks of pregnancy and the first 4
weeks of lactation.
The clinical signs of milk fever are nonspecific and therefore
cannot be relied upon. The differential diagnosis of milk fever
includes hypomagnesemia, osteomalacia, pregnancy toxemia
and enterotoxemia (2, 10).
In cows, milk fever may coexist with hypermagnesemia or
hypomagnesemia. Relative hypermagnesemia may occur by
shifting the ratio of Ca:Mg from 6:1 to 2:1. Hypophosphatemia
in milk fever may be secondary to the hypocalcemia rather
than being a concurrent event. Woldemeskel et al. (5) found
that serum while total calcium may be decreased phosphorus
and magnesium were normal in sheep with milk fever. In
contrast, El-Khodery et al. (1) reported both total calcium and
magnesium levels were low in milk fever.
The clinical pathological diagnosis of milk fever is based
on the measurement of the total serum calcium concentration
which is comprised of the sum of ionized calcium and the
calcium bound protein. Ionized calcium is important for
immediate metabolic functions however the analysis of ionized
calcium in the field is not practical due to the unavailability of
equipment and the high expense involved (2). Practically this is
not required due to the correlation between the concentrations
of ionized and total sera (2, 4, 11). In the last decade, there
have been many reports of diagnosis of milk fever using total
serum total calcium level in cows (12, 13, 14), buffalo (15),
and sheep (1, 5, 6, 16). Bickhardt et al. (9) showed that serum
total calcium concentrations are less 8 mg/dl in sheep with
milk fever.
In the field the drawing blood from the animal with
suspected milk fever, delivering the sample to the laboratory
and waiting for the result lead to a loss of valuable time
which is disadvantageous to the health of the patient. In the
109
ARTICLES
1990s, portable biochemical analyzers developed for humans
were used in animals, particularly in cats, dogs and horses
providing more accessible results in a shorter time frame
(18). Later, portable biochemical analyzers were produced
specific for animals including sheep, which are still being used
successfully. The disadvantage of these analyzers are their
high costs.
In this study, sera total calcium concentrations were
determined by using a commercial water hardness test kit
which is highly affordable and the results correlate well with
the standard laboratory method (P < 0.001) (Spearmans p =
0.896). Previous studies have been undertaken to determine
the calcium levels in sera using commercial water hardness
test kits. A commercial kit designed for water quality analysis
was used by Ley et al. (17) in order to obtain the quantitative
value of calcium concentration in mare milk. Matsas et al. (16)
further determined sera total calcium levels in dairy cattle by
using such a kit in order to obtain a diagnosis of milk fever.
They found sensitivity of 100% and specificity of 73% when
comparing the laboratory method with the data obtained by
using WHTK indicating that there was a significant correlation
between two methods (P<0.001). Comparing the laboratory
results and the results obtained by using WHTK in the present
study we found a sensitivity of 83.3% and a specificity of
100%. There was a significant correlation (P<0.001) between
two methods as was shown Matsas et al. (16) working with
dairy cattle.
The WHTK lacks the ability to determine magnesium and
phosphorus concentration which is a disadvantage. The use of
non-hemolysed blood is a prerequisite for using the WHTK
analysis. The advantages of the kit lies in the fact that the
test is a rapid (less than 5 minutes) and inexpensive method
for measuring serum total Ca concentrations in sheep. This
offers a benefit ovine practitioners and veterinarians who
do not own portable clinical analyzers or blood chemistry
machines, allowing diagnosis of milk fever in individual
sheep and monitoring of postpartum Ca concentrations of
a herd. The assay range of WHTK (2 to 20 mg/dl) is wide
enough to measure total calcium level in serum samples. It can
be assumed that this test may be used in other situation other
than milk fever which has been correlated in this study with a
standard laboratory method.
In conclusion, it has been determined that total serum
calcium levels in sheep may be measured with the water
hardness test kit used in this study, and that data are in
concordance with standard laboratory results.
REFERENCES
1.
2.
3.
4.
110
El-Khodery, S., El-Boshy, M., Gaafar, K. and Elmashad, A.:

Hypocalcaemia in Ossimi Sheep Associated with Feeding on Beet
Tops (Beta vulgaris). Turk. J. Vet. Anim. Sci. 32: 199-205, 2008.
Radostits, O.M., Gay, C.C. and Hinchcliff, K.W., Constable, P.D.:
Parturient paresis (milk fever).Veterinary Medicine. 10th Ed.,
Elsevier Saunders, London. pp. 1626-1644, 2007.
Sweeney, H. J. and Cuddeford, D.: An outbreak of hypocalcaemia
in ewes associated with dietary mismanagement. Vet. Rec.
120:114, 1987.
Hunt, E. and Blackwelder, J.T.: Disorders of Ca metabolism. In:
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
Smith, B.P. (ed.): Large animal internal medicine, 3th Ed., Mosby
copyright, California. pp. 1248-1252, 2002.
Woldemeskel, M., Eneyew, M. and Kassa, T.: Study on ovine
hypocalcaemia in ewes in central Ethiopia. Revue. Med. Vet. 151:
345-350, 2000.
Gurbulak, K., Pancarc, S. M., Gungor, O., Kacar, C., Oral, H.,
Krmzgul, A.H., Kamiloglu, N.N., Karapehlivan, M. and Kaya
D.: Postpartum Uterine Involution in Winter-Lambing Tuj Breed
Sheep and Effects of Subclinical Hypocalsemia on Uterine
Involution in Tuj Breed Sheep. Kafkas Univ.Vet. Fak. Derg. 11:
55-59, 2005.
Saun, R. V.: Nutritional Diseases of Small Ruminants: diagnosis,
treatment and prevention. http://vbs.psu.edu/ext/resources/pdf/
small-ruminant/Sm%20Rum%20nutr%20disease.pdf 2010.
Houe, H., Ostergaaard, S., Thilsing-Hansen, T., Jorgensen RJ.,
Larsen T., Sorensen JT., Agger JF. and Blom JY.: Milk fever
and subclinical hypocalcaemia-an evaluation of parameters on
incidence risk, diagnosis, risk factors and biological effects as
input for a decision support system for disease control. Acta. Vet.
Scand. 42: 1-29, 2001.
Bickhardt, K., Henze, P. and Gander, M.: Clinical findings and
differential diagnosis in ketosis and hypocalcaemia in sheep.
Dtsch. Tiarariztl. Wochenschr. 105: 413-419, 1998.
Thomas, H. H.: Metabolic Diseases. In: Jimmy, L. H. and Robert,
A. S. (eds.): Current Veterinary Therapy 4 Food Animal Practice,
W.B. Saunders Company, Philadelphia. pp. 215-218, 1999.
Lincoln, S. D. and Lane, V. M.: Serum ionized Ca concentration
in clinically normal dairy cattle, and changes associated with Ca
abnormalities. J. Am. Vet. Med. Assoc. 197: 1471-1474, 1990.
Zadnik, T., Staric, J., Klinkon, M. and Sorsak, B.: Impact of Two
Different Preventive Treatments on Milk Fever Incidence in Dry
Dairy Cows. Krmiva. 6: 349-355, 2006.
Kojouri, GH. A.: Parturient Paresis and its Relationship with
Hypophosphatemia Acta Vet. Scand. 44:126, 2003.
Sakha, M. and Jamshidian, M.: Evaluation of Bovine Parturient
Paresis in 64 Cows With Respect To Preventive Methods. Acta
Vet. Scand. 44: 136, 2003.
Saeed, M., Khan, M. S., Avais, M., Ijaz, M., Mahmood, A. K. and
Ur-Rehman, Z.: A Study on Serum Ca, Creatine Phosphokinase
and Lactate Dehydrogenase Concentrations in Post Parturient
Hypocalcemic Nili- Ravi Buffaloes. Pakistan J. Zool. Suppl. Ser.
9: 357-359, 2009.
Matsas, D. J., Warnick, L. D., Mechor, G. D., Seib, L. N., Fatone,
S., White, M. E. and Guard, C. L.: Use of a water hardness test
kit to measure serum Ca concentration in cattle. J. Am. Vet. Med.
Assoc. 214: 826-828, 1999.
Ley, W. B., Bowen, J. M., Purswell, B. J., Irby, M. and GreiveCrandell, K.: The sensitivity, specificity and predictive value of
measuring Ca carbonate in mares prepartum mammary secretions.
Theriogenology 40: 189-198, 1993.
Grosenbaugh, D. A., Gadawski, J. E. and Muii, W. W.: Evaluation
of a portable clinical analyzer in a veterinary hospital setting. J.
Am. Vet. Med. Assoc. 213: 691-694, 1998.
Volume 65 (3) 2010
Canine oral papillomavirus infection: clinical

