Construction of GFP Gene into Yeast Vector

Farhana Muhammad Yusoff (30158)

Resource Biotechnology
Faculty of Science and Technology
Universiti Malaysia Sarawak

ABSTRACT
The construction of Green Fluorescent Protein (GFP) gene into yeast vector is very important as it
can ensure the successful of expression of GFP gene in a yeast, Pichia pastoris. The construction of
this gene is integrated into pPICZ A vector which is yeast expression vector. The GFP gene that
will be constructed into yeast vector is due to the easy to be manipulated genetically and culture
than mammalian cells and can be grown to high cell densities compared to other expression system
that available. The technique used in this study is mainly about amplifying the gene by using
Polymerase Chain Reaction (PCR). The product was attempted to clone into pGEM-T and the
transformation process was done by using heat shock method. Instead of using pGEM-T cloning
method, the PCR product was subcloned directly into pPICZ A vector. The confirmation of
positive transformant which contain of pPICZ A/ GFP was done to ensure the successful of
construction of GFP gene into yeast vector by using colony PCR. This might be prior things in
order to continue the next step in recombinant DNA technology.
Key words: GFP, pPICZ A, pGEM-T

ABSTRAK
Pembentukan GFP gen ke dalam vektor yis adalah sangat penting kerana ia boleh memastikan
kejayaan ekspresi GFP gen dalam yis, Pichia pastoris. Pembentukan gen ini disepadukan dalam
pPICZ A vektor yang yis vektor telah diekspreskan. Gen GFP yang telah dibentuk ke dalam vektor
yis adalah disebabkan oleh manipulasi secara genetik terutamanya daripada sel mamalia dan
boleh berkembang kepada kepadatan sel tinggi berbanding dengan sistem ekspresi lain yang ada.
Teknik yang digunakan dalam kajian ini adalah memperbanyakkan gen dengan menggunakan
Polymerase Chain Reaction ( PCR ). Produk daripada PCR telah cuba untuk diklonkan ke dalam
pGEM T vektor dan proses transformasi itu dilakukan dengan menggunakan kaedah kejutan
haba.Selain daripada itu, produk daripada PCR juga telah diklonkan terus ke dalam vektor pPICZ
A . Pengesahan transformant positif pPICZ A / GFP telah dilakukan untuk memastikan kejayaan
pembinaan GFP gen ke dalam vektor yis dengan menggunakan koloni PCR. Ini mungkin Antara
perkara utama yang perlu dilaksanakan untuk meneruskan langkah seterusnya dalam teknologi
DNA rekombinan.
Kata kunci: GFP, pPICZ A, pGEM-T

1.0 INTRODUCTION
Green Fluorescent Protein (GFP) gene that is mainly from jellyfish, Aequorea victoria has
becoming one of the most widely used reporter proteins. Recent application have been
found regarding the use of GFP gene which is the GFP genetically modified cats will aid
human and feline medical research. Based on several researches, scientists use genetically
modified animals that have been inserted with GFP gene for the study of HIV/ Aids (Jha,
2011). Therefore, there are many important reasons for choosing GFP gene in this project.
GFP is the protein of choice compared to other fluorescent proteins is due to its fluorescent
is more stable and species-independent. It also allows a simple detection under UV light
and can be monitored non-invasively in living cells (Kain et al., 1995).
In this project, the yeast expression system being used to produced recombinant
protein. Nowadays, the developments of Pichia expression, which is the yeast system that
was used in this project, had an impact on not only the expression levels, but also the
bioactivity of various heterologous proteins (Macauley-Patrick et al., 2005). There are
some advantages of yeast compare to mammalian and bacteria which is usually E. coli
expression system. Pichia pastoris that will be used is easier to be manipulated genetically
and culture than mammalian cells and can be grown to high cell densities. Due to the
eukaryotic type of cells, P. pastoris, can provide correctly folded recombinant proteins that
have undergone the post-translational modifications required for functionality. Based on
the research that has been made by the researchers, the P. pastoris system has strong
promoters to drive the expression of a foreign gene of interest. Hence, this will produce
large amount of the target protein with technical ease and low cost rather than most
eukaryotic systems (Daly and Hearn, 2005).

Obviously, the construction of GFP gene into yeast expression vector will provide a
platform to established P. pastoris expression system for production of other recombinant
protein. The construction will involve the amplification of GFP gene by PCR there are also
other methods which are cloning, ligation and transformation. The PCR will be used in this
research to amplify the desired gene. The PCR process is the process of amplification of
primer-mediated enzyme for specifically cloned or genomic DNA sequence (Innis,
Gelfand, Sninsky, and White, 1990). The construction of GFP gene into yeast vector
requires some important steps. The objective of this project is to construct GFP gene into
yeast vector which is P. pastoris, before the successful of the next step of recombinant
technology which is expression step. Most of the research made for GFP gene are basically
was constructed successfully into large and ever-growing number of species, for example
bacteria, fungi, plants, insects, and nematodes (Chalfie et al., 1994). However, in this
project, the construction will be made into P. pastoris, which is the yeast species.
Therefore, the objectives of this study are:
1. to amplify the GFP gene by using PCR method
2. to clone the GFP gene into pPICZ vector
3. to extract plasmid of positive transformant
4. to confirm the insertion by using colony PCR

