Eur. J. Biochem.

255, 4002408 (1998)

FEBS 1998

Sechiumin, a ribosome-inactivating protein from the edible gourd,

Sechium edule Swartz
Purification, characterization, molecular cloning and expression
Tsann-Huei WU, Lu-Ping CHOW and Jung-Yaw LIN
Institute of Biochemistry, College of Medicine, National Taiwan University, Taipei, Republic of China
(Received 24 March 1998) 2 EJB 98 0392/2

A new ribosome-inactivating protein (RIP), sechiumin, was purified from the seeds of edible gourd,
Sechium edule Swartz by gel-filtration and ion-exchange chromatography, with an apparent relative molecular mass of 27 kDa. It inhibits the protein synthesis of rabbit reticulocyte lysate strongly with a
concentration causing 50% inhibition (IC50) of 0.7 nM, but has a much lower inhibitory effect on intact
HeLa cells, with an IC50 of 5000 nM. Sechiumin has a highly specific RNA N-glycosidase activity
towards 28S rRNA, as does the A-chain of abrin. It suggests that sechiumin is one of the type-I ribosomeinactivating proteins. The cDNA of sechiumin has been cloned and expressed using a pET expression
system in Escherichia coli. The sechiumin cDNA has 951 nucleotides, encoding a protein with 285 amino
acids. The amino acid sequence deduced from the cDNA reveals that the first 21 N-terminal amino acid
residues constitutes a signal peptide. Sechiumin has nearly 60% similarity to several type-I RIPs purified
from the Cucurbitaceae family, such as luffin-a (62.5 %) and trichosanthin (64.8%), but less similarity to
other type-I RIPs. Two amino acid residues, Glu160 and Arg163, at the putative active site of sechiumin,
are known to be catalytically active in ricin and abrin. The N-terminal amino acid sequence of sechiumin
is very similar to that of trichosanthin. The recombinant sechiumin was obtained as an insoluble protein,
and the preparation of the active soluble form was achieved by renaturing the denatured protein. These
studies suggest that the recombinant sechiumin could be used for the preparation of immunotoxin as a
potential cancer chemotherapeutic agent.
Keywords : Sechium edule Swartz; sechiumin ; inhibition of protein synthesis; cytotoxicity; ribosomeinactivating protein.

Ribosome-inactivating protein(s) (RIPs) are a group of plant

enzymes that can inhibit polypeptide-chain elongation by inactivating the ribosomes [1]. The molecular mechanism of the inhibition is identified as a specific N-glycosidase activity that hydrolytically cleaves the N-glycosidic bond of adenine at position
4324 of 28S rRNA [2, 3]. RIPs are divided into two groups: (a)
type-I RIPs, single-chain polypeptide with molecular masses of
25230 kDa, generally glycoproteins with basic pI values; (b)
type-II RIPs, heterodimer proteins consisting of an enzymatically active A chain and a lectin-like B chain. The B chain of
type-II RIPs binds to cell-membrane receptors with D-galactose,
allows the A chain to enter the cytoplasm, then irreversibly inactivate ribosomes, thus inhibiting protein synthesis and the
growth of the cells [1]. Based on their structures and functions,
most type-II RIPs are very potent toxins, the best known being
ricin [4] and abrin [5], while type-I RIPs are much less toxic
than type II. Type-I RIPs can be transferred into cells if they are
crosslinked with appropriate carriers capable of binding to the
cell surface [6].
Correspondence to J. Y. Lin, No. 1, Sect. 1, Jen-Ai Road, Taipei,
Taiwan, 10018, Republic of China
Fax: 1886 2 23415334.
E-mail: linma@tpts4.seed.net.tw
Abbreviations. RIP(s), ribosome-inactivating protein(s) ; IC50, concentration causing 50% inhibition ; IPTG, isopropyl thiogalactopyranoside; RACE, rapid amplification of cDNA ends.
Enzyme. rRNA N-glycosidase (EC 3.2.2.22).

RIPs have been of considerable interest in recent years due

to their use in the development of immunotoxins with cancer
chemotherapeutic potential, which can be targeted to cancer cells
[7]. One of type-I RIPs, A-trichosanthin has been shown to have
a potent inhibitory activity against HIV-1-infected T-cells and
macrophages [8]. Recently, the physiological roles of RIPs in
defense against fungal and viral infections have been reported
[9, 10].
In the present studies, a new type-I RIP, sechiumin, was isolated and purified from the seeds of edible gourd, Sechium edule
Swartz (a member of Cucurbitaceae family). The physico-chemical and biological characteristics were studied. The cDNA coding for sechiumin was cloned and expressed in Escherichia coli,
and the active recombinant sechiumin was obtained.
MATERIALS AND METHODS
Materials. Seeds of S. edule Swartz were obtained from local sources. L-[ 3H]Leucine, [35S]dATP, messenger RNA affinity
paper and Sequenase version-2.0 DNA sequencing kit were
purchased from Amersham Life Science, Inc. The FPLC system,
Mono S column, Sephadex G-75 gel and protein markers were
obtained from Pharmacia LKB Biotechnology. Carboxymethyl52 cellulose was the product of Whatman Laboratory Division.
Rabbit reticulocyte lysate cell-free system, Taq DNA polymerase and pGEM T-easy vector were purchased from Promega.
Restriction endonucleases and T4 DNA ligase were obtained