course, pathology, L1 Gene and NCR2 gene
sequencing
Jun, D.1,, Yi, G.1,, Na, T.1,, Yipeng, J1, Rui, Z2, Degui, L1,*, Guozhong, Z2,*
Department of Small Animal Clinical Sciences, College of Veterinary Medicine,
China Agricultural University, Beijing 100193, P.R.China
2
Department of Preventive Veterinary Medicine, College of Veterinary Medicine,
China Agricultural University, Beijing 100193, P.R.China
1
*Corresponding author:
Zhang Guozhong; Lin Degui
Telephone: +86-10-62733660
Fax: +86-10-62732984
E-mail: zhanggz@cau.edu.cn (G.Z. Zhang); csama@sina.com (D.G. Lin)
Postal address: College of Veterinary Medicine, China Agricultural University, Beijing100193, P.R. China
ABSTRACT
Canine oral papillomatosis is a self-limiting and spontaneous-regressing neoplastic disease caused by canine oral
papillomavirus (COPV). In this report, five warts from the oral mucosa of five dogs suffering from canine oral papillomatosis
were removed surgically for histopathologic examination, immunohistochemical analysis, L1 gene and NCR2 gene
sequencing. Histopathology revealed various degrees of epithelial hyperplasia, hyperkeratosis and basophilic keratohyalin
granules in the stratum lucidum and granular layer. COPV-L1 gene was highly conserved in all the five samples and several
mutations of non-coding region (NCR2) gene were detected in three out of five samples. Immunohistochemistry revealed
that cell division took place from stratum basale to stratum spinosum, even reaching the granular layer with COPV-L1
protein mainly distributed in stratum corneum and adjacent granular layer. The tendency of canine oral papillomatosis to
transform into a squamous cell carcinoma is also discussed.
Keywords: Canine oral papillomatosis, histopathology, immunohistochemistry, sequencing.
Introduction
Canine oral papillomatosis is a self-limiting neoplastic

disease caused by canine oral papillomavirus (COPV)
(1). Major lesions are observed in the canine oral cavity
characterized by the formation of papillary or cauliflowerlike tumors. The most significant cytopathic feature caused by
COPV is the vacuolization of cells in the granular layer and
prickle cell layer (2).
COPV is a double-stranded DNA virus of 8,607 base-pairs
(bp), and its genome contains several major early (E6, E7, E1,
E2 and E4) and late (L2 and L1) open reading frames, and two
non-coding regions (NCR1 and NCR2). The early viral proteins
E1 and E2 play a role in replication of the viral genome. E4
may play some part in viral DNA replication or release of viral
particles from infected cells. E6 and E7 control cell growth
and the cell cycle which maximizes viral DNA replication, and
the late proteins L1 and L2 form the viral capsid and package
viral DNA. The function of two non-coding regions is not
known (3,4,5,6,7,8,9).
In the study, five cases from canine oral papillomatosis were
chosen for histopathologic examination, immunohistochemical
analysis, L1 gene and NCR2 gene sequencing. Our aim was to
provide evidence for the clinical diagnosis from a pathological
view point with reference to the relationship between the
proliferation of papillomavirus, the structure of the histiocyte,
the development and regression of the tumor, and its tendency
of inducing carcinoma. To the best of the authors knowledge
this is the first time that research on the pathology with
Volume 65 (3) 2010
reference to the viral gene of canine oral papillomatosis has

been undertaken in China.
Materials and methods
Patient selection
The 5 samples in this study were obtained from 5 domestic
dogs of different ages and breeds. They were all diagnosed
with canine oral papillomatosis at the Animal Hospital of the
China Agricultural University (Table 1).
Histopathology
The papilloma tissue were collected by biopsy, fixed in
10% neutral buffered formalin solution and processed routinely
in paraffin wax. Sections (5 m) were cut and stained with
haematoxylin and eosin (H&E).
Electron microscopy
The papilloma tissue were collected by biopsy, immersed in
2.5% glutaraldehyde solution, washed with 0.1M PBS buffer
(pH7.2), fixed by 1% osmic acid solution, dehydrated and
embedded. Ultrathin slides were prepared and double-stained
with uranyl acetate and lead citrate, and examined under a
JEM-1230 electron microscope (Jeol, Tokyo, Japan).
Immunohistochemistry
Papilloma and normal canine oral mucosa epithelial
tissue were treated following routine process, fixed in 4%
paraformaldehyde, embedded and cut at 3m. The samples
were dewaxed, the antigens repaired and the endogenous
biotin removed by 3% H2O2. Immunohistochemical staining
of proliferating cell nuclear antigen (PCNA) was performed
111
ARTICLES
using a mouse anti-PCNA antibody (WuHan Boster Bioengineering co. Ltd.) as the first antibody and a horseradish
peroxidase (HRP)-conjugated sheep anti-mouse IgG as the
second antibody. The staining intensities were observed and
photographed microscopically. The positive signal was dark
brown and the negative signal colorless to very light yellow.
The same method was used to perform COPV L1 gene
immunohistochemical staining (rabbit anti-human HPV L1
antibody as the first antibody and HRP-conjugated sheep antirabbit IgG as the second antibody).
For the control groups, slides were taken from the
papillomatous lesions and PBS was used to replace the first
antibody. Tissue from normal oral epithelium was used as a
negative control.
Polymerase chain reaction and sequencing
Viral DNA was extracted with DNAVzol kit (Vigorous
Biotechnology Beijing Co. Ltd., China) according to the
manufacturers instructions. The primers for L1 gene and
NCR2 sequence were designed based on sequenced COPV
genome (GenBank Accession No.D55633) as shown in Table
2. Specific polymerase chain reaction (PCR) was performed
using primers described in Table 2. Briefly, a 20l reaction
system was composed which included the template DNA 3l,
0.5l of upstream and downstream primer, 10l of PCRmix
(Mylab Corporation, Beijing, China) and 6l tri-distilled water.
This was uniformly mixed and then started with an initial
heating step of 5 minutes at 940C. Further cycles consisted of a
denaturation step of 45 seconds at 940C, followed by 45 second
primer annealing at 59.90C, and 90 second primer extension at
720C. After 35 cycles, the final extension step was set at 10min/
720C. The amplified products were examined and target DNA
were recovered using the Axygen kit, then directly sequenced
at a commercial sequencing facility (Beijing Sunbiotech Co.
Ltd., Beijing, China).
Phylogenetic analysis
The available sequences of COPVs and other major PVs
were downloaded from NCBI to compare their relationship
with the determined sequences in the study. Multiple sequence
alignments were performed with DNAman computer software
and phylogenetic trees were constructed with MEGA 4.0
program.
Results
Clinical aspects
On visual inspection single or multiple pink filiform
papillae-like growths were seen in or around the lip, tongue,
buccal mucosa and hard palate. The diameter of the growths
was often less than 1 cm (Fig.1A). Highly mature tumors
could be removed easily. All five dogs had undergone surgery
to remove their warts; no recurrences were observed.
Histological examination
Under light microscopy, hyperplasia of the epithelium,
hyperkeratosis, basophilic keratohyalin granules in stratum
lucidum and granular layer were observed. Large koilocytes
were found in the granular layer and prickle cell layer.
Compared with the three dogs which had tumors for only a
short time, koilocytes in the two dogs with tumors of 5 and 6
weeks were larger in both number and size. Among tumor cells,
exposed intercellular bridges were significantly elongated.
Mitotic figures and intranuclear inclusion bodies formed by
virus could also be seen in cells from dogs which had had
112
tumors of 3 or 4 weeks (Fig.1B).