2.0 LITERATURE REVIEW

2.1 Green Fluorescent Protein (GFP)
Green Fluorescent Protein (GFP) is amazingly becoming useful for studying living cells,
and recently, scientists are making it even more useful. Scientist using GFP to create
biosensors for example is for molecular machines that can detect the levels of ions or Ph,
then the report is done by fluorescing. There is one example of fluorescent protein which is
-glucuronidase (GUS) gene that also has been used widely. The transformed tissue can be
identified histochemically, but it is a destructive test and not suitable for assaying the
primary transformats. However, GFP gene shares none of these problems (Haseloff, 1999).
The GFP was found by Osamu Shimomura, one of the professors at the Priceton
University, USA during a visit to US Pacific coast for a vacation in the late 1960s. He
collected some specimen of Aequorea victoria and was known to glow with bluish colour
that can turn green. The size of the GFP is a relatively small which about the half of the
size of serum albumin and also the half of the size of haemoglobin in the blood stream
(Ward, 2009). The gene contains 238 amino acids and the residues 65 to 67 (Ser-Tyr-Gly)
in the sequence of GFP will spontaneously form the fluorescent chromophore phydroxybenzylideneimidazolinone. The chromophore is resulting from the process of
spontaneous cyclization and oxidation of the residues. It also needs the native protein fold
for both formation and fluorescence emission (Ormo et al., 1996). Besides, the GFP is in
barrel structure to keep the chromophore away from solvents. Thus, the GFP are able to
fluorescing under almost any conditions (King and May, n. d.). Figure 1 shows the
structure of GFP gene.

Figure 2.1: The chemical structure of the GFP gene (Prashera, Eckenrodeb, Wardc, Prendergastd, &
Cormierb, 1992).

The first function of GFP was discovered in the 1970s by Morin and Hastings
which was to turn the bioluminescence flash of jellyfish, hydroids, and sea pansies from
blue to green. After that time, there are a lot of functions has been found. In science
research, the GFP gene is used widely in scientific research because GFP is the only
fluorescent protein which is the only coloured protein that can be transfer genetically into
other cells, tissues, organs, and organisms after the gene transplant. In fact, many other
proteins have colours and fluorescence, but none of them can be cloned. They only can just
being inserted, through single gene into another organism. Hence, the unique GFP gene is
used widely rather than any other gene. By using GFP gene, scientist and researchers can
watch what is happening in cells in real time. This is done by monitoring a non-invasive,
non-toxicfluorescent marker for GFP. Before the findings of GFP, scientist usually kills the
organisms, preserve them, and stain them in toxic chemicals to see what is happening
5

inside the cells and tissues. Now, the ways of research have been upgraded by the use of
GFP gene as it can report the development and details of cellular metabolism in cells that
are still living. GFP makes the whole organism which is every cell in the body becoming
green-fluorescent. The GFP gene also can be linked to the cellular control factor which is
called the promoters. There is an example of research in Columbia University which is on
the nerve growth of round worm. In the research, the GFP have been linked to the
promoter for nerve growth. Thus, the Columbia scientists can study on what triggers others
cells to grow into nerves. Based on the study, the nerves begin to grow when the cells
begin to glow green (Ward, 2009). According to Zupan, Trobec, Gaberc-Porekar and
Menart (2004), the fused GFP to the N- or C- terminus of proteins, GFP can be used to
express their intracellular location and arrangement. It also is to determine the level of
gene expression due to GFP fluorescence and to study the transportation and secretory
processes that happen in the cell.
2.2 The Yeast Expression Vector
The vector used for this project is yeast vector which is P. pastoris. The yeast is a
methylotrophic yeast species and it also is widely used for the production of recombinant
protein (Cregg et al., 2009). P. pastoris is chosen because of its capability of
accomplishing post-translational modifications that will be result to the proper folding of
numerous foreign proteins. In recent research, there are only a few reported cases of
protein expression in the form of insoluble particles (Sreekrishna et al., 1988). Compare to
other yeast vector, P. pastoris is known as an excellent expression host. There is also a
promoter which is derived from alcohol oxidase I (AOX1) gene from P. pastoris that is
very unique to suite the control of expression for foreign gene. The type of yeast vector
used in this project is pPICZ expression vector. Basically, a yeast, P. pastoris, is a single6

celled microorganism which can manipulate and culture in easy way. However, the nature
of yeast is, they are also a eukaryote and able to do many post-translational modifications
that usually performed by higher eukaryotic cells. Moreover, P. pastoris system can
generally being easier, faster, and less expensive to use rather than expression systems that
comes from higher eukaryotes like mammalian tissue culture or insects cell systems. This
is because the higher eukaryotes systems usually give higher expression levels.

3.0 MATERIALS AND METHODS

3.1 Materials
Low Salt LB medium with Zeocin and pPICZ vector was obtained from Invitrogen, and
pGEM-T Easy vector was obtained from Promega. GFP gene in the plasmid of pAGS/GFP
and E. coli XL1Blue competent cell was obtained from Department of Molecular Biology
UNIMAS. The extraction of plasmid materials; Solution I (50 mM Glucose, 1.8 M Formic
Acid, 25 mM Tris-HCl pH8), Solution II (0.2 N NaOH, 1% SDS), Solution III (3 M KAc,
10

mM

EDTA

pH8)

was

used

for

plasmid

extraction.

