TSUD AnalysisReportGuide 3.2 1 PDF

Version 3.
2
- Page 1 -
Copyright 2012 Life Technologies Corporation
For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use.
Torrent Browser Analysis Report Guide
Version 3.2
- Page 2 -
Introduction
A Torrent Browser run report contains statistics and quality metrics for your run. From a run report you can do the
following:
Review pre-alignment metrics such as bead loading, Ion Sphere Particle (ISP) density, total number of
reads, percentage of reads at Q30 quality, and mean read length
Review alignment metrics such as total aligned bases, average coverage, and mean raw accuracy
Download the result set
Manually run a plugin on the run results
Review the planned run settings
Review the test fragments used with this run and test fragment quality metrics
Review analysis information and Torrent Suite software versions
Review the analysis log
Generate a zip file for technical support
See to handle runs generated with version of Torrent Suite earlier than 3.0. Old report analysis
A run report is divided into the following main areas (see the example run report below):
Report header A button to download the run report as a PDF, a button to review the planned run settings
for the run, a menu to change to a different result set for the same sample, and a navigation bar, for instance
to jump to the Output Files section.
Barcode Summary For barcoded runs, a barcode summary table appears at the top of the run report.
Unaligned Metrics taken before alignment, including bead loading, ISP density and other metrics,
sequencing quality metrics, and read length
Aligned Metrics on the aligned reads
Plugin Previews Summary output of completed plugins (when supported by the plugin)
Output Files Download buttons for both pre-aligned reads and aligned reads files
Plugin Summary Links to plugin reports and a button to select another plugin to run (on a completed
analysis)
A button which displays information about the Test Fragments performance of each test fragment included
in the experiment
Analysis Details A button which displays a set of information about the sequencing run environment (run
date, sample name, chip type, instrument name, barcode set, etc.)
Support A button which displays a link to the report log and a link to generate information for technical
support
A button which displays the version of Torrent Suite software and its modules Software Version
Version 3.2
- Page 3 -
Version 3.2
- Page 4 -
Report header
The run report header contains the following:
A navigation bar to jump to other areas of the report, such as the Output Files section
A button to download the run report as a PDF file
A Result Set menu to view the run report of a different result set for the same sample
A Review Run Plan button to view the planned run information for this run
Version 3.2
- Page 5 -
Old report analysis
The Torrent Browser cannot display run reports from earlier versions of the Torrent Suite software in the new run
report format.
To work with results generated with an earlier version of Torrent Suite software, you have these options:
Re-analyze the run to generate a new report Opens the Data > Completed Runs & Reports >
Reanalyze page. Typically you click button to re-analyze with the same settings. The Start Analysis Adv
page is also available to change the analysis settings. After you re-analyze the run, you then have anced
all 3.x features available in the new run report.
View the pre-3.0 report Open the run report in the old pre-3.0 style. Many 3.x features are not
available in the old style run report.
View this report log Open the text log for this run.
Version 3.2
- Page 6 -
Contents
Run Report Metrics
Run Metrics Overview
Run Report Metrics Before Alignment
Run Report Metrics on Aligned Reads
Barcode Reports
Test Fragment Report
Report Information
Output Files
Plugin Summary
Run the Installed Plugins
Alignment Plugin
Coverage Analysis Plugin
ERCC Analysis Plugin
IonReporterUploader Plugin
Run RecognitION Plugin
sampleID Plugin
Torrent Variant Caller Plugin
Pre-3.0 Run Reports
Version 3.2
- Page 7 -
Run Report Metrics
Run Report Metrics
This section provides background information on run metrics and detailed descriptions of a run report. See Run
for explanations of quality metrics, read length calculations, and alignment. Metrics Overview
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
Version 3.2
- Page 8 -
1.
2.
3.
Thispage provides background information on quality metrics, read lengths, and alignment. These concepts are
required to understand your run report.
The Torrent Browser Analysis Report gives performance metrics for reads whose initial bases match the library key.
These reads are generated from the input library, not from the positive control Test Fragments.
Performance is measured based on either predicted quality or quality as measured following alignment. Q20 and
AQ20 are explained as examples of predicted quality and quality following alignment.
Predicted Quality (Q20)
Quality Following Alignment (AQ20)
Predicted Quality (Q20)
The number of called bases with a predicted quality of Q20 is reported. The predicted quality values are reported on
the Phred scale, defined as (error probability). Q20, therefore, corresponds to a predicted error rate of -10log10
one percent.
Refer to for a more complete description of http://en.wikipedia.org/wiki/Phred_quality_score
Phred values.
Quality Following Alignment (AQ20)
Alignment of reads can be a useful process to assess the quality of the sequencing reaction and the quality of the
underlying library where an accurate reference is available. Reads are aligned to a reference genome. Any
discrepancy in alignment to a reference (whether biological or technical, meaning a real variant or a sequencing
error) is listed as a mismatch. Alignment performance metrics are reported depending on how many misaligned
bases are permitted. Torrent Suite reports alignment performance at two quality levels:
AQ20
Perfect
How Is Aligned Read Length Calculated?
The aligned length of a read at a given accuracy threshold is defined as the greatest position in the read at which
the accuracy in the bases up to and including the position meets the accuracy threshold. So for example the AQ20
length is the greatest length at which the error rate is 1% or less. The "perfect" length is simply the longest perfectly
aligned segment. For all of these calculations the alignment is constrained to start from position 1 in the read - in
other words, no 5' clipping is permitted.
The underlying assumption is that the reference to which the read is aligned represents the true sequence that
should have been seen. Suitable caution should be taken when interpreting AQ20 values in situations where the
sample sequenced has substantial differences relative to the reference used, such as working with alignments to a
rough draft genome or with samples that are expected to have high mutation rates relative to the reference used. In
these situations the AQ20 lengths might be short even when sequencing quality is excellent.
Specifically, the AQ20 length is computed as follows:
Every base in the read is classified as being correct or incorrect according to the alignment to the reference.
At every position in the read the total error rate is computed up to and including that position.
Version 3.2
- Page 9 -
3. The greatest position at which the error rate is one percent or less is identified and that position defines the
AQ20 length.
For example, if a 100bp read consists of 80 perfect bases followed by 2 errors followed by 18 more perfect bases,
the total error rate at position 80 is zero percent. At position 81 the total error rate is 1.2% (1/81), at position 82 the
error rate is 2.4%, continuing up to position 100 where it is two percent (2/100). The greatest length at which the
error rate is one percent or less is 80 and the greatest length at which the error rate is two percent or less is 100, so
the AQ20 lengths are 80 and 100 bases, respectively.
How Is Alignment Performed?
Within Torrent Browser, the objective is to provide you with a view on alignment that helps determine run and library
quality.
There are many alignment algorithms available within the marketplace and you are encouraged to
consult with a bioinformatician for the most appropriate alignment algorithm for your downstream analysis
needs. Alignment algorithms are also embedded in many of the commercial software tools available
within the Ion Torrent Web store. You are also encouraged to experiment with these tools.
Alignment within Torrent Browser is performed using TMAP. TMAP is currently an unpublished alignment algorithm,
created by the authors of the BFAST algorithm. Please, contact Ion Torrent Technical Support for more information
about TMAP.
Technical Note - Analysis Pipeline
Technical Note - TMAP Alignment
Although TMAP is unpublished and a reference is not currently available, the precursor to TMAP,
BFAST, is based on the ideas in the following publications:
Homer N, Merriman B, Nelson SF.
BFAST: An alignment tool for large scale genome resequencing.
PMID: 19907642
PLoS ONE. 2009 4(11): e7767. http://dx.doi.org/10.1371/journal.pone.0007767
Local alignment of two-base encoded DNA sequence.
BMC Bioinformatics. 2009 Jun 9;10(1):175.
PMID: 19508732 http://dx.doi.org/10.1186/1471-2105-10-175
Which Reads Are Used in the Alignment Process?
The alignment stage involves aligning reads produced by the pipeline to a reference genome and extracting metrics
from those alignments. By default, Torrent Suite aligns all reads to the genome, however there may be situations,
particularly with large genomes, where the alignment takes longer than the user is willing to wait. So for such
circumstances the Torrent Suite also has the capability to define on a per-reference basis the maximum number of
reads that should be aligned from a run. For more detail on how to enable and specify this reference-specific limit
see the Adding a Reference Sequence section of . Working with Reference Sequences
When the number of reads in a run exceeds a genome-specific maximum, a random sample of reads is taken and
results are extrapolated to the full run. By sampling a quickly-aligned subset of reads and extrapolating the values
to the full run, the software gives you enough information to be able to judge the quality of the sample, library and
sequencing run for quality assessment purposes.
The outputs of the alignment process is a BAM file. The BAM file includes an alignment of all reads, including the
Version 3.2
- Page 10 -
unmapped, with exactly one mapping per read. When a read maps to multiple locations, the mapping with the best
mapping score is used. If more than one such mapping exists, a random mapping is used and given a mapping
quality of zero.
If sampling is in effect for a run and full read alignment is needed, the analysis can be manually
re-run using the tab option and checking the ch Runs Advanced Override alignment sampling
eckbox.
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports

Version 3.2
- Page 11 -
The Unaligned area in the Run Summary section provides before-alignment metrics. There are four sections in the
Unaligned area:
ISP Density
ISP Summary
Quality
Mean Read Length
ISP Density
This table describes the I density metrics: on Sphere Particle (ISP)
Metric Description
Total Bases Number of filtered and trimmed million base pairs
reported in the output BAM, SFF, and FASTQ files.
Note: The SFF file format is deprecated and will not
appear in future releases.
Bead Loading Percentage of chip wells that contain a live ISP. (The
percentage value considers
only potentially addressable wells.)
Version 3.2
- Page 12 -
The ISP Density image is is a pseudo-color image of the Ion Chip showing percent loading across the physical
surface.
ISP Summary
This table describes the ISP summary metrics:
Metric Description Calculation
Total Reads Total number of filtered and
trimmed reads independent of
length reported in the output BAM,
SFF, and FASTQ files.
Note: The SFF file format is
deprecated and may not appear in
future releases.
Usable Sequence
Loading Percentage of chip wells that
contain a live ISP. (The percentage
value considers only potentially
addressable wells.)
Version 3.2
- Page 13 -
Empty Wells Percentage of chip wells that do not
contain an ISP. (The percentage
value considers only potentially
addressable wells.)
Enrichment Predicted number of Live ISPs that

have a key signal identical to the
library key signal (the same value
as shown in the Well Information
table).
The Percent Enrichment value
reported is the number of loaded
ISPs that are Library ISPs, after
taking out Test Fragment ISPs.
Library ISPs / (No. of Loaded ISPs
minus TF ISPs)
No Template Percentage of chip wells that do not
contain a DNA template.
Clonal Percentage of clonal ISPs.

An ISP is clonal if all of its DNA
fragments are cloned from a single
original template. All the fragments
on such a bead are identical (and
they respond in unison as each
nucleotide is flowed in turn across
the chip).
Polyclonal Percentage of polyclonal ISPs (ISP

s carrying clones from two or more
templates).
Polyclonal ISPs / Library ISPs
Final Library Percentage of reads which pass all
filters and which are recorded in the
output BAM, SFF, and FASTQ files.
This value may be different from the
Total Reads due to technicalities
associated with read trimming
beyond a minimal requirement
resulting in Total Reads being
slightly less than Final Library.
Final Library / Library ISPs
% Test Fragments Percentage of Live ISPs with a key
signal that is identical to the test
fragment key signal.
Test Fragment ISPs / Live ISPs
% Adapter Dimer Percentage of ISPs with an insert
length of less than 8 bp.
Primer dimer ISPs / Library ISPs
% Low Quality Percentage of ISPs with a low or
unrecognizable signal.
Low quality ISPs / Library ISPs
Version 3.2
- Page 14 -
Quality
This table describes the quality metric:
Metric Description
Fraction of total bases >= Q30 Percentage of total bases with a predicted quality of
Q30 or better.
The quality histogram gives the percentage of bases that have a predicted quality level in each of seven bins.
The performance measurements in this section are based on predicted quality.
Read Length
Version 3.2
- Page 15 -
This table describes the read length metric:
Metric Description
Mean Read Length Average length, in base pairs, of all filtered and
trimmed library reads reported in the output BAM, SFF,
and FASTQ files.
The read length histogramis a histogram of the trimmed lengths of all reads present in the output files.
For more information on filtering and trimming, please see Technical Note - Filtering and
. Trimming
Version 3.2
- Page 16 -
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports

