Professional Documents
Culture Documents
A new ribosome-inactivating protein (RIP), sechiumin, was purified from the seeds of edible gourd,
Sechium edule Swartz by gel-filtration and ion-exchange chromatography, with an apparent relative molecular mass of 27 kDa. It inhibits the protein synthesis of rabbit reticulocyte lysate strongly with a
concentration causing 50% inhibition (IC50) of 0.7 nM, but has a much lower inhibitory effect on intact
HeLa cells, with an IC50 of 5000 nM. Sechiumin has a highly specific RNA N-glycosidase activity
towards 28S rRNA, as does the A-chain of abrin. It suggests that sechiumin is one of the type-I ribosomeinactivating proteins. The cDNA of sechiumin has been cloned and expressed using a pET expression
system in Escherichia coli. The sechiumin cDNA has 951 nucleotides, encoding a protein with 285 amino
acids. The amino acid sequence deduced from the cDNA reveals that the first 21 N-terminal amino acid
residues constitutes a signal peptide. Sechiumin has nearly 60% similarity to several type-I RIPs purified
from the Cucurbitaceae family, such as luffin-a (62.5 %) and trichosanthin (64.8%), but less similarity to
other type-I RIPs. Two amino acid residues, Glu160 and Arg163, at the putative active site of sechiumin,
are known to be catalytically active in ricin and abrin. The N-terminal amino acid sequence of sechiumin
is very similar to that of trichosanthin. The recombinant sechiumin was obtained as an insoluble protein,
and the preparation of the active soluble form was achieved by renaturing the denatured protein. These
studies suggest that the recombinant sechiumin could be used for the preparation of immunotoxin as a
potential cancer chemotherapeutic agent.
Keywords : Sechium edule Swartz; sechiumin ; inhibition of protein synthesis; cytotoxicity; ribosomeinactivating protein.
401
1.
2.
3.
4.
Crude extract
Sephadex G-75
CM-52 cellulose
FPLC Mono-S
Total
protein
Total
activity
Specific
activity
mg
unit 3 106
unit/mg 3104
690.1
262.4
12.2
3.1
2
3.13
2.44
2.00
2
1.2
20.0
65.8
from New England Biolabs, Inc. The expression vector, pET 21-a,
and pET system components were obtained from Novagen, Inc.
Deoxyribonucleotide primers were synthesized using the phosphoramite method in an Applied Biosystem automated DNA
synthesizer. Marathon cDNA amplification kit was purchased
from Clontech Laboratories, Inc. Abrin A chain was isolated and
purified as described previously [11]. All other chemicals were
of analytical grade.
Purification of ribosome-inactivating protein. 400 g seed
was homogenized in a Waring blender with 800 ml 0.05 M acetic acid at 4 C. After standing at 4C for 4 h, the extracts were
centrifuged at 15000 rpm for 20 min. The supernatant was precipitated with 90% saturated ammonium sulfate. The mixture
was centrifuged at 15 000 rpm at 4 C for 20 min, and the precipitates were redissolved and dialyzed in 10 mM sodium acetate,
pH 5.5, for 36 h. After removing the precipitates produced during dialysis by centrifugation, the clear supernatant was applied
to a Sephadex G-75 column (90 cm32.4 cm), and the fractions
containing protein biosynthesis inhibitory activity were pooled
and applied to a carboxymethyl-52 cellulose column (10 cm
32.2 cm) which was equilibrated with the same buffer. The column was eluted with a linear gradient of 10 mM sodium acetate,
pH 5.5, containing 020.2 M NaCl, and the active fractions were
pooled and applied to a FPLC Mono S column (HR 5/5 column,
50 mm31.6 mm). The adsorbed proteins were eluted with a gradient of 020.5 M NaCl in 10 mM sodium acetate buffer, pH 5.5,
and the purified RIP was obtained and designated as sechiumin.
Determination of protein biosynthesis inhibitory and
RNA N-glycosidase activities. The inhibitory effect of purified
402
Fig. 3. Effects of sechiumin on the protein synthesis of a rabbit reticulocyte lysate cell-free system or HeLa cells. The assays were carried
out with duplicate samples as described in Materials and Methods. (A)
Rabbit reticulocyte lysate cell-free system. (B): Intact HeLa cells.
and the cells were incubated at 37C for 18 h. The protein synthesis was measured after incubating the cells in serum-free and
leucine-free RPMI 1640 medium containing 0.5 Ci L-[3H] leucine/ml for 1 h. The radioactivity incorporated into protein was
determined as described previously [15].