Electron microscopy (EM)
Under electron microscope, small polygonal particles
aggregated in the nucleus were observed in tumor cells of
all cases. Other changes noted were swelling of organelles,
vacuolar degeneration, distortion of nuclear appearance,
shrunken, margination and dissolution of chromatin,
microfilament aggregated in the cytoplasm or connections with
abnormal hyperplasic desmosomes around the cell membranes
(Fig.2).
PCNA immunohistochemical staining
After PCNA staining, positive cells were detected only in
stratum basale of normal canine oral epithelial tissue (Fig.3C),
while in all of the oral papillomatosis sections of dogs, positive
cells were distributed from stratum basale to stratum spinosum,
and even to granular layer (Fig.3A). This demonstrated that
the prickle cell layer and granular layer both were undergoing
cell division in addition to the stratum basale in the case of oral
papillomatosis. This phenomenon might have resulted from
virus proliferating in tumor cells.
COPV L1 protein immunohistochemical staining
No positive signal was found in control group, while
in each section of the experimental group positive signals
were present mainly distributed in the stratum corneum and
adjacent granular layer. In the koilocytes of the granular layer
and prickle cell layer, only in those cells which were close
to the stratum corneum could a positive signal be detected.
Furthermore, the closer the cells were to the surface layer,
the easier it was to detect a positive signal. Under higher
magnification, a greater number of deeply stained irregular
particles could be seen. Thin strong-positive deposit areas
could often be seen in parakeratotic area of some dogs. Positive
cells of all cases in the non-stratum corneum mostly showed a
weak positive diffusively stained reaction with the cytoplasm,
however some cell presented with a strong positive nuclear
reaction (Fig.3B,D).
PCR Amplification and Sequencing
COPV L1 gene
In all five cases, the same size L1 DNA sequence could be
amplified by PCR, as shown in Fig.4A confirming the presence
of COPV. All the L1 genes were sequenced and submitted to
the GenBank. GenBank accession numbers were HM054511,
HM054512, HM054513, HM054514 and HM054515.
Compared with all other COPV sequence loaded in GenBank
by DNAman computer software there was no variation among
L1 gene sequences.
Specific NCR2 sequence
All the NCR2 sequences were obtained and submitted to
the GenBank. GenBank accession numbers were HM054516,
HM054517, HM054518, HM054519 and HM054520. The
amplified NCR2 sequence had a length of 849bp (Fig.4B)
and was rich in base A and base T (about 65%, which was
about 56% in the entire genome of COPV). Compared with
the isolate Y62 (GenBank Accession No.D55633) (10), point
mutations existed in sample 2, sample 3 and sample 4 in the
NCR2 gene (Table 3).
Phylogenetic analysis
The L1 gene sequences determined in the study were
compared and phylogenetically analyzed with all other PVs
L1 gene sequence obtained from GenBank (Fig.5). Compared
with other viruses from papillomavirus family, COPV
Volume 65 (3) 2010

had the most closely evolutionary relationship with feline
papillomavirus (FPV). COPV was also evolutionary related to
the Canis familiaris papillomavirus type 2 (CfPV-2) which is
also a variety of canine papillomavirus (11).
Discussion
Generally, clinical signs of canine oral papillomatosis

appear 1 to 4 weeks after infection and disappear 6 to 12 weeks
later (12). All five dogs used in the study had tumors for more
than 3 weeks of tumor growth indicating that the tumors were
in the maturation period.
Observation with light microscopy revealed that koilocytes
were larger than normal cells. In affected cells the cytoplasm
was found to be hollow and transparent, the nucleus pyknotic
and the nucleolus heavily stained. Under electron microscopy,
koilocytes were pyknotic and the nuclear membrane severely
wrinkles with halos appearing around the nucleus. At different
growth stages the appearance of the tumor changed. In the
cytoplasm, vacuoles of different sizes replaced swelling
denatured organelles occupying a major portion of the cell.
Compared with the disappearance of many inherent structures
in the cytoplasm, microfilament increased and aggregated.
In more mature papillomas, koilocytes were filled with
homogeneous rarefied substances which obliterated the
nucleus. A few cells even appeared to undergo apoptosis,
which may represent the spontaneous regression of the tumor.
The formation of koilocytes may have resulted from the
joint change of nucleus and cytoplasm infected by COPV.
Reproduction of virus possibly compromised normal cell
activities resulting in changes in material exchange and energy
consumption appearing as an enlarged cell with pathological
changes in mitochondria and endoplasmic reticulum (13).
Changes in the nucleus presented as nuclear membrane
wrinkling and perinuclear space broadening. With growth of
the papilloma, cells infected by virus gradually underwent
necrosis resulting in the disappearance of all kinds of structures
and finally presenting as a completely homogeneous cavitationlike framework.
Sundberg et al. (8) reported that squamous cell carcinoma
might occur at injection site in dogs which had been vaccinated
for COPV , and that in some dogs with some degree of
immunodeficiency, benign canine oral papillomatosis could
transform into squamous cell carcinoma (14). This suggests
that canine oral papillomatosis and squamous cell carcinoma
might have a closer relationship than previously thought (15,
16). An increase in microfilaments and apparent intercellular
bridge and multi-layer keratinized keratin pearls has been
reported in carcinogenic tissues of squamous cell carcinoma
type-1 (17). In this study we found similar characteristics as
mentioned above. Electron microscopic observation showed
an abundance of stacking desmosomes, step-type intercellular
bridges and related microfilament aggregates which stratified
inside the cell membrane. Large blocks or concentric circular
multi-layer structures composed of keratin microfilamentthere
were also seen (Fig.6). The findings mentioned above illustrated
that the development of canine oral papillomatosis has caused
damage to microfilaments and intercellular bridges, which
resulted in abnormal hyperplasia of these structures. Under the
situation of immunosuppression or immunodeficiency, where
the papilloma could not regress normally these hyperkeratotic
structures could possibly become induced to develop into
Volume 65 (3) 2010
squamous cell carcinomas.

Results of COPV L1 protein staining showed that a strong
positive signal was distributed in the stratum corneum. L1
protein is one of PVs major proteins and its appearance
suggests that the virus is reproducing. Former research has
shown that only the stratum corneum and granular layer
have the essential materials for virus assembly, so that the
stratum corneum and granular layers are the major sites of
for reproduction and assembling of PV (18). Only when the
infected cells differentiated to hornification did the late protein
L1 of COPV began to appear and complete the final assemblage
(19, 20). During this period, stratum corneum cells full of virus
particles can exfoliate easily and infect other healthy dogs thus
starting a new round of infection.
As mentioned above, the distribution of L1 protein positive
signal and long fine cosh-like positive particle sedimentation
area detected in parakeratotic areas have been previously
reported in HPV research (21). Therefore, we concluded that
COPV and HPV had a few similarities in their pathogenic
processes.
The comparison of gene sequences showed no variation
among different strains of COPV, indicating that L1 gene is
quite conserved. L1 gene of COPV had a relatively higher
homology with FPV (22), HPV-1a and HPV-63 (23, 24). The
phylogenetic tree indicated further that COPV has quite close
evolutionary relationship with HPV. We also successfully
detected COPV L1 protein using rabbit HPV L1 antibody in an
immunohistochemical test. Therefore, it is possible that canine
infected by COPV can be used as an animal model for human
infection by HPV.
Based on the coherence of molecular mass measurement,
identity of restriction enzyme patterns between sequenced
cloned COPV and different wild-type COPV (10, 25), we
may conclude that NCR2 was essential DNA part of wildtype COPV rather than artificial cloned product. Retrieval in
GenBank and EMBL database revealed no similarity between
NCR2 and known DNA sequence. Therefore, we considered
the detection of NCR2 as basis for identification of COPV.
As opposed to the conservative L1 gene, NCR2 sequence
has a relatively stronger variability. Compared with the isolate
Y62 (26), 3 of the 5 samples demonstrated point mutation in
different degrees (Table 1). The significance of these mutations
needs further study.
References
1.
Nicholls, P.K. and Stanley, M.A.: Canine papillomavirus-A

