Volume 278, number 1, 91-94 FEBS 09314

0 1991 Federation of European Biochemical Societies 00145793/91/$3.50

ADONS 001457939100029V
January 1991
The family of human Na,K-AT&se genes
A TPLUJ gene is transcriptionally competent and probably encodes the related ion
transport ATpase
N.N. Msdyanov, K.E. Petrukhin, V.E. Sverdlov, A-V. Grishin, M.Y. Orlova, MB. Kostina,
0.1. Makarevich, N.E. Broude, G.S. Monastyrskaya and E.B. Sverdlov
Sitemyakin Institute of Bioorganic Chemistry, USSR Academy of Sciences, GSP-7 V-437 I1 7871, Moscow, USSR
Received 15 November 1990
The multigene family of human Na,K-ATPase is composed of 5 u-subunit genes, 3 of which were shown to encode the functionally active al,
a2 and a3 isoforms of the catalytic subunit. This report describes the isolation, mapping and parM sequencing of the fourth gene (rP TPI ALI )
that was demonstrated here to be functionally active and expressed in human brain and kidney. Limited DNA sequencing OF the ATPI ALI exow
allowed one to suggest that the gene probably encodes a new ion transport ATPase rather than an isoform of the Na,K-ATPase or the closely
related F&K-ATPase.
1, INTRODUCTION
Na+,K+-ATPase; Ion transport ATPase; Gene family; Wuman genome
Na+,K+-activated adenosia,: triphosphatase is an in-
tegral membrane protein that transduces the energy
from the hydrolysis of ATP into a gradient for Na+ and
K across the cell membrane. The enzyme molecule
consists of the catalytic ru-subunit and glycosylated ,&
subunit of unknown function. As of now, 5 a-subunit
genes and one closely related gene for the catalytic
subunit of H,K-ATPase were identified in the human
genome [1,2]. Three of the Na,K-ATPase u-subunit
genes encoding the crl, ~2 and ru3 isoform were shown
to be expressed in a variety of human and animal
tissues (for review see [S]). The functional status of the
remaining two genes designated as ATPlALl and
ATFlAL2 [4] was still unknown. Were we report the
data on cloning, mapping and partial sequencing of
ATPZALl. In addition, we present results indicating
that A TPlALZ is a new functionally active member of
the Na,K-ATPase gene family and expressed in the
human brain and kidney,
chromosome walking, high-stringency hybridization was performed
at 65C as described [9]. Phage DNAs of hybridizable clones were
isolated according to the procedure of Yamamoto [lo] and mapped
for &oRI and HindlIl sites, combining the double digestion method
[6] and the technique of partial digestion [!!I. The exon-containing
fragments of ,the phage inserts were identified after the low-
stringency hybridization with pig kidney cDNA [12] at SSC!. The
cDNA-hybridizable fragments were subcloned into Ml3mplg and se-
quenced by the method of Sanger [13]. The poly(A*)-fraction of total
cellular RNA was isolated from frozen human tissues as previously
described [14]. The random-primed cDNA was generated from 0.5 pg
of the poly(A)-RNA following the standard technique [6] and one-
tenth of the synthesized cDNA was subjected to 25-30 cycles of en-
zymatic amplification [IS] at 94OC, 1 min; 4gC, 1.5 min; and 72C,
2 min, using the AGATTCCGAGAAGAAGACCA and
GCTGGGGCTCAGACTCCCCCGTGAGA oligonucleotides as
gene-specific primers. The PCR product was analyzed by elec-
trophoresis on 8% polyacrylamide gels [6], followed by transferring
to Mybond N membranes (Arnersham, England) and low-stringency
hybridization with a pig kidney cDNA probe. The part of the PCR
product was cloned to the undephosphorylated SmaI-cut Mlfmplg
and sequenced by the dideoxy method [13].