Agarose

gel,

phenol/chloroform/isoamyl alcohol, T4 DNA ligase, T4 DNA Ligase buffer, water,

nuclease-free, phosphorylated linkers was used during ligation process.
3.2 Method
3.2.1 Competent Cell Preparation
The culture containing 5 ml Luria broth with 5 l of 50 mg/ml ampicillin and a single
colony or thawed frozen glycerol stock of Escherichia coli strain XL1Blue were grown
overnight at 37C with shaking at 250 rpm. The culture was transferred to Erlenmeyer
flask that contains 50 ml of pre-warmed Luria broth media without the presence of any
antibiotics. The culture was allowed to grow again at 37C with shaking at 250 rpm until
the OD of 600 reached the reading between, 0.45 to 0.5. The flask was put on ice for 20
minutes and centrifugation was performed at 3500 rpm for 5 minutes at 4C in a cooled
McCartney bottles. The supernatant was removed and the cells were re-suspended in a 12.5
ml iced-cold 100 mM CaCl. Centrifugation was performed for 5 minutes at 3500 rpm.
Incubation on ice for 1 hour also was performed (Sambrook, Fritsch, and Maniatis, 1989).

3.2.2 Plasmid Extraction

The overnight bacterial culture was transferred into a 2 ml microcentrifuge tube and was
centrifuged for 2 min at 8000 rpm. The supernatant was removed and re-centrifuged the
pellet for 1 min. Any traces of liquid media were removed from the tube. The cell pellet
was re-suspended by using 100 l of Solution I by vortexing about 10 seconds and was
kept on ice. Solution II was added about 100 l into the cell suspension and was mixed
gently by inverting 10X. The tube was left at room temperature for exact 5 min. Solution
III then was added into the tube and mix by inverting 10X. The solution was centrifuged at
10000 rpm for 5 min. The supernatant was transferred carefully by pipetting into a 1.5 ml
microcentrifuge tube. The DNA was precipitated by adding 2 volumes of cold absolute
ethanol and the tube was inverted at least 10X. Centrifugate at 13000 rpm for 5 minutes.
The pellet was washed with 500 l of 70% ethanol and was re-centrifuged again at 13000
rpm for 2 min. The pellet was air dried and re-suspended the pellet in 50 l of ultrapure
water. The 5 l plasmid DNA was checked or determined by Agarose Gel Electrophoresis
(AGE). A 1% agarose gel was used and AGE was performed at 105 V for 30 min.

3.2.3 Purification of Extraction Product

An equal volume of phenol/chloroform/isoamyl alcohol was added to the DNA solution to
be purified in a 1.5-ml microcentrifuge tube and was vortex vigorously 10 seconds as well
as centrifuged for 15 seconds at room temperature. The top part which was the aqueous
phase containing the DNA was removed carefully by using a 200 l pipette and was
transferred to a new tube. About 1/10 volume of 3M sodium acetate, pH 5.2, was added to
the solution of DNA and was mixed by vortexing briefly or by flicking the tube several
times with a finger. About 2 to 2.5 volume (calculated after salt addition) of ice-cold 100%
9

ethanol was added and then was mixed by vortexing and place in crushed dry ice for 5 min
or longer. It was spin for 5 min in a fixed-angle microcentrifuge at high speed and the
supernatant was removed. About 1 ml of room temperature 70% ethanol was added. The
tube was inverted several times and was centrifuged back. The supernatant was removed.
Air was allowed to dry for 15 minutes. DNA pellet was resuspended in 100 l of ultrapure
water.
3.2.4 Polymerase Chain Reaction
Before applying PCR process, the primer for the GFP gene was designed. After the
forward and reverse primer was designed, the process was preceded to PCR. The PCR
amplification, the specific PCR primers were chose to prime the nucleic acid template to
make the polymerase to be attached to it. This is the first step for the duplications of the
template (Mackay, 2013). The protocol of PCR is based on PCR Master Mix by Promega.
The PCR was performed after all reactions were prepared, 1 X reaction mix was allowed,
when the DNA template was added. The amplification process was performed by
following the cycling profile which is: 94C for 5 minutes, 35 cycles at 94C for 30
minutes, and lastly, 72C for 10 minutes in 1 cycle. The reaction product was visualised by
using agarose gel electrophoresis and the product was stained with ethidium bromide.
3.2.5 Gel Extraction of PCR Product
The bigger AGE well was performed and the 50 l was loaded into each well. The gel slice
containing the DNA fragment was excised by using a clean scalpel or razor blade. The gel
was cut as close as possible to minimize the gel volume. The gel slice was placed into preweighed 1.5 ml tube and weighed back. The weight of the gel slice was recorded. This step
of gel extraction was done by using GeneJET Gel Purification Kit by Thermo Scientific.
10

Then, 1:1 volume of Binding Buffer was added to the gel slice (volume: weight). The gel
mixture was incubated at 50-60C for 10 minutes or until the gel slice was completely
dissolved. The tube was mixed by inversion every few minutes to facilitate the melting
process. The gel was make sure completely dissolved. The gel mixture was vortex briefly
before loading on the column. Up to 800 l of the solubilised gel solution was transferred
to the GeneJET purification column, then it was centrifuged for 1 minute. The flowthrough was discarded and the column was placed back into the same collection tube. The
Wash Buffer of 700 l was added to the GeneJET purification column. It was centrifuged
for 1 minute. The flow-through was discarded and placed back into the same collection
tube. The empty GeneJET purification column was centrifuged for an additional 1 minute
to completely remove residual wash buffer. The GeneJET purification column was
transferred into a clean 1.5 ml microcentrifuge tube. Elution Buffer of 50 l was added to
the center of the purification column membrane for 1 minute. The GeneJET purification
column was discarded and the purified DNA product was stored at -20C.
3.2.6 Ligation of pGEM-T and pAGS/GFP gene
Table 3.2.6: The ligation mixture of pGEM-T and pAGS/GFP gene