This section of a run report provides metrics on aligned reads:
Version 3.2
- Page 17 -
The Total Aligned Bases
The following table describes metrics in the Total Aligned bases column.
Metric Description
Total Aligned Bases Number of filtered and trimmed million base pairs
reported in the output BAM, SFF, and FASTQ files.
% Aligned Bases Percentage of Total Aligned Bases out of all reads.
Average Coverage Depth of Reference The average of the number of reads that cover each
reference position.
. Trimming
The graph in the Total Aligned reads column plots number of aligned (in blue) and unaligned (in grey) bases by posit
Version 3.2
- Page 18 -
ion in an aligned sequence:
For each position in an aligned sequence, the height of the blue area shows the number of aligned bases at that
position. The grey area shows the number of unaligned bases at that position. Unaligned bases are not shown by
the absolute height on the number of bases axis, but by the difference between the grey height and the blue height.
Raw Accuracy
The following table describes metrics in the Raw Accuracy column.
Metric Description
Mean Raw Accuracy 1x .
The graph in the Raw Accuracy column plots percent accuracy for each position in an aligned sequence:
Version 3.2
- Page 19 -
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
Version 3.2
- Page 20 -
Barcode Reports
Barcode Reports
The barcode section of a run report displays the following information per barcode:
Column Description
Barcode Name The individual barcode in the barcode set.
The row labeled as No barcode reports on unclassified
barcodes, which are reads that could not be classified
as matching one of the expected barcodes in the
barcode set.
Sample Name of the sample that was sequenced on
instrument.
Output Total number of reads.
% >= Q20 The percentage of reads that have a predicted quality
score of Q20 or better.
A Q20 score is the predicted quality of a Phred-like
score of 20 or better, or one error in 100 bp.
Reads Total number of filtered and trimmed library reads
(independent of length). This number is reported in the
barcode BAM file.
Mean Read Length The average read length, in bp, of all filtered and
trimmed library reads reported in the barcode BAM file.
Version 3.2
- Page 21 -
Read Length Histogram A thumbnail histogram of the read lengths for this
barcode.
BAM Buttons to download the BAM and BAM index file (BAI)
for this barcode. The BAM file contains aligned reads
sorted by reference location.
See also for a description of Run Metrics Overview
alignment data.
The number of barcodes shown in the barcode section varies according to the barcode set used in your run and on
the barcodes actually present in the sample. Only data for barcodes present in the run are displayed in the run
report.
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
Version 3.2
- Page 22 -
Output Files
Output Files
These links permit you to directly download the data and report files.Some files are compressed, using the for .zip
mat, to provide data integrity and to reduce download time.
Click on a file type button to save the file to your local computer.Most outputfiles can be loaded into third-party
viewers (such as IGV) for visualization. The barcode row only appears for runs on barcoded data.
Files in the barcode row are zips of one file per active barcode. To download only BAM and BAI files for a single
barcode, go to the barcode section at the top of the run report (see ). Barcode Reports
Column Description
Reads Files with unaligned reads (before alignment)
Aligned Reads Files with aligned reads
File type Reads Aligned reads
BAM Unaligned reads in BAM format.
In this release, the BAM file
contains some flow space
information.
Aligned reads sorted by reference
location.
See Run Metrics Overview for a
description of the alignment data
included in this BAM file.
BAI BAM index file
Version 3.2
- Page 23 -
SFF Compressed (.zip) Standard
Flowgram Format (SFF) -formatted
file that contains "flow space" data.
The bases called in a run are stored
in two formats: SFF and FASTQ.
Both files contain the nucleotide
calls and associated quality values,
the SFF files, additionally, contain
signal values in flow space and a
mapping between sequence and
flow spaces.
The data are organized on a per
flow basis, and contain information
about nucleotide flows that both did
and did not result in base
incorporation. (See Technical Note -
.) Filtering and Trimming
Note: The SFF file format is
deprecated and may not appear in
future releases.
FASTQ Compressed
(.zip)FASTQ-formatted file
containing data organized in a
per-base basis, including quality
scores. The reads contained in the
file are unaligned reads. (See Tech
nical Note - Filtering and Trimming.)
Note: Large FASTQ files are zipped with a format that is not compatible with the native Windows unzip utility.
The BAM format
Binary Sequence Alignment/Map (BAM), is a compressed, binary form of the SAM format. BAM files can be
indexed, using the BAM Index file, for quick access to sequence alignment data. See http://samtools.sourceforge.net
for more a more detailed description of the SAM/BAM file format. Many tools are available for working with SAM
files.
Version 3.2
- Page 24 -
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
Version 3.2
- Page 25 -
Plugin Summary
Plugin Summary
The section lists the plugins associated with the analysis, and provides an interface for running Plugin Summary
and monitoring your plugin(s).
Plugins can have one of the following behaviors:

Run without user input.
Run with a user interface for getting plugin parameters.
Plugins without a user interface display a confirmation message that the plugin has been submitted to run. Plugins
requiring input parameters display a user interface dialog and are launched after you click on the plugin user Submit
interface.
The Combine Alignment and IonReporterUploader functionality
In previous releases, Combine Alignment was a plugin available through the button. Select plugins to run Combine
Alignment is now available in a project result set page, Data > Projects > , with the projectname Combine
button. The result sets to be combined must be members of the same project. Selected...
The IonReporterUploader plugin is available here to launch manually through the Select plugins to run button and
can also be specified in the template and planned run wizard, under the Export chevron, to run automatically (after
the plugin is configured).
Version 3.2
- Page 26 -
1.
2.
3.
Run a plugin
The Plugin Summary list
Plugin reports
Plugin log files
Run a plugin
The following plugins are pre-installed on Torrent Server. See for a Running the Installed Plugins
description of these plugins.
Alignment
Coverage Analysis
ERCC_Analysis
IonReporterUploader
Run RecognitION
sampleID
Torrent Variant Caller
To manually run a post-analysis plugin on the report data:
Click . Select Plugins To Run
The Plugin List pops up and displays a list of available plugins:
Click the plugin you want to run.
If the plugin does not require user input, it begins execution.
This displays the user interface for your plugin. In this example, the plugin is selected, displaying Alignment
the plugin dialog (see for more information about running pre-installed Alignment Run the Installed Plugins
plugins):
Version 3.2
- Page 27 -
3.
4.
5.
Select the desired plugin options and click . This runs your plugin, listing the run status in the Submit Plugin
panel. Summary
For plugins that take a long time to run, click to update the plugin display status. Refresh Plugin Status
The PluginSummary list
After a plugin runs, it is listed in the panel: Plugin Summary
Some plugins, such as Alignment,display a preview results window in the Plugin Summary list.
Plugin reports
Plugin results, results summaries, links to output files, and other information are available in the plugin report
pages. See for a description of report pages for the installed plugins. Run the Installed Plugins
Click the plugin html link in the Plugin Summary section to open that plugin's report page:
Version 3.2
- Page 28 -
1.
2.
Plugin log files
To view the plugin log file, hover your mouse pointer over the log icon to the right of your plugin to display the
plugin log file:
Click the icon to display the log:
Version 3.2
- Page 29 -
2.
3. Click to exit the display. Close
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
Version 3.2
- Page 30 -
You customize your analysis by running one or more plugin applications at the end of each Torrent Suite Software
run. Your Torrent Browser includes several of these plugins, such as for variant calling and realignment. The Torrent
Browser Plugin Store offers other plugins written by Ion Community members. The is Torrent Browser Plugin Store
on the Ion Community (registration required).
Available plugins
Manually run a plugin
Automatically run plugins
Available plugins
This table lists the pre-installed and officially supported plugins.
Plugin Description
Alignment Plugin Performs a new alignment to the reference you specify.
Note: Plugins run after the Torrent Suite analysis
pipeline. This plugin does not affect the alignment
during pipeline analysis.
Coverage Analysis Plugin Provides statistics and graphs describing the level of
sequence coverage produced for targeted genomic
regions.
ERCC Analysis Plugin Helps with ERCC RNA Spike-in Controls: enables you
to quickly determine whether or not the ERCC results
indicate a problem with either the library preparation or
the sequencing instrument run.
IonReporterUploader Transfers run results files to your organization in Ion
Reporter Software (available under a separate
license).
Run RecognitION Plugin Considers candidate runs for inclusion in Ion
Community leaderboards. Within each chip type (Ion
314 chip, Ion 316 chip, and Ion 318 chip), top
runs are ranked according the number of AQ20 bases
mapped.
sampleID Plugin Uses sample fingerprinting to identify any
cross-contamination between samples or between
barcodes in a run.
Version 3.2
- Page 31 -
1.
2.
3.
Torrent Variant Caller Plugin Calls SNP and InDel variants across a reference or
within a targeted subset of that reference. With
low-frequency variant options, the plugin can call
variants down to a 5% level of variant frequency. It can
also show which variants coincide with predefined
HotSpot positions on the reference sequence.
This table lists plugin functionality that is available in other areas of the Torrent Browser.
Previous plugin Description and new location
IonReporterUploader Transfers run results files to Ion Reporter Software
(access is available under a separate license).
The IonReporterUploader is now selected before a run
in the > , > , and Plan Templates Plan Planned Run wiza
pages. After a run, if the results set is a member of a rd
project, you invoke the p IonReporterUploader from the
roject page (see ). Projects
combineAlignment Combines reads aligned to the specified reference from
multiple run reports. Intended for use when multiple
runs analyze the same tissue sample, for example
when a tissue sample is run on more than one chip.
You invoke combineAlignment from the project page
(see Projects). The runs you combined must be
members of the same project.

You manually run a plugin in the run report of a completed analysis run, with the button.Only Select plugins to run
enabled plugins are listed.
Follow these steps to manually run a plugin:

Go to the tab, then click the link for your completed analysis run. Data > Completed Runs & Reports
In the run report, scroll down to Plugin Summary tab.
The Plugin Summary also lists any plugins that executed on your run (not shown in this example).
Version 3.2
- Page 32 -
3.
4.
5.
Click to see the list of available on your Torrent Server. See f Select plugins to run plugins Available Plugins
or the pre-installed plugins. Your server may have additional plugins or other versions installed.
Click the desired plugin name to run a plugin.
If the plugin does not require user input, it starts immediately, without a confirmation screen.
Click to close the Plugin List without running a plugin. Close

When you design your sequencing protocol in the Plan > Template page, you specify which plugins to execute. You
can select any plugin that is installed and configured on your Torrent Server. You are not limited to the pre-installed
plugins.
See the following for more information on specifying plugins in your templates and planned runs:
Plan Tab
Templates
Planned Runs
Template and Planned Run Wizard
The old method to autorun a plugin
Your Torrent Server administrator can set plugins to be executed automatically on every run; however, the
preinstalled plugins are not good candidates to be run automatically. For example, the Torrent Variant Caller plugin
fails on runs that do not use both the hg19 reference and the Ion AmpliSeq Cancer Panel or custom product data.
Version 3.2
- Page 33 -
The Alignment and RunRecognitION plugins cannot be be executed automatically because they
require manual user input before every run.
For Ion Reporter users, enabling Autorun with the IonReporterUploader plugin could cause you
extra expense, by transferring unnecessary results to the Ion Reporter server. (The Plan tab
allows you to turn off the plugin for a template and for a planned run.)
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
Alignment Plugin
Version 3.2
- Page 34 -
1.
2.
3.
4.
5.
Alignment Plugin
The Alignment plugin performs a new alignment to the user-selected reference file. Output files include SAM/BAM
and FASTQ files of sampled reads. This plugin cannot be auto-run because it requires user input before execution.
The new alignment appears . in the context of the same run report
The recommend way to do a re-alignment is through the run report under Data > Completed
Runs & Reports > run report > gear menu > Reanalyze > Advanced > Start reanalysis from:
. The method generates a new run report and you optionally can run other Alignment Reanalyze
plugins on the new result set.
Follow these steps to run the plugin and to review the plugin output report.
To run this plugin, in the report for your run, scroll down to the Plugin Summary section, and click Select
. plugins to run
In , select .Theplugin displays the plugin user interface: Select a plugin Alignment
From the drop-down list, select the desired library. Libraries
Select the desired option. Sampling
Click the checkbox for each of the desired plugin output formats: , , and . .sam .bam .fastq
Version 3.2
- Page 35 -
5.
6. Click to run the plugin with the specified parameters. Submit
The interface provides feedback that the plugin has started:
On completion, the displaysa minimal output preview in the plugin list of the pa Alignment Plugin Summary
nel:
Click the link to display the full plugin output. Alignment.html
Plugins run after the Torrent Suite analysis pipeline. This plugin does not affect the alignment during pipeline Note:
analysis.
Version 3.2
- Page 36 -
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports

The Coverage Analysis plugin provides statistics and graphs describing the level of sequence coverage produced
for targeted genomic regions.
You can run the Coverage Analysis plugin automatically or manually.
To run theCoverage Analysis plugin automatically, you select Coverage Analysis plugin during template setup.
Refer to the and pages section of the for information Plan Tab Templates Torrent Browser User Interface Guide
about how to set up a template and create a planned run.
To run the Coverage Analysis plugin manually, perform the following steps:
Version 3.2
- Page 37 -
1. In the Torrent Browser, select a run report by clicking a run link, then clicking a report from the dropdown area.
The run report opens.
2. On the run report page, scroll about halfway down the screen to the Plugin Summary area. Click Select plugins
. The popup appears: to run Select a plugin
3. Select . TheCoverage AnalysisPlugin interface appears. coverageAnalysis

4. Select a library type.
5. If you have one and would like to use it, select a targeted regions file.
Version 3.2
- Page 38 -
6. If you would like to pad the target by a number of bases, enter the desired number. If you do not enter a
number,the default of 0 is used.
7. If you would like the option to examine unique starts, select the checkbox.
8. When you are satisfied with your selections, click . Submit
The analysis runs and a group of output reports is created.
The following sections of this document describe the output reports generated by theCoverage Analysisplugin.
Coverage Analysis Plugin Output
The Coverage Analysis Plugin output is a report called the Coverage Analysis Report. This report includes statistics
about all reads, and the following information in graphical form:
Target Coverage
Binned Target Coverage
Target Coverage by Chromosome
Individual Target Coverage
On/Off Target Read Alignment
Normalized Target Coverage
In addition, from the bottom ofthe Coverage Analysis Report, you can download a BAM file or its related BAM index
file.
All Reads
The All Reads section of the Coverage Analysis Report provides statistics about all reads. The items in this report
are described in the table below.
Version 3.2
- Page 39 -

