Revista Mexicana de Fitopatologa

Sociedad Mexicana de Fitopatologa, A.C.

guillermofuentes_davila@hotmail.com

ISSN (Versin impresa): 0185-3309

MXICO

2005
Hugo Galindo Flores / Juan Carlos Martnez lvarez / Eusebio Nava Prez /
Raymundo Sal Garca Estrada / Ignacio Eduardo Maldonado Mendoza
A SAPROTROPHIC FUNGAL ISOLATE FROM NORTHERN SINALOA, MEXICO,
WITH HOMOLOGY TO MEMBERS OF THE CHAETOMIACEAE BEHAVES AS AN
ANTAGONIST OF PHYTOPATHOGENIC FUNGI IN VITRO
Revista Mexicana de Fitopatologa, julio - diciembre, ao/vol. 23, nmero 002
Sociedad Mexicana de Fitopatologa, A.C.
Ciudad Obregn, Mxico
pp. 130-139

Red de Revistas Cientficas de Amrica Latina y el Caribe, Espaa y Portugal

Universidad Autnoma del Estado de Mxico
http://redalyc.uaemex.mx

130 / Volumen 23, Nmero 2, 2005

A Saprotrophic Fungal Isolate From Northern Sinaloa, Mexico,

with Homology to Members of the Chaetomiaceae Behaves as an
Antagonist of Phytopathogenic Fungi in vitro
Hugo Galindo-Flores1, Juan Carlos Martnez-lvarez1, Eusebio Nava-Prez 1,
Raymundo Sal Garca-Estrada2, and Ignacio Eduardo Maldonado-Mendoza1,3,
1
Centro Interdisciplinario de Investigacin para el Desarrollo Integral Regional, Instituto
Politcnico Nacional, Unidad Sinaloa (CIIDIR-IPN-Unidad Sinaloa), Apdo. Postal 280,
km 1.0 Carr. Las Glorias, Guasave, Sinaloa, Mxico CP 81101; 2CIAD-Culiacn, Apdo.
Postal 32-A, km 5.5 Carr. Culiacn-El Dorado, Sucursal Palacio de Gobierno, Culiacn,
Sinaloa, Mxico CP 80129; 3Current Address: Boyce Thompson Institute for Plant
Research. Tower Rd. Ithaca, NY, USA 14853. Correspondence: iem3@cornell.edu.
(Received: November 19, 2004 Accepted: March 31, 2005)
Galindo-Flores, H., Martnez-lvarez, J.C., Nava-Prez, E.,
Garca-Estrada, R.S., and Maldonado-Mendoza, I.E. 2005.
A saprotrophic fungal isolate from northern Sinaloa, Mexico,
with homology to members of the chaetomiaceae behaves as
an antagonist of phytopathogenic fungi in vitro. Revista
Mexicana de Fitopatologa 23:130-139.
Abstract. An ascomycete was isolated from spore
preparations of arbuscular mycorrhizal fungi from soil
samples collected in northern Sinaloa, Mexico. This fungal
isolate named CIIDIR-1, is ubiquitous in soils of this
agricultural region. Only the asexual phase of CIIDIR-1 can
be cultured in vitro in different culture media. DNA extracted
from mycelium was used to amplify and sequence a 28S rDNA
hypervariable region, which allowed its identification as
related to members of the Chaetomiaceae family
(Aporothielavia leptoderma and members of the genus
Chaetomium). CIIDIR-1 showed a saprophytic behavior in
the presence of plant roots grown in vitro. Bioassays showed
that the isolate acts as an antagonist against phytopathogenic
fungi. When mycelium from the isolate was placed in contact
with Rhizoctonia solani and Fusarium oxysporum f. sp.
lycopersici, it proliferated, surrounded them and inhibited
their growth. The presence of CIIDIR-1 in all soil samples
evaluated suggests an important role in the rhizosphere; also,
the understanding of its interactions with plants and other
rhizospheric organisms might be important for future
ecological and agricultural studies.
Additional keywords: Aporothielavia leptoderma, 28S rDNA
hypervariable region, Rhizoctonia solani, Fusarium
oxysporum f. sp. lycopersici, antagonism.
Resumen. Se aisl un ascomiceto en el norte del estado de
Sinaloa, Mxico, a partir de preparaciones de esporas de