Ligation for pGEM-T vector

Standard
Reaction
2X Rapid Ligation Buffer, T4 DNA 5 l
Ligase
PGEM-T Easy Vector
1 l
PCR Product
3 l
Control Insert DNA
T4 DNA Ligase
1 l
Deionised water to a final volume of
10 l

Positive
Control
5 l

Negative
Control
5 l

1 l
2 l
1 l
10 l

1 l
1 l
10 l

The reactions were mixed by pipetting. The reactions were incubated 1 hour at room
temperature. Alternatively, the reactions were incubated overnight at 4C.
11

3.2.7 Cloning of PCR product into pGEM-T Vector

The cloning of the PCR product into pGEM-T vector was lead to the formation of
fragment that consists of pGEM-T/ pAGS/GFP gene. The ligation reaction was set up with
the sample contained of 5 l of 2X rapid ligation buffer, 1 l of pGME-T vector, 3 l of
insert DNA restricted with EcoRI and 1 l of T4 DNA ligase. The total volume of the
mixtures was about 10 l per sample. All the reactions were mixed by pipetting gently.
The 1.5 ml of autoclaved Eppendorf tubes was used for ligations. The mixtures were kept
in refrigerator (4C) and incubated overnight.
3.2.8 Transformation of pGEM-T/pAGS/GFP Gene in E. coli competent cells
The transformation process was done by using heat shock method based on the
Sambrooks method of transformation. Before the process is done, the shaker was
preheated 37C as well as the water bath to exactly 42C. The ligation reaction mixture was
removed from the refrigerator and equilibrates to room temperature for 1 minute. Each
ligation of 2 ml was added to the bottom of a sterile 5 ml Falcon round-bottomed tube that
has been pre-cooled on ice. XLIBlue competent cell was removed from freezer and was
placed in a 50% ice/deionised water bath for 5 minutes. The mixture was mixed by flicking
gently. Competent cells for about 50 ml was added to the Falcon round-bottomed tubes on
ice using wide-bore pipette tips and was pipetted gently. Then, it was left on ice for 20
minutes. The cells were heat shocked for exactly 45 seconds at 42C in a water bath. The
cells was returned to ice for 2 minutes. SOC media was added to each transformation and
was mixed by flicking gently. The tubes were closed completely to make it airtight. The
tubes were put in an incubator-shaker at 37C for 90 minutes. After 60 minutes, LB with
ampicillin plates were put in 37C incubator oven inverted with lids off to dry for 30
12

minutes. After the plates are dry and the transformations have been incubated for 90
minutes in the shaker, it was taken to a laminar flow hood. A sterile pipette tip was used;
the transformation cultures were added and spread onto the LB with ampicillin plates. This
was performed for about 4 plates per sample. The plates was sealed with parafilm strip and
placed in a 37C dry oven for overnight (Sambrook, Fritsch, and Maniatis, 1987).
3.2.9 Blue/White Screening
The white colony was picked about 5 colonies and subcultured. The subculture was
incubated overnight and the extraction of plasmid was done as in 3.2.2.
3.2.10 Restriction Enzyme Digestion
The specific Restriction Enzyme was selected to digest the plasmid. The double digestion
of restriction enzyme was used to cut both GFP gene and PPICZ A vector at the same
reaction tube. The appropriate reaction buffer for enzymes was used. Plasmid, Restriction
Enzyme, buffer and dH2O was combined in a microcentrifuge tube. The combination was
mixed gently by pipetting. The tube was incubated at appropriate temperature which is
37C for 1 hour.
3.2.11 Gel purification
Gel purification was done as in 3.2.5 method.
3.2.12 Ligation of pPICZ A and GFP gene
The enzyme that was used for the ligation of pPICZ and GFP gene is T4 DNA ligase. The
protocol that was used is based on the Fermentas protocol for T4 DNA ligase. The
following reaction mixtures were as followed:
13

Table 3.2.12: List of reaction mixture for 1:4 ration of 30 l.

pPICZ A vector
GFP gene (insert)
10X T4 DNA Ligase buffer
T4 DNA Ligase

5 l
20 l
3 l
2 l

Total Volume

30 l

The mixture was mixed thoroughly and spins. Then, it was incubated for 1 hour at 22C.
The heat was inactivated at 65C for 10 minutes or at 70C for 5 minutes (Linker ligation,
2013).
3.2.13 Transformation of pPICZ A and GFP gene into E. coli competent cells
The transformation was done as in 3.2.6 method.
3.2.14 Confirmation of positive transformants by using colony PCR
The confirmation of successful transformants was done by picking 8-10 small colonies in
the plates that contain transformants of pPICZ A/GFP gene. The colonies was streak in the
plates before put into PCR tubes. The PCR protocols was done as in 3.2.4.