Statistic Description
Number of mapped reads Total number of reads mapped to the reference.
Number of reads on target Total number of reads mapped to any targeted region
of the reference. A read is considered to be on target if
at least one alignedbaseoverlaps a target region. A
read that overlaps a targeted region but where only
flanking sequence is aligned, for example, due to poor
matching of 5' bases of the read, is not counted.
Percent of reads on target The percentage of reads mapped to any targeted
region relative to all reads mapped to the reference.
Total aligned base reads The total number of bases covered by reads aligned to
the reference.
Total base reads on target The total number of target bases covered by any
number of aligned reads.
Version 3.2
- Page 40 -
Percent base reads on target The percent of all bases covered by reads aligned to
the reference that covered bases in target regions.
Bases in targeted reference The total number of bases in all target regions of the
reference.
Bases covered (at least 1x) The total number of target bases that had at least one
read aligned over the proximal sequence. Only the
aligned parts of each read are considered. For
example, unaligned (soft-cut) bases at the 5' ends of
mapped reads are not considered. Covered target
reference bases may include sample DNA read base
mismatches, but does not include read base deletions
in the read, nor insertions between reference bases.
Average base coverage depth The average number of reads of all targeted reference
bases...
Uniformity of coverage The percentage of all target bases covered by at least
0.2x the average base coverage depth.
Maximum base read depth The maximum number of times any single target base
was read.
Average base read depth The average number of reads of all targeted reference
bases that were read at least once.
Std.Dev base read depth The standard deviation (root variance) of the read
depts of all targeted reference bases that were read at
least once.
Target coverage at 1x The percentage of target bases covered by at least one
read.
Target coverage at 10x The percentage of target bases covered by at least ten
reads.
Target coverage at 20x The percentage of target bases covered by at least20
reads.
Target coverage at 50x The percentage of target bases covered by at least 50
reads.
Target coverage at 100x The percentage of target bases covered by at least 100
reads.
Target Coverage Graph
In the Target Coverage graph, target base coverage is plotted against read depth, where read depth is the number
Version 3.2
- Page 41 -
of times a particular base is read and coverage is the number of counts of bases read at that read depth. This plot
includes the number of target bases that were not read (to 0x coverage). The right-hand y-axis shows the
cumulative coverage as a percentage of the total number of targe base reads, corresponding to the blue line. This
may be used to gauge the target number of bases read to a particular depth.
Binned Target CoverageGraph
In the Binned Target Coverage graph, as in the Target Coverage graph above, target base coverage is plotted
against read depth, where read depth is the number of times a particular base is read and coverage is the number of
counts of bases read at that read depth. However, in the Binned Target Coverage graph, the read depthsare binned
to better represent coverage where the maximum read depth is high. The binning size is chosen accordingly. For
example, an x-axis value of 20x indicates the sum of coverage for reads from 1 to 20, or 11 to 20 if the preceding
bar was labeled 10x, etc. This plot does not include the coverage for non-covered target bases (0x coverage).
Version 3.2
- Page 42 -
Target Coverage by Chromosome Graph
In the Target Coverage by Chromosome graph, the number of reads that align to each chromosome of the reference
are plotted as a bar chart. The number of reads that have aligned sequence overlapping any part of the target region
are represented by the gray portion of the plot. Those aligned off-target are represented by the white region.
Version 3.2
- Page 43 -
Individual Target Coverage Graph
In the Individual Target Coverage graph, the number of aligned base reads are counted for individual target regions
of the reference and normalized by dividing by the length of the target. These valuea are plotted on a bar chart for
each chromosome of the reference to a common scale, set by the highest normalized count. Red areas of the bars
show the fraction of the target bases uncovered by any read. For example, 20:80 red:gray indicates only 80% of the
original target was read. Note that with large numbers of targets, details for individual target regions (bars) may not
be visible. Download the data file using the link provided to examine the individual target coverage in full detail.
Version 3.2
- Page 44 -
On/Off Target Read Alignment Graph
In the On/Off Target Read Alignment graph aligned read starts are counted for each 100 bases of the reference and
plotted as a bar if the count as at least five. Hence zero- or low-coverage regions, including isolated read mappings,
are not represented in these plots. Plot color is alternated to show continuous regions of coverage. Red and blue
represent the reads starting in a 100 base region overlapping a target region. Black and gray represent reads
starting outside of a target region. Peaks are contiguous and aligned to 100 base counts along the reference but no
distance between any two peaks is depicted. Note that with large numbers of targets, peak shape and resolution
between on- and off-target peaks may not be discernible. Download the data file usingthe link provided to examine
the coverage in full detail.
Version 3.2
- Page 45 -
Normalized Target CoverageGraph
In the Normalized Target Coverage graph, the fraction of total target bases covered is plotted against normalized
coverage, where normalized coverage is the number of times a particular base is read (read depth) divided by the
read depth of all target bases. The y-axis is the cumulative read depth divided by the total number of target base
reads.
Version 3.2
- Page 46 -
Version 3.2
- Page 47 -
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
This section describes the ERCC Analysis plugin. This plugin helps with analyses that use ERCC RNA Spike-in
Controls. The plugin enables you to quickly determine whether or not the ERCC results indicate a problem with
either the library preparation or the sequencing instrument run.
Enable the ERCC Analysis plugin
Manually run the ERCC Analysis plugin
Configure a template to run the ERCC plugin
Plugin run times
View analysis results
Interpret the data
View transcript details
Definitions
( ) Configure the ERCC Optional Analysis plugin
View plugin error information
Version 3.2
- Page 48 -
1.
2.
1.
2.
ERCC resources
Enable the ERCC Analysis plugin
A plugin must be enabled before it can run. Your Torrent Server administrator may have already enabled ERCC
Analysis plugin and then the plugin appears in the run report Plugin Summary Select Plugin to Run list.
Follow these steps if you need to enable the plugin:
Scroll to the top of the Torrent Browser and click in the gear menu on the right: Plugins
If the ERCC_Analysis plugin does not appear on your plugin page, click the column to sort by name Name
and scroll to the plugin. In the ERCC_Analysis row, click the Enable column checkbox:
Auto-run is not recommended for the ERCC_Analysis plugin unless most analyses on this
Torrent Server use ERCC controls.
Manually run the ERCC Analysis plugin

Follow these steps to manually launch the ERCC_Analysis plugin. You can use the default minimum R-squared
value or enter you own value.
Open the run report for the analysis. Scroll down to the Plugin Summary section.
Version 3.2
- Page 49 -
1.
2.
3.
4.
5.
Click to open the plugin list: Select plugin to run
Click . (The version number on your system might be different from the version shown here.) ERCC_Analysis
A popup window with a minimum acceptable R-squared value appears. You can use the default value or
enter your own value.The value should be in the range from 0 to 1.
Click to start the plugin. Submit
Configure a template to run the ERCC plugin
If you configure a template or planned run to execute the ERCC Analysis plugin, your experiment uses the Ion and
Total RNA-Seq Kit V2, then on the wizard Kits page, you must make a Barcode Set selection. Select either one of
the following in the Barcode Set menu:
IonXpressRNA Select this if your experiment uses this kit.
RNA_Barcode_None Select this if your experiment does not use a barcode kit. This selection is required
Version 3.2
- Page 50 -
for the correct trimming.
The following wizard image shows the two barcode kit selections. (Make only one selection per run.)
Plugin run times

For analysis runs with total reads under 1,000,000, the plugin normally takes 2-3 minutes to run (on supported
hardware). For larger runs, the plugin takes approximately an additional 1-2 minutes per million total reads. For
example, a run with 5 million reads may take 10-15 minutes. These run times are offered only as a guideline. If your
Torrent Server is busy with other processing, plugin run times are longer.
After the ERCC analysis is completed, you can view the analysis results.
View analysis results
Plugin analysis results appear in the plguin summary area:
After the status of the ERCC plugin has changed to Completed, click the ERCC_Analysis.html link in the Plugin
Summary section to open the ERCC Report and view analysis results:
Version 3.2
- Page 51 -
Interpret the data
The ERCC Report screen (shown on page 5) displays the ERCC Dose Response plot. The points are color-coded,
based on mapping quality. There is also a trendline, based on the parameters shown in tabular form to the right of
the graph.
The y-axis of the plot is the log (base 2) of the raw counts found for the transcript in question. The x-axis is also
logarithmic, but represents the known relative concentration of the ERCC transcripts. Ideally, the points all fall on a
straight line.
More realistically, in the good case, the raw counts and relative concentration should at least correlate with a high
R-squared (for example, 0.9 or higher). The table to the right of the plot (shown on page 5) shows the R-squared
value found for this plot, as well as the Slope, Y-intercept, and N (number of transcripts found) values. Although
there are 92 transcripts in the ERCC mix, it is not expected that all 92 will be detected. The number of transcripts
detected depends on the sequencing depth.
Version 3.2
- Page 52 -
View transcript details

If you want to look at the details regarding a particular transcript, there are two methods you can use:
Hover your mouse-cursor over a point on the ERCC Dose Response plot to display a popup window that
shows details about that transcript (the name, reads, and coverage plots).
If several points are very close together on the plot and it is difficult to hover over the point you are interested
in, you can zoom in on the plot to more easily distinguish points:
Use your mouse to draw a box around the point of interest and magnify it.
To zoom out to the full view of the ERCC Dose Response plot, either doubleclick the plot, or click the
button. Reset Zoom
Scroll to the particular transcript, and click the [+] next to the transcript name.
This method shows the same information, plus a few additional pieces. See Definitions if the meaning of any
of these pieces is unclear.
Definitions
This section defines terms used in the plugin output.
Coverage DepthThe minimum and maximum number of reads covering bases in the transcript. If
coverage is 100%, the minimum value will be > 0.
CoverageThe number of base positions covered by at least one read.
Start SitesThe number of base positions that are the start site for a read.
Unique Start SitesThe number of start sites that have only one read starting at the site.
Coverage CVCoefficient of Variation for coverage = average coverage / stddev coverage for the entire
transcript.
( ) Configure the ERCC Analysis plugin Optional

You can optionally change the R-squared value to set a default value for the summary report screen:
1. If the window showing the minimum acceptable R-squared value is open, close it. Then scroll to the top of
the Torrent Browser and click in the gear menu on the right: Plugins
Version 3.2
- Page 53 -
2. If the ERCC_Analysis plugin does not appear on your plugin page, click the column to sort by name Name
and scroll to the plugin. In the row, click the Manage column gear menu, then select ERCC_Analysis Configur
. e
3. The ERCC Plugin Configuration screen opens:
Enter a value between 0 and 1 as your minimum acceptable R-squared value (a lower value is indicated
by a red light in the summary report). Then click . Submit
The value you enter on the is used when the plugin is auto-run and ERCC Plugin Configuration screen
when a user Users can manually launches the plugin without entering a value. override this value on a
per-run basis when they manually launch the plugin.
Version 3.2
- Page 54 -
1.
2.
View plugin error information
If the ERCC_Analysis plugin status changes to Error after you click the ERCC_Analysis.html link, then something
went wrong during the running of the plugin. In this case, look at the error log:
Return to the Plugin Summary, then click the log file icon to see the error log:
Scroll to the bottom of the log to see error messages:
An Error status for the ERCC_Analysis plugin should be a rare event and indicates that the ERCC_Analysis plugin
itself failed to run. A plugin error does not indicate that the ERCC_Analysis results are bad.
ERCC resources
The External RNA Controls Consortium (ERCC) is hosted by the U.S. National Institute of Standards and
Technology. The plugin is for experiments that use ERCC Analysis ERCC RNA Spike-In Control Mixes, set of RNA
controls derived from the ERCC plasmid reference library.
For information on ERCC RNA Spike-In Control Mixes, please refer to the ERCC RNA Spike-In Control Mixes User
Version 3.2
- Page 55 -
(Pub no. 4455352). Guide
For more information on ERCC analysis, refer to the following resources:
Figure 2, Analysis of ERCC read counts, in Sensitivity of RNA-Seq using Ion semiconductor sequencing a
comparison to microarrays and qPCR
The Ion Torrent white paper Methods, tools, and pipelines for analysis of Ion PGM Sequencer miRNA and gene
expression data
The information on the product page. ERCC ExFold RNA Spike-In Mix
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports

The Run RecognitION plugin allows you tosubmit your best runs to the Ion Community leaderboards.The
Version 3.2
- Page 56 -
1.
2.
leaderboards are available on the Ion Community, and are organized in leagues according to chip type:
Your Torrent Suite software must be at least version 1.5.1 to use this plugin.
Running the RunRecognitION Plugin

Follow these steps to run to the RunRecognitION plugin:
Go to the report page for your run. Scroll down to the Plugin Summary section, and click Select plugins to
. run
In , click : Select a plugin RunRecognitION
Version 3.2
- Page 57 -
2.
1.
The leaderboard for your chip type is shown, with a message indicating where your ranks among the
leaderboard runs.
How Do I Submit My Run to the RunRecognitION leaderboard?