2. EXPERIMENTAL
Genomic DNA was isolated from the human sperm [g] partially
digested with Suu3A [fi] and fractionated by NaCl gradient cen-
trifugation [S]. Fractions containing 15-23 kb in length were used for
cloning in the AEMBL3 vector according to [7]. To make a
Correspondence address: K.E. Petrukhin, Shemyakin InStitUte of
Bioorgamc Chemistry, USSR Academy of Sciences, GSP-7 V-437
11787 1, Moscow, USSR
Published by Elsevier Science Publishers B. V. (Biomedical Division)
The ATplALl gene was described as a member of
the human Na,K-ATPase gene family under the names
of aNKaSW3.2 [l] and LYD [2]. Sverdlov et al. [I], and
Shull and Lingrel [%] published the nucleotide sequence
of exons 6, 7 [2] and 9 Cl] as well as the partial physical
map of this gene [%]. The chromosomal location of
A TFlALl was determined by somatic cell hybrid map-
ping studies and assigned to,the human chromosome 13
[4]. The objective of tliis study was to clone and map
ATPlALl completely, and to determine whether the
gene is transcriptionally competent. To isolate the A
91
Volume 218, number 1 FEBS LETTERS January 1991
/
Giw13.2 ,
L
xsw 15
I
XSW3L
4 xsw14
xsw 21
,
I
1
:NKsSW 3 2
1.2 1.0
Fig. 1. Restriction enzyme map of the human ATPlALl gene. The gene is represented as a thick line in the middle of the figure, overlapping
inserts from the recombinant phages are shown above. Below the gene structure is a map for two restriction endonucleases with fragment sizes
indicated in kb.
phage inserts which encompass the entire A TPdALZ we
performed two steps of bidirectional chromosome
walking starting from the end fragments of the primary
clone ANKaSW3.2. The set of overlapping clones span-
ning more than 60 kb were characterized. Hybridiza-
tion analysis with the pig kidney cul cDNA probe
revealed that the gene itself is Z-30 kb in length. The
restriction enzyme map of the ATPlALl depicted in
Fig. 1 shows some differences when compared with
pdblished data 121. We failed to find the 2.2 and 0.6 kb
fragments which were positioned by Shull and Lingrel
between the 2.9 and 12.3 kb cDNA hybridizable
fragments. In addition, the locations of the 15th and
20th exons (Fig. 1) indicate that the ATPI ALl .is longer
than was presented earlier 121. DNA sequence analysis
of the h phage portions that hybridized with pig kidney
cul cDNA allowed us to determine the structtire of ex-
ons 5, 9 and 20, and part of the 15th exon, as well as
exons 6 and 7 which were sequenced by Shull and
Lingrel [Z] . The deduced amino acid sequences showed
65-75% homology for exons 5i 6 and 20, and 85-9OVo
homology for the highly conservative exons 9 and 9
when compared with the corresponding regions of cul,
CY~, and a3 isoforms, as well as with the c+subunit of
human M,K-ATPase. The degree of homology could be
sufficient to consider the putative ATPlALZ product
as an isoform of the satalytic subunit of either Na,K-
ATPase or H,K-ATPase, but several features of the
ATPlALZ nucleotide sequences caution against this
conclusion. Fig. 2A presents the comparison of amino
acid sequences encoded by the Sth, 6th and 20th exons
of the human genes for a*l, cu2, ru3 isoforms of Na,K-
ATPase, a-subunit of I-&K-ATPase and ATPI ALI .
The comparison revealed that the ~1, (~2, and CY~ se-
quences represent one class of homology exhibiting
abaut 90% identity, while the ATPlALl and I-I,K-
ATPase form a second class which is only ,7-69% _,
homologous when compared with human cul . In addi-
tion, the exon/intron boundary at the 3-end of the ex-
on 20 is identical for the M,K-ATPase g&e and
ATPI ALI but differs from the al, cu2, and a3 genes,
which have a three nucleotide (one amino acid) deletion
at that position (Fig. 2A). On the other hand, it is not
very likely that the A TPlALl represents the isoform of
the H,K-ATPase because the pairwise comparison of
the amino acid sequences encoded by exons 5,6 and 20
ma
ATPlAl
ATPlA2
WLCVVLSAVVIITGCFRYYQEAKSStil!4ESFKWtVPQ 100.