401

Wu et al. (Eur. J. Biochem. 255)

Table 1. Purification of sechiumin from 400 g seeds of S. edule

Swartz. One unit is defined as the amount of protein necessary to inhibit
protein sythesis by 50 % in 0.025 ml rabbit reticulocyte lysate reaction
mixture.
Fraction

1.
2.
3.
4.

Crude extract
Sephadex G-75
CM-52 cellulose
FPLC Mono-S

Total
protein

Total
activity

Specific
activity

mg

unit 3 106

unit/mg 3104

690.1
262.4
12.2
3.1

2
3.13
2.44
2.00

2
1.2
20.0
65.8

Fig. 2. Electrophoretic analysis of sechiumin. Sechiumin purified by

gel-filtration and ion-exchange chromatography was subjected to SDS/
PAGE. M, molecular-mass markers, Lane 1, crude extracts, Lane 2, the
active fraction of Sephadex G-75 column chromatography, Lane 3, the
active fraction of carboxymethyl-52 cellulose chromatography, Lane 4,
the active fraction of Mono S column chromatography.

Fig. 1. Purification of sechiumin from the seeds of S. edule Swartz.

(A) Gel-filtration column chromatography of sechiumin. The supernatant
of dialyzate of ammonium sulfate precipitates was applied to a Sephadex
G-75 column (90 cm32.4 cm) and eluted with 0.01 M sodium acetate at
a rate of 16 ml/h. Fractions (4 ml each) were collected, and the fractions
containing protein synthesis inhibitory activity were pooled. (B) Ionexchange column chromatography with a carboxymethyl-52 cellulose
column. The fractions containing protein synthesis inhibitory activity
from the gel-filtration column chromatography was applied to a
carboxymethyl-52 cellulose column (10 cm32.2 cm). Fractions (2.5 ml
each) were collected and analyzed for biological activities. (C) Ion-exchange column chromatography of sechiumin with a Mono S column.
The active fractions from carboxymethyl-52 cellulose column chromatography were applied to a FPLC Mono S column (50 mm31.6 mm).
Fractions (1 ml each) were collected and examined for biological activities. The horizontal bar indicates the active fractions.

from New England Biolabs, Inc. The expression vector, pET 21-a,
and pET system components were obtained from Novagen, Inc.
Deoxyribonucleotide primers were synthesized using the phosphoramite method in an Applied Biosystem automated DNA
synthesizer. Marathon cDNA amplification kit was purchased
from Clontech Laboratories, Inc. Abrin A chain was isolated and
purified as described previously [11]. All other chemicals were
of analytical grade.
Purification of ribosome-inactivating protein. 400 g seed
was homogenized in a Waring blender with 800 ml 0.05 M acetic acid at 4 C. After standing at 4C for 4 h, the extracts were
centrifuged at 15000 rpm for 20 min. The supernatant was precipitated with 90% saturated ammonium sulfate. The mixture
was centrifuged at 15 000 rpm at 4 C for 20 min, and the precipitates were redissolved and dialyzed in 10 mM sodium acetate,
pH 5.5, for 36 h. After removing the precipitates produced during dialysis by centrifugation, the clear supernatant was applied
to a Sephadex G-75 column (90 cm32.4 cm), and the fractions
containing protein biosynthesis inhibitory activity were pooled
and applied to a carboxymethyl-52 cellulose column (10 cm
32.2 cm) which was equilibrated with the same buffer. The column was eluted with a linear gradient of 10 mM sodium acetate,
pH 5.5, containing 020.2 M NaCl, and the active fractions were
pooled and applied to a FPLC Mono S column (HR 5/5 column,
50 mm31.6 mm). The adsorbed proteins were eluted with a gradient of 020.5 M NaCl in 10 mM sodium acetate buffer, pH 5.5,
and the purified RIP was obtained and designated as sechiumin.
Determination of protein biosynthesis inhibitory and
RNA N-glycosidase activities. The inhibitory effect of purified

402

Wu et al. (Eur. J. Biochem. 255)

Fig. 4. N-glycosidase activity of sechiumin. The electrophoresis was

carried out on a 3.5 % acrylamide gel (with 7 M urea) at 25 mA for 2 h.
The arrow indicates the fragment cleaved with aniline from rRNAs of
treated ribosomes. (B) Rat liver ribosomes treated with H2 O. (A) Rat
liver ribosomes treated with 10 nM abrin A chain, then with aniline.