centenary review. J. Comp. Pathol. 120: 219-233, 1999.
2. Bell, J.A., Sundberg, J.P., Ghim, S.J., Newsome, J., Jenson, A.B.
and Schlegel, R.A.: A formalin-inactivated vaccine protects
against mucosal papillomavirus infection: a canine model.
Pathobiol. 62: 194-198, 1994.
3. Birnstiel, M.L., Busslinger, M. and Strub, K.: Transcription
termination and 3 processing: the end is in site! Cell. 41: 349359, 1985.
4. Delius, H., Van Ranst, M.A., Jenson, A.B., zur Hausen, H. and
Sundberg, J.P.: Canine oral papillomavirus genomic sequence: a
unique 1.5-kb intervening sequence between the E2 and L2 open
reading frames. Virology. 204: 447-452, 1994.
5. Goldstein, D.J., Finbow, M.E., Andresson, T., McLean, P.,
Smith, K., Bubb, V. and Schlegel, R.: Bovine papillomavirus
E5 oncoprotein binds to the 16K component of vacuolar H(+)-
113
ARTICLES
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
ATPases. Nature. 352: 347-349, 1991.

Masterson, P.J., Stanley, M.A., Lewis, A.P. and Romanos, M.A.:
A C-terminal helicase domain of the human papillomavirus E1
protein binds E2 and the DNA polymerase alpha-primase p68
subunit. J. Virol. 72: 407-7419, 1998.
Proudfoot, N.: Poly (A) signals. Cell. 64: 671-674, 1991.
Sundberg, J.P., OBanion, M.K., Schmidt-Didier, E. and
Reichmann, M.E.: Cloning and characterization of a canine oral
papillomavirus. Am. J. Vet. Res. 47: 1142-1144, 1986.
Teifke, J.P., Lohr, C.V. and Shirasawa, H.: Detection of
canine oral papillomavirus-DNA in canine oral squamous cell
carcinomas and p53 over expressing skin papillomas of the dog
using the Polymerase chain reaction and non-radioactive in situ
hybridization. Vet. Microbiol. 60: 119-130, 1998.
Sandburg, J.P., Reszka, A.A., Williams, E.S. and Reichmann,
M.E.: An oral papillomavirus that infected one coyote and three
dogs. Vet. Pathol. 28: 87-88, 1991.
Yuan, H., Ghim, S., Newsome, J., Apolinario, T., Olcese, V.,
Martin, M., Delius, H., Felsburg, P., Jenson, B. and Schlegel,
R.: An epidermotropic canine papillomavirus with malignant
potential contains an E5 gene and establishes a unique genus.
Virology. 359: 28-36, 2007.
Calvert, C.A. Canine viral papillomatosis. In: Greene CE, eds.
Infectious Diseases of the Dog and Cat. Philadelphia: WB
Saunders, 288. 1990.
Ling, Y. P. and Yu, Z.: Cell ultrastructure and electron microscopy,
Fu Dan University Press, Shanghai, 2004.
Watrach, A.M., Small, E. and Case, M.T.: Canine papilloma:
progression of oral appaloosa to carcinoma. J. National Cancer
Institute. 45: 915-920, 1970.
Nespeca, G., Grest, P., Rosenkrantz, W.S., Ackermann, M. and
Favrot, C.: Detection of novel papillomaviruslike sequences in
paraffin-embedded specimens of invasive and in situ squamous
cell carcinomas from cats. Am. J. Vet. Res. 67: 2036-2041,
2006.
Zaugg, N., Nespeca, G., Hauser, B., Ackermann, M. and Favrot,
C.: Detection of novel papillomaviruses in canine mucosal,
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
cutaneous and in situ squamous cell carcinomas. Vet. Dermatol.

16: 290-298, 2005.
Liu, F.S. and Liu, T.H.: Pathology of Tumours, United Press of
Beijing Medical University and China Union Medical University,
Beijing, 1997.
Tori, T.: Immunoperoxidase demonst rat ion of papillomavirus
antigen in dysp lasia of the uterinecervix. Nippon Sanka Fujinka
Gakkai Zassbi. 37: 411, 1985.
Chen, B.P., Fang, P. and Dong, C.Y.: Observation of Human
Papillomavirus Morphogenesis in Warts. Acta Acad. Med.
Hubei. 18: 21-24, 1997.
Doorbar, J.: The papillomavirus life cycle. J. Clin. Virol. 32: S715, 2005.
Yu, L., Peng, J., Peng, J.Q., Bao, J.Y., Wu, Q.H. and
Liu, X.H.: Study on condyloma acuminatum by in situ
hybrihistochemistry compared with immunohistochemistry.
Chin. J. Dermatovenereology. 18: 233-234, 2004.
Terai, M. and Burk, R.D.: Felis domesticus papillomavirus,
isolated from a skin lesion, is related to canine oral papillomavirus
and contains a 1.3 kb non-coding region between the E2 and L2
open reading frames. J. Gen. Virol. 83(Pt 9): 2303-2307, 2002.
Danos, O., Katinka, M. and Yaniv, M.: Human papillomavirus 1a
complete DNA sequence: a novel type of genome organization
among Papovaviridae. The EMBO Journal. 1: 231-236, 1982.
Egawa, K., Delius, H., Matsukura, T., Kawashima, M. and De
Villiers, E. M.: Two Novel Types of Human Papillomavirus,
HPV 63 and HPV 65: Comparisons of Their Clinical and
Histological Features and DNA Sequences to Other HPV Types.
Virology. 194: 789-799, 1993.
Sundberg, J.P., Smith, E.K., Herron, A.J., Jenson, A.B., Burk, R.D.
and Van Ranst,M.: Involvement of canine oral papillomavirus in
generalized oral and cutaneous verrucosis in a Chinese Shar Pei
dog. Vet. Pathol. 31: 183-187, 1994.
Isegawa, N., Nakano, K., Ohta, M., Shirasawa, H., Tokita, H.
and Simizu, B.: Cloning and sequencing of the L1 gene of canine
oral papillomavirus. Gene. 146: 261-265, 1994.
Tables
Table 1 - Information of dogs
No.
Breed
Age (Month)
Sex
Weight (kg)
Wart existence (week)
German Shepherd Dog
Male
20
Beagle
Female
Siberian Husky
Female
13
Great Pyrenees
Male
18
Caucasian Sheepdog
Female
20
Table 2 - The primers used in the study

Target gene
Primers (5-3)
Predicted product
L1
P1:CACAGCCCAGCACCAAG
P2:TGCGTTTGCGTTTCACA
1464 bp including nt 6879-8343
NCR2
P1:GACAAGTCCGACAGTCCAAC
P2:GGTCAGATAAGCGGGTAGG
916 bp including nt 4218-5134
114
Volume 65 (3) 2010