hongos micorrzicos arbusculares. Este aislamiento fngico

designado como CIIDIR-1, es ubicuo en suelos de esta
importante regin agrcola. CIIDIR-1 puede ser cultivado in
vitro solamente en su etapa asexual en diversos medios de
cultivo. Se utiliz DNA extrado de micelio para amplificar
y secuenciar una regin hipervariable del rDNA 28S, lo cual
permiti identificarlo como un organismo relacionado a los
miembros de la familia Chaetomiaceae (Aporothielavia
leptoderma y miembros del gnero Chaetomium). CIIDIR-1
mostr un comportamiento saproftico en presencia de races
vegetales desarrolladas in vitro. En bioensayos se mostr que
el aislamiento acta como antagonista contra otros hongos
fitopatgenos. Al poner en contacto el micelio de CIIDIR-1
con Rhizoctonia solani o Fusarium oxysporum f. sp.
lycopersici, ste prolifer alrededor de los fitopatgenos e
inhibi su crecimiento. Ya que CIIDIR-1 se encontr en todas
las muestras de suelo evaluadas, esto sugiere un papel
importante en la rizsfera; tambin, puede ser importante para
estudios futuros referentes al manejo agrcola y ecolgico,
as como para el entendimiento sobre sus interacciones con
plantas y otros organismos rizosfricos.
Palabras clave adicionales: Aporothielavia leptoderma,
regin hipervariable 28S rDNA, Rhizoctonia solani,
Fusarium oxysporum f. sp. lycopersici, antagonismo.
Guasave Valley in the state of Sinaloa, Mexico, is one of the
most prominent agricultural regions of the country. Diverse
factors such as water availability, crop management, and
technology, and soil quality contribute to obtain high crop
yields in this area. Nevertheless, several fungal
phytopathogenic diseases have been described affecting the
root system of commercial crops, such as tomato
(Lycopersicon esculentum Mill.) and pepper (Capsicum

Revista Mexicana de FITOPATOLOGIA/ 131

annuum L.), causing important economic losses due to their
devastating effect on crop production. One of these is root
rot disease, caused by a consortium of soil microorganisms
from which Fusarium oxysporum Schlechtend.:Fr. f. sp.
lycopersici (Sacc.) Snyder and Hansen and Rhizoctonia solani
Khn have been found consistently associated (Carrillo-Fasio
et al., 2003; Gonzlez-Chavira et al., 2002). Besides chemical
control, no biocontrol agents have been described that impact
several of the fungal components of this consortium. Soils
possess the biological capacity to restrict disease progression.
This phenomenon, termed general suppression, is conferred
by the overall activity of the microbial community resident
to the soil (Cook and Baker, 1983). The biotic and abiotic
factors that contribute to specific soil suppressiveness have
been elucidated for a number of plant pathogen systems (Amir
and Alabouvette, 1993; Weller et al., 2002). Mycoparasitic
fungi such as Trichoderma (Green et al., 1999) and
Gliocladium (Ortiz and Orduz, 2000) display antagonistic
mechanisms against phytopathogenic fungi. Biocontrol of
phytopathogenic fungi has been carried out using saprotrophic
fungi, bacteria (Whipps, 2001), or yeasts (El-Tarabily, 2004).
The key is the knowledge of the ecological interactions taking
place in soil and root environment. This can then be used to
predict the necessary conditions for biocontrol of
phytopathogenic fungi (Whipps, 2001). Information on the
physicochemical and biological components of the soils of
northern Sinaloa is still lacking. The microorganisms present
in the rhizosphere of these soils are basically unknown. Our
group has initiated the characterization and identification of
the fungal entities present in the rhizosphere of soils of
northern Sinaloa; as a result of this work, we have isolated a
chetomiaceous fungus, with potential use as a biological
control agent against root pathogens. In this paper, we report
the molecular identification, saprophytic behavior in the
presence of plant roots, and its antagonistic effect against
Fusarium oxysporum and Rhizoctonia solani.
MATERIALS AND METHODS
Purification of microsclerotia from soil samples.
Microsclerotia of the fungal isolate were obtained by wet
sieving and decanting, a method commonly used to isolate
arbuscular mycorrhizal fungi (AMF) from soil samples,
involving the passage of the soil through specific-size meshes
followed by differential centrifugation in sucrose
discontinuous gradients (Brundrett et al., 1996).
Microsclerotia were co-isolated with AMF spores due to their
similarities on size and shape. This fungal isolate was
denominated CIIDIR-1, and currently it is deposited in the
ceparium of CIAD-Culiacn and CIIDIR-IPN, Unidad
Sinaloa, Mexico.
Surface sterilization of microsclerotia and AMF spores.
Microsclerotia were treated with chloramine-T (2% w/v) and
Tween-20 (0.01% w/v) following several washes with sterile
distilled water. Microsclerotia were then treated overnight
with an antibiotic solution (50 mg gentamycin and 100 mg