14

4.0 RESULTS AND DISCUSSION

4.1 The primer design for PCR
The construction strategy was designated to ensure the successful of construction of GFP
gene into pPICZ. The GFP gene was design to be inserted into multiple cloning sites in the
pPICZ vector. In the multiple cloning sites, there are C-terminal peptide which contains cmyc epitope and a polyhistidine (6xHis) tag. The C-terminal peptide is where the
expression of recombinant protein occurs. There is some cloning consideration of that has
been done before construct the GFP gene into the pPICZ vector. For better initiation of
translation, the insert contain an initiation ATG codon as part of a yeast consensus
sequence (Romanos et al., 1992). In this project, the yeast consensus sequence that has
been chosen is provided below. The ATG initiation codon is shown underlined.
(G/A)NNATGG
For the expression of the gene as a recombinant fusion protein, the clone was designed and
must be frame with the C-terminal peptide containing the c-myc epitope and the
polyhistidine tag. On the other option, if the expression of the gene without the C-terminal
peptide, the stop codon was included.
After all the consideration was done, the design of the specific primer for GFP gene
was conducted. The first step of primer design was conducted after getting the GFP
sequence. The primer was designed 20 nucleotides before the start codon which is ATG
codon. Before designing the primer for PCR, the site of restriction enzyme from pPICZ
and GFP gene sequence were identified. The restriction enzyme site in GFP gene was
identified by using NEBcutter, (n. d.) in the internet, while the restriction enzyme site for
pPICZ was identified by using the map in Invitrogen manual. The selection of restriction
15

enzyme in the GFP gene must be the same to the restriction enzyme site in the sequence of
the pPICZ vector. The restriction enzymes that were chosen are Not1 and Xho1. The Xho1
was designed at the upstream of the gene inside the forward primer while Not1 was
designed at the downstream of the gene inside the reverse primer.

Figure 4.1.1: The restriction enzyme site available in GFP gene sequence by using NEBcutter
tool. Adapted from
http://tools.neb.com/NEBcutter2/cutshow.php?name=75615b0d-.

16

Figure 4.1.2: The summary of pPICZ features.

17

Figure 4.1.3: The multiple cloning site of pPICZ A with the restriction enzyme sites that have
been chosen highlighted in the box which are Xho1 and Not1.

The ligation will produced pPICZ/GFP. The restriction enzyme site that was found in both
vector and GFP gene are:
Xho1 : 5-CTCGAG-3
Not1 : 5-GCGGCCGC-3

18

After all the consideration and possible design that was made, the forward and reverse
primers for the GFP gene are as below. Xho1 was located at the forward primer while Not1
was at reverse primer. The location of restriction enzymes for forward and reverse primers
is highlighted in red as follows:
Forward primer:
5- ATCTCGAGATGTGGAACGCCTGCGCC -3

Reverse primer:
5- TAGCGGCCGCGCAAACTCCAGTAACA - 3

The consideration made by determining the restriction site that has only one site in both
vector and GFP gene. This is to make sure the restriction enzyme cut only in one site for
both vector and gene. The restriction enzyme site for gene and vector must be the same for
both gene and vector. This is to ensure the gene can be ligated at the same restriction
enzyme site at the vector.
In the forward primer, there is a recommendation that it is better to use Kozak translation
initiation sequence for pPICZ A vector. This is also one example of a yeast consensus
sequence. This Kozaks sequence is thought to have two to three effect of the efficiency for
the translation initiation. The ATG initiation codon is:
(G/A)NNATGG
The initiation ATG codon as a part of yeast consensus sequence was underlined. The
insertion of ATG codon is for the proper initiation of translation (Romanos et al., 1992).
However, in the forward primer that was designed, there is no Kozaks translation
19

initiation sequence. This is due to the alteration of amino acids happen if there is the
insertion of the sequence. The underlined base pair below shows the defective part of the
alteration of amino acids produced.
Forward primer:
5- AT CTC GAG ATG TGG AAC GCC TGC GCC -3
The formula for the sequence should be guanine,G, but it has been changed to become
thymine, T since the addition of guanine in the sequence will produce different class of
amino acids. Thus, it might alter the production of protein. The TGG codon will produced
tryptophan, meanwhile the GGG codon will produced glycine.
4.2 Transformation of pPICZ A vector and pAGS/GFP gene
The concentration of pure vector used must be more than 10 ng/l for the best
transformation to occur. The transformation for both pPICZ A and pAGS/GFP gene was
done by using E. Coli XL1Blue competent cells. The competent cells must be stored at 80C to preserve the cells since the competent cells is fragile and easy to rupture. The
preservation method for the competent cells is needed because the cells provide the
benefits of economy of effort especially in preparation and the reproducibility of results.
The calcium-treated of the competent cells which is frozen and stored at -80C shows good
competence after thawing (Morrison, 1977). The method was done by using heat shock
method. The heat shock duration is only 45 seconds. This is the crucial step in
transformation. However, the heat shock duration is different depends on strain of
competent cells used. Competent cells are very sensitive towards any temperature changes.
The thawing process still needs to be done on ice. The process of transformation need to be
done immediately when the cells already being thawed. Due to the sensitivity of the
competent cells, the transformation with the cells need to be treated gently and handled
20

with care. The competent cells that need to be refreezing will result in a significant drop in
transformation efficiency (NextGen Sciences, 2005).

Figure 4.2: The colony of the overnight transformants on LB low salt plate.