Fig. 3. Effects of sechiumin on the protein synthesis of a rabbit reticulocyte lysate cell-free system or HeLa cells. The assays were carried
out with duplicate samples as described in Materials and Methods. (A)
Rabbit reticulocyte lysate cell-free system. (B): Intact HeLa cells.

protein on translation in vitro was determined by measuring the

incorporation of L-[3H]leucine into proteins using a rabbit reticulocyte lysate cell-free system as described previously [12]. Nglycosidase activity was determined by treating rat liver ribosomes with purified protein in a reaction buffer (113 mM KCl,
10 mM MgCl2, 0.05 % 2-mercaptoethanol, 2 U RNasin). After
adding the toxic protein, the reaction mixture was incubated at
37C for 15 min, then the reaction was terminated by adding
0.5 % SDS. The reaction products were extracted with phenol,
precipitated with alcohol, then treated with 0.8 M aniline,
pH 4.5, to selectively cleave the 28S rRNA at the depurinated
site by -elimination. The reaction products were analyzed by
using 7 M urea/3.5% PAGE and the gel was stained with ethidium bromide [13, 14].
Cytotoxicity. The cytotoxicity of sechiumin was examined
by its inhibitory effect on the protein synthesis of HeLa cells.
The cells were cultured in trays with 20 mm wells, at 13105
cells/well, in RPMI 1640 medium supplemented with 10% fetal
calf serum, streptomycin (100 U/ml) and penicillin (100 ug/ml).
On the second day, the medium was replaced with serum-free
RPMI 1640 medium containing various amounts of sechiumin

and the cells were incubated at 37C for 18 h. The protein synthesis was measured after incubating the cells in serum-free and
leucine-free RPMI 1640 medium containing 0.5 Ci L-[3H] leucine/ml for 1 h. The radioactivity incorporated into protein was
determined as described previously [15].
Electrophoresis. The molecular mass of sechiumin was determined by SDS/polyacrylamide gel electrophoresis [16] with
the following markers: A-lactoalbumin (14 400 Da), soybean
trypsin inhibitor (20 000 Da), carbonic anhydrase (30 000 Da),
ovalbumin (43 000 Da), bovine serum albumin (67 000 Da),
phosphorylase b (94 000 Da). The gels were stained with Coomassie brilliant blue to detect the protein and periodic acid2
Schiffs reagent to detect glycoprotein [17]. The pI of sechiumin
was estimated from isoelectric focusing electrophoresis performed with a pH 3.5210 gel.
N-terminal and internal microsequence analysis of sechiumin. For cyanogen bromide cleavage, 300 g purified sechiumin was treated with an 100-fold molar excess of cyanogen
bromide/methionine residue in 70% formic acid at room temperature for 72 h. The reaction products were separated by 16.5%
(mass/vol.) tricine system polyacrylamide gel electrophoresis as
described by Schgger [18], then subsequently electroblotted
onto a poly(vinylidene difluoride) membrane using a semi-dry
blotting system (Nihon-Eido) at 1 mA/cm2 for 4 h. The blot was
stained with 0.1 % Coomassie brilliant blue and the stained polypeptide bands were excised and subjected to a protein sequencer
(Perkin Elmer division applied biosystem model 476 A). For Nterminal amino acid sequence analysis, 3 g purified sechiumin
was loaded onto a polybrene-coated filter and automatically
sequenced.
Cloning of sechiumin cDNA. Total cellular RNAs were isolated from the seeds of young edible gourd by homogenizing in
4 M guanidinium thiocyanate [19], and poly(A)-rich mRNA was
purified from total cellular RNAs with messenger affinity paper
[20]. Poly(A)-rich mRNA (1 g) was reverse transcribed with
the Marathon cDNA amplification kit, and the double-stranded
cDNAs were ligated to Marathon cDNA adaptors. Based on Nterminal and internal amino acid microsequences of sechiumin,
degenerate oligonucleotides were synthesized (Fig. 5 B). The
sense primer A corresponds to N-terminal amino acids 129 and

Wu et al. (Eur. J. Biochem. 255)

403

Fig. 5. cDNA cloning of sechiumin. (A) Schematic diagram of cDNA cloning strategy of sechiumin. The double-stranded cDNAs were ligated
with adaptors and subjected to PCR with various primers as shown. (B) Oligonucleotide primers used in the cDNA cloning. Primers A and C
correspond to the N-terminal amino acid sequence of sechiumin and primers B and D were derived from the cyanogen-bromide-cleaved polypeptides.
GSP, gene-specific primer, AP, adaptor primer.