streptomycin in 10 ml water), and washed three times with

abundant sterile distilled water. At this point, a mix of spores
of AMF and microsclerotia was obtained.
Quantitation and morphological identification of
microsclerotia in soil samples. Samples containing a mix of
AMF spores and microsclerotia were separated manually
under a stereoscope using a fine paint brush, and spores (and
microsclerotia) were subdivided according to color
morphotypes. One of the subsamples was denominated BM
for black morphotype, which was conformed by a mix of
black AM spores and microsclerotia. BM subsamples were
kept for two months at 4C in 1 mL of sterile water in
microcentrifuge tubes. The abundance of microsclerotia
compared to black AMF spores in BM subsamples was
determined by visual inspection under the stereoscope.
Calculated microsclerotia levels were expressed as
microsclerotia per kilogram of soil analyzed. Sample numbers
and names included in Table 1 are those of a current database
containing information on these soil samples (MartnezAlvarez, 2003; launching of website in preparation).
Confirmation of the identity of the microsclerotia was done
by PCR amplification and sequencing as described below.
In vitro growth of the fungal isolate CIIDIR-1. The purified
mix of AMF spores/microsclerotia were transferred to multicell dishes using minimal M medium (Bcard and Fortin,
1988) as substrate, and containing 10 g L-1 of sucrose and 4 g
L-1 of gellan gum. They were germinated into an enriched
CO2 (2%) atmospheric chamber in darkness at 20-23C. The
fungal isolate grew profusely under these conditions and after
one week, this fungus formed microsclerotia in the multi-cell
dishes. A piece of agar medium (0.8 cm in radius) containing
mycelium and microsclerotia were used as inoculum to
propagate the fungus in Petri dishes containing M medium.
Molecular identification of the fungal isolate. DNA was
extracted from mycelium and microsclerotia obtained in vitro,
or from soil samples, using plant DNAzol reagent (Invitrogen
Cat. No. 10978-021 Carlsbad, California, USA). A
hypervariable region from the 28S rDNA region was amplified
by PCR using the primer set LSU 0061/LSU0599 (Kjller
and Rosendahl, 2000). PCR conditions were an initial step
of 95C for 3 min, denaturing at 95C for 30 sec, annealing at
55C for 30 sec, and elongation at 72C for 30 sec, and a
total of 30 cycles. Final elongation was 72C for 5 min. The
amplification product was then cloned into the pGEM-T easy
vector (Promega, Cat. No. 157348, Madison, WI, USA), and
sequenced from both strands using an ABI Prism 310
sequencer. Sequences were compared using the BLAST-N
program (NCBI) with the GenBank database.
Growth of the fungal isolate CIIDIR-1 on sterile tomato
plantlets and hairy root cultures. Tomato seeds were surface
sterilized and grown in Whatman 1 wet paper placed inside
Petri plates under sterile conditions for ten days. Then, they
were transferred to Petri dishes containing M medium pH
5.5. Plugs of M medium (0.8 cm in diameter) containing
mycelium and microsclerotia of isolate CIIDIR-1 (3 weeks