Electrophoresis. The molecular mass of sechiumin was determined by SDS/polyacrylamide gel electrophoresis [16] with
the following markers: A-lactoalbumin (14 400 Da), soybean
trypsin inhibitor (20 000 Da), carbonic anhydrase (30 000 Da),
ovalbumin (43 000 Da), bovine serum albumin (67 000 Da),
phosphorylase b (94 000 Da). The gels were stained with Coomassie brilliant blue to detect the protein and periodic acid2
Schiffs reagent to detect glycoprotein [17]. The pI of sechiumin
was estimated from isoelectric focusing electrophoresis performed with a pH 3.5210 gel.
N-terminal and internal microsequence analysis of sechiumin. For cyanogen bromide cleavage, 300 g purified sechiumin was treated with an 100-fold molar excess of cyanogen
bromide/methionine residue in 70% formic acid at room temperature for 72 h. The reaction products were separated by 16.5%
(mass/vol.) tricine system polyacrylamide gel electrophoresis as
described by Schgger [18], then subsequently electroblotted
onto a poly(vinylidene difluoride) membrane using a semi-dry
blotting system (Nihon-Eido) at 1 mA/cm2 for 4 h. The blot was
stained with 0.1 % Coomassie brilliant blue and the stained polypeptide bands were excised and subjected to a protein sequencer
(Perkin Elmer division applied biosystem model 476 A). For Nterminal amino acid sequence analysis, 3 g purified sechiumin
was loaded onto a polybrene-coated filter and automatically
sequenced.
Cloning of sechiumin cDNA. Total cellular RNAs were isolated from the seeds of young edible gourd by homogenizing in
4 M guanidinium thiocyanate [19], and poly(A)-rich mRNA was
purified from total cellular RNAs with messenger affinity paper
[20]. Poly(A)-rich mRNA (1 g) was reverse transcribed with
the Marathon cDNA amplification kit, and the double-stranded
cDNAs were ligated to Marathon cDNA adaptors. Based on Nterminal and internal amino acid microsequences of sechiumin,
degenerate oligonucleotides were synthesized (Fig. 5 B). The
sense primer A corresponds to N-terminal amino acids 129 and
403
Fig. 5. cDNA cloning of sechiumin. (A) Schematic diagram of cDNA cloning strategy of sechiumin. The double-stranded cDNAs were ligated
with adaptors and subjected to PCR with various primers as shown. (B) Oligonucleotide primers used in the cDNA cloning. Primers A and C
correspond to the N-terminal amino acid sequence of sechiumin and primers B and D were derived from the cyanogen-bromide-cleaved polypeptides.
GSP, gene-specific primer, AP, adaptor primer.
to nucleotides 1512174). After the fusion of corresponding 5RACE and 3-RACE fragments, full-length cDNA was cloned.
Expression and purification of recombinant sechiumin.
The expression plasmid was constructed by ligating a 821-bp
NdeI2NotI fragment (derived from sechiumin cDNA by PCR
with primer sec N, 5 GGAATTCCATATGGATATCAACTTCAATCTA 3 and primer sec C, 5 TATCAAATGCGGCCGCCCACATAGTAGTTTGATG 3) to the pET-21a expression
vector at NdeI2NotI cloning sites. The expression plasmid
(pET21a-sec) was transfomed into E. coli strain TG1, and the
insert of the positive clone was confirmed by sequencing analysis. For expression, the expression plasmid was introduced into
BL21(DE3), a host strain with the T7 RNA polymerase gene,
by CaCl2-mediated transformation. The transformants were
grown at 37C in Luria-Bertani medium containing ampicillin
(0.1 mg/ml) to an optical absorbance of 0.8 at 600 nm. After induction with 1 mM isopropyl thiogalactopyranoside at 25C for
2 h, the cells were harvested and the cell pellet was resuspended
in 5 mM imidazole binding buffer and lysozyme (0.2 mg/ml)
was added. The cells were lysed by freeze/thawing three times,
then treated with DNase/RNase. The pellet was collected by centrifugation and resuspended in binding buffer containing 6 M
urea and incubated at 4 C for 1 h. After removing insoluble
materials by centrifugation, the supernatant was applied to a
404
Fig. 6. Nucleotide sequence and deduced amino acid sequence of sechiumin cDNA. The first 21 amino acid residues (*) represent the N-terminal
signal sequence and the first amino acid residue of sechiumin, Asp, is boxed. A potential polyadenylation signal is underlined. The arrows indicate
the cyanogen-bromide-cleaved polypeptides I and II.