Table 3 - Mutations in specific NCR2 sequence of COPV
Sample No.
Mutation sites
Changes
COPV T2
nt 4254
T was replaced by C
COPV T3
nt 4252-4253
AT were replaced by ACT
COPV T4
nt 4379
A was replaced by T
nt 4937-4938
TG were replaced by TTG
nt 4992
A was replaced by G
Figures
Figure 1 - Clinical and histopathological examination of canine
oral papillomatosis. (A) Appearance of dogs oral mucosa (German
Shepherd Dog). (B) Transverse section of canine oral papillomatosis,
H.E staining, 100. This picture displays each layer of epithelium
thickened around vascular connective tissue axis, hyperkeratosis.
Koilocytes in different sizes distribute in prickle cell layer.
Figure 2 - Koilocytes. (A) Panorama of a typical koilocyte. Cell

nucleus is extruded to side, the nuclear membrane is wrinkled, the
chromatin is marginated and the cytoplasm is filled with rarefied
substance (Scale=2000nm). Inset: small particles in cell nucleus
(Scale bar=500nm). (B) Mitochondria in koilocyte are swollen with
vacuolization. (Sale bar=500nm). (C) Microfilament-like substances
aggregated in koilocyte; with slight swelling mitochondria. (Scale
bar=500nm).
Volume 65 (3) 2010
Figure 3 - Results of PCNA and COPV L1 protein

immunohistochemical staining (100). (A) PCNA positive cells
distributed widely from stratum basale to granular layer of the
epithelium. (B) Strong positive signal of COPV L1 protein mainly
distributed in stratum corneum while weak positive signal could
be seen in granular and prickle cell layer. (C) The control group of
PCNA presented no positive signal. (D) The control group of L1
protein immunohistochemical staining presented no positive signal
in any layer.
115
ARTICLES
Figure 4 - Electrophoretogram of COPV L1 and NCR2. (A) Amplified
products of COPV L1. (B) Amplified products of NCR2. 1-5: Sample
No. of amplification. M: DNA Marker III. The length of L1 gene
amplification is about 1386bp and the length of NCR2 amplification
is about 849bp.
Figure 5 - Phylogenetic tree of PVs L1 gene. The percentage of

replicate trees in which the associated taxa clustered together in
the bootstrap test (1000 replicates) is shown next to the branches
(only>50% is shown). The tree is drawn to scale, with branch lengths
in the same units as those of the evolutionary distances used to infer
the phylogenetic tree. The evolutionary distances were computed
using the Maximum Composite Likelihood model as described
in the methods section, and are in the units of the number of base
substitutions per site. All positions containing gaps and missing
data were eliminated from the data set (Complete deletion option).
Phylogenetic analyses were conducted in MEGA4. COPVs Accession
No. are D55633, L22695, NC_001619 and D26115, the other 6 kinds
of PVs were taken from their standard strain.
116
Figure 6 - Intercellular bridge and unknown multi-layer keratinized

structure. (A) Elongated step-type intercellular bridges between cells
with intermediates desmosomes. (Scale bar=1000nm). (B) Concentric
circular multi-layer hornification structure in mature papilloma prickle
cell layer, about ten times the size of koilocytes. Several organelles
arescattered in the center while a few completely vacuolized cells (K)
are present in the surrounding around (Scale bar=5000nm).
Volume 65 (3) 2010
What is your diagnosis?
Cardiology
ECG of the Month
Golani, Y. and Ohad D.
Cardiology Unit
The Koret School of Veterinary Medicine
The Robert H. Smith Faculty of Agriculture, Food and Environment
The Hebrew University of Jerusalem, Israel.
Case report
A 10 year old spayed female, mixed brachycephalic dog,

weighing 25 kg was presented for routine annual vaccination.
The owners described a healthy energetic dog with a good
appetite and normal bowel movements. On physical examination
the heart rate was noted to be irregular and on femoral artery
palpation an occasional pulse deficit was detected. The first
pulse palpated after the pulse deficit appeared to be much
stronger than others. The rest of the physical examination was
unremarkable.
The concern generated by these findings led the clinician to
carry out an ECG and to request a blood panel consisting
of complete blood count, electrolytes and biochemistry. All
clinical pathology results were within normal limits.
A 30-second-long Lead-II rhythm strip was recorded (Figure
1A). A short strip of all 6 leads at a paper speed of 50 mm/sec
was also recorded (Figures 1B and 1C).
What is your diagnosis and why? What are the possible
etiologies? How do you propose to manage this case?
Legends for Figures
Figure 1: Electrocardiograms recorded from a 10 year old

spayed female, mixed brachycephalic dog. A: a 30 second
continuous recoding of Lead II divided into three continuous
rows, each representing 10 seconds recording. Calibration is
10mm=1mV and paper speed is 25mm/sec. B: A short recording
of six frontal plane leads, calibrated at 2.5mm=1mV (note the
difference in calibration between Figure1A and 1B causing
the amplitudes to appear different). Paper speed is 50mm/sec,
which causes waves and complexes to appear wider than those
in Figure 1A. C: This section represents an average of one beat
per lead for each of the six leads. Calibration: 10mm=1mV,
paper speed 50mm/sec. This calibration and paper speed is the
most useful for measuring intervals such as P, PR (PQ), QRS,
and QT.
Turn the following page to read the interpretation and
diagnosis
Figure 1
Volume 65 (3) 2010
117

What are the ECG findings? Should this patient be
treated based on these finding, and if it should, what is the
best treating strategy?
It is recommended to examine the ECG systematically
in order to collect and then integrate all findings, prior to
concluding a final diagnosis. The following features should be
examined:
1. Is the ventricular rate normal? Determine whether
Tachyarrhythmia or Bradyarrhythmia is present taking
note of the paper speed.
2. Is the rhythm regular? If not, define the rhythm changes.
3. Try to find at least one gold standard (sinus) beat which
can be used as a reference of comparison to other beats.
Are all P-QRS-T complexes identical to this specific beat,
in shape and character?
4. Are there any QRS complexes that do not have a P wave
preceding them? Are there any P waves that are not
followed by a QRS complex?
5. Is the P-R interval repeatable and constant?
6. Measure the width of P wave, P-R interval (from the
beginning of P wave till the beginning of QRS), the width
of QRS complex, the Q-T interval (from the beginning
of QRS complex till the end of the T wave), and the
amplitudes of P, R, and S waves. (See Table 1 for normal
values).
7. Calculate the Mean Electrical Axis (MEA) using the
algebraic sum of the predominant QRS deflections in
any two leads. Using leads I and aVF may often be the
most convenient, but nit necessarily the only pair for this
purpose.
8. Are there any pre-mature complexes? Note their timing,
width and morphology.
Answers:
1. The calculated heart rate was 90 beats per minute (bpm).

2. The rhythm was irregular. The third row is the most
3.
4.
5.
118
useful to observe in this respect. The R-R interval appears

to change in a predictive periodical manner which
can be defined as regularly-irregular. This finding is
characteristic of Sinus Arrhythmia, indicating that the
arrhythmia originates from the Sino-Atrial node (SA node)
and is the result of regular and periodic changes in the
autonomic input to that main pacemaker. Sinus arrhythmia
confirms the presence of an arrhythmia but also establishes
that the irregularity is not pathologic. The presence of
sinus arrhythmia is incompatible with heart failure as
it indicates a sufficiently high parasympathetic tone.
On physical examination, one might have noticed a cyclic
change of heart rate related to respiration, with an increase
during inspiration and decrease during expiration. If
so, that is also a normal finding characteristic, termed
Respiratory Sinus Arrhythmia.
There were many gold standard P-QRS-T complexes (see
the complex labeled A in Figure 2, as an example).
There is a QRS complex after each and every P wave.
There is a P wave before every QRS complex, except for
the complexes marked B and C in Figure 2
The P-R interval was constant, indicating a causative
relationship between the P wave and the subsequent QRS
complex. This finding confirms the presence of sinus
rhythm.
6. Measurements of waves and intervals should be performed
in Lead II. (Table 1)

Normal findings:
1. The amplitude of the P wave was seen to change in a cyclic
way. This is considered a normal finding referred to as a
wandering pacemaker which is commonly seen with
sinus arrhythmia. Although P wave width was longer than
the normal range (P>0.04sec) and might have indicated the
presence left atrial enlargement, this is considered a nonspecific finding and may be of little significance where
there is no other supporting evidence such as radiographic
or sonographic left atrial enlargement.
2. R wave amplitude was normal
3. Q-T interval was normal