132 / Volumen 23, Nmero 2, 2005

Table 1. Number of microsclerotia of CIIDIR-1 fungal isolate on soils from Guasave,
Sinaloa, Mexico.
UTM
UTM
Sample number and namew
Coordinates Coordinates Microesc./ Morph.
(West)x
(North)
kg soily
(%)z
10. Callejones de Tamazula (surface) 756991
2816742
420
28
14. Cruz Blanca (surface)
763689
2841517
468
49
16. El Amole (surface)
757582
2810885
2852
31
17. El Coyote (1 m)
733922
2853389
353
47
21. El Varal (surface)
759045
2838085
1196
52
23. Estacin Naranjo (surface)
753515
2856375
1020
60
32. Las Lichis (1 m)
760119
2839808
714
34
40. Portugus de Glvez (1 m)
761384
2848348
848
53
41. Pozo Mezquitn (1 m)
742814
2828511
125
25
46. Santa Fe (surface)
737331
2836391
595
35
w
Surface (0-30 cm) and 1 m (90 to 120 cm) indicates the depth at which the samples were
taken from the soil.
x
The positioning of the sampling points is given on UTM coordinates.
y
Microsclerotia per kilogram of soil.
z
Percentage of microsclerotia from the total mix of AMF spores and microsclerotia from
the black morphotype.
old) were placed surrounding the root system. Two-week old
hairy root cultures of carrot [Daucus carota subsp. sativus
(Hoffm.) Arcang.] and tomato growing on M solid medium
in Petri plates, were inoculated with plugs containing
mycelium and microsclerotia of isolate CIIDIR-1 (two-weeks
old), as described above. Fungal growth was monitored at
one week post-inoculation for the tomato experiment, and at
one and four weeks post-inoculation for the hairy root
experiment.
Fungal strains. Endemic strains of Rhizoctonia solani and
Fusarium oxysporum f. sp. lycopersici (Carrillo-Fasio et al.,
2003) were provided by the ceparium of CIAD-Culiacn.
These are two aggressive strains of phytopathogenic fungi
and were used in antagonism experiments.
Staining of CIIDIR-1 isolate. Young root tissues were
cleared using 20% KOH, washed 4 times for 5 min at room
temperature with abundant distilled water. Tissues were rinsed
once again at room temperature for 5 min using 1X PBS buffer
(8 g of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4, and 0.24 g of
KH2PO4) at pH 7.4. Staining of the fungus was performed
using 10 L of 0.1 g L-1 wheat germ agglutinin conjugate
(WGA-488; Molecular Probes, Cat. No. W11261; Eugene,
OR, USA) in 100 ml PBS pH 7.4. This is an antibody that
specifically stains sialic acid residues from the fungal walls.
Tissues were incubated overnight at 4C and the staining was
visualized using fluorescence microscopy.
Mycelium extract preparation. CIIDIR-1 was grown for
one week on a 500 ml Erlenmeyer flask containing 100 mL
of M liquid medium at 28C on an orbitary shaker (250 rpm).
Mycelium was collected, frozen, and pulverized on a mortar
in fresh M medium. Final concentration of mycelium was
1% w/v. The extract was filter-sterilized by passing the

homogenate through a 0.2 M Millipore filtration unit.

Antagonism bioassays. Two types of experiments were set
up: 1) Co-inoculation of plates with phytopathogenic and
antagonistic fungi. This first type of experiment involved two
subexperiments: A) one 8 mm agar disc containing the
phytopathogen inoculum was placed in the center of the plate,
while two 8 mm paper discs containing either 100 L of water,
fungal extract (1% w/v), fungicide (3 g L-1), or 8 mm agar
discs containing CIIDIR-1. They were set up on opposite sides
of the plates at 0.5 cm from the edges. The commercial
fungicide TIMSEN (United Promotions Inc. Atlanta, GA,
USA, active ingredient n-alkyl dimethyl benzyl ammonium
chloride 3% w/w) was utilized as a control in antagonistic
experiments. Based on dose-response experiments of
TIMSEN on R. solani and F. oxysporum (data not shown), a
concentration of 3 g L-1 of the powder was used in subsequent
experiments. B) Another set of plates were done inoculating
the phytopathogen on opposite sides of the plates from 0.5
cm to the edges, and one disc containing the different
treatments (water, fungal extract, fungicide, and CIIDIR-1)
in the center of the plate (Fig. 1). Growth of the
phytopathogens in the first set of plates was calculated by
measuring the diameter of their mycelium, and in the second
set of plates by measuring the length of the mycelial growth
from the middle of the disc towards the center of the plate.
Each of these experiments was performed twice with each
phytopathogen using three replicate plates obtaining similar
results in each experiment. Both experiments were done using
PDA plates and incubated at 23C. 2) Inoculation of
phytopathogens on a CIIDIR-1 mycelium net. To gain insight
on the mechanisms of growth inhibition of the pathogens and
to analyze the response of CIIDIR-1 to physical contact with

134 / Volumen 23, Nmero 2, 2005

1
5
61
65

agcatatcaataagcggaggaaaagaaaccaacagggattgccctagtaacggcgagtga
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
agcatatcaataagcggaggaaaagaaaccaacagggattgccctagtaacggcgagtga

60
64

agcggcaacagctcaaatttgaaatctggcctcggcccgagttgtaatttgTagaggaag 120
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
agcggcaacagctcaaatttgaaatctggcctcggcccgagttgtaatttgcagaggaag 124