ATPl.43
LYLqVVt.aAVVIvTCCFSYYQE.,WSKIt4dsFKNt4VPQ 92.
LYLQiVLeAVVXlTGCFSYYQEAKsSKIMESFKN,tVPQ 95.
ATPlALI vYLGCVLOL\vILTGIFAYYQEAKSTSI~sSFSK~IPQ lOOI
ATPlALl VYLGCVL~~VVIITG~F~YYQEAKS~~~~~SFI~~~~QQ 66,
tI.K-ATPdse IYLaiaLia\YvvTCcFgYYOEfRSTNIlaSFLnlvPO
55.
H,K-ATPeW LYLaiaLiAVVvvTGCFgYYQStKStflIi~SFKSl~PQ 66%
ATM Al
l%Z
QALVIRHGEKWINAEEVYVODLVEVKGGDR~PADLRIISANOCK 100%
QALVIR&EKnqINAEEYVVGDLVEVKGoDRVPADLRIlSst,G~K 89,
QALVIRsGEKnqvNAEEVVVGDLvSiKooDRvPADLRllSAhqcK SC\
ATP1AL.i QALVIRdsEKktI~.EqlVVGDi~EVKGGDqIPAD~R~lSSqq~r
HrK-ATPLae QAtVIRdGdKCqINAdqlVVG,,U,EmKoGDRVPADI~~laAqOCK
6,.
69,
ESH 20
ATPlAl
AWlA
TY~QRKIVEFTCMTAFFVSIVVVQkADUJICKTRRNSVFQQGN-K 100,
ATPlAJ
TYEQRSVVR~C~~TAFF~S~VVVQ~~ADUICKTRRNSVF~~+K 93,
ATP1ALI PRIQREYLEYTCYT~~F~OILV~I~DLI~RKTRRYSIF~LFR 100.
ATP1AL.l
TYGQRKvVE~C~TA~FVS~~~~Q~ADLIICKTR~NS~F~~-~ 93%
TLYQReylE~TgyTAFFVgI1VqQlADLiIrKTRRNSiFQQOltR
H.P-ATPase T~~QR~YQ~YTcYTvFF~oI~VCQIAD~~IRKTRRIS~FQ~~FR
ti,K-ATPam TfgPRlyqqyTC,TVFFiSIoYcglADVllrKTRRlSaFQQG~fR
55,
ma
57%
Fig. 2. Analysis of the amino acid sequences deduced from the structure of the ATPI ALl exons and the corresponding regions of al cDNA,
ATPlA2 (cd gene), ATPI A3 (a3,gene), and the human H,K-ATPase gene (data from ref. 17, 18, 19, 16 respectively). eeicentage identity is
indicated on the right, non-identical residues are indicated in lower case. A: Homology of amino acid sequences encoded by ihe members of the
Na,K-ATPase gene family and the H,KLATPase iene. B: Comparison of the ATPlALl and human H,K-ATPase amino acid sequences.
92
Fig. 3. Nucleotide sequence of the ATPfALl fragment flanked by
two oligonucleotides which were used for the PCR analysis of the
ATPJ ALI transcript. The intron sequence is shown in lower case.
PCR primers are underlined.