Follow these steps to submit a candidate run to the leaderboard:
Go to the report page for your run. Run the RunRecognitION plugin, as described in #Running the
. RunRecognitION Plugin
The Run RecognitION leaderboard is displayed for your chip type.
Version 3.2
- Page 58 -
1.
2.
3.
1.
2.
Scroll to the Ion Community Login section below the leaderboard. If you do not have an Ion Community
account, click to register. Enter your community user name and password. create an account
Optionally enter the any of this information about your run:

Your site name
The reference genome used in this run
The application type for this run
Below the information fields, click and carefully read that information. Click the Terms and Conditions
checkbox " ". I agree to the Terms and Conditions
Click at the bottom of the page. If your run qualifies, it is added to the leaderboard: Submit
Version 3.2
- Page 59 -
2.
What Information About Me Does RunRecognitION Make Public?

If your run is published to the leaderboard, your Ion Community user name and avatar are visible to other members
of the community.
Version 3.2
- Page 60 -
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
The IonReporterUploader Plugin
IonReporterUploaderPlugin
The IonReporterUploader plugin transfer results files directly from a Torrent Server analysis to your Ion Reporter
Software organization (available under a separate license).
You can run the plugin on a completed analysis, in the Report tab, or create a run plan that launches the plugin
automatically when the PGM sequencer analysis completes.
When you run the plugin, you have these options:
Transfer and analyze Select the Ion Reporter workflow to analyze the newly-transferred files. The Ion
Reporter analysis begins automatically when file transfer completes. In this release, only single-sample
workflows are supported.
Transfer but do not analyze automatically Select to have the files transferred to the No Workflow
server and imported into Ion Reporter application. An analysis is not automatically launched, but the
transferred files appear in the Search Sample page, and an analysis can be launched from the Ion
Version 3.2
- Page 61 -
1.
2.
3.
4.
5.
Reporter UI. Software
Do not transfer Select to turn off the plugin Do not upload or launch Ion Reporter Analysis
in a run plan. This feature prevents the unnecessary transfer of results when Auto-Run is set for the plugin.
This option does not appear in the Select Plugin to Run submission page.
There is a one-time configuration of the plugin in both the Ion Reporter UI and the Torrent Browser, Software
before the plugin can be used.
Role Requirements
An Ion Reporter administrator role must generate an authentication token in the Ion Reporter Software Software
UI. This token is used to configure the IonReporterUploader plugin in the Torrent Browser (as described below).
Either a regular user or an can configure the plugin in the Torrent Browser. ionadmin
Transfer Limitations
The following limitations apply to the Uploader plugin:
The Uploader plugin transfers results files for a completed run that executed on the Torrent Server where the
plugin is configured.
You cannot copy results file from a different Torrent Server and have the plugin transfer those files.
Only files appearing in the File Links section of a run report are transferred.
You cannot add supplemental files to the results files of a run, in order to have the plugin transfer those files.
Run the IonReporterUploader Plugin from a Run Report
Follow these instructions to run the plugin on a completed PGM analysis.
Log into your Torrent Browser, and go to the Reports tab.
Open the run report for the PGM sequencing data to be transferred, and scroll down to the Plugin
Summary section.
Check that the VariantCaller plugin is not in progress.
Click the button. Select Plugins to Run
Double-click the IonReporterUploader entry. The Ion Reporter Uploader submission screen opens:
Version 3.2
- Page 62 -
5.
6.
7.
8.
Do not change the pre-configured fields.
If you select an Ion Reporter workflow, the uploader plugin launches an analysis on the transferred results
files.
In the Launch Ion Reporter analysis section, select one of the following in the Ion Reporter workflow menu:
No Workflow The plugin transfers your files to the Ion Reporter system, but does not
automatically launch an analysis.
A specific workflow After the plugin transfers your files to the Ion Reporter system, it name
launches an analysis using the workflow you select with this menu.
Note:The list of workflow names is read from your Ion Reporter department. Please allow a moment for
the menu to be populated.
Click . Submit
Because of the large size of sequencing results files, file transfer typically takes some time. The Ion
Reporter analysis cannot be started until file transfer is complete.
Check the progress of the analysis on the import role tab or in the tab p Home Analysis > Analysis Tracker
age.
Add the IonReporterUploader Plugin to a Run Plan
To set a run plan to automatically transfer files (after the completion of the PGM analysis), use the Ion Reporter
menu on the Edit Plan page.
The plugin supports the following options:
Transfer and analyze Select the Ion Reporter workflow to analyze the newly-transferred files. The Ion
Reporter analysis begins automatically when file transfer completes. In this release, only single-sample
workflows are supported.
Version 3.2
- Page 63 -
Transfer but do not analyze automatically Select to have the files transferred to the No Workflow
server and imported into Ion Reporter application. An analysis is not automatically launched, but the
transferred files appear in the Search Sample page, and an analysis can be launched from the Ion
Reporter UI.
Do not transfer Select to turn off the plugin Do not upload or launch Ion Reporter Analysis
in a run plan. This feature prevents the unnecessary transfer of results when Auto-Run is set for the plugin.
This option does not appear in the Select Plugin to Run submission page.
The menu by default is set to not transfer:
The plugin supports automatic launch of an analysis on the transferred files. In this release, Ion Reporter
single-sample analyses are supported (related samples are not supported). For t a workflow: automatic launch, selec
To transfer files without analysis launch, select in the menu. No Workflow
Plugin Not Configured or Not Enabled
If the Uploader plugin is not enabled for Auto-Run, the Ion Reporter menu does not appear in in the Edit Plan
page.
If the Uploader plugin is not configured with the authentication token, the plan page provides a link to Ion Reporter
the Config tab:
Configure Ion Reporter for the Plugin
An generates an authentication token. Ion Reporter administrator
Version 3.2
- Page 64 -
1.
2.
3.
4.
5.
If a second authentication token is generated, the previous token becomes invalid immediately.
Configuration Limitation
You cannot configure the plugin to support more than one Ion Reporter organization on the Ion Reporter server.
Configure the IonReporterUploader Plugin
You configure the plugin in the Torrent Browser with the authentication token that an Ion Reporter administrator
generated in the Ion Reporter UI. The plugin is configured once, and then is available for all users on your Torrent
Server.
Follow these steps to configure your IonReporterUploader plugin:
Log into the Torrent Browser as either an or a regular user. ionadmin
Go to the tab and scroll down to the plugin section. Find the entry for IonReporterUploader. Config
Click the link for IonReporterUploader, and select : Manage Configure IonReporterUploader
The Ion Reporter Uploader Configuration page opens:
If the configuration page already contains an different authentication token, that
configuration might now be invalid.
Enter the authentication token from the Ion Reporter administrator in the authentication token field, and
Version 3.2
- Page 65 -
5.
6.
7.
8.
9.
click . Save
If the IonReporterUploader is not enabled, click that checkbox to enable it:
Torrent Browser plugins optionally support an Auto-Run feature. If Auto-Run is enabled for
IonReporterUploader, the plugin attempts to transfer all results files from all completed runs on this Torrent
Server. In most situations, this behavior is not appropriate and could be expensive. The run plan page
supports a plugin option to not transfer the results of run being planned.
If you enable Auto-Run for the plugin, select the plugin option in the Torrent Do not upload or launch
Browser Planning tab to avoid transferring files you do not want.
This configuration of the plugin makes all files transferred by the plugin available to the Ion Reporter
organization that generated the authentication key.
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
Version 3.2
- Page 66 -
The SampleID Plugin
The SampleIDPlugin
Ion AmpliSeq Sample ID Panel is a human SNP genotyping panel enabling accurate sample verification for
increased confidence in sample data management. The plugin is comprised of nine primer pairs that can be
combined with any Ion AmpliSeq Ready-to-Use or Custom Panel for the generation of a unique ID during
post-sequencing analysis of research samples.
The Ion AmpliSeq Sample ID Panel can be used in combination with any Ion AmpliSeq Ready-to-Use or
Custom Panel using the Ion AmpliSeq Designer 1.2 or greater. This plugin is compatible with the Ion Xpress
barcodes set.
Plugin output
Run the SampleID plugin automatically
Run the SampleID plugin manually
On-target metrics
Plugin output
Example plugin output is shown below:
Use the Sample ID column to verify sample fingerprints.
Click on a barcode ID to open the detail report:
With the detail report, you can review the IUPAC SNP calls and click a link in the TaqMan Assay ID column to
order the corresponding TaqMan Assay.
Version 3.2
- Page 67 -
1.
2.
Run the SampleID plugin automatically
You set up the plugin to run automatically when you configure your template. In the Plugin chevron of the template
wizard, you select which plugins run automatically on planned runs created from that template. See the p Templates
age in the . Torrent Browser User Interface Guide
Run the SampleID plugin manually
You can launch the plugin manually from a completed run report.
Follow these steps to run the plugin manually:
Open the run report and scroll down to the Plugin Summary button. Click . Select plugins to run
In the list, click . The sampleID plugin does not take user input. The plugin Select a plugin sampleID
executes immediately (depending on server load) when you click it in the list. Select a plugin
On-target metrics
When you use the SampleID Panel, lower-than-expected number of on-target reads may occur.To recover the
correct on-target reads metrics, add back the On-Target reads from the Sample ID Panel into the Ion AmpliSeq
Ready-to-Use or Custom Panel Coverage Analysis plugin data.
Version 3.2
- Page 68 -
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports

Torrent Browser Analysis Report Guide (v3.x)
Introduction
The Torrent Variant Caller (TVC) plugin calls SNP and indel variants in a sample across a reference or within a
targeted subset of that reference.
Using the Torrent Variant Caller plugin, you can perform six possible analysis typesby selecting one of three library
types (Whole Genome, Ion AmpliSeq, Ion TargetSeq) and one of two variant frequencies (Germ-line or Somatic)
. In addition, if you have Target Region and/or HotSpot Region files in BED format, you can upload them and select
them fromthe dropdown menu, and they will be applied to your analysis.
If you do not select a Target Regions file or a HotSpot Regions file, the Torrent Variant Caller
plugin assumes there are no targeted regions when it runs the analysis.
Version 3.2
- Page 69 -
1.
2.
3.
4.
1.
2.
Run the Torrent Variant Caller plugin
There are two ways to run the Torrent Variant Caller plugin: automatically, by preconfiguring the plugin to run as
soon as primary analysis has completed, or manually, allowing you to run the plugin at any time from a completed
run report.
The Torrent Variant Caller takes a significant amount of time to complete. Setting it up to run
automatically saves time compared to running it manually.
Run Torrent Variant Caller automatically
To run the Torrent Variant Caller plugin automatically, perform the following steps on the Torrent Browser before
running the chip on the PGM instrument:
If you have not previously uploaded BED files for your intended reference library, click the option References
in the Admin gear menu. Click the name of your reference (or " " for a new reference) and upload your Add
BED files. (Skip this step if you have already uploaded BED files for your reference. For information about
working with BED files, see the section in .) Work with BED Files Torrent Suite User Documentation
Click the tab in the Torrent Browser. In your template, Plan your run and select Run Type, Variant Plan
Frequency, and Reference. For information about templates and planning a run, see the and Plan Tab Templ
pages in the . ates Torrent Browser User Interface Guide
If the application type is AmpliSeq or TargetSeq, select the proper target and HotSpot region files. The menu
selections will depend on your selected reference.
Run the plan on the PGM or Protoninstrument (either by selecting the planned run or entering the plan's
For information about running a plan, see the "Work with Completed Runs" section in short code). theTorrent
. The Torrent Variant Caller runs automatically after primary analysis has Browser User Interface Guide
completed.
The Torrent Variant Caller plugin is not run if you select Generic Sequencing as the sequencing
run type.
Run Torrent Variant Caller Manually