121 ctttaggcgcggcaccTTctgagtcTccctggaacggggcgccatagagggtgagagccc 180

|||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||
125 ctttaggcgcggcaccaactgagtc-ccctggaacggggcgccatagagggtgagagccc 183
181 cgtatagtCggaTgcctagcctgtgtaaagctccttcgacgagtcgagtagtttgggaat 240
|||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||
184 cgtatagttggacgcctagcctgtgtaaagctccttcgacgagtcgagtagtttgggaat 243
241 gctgctcaaaatgggaggtaaatttcttctaaagctaaataccggccagagaccgatagc 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
244 gctgctcaaaatgggaggtaaatttcttctaaagctaaataccggccagagaccgatagc 303
301 gcacaagtagagtgatcgaaagatgaaaagcGctttgGaaagagggttaaatagcacgtg 360
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||
304 gcacaagtagagtgatcgaaagatgaaaagcactttgaaaagagggttaaatagcacgtg 363
361 aaattgttgaaagggaagcgcttgtgaccagacttgcgccgggcTgatcatccggtgttc 420
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
364 aaattgttgaaagggaagcgcttgtgaccagacttgcgccgggcggatcatccggtgttc 423
421 tcaccggtgcactcTgcccggctcaggccagcatcggttctcgcggggggaCaaaggCcc 480
|||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||
424 tcaccggtgcactccgcccggctcaggccagcatcggttctcgcggggggataaaggtcc 483
481 TgggaacgtagctcctccgggagtgttatagcccAgggcgCaatgccctcgcggggaccg 540
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||
484 cgggaacgtagctcctccgggagtgttatagcccggggcgtaatgccctcgcggggaccg 543
541 aggttcgcgc-tctgcaaggatgctggcgtaatggtcatcagcgacccgtcttgaaacac 599
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
544 aggttcgcgcatctgcaaggatgctggcgtaatggtcatcagcgacccgtcttgaaacac 603
600 ggacca 605
||||||
604 ggacca 609

Fig. 3. Sequence comparison of the fungal isolate CIIDIR-1 and Aporothielavia leptoderma.
The top sequence corresponds to CIIDIR-1 fungal isolate and the bottom sequence from A.
leptoderma. Primers used at the 5 and 3 ends of the fragment are shown in bold. Mismatches
between CIIDIR-1 and the A. leptoderma sequence are shown in upper cases and bold on the
CIIDIR-1 sequence. Sequence alignment was performed using the Blast 2 sequences program
from NCBI (Tatusova and Madden, 1999).
throughout this study (different common nutrient media such
as M, PDA, MS (Murashige and Skoog, 1962), and V8 were
tested, in addition to different pH and cold and heat treatments
[data not shown]). No differences in length or sequence were
observed between the PCR products obtained from fungal
material isolated from soil or in vitro. This confirmed that
the microsclerotia obtained from soil samples and germinated
microsclerotia in water, are from the same fungus as the one

isolated in vitro.
CIIDIR-1 forms microsclerotia when cultured in vitro.
CIIDIR-1 microsclerotia survived the surface sterilization
protocol used to sterilize AMF spores and grew on minimal
M medium. The fungus grew profusely in rich nutrient media
such as PDA (Fig. 2D) or MS, and less in minimal M medium
(Fig. 2C). Microsclerotia remained clear while developing
(Fig. 2A) and acquired a dark coloration when they reached

136 / Volumen 23, Nmero 2, 2005

7

3.5

Mycelium length (cm)

Mycelium length (cm)

3
2.5
2
1.5
1
0.5

6
5
4
3
2
1
0

0
0

days post inoculation

3.5

Mycelium length (cm)

Mycelium length (cm)

days post inoculation

3
2.5
2
1.5
1
0.5

8
7
6
5
4
3
2
1
0

0
0

days post inoculation

days post inoculation

Fig. 5. Effect of CIIDIR-1 isolate on mycelium growth of Fusarium oxysporum f. sp. lycopersici and Rhizoctonia solani. A)
Type 1A experiment with F. oxysporum; B) Type 1B experiment with F. oxysporum; C) Type 1A experiment with R. solani, D)
Type 1B experiment with R. solani. Open circles refer to water control samples; open diamonds to fungicide (TIMSEN); closed
squares to intact CIIDIR-1 fungal isolate; and closed triangles to aqueous extracts of CIIDIR-1 mycelium.