the antisense primer B was derived from positions 15222 of

cyanogen-bromide-cleaved polypeptide I. The resulting adaptorligated cDNAs were 50-fold diluted and amplified by PCR
(94C for 1 min, 45C for 1 min, 67C for 2 min) in the presence of primers A and B. After 35 cycles of PCR ampilification,
1 l PCR products were used as a template for second (nested)
PCR, with the sense primer C corresponding to N-terminal
amino acids 13220 and the antisense primer D, positions 102
17 of cyanogen-bromide-cleaved polypeptide II. The ampilified
DNA products were cloned into the pGEM T-easy vector and
sequenced in both directions by the dideoxy chain termination
method [21] with Sequenase, version 2.0 DNA sequencing kit.
Full-length cDNA was obtained by 5 rapid amplification of
cDNA ends (RACE) and 3-RACE [22] (Fig. 5). For 5-RACE,
double-stranded cDNAs with adaptors were subjected to PCR
(94C for 1 min, 50C for 2 min, 67C for 2 min) using adaptor
primer 1 (AP1) and the antisense primer D. The first PCR products were subjected to nested PCR by adaptor primer 2 (AP2)
and a gene-specific primer 2 (GSP2) (complementary to nucleotides 4542477). The nested PCR-amplified DNA fragment was
cloned into pGEM T-easy vector and sequenced. For 3-RACE,
the adaptor-ligated cDNAs were subjected to PCR using AP1
and sense primer C and the nested PCR was accomplished by
using AP2 and a gene-specific primer 1 (GSP1) (complementary

to nucleotides 1512174). After the fusion of corresponding 5RACE and 3-RACE fragments, full-length cDNA was cloned.
Expression and purification of recombinant sechiumin.
The expression plasmid was constructed by ligating a 821-bp
NdeI2NotI fragment (derived from sechiumin cDNA by PCR
with primer sec N, 5 GGAATTCCATATGGATATCAACTTCAATCTA 3 and primer sec C, 5 TATCAAATGCGGCCGCCCACATAGTAGTTTGATG 3) to the pET-21a expression
vector at NdeI2NotI cloning sites. The expression plasmid
(pET21a-sec) was transfomed into E. coli strain TG1, and the
insert of the positive clone was confirmed by sequencing analysis. For expression, the expression plasmid was introduced into
BL21(DE3), a host strain with the T7 RNA polymerase gene,
by CaCl2-mediated transformation. The transformants were
grown at 37C in Luria-Bertani medium containing ampicillin
(0.1 mg/ml) to an optical absorbance of 0.8 at 600 nm. After induction with 1 mM isopropyl thiogalactopyranoside at 25C for
2 h, the cells were harvested and the cell pellet was resuspended
in 5 mM imidazole binding buffer and lysozyme (0.2 mg/ml)
was added. The cells were lysed by freeze/thawing three times,
then treated with DNase/RNase. The pellet was collected by centrifugation and resuspended in binding buffer containing 6 M
urea and incubated at 4 C for 1 h. After removing insoluble
materials by centrifugation, the supernatant was applied to a

404

Wu et al. (Eur. J. Biochem. 255)

Fig. 6. Nucleotide sequence and deduced amino acid sequence of sechiumin cDNA. The first 21 amino acid residues (*) represent the N-terminal
signal sequence and the first amino acid residue of sechiumin, Asp, is boxed. A potential polyadenylation signal is underlined. The arrows indicate
the cyanogen-bromide-cleaved polypeptides I and II.

Ni21-immobilized resin column (1 ml), which was washed with

20 mM imidazole, 0.5 M NaCl and 20 mM Tris/HCl. pH 7.9 in
6 M urea, then eluted with 200 mM imidazole, 0.5 M NaCl and
20 mM Tris/HCl, pH 7.9, in 6 M urea. The recombinant protein
was gradually dialyzed in 10 mM sodium acetate, pH 5.5, to
remove urea and obtain biologically active protein.

RESULTS
Purification of sechiumin. After the extraction of sechiumin
from the seeds and fractionation with ammonium sulfate, the
dialyzate was subjected to Sephadex G-75 gel-filtration column
chromatography, and two protein peaks were detected (Fig. 1 A).
The fractions containing sechiumin were found by its inhibitory
effect on the protein synthesis of rabbit reticulocyte lysate. The
active fractions were subjected to carboxymethyl-52 cellulose
column chromatography and four major protein peaks were obtained. Peak 4 containing the protein synthesis inhibitory activity
(Fig. 1 B) was further fractionated with a Mono S column
(50 mm316 mm) and peak 5 from the Mono S column was
active against protein synthesis of rabbit reticulocyte lysate
(Fig. 1 C). Table 1 summarizes the results of a typical purification of sechiumin. About 3.1 mg sechiumin was purified from
400 g seeds. The purified sechiumin showed a single band
(Fig. 2, lane 4) with an apparent molecule mass of 27 kDa in
SDS/PAGE analysis. From isoelectric focusing electrophoresis