One colony was picked and grown overnight for the purpose of extraction the
plasmid.
4.3 Extraction of plasmid
Both plasmid pPICZ A and pAGS/GFP were successfully isolated by using alkaline lysis
method. This method requires the use of Solution I, Solution II and Solution III. The use of
Solution I or known as alkaline lysis step is to break down the cell wall of the bacteria. The
other alternative that can be used for the alkaline lysis is the use of RNase. RNase is used
to degrade the RNA in the cells. The function of alkaline lysis is to homogenize the cell as
well as to give the single cell suspension. Solution I contain glucose, Tris-HCl (pH 8.0)
and EDTA. The glucose is to maintain the osmotic pressure while doing the alkaline lysis.
21

The Tris-HCl is buffering the cells at the pH of 8.0. Hence, the Tris buffer helps to
maintain the pH at a constant level (Rothe & Heisler, 1986). Meanwhile, the EDTA is used
to bind with the lipid bilayer to make the cell envelope become weak. After the cell lysis,
EDTA will act to limit the DNA degradation by binding the magnesium ions to the DNA.
The Solution I also need to be store in 4C. In addition, TE buffer contains TRIS and
EDTA (DNA Isolation and Analysis, n.d.). This buffer solution helps to suppress the
degradation of DNA at an optimum pH (Open Wet Ware, 2013).
In addition, there is also the use of Solution II. Solution II is used to lysis the cells.
It contains sodium dodecyl sulphate (SDS) detergent and sodium hydroxide (NaOH). SDS
detergent is to dissolve the lipid components in the cell membrane as well as the cellular
proteins. Meanwhile, NaOH is used to denature the chromosomal and plasmid DNA into
single strands. After the used of Solution II, there is also the used of Solution III. The
KoAC which is in the Solution III is to precipitate the SDS from the solution. Thus, it can
trap the tangled chromosomal DNA. After the centrifugation was done, the KoAC become
white which is become the pellet. The function of acetic acid is to bring the pH to neutral
and makes the DNA strand become denature. The chromosomal strands will become
partially hybridised tangle. The remaining components in the solution after the adding
Solution III are plasmid DNA, small fragments of chromosomal DNA and also RNA. The
pH and the concentration of Tris-Cl and EDTA is crucial for the successful of the
extraction.
The extraction was done with the standard protocols of Sambrook, (1987) in sterile
condition. The overnight culture was harvest 2 times to increase the concentration of the
pellet that contains cultures DNA. The pellet formed at the bottom of the 1.5 mL
microcentrifuge tube need to be dried properly before adding TE buffer. The pellet was
22

resuspended with TE buffer rather than ultrapure water. TE buffer can solubilize the DNA
and protect it from degradation. The DNA nucleases is supposed to be less active at certain
pH values, but pH 8.0 can safely be used to store the DNA (Aitken, 2012). The elution part
is the crucial one when it comes to decide the volume of the TE buffer that need to be
added. The volume of TE buffer is depends on the size of the pellet formed at the bottom
of the microcentrifuge tube. The small size of the pellet, 15-20 l of TE buffer is
preferable. If the pellet formed is large, the elution of TE buffer is preferred around 30-50
l. After adding TE buffer, it is recommended to incubate the pellet 30 minutes to 1 hour
before determine the band by doing Agarose Gel Electrophoresis. This is to ensure the
pellet which is the plasmid is properly conserved by the TE buffer. The AGE was done
with 100 volts of electric current and the duration of running the AGE is between 25-30
minutes depending of the size of the agarose well and the size of the agarose itself. There is
the use of ethidium bromide which is the traditionally used for visualising DNA molecules
within the gel. The used of ethidium bromide has mutagenic effect. The used of ethidium
bromide must be handle with double gloves protection to avoid contamination to the skin.
4.4 Purification of the Extraction Products
The using of RNase for the purification is to degrade the RNA in the extraction products.
The sodium acetate is to neutralise the result in renaturation of plasmid. The
phenol/chloroform/isoamyl alcohol is used in the proportion of 25:24:1 to remove all the
protein and lipid contamination. Phenol inhibits nucleases effectively (Howard &
Whitcombe, 1995). Besides that, phenol also helps in preparing DNA low in protein
contamination without the need for a large number of chloroform use (Howard &
Whitcombe, 1995). The function of highest speed of centrifugation is to ensure the
removal of phenol/chloroform/isoamyl alcohol completely because phenol can inhibit most
23

of the enzymatic reaction in the cells. The cold absolute ethanol is needed to remove salt in
the sample before adding 70% ethanol. 70% ethanol is used to eliminate unwanted salt
residue and organic molecules (Shrey & Coon, 1998). After the adding of 70% ethanol, the
centrifugation can be done twice to make the pellet of the plasmid at the bottom of the
microcentrifuge tube. In purification process, the pellet is avoided to be too dry to avoid
the difficulties in dissolving the pellet with TE buffer. The volume of TE buffer that was
added was still depends on the size of the pellet formed.

Ladder

5793 bp

5200 bp

Figure 4.4.1 : Agarose gel (1.0%) electrophoresis of gene extraction. First lane:1 kb ladder (Vivantis), lane
1: other sample, lane 2-3: pAGS/GFP extraction samples.

The shape of the band is U-shaped since the extraction done is the vector. U-shaped
formed is due to the superhelical form of the DNA that was extracted.