experiment. Similar results were observed for the slower

growing F. oxysporum f. sp. lycopersici after 8 days cocultivation (Figs. 5A and B). The percentage of inhibition
compared to the negative control was 59.78 and 50% for
experiments A and B, respectively, at the end of the
experiments. These results obtained at day 4 and day 8 of
growth for R. solanii and F. oxysporum f. sp. lycopersici,
respectively, are statistically different (ANOVA) with a degree
of significance of 0.05 to the negative and positive control
treatments (data not shown). The addition of CIIDIR-1
aqueous extract had no inhibitory effect on any of the
experiments made. In fact, in one of the experiments (Type
1A, R. solani), a slight enhancement on growth at two and
three days post inoculation was observed compared to the
intact fungus (Fig. 5C).
Mycelium of the fungal isolate CIIDIR-1 responds to
physical contact with phytopathogenic fungi. The response
of CIIDIR-1 mycelium net to the presence of the
phytopathogenic fungi was the production of halos of profuse
mycelium growth surrounding both R. solani and F.

oxysporum f. sp. lycopersici (Fig. 6A-D) and the restriction

of growth of these phytopathogens. Plugs of M medium or
mycelium from the plant symbiotic fungus G. intraradices
were used as negative controls and no effect on CIIDIR-1
mycelium net overgrowth was observed 4 days post
inoculation (Figs. 6E and F), or even two weeks after their
addition (data not shown). Quantitative results showed a
growth inhibition effect at day 4 for F. oxysporum f. sp.
lycopersici and R. solani. The percentage of growth inhibition
compared to the water control was of 50-60% and 40-50%
for F. oxysporum f. sp. lycopersici and R. solani, respectively.
These data support our hypothesis that CIIDIR-1 has an
antagonistic effect on the phytopathogenic fungi growth.
DISCUSSION
CIIDIR-1 fungal isolate might belong to the genus
Aporothielavia or Chaetomium. Molecular analysis of a 28S
rDNA hypervariable region suggests that the fungus isolated
in this work from soils of Guasave, Sinaloa in Mexico, may
belong to the species Aporothielavia leptoderma.

138 / Volumen 23, Nmero 2, 2005

propagation and dispersal mechanism for this fungal species.
Microsclerotia of CIIDIR-1 were semi-purified from the total
AMF spore preparations as forming part of the black spore
morphotype, which constitutes the most abundant AMF
morphotype in this region. Detailed studies of AMF
composition from these soils has shown that only two out of
75 different soil samples from this region do not contain spores
of this morphotype (Martnez-Alvarez, 2003), which suggests
its possible ubiquitous presence throughout the Guasave
valley. CIIDIR-1 might be an important component of the
rhizosphere and its microbial interactions, and it may
contribute to the soil suppressiveness of disease in these soils.
CIIDIR-1 behaves in vitro as a saprophyte in the presence
of roots. Observations made in vitro with hairy roots (Fig.
4A) and non-transformed roots of carrot and tomato (data
not shown), showed that CIIDIR-1 grows abundantly over
the roots without any sign of root penetration (Fig. 4D) when
they are young and alive. When the plant tissue aged, profuse
mycelium growth and formation of microsclerotia was
observed on the decaying roots (Figs. 4B and C). CIIDIR-1
most probably behaves saprotrophically in vivo. This would
explain its widespread distribution throughout the valley. C.
globosum, one of the fungi with close homology to the 28S
rDNA region of CIIDIR-1, has been described as a
saprotrophic growing fungus. C. globosum, when grown on
aeroponics, does not invade the root tissue and interacts only
with the epidermis and never invades the exodermis. In MS
agar (Murashige and Skoog, 1962), C. globosum is able to
grow not only in the epidermis, but also in the exodermis and
cortical cells. The main difference between root tissues
growing under these two conditions is the formation of an
exodermis with Casparian bands and complete suberin
lamellae under aeroponics conditions. This suggests an
inhibitory role of the exodermis for the establishment of a
plant-pathogen association (Reissinger et al., 2003). It is still
not known if there is a similar mechanism for root protection
against invasion by CIIDIR-1, and will need to be addressed
in the future.
CIIDIR-1 behaves as an antagonist of root rot fungi.
CIIDIR-1 fungal isolate showed an antagonistic effect on F.
oxysporum f. sp. lycopersici and R. solani in in vitro bioassays.
The immediate response of CIIDIR-1 mycelium to the
presence of the phytopathogens was exacerbated growth
surrounding and limiting growth of the pathogenic fungi (Fig.
6). Competition for carbon, nitrogen, and iron has been shown
to be a mechanism associated with biocontrol or suppression
of Fusarium wilt in several systems by non-pathogenic
Fusarium and Trichoderma species (Couteaudier, 1992;
Mandeel and Baker, 1991; Sivan and Chet, 1989) and
competition for thiamine factors into the control of
Gaeummanomyces graminis (Sacc.) Arx and D. Olivier var.
tritici J. Walker by a sterile red fungus in the rhizosphere of
wheat (Triticum aestivum L.) (Shankar et al., 1994). It is
possible that CIIDIR-1 might use a similar antagonistic
mechanism. Chaetomium globosum shows antagonism to