Figure 2
Abnormal findings:
1. The P-R interval was longer than the normal range at 0.14
ms (see Table 1), indicating a first degree AV block. This
conduction disturbance derives from a slow conduction of
the AV-node. Possible etiologies of prolonged conduction
across the AV-node may be associated with disorders that
cause an increased parasympathetic tone. It may be an
incidental finding or resultant to anti-arrhythmic drugs
therapy, which was not administered to this patient).
There are no immediate hemodynamic consequences
for this condition and therefore there is no indication for
treatment.
2. Prolongation of the QRS complex (0.09 sec).
Possible etiologies: Severe hyperkalemia, ventricular
escape beats due to severe bradycardia, an extremely sick
myocardium (e.g. cardiomyopathy or sub-aortic stenosis
with secondary myocardial fibrosis) (which are unlikely
as dog seems clinically healthy and has a high vagal
tone), ventricular premature complexes (VPC) or a bundle
branch block (BBB).
Although there was a slight conduction disturbance through
the AV-node, there was still a constant P-R interval with sinus
rhythm at a normal rate of 90 bpm. All these findings rule out
ventricular escape complexes or VPCs (as opposed to the 2
complexes labeled B and C; see below) and indicates that
the cause for the prolonged QRS can only be derived from a
ventricular conduction disturbance, i.e. a BBB.
In a normal heart, the activation of the ventricles takes
place nearly simultaneously thanks to the fast conduction
Volume 65 (3) 2010

through the Purkinje fibers. These fibers are located at the left
and right branches of the bundle of His that runs through the
sub-endocardium of the inter-ventricular septum. Each branch
passes the electrical impulse arriving from the atria to the
ventricles through the AV-node, to its corresponding single
ventricle. With a (left or right) BBB, there is a lesion in one
of the bundle branches that completely blocks the conduction
down this branch to the ventricle. The result is a blockade of the
fast conduction to the affected ventricle. The depolarization
process in this ventricle, therefore, propagates very slowly
through contracting myocytes that are not specialized in fast
conduction. As a result, a slow bypass is formed in one
ventricle while the other still does go through a normal fast
propagation process that ends much earlier. The graphic result
is a wider (slowly inscribed) QRS.
What kind of a Bundle Branch Block does this dog have?
Right (R-) or Left (L-) BBB?
A left-BBB can often be recognized based on a supraventricular origin (i.e. having a P-wave in front of it, with a
constant PR interval), a wide QRS, a left-sided ventricular
MEA and a predominant R wave on Lead I. Often, a right BBB
is similarly of a supra-ventricular origin with a wide QRS, a
right ventricular MEA and a predominant S wave in Lead I.
According to Lead I (at the lower right corner Labeled
C in Figure 1), this dog had a left BBB. The normal fast
propagation of the right ventricle ended much earlier than
the left ventricular one. The graphic result was that the S
wave (RV propagation) was swallowed and offset by the R
wave (reflecting mostly the LV propagation), which is more
dominant because by the time it completes its course there
Volume 65 (3) 2010
is no longer any negation coming from the faster-conducting

right ventricle.
In a healthy myocardium, there is only little hemodynamic
impact as a result of a BBB. Nonetheless, there may be some
prognostic value to this diagnosis since a left BBB is typically
expected to be less reversible than a right BBB. No treatment
is indicated, nor is one possible (other than via invasive
electrophysiological intervention which is not yet available to
veterinary patients).
7) The mean electrical axis of the ventricles was calculated
using the complexes illustrated in Figure 1C: the QRS complex
in Lead I was mostly positive. In Lead aVF it was also positive.
The MEA is aimed, therefore, towards the left ventricle (Figure
3). When combined with a sinus rhythm demonstrating wide
QRS complexes, this finding is compatible with a left BBB.
Figure 3
Two pre-mature complexes were seen on the Lead II
strip, labeled B and C in Figure 2. They were both identical
to each other, but morphologically very different from the
gold standard. Their timing was early, and they begin at the
very end of the preceding T wave with a direction opposite to
the other complexes. The origin of a pre-mature complex that
looks different form the gold standard is usually ventricular
(e.g. a VPC) as opposed to an atrial pre-mature complex
(APC) which looks identical (albeit early in timing) to the
gold standard. The VPCs morphology is different, because
there is an ectopic ventricular origin to this beat, that forces
the ventricular depolarization front to propagate between
myocytes in an abnormal course which does not utilize the
119

fast conducting Purkinje fiber network. This course does not
allow for rapid conduction, hence is slower than usual and
is inscribed as a wide QRS complex. Note that the T wave
of this VPCs might be mistakenly identified as an R wave,
appearing almost the same as the R wave of the preceding
complex. Although its morphology is almost identical, there is
an essential difference between the two: the R wave represents
ventricular depolarization as opposed to the T wave that
represents ventricular repolarization. This difference can be
picked up by carefully paying attention to timing: in order to
be sure a suspected wave is a T wave it is necessary to measure
the Q-T interval, which is typically longer than a QRS complex.
In this case, Q-T=0.22sec, which indicates that this is truly a T
wave rather than an R wave.
Why do these VPCs seem so narrow? In fact, they are not
narrow at all, as their width is above normal range at 0.09sec.
Their appearing narrow is only an optical illusion because of
a relative (rather than absolute) difference: while the VPCs
are composed of 2 waves with a total duration of 0.09sec, the
gold standard complex is composed of one single (R) wave
of an identical duration, and therefore appears wider.
Whats the location of the ectopic focus or foci? This
question cannot be answered judging a single lead. In Lead
II, the (negative) S wave in complexes B and C is dominant.
Hence the depolarization front propagates away from the
positive electrode of this particular lead, i.e. moving toward
the right ventricle. Based on this one can only suspect that
the origin may be left ventricular. Another VPC labeled D
in Figure 2 is different in shape and direction from the other
complexes. It has a dominant S wave in Leads II (D4) and aVF
(D3), and a positive R wave in Leads aVR (D1) and aVL (D2).
Because it is taller in aVR than it is in aVL, this indicates that
the depolarization not only propagates towards the head, but
also moves towards the right. It is now possible to confirm that
Complexes B and C in Figure 2 are definitively left ventricular
VPCs.
The hemodynamic consequence is only momentary.
The pre-mature beat doesnt allow the heart to fill properly
during the short preceding diastole, thus causing a transiently

decreased stroke volume (SV) following this specific beat.

This is the reason for the pulse deficit. The volume of the
next beat will be above normal because there is a prolonged
pause after the VPC (labeled Z in Figure 2), resulting in the
diastole that immediately follows the VPC being longer and
leading to a higher end-diastolic volume and an increased SV
(according to the Frank-Starling law). This is felt as the single
strong femoral pulse that follows the pulse deficit, as described
earlier.
There is no treatment indicated for these two VPCs, as the
dog is stable and asymptomatic, based on the history, physical
examination, and background sinus arrhythmia attesting to
a high vagal (parasympathetic) tone. There is probably no
myocardial pathology and the VPCs will unlikely increase
the risk of secondary complications. However, it would be
advisable to consider an echocardiogram to confirm the
condition of the heart, especially since there are two separate
findings involving the left ventricle.
Summary of Findings:
1. Sinus arrhythmia with a wandering pacemaker, reflecting
a high enough vagal tone.
2. A first degree AV Block, probably reflecting a conduction
anomaly.
3. A Left BBB.
4. Left ventricular VPCs
The main finding of this case is the combination of two types
of conduction disturbances in two different cardiac locations
(one is supra-ventricular and the other is intra- ventricular).
This is probably not coincidental and may be indicative of
a rather diffuse conduction disturbance. Nonetheless, the
conduction disturbances did not appear to have hemodynamic
consequences at the time of ECG recording and the presence
of a high vagal tone indicated there was no distress at that time.
The VPCs occurred at a low frequency and therefore there
appeared to be no need for treatment at that point in time. It is
recommended, however, to follow up the case with a periodic
ECG, to make sure the AV block does not degenerate to a
higher degree. Also, in light of the findings echocardiography
should be considered.
Table 1
120
Wave
Normal Reference Range
Amplitude (mV)
Width (sec)
< 0.04 sec < 0.4mV
Changes along with the