of sechiumin using a polyacrylamide gel with ampholyte in the

range pH 3.5210, the pI value of sechiumin was found to be
8.4 (data not shown).
RNA N-glycosidase and protein biosynthesis inhibitory activities. The inhibitory effect of sechiumin on protein biosynthesis
was determined with a rabbit reticulocyte lysate cell free system.
The IC50 of sechiumin was estimated to be 0.7 nM, while that
of abrin A chain was 0.1 nM (Fig. 3 A). The RNA N-glycosidase
activity of sechiumin was measured by treating rat liver ribosomes with sechiumin and analyzing the reaction products of
rRNAs by polyacrylamide gel electrophoresis. The depurination
of adenine base at position 4324 of 28S rRNA [23, 24] occurred
as indicated by the appearance of a new RNA fragment of 420
nucleotides after the sechiumin-treated rRNAs had reacted with
aniline (Fig. 4).
Cytotoxicity of sechiumin. After the HeLa cells had been
treated with sechiumin for 18 h, the cells were further cultured
in leucine-free medium containing [3H]leucine for 1 h, and the
amounts of [ 3H]leucine incorporated were measured. Sechiumin
showed a very weak toxicity towards intact HeLa cells and required 5000 nM sechiumin to cause 50% inhibition of protein
synthesis (Fig. 3 B), while abrin, a type-II RIP, had a very strong
toxicity with an IC 50 of 0.01 nM. Abrin A chain possessed a
very weak toxicity to intact cells with an IC50 of 5000 nM.

Wu et al. (Eur. J. Biochem. 255)

405

Fig. 7. Comparison of deduced amino acid sequence of sechiumin (SEC) with several type-I RIPs and the A chains of type-II RIPs. The
amino acid sequence of abrin A chain (ABR), ricin A chain (RIC), Ricinus communis agglutinin (RCA), luffin-a (LUFa), momordin (MOM),
trichosanthin (TRI), pokeweed antiviral protein-S (PAP), Mirabilis antiviral protein (MAP), saporin (SAP), barley translation inhibitor (BAR) and
sechiumin were arranged to their similarities. The completely conserved residues are boxed, while the highly conserved hydrophobic and positively
charged residues are marked by asterisks (*) and plus (1), respectively.

Cloning of sechiumin cDNA. From the seeds of young edible

gourd, total RNA and poly(A)-rich mRNA were isolated, and
the cDNAs were synthesized from the poly(A)-rich mRNA by
reverse transcriptase. By the application of degenerate primers

based on the N-terminal amino acid sequence of sechiumin and

its cyanogen-bromide-cleaved polypeptides (Fig. 5), the specific
sequence of sechiumin cDNA was cloned (Fig. 6). The cDNA
had 951 bp and encoded a precursor protein of 285 amino acid

406

Wu et al. (Eur. J. Biochem. 255)

DISCUSSION

Fig. 8. The expression of sechiumin cDNA. (A) SDS/PAGE analysis

of recombinant sechiumin. M, molecular-mass markers, Lane 1, native
sechiumin, Lane 2, recombinant sechiumin. (B) Effects of recombinant
sechiumin on protein synthesis of a reticulocyte lysate cell-free system.
reSec, recombinant sechiumin.

residues. The analysis of the deduced amino acid sequence from

cDNA with the N-terminal sequence of purified sechiumin
showed that sechiumin cDNA encodes a signal peptide of 21
amino acid residues. Alignment of the deduced amino acid sequence of sechiumin cDNA with those of other type-I and typeII RIPs (Fig. 7) revealed that sechiumin contains 12 conserved
amino acid residues [25], including the amino acid residues at
the proposed active site (Glu160 and Arg163).
Expression of sechiumin cDNA. The open reading frame of
sechiumin cDNA was cloned into the pET-21a expression vector
and expressed in E. coli host strain, BL21(DE3). Most of recombinant sechiumin appeared as an insoluble form. The insoluble
proteins were dissolved in binding buffer containing 6 M urea
and retained with a Ni21-immobilized resin column. After elution with 200 mM imidazole, recombinant sechiumin was obtained, then dialyzed against 10 mM sodium acetate, pH 5.5, to
remove urea. The recombinant sechiumin was homogeneous
upon analysis by 12.5% SDS/PAGE. The molecular mass of recombinant sechiumin was estimated to be 30 kDa (Fig. 8A). The
biological activities of recombinant sechiumin were determined
by measuring its inhibitory effect on the protein synthesis of
rabbit reticulocyte lysate, and the IC 50 of recombinant sechiumin
was found to be 3 nM (Fig. 8 B). About 1 mg soluble recombinant sechiumin was obtained from 1 l induced E. coli culture.