other fungi involved in root diseases, including Fusarium

culmorum (W.G. Sm.) Sacc. (Knudsen et al., 1995) and
Pythium ultimum Trow (Di Pietro et al., 1992). The
mechanism that this Chaetomium species uses, involves the
production of antibiotic substances (Di Pietro et al., 1992;
Hubbard et al., 1982). This does not seem to be the mechanism
that CIIDIR-1 isolate uses, since aqueous extracts of the
mycelium did not seem to inhibit growth of the
phytopathogens (Fig. 5). Nevertheless, the antagonistic
mechanism used by this fungus remains to be elucidated.
Further experiments in vitro, in pots, and in the field are
currently underway to discover if the effect observed in vitro
has any relevance in vivo. CIIDIR-1 has the potential to be
used as a biocontrol agent to prevent root rot disease. This is
especially relevant for horticultural crops that involve
germination in the greenhouse and further transfer of plantlets
to soil, since the fungus could be established on the root
system in the greenhouse. This would create a mycelial net
that would help prevent the infection of roots with
phytopathogens.
Acknowledgements. The authors thank Dr. Melina LopezMeyer and Megan Ackerman for the critical review of this
manuscript; and the support received by IPN (CGPI20020546), CECyT-Sinaloa (2002, and 2003) and UNESCO
(MEX200606).
LITERATURE CITED
Amir, H., and Alabouvette, C. 1993. Involvement of soil
abiotic factors in the mechanisms of soil suppressiveness
to Fusarium wilts. Soil Biology and Biochemistry 25:157164.
Andrews, J., Berbee, F., and Nordheim, E.F. 1983. Microbial
antagonism to the imperfect stage of the apple scab
pathogen, Venturia inaequalis. Phytopathology 73:228234.
Bcard, G., and Fortin, J.A. 1988. Early events of vesiculararbuscular mycorrhiza formation on Ri T-DNA
transformed roots. New Phytologist 108:211-218.
Brundrett, M., Bougher, N., Dell, B., Tim, G., and Nick, M.
1996. Working with mycorrhizas in forestry and
agriculture. Australian Centre for International Agricultural
Research. Canberra, Australia. 374 p.
Carrillo-Fasio, J., Montoya-Rodrguez, T., Garca-Estrada,
R., Cruz-Ortega, J., Mrquez-Zequera, I., and SaudoBarajas, A. 2003. Races of Fusarium oxysporum f. sp.
lycopersici Snyder and Hansen, in tomato (Lycopersicon
esculentum Mill.) in the valley of Culiacan, Sinaloa,
Mexico. Revista Mexicana de Fitopatologa 21:123-127.
Cook, R., and Baker, K. 1983. The Nature and Practice of
Biological Control of Plant Pathogens. American
Phytopathology Society, St. Paul, Minnesota, USA. 539
p.
Couteaudier, Y. 1992. Competition for carbon in soil and
rhizosphere, a mechanism involved in biological control