sinus arrhythmia up to a
maximum of 0.3
0.06
> 2.5mV
(> 3.0 mV in Giant Breeds)
1.5
QRS
< 0.06sec;
(< 0.065 sec in
Giant Breeds)
0.09
P-R
0.06-0.13 sec
0.14
Q-T
0.15-0.25 sec
0.22
Volume 65 (3) 2010
RADIOLOGY
A DOG WITH ACUTE VOMITING
Bibring, U. and Eizenberg, Z.
Imaging Unit
The Koret School of Veterinary Medicine
The Robert H. Smith Faculty of Agriculture, Food and Environment
The Hebrew University of Jerusalem, Israel
History
Lady, an eleven year-old, spayed golden retriever, was presented

to the Koret School of Veterinary Medicine, Hebrew University
of Jerusalem Teaching Hospital for evaluation for acute vomiting.
Lady was fully vaccinated and dewormed and lived in a private
house with free access to a garden. The owner reported that during
the morning Lady vomited several times. They reported that the
vomitus consisted of a large amount of watery yellow fluid with
digested food. She also had soft stool with a normal brown color.
Since then, Lady has been lethargic. For the last 2 weeks Lady has
been on cortisone (Prednisone) due to pruritis.
Physical Examination
Lady weighed 33 kg (BCS=6/9). Her demeanor was bright,

alert and responsive. She was adequately hydrated and her mucous
membranes were hyperemic. Her body temperature was 41.4oC;
pulse 180 beats per minute and on examination she was panting.
Her CRT was less than 2 seconds. On palpation she exhibited a
distended and painful abdomen. Abnormalities detected on the
Complete Blood Count (CBC) included a leucopenia (WBC = 4.09
x103/L (normal range 5.2-13.9 x103/L)) and thrombocytopenia
(PLT = 88 x103/L (normal range 143-400 x103/L)). Examination
of the blood smear revealed a left shift and toxicity.
Blood Chemistry abnormalities were limited to increased
activities of alkaline phosphatase (ALP = 309 U/L (normal range
4-140 U/L)) and alanine aminotransferease (ALT = 497 U/L
(normal range 5-103 U/L)).
Thoracic radiographs were performed (Figures 1 and 2)
1. What are your radiographic findings?
2. Make a list of differential diagnoses for each abnormal
finding.
3. Make a radiographic diagnosis.
4. Decide whether additional imaging studies are required.
SEE THE FOLLOWING PAGE FOR THE DIAGNOSIS
AND EXPLANATION.
Volume 65 (3) 2010
121
Radiographic findings
The overall opacity of the thorax was increased. On the lateral

view, there was border effacement of the cardiac silhouette (mainly
at the ventral margins). Fluid opacity was observed at the ventral
thorax-dorsal to the sternum and there was loss of visibility of the
pulmonary parenchyma as well as the diaphragmatic outline at this
area. Skin fold artifact was also visible at the ventral thorax.
Within the viewable abdomen, there was a decrease of
peritoneal detail, and multiple poorly defined radiolucent gas
shadows were visible at the area of the ventral liver parenchyma
(Figure 3-black arrows). The liver margins extends beyond the
costal arch.
On the dorsoventral view, numerous interlobar fissure lines
were observed and the lung lobes were displaced away (retracted),
from the thoracic wall. Fluid opacity was visible between the
lung lobes and the thoracic wall. The cardiac and diaphragmatic
silhouettes were completely obscured. Loss of peritoneal detail
was again evident within the viewable abdomen.
Differential diagnoses for increased radio-opacity of the pleural
cavity and lung lobe retraction
1. Pleural effusion
2. Pleural fat deposition
3. Diaphragmatic hernia
Differential diagnoses for border effacement in the thorax
1. Pleural effusion or pleural masses
2. Alveolar or severe interstitial lung pattern
3. Pulmonary or large mediastinal masses
4. Diaphragmatic hernia
5. Artifactual due to technical factors (e.g., underexposure)
due to rupture of hepatic abscess. On surgery, a large focal hepatic

abscess was observed. Hepatic lobectomy was made and the
abdominal cavity flushed.
Imaging discussion
This case emphasizes the significance of a thorough and

systematic radiographic evaluation. Even-though the initial aim
of the radiographs were to evaluate the thoracic cavity, it is very
important to also evaluate systematically the extra thoracic structures
such as the peripheral soft tissues, skeletal structures (vertebrae,
ribs etc.) and the viewable abdomen. The small part of the viewable
cranial abdomen that was seen at the radiograph provided essential
information (i.e. irregular gas lucencies, decreased peritoneal
details) for further diagnostic work-up. Abdominal ultrasound
findings were suggestive of hepatic abscessation and abdominal
effusion. The ultrasonographic examination and the aspiration
results provided a definitive diagnosis. These results, combined
with the poor clinical state of the patient, brought the clinician to
decide that emergency procedures were required.
REFERENCES
1.
2.
Thrall, D.E. (2007) Veterinary Diagnostic Radiology, fifth

edition.
Dennis, R., Kirberger, R.M., Wrigley, R.H. and Barr, F.J. (2001)
Small Animal Radiological Differential Diagnosis, first edition.
Differential diagnoses for decreased peritoneal detail

1. Peritoneal effusion (e.g., ascites, peritonitis, uroabdomen)
2. Emaciation or normal puppy/kitten (due to lack of abdominal fat)
3. Artifactual due to technical factors (e.g., underexposure)
Differential diagnoses for focal irregular gas lucencies within
the liver
1. Hepatic abscess (penetrating injury or hematogenous)
2. Infection with gas-producing organisms
Radiographic diagnosis
1. Pleural effusion
2. Abdominal effusion
3. Hepatomegaly and suspected hepatic abscessation
Since Ladys condition deteriorated quickly, abdominal ultrasound
was undertaken (Figure 4).
Abdominal ultrasound-findings
1) Free abdominal fluid (Figure 5- arrows)
2) Hepatic gas pockets with ecogenic shadows (reverberation
artifacts). (Figure 5-arrow heads)
These findings were consistent with abdominal effusion and
liver abscessation.
Needle aspiration of the abdominal free fluid was performed.
Neutrophils, and many cocci and rod bacteria were observed. One
liter of pleural fluid was drained.
The assessment was that Lady suffered from septic peritonitis
122
Volume 65 (3) 2010
Improved Animal Feed Control and

"Farm to Fork" Food Safety Policy
Shlosberg, A.
Department of Toxicology, Kimron Veterinary Institute, 50250 Bet Dagan, Israel
Email: alans@moag.gov.il
As part of the policy of the Israeli Governmental aimed at
improving the safety of food for human consumption, it was
decided in the Ministry of Agriculture (MOAG) in the last few
months to gradually move the control of animal feed within
MOAG to the Veterinary Services and Animal Health (VSAH).
In so doing, it was understood that VSAH will implement a
considerable upgrade in the present feed control systems. The
changes and improvements will be made concomitantly with
the introduction of a new Feed Law and many accompanying
new Regulations. In addition, this whole process will be
done in parallel with an 18 months-long Twinning project
supplied by the European Union (EU). The EU adopted in
2003 a new framework for its relations with its neighbours,
including Israel, the so-called European Neighbourhood
Policy (ENP), whose overall goal is to foster economic reform
processes, promote closer economic integration, legal and
technical approximation and sustainable development. The
ENP is backed by financial and technical assistance to bring
about reforms that will bring benefits in terms of economic
and social development with the potential of greater trade and
other access to the EU. This is done through approximation
or harmonisation with the relevant acquis communautaire (the
body of EU laws and policies already in place), that may be
required in order to be capable of fully reaping the benefits of
such participation. For instance, for more efficient trade, it is
necessary to harmonise with parts of EU labelling rules and
with food safety (veterinary and phytosanitary) standards and
to use EU customs procedures. Twinning is a project tool
within the ENP, enabling the EU to send out officials from
EU Member State administrations to work together with their
counterparts in the administration of a partner country, so as
to prepare together for the implementation of the acquis in a
particular sector. Such a Twinning Project is paid for by the
EU and demands both thorough preparation and a long-term
official commitment from the partner to act according to the
protocols of the Project. In the next few months a Twinning
Project will be agreed upon and signed between the EU and its
partner, the Government of Israel, the overall objective being
to strengthen the means of the VSAH/MOAG to implement the
Farm to Fork food safety policy. This food safety policy will
be within a new legislative framework compliant in quality
with EU provisions and international standards allowing for
the enhancement of food and feed quality. The Twinning
Project aims at multiplying the chances for Israeli agricultural
products to land on EU and international markets. In order
to reach this goal, improvements in the fields of animal feed,
animal health, and animal welfare will be approximated or
harmonized to the EU acquis, institutional capacity will be
strengthened, training will be instigated, and information
recording and registration systems developed. The Twinning
Project, which will start most probably in January 2011, will
mainly comprise the planning, establishment and training of
Volume 65 (3) 2010
an Animal Feed Control Unit (AFCU) within VSAH/MOAG