In the present studies, a type-I RIP, sechiumin, from the

seeds of edible gourd, S. edule Swartz was purifed. Sechiumin
is a single polypeptide chain with a molecular mass of 27 kDa
(Fig. 2) and a pI of 8.4, similar to values of other type-I RIPs
[1, 26]. The IC50 of sechiumin for the inhibition of protein synthesis of rabbit reticulocyte lysate and intact HeLa cells is
0.7 nM and 5000 nM, respectively. Both sechiumin and abrin A
chain inhibited protein synthesis of the cell-free system in a
dose-dependent manner and their activities were very similar
(Fig. 3 A). In contrast, sechiumin and abrin A chain showed a
very low toxicity to cultured HeLa cells but a type-II RIP, abrin,
was found to be much more toxic (Fig. 3 B). These results are
consistent with the characteristics of type-I RIP that the inhibition of protein synthesis on intact cells was much lower than that
in cell free system. Sechiumin cleaved the N-glycosidic bond at
the A4324 of rat liver 28S rRNA, then released a 420-nucleotide
RNA fragment after treatment of the 28S rRNA with aniline, as
did abrin A chain (Fig. 4). Based on these studies, sechiumin is
classified as a type-I RIP [23, 24].
The cDNA encoding sechiumin was cloned, sequenced and
found to contain 951 nucleotides with an open reading frame of
855 nucleotides (Fig. 6). The nucleotide sequence codes for a
precursor of 285 amino acid residues including a putative signal
peptide of 21 amino acid residues. The sequence of the N-terminal 26 amino acid residues deduced from the cDNA was identical to that determined by N-terminal amino acid sequencing of
purified sechiumin. As in the most plant and animal mRNAs, a
consensus polyadenylation signal (AATAAA) was found.
The sechiumin cDNA was cloned and expressed in E. coli.
Since most recombinant sechiumin was insoluble, the insoluble
proteins were dissolved in binding buffer containing 6 M urea,
then purified with a Ni21-immobilized resin column. The molecular mass of recombinant sechiumin was approximately 30 kDa,
which is 3 kDa larger than the native sechiumin protein, as
shown by SDS/PAGE (Fig. 8 A). This difference is probably due
to the presence of a C-terminal region (Gly2472Trp264)
following the additional 11 amino acid residues containing six
His residues at the C-terminus of recombinant sechiumin. The
IC50 of recombinant sechiumin for the inhibition of protein synthesis of rabbit reticulocyte lysate was determined to be 3 nM
which is approximately fivefold weaker than that of native
sechiumin (Fig. 8B). The result consists with the investigation
reported by Shaw et al. [25], that the recombinant trichosanthin
containing 19 amino acids at the C-terminus is five times less
active than that possessing the mature trichosanthin sequence in
inhibiting protein synthesis by a rabbit reticulocyte lysate.
Alignment of the amino acid sequences deduced from the
cDNA of sechiumin with that of known RIPs reveals several
interesting features (Fig. 7). First, the C-terminal region
(Gly2472Trp264) of the deduced amino acid sequence of sechiumin is not present in most mature type-I RIPs. The post-translational processing of larger precursor by removal of the C-terminal region has been described in many species, such as trichosanthin [25] and saporin-6 [26]. The cDNA of these two type-I
RIPs encodes an extra C-terminal region containing 19 and 22
amino acid residues, respectively. Since the molecular mass of
native sechiumin is 27 kDa (theoretical value, 26 748 Da) while
that of recombinant sechiumin is 30 kDa (theoretical value,
30167 Da), it suggests that the post-translational modification
could happen in the mature sechiumin. Second, sechiumin has
nearly 60% similarity to several type-I RIPs purified from the
Cucurbitaceae family, such as luffin-a (62.5%), momordin
(53.8%), trichosanthin (64.8 %), but there is a lower similarity
to other type-I RIPs, such as the barley translation inhibitor

Wu et al. (Eur. J. Biochem. 255)

(20.4 %) and SAP (24.6 %). Third, sechiumin shared a similar

amino acid sequence at positions Ala1502Glu200 with all other
type-I or the A chain of type-II RIPs. This relatively well conserved region is assigned to be the active site of the enzyme [1,
27, 28]. It has been shown that two amino acid residues of ricin
A chain (Glu177 and Arg180) or abrin A chain (Glu164 and
Arg167), located at the well-defined cleft, are involved in the
catalytic activity [29, 30], and that these two amino acid residues
are Glu160 and Arg163 in sechiumin. Sechiumin also has two
tyrosine residues, Tyr71 and Tyr109, corresponding to the tyrosine residues of ricin A chain at positions 80 and 123, which are
involved in the interaction with A4324 of the eukaryotic 28S
rRNA [27, 29].
A major drawback in using type-II RIPs to inhibit the growth
of tumor cells is that they also bind to D-galactose present on
the surface of normal cells. Recently, there has been a growing
interest in using type-I RIPs as an alternative in immunotoxin
preparations, and it offers many advantages in the treatment of
several clinical diseases [31]. These type-I RIPs which are
linked to tumor-associated monoclonal antibodies, were trichosanthin isolated from the plant Trichosanthes kirilowii [32],
pokeweed antiviral proteins (PAP) isolated from the plant Phytolacca americana [33], saporin 6 purified from the plant Saponaria officinalis [34] and gelonin isolated from Gelonum
multiflorum [35]. When they were conjugated to a hepatomaassociated antibody, the trichosanthin immunotoxin had a 500fold higher inhibitory activity on the growth of tumor cells than
native trichosanthin, and was only 1 log lower than that of free
ricin [32]. When saporin was crosslinked to an anti-CD4 Ig, it
could kill CD41 cells effectively [31]. The other single-chain
RIP purified from Cucurbitaceae, momordin linked to monoclonal antibody 482127, recognized a glycoprotein (gp54) and was
more toxic to human bladder carcinoma cell lines than momordin itself [36]. The selective toxicity of these immunotoxins encourages further studies in view of a potential use in clinical
trials for the therapy of human diseases. Therefore, when sechiumin, is conjugated with specific monoclonal antibodies, it
might be a potential therapeutic agent for cancer chemotherapy.
This work was supported in part by a grant NSC-87-2314-B-002153 from the National Science Council, Republic of China.