To run the Torrent Variant Caller plugin manually, perform the following steps:
In the Torrent Browser, select a run report on the page or on a Data > Completed Runs & Reports Data >
page. Projects > projectname
On the run report page, scroll about halfway down the screen to the Plugin Summary area. Click Select
plugins to run. In the list of plugins, click on variantCaller.
Version 3.2
- Page 70 -
2.
3. The Torrent Variant Caller Plugin interface appears.
The first item, Reference Genome, displays the reference used for mapping. The same reference is used
for the variant caller run. The reference cannot be changed from within the Torrent Variant Caller Plugin
interface.
The TVC plugin supports multiple run analysis. The plugin can analyze a BAM file generated from
Combine Alignment on multiple reports in a project. Combine Alignment creates a new run report (in the
ou can open the new combined run report and use the button to same project). Y Select plugins to run
launch the TVC plugin.
Version 3.2
- Page 71 -
4. Select a Library Type for your analysis from the dropdown menu. Options include , Whole Genome Ion
, and . AmpliSeq Ion TargetSeq
The TVC plugin supports the various panels in the Ion AmpliSeq family of sequencing kits:
Ion AmpliSeq Cancer Panel
Ion AmpliSeq Comprehensive Cancer Panel
Ion AmpliSeq Inherited Disease Panel
Ion AmpliSeq Custom Panels
The TVC plugin can also analyze data generated from the Ion TargetSeq Exome kit.
When an is selected, a Trim Reads checkbox appears, for which the default Ion AmpliSeq product
setting is checked. This setting trims reads to amplicon targets, primarily to avoid variant sites being
covered by residual primers from overlapping amplicons.
The Ion TargetSeq allows you to specify Target Padding and whether to Use Unique Starts. option
Target Padding allows for calling variants the specified number of bases adjacent to a target region.
Checking Unique Starts will perform the variant calling using just one read starting at each reference
position for both read orientations. This removes bias due to non-uniform library enrichment but produces
a most conservative representation of target coverage. Checking this option can increase specificity and
reduce sensitivity.
5. Select a Variant Frequency for your analysis from the dropdown menu. Options include or Germ-line Somat
ic. Select Germ Line unless you are looking for low frequency variants (<20%); in that case, select Somatic.
6. If they are needed for your analysis, selectTargeted Regions or HotSpot Regions BED files by doing one of
the following:
If the Target Regions file and/or HotSpot regions files you want to use already appear in the dropdown
menu, select them.
If you want to use a Target Regions or HotSpot Regions file that is not already included as an option in
the dropdown menu, use the BED file uploader on a reference page to upload the BED file. Once you
have uploadeda new BED file, it appears in the dropdown menu, and youcan select it foruse in your
analysis.
If you do not select a Target Regions file or a HotSpot Regions file, the Torrent
Variant Caller plugin assumes there are no targeted regions when it runs the
analysis.
BED files provided by Life Technologies can be downloaded from the Ion Community.Use the BED file
uploader to include these filesas options in the dropdown menu.
For more information about BED files, see . Work with BED Files
7. When you are satisfied with your selections, click . The analysis runs and a group of output reports is Submit
created.
Torrent Variant Caller plugin output
The Torrent Variant Caller plugin output includes the following details reports:
Barcode Coverage and Variants Report
Variant Caller Report
Version 3.2
- Page 72 -
Variant Calls Summary
Variant Calls
Allele Coverage for All Bases in HotSpot Regions
In addition, there is a File Links section, which is a list of output files generated by the Torrent Variant Caller Plugin.
The plugin outputfiles can be loaded into the Broad Institute's IGVor other third-party tools for further visualization
or analysis.
Variant Caller results for analyses with a very large number of variants (such as exome or genome analyses) are
best viewed in Chrome or Firefox rather than Internet Explorer, because Internet Explorer runs Javascript more
slowly than other browsers, especially on large datasets. The workaround for using Internet Explorer is to confirm
continuing to run the scripts as many times as prompted until the results load.
You can hide report sections by clicking the collapse icon for a section, in hts header bar:
Barcode Coverage and Variants Report
The Barcode Coverage and Variants Report is a table that provides a summary list of reports per barcode. For each
barcode, various types of data are displayed that can help you evaluate the quality of your run.
Barcoded samples are represented by different colors. A successful barcode is shown with a clickable hyperlink, a
failed barcode is shown with a red term, and non-existent barcode is represented with a gray term.The following
table provides descriptions of the Barcode Coverage and Variants Report columns.
Column Description
Variant Caller Reports Individual reports for each barcode.For a
non-barcoded run, this report is not generated.
Mapped Reads Number of reads that map to the reference genome.
Reads On-Target Number of reads that overlap the target region.
Bases On-Target Number of bases that overlap the target region.
Read Depth Average coverage in all targeted regions. (The number
of bases in reads that overlap the targeted region,
divided by total length of the region.)
Version 3.2
- Page 73 -
1x Coverage Percentage of the targeted regionthat has at least 1x
coverage.
20x Coverage Percentage ofthe targeted region that has at least 20x
coverage.
100x Coverage Percentage ofthe targeted region that has at least
100x coverage.
Variants Detected Number of variants detected in the targeted region.
Variant Caller Report
Variant Caller Reports are individual reports (per barcode) which can be selected from the Barcode Coverage and
Variants Report shown above.
While the Barcode Coverage and Variants Report provides a summary of all available barcode reports, the Variant
Caller Report provides additional data, such as variant categories and information in HotSpot regions.
The following tables provide descriptions of the Variant Caller report columns.
Report Header
Column Description
Number of mapped reads Total number of reads mapped to the reference.
Version 3.2
- Page 74 -
Percent reads on target The percentage of reads mapped to any targeted
region relative to all reads mappedto the reference.
Number of mapped bases The total number of target bases covered by any
number of aligned reads.
Percent bases on target The percent of all bases covered by reads aligned to
the reference that covered bases in target regions.
Report Tables - Target Regions / HotSpot Regions
Column Description
Bases in target regions The total number of bases in all target regions of the
reference.
Average base coverage depth The average number of reads of all targeted reference
bases. This is the total number of base reads on target
divided by the number of targeted bases, and therefore
includes any bases that had no coverage.
Uniformity of coverage The percentage of target bases covered by at least
0.2x the average base coverage depth.
Coverage at 1x The percentage of target bases covered by at least1
read.
Coverage at 20x The percentage of target bases covered by at least 20
reads.
Coverage at 100x The percentage of target bases covered by at least100
reads.
Heterozygous SNPs Number of called heterozygous SNPs in target regions
or loci.
Homozygous SNPs Number of called homozygous SNPs in target regions
or loci.
Heterozygous INDELs Number of called heterozygous INDELs in target
regions or loci.
Homozygous INDELs Number of called homozygous INDELs in target
regions or loci.
Heterozygous SNPs and INDELs differ from the reference in only one copy of the chromosome,
while homozygous SNPs and INDELs differ from the reference in both copies of the
chromosome.
Version 3.2
- Page 75 -
Variant Calls Summary
The Variant Calls Summary table shows the number of variants per chromosome. In this table, you can select the
number of entries to display, filter the table based on search terms, or export the table for use with other third-party
data analysis tools.
You can use this report monitorthequality of your run on a per-chromosome basis. For example, if one
chromosome has an unexpected number of variants, this might indicate an issue with the run.
The following table provides descriptions of the Variant Calls Summary Report columns.
Column Description
Chromosome The chromosome (or contig) name in the reference
genome.
Variants The total number of variantscalled (in the target
regions of) the reference.
Het SNPs The total number of heterozygous SNPscalled (in the
target regions of) the reference.
Hom SNPs The total number of homozygous SNPs called (in the
Het INDELs The total number of heterozygous INDELs called (in the
Hom INDELs The total number of homozygous INDELs called (in the
HotSpots The total number of variants identified with one or more
HotSpots.
Variant Calls
The Variant Calls table has several interactive features, including the following:
Version 3.2
- Page 76 -
Multi-column sorting
Table search and filter
Paging and re-sizing
Column hiding, re-sizing and moving
Linking to IGV (Integrative Genomic Viewer)
Displaying up to 5 million records
Row selection for exporting data
The following table provides descriptions of the Variant Calls report columns.
Column Description
View Click to open the variant in the Broad Institute's IGV
Integrative Genomics Viewer to see all reads covering
the variant.
The IGV is hosted by the Broad
Institute, so internet connectivity is
required from the machine running
your web browser.Use of the IGV
also requires a Java Runtime
Environment installed on the
desktop.
Version 3.2
- Page 77 -
genome.
Position The one-based position in the reference genome.
Gene Sym Gene Symbol for the gene where the variant is located.
This value is not available (N/A) if no target regions
were defined (full genome was used).
Target ID Name of the target region where the variant is located.
This value is not available (N/A) if no target regions
were defined (full genome was used).
Var Type Type of variation detected: SNP (single nucleotide
polymorphism), MNP (multinucleotide polymorphism),
IN (insertion), or DEL (deletion).
Zygosity Assigned zygosity of the variation: HOM (homozygous),
HET (heterozygous), or NC (no call).
Ref The reference base(s).
Variant Variant allele base(s).
Var Freq Frequency of the variant allele.
P-value Estimated probability that the variant could be
produced by chance. (The smaller the p-value, the
higher the confidence in the variant call.)
Coverage The total reads covering the position.
Ref Cov The number of reads covering the reference allele.
Var Cov The number of reads covering the variant allele.
HotSpot ID The HotSpot ID for one or more startinglocations
matching the identifiedvariant.(Examples: cosmic ID,
dbSNP ID.)
Allele Coverage for all Bases in HotSpot Regions
The Allele Coverage for all Bases in HotSpot Regions report provides allele- and strand-specific coverage
information for each location of interest, as defined in a HotSpot BED file. The purpose of this table is to provide
investigators with additional informationabout locations of interest,in the event that a variant wasn't called atthe
location of interest and wasn't shown in theVariant callstable.
TheAllele Coverage for all bases inHotSpot regionsreport has been updated for the Torrent Suite 2.0 release. New
columns include: HotSpot ID, Cov (+), and Cov (-).
Version 3.2
- Page 78 -
The following table provides descriptions of the Allele Coverage for All Bases in HotSpot Regions report columns.
Column Description
genome.
Position The one-based position in the reference genome.
Target ID Name of the target region containing the HotSpot
variation site.
HotSpot ID Name of the HotSpot variant site (s) s overlapping
. (Examples: cosmic ID, dbSNP ID.) current position
Name(s) marked with a '*' have multiple start positions
or start position changed after LeftAlignment.
Ref The reference base(s).
Coverage The total reads covering the position.
A Number of reads calling A.
C Number of reads calling C.
G Number of reads calling G.
T Number of reads calling T.
INDEL Number of reads calling either an insertion or deletion
at this base location.
Cov (+) Number offorward reads aligned over the reference
base.
Version 3.2
- Page 79 -
Cov (-) Number ofreverse reads aligned over the reference
base.
File Links
The File Links section contains links to the plugin results files.The variant calls files (VCF files) are in VCF 4.1
format. The plugin outputfiles can be loaded into the Broad Institute's IGVor other third-party tools for further
visualization or analysis.If your run includes barcoded data, barcode file links also appear in this section.
The following table provides descriptions of the files available in the File Links section.
Link Description
Open internal IGV to import genome Opens the genome in the IGV browser.
Variant calls file Variant calls generatedby this plugin, in table format: t
extfile.xls
Allele counts file Coverage and allele information, in table format: textfil
e.xls
SNP calls file SNP calls generatedbythis plugin, in VCF format: bina
ryfile.vcf.gz
SNP calls VCF index file Index ofthe SNP calls file, generated from the SNP
calls file. Format: binaryfile.vcf.gz.tbi
INDEL calls file INDEL calls generated bythis plugin, in VCF format: bi
naryfile.vcf.gz
Version 3.2
- Page 80 -
INDEL calls VCF index file Index of the INDEL calls file, generated from the INDEL
calls file. Format: binaryfile.vcf.gz.tbi
Target regions file Target regions file generated by this plugin, in BED
format: textfile.bed
Target hotspots file Target HotSpots file generated by this plugin, in BED
format: textfile.bed
Mapped reads file Mapped reads file generated by this plugin, in BAM
format: binaryfile.bam
Mapped reads index file Index ofthe mapped reads file, generated from the
mapped reads file. Format: binaryfile.bai
TaqMan Assay Search
After running the TVC plugin, you can select variants from a report table and submit a search against the TaqMan
Assay Search webpage. When the search is submitted, you can choose which Assay database to search. TaqMan

A new browser window appears with the search results. If assays are available for the selected variant, TaqMan

you can immediately order the assay directly from the landing page. You must be connected to the internet to
access this feature.
To initiate a search, simply select variants from the TVC plugin report and click on the tool icon. A pop-up window
allows you to submit variants for TaqMan assay design.
Version 3.2
- Page 81 -
You are then presented with a list of validation assays that you can order from Life Technologies.
2012 Life Technologies Corporation. All rights reserved.

The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners.
Taqman is a registered trademark of Roche Molecular Systems, Inc.
Version 3.2
- Page 82 -
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
Version 3.2
- Page 83 -
The section of the Analysis Reportprovides information about the performance of each Test Fragment Summary
Test Fragment included in the experiment.
Test Fragments are used during analysis to predict the CF/IE/DR values for each Test Fragment,
regionally.Analysis results for a Test Fragmentare displayed when there are at least 1000 high-quality Test
Fragments, where there is an 85% match against the appropriate template in the Test Fragmentlist. This includes
CF/IE/DR estimates and performance calculations.
The number of TFs reported includes lower quality TFs, down to 70% match, to better represent
the run quality from all TF's.
Open the test fragment report

Open the test fragments report with the Test Fragments button, near the bottom of the run report:
Test fragment metrics
The Test Fragments report displays the following information:
Parameter Description
Test Fragment Test fragment name (defined in the Admin >
References tab of Torrent Browser).
Reads Number of filtered & trimmed reads identified for this
test fragment.
Version 3.2
- Page 84 -
Percentage 50AQ17 The percentage of reads for this with a test fragment
minimum of 50 base pairs in length and an error rate of
1 in 50, Phred-like 17, or better. Quality is based on
alignment, not predicted quality.
The test fragment sequence is also shown in the read length histogram.
Read length histogram
This is a histogram of read lengths, in units, that have a Phred-like score of 17 or better, or one error in 50 bp bp
(the ends only are shown because of width considerations):
Distributions skewed to the right are ideal, showing longer read lengths (test fragments are a discrete length).It is
likely that the sequence can extend all the way through the , if enough flows are run, so the histogram test fragment
only displays a maximum size based on the length of the . test fragment
Version 3.2
- Page 85 -
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
Version 3.2
- Page 86 -
Report Information
Report Information
This section describes the following run report buttons:
Analysis Details
Software Version
Support
Analysis Details
The report displays the following information: Analysis Details
Run Name Name of the run.
Version 3.2
- Page 87 -
Run Date Date and time the PGM run was started. or Proton
Run Cycles Number of PGM cycles analyzed for this or Proton
report. Note that this number can differ from the total
number of cycles run on the sequencer.
Run Flows Number of PGM nucleotide flows or Proton
analyzed for this report. Note that this number can
differ from the total number of flows occurring on the
sequencer.
Project Names of the projects the result set is a member of.
Sample Name of the sample assigned to the run used to
generate this analysis. This is assigned on the PGM
sequencer. or Proton
Library Name of the library assigned to the run used to
generate this analysis. This library name is used to
specify the reference genome used for alignment.
PGM Name of the PGM or Proton sequencer on which
the run was performed. This value is typically entered
on the sequencer.
Flow Order Flow order selected on PGM sequencer: or Proton