24

Ladder

3300 bp
2500 bp

Figure 4.4.2 : Agarose gel (1.0%) electrophoresis of plasmid extraction. First lane:1 kb ladder (Promega),
lane 1-2: The pPICZ A extraction and purification results.

25

4.5 Amplification of GFP gene by PCR

Ladder

750 bp

693 bp

. Figure 4.5: Agarose gel (1.0%) electrophoresis of amplified plasmid using PCR. The results with amplicons
indicate plasmids containing insert. Last lane: 1 kb ladder (Promega), lane 1-6: GFP gene PCR samples.

The PCR condition was optimized for amplification of GFP gene. The optimized annealing
temperature was set at 52 C. The annealing temperature was determined and calculated by
considering the CG content of the primer. The gel purification was done by using GeneJET
Gel Extraction kit by Thermo Scientific. The gel was purified to recover the PCR product.

26

4.6 Ligation of pGEM-T and GFP gene

The ligation was done overnight to increase the efficiency of the ligation process. The
vector used was pGEM-T Easy vector. This step is to enhance the efficiency of GFP gene
to ligate with the pPICZ A vector.
4.7 Transformation of pGEM-T/GFP gene and blue/white screening
There is no band after doing AGE for the extraction products of transformation of pGEMT/GFP. It might be because of the competent cells used in the transformation is ruptured
due to the vigorous pipetting. The competent cells are so fragile and must handle with care.
The first trial of transformation of pGEM-T/GFP gene is failed might be due to the
exceeding duration of heat shock step which is done for 2 minutes. The standard protocol
recommended only 45 seconds is needed for the heat shock step. The prolonged of the heat
shock duration might break down the competent cells. Besides, the duration of incubation
in ice after the heat shock step was also being prolonged up to 10 minutes. The standard
protocols recommended were only 2 minutes in ice. The cells might be too long in the ice
and it is not a suitable condition for the cells after having heat shock step. The
transformation of the pGEM-T/GFP was done with positive and negative controls. The
plating of the pGEM-T/GFP gene was done in LAIX plate for the blue/white screening.

27

Figure 4.8.2: The positive control of the transformation which were all white colonies.

Figure 4.8.3: The negative control of the transformation with only two blue colonies that have no insert.

The positive transformants are grown in white colony as expected instead of negative
control of the transformant. The negative transformant plate should be all blue colony
rather than white due to the absence of the insert in the vector. There are only two colonies
that were in blue for the negative colony. This might because of the poor efficiency of the
ligation and transformation process due to the problems of techniques used as well as the
inefficient of competent cells. Instead of poor transformation efficiency, it also might be
28

because of the competent cells used for the transformation. The competent cells that were
used was already put outside -80C overnight which was stored at -20C. The competence
ability is strictly based on the stored temperature. The competent cells only can be stored
outside -80C for 1 hour. Exceeding the period may result in poor efficiency of the
competency of the cells.
The blue/white screening can be done for this transformation due to the presence of
LacZ gene in the pGEM-T vector. The transformant is cultured in a medium called X-gal.
There are two essential components in the X-gal which are ampicillin, that prevents the
growth of any bacterium that has not successfully received the gene which is ampicillinresistance from the plasmid and the other one is the substrate for -galactosidase. The
bacteria that have the foreign gene that was inserted in it will not hydrolyze the lactose and
will produce the white colony. Meanwhile, if the gene has the original LacZ gene, the cells
will hydrolyzed the X-gal and produced blue-colored compound that will make the colony
become blue (Tortora, Funke, & Case, 2010). In this process, there are also two genes to
complete the process of screening for determination of the host bacterium that already
being inserted with plasmid DNA (Tortora, Funke, & Case, 2010).
4.8 Restriction Enzyme Digestion
The restriction enzyme used for the restriction enzyme digestion was Not1 and Xho1.

29

4.9 Transformation of PPICZ A/ GFP gene into E. coli competent cells

Figure 4.9.1: The transformants of pPICZ A/GFP grown on LB low salt with Zeocin.

Figure 4.9.2: The plate of negative control showed the absence of colonies.

30

There are a few colonies formed on the plate of LA low salt with Zeocin. Confirmation
was done to determine the form of pPICZ A/GFP ligation in the E. coli competent cells.
4.10 Confirmation of pPICZ A/GFP by using PCR colony

Ladder

1000 bp
693 bp
500 bp

Figure 4.10: Agarose gel (1.0%) electrophoresis of confirmation for GFP gene after the construction
into pPICZ A. Lane 1-5: GFP gene.

The size obtained shown indicate the original size of the GFP gene which is 693 bp. The
presence of the band indicates the successful of the ligation and transformation of the
pPICZ A/GFP into the E. coli competent cells. Thus, the construction of the GFP gene into
yeast vector which is pPICZ A vector was successful. The lane that was not bright might
be due to the low concentration of the plasmid during ligation.
31

5.0 CONCLUSION AND RECOMMENDATION

As a conclusion, the construction of GFP gene into pPICZ A which was the yeast vector
was successful. The subcloned method by using restriction enzyme digestion method is
more preferable instead of using pGEM-T method of transformation. Thus, it is
recommended that the further study should be done in the stage of the recombinant
technology which is expression level.

32

References
Aitken,

A.

(2012).

TE

buffer

(Tris-EDTA

buffer).