REFERENCES
1. Stirpe, F., Barbieri, L., Battelli, M. G., Soria, M. & Lappi, D. A.
(1992) Ribosome-inactivating proteins from plants: present status
and future prospects, Biotechnology 10, 4052412.
2. Endo, Y., Mitsui, K., Motizuki, M. & Tsurugi, K. (1987) The mechanism of action of ricin and related toxic lectins on eukaryotic
ribosomes. The site and the characteristics of the modification in
28S ribosomal RNA caused by the toxins, J. Biol. Chem. 262,
590825912.
3. Endo, Y., Tsurugi, K. & Franz, H. (1988) The site of action of the
A chain of mistletoe lectin I on eukaryotic ribosomes. The RNA
N-glycosidase activity of the protein, FEBS Lett. 231, 3782
380.
4. Olsnes, S. & Pihl, A. (1973) Different biological properties of the
two constituent peptide chains of ricin, a toxic protein inhibiting
protein synthesis, Biochemistry 12, 312123126.
5. Olsnes, S. & Phil, A. (1982) Toxic lectins and related proteins, in
Molecular action of toxins and viruses (Cohen, P. & Van Heyningen, S., eds) pp. 512105, Elsevier Scientific Publishing Co.,
New York.
6. Barbieri, L. & Stirpe, F. (1982) Ribosome-inactivating proteins from
plants: properties and possible uses, Ca. Surveys 1, 4892520.
7. Vitetta, E. S. & Uhr, J. W. (1985) Immunotoxins, Annu. Rev. Immunol. 3, 1972212.