210
Ifi:
(Fig. X4) exhibits about 60% homology. This level is
markedly 1 ess than that of the 3 sodium pump cy-
subunit ge :nes. In addition, a recently published
genomic s sequence of human H,K-ATPase 1161
demonstrated the absence of an intron between the-6th
and 7th exon. In contrast, the ATPlALl gene possesses n
the 126 bp intron at this position (Fig. 3). Thus, the
limited sequence information on the ATPlALZ struc-
12 3 4 5 ' 6 7
1159
1093
805
514
468
449
339
284
249
Fig. 5. PCR-based search for the presence of the ATPfALl
transcript in poly(A+)-RNA of human tissues. Poly(A+)-RNA w as
converted to single stranded cDNA and subjected to 25 cycles of PCR
with ATPfALI-specific oligonucleotides. The PCR products were
electrophoretically analyzed on an 8% polyacrylamide gel (A)
followed by Southern blotting and hybridization to the P-labeled Cal
Pig cDNA (B). Lanes 3, 4, 5 and 6, PCR from poly(A+)-RNA of the
human brain, kidney, liver, and renal carcinoma, respectively. Lane
2, PCR from the DNA of genomic clone MWZI (contains intron 6
that increases the size of the fragment). Lanes 1. 7, size markers
(PlincIl digest of #X 174 DNA and Hue111 digest of pBR 322 DNA,
respectively).
Fig. 4. Test for the specificity of the oligonucleotides which were
used to detect the ATPlALI gene transcript. 1 ng of the phage A and
cosmid DNAs from the clones containing exons 6 and 7 of five II-
subunit genes were subjected to 25 cycles of PCR followed by gel
electrophoresis in 2% agarose. Lanes 1, 2, 3, 4 and 5 represent PCR
from the DNA of ASW21 (gene A TPI ALI ), ARS9-1 (gene ATPIAI),
cosRC16-10 (gene ATPfA2), ARSB.l (gene ATPI AS) and hSAKS35
(gene ATPI ALI ), respectively. Lane 6, PCR from the 10 ng of the
pGC 35 DNA (full-length pig cul cDNA). Lane 7, size markers (PstI
digest of phage h DNA).
ture allowed to suppose that the gene is evolutionary
distant from either a Na,K-ATPase or a H,K-ATPase
and can represent a gene for the related ion transport
ATPase, although the possibility that ATPlALZ en-
codes the marginal forms of a Na,K-ATPase or a H,K-
ATPase cannot be excluded.
I t should be noted that the determined nucleotide se-
quence of the ATPlALl exons as well as the structure
of the exon/intron boundaries gave no indication that
ATPiALi represents a pseudogene but its functional
93
Voh i l l l ,~ 2714. l l t l l i l b l ~ I l q : l i q f.i ~; It ' I~ .R~ J ~i t | l l af) l q g t
~ l l i l l i ~ r el i l l i h l ed I l f l k l i O W l l . I l l of d ~ l ' 1o d l cl ' nl i ne
w h et h er l l l i ~ t I1i ~ i ~ l i ' ~ ui ~ cr i p l i O l i al l y oni p l cni w e
d eci d ed i o 11~ t t i e l l l ~ l h od of l l Ol v i i l l ' ~ l ~ v h ah t r ~ i l h l l l
( P( ' I # . } f or l h ni R N A d l ct ; l i O l ~ l l l ' l ~: i ' l t l ~ O l l ~ el ' ~ h l i l of
i i R N A i ~ i ' ~ l ~ al ' i l l i Ol l ! o i l l ~ conl l ! l l i l l l l i ~ i r y I ) N A. l ' h
~peci fi i i y of PCR amp Ii fi cai i ol ~ is ba~d oi l Ihc
~peci fi i t y of lWO pfhnl' S i l l l i i f h i i i k t he I ) N A s-
q t i l i Ce. I l l i l i ~ case of A F PI A L / l i l I ~ { N A d t ~ l i O l l w e
110i t wo ol i g onucl eol i d es f l ' om C X O I U i 6 al l t l 7 (s
F i g , 3} , r h p r i mer s w er e ~dlOWll t o be ver y sp ci f i , : f oi '
. 4 T P ' I A I . I al l ; ! g; r ' e i l o al np l i f i cat i oi l p l ' od l i ct Whl~
p l l ag e A I ) N A~ , onl ai i l i l i 8 t h e cor i ' e. ~ p O l l d i i l g r cg i ol l f ( i f
l h e oi l i er ct . sl i b l i i l i t gel l CS w er e l i sed i i .~ l emD l at cs i l l l h c
I ' C R r eact i on (Fig, ,1), Sear chh/g f or t he A77' I ALt
tran.~cripl in the poly(A' ~)-fraction of the human brain,
kidney, liver and retail carcinonm RNA illcluded eDNA
synthesis and 25~30 cycles of PCR followed by elec-
iropl~oresis, hybridization analysis and sequeucing of
the amplified product. The PCR analysis revealed the
presence of the ATPI ALi transcript in the human
braiu and kidney (FIB. 5) . Direct sequencing confirmed
the identity of ~l~e P CR p r od u c t a nd the d ed u c ed
A TPI ALI trans cript. This resul t c l ea r l y d emons tr a ted
that the ATPI ALI is cpres s ed at l east at the l evel of
m R N A a nd c a n enc od e th e fu nc ti ona l i s ofor m of an
i on tr a ns por t ATP a s e. Th e p os s i b l e c a nd i d a tes for the
ATPI ALI g ene p r od u c t c ou l d be the ou a b a m-
ins ens itive Na +- a nd K+ - ATP a s es wh i c h wer e identified
in differ ents parts of ma mma l kidney [ 20, 211.