RESULTS
Purification of sechiumin. After the extraction of sechiumin
from the seeds and fractionation with ammonium sulfate, the
dialyzate was subjected to Sephadex G-75 gel-filtration column
chromatography, and two protein peaks were detected (Fig. 1 A).
The fractions containing sechiumin were found by its inhibitory
effect on the protein synthesis of rabbit reticulocyte lysate. The
active fractions were subjected to carboxymethyl-52 cellulose
column chromatography and four major protein peaks were obtained. Peak 4 containing the protein synthesis inhibitory activity
(Fig. 1 B) was further fractionated with a Mono S column
(50 mm316 mm) and peak 5 from the Mono S column was
active against protein synthesis of rabbit reticulocyte lysate
(Fig. 1 C). Table 1 summarizes the results of a typical purification of sechiumin. About 3.1 mg sechiumin was purified from
400 g seeds. The purified sechiumin showed a single band
(Fig. 2, lane 4) with an apparent molecule mass of 27 kDa in
SDS/PAGE analysis. From isoelectric focusing electrophoresis
405
Fig. 7. Comparison of deduced amino acid sequence of sechiumin (SEC) with several type-I RIPs and the A chains of type-II RIPs. The
amino acid sequence of abrin A chain (ABR), ricin A chain (RIC), Ricinus communis agglutinin (RCA), luffin-a (LUFa), momordin (MOM),
trichosanthin (TRI), pokeweed antiviral protein-S (PAP), Mirabilis antiviral protein (MAP), saporin (SAP), barley translation inhibitor (BAR) and
sechiumin were arranged to their similarities. The completely conserved residues are boxed, while the highly conserved hydrophobic and positively
charged residues are marked by asterisks (*) and plus (1), respectively.
406
DISCUSSION
REFERENCES
1. Stirpe, F., Barbieri, L., Battelli, M. G., Soria, M. & Lappi, D. A.
(1992) Ribosome-inactivating proteins from plants: present status
and future prospects, Biotechnology 10, 4052412.
2. Endo, Y., Mitsui, K., Motizuki, M. & Tsurugi, K. (1987) The mechanism of action of ricin and related toxic lectins on eukaryotic
ribosomes. The site and the characteristics of the modification in
28S ribosomal RNA caused by the toxins, J. Biol. Chem. 262,
590825912.
3. Endo, Y., Tsurugi, K. & Franz, H. (1988) The site of action of the
A chain of mistletoe lectin I on eukaryotic ribosomes. The RNA
N-glycosidase activity of the protein, FEBS Lett. 231, 3782
380.
4. Olsnes, S. & Pihl, A. (1973) Different biological properties of the
two constituent peptide chains of ricin, a toxic protein inhibiting
protein synthesis, Biochemistry 12, 312123126.
5. Olsnes, S. & Phil, A. (1982) Toxic lectins and related proteins, in
Molecular action of toxins and viruses (Cohen, P. & Van Heyningen, S., eds) pp. 512105, Elsevier Scientific Publishing Co.,
New York.
6. Barbieri, L. & Stirpe, F. (1982) Ribosome-inactivating proteins from
plants: properties and possible uses, Ca. Surveys 1, 4892520.
7. Vitetta, E. S. & Uhr, J. W. (1985) Immunotoxins, Annu. Rev. Immunol. 3, 1972212.
407
408
29. Kim, Y. & Robertus, J. (1992) Analysis of several key active site
residues of ricin A chain by mutagenesis and X-ray crystallography, Protein Engineering 5, 7752779.
30. Hung, C. H., Lee, M. C., Chen, J. K. & Lin, J. Y. (1994) Cloning
and expression of three abrin A chains and their mutants derived
by site-specific mutagenesis in Escherichia coli, Eur. J. Biochem.
219, 83287.
31. Ramakrishnan, S., Fryxell, D., Mohanraj, D., Olson, M. & Li, B.
Y. (1992) Cytotoxic conjugates containing translational inhibitory
proteins, Annu. Rev. Pharmacol. Toxicol. 32, 5792621.
32. Wang, Q. C., Ying, W. B., Xie, H., Zhang, Z. C., Yang, Z. H. &
Ling, L. Q. (1991) Trichosanthin-monoclonal antibody conjugate
specifically cytotoxic to human hepatoma cells in vitro, Ca. Res.
51, 335323355.
33. Ramakrishnan, S. & Houston, L. L. (1984) Prevention of growth of
leukemia cells in mice by monoclonal antibodies directed against