Revista Mexicana de FITOPATOLOGIA/ 139

of Fusarium wilts. pp. 99-104. In: E.C. Tjanos, A.C.
Papavizas, and R.J. Cook (eds.). Biological Control of
Plant Diseases. Plenum Press. New York, USA. 462 p.
Di Pietro, A., Gut-Rella, M., Pachlatko, J., and Schwinn, F.
1992. Role of antibiotics produced by Chaetomium
globosum in biocontrol of Phytium ultimum, a causal agent
of damping off. Phytopathology 82:131-135.
El-Tarabily, K.A. 2004. Suppression of Rhizoctonia solani
diseases of sugar beet by antagonistic and plant growthpromoting yeasts. Journal of Applied Microbiology 96:6975.
Gonzlez-Chavira, M., Torres-Pacheco, I. y GuzmnMaldonado, H. 2002. Patgenos involucrados en la
marchitez del chile. Proceedings of the 16th International
Pepper Conference: Tampico, Tamaulipas, Mexico. pp.
25-28.
Green, H., Larsen, J., Olsson, P.A., Jensen, D.F., and
Jakobsen, I. 1999. Suppression of the biocontrol agent
Trichoderma harzianum by mycelium of the arbuscular
mycorrhizal fungus Glomus intraradices in root-free soil.
Applied and Environmental Microbiology 65:1428-1434.
Hubbard, J., Harman, G., and Eckenrode, C. 1982. Interaction
of a biological control agent, Chaetomium globosum, with
seed coat microflora. Canadian Journal of Microbiology
28:431-437.
Kjller, R., and Rosendahl, S. 2000. Detection of arbuscular
mycorrhizal fungi (Glomales) in roots by nested PCR and
SSCP (Single Stranded Conformation Polymorphism).
Plant and Soil 226:189-196.
Knudsen, I., Hockenhull, J., and Jensen, D. 1995. Biocontrol
of seedling diseases of barley and wheat caused by
Fusarium culmorum and Bipolaris sorokiniana: Effects
of selected fungal antagonists on growth and yield
components. Plant Pathology 44:467-477.
Malloch, D., and Cain, R. 1973. The Genus Thielavia.
Mycologia 65:1055-1077.
Mandeel, Q., and Baker, R. 1991. Mechanisms involved in
biological control of Fusarium wilt on cucumber with
strains of non-pathogenic Fusarium oxysporum.
Phytopathology 81:462-469.
Martnez-Alvarez, J.C. 2003. Identificacin Molecular de
Hongos Micorrzicos Arbusculares (HMAs) y Hongos
Asociados en Suelos del Norte de Sinaloa. Tesis de
Maestra en Ciencias en Recursos Naturales y Medio
Ambiente. Instituto Politcnico Nacional. CIIDIR-IPN
Unidad Sinaloa. Guasave, Sinaloa, Mexico. 78 p.
Murashige, T., and Skoog, F. 1962. A revised medium for

rapid growth and bioassays with tobacco tissue cultures.

Physiologia Plantarum 15:473-497.
Ortiz, A., and Orduz, S. 2000. In vitro evaluation of
Trichoderma and Glyocladium antagonism against the
symbiotic fungus of the leaf-cutting ant Atta cephalotes.
Mycopathologia 150:53-60.
Pereira, J., and Dhingra, O. 1997. Suppression of Diaporthe
phaseolorum f. sp. meridionalis in soybean stems by
Chaetomium globosum. Plant Pathology 46:216-223.
Reissinger, A., Winter, S., Steckelbroeck, S., Hartung, W.,
and Sikora, R.A. 2003. Infection of barley roots by
Chaetomium globosum: evidence for a protective role of
the exodermis. Mycological Research 107:1094-1102.
Shankar, D., Kurtbke, D., Gillespie-Sasse, L., Rowland, C.,
and Sivasithamparam, K. 1994. Possible roles of
competition for thiamine, production of inhibitory
compounds and hyphal interactions in suppression of the
take-all fungus by a sterile red-fungus. Canadian Journal
of Microbiology 40:478-483.
Sivan, A., and Chet, I. 1989. The possible role of competition
between Trichoderma harzianum and Fusarium
oxysporum on rhizosphere colonization. Phytopathology
79:198-203.
Suh, S., and Blackwell, M. 1999. Molecular phylogeny of
the cleistothecial fungi placed in Cephalothecaceae and
Pseudeurotiaceae. Mycologia 91:836-848.
Untereiner, W., Dbois, V., and Naveau, F. 2001. Molecular
systematics of the ascomycete genus Farrowia
(Chaetomiaceae). Canadian Journal of Botany 79:321-333.
Tatusova, T.A., and Madden, T.L. 1999. Blast 2 sequences-a
new tool for comparing protein and nucleotide sequences.
FEMS Microbiology Letters 174:247-250.
Von Arx, J. 1975. On Thielavia and some similar genera of
the Ascomycetes. Studies in Mycologia 8:1-31.
Von Arx, J. 1987. A re evaluation of the Eurotiales. Persoonia
13:273-300.
Von Arx, J., Guarro, J., and Figueras, M. 1986. The
Ascomycete genus Chaetomium. Nova Hedwigia 84:1162.
Weller, D.M., Raaijmakers, J.M., Gardener, B.B.M., and
Thomashow, L.S. 2002. Microbial populations responsible
for specific soil suppressiveness to plant pathogens. Annual
Review of Phytopathology 40:309-348.
Whipps, J.M. 2001. Microbial interactions and biocontrol in
the rhizosphere. Journal of Experimental Botany 52:487511.