407

8. McGrath, M. S., Hwang, K. M., Caldwell, S. E., Gaston, I., Luk,

K., Wu, P., Ng, V. L., Crowe, S., Daniels, J., Marsh, J., Deinhart,
T., Lekas, P. V., Vennari, J. C., Yeung, H. W. & Lifson, J. D.
(1989) GLQ223: An inhibitor of human immunodeficiency virus
replication in acutely and chronically infected cells of lymphocyte
and mononuclear phagocyte lineage, Proc. Natl Acad. Sci. USA
86, 284422848.
9. Ready, M. P., Brown, D. T. & Robertus, J. D. (1986) Extracellular
localization of pokeweed antiviral protein, Proc. Natl Acad. Sci.
USA 83, 505325056.
10. Hong, Y., Saunder, K., Hartley, M. R. & Stanley, J. (1996) Resistance to geminivirus infection by virus-induced expression of dianthin in transgenic plants, Virology 220, 1192127.
11. Hung, C. H., Lee, M. C., Lee, T. C. & Lin, J. Y. (1993) Primary
structure of three distinct isoabrins determined by cDNA sequencing, J. Mol. Biol. 229, 2632267.
12. Thorpe, P. E., Brown, A. N. F., Ross, W. C. J., Cumber, A. J., Detre,
S. I., Edwards, D. C., Davies, A. J. S. & Stirpe, F. (1981) Cytotoxicity acquired by conjugation of an anti-Thy1.1 monoclonal antibody and the ribosome-inactivating protein, gelonin, Eur. J. Biochem. 116, 4472454.
13. Garren, L. D., Richardson, A. P. & Crocco, R. M. (1967) Studies
on the role of ribosomes in the regulation of protein synthesis in
hypophysectomized and thyroidectomized rats, J. Biol. Chem.
242, 6502656.
14. May, M. J., Hartley, M. R., Roberts, L. M., Krieg, P. A., Osborn, R.
W. & Lord, J. M. (1989) Ribosome inactivation by ricin A chain:
a sensitive method to assess the activity of wild-type and mutant
polypeptides, EMBO J. 8, 3012308.
15. Oda, T., Aizono, Y. & Funatsu, G. (1984) Binding and cytotoxicity
of Ricinus communis lectins to HeLa cells, Sarcoma 180 ascites
tumor cells and erythrocytes, J. Biochem. 96, 3772384.
16. Laemmli, U. K. (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T4, Nature 227, 6802
685.
17. Zacharius, R. M., Zell, T. E., Morrison, J. H. & Woodlock, J. J.
(1969) Glycoprotein staining following electrophoresis on acrylamide gels, Anal. Biochem. 30, 1482152.
18. Schgger, H. & von Jagow, G. (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa, Anal. Biochem. 166, 3682
379.
19. Sambrook, J., Fritsch, E. F. & Manitatis, T. (1989) Molecular cloning: a laboratory manual, 2nd edn, pp. 7.227.87, Cold Spring
Harbor Laboratory, Cold Spring Harbor New York.
20. Werner, D., Chemla, Y. & Herzberg, M. (1984) Isolation of poly(A)1
RNA by paper affinity chromatography, Anal. Biochem. 141,
3292336.
21. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) DNA sequencing
with chain-terminating inhibitors, Proc. Natl Acad. Sci. USA 74,
546325467.
22. Sekimoto, H., Seo, M., Dohmae, N., Takio, K., Kamiya, Y. & Koshiba, T. (1997) Cloning and molecular characterization of plant
aldehyde oxidase, J. Biol. Chem. 272, 15 280215 285.
23. Endo, Y. & Tsurugi, K. (1987) RNA N-glycosidase activity of ricin
A chain. Mechanism of action of the toxic lectin ricin on eukaryotic ribosomes, J. Biol. Chem. 262, 812828130.
24. Endo, Y. & Tsurugi, K. (1988) The RNA N-glycosidase activity of
ricin A chain. The characteristics of the enzymatic activity of ricin
A chain with ribosomes and with rRNA, J. Biol. Chem. 263,
873528739.
25. Zhu, R. H., Ng, T. B., Yeung, H. W. & Shaw, P. C. (1992) High
level synthesis of biologically active recombinant trichosanthin in
Escherichia coli, Int. J. Peptide Protein Res. 39, 77281.
26. Benatti, L., Nitti, G., Solinas, M., Valsasina, B., Vitale, A., Ceriotti,
A. & Soria, M. R. (1991) A saporin-6 cDNA containing a precursor sequence coding for a carboxyl-terminal extension, FEBS Lett.
291, 2852288.
27. Funatsu, G., Islam, M. R., Minami, Y., Sung-Sil, K. & Kimura, M.
(1991) Conserved amino acid residues in ribosome-inactivating
proteins from plants, Biochimie (Paris) 73, 115721161.
28. Barbieri, L., Battelli, M. G. & Stirpe, F. (1993) Ribosome-inactivating proteins from plants, Biochim. Biophys. Acta 1154, 2372
282.

408

Wu et al. (Eur. J. Biochem. 255)

29. Kim, Y. & Robertus, J. (1992) Analysis of several key active site
residues of ricin A chain by mutagenesis and X-ray crystallography, Protein Engineering 5, 7752779.
30. Hung, C. H., Lee, M. C., Chen, J. K. & Lin, J. Y. (1994) Cloning
and expression of three abrin A chains and their mutants derived
by site-specific mutagenesis in Escherichia coli, Eur. J. Biochem.
219, 83287.
31. Ramakrishnan, S., Fryxell, D., Mohanraj, D., Olson, M. & Li, B.
Y. (1992) Cytotoxic conjugates containing translational inhibitory
proteins, Annu. Rev. Pharmacol. Toxicol. 32, 5792621.
32. Wang, Q. C., Ying, W. B., Xie, H., Zhang, Z. C., Yang, Z. H. &
Ling, L. Q. (1991) Trichosanthin-monoclonal antibody conjugate
specifically cytotoxic to human hepatoma cells in vitro, Ca. Res.
51, 335323355.
33. Ramakrishnan, S. & Houston, L. L. (1984) Prevention of growth of
leukemia cells in mice by monoclonal antibodies directed against

Thy 1.1 antigen disulfide linked to two ribosomal inhibitors:

Pokeweed anti-viral protein or ricin A chain, Ca. Res. 44, 13982
1404.
34. French, R. R., Courtenay, A. E., Ingamells, S., Stevenson, G. T. &
Glennie, M. J. (1991) Cooperative mixtures of bispecific F(ab)2
antibodies for delivering saporin to lymphoma in vitro and in vivo,
Ca. Res. 51, 235322361.
35. Wawrzynczak, E. J., Cumber, A. J., Henry, R. V., May, J., Newell,
D. R., Parnell, G. D., Worrell, N. R. & Forrester, J. A. (1990)
Pharmacokinetics in the rat of a panel of immunotoxins made
with abrin A chain, ricin A chain, gelonin and momordin, Ca.
Res. 50, 751927526.
36. Battelli, M. G., Polito, L., Bolognesi, A., Lafleur, L., Fradet, Y. &
Stirpe, F. (1996) Toxicity of ribosome-inactivating proteins-containing immunotoxins to a human bladder carcinoma cell line, Int.
J. Cancer 65, 4852490.