Samba = TACGTACGTCTGAGCATCGATCGATGTACAGC [
Default]
Regular = TACG

The "regular" flow order adds bases most rapidly to
sequenced molecules but is vulnerable to phase errors.
The Samba flow order consists of a 32-base sequence,
repeated. This flow order resists phase errors by
providing opportunities for out-of-phase molecules to
catch up and is designed to sample all dimer
(nucleotide pair) sequences, efficiently. Samba is the
default flow order because itimprove sequencing
accuracy for longer reads by resisting phase errors.
Library Key A short known sequence of bases used to distinguish
the library fragment from the test fragment.Example:
"TCAG"
TF Key A short known sequence of bases used to distinguish
the test fragment.
Chip Check A series of tests on reference wells (about 10% of the
chip in non-addressable areas) is performed to ensure
that the chip is functioning at a basic level. The value of
this field is either or . Passed Failed
Version 3.2
- Page 88 -
Chip Type Type of chip used on the PGM . Usually, sequencer
314, 316, or 318 (for the Ion 314 chip, Ion 316
chip, and Ion 318 chip.) A letter follows the numbers,
indicating the chip version.
Chip Data In this release, the value is , for a forward run. single
Notes A space for text notes entered during the PGM or Pr
sequencer run. oton
Barcode Set The name of the barcode set assigned to the run.
Blank for non-barcode libraries.
Analysis Name Name of the analysis provided in Torrent Browser when
the analysis was initiated. If the analysis was scheduled
to auto-start, this is the default analysis name.
Analysis Date Date the analysis was performed.
Analysis Flows Number of PGM nucleotide flows or Proton
analyzed for this report. Note that this number can
differ from the total number of flows occurring on the
PGM sequencer. or Proton
runID The run code that the Torrent Browser assigned to the
planned run for this analysis.
Software Version
The report display includes version information for the Torrent Suite Software and its modules Software Version
installed on your Torrent Server.
The version numbers shown in the example may be different from your current version of the
software depending on the age of the analysis. See the About tab in the Torrent Browser for a
complete list of modules and version on your server. See the Torrent Suite Release Notes for
the package versions in a specific release.
Version 3.2
- Page 89 -

Torrent Suite Version of Torrent Suite software used to generate the
analysis.
Datacollect Version of the Datacollect package.
Graphics Version of the Graphics package
LiveView Version of the LiveView package.
Script Version of the Script package.
host Host name where the Torrent Server is installed.
ion-alignment Version of the Torrent Suite alignment module used for
this analysis.
ion-analysis Version of the Analysis Pipeline used to generate the
analysis.
ion-gpu Version of the NVIDIA Tesla GPU driver.
ion-pipeline Version of the analysis pipeline.
Support
The Support button opens links to the following:
Download the Customer Support Archive Download a ZIP archive containing the PDF and HTML
Version 3.2
- Page 90 -
version of the run report as well as useful logs in case troubleshooting is required.
Download the New Customer Support Archive Generate a new customer support archive and download
it.
View the Report Log View the error log for this run report.
An example report log is shown below (chopped for width considerations):
Version 3.2
- Page 91 -
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
Version 3.2
- Page 92 -
CSV Metric File Format
A Comma-Separated Value (CSV) file is a universal text file format for storing data. You can download an analysis
metrics CSV file that contains analysis-level information for each Torrent Server analysis run, using the Torrent
Browser list view. Data > Completed Runs & Reports
In the CSV file, each line represents a Torrent Server analysis run, and within each line information fields are
separated by a comma. These files are easily opened using spreadsheet software, such as Microsoft Office Excel or
Open Office Calc, where each comma-separated field is listed in a separate column. The Torrent Browser CSV file
has 82 CSV fields per entry, as described in the following table:
Field Description
Report Name of the analysis run report
Status Status of the analysis (e.g., Started, Complete)
Cycles Number of flow cycles from the actual sequencing run
Plugin Data JSON string of plugin data
TF Name* Test Fragment Name
Q10 Mean* Average Q10 read length.
Q17 Mean* Average Q17 read length
Q10 Mode* Mode Q10 read length
Q17 Mode* Mode Q17 read length
System SNR* System Signal-to-Noise Ratio
50Q10* Number of TF Ion Sphere Particles (ISP) at 50+ bp at
Q10
50Q17* Number of TF Ion Sphere Particles (ISP) at 50+ bp at
Q17
Keypass Reads* Number of reads that have test fragment keys
CF* CAFIE metric: Carry forward
IE* CAFIE metric: Incomplete extension
DR* CAFIE metric: Signal/polymerase loss (droop)
TF Key Peak Counts* Signal strength of the first three bases of the TF key
Version 3.2
- Page 93 -
Total_Num_Reads Total number of reads
Library_50Q10_Reads Reads of length at least 50bp with 90% or greater
accuracy
accuracy
accuracy
Library_Mean_Q10_Length Average length of reads with 90% or greater accuracy
Library_Q10_Coverage Average per base coverage considering reads with
90% or greater accuracy
Library_Q10_Longest_Alignment Longest read length amongst reads with 90% or
greater accuracy
Library_Q10_Mapped Bases Total bases from reads with 90% or greater accuracy
Library_Q10_Alignments Number of alignments from reads with 90% or greater
accuracy
accuracy
accuracy
accuracy
greater accuracy
Library_Q17_Mapped Bases Total bases from reads with 98% or greater accuracy
accuracy
accuracy
Version 3.2
- Page 94 -
accuracy
accuracy
greater accuracy
Library_Q20_Mapped_Bases Total bases from reads with 99% or greater accuracy
accuracy
Library_Key_Peak_Counts Signal strength of the first three bases of the library key
Library_50Q47_Reads Number of perfect reads of length at least 50bp
Library_Mean_Q47_Length Average length of perfect reads
Library_Q47_Coverage Average per base coverage considering only perfect
reads
Library_Q47_Longest_Alignment Longest reads length amongst perfect reads
Library_Q47_Mapped_Bases Total bases from perfect reads
Library_Q47_Alignments Number of alignments from perfect reads
Library_CF CAFIE metric: Carry forward
Library_IE CAFIE metric: Incomplete extension
Library_DR CAFIE metric: Signal/polymerase loss (droop)
Library_SNR System Signal-to-Noise Ratio
Sample Name of the sample
Version 3.2
- Page 95 -
Project Name of the project to which the sample belongs
Library Name of the reference genome
Notes Any additional user-provided notes
Run Name Long name of the analysis run
PGM Name Name of the PGM where the sample was sequenced
Run Date Date the sample was sequenced
Run Directory Location of the raw DAT files on the Torrent Server
Num_Washouts NA
Num_Dud_Washouts NA
Num_Washout_Ambigous NA
Num_Washout_Live NA
Num_Washout_Test_Fragment NA
Num_Washout_Library NA
Library_Pass_Basecalling NA
Library_pass_Cafie NA
Number_Ambiguous NA
Number_Live Number of wells producing a signal
Number_Dud Number of wells with ISPs but no signal
Number_TF Number of wells containing test fragment
Number_Lib Number of wells containing library
Number_Bead Number of wells containing beads
Library_Live Number of wells containing library ISP with signal
Library_Keypass Number of wells containing library ISP with signal and
match key
Version 3.2
- Page 96 -
TF_Live Number of wells containing test fragment ISP with
signal
TF_Keypass Number of wells containing test fragment ISP with
signal and match key
Keypass_All_Beads Number of wells containing ISP with signal and match
key
* Columns 5-17 contain test fragmentmetric. There is one row of metrics for each test fragment: A through D. The
other columns contain library read metrics.
Version 3.2
- Page 97 -
Pre-3.0 Run Reports
Pre-3.0 Run Reports
This section describes the old style run reports used before release 3.0. The old style run report use an older layout
and do not offer 3.x features.
To view analysis runs generated with earlier version of the Torrent Suite software, you must either re-analyze the
run to create a 3.x-style run report or use the older report format.
Some features that previously were available in run reports are moved in 3.x releases. For example, in 3.x, to
combine alignments you create a project, use a template that creates run results in that project, and use the Data >
button. This button replaces the combinAlignments plugin that was Projects > > Combine Selected... projectname
available in previous releases.
Contents
(3.x) Torrent Browser Analysis Report Guide
Pre-3.0 Run Reports
Pre-3.0 Library Summary Overview
Pre-3.0 Library Summary Report
Pre-3.0 Barcode Reports
Pre-3.0 Test Fragment Report
Pre-3.0 Ion Sphere Particle Summary
Pre-3.0 Report Information
Pre-3.0 File Links
Pre-3.0 Plugin Summary
Pre-3.0 Running the Installed Plugins
(3.x) Alignment Plugin
(3.x) Coverage Analysis Plugin
(3.x) ERCC Analysis Plugin
(3.x) Run RecognitION Plugin
(3.x) sampleID Plugin
(3.x) Torrent Variant Caller Plugin
Pre-3.0 Library Summary
Version 3.2
- Page 98 -
Pre-3.0 Library Summary
This section provides background information and a detailed description of the report. Library Summary
Library Summary Overview
Library Summary Report
Contents
Run Report Metrics
Barcode Reports
Report Information
Output Files
Plugin Summary
Alignment Plugin
sampleID Plugin
Pre-3.0 Run Reports
This section of the Torrent Browser Analysis Report gives performance metrics for reads whose Library Summary
initial bases match the library key.
These reads are generated from the input library, not from the positive control Test Fragments.
Performance is measured based on either predicted quality or quality as measured following alignment.
Version 3.2
- Page 99 -
1.
2.
3.
Using Predicted Quality (Q17/Q20)
Using Quality Following Alignment (AQ17/AQ20)
Using Predicted Quality (Q17/Q20)
The number of called bases with a predicted quality of Q17 or Q20 is reported. The predicted quality values are
reported on the Phred scale, defined as (error probability). Q20, therefore, corresponds to a predicted -10log10
error rate of one percent and Q17 corresponds to a predicted error rate of two percent.
Refer to for a more complete description of http://en.wikipedia.org/wiki/Phred_quality_score
Phred values.
Using Quality Following Alignment (AQ17/AQ20)
Alignment of reads can be a useful process to assess the quality of the sequencing reaction and the quality of the
underlying library where an accurate reference is available. Reads are aligned to a reference genome. Any
discrepancy in alignment to a reference (whether biological or technical, meaning a real variant or a sequencing
error) is listed as a mismatch. Alignment performance metrics are reported depending on how many misaligned
bases are permitted. Torrent Suite reports alignment performance at three quality levels:
AQ17
AQ20
Perfect
How Is Aligned Read Length Calculated?
The aligned length of a read at a given accuracy threshold is defined as the greatest position in the read at which
the accuracy in the bases up to and including the position meets the accuracy threshold. So for example the AQ17
length of a read is the greatest length at which the read error rate is 2% or less, and the AQ20 length is the greatest
length at which the error rate is 1% or less. The "perfect" length is simply the longest perfectly aligned segment.
For all of these calculations the alignment is constrained to start from position 1 in the read - in other words, no 5'
clipping is permitted.
The underlying assumption is that the reference to which the read is aligned represents the true sequence that
should have been seen. Suitable caution should be taken when interpreting AQ17 values in situations where the
sample sequenced has substantial differences relative to the reference used, such as working with alignments to a
rough draft genome or with samples that are expected to have high mutation rates relative to the reference used. In
these situations the AQ17 lengths might be short even when sequencing quality is excellent.
Specifically, the AQ20 length is computed as follows:
Every base in the read is classified as being correct or incorrect according to the alignment to the reference.
At every position in the read the total error rate is computed up to and including that position.
The greatest position at which the error rate is one percent or less is identified and that position defines the
AQ20 length.
For example, if a 100bp read consists of 80 perfect bases followed by 2 errors followed by 18 more perfect bases,
the total error rate at position 80 is zero percent. At position 81 the total error rate is 1.2% (1/81), at position 82 the
error rate is 2.4%, continuing up to position 100 where it is two percent (2/100). The greatest length at which the
error rate is one percent or less is 80 and the greatest length at which the error rate is two percent or less is 100, so
the AQ20 and AQ17 lengths are 80 and 100 bases, respectively.
How Is Alignment Performed?
Version 3.2
- Page 100 -
Within Torrent Browser, the objective is to provide you with a view on alignment that helps determine run and library
quality.
There are many alignment algorithms available within the marketplace and you are encouraged to
consult with a bioinformatician for the most appropriate alignment algorithm for your downstream analysis
needs. Alignment algorithms are also embedded in many of the commercial software tools available
within the Ion Torrent Web store. You are also encouraged to experiment with these tools.
Alignment within Torrent Browser is performed using TMAP. TMAP is currently an unpublished alignment algorithm,
created by the authors of the BFAST algorithm. Please, contact Ion Torrent Technical Support for more information
about TMAP.
Technical Note - Analysis Pipeline
Technical Note - TMAP Alignment
Although TMAP is unpublished and a reference is not currently available, the precursor to TMAP,
BFAST, is based on the ideas in the following publications:
BFAST: An alignment tool for large scale genome resequencing.
PMID: 19907642
PLoS ONE. 2009 4(11): e7767. http://dx.doi.org/10.1371/journal.pone.0007767
Local alignment of two-base encoded DNA sequence.
BMC Bioinformatics. 2009 Jun 9;10(1):175.
PMID: 19508732 http://dx.doi.org/10.1186/1471-2105-10-175
Which Reads Are Used in the Alignment Process?
The alignment stage involves aligning reads produced by the pipeline to a reference genome and extracting metrics
from those alignments. By default, Torrent Suite aligns all reads to the genome, however there may be situations,
particularly with large genomes, where the alignment takes longer than the user is willing to wait. So for such
circumstances the Torrent Suite also has the capability to define on a per-reference basis the maximum number of
reads that should be aligned from a run. For more detail on how to enable and specify this reference-specific limit
see the Adding a Reference Sequence section of . Working with Reference Sequences
When the number of reads in a run exceeds a genome-specific maximum, a random sample of reads is taken and
results are extrapolated to the full run. By sampling a quickly-aligned subset of reads and extrapolating the values
to the full run, the software gives you enough information to be able to judge the quality of the sample, library and
sequencing run for quality assessment purposes.
The outputs of the alignment process is a BAM file. The BAM file includes an alignment of all reads, including the
unmapped, with exactly one mapping per read. When a read maps to multiple locations, the mapping with the best
mapping score is used. If more than one such mapping exists, a random mapping is used and given a mapping
quality of zero.
If sampling is in effect for a run and full read alignment is needed, the analysis can be manually
re-run using the tab option and checking the ch Runs Advanced Override alignment sampling
eckbox.
Version 3.2
- Page 101 -
Contents
Pre-3.0 Run Reports
Pre-3.0 File Links
Performance, based on either predicted quality or quality as measured following alignment, is provided in the Librar
section of the Detailed Report. This section of the report contains the following information: y Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
The section gives performance Based on Predicted Per-Base Quality Scores - Independent of Alignment
measurements based on predicted quality:
Version 3.2
- Page 102 -
Total Number of Bases [Mbp] Number of filtered and trimmed million base pairs
reported in the SFF and FASTQ files.
Number of Q20 Bases [Mbp] Number of bases with predicted quality of Q20 or
greater.
Total Number of Reads Total number of filtered and trimmed reads
independent of length reported in the SFF and FASTQ
files.
Mean Length [bp] Average length, in base pairs, of all filtered and
trimmed library reads reported in the SFF and FASTQ
files.
Longest Read [bp] Maximum length, in base pairs, of all filtered and
trimmed library reads reported in the file.
. Trimming
Read Length Histogram
The is a histogram of the trimmed lengths of all a reads present in the SFF file. The Read Length Histogram
following figure illustrates an example graph:
Consensus Key 1-Mer
The graph shows the strength of the signal from the first three one-mer bases of the library Consensus Key 1-Mer
key. This graph represents the consensus signal measurement of release of H+ during nucleotide incorporation.
Version 3.2
- Page 103 -
The y-axis shows signal strength, measured in , which is an arbitrary but consistent unit of measure. The Counts
x-axis shows time as nucleotide over the chip. Flows
There is a known key at the beginning of every library read. Typically, three bases are shown of the 4-mer key. Note
that the graph is displayed in "flow order" rather than "base order." For example, the four-base library key is typically
TCAG for nucleotides one through four and is graphed as TCA, representing the nucleotide flow order. Negative
flows are not displayed.
Q: If the library key is 4 bases, why are only three bases displayed in the key one-mer graph?
A: The next base after the last key base is the first library base. This base varies depending on the library
fragment. If the last key base is a G and the first library base is a G, both of these are incorporated in the
same flow resulting in a signal roughly 2X of a one-mer. Thus, the last base of the library read is not
informative for quality purposes because that flow can contain library information in addition to key
information. The one-mer key pass graph only contains n-1 flows for an n-mer library key.
Reference Genome Information
The includes the : Library Summary Reference Genome Information
Genome Name Name of reference genome.
Genome Size Number of bases in the reference genome.
Genome Version Version information for the genome used.
Index Version Version information for the genome index used.
If an alignment error occurred, a message prompts you to view the report log for information about the error.
Based on Full Library Alignment to Provided Reference
Version 3.2
- Page 104 -
This section of the report shows performance as measured following alignment. Library Summary
Total Number of Bases [Mbp] Number of million of base pairs that have been aligned
to the genome at the specified quality level.
Mean Length [bp] Average length, in base pairs, of all library reads that
aligned to the genome at and (the longest Q20 Perfect
perfectly aligned segment).
Longest Alignment [bp] Maximum length, in base pairs, of all library reads that
aligned to the genome at a specific quality level.
Mean Coverage Depth Average number of times that a base was
independently sequenced and aligned to the reference
genome. 1X means that every base was sequenced
and aligned, on average, once. 2X means that every
base was sequenced and aligned, on average, twice.
Percentage of Library Covered [bp] Percentage of the reference genome that is covered at
a minimum of 1X by filtered library reads at a specific
quality.
Using the TMAP Alignment Algorithm
When the reference genome is a large genome, alignment is performed on a random subset of the reads in the SFF
and FASTQ files. You can specify sampling and the number of reads to sample on a per-genome basis. Sampling
only occurs if this number is set during reference upload. Otherwise, complete alignment is performed. The values in
this table areextrapolated to the full number of reads.
Refer to the section of the for Work with Completed Runs Torrent Browser User Interface Guide
a description of how to use the flag to force all reads to be used Override alignment sampling
for alignment.
Read Alignment Distribution
Summarizing the alignments produces the following report format:
Version 3.2
- Page 105 -
The number of rows displayed varies depending on the read length.
Each column showsdata based on alignment of the sample.
Column Description
Read Length [bp] The number of bases in each read considered for the
row in the table.
Reads Number of reads with at least bases. Read Length
Unmapped Number of reads that TMAP could not map.
Excluded Number of reads mapped but not having 90% accuracy
in first 50 bases.
Clipped Number of reads mapped and with accuracy of greater
than 90% in first 50 bases, but with align length less
than the threshold. Read Length
Perfect Number of aligned reads with zero mismatches in the
first bases. Read Length
1 mismatch Number of aligned reads with one mismatch in the first
bases. Read Length
2 mismatches Number of aligned reads with two or more mismatches
in the first bases. Read Length
SAM/BAM files for reports with sampled data only include alignment information for the sampled
subset.
Version 3.2
- Page 106 -
Contents
Pre-3.0 Run Reports
Pre-3.0 File Links
The Barcode Reports section displays histograms for the following metrics per barcode:
Chart Description
Total number of reads Total number of filtered and trimmed reads
independent of length. This number is reported in the
barcode SFF and FASTQ files.
AQ20 Bases Number of base pairs of sequence from reads with
aligned quality score of AQ20 or better.
Mean AQ20 read length An AQ20 read length is the length, in units, that after bp
alignment has a Phred-like score of 20 or better, or one
error in 100 bp. This histogram charts the mean of
these AQ20 read lengths per barcode.
Version 3.2
- Page 107 -
AQ20 Reads The number of reads with an aligned quality score of
AQ20 or better.
The number of barcodes shown in the reports varies according to the barcode set used in your run and on the
Version 3.2
- Page 108 -
barcodes actually present in the sample. Only data for barcodes present in the run are displayed in the chart.
Each bar is labeled with the barcode ID. Data labeled as barcode ID X reports the number of unclassified barcodes:
reads which could not be classified as matching one of the expected barcodes in the barcode set.
Contents
Pre-3.0 Run Reports
Pre-3.0 File Links
The section of the Analysis Reportprovides information about the performance of each Test Fragment Summary
Test Fragment included in the experiment.
The report has a heading for each Test Fragment, in the form . Test Fragment - <TestFragmentName>
Test Fragments are used during analysis to predict the CF/IE/DR values for each Test Fragment,
regionally.Analysis results for a Test Fragmentare displayed when there are at least 1000 high-quality Test
Fragments, where there is an 85% match against the appropriate template in the Test Fragmentlist. This includes
CF/IE/DR estimates and performance calculations.
Version 3.2
- Page 109 -
The number of TFs reported includes lower quality TFs, down to 70% match, to better represent
the run quality from all TF's.
Test Fragment Summary