at the Bet Dagan campus, which will be responsible for all
aspects of feed control, as detailed below. AFCU will comprise
mainly field inspectors highly-trained in regulatory inspection
and sampling, a well-equipped toxicology laboratory with a
well-qualified staff to enable analysis for the necessary natural
and synthetic toxicants at the level of a National Feed Reference
Laboratory, and a small administrative staff. Other tasks of the
AFCU will be the registration and control of medicated feeds,
feed additives, and companion animal feeds. A major role will
be the much-improved control of the very large amounts of
imported feedstuffs arriving at the port terminals of Ashdod
and Haifa, including state of the art sampling techniques of
immense cargoes. The AFCU, as envisaged by the Twinning
Project, will comprise a total of up to about 20 permanent staff
members in all of these activities. Although some compulsory
fees will be charged by the AFCU, the Government of Israel
will have the overall responsibility for providing funding to
employ the recommended staff and to acquire the analytical
equipment needed for the toxicological examinations. The
new legislation, the training and guidance in the Twinning
Project, and the consequent development of the AFCU, will
bring about marked changes in animal feed control in Israel,
to ensure maximal food and feed safety. These changes will
address various obligations (taken from EU food and feed
legislation), still to be finalized, but basically comprising:1. Responsibility. Feed operators will be registered and are
responsible for the safety of the feedstuffs which they
import, produce, transport, store, sell or provide without
cost. Farmers are responsible for the feedstuffs that they
use in animal production. This is the basic principle of
Feed Control. In order to ensure food and feed safety, feed
suppliers and producers will be responsible for examining
feedstuffs for potential toxicants. AFCU will periodically
sample and analyze feedstuffs from all feed operators to
ensure compliance with the responsibilities of the feed
operators;
2. Prevention. Feed operators will identify and regularly
review the critical points in their processes and ensure that
pre-determined controls are applied at these points;
3. Safety. Feed operators will not supply any feed thought,
known or found to be potentially harmful. The new Feed
Regulations that will be part of the Feed Law will list all
the feedstuffs regarded as being suitable and safe. Any
substance not in that list, including non-conventional
feedstuffs, will have to be shown to be suitable and safe, as
they are supplied, and also during conditions of storage;
4. Traceability. Feed operators will have to be able to rapidly
identify the source of any feedstuff and to ascertain the
route of supply to all recipients. This will be done mainly
by identification / marking of feedstuffs, and computerenabled tracking;
123
5. Transparency. Feed operators will immediately inform the
6.
7.
124
competent authorities if they have any reason to believe

that any of their feed is potentially unsafe. Feed operators
will be encouraged to ensure availability of feedstuff
control practises and results to their clients through
newsletters and the internet;
Emergency. Feed operators will immediately inform the
competent authorities and all recipients if they suspect,
know or find that a feedstuff is potentially unsafe. They
will immediately start a withdrawal of feedstuffs (recall)
from all supply routes and recipients;
Cooperation. Feed operators will cooperate with the
competent authorities in actions planned and taken to
avoid or reduce risks.
Development and approval of the Feed Regulations and

the implementation of the Feed Law and Regulations will take
many months to complete. There will be time to invest
in comprehensive discussion and interaction with other
government bodies and feed operators, and to ensure that
whilst food and feed safety is the prime objective, there may
be approximation in some obligations to suit the unique facts
of feedstuff supply in Israel.
Overall, this is a very positive step that the Government of
Israel has committed itself to take and our veterinary profession
will be at the forefront of both bringing the changes into action
and in benefiting from the improved animal health that they
will doubtless engender. As citizens, we shall have an optimal
feed control system to ensure that food of animal origin will be
both wholesome and safe to eat.
Volume 65 (3) 2010

2

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

2

Uploaded by

Copyright:

Available Formats

israel journal of

ISRAEL VETERINARY MEDICAL ASSOCIATION

AMERICAN VETERINARIANS FOR ISRAEL

BOVINE UROLITHS ANALYSIS:

DIAGNOSIS OF MILK FEVER BY A WATER

Canine oral papillomavirus infection:

Cardiology : What is your diagnosis

Imaging: A DOG WITH ACUTE VOMITING

S. Altman - Vice President

ISRAEL JOURNAL OF VETERINARY MEDICINE

All manuscripts are subject to editorial review by experts in the

ISRAEL JOURNAL OF VETERINARY MEDICINE

Book references: Whole book: Author (or editor), Title, Publisher,

ISRAEL JOURNAL OF VETERINARY MEDICINE

Volume 65 (3) 2010

STAPHYLOCOCCUS AUREUS MASTITIS:

Among bacteria causing mastitis, only Streptococcus

Volume 65 (3) 2010

(9). Thus, the importance of evaluating the combination of

Several factors have been shown to influence accuracy

Milk culture could be performed either on blood-agar plate

Traditionally the prevalence of mastitis in heifers prepartum

influence the odds of having clinical mastitis in early lactation.

In practice, the common opinion that S.aureus has a

Volume 65 (3) 2010

ISRAEL JOURNAL OF VETERINARY MEDICINE

Much interest has been devoted to the development of

clinical mastitis in the herd. Results showed that prevalence

Environmental sources and non-dairy animals do not

mammary quarters of all cows are treated at drying-off with a

Programs based on segregation has been applied, but on

Volume 65 (3) 2010

ISRAEL JOURNAL OF VETERINARY MEDICINE

Zecconi, A. Contagious mastitis control program: the

Volume 65 (3) 2010

12. Gonzalez, R.N., Jasper, D.E., Farver, T.B., Bushnell, R.B.,

Pankey, J.W., Weaver, L.D. Survey of intramammary infections

subclinical staphylococcal mastitis with antibiotics. J. Dairy.

Volume 65 (3) 2010

ISRAEL JOURNAL OF VETERINARY MEDICINE

65. Zecconi, A., Piccinini, R., Fox, K.L. Epidemiologic study of

Figure 1 - Control program scheme

Volume 65 (3) 2010

INTOXICATION OF YOUNG CROCODILES IN CAPTIVITY DUE

Since the late 80s, some attempts have been carried in

Young crocodile hatchlings (Crocodylus niloticus) where

Volume 65 (3) 2010

ISRAEL JOURNAL OF VETERINARY MEDICINE

glands able to produce a mixture of p-benzoquinones and

Distention of the stomach or bloating has been reported

Volume 65 (3) 2010

Ardoin, P. Contribution ltude des Tenebrionidae (Coleoptera)

Legends for figures

Figure 4 - Large quantities of black beetles were found covering the

Figure 2 - Post mortem examination of a young affected crocodile

Figure 5 - Blaps nitens laportei 1973 - darkling beetle, Negev, Israel

Figure 3 - Open stomach showing bleeding and desquamation of the

Volume 65 (3) 2010

ISRAEL JOURNAL OF VETERINARY MEDICINE

BOVINE UROLITHS ANALYSIS: A REVIEW OF 30 CASES.

Urolithiasis in countries like India presents an important

Volume 65 (3) 2010

Materials and methods

Thirty male cattle calves, suffering from complete retention