Th e s eq u enc e i nf or ma t i on on th e s tr uc tur e of the
A TPl ALI eons a l l owed us to s y nth es i z e the i s ofor m-
s pec ific ol i g onu c l eoti d es a nd beg in the a na l y s is of ,'1
h u ma n k id ney eD N A l ibrary.
Acknowletlgement: The autllors arc grateful to Dr 1, Chernov for the
synthesis of the oligonulcotidcs,
R E F E R E N C E S
[1] Sveralov, E.D,. Monastyrskaya, G.S.. Broude, N,E,,
Ushkarev. Y.A.. Allikmeis. R,L,, Melkov, A. M. , Smirnov
Y.V,. Malyshev, [,V., Dulub0va, I,E,, Peirukhin. K,E,,
Grishin, A,V., Kijatkin, N. i. . Kostina, M,B,, Sverdlov, V, E,
Modyanov. N.N. and Ovchinnikov. Y,A. (1987) FEBS Leu
2t7, 275-278,
[}1 '~ll~itt, M , M al~d t i i l ~ f l , I,I1 i I~t ~?l 1"1,>~ Nai l Acri d. ~,~i,
I ; ~, A b t,t, . l i l l , l , t i ) . t l .
t } l 1 .i i l! lfl. 1.11. ( l l t ~* ~ki , l , , ~l t l t l t . M- M, ail~t I ' I i . t+.~,1. I l' t~mi
f' t l ~'iillt~,l't~l|t~, I<1 ,. %hiwt~lel, .1,~ it ,, i .l t t d~l l l , ~l'.. Shllll %l,kl .
It 11.~ I' _ I , , l . i l l l ~l . I . I 1, ,li~d I f~lll~k, |~ i l ' l ~ ] t .i llOllli ,~ ~.
I~1 Kai .~i ' , 1~, ; llt d Nhi fl' i ly, N, I ; , i I ' l ~ i t i t : I i N A ( hi tli l~tL A
l~ft lli ~ll Al~Pl't~clch I( i { o~ i . I } , M, ~d,t ,.>1, I, i~l,. I - .i l q IRI.
I'1 ,Nlani ali ~, r ,, I q ' i i ~ h , I ' . 1 <, ,l i l d 7~lt llbi ~ok. I. i lu.' t 2i <Nlt~tuhlf
(' lolt i lt b~: A l>aboflllor ) $1111ut~tl. ( ' ol d .~l~fi llt~ }l.,ifl~i~f
l,i lbof.lt Ol' ~. ( ' ol d Spfi li ~ 11.lfbof. ~ t ' .
I?1 l : l ' i ~ h auf , A . . M , , I,hi ' i ~dl I I , Pou~lka, A , i u~d <MiIl'fa), N
119~Jl J. Mol . I l i ol li D..,,i 27 -1f.12
I~1 .~hapi fo, Y . A. , /,;iyI~cV. I,/.,, VIIft t ~, Y,II,, ~ ' ak ~ l cv , A. ( I .
i l l l d ( i t udi t i ~. V . M. 119~2} Il i oofg , i ~li i llt , ~, l J J 9 - I' J .t 2,
i ' l l ( h cl i i i l l l i k ov , Y , A, , Moi lll~t yf~kllyll, ( l ,S., llfoud, N . t i . .