Retrieved

from

http://www.nhm.ac.uk/resources-rx/files/te-buffer_aug12-118648.pdf.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and
Struhl, K. (2002). Short protocols in molecular biology: a compendium methods
from Current protocols in molecular biology (5th ed.). Canada: John Wiley & Sons,
Inc.
Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W., and Prasher D. C. (1994).
Greenfluorescent protein as a marker for gene expression. Science, 263(5142), 802805.
Cregg, J. M., Tolstorukov, I., Kusari, A., Sunga, J., Madden, K., and Chappell, T. (2009).
Expression in the yeast Pichia pastoris. Methods Enzymol, 463, 169-189.
Daly, R., and Hearn, M. T. (2005). Expression of heterologous proteins in Pichia pastoris:
a useful experimental tool in protein engineering and production. Journal
Molecular Recognition, 18(2), 119-138.
DNA isolation and analysis. (n.d.). Retrieved March 7, 2013 from
http://www.emcp.com/product_catalog/resourcefile.php?ID=3219
Haseloff, J. (1999). Imaging living cell. Cambridge, UK: Springer Berlin Heidelberg.
Howard, J., & Whitcombe, D. M. (1995). Diagnostic bacterial protocols. United States of
America: Humana Press Inc
Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. (1990). PCR protocols. A
guide to methods and applications. San Diego, CA: Academic.
Jha, A. (2011). Glow cat: fluorescent green felines could help study of HIV. The Guardian.
Kain, S. R., Adams, M., Kondepudi, A., Yang, T. T., Ward, W. W., and Kitts, P. (1995).
Green fluorescent protein as a reporter of gene-expression and protein localization.
Biotechniques, 19, 650-655.
King, T., and May, P. (n.d.). Green fluorescent protein. Retrieved September 28, 2013,
from http://www.chm.bris.ac.uk/motm/GFP/GFPh.htm.
Linker

ligation.
(2013).
Retrieved
October
15,
2013,
from
http://www.thermoscientificbio.com/uploadedFiles/Resources/linker-ligation.pdf.

Macauley-Patrick, S., Fazenda, M. L., McNeil, B., and Harvey, L. M. (2005).

Heterologous protein production using the Pichia pastoris expression system.
Yeast, 22(4), 249-270.
33

Mackay, M. (2013). PCR down under. Retrieved September 29, 2013, from
http://www.uq.edu.au/vdu/PDU_PCRPrimers.htm.
Morrison, D. A. (1977). Transformation in Escherichia coli: cryogenic preservation of
competent cells. Journal of Bacteriology, 132(1), 349-351.
NEBcutter.
(n.
d.).
Retrieved
December
16,
2013,
http://tools.neb.com/NEBcutter2/cutshow.php?name=75615b0d-.

from

NextGen
Sciences.
(2005).
Retrieved
from
http://wolfson.huji.ac.il/expression/procedures/bacterial/competent_cells%20_guid
e_v3.pdf.
Open Wet Ware. (2013). TE. Retrieved from http://openwetware.org/wiki/TE_buffer.
Ormo, M., Cubitt, A. B., Kallio, K., Gross, L. A., Tsien, R. Y., and Remington, J. (1996).
Crystal structure of the Aequorea victoria green fluorescent protein. Science,
273(5280), 1392-1395.
Prasher, D. C., Eckenrodeb, V. K., Wardc, W. W., Prendergastd, F. G., and Cormierb, M.
J. (1992). Primary structure of the Aequorea victoria green-fluorescent protein.
Gene, 111, 229-233.
Ravichandran,
M.
(n.d.).
Retrieved
www.ppsk.usm.my/lecturers/mravi/PDF.

October

14,

2013,

from

Romanos, M. A ., Scorer, C. A., and Perret, J. (1992). Foreign gene expression in yeast: A
review. Yeast, 8, 423-488.
Rothe, K.F., & Heisler, N. (1986). Distribution of tris buffer between intracellular and
extracellular space as a function of plama pH in the rat, Acta Anaesthesiologica
Scandinavica, 30(2), 111-115.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1987). Molecular cloning: A laboratory
manual (2nd ed.). New York: Cold Spring Harbor Laboratory Press.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning. A laboratory
manual (2nd ed.). USA: Cold Spring Harbor Laboratory Press.
Shrey, A., & Coon, C. (1998). Phenol-Chloroform Isoamyl Alcohol DNA extraction.
Retrieved from
http://ccoon.myweb.usf.edu/ecoimmunology.org/PCI_extraction.html.
Sreekrishna, K., Potenz, R. H., Cruze, J. A., McCombie, W. R., Parker, K. A., Nelles, L.,
Wood, P. J. (1988). High level expression of heterologous proteins in
methylotrophic yeast Pichia pastoris. Basic Microbiol, 28, 265-278.
Tortora, G. J., Funke, B. R., & Case, C. L. (2010). Microbiology an introduction (10th
ed.). San Francisco: Pearson International Edition.
34

Ward, W. (2009). History of GFP and GFP antibodies. Retrieved September 24, 2013,
from http://www.brighterideasinc.com/proteins-antibodies/history-of-gfp-and-gfpantibodies/.
Zupan, A. L., Trobec, S., Gaberc-Porekar, V., and Menart, V. (2004). High expression of
green fluorescent protein in Pichia pastoris leads to formation of fluorescent
particles. Biotechnology, 109, 115-122.

35

36