The part of the displays the following information: Test Fragment Summary Test Fragment Report
Test Fragment List
Consensus Key 1-Mer

The Consensus Key 1-Mer graph shows the strength of the signal from the first three one-mer bases of the Test
Fragment key. This graph represents the consensus signal measurement of release of H+ during nucleotide
incorporation.
The y-axis shows signal strength, measured in Counts, which is an arbitrary but consistent unit of measure. The
x-axis shows time as nucleotide Flows over the chip.
There is a known key at the beginning of every read. Typically, three bases are shown of the 4-mer key. Note that
the graph is displayed in "flow order" rather than "base order." For example, the four-base Test Fragment key is
typically ATCG for nucleotides one through four and is graphed as ATC, representing the nucleotide flow order.
Negative flows are not displayed.
Quality Metrics
Version 3.2
- Page 110 -
The part of the displays the following information: Quality Metrics Test Fragment Report
TF Name Test Fragment name, as defined in the tab Templates
of Torrent Browser.
TF Seq Test Fragment sequence.
Num Number of filtered & trimmed reads identified for this
Test Fragment.
Avg Q17 read length Average read length with Q17, or better, for this Test
Fragment.
50AQ17 Number of reads for this Test Fragment with a
minimum of 50 base pairs in length and an error rate of
1 in 50, Phred-like 17, or better. Quality is based on
alignment, not predicted quality.
Graphs
The part of the displays the following information: Graphs Test Fragment Report
AQ17 Read Lengths

The graph is a histogram of read lengths, in units, that have a Phred-like score of 17 or AQ17 Read Lengths bp
better, or one error in 50 bp.
Distributions skewed to the right are ideal, showing longer read lengths (remembering that Test Fragments are a
discrete length). It is likely that the sequence can extend all the way through the Test Fragment, if enough flows are
run, so the histogram only displays a maximum size based on the length of the Test Fragment.
Version 3.2
- Page 111 -
Average Corrected Ionogram
In the graph, the x-axis is in flow space and the y-axis shows the signal intensity. Average Corrected Ionogram
A unit of one indicates that there is only one base. A unit of two indicates that there are two bases of that specific
nucleotide incorporated during the single flow event.
Version 3.2
- Page 112 -
Contents
Pre-3.0 Run Reports
Pre-3.0 File Links
Pre-3.0Ion Sphere Particle (ISP) Summary
The section of the Analysis Report gives summary statistics Ion Sphere Particle (ISP) Identification Summary
of Ion Sphere Particle performance:
Version 3.2
- Page 113 -
This section of the report is available before the or sections, providing Library Summary Test Fragment Summary
a quick determination of whether or not the analysis should be permitted to continue.
The report displays:
Well Information
The data generated in this section are created "early" in the analysis process, before base
calling, and are intended to be a coarse, initial assessment of run performance. The well data are
subject to more stringent filtering in later stages of the analysis.
Parameter Description Percentage

Total Addressable Wells Total number of addressable wells. Not calculated
Version 3.2
- Page 114 -
Wells with ISPs Number (and percentage of
addressable wells) of wells that
were determined to be "positive" for
the presence of an ISP within the
well. "Positive"is determined by
measuring the diffusion rate of a
flow with a different pH. Wells
containing ISPs have a delayed pH
change due to the presence of an
ISP slowing the detection of the pH
change from the solution.
Wells with ISPs / Total Addressable
Wells
Live ISPs Number (and percentage of wells
with ISPs) of wells that contained
an ISP with a signal of sufficient
strength and composition to be
associated with the library or Test
Fragment key. This value is the
sum of the following categories:
Test Fragment
Library
Live ISPs / Wells with ISPs
Test Fragment ISPs Number (and percentage of Live
ISPs) of LiveISPs with a key signal
that was identical to the Test
Fragment key signal.
Test Fragment ISPs / Live ISPs
Library ISPs Number (and percentage of Live
ISPs) of Live ISPsthat have a key
signal identical to the library key
signal. These reads are input into
the Library filtering process.
Library ISPs / Live ISPs
Library ISP Details
The Library ISP Details table is available after basecalling and read filtering are complete.This tableprovides
information on a collection of read filters, which are applied after basecalling to ensure only high-quality reads are
written to the final results.
The Polyclonal filter removes ISPs carrying clones from two or more templates.
The Primer dimer filter removes reads carrying an insert of fewer than 8 bp.
The Low quality filter removes reads that fail to attain a high level of accuracy.
Version 3.2
- Page 115 -
Parameter Description Percentage