..%lliknil~. R , I . , Udlki li ' ~ Y, A, , ,Mclko~, ," i ,M., Si li i fno~,
Y . V , , ,Maiy~h~',. I,V,, I)ulubo~a, I . l i , , Pli ' ukhun, K.E.,
( i f i ~ l i i n. A , V . , S~ l t d l ov . V . l ! . . Ki v l l l k i i i , N,t ., K ~ t i i i l l . HI,It .,
Mod y l i i l ov , N . N . . t f i d Swl ' d l ov , I L l ) . t t g KII f: I( t lS I.el l . ] l J .
7J,.80.
l i l t ] Y; i l; i i , lll~lll, K . R. . AIl~rl~, II,M , I| ~n~i li l! f, R., I,i l~hol' n, 1,,
ar i d l'*fibl'. ( } ( 197oi Vi r ok q l y ,l(i , 7J.1.-739.
f111 l i nk er , R.T, and Boar d. l / . ( i , (t l)~l~l Nudci A~hts 14~, 16,
I I 0~,
1121 Ov ch i l l l l i k ov , Y , A, , Modyano~. I N, N. i l r oud, N,E.,
I~i i ' ti khi i ~, K , E, , Gr i ~t l i l l , A, V , , Af/al l ' l i l z ov Il , N, M, ,
Al d anov a, N.A,..MOli ~l~lyl' ~kli ya, ( I , S . . ' | l i d SVl' dlov, E.D,
(1986) I; EI} S Left . 201. 23%..2.t$,
l l 31 Sai lgl' , F., Ni ck l en, S, ai ld ( : oi i h oi l . A,R, (1977} Pro, Nai l,
Ai ~ml, Sci . I.JSA 74, $,163-:$467,
1141 Sv ~ r d l o v , E. I ), , l l l l ' uk hi i l . K,E,, Ak0pyt llll~i . N,S,, lh' oli d
N. [ ! . (h=i shhl, A,V., Svcr dl0v, V.E. ~illd ModyallOV, N,N,
(1988) Dokl. Akad. Nauk SSSR 298, 236..239.
[151 Saiki R,K,,(]lfaild, D. H. , SIoff~l, S, , Slliil' f, S. , I. , lliguchi
R,, tlolm, G. T, . Mullis K,I}, and l'.'rlh:h, II,A. (1988) ,Science
239, 487--491.
[161 Macda, M. , Oshhll~i n, K. - I , , Taml i r a, S mi d Ft l l t l i , M. (1990)
J, Bi ol . Chen~, 265, 9027.-9032,
[17] Kawak ami , K,, Oh l a, T. , Noj h i l a, t l . and Ntigan0> K, (1986)
J, I]i 0henL 100, 389- 397,
Di l l Shu| l, M , M . , l J ul h , I.).G. and IAngr l, J.IL (1989} J. Bi ol.
C{lem. 264. 17532.-17543,
[191 Ovchinnikov. Y,A,, Monastyrskaya, G,S., Broud, N.E.,
Ushkarev. Y. A. , Melkov, A,M., Smimov, Y.V,, Mnlyshev,
I,V.. Allikmets, R, L. Kostina, M,B,, Dulubova, I,E,,
Kiyatkin. N.I., Grishin, A,V., Modyanov, N.N. a~ld Sverdlov.
E, D. (1988) FEBS Leti 233. 87-94
[20] Doucet, A, and Marsy, S, (1987) Am, J. Physiol, 253,
F418-F423.
[211 Matin, R,, Gomes, D.C.. Rodrigues, G,A,, Proverbio, T, and
Proverbio, F, (1990) FEBS Left, 269. 77-78.
94