Library ISPs/Percent Enrichment Predicted number of Live ISPs that
have a key signal identical to the
library key signal (the same value
as shown in the Well Information
table).
The value Percent Enrichment
reported is the number of loaded
ISPs that are Library ISPs, after
taking out Test Fragment ISPs.
Library ISPs / (No. of Loaded ISPs
minus TF ISPs)
Filtered: Polyclonal ISPs carrying clones from two or
more templates.
Polyclonal ISPs / Library ISPs
Filtered: Primer dimer Insert length of less than 8 bp. Primer dimer ISPs / Library ISPs
Filtered: Low quality Low or unrecognizable signal. Low quality ISPs / Library ISPs
Final Library Reads Number (and percentage of Library
ISPs) of reads passing all filters,
which are recorded in the SFF and
FASTQ files.
This value may be different from the
located in Total number of reads
the Library Summary Section due to
technicalities associated with read
trimming beyond a minimal
requirement resulting in Total
being slightly less number of reads
than . Final Library Reads
Final Library / Library ISPs
Chip Loading Image
The section includes a Chip Loading Image, similar to the image Ion Sphere Particle Identification Summary
shown in the following figure:
Version 3.2
- Page 116 -
This is a pseudo-color image of the Ion CHIP showing percent loading across the physical surface.
The percentage is displayed above the image, with the percentage value that considers Loading Density
onlypotentially addressable wells.
Contents
Pre-3.0 Run Reports
Pre-3.0 File Links
Version 3.2
- Page 117 -
Pre-3.0Report Information
Analysis Info
The report displays the following information: Analysis Info
Run Name Name of the PGM sequencer run entered. This value
is typically entered on the PGM sequencer.
Run Date Date and time the PGM run was started.
Version 3.2
- Page 118 -
Analysis Name Name of the analysis provided in Torrent Browser when
the analysis was initiated. If the analysis was scheduled
to auto-start, this is the default analysis name.
Analysis Date Date the analysis was performed.
Analysis Cycles Number of PGM cycles analyzed for this report. Note
that this number can differ from the total number of
cycles run on the PGM sequencer.
Analysis Flows Number of PGM nucleotide flows analyzed for this
report. Note that this number can differ from the total
number of flows occurring on the PGM sequencer.
Project Name of the project assigned to the run. This is
typically assigned on the PGM sequencer.
Sample Name of the sample assigned to the run used to
generate this analysis. This is assigned on the PGM
sequencer.
Library Name of the library assigned to the run used to
generate this analysis. This library name is used to
specify the reference genome used for alignment.
PGM Name of the PGM sequencer where the run was
performed.
Chip Check A series of tests on reference wells (about 10% of the
chip in non-addressable areas) is performed to ensure
that the chip is functioning at a basic level. The value of
this field is either or . Passed Failed
Chip Type Type of chip used on the PGM. Usually, 314, 316, or
318 (for the Ion 314 chip, Ion 316 chip, and Ion
318 chip.) A letter follows the numbers, indicating the
chip version.
Barcode Set The name of the barcode set assigned to the run.
Blank for non-barcode libraries.
Notes A space for text notes entered during the PGM
sequencer run.
Version 3.2
- Page 119 -
Flow Order Flow order selected on PGM sequencer:

Samba = [ TACGTACGTCTGAGCATCGATCGATGTACAGC
Default]
Regular = TACG

The "regular" flow order adds bases most rapidly to
sequenced molecules but is vulnerable to phase errors.
The Samba flow order consists of a 32-base sequence,
repeated. This flow order resists phase errors by
providing opportunities for out-of-phase molecules to
catch up and is designed to sample all dimer
(nucleotide pair) sequences, efficiently. Samba is the
default flow order because itimprove sequencing
accuracy for longer reads by resisting phase errors.
Library Key A short known sequence of bases used to distinguish
the library fragment from the Test Fragment.Example:
"TCAG"
Software Version
The report display includes version information for the modules installed on your Torrent Server. Software Version
The version numbers shown in the example may be different from your current version of the
software depending on the age of the analysis. See the About tab in the Torrent Browser for a
complete list of modules and version on your server. See the Torrent Suite Release Notes for
the package versions in a specific release.

Version 3.2
- Page 120 -
Torrent Suite Version of Torrent Suite software used to generate the
analysis.
Datacollect Version of the Datacollect package.
LiveView Version of the LiveView package.
Script Version of the Script package.
ion-alignment Version of the Torrent Suite alignment module used for
this analysis.
ion-analysis Version of the Analysis Pipeline used to generate the
analysis.
ion-dbreports Version of the ion-dbreports package.
ion-gpu Version of the NVIDIA Tesla GPU driver.
ion-plugins Version of the pre-installed plugins.
ion-torrentR Version of the TorrentR stats package.
tmap Version of the TMAP alignment package.
Version 3.2
- Page 121 -
Contents
Pre-3.0 Run Reports
Pre-3.0 File Links
Pre-3.0 File Links
Pre-3.0File Links
These links permit you to directly download the data and report files.Some files are compressed, using the for .zip
mat, to provide data integrity and to reduce download time.
Right-click the wanted file type and follow the dialog to save the file to your local computer. Most Save link as
outputfiles can be loaded into third-party viewers (such as IGV) for visualization. The barcode links only appear for
runs on barcoded data.
Version 3.2
- Page 122 -
File Type Description
Library Sequence (SFF) Compressed (.zip) Standard Flowgram Format (SFF)
-formatted file that contains "flow space" data.
The bases called in a run are stored in two formats:
SFF and FASTQ. Both files contain the nucleotide
calls and associated quality values, the SFF files,
additionally, contain signal values in flow space and a
mapping between sequence and flow spaces.
The data are organized on a per flow basis, and
contain information about nucleotide flows that both did
and did not result in base incorporation. (See Technical
.) Note - Filtering and Trimming
Library Sequence (FASTQ) Compressed (.zip)FASTQ-formatted file containing
data organized in a per-base basis, including quality
scores. The reads contained in the file are unaligned
reads. (See .) Technical Note - Filtering and Trimming
Library Alignments (BAM) Binary Sequence Alignment/Map (BAM), is a
compressed, binary form of the SAM file. BAM files can
be indexed, using the BAM Index file, for quick access
to sequence alignment data. See http://samtools.sourc
for more a more detailed description of the eforge.net
SAM/BAM file format. Many tools are available for
working with SAM files.
See for a Pre-3.0 Library Summary Overview
description of the alignment data included in the BAM
file. The reads in the file are sorted by reference
location.
Version 3.2
- Page 123 -
Library Alignments (BAM Index) Binary Sequence Alignment/Map Index (BAI)
-formatted file.A BAM index file speeds up the access
time for a coordinate-sorted BAM file, enabling software
to more quickly access random parts of the genomic
information in a BAM file. Each BAM index file is
associated with a BAM file so be careful not to confuse
them. They share the same file name but the BAM
index file has a .bai extension. To access information in
a BAM file, a BAM index file is not required but does
improve time-to-access.
Barcode Alignments Summary A summary file of alignment metrics for barcodes. The
metrics include the quality and read lengths at which
each barcode aligns to reference.
This link appears on barcode runs only.
Barcode-specific Library Alignments (BAM and
BAM Index)
The same format and purpose as the Library
Alignments (BAM) and Library Alignments (BAM Index)
files, with content for specific barcodes. The BAM and
BAM Index files for each barcode are zipped together.
Barcode-specific Library Sequence (FASTQ) The same format and purpose as theLibrary Sequence
(FASTQ) file, with content for specific barcodes. The
FASTQ files for each barcode are zipped together.
Barcode-specific Library Sequence (SFF) The same format as theLibrary Sequence (SSF) file,
with content for specific barcodes. The SFF files for
each barcode are zipped together.
Test Fragments (SFF) Test Fragment data are provided as a compressed,
binary Standard Flowgram Format (SFF) file. Seehttp:/
/www.ncbi.nlm.nih.gov/Traces/trace.cgi?cmd=show&f=f
for a detailed description ormats&m=doc&s=format#sff
of the file format.
PDF of this Report Complete detailed in PDF format. Analysis Report
Customer Support Archive ZIP archive containing the PDF and HTML version of
the run report as well as useful logs in case
troubleshooting is required.
Version 3.2
- Page 124 -
Contents
Pre-3.0 Run Reports
Pre-3.0 File Links

The lists the plugins associated with the analysis, and provides an interface for running and Plugin Summary
monitoring your plugin(s).
Plugins can have one of the following behaviors:

Run without user input.
Run with a user interface for getting plugin parameters.
Version 3.2
- Page 125 -
1.
2.
3.
Plugins without a user interface display a confirmation message that the plugin has been submitted to run. Plugins
requiring input parameters display a user interface dialog and are launched after you click . Submit
Running Plugins
The following plugins are pre-installed on Torrent Server. See Pre-3.0 Running the Installed
for a description of these plugins. Plugins
Alignment
Coverage Analysis
ERCC Analysis
IonReporterUploader
Run RecognitION
SampleID
Torrent Variant Caller
To manually run a post-analysis plugin on the report data:
Click . Select Plugins To Run
The Plugin List pops up and displays a list of available plugins:
Click the plugin you want to run.
If the plugin does not require user input, it begins execution.
This displays the user interface for your plugin. In this example, the plugin is selected, displaying Alignment
the plugin dialog (See for more information about running Alignment Pre-3.0 Running the Installed Plugins
pre-installed plugins.):
Version 3.2
- Page 126 -
3.
4.
5.
1.
2.
Select the desired plugin options and click . This runs your plugin, listing the run status in the Submit Plugin
panel. Summary
For plugins that take a long time to run, click to update the plugin display status. Refresh Plugin Status
When your plugin completes, the status is updated to Started.
The PluginSummary List
After a plugin runs, it is listed in the panel: Plugin Summary
Some plugins, such as Alignment,display a preview results window in the Plugin Summary list.
Plugin Reports
Plugin results, results summaries, links to output files, and other information are available in the plugin report
pages. See for a description of report pages for the installed plugins. Pre-3.0 Running the Installed Plugins
Click the plugin html link in the Plugin Summary section to open that plugin's report page.
Plugin Log Files
To view the plugin log file, hover your mouse pointer over the log icon to the right of your plugin to display the
plugin log file:
Click the icon to display the log:
Version 3.2
- Page 127 -
2.
3. Click to exit the display. Close
Contents
Pre-3.0 Run Reports
Pre-3.0 File Links
Version 3.2
- Page 128 -
Pre-3.0Run the Installed Plugins
Available Plugins
Manually Run a Plugin
Automatically Run Plugins
Available Plugins
This table lists the pre-installed and officially supported plugins.
Plugin Description
Alignment Plugin Performs a new alignment to the reference you specify.
Note:Plugins run after the Torrent Suite analysis
pipeline. This plugin does not affect the alignment
during pipeline analysis.
Coverage Analysis Plugin Provides statistics and graphs describing the level of
sequence coverage produced for targeted genomic
regions.
ERCC Analysis Plugin Helps with ERCC RNA Spike-in Controls: enables you
to quickly determine whether or not the ERCC results
indicate a problem with either the library preparation or
the sequencing instrument run.
Run RecognitION Plugin Considers candidate runs for inclusion in Ion
Community leaderboards. Within each chip type (Ion
314 chip, Ion 316 chip, and Ion 318 chip), top
runs are ranked according the number of AQ20 bases
mapped.
sampleIDPlugin Uses sample fingerprinting to identify any
cross-contamination between samples or between
barcodes in a run.
Torrent Variant Caller Plugin Calls SNP and InDel variants across a reference or
within a targeted subset of that reference. With
low-frequency variant options, the plugin can call
variants down to a 5% level of variant frequency. It can
also show which variants coincide with predefined
HotSpot positions on the reference sequence.
This table lists functionality that was available as plugins in previous releases. These are now available in other
areas of the Torrent Browser.
Previous plugin Description and new location
Version 3.2
- Page 129 -
1.
2.
3.
IonReporterUploader Transfers run results files to the Ion Reporter
Software (access is available under a separate
license).
The IonReporterUploader is now selected before a run
in the > , > , and Plan Templates Plan Planned Run wiza
pages. After a run, if the results set is a member of a rd
project, you invoke theIonReporterUploader from
theproject page (see ). Projects
combineAlignment Combinesreads aligned to the specified reference from
multiple run reports. Intended for usewhen multiple
runs analyze the same tissue sample, for example
when a tissue sample is run on more than one chip.
You invoke combineAlignmentfrom theproject page
(see ). The runs you combined must be Projects
members of the same project.

The is the mechanism to manually run plugins.The Plugin List is accessed in the run report of Plugin List
completed analysis runs. Only enabled plugins are listed.
Follow these steps to manually run a plugin:

Click the tab, then click the link for your completed analysis run. Reports
In the run report, scroll down to Plugin Summary section.
The Plugin Summary also lists any plugins that executed on your run (not shown in this example).
Click to see the list of available plugins. See for the pre-installed Select Plugins To Run Available Plugins
plugins. Your server may have additional plugins installed.
Version 3.2
- Page 130 -
3.
4.
5.
Click the desired plugin name to run a plugin.
If the plugin does not require user input, it starts immediately, without a confirmation screen.
Click to close the Plugin List without running a plugin. Close

When you design your sequencing protocol in the Plan > Template page, you specify which plugins to execute. You
can select any plugin that is installed and configured on your Torrent Server. You are not limited to the pre-installed
plugins.
See the following for more information on specifying plugins in your templates and planned runs:
Plan Tab
Templates
Planned Runs
Template and Planned Run Wizard
The old method to autorun a plugin
Your Torrent Server administrator can set plugins to be executed automatically on every run; however, the
preinstalled plugins are not good candidates to be run automatically. For example, the Torrent Variant Caller plugin
fails on runs that do not use both the hg19 reference and the Ion AmpliSeq Cancer Panel or custom product data.
The Alignment and RunRecognitION plugins cannot be be executed automatically because they
require manual user input before every run.
For Ion Reporter users, enabling AutoRun with the IonReporterUploader plugin could cause
you extra expense, by transferring unnecessary results to the Ion Reporter server. (The Plan
tab allows you to turn off the plugin for a template or a planned run.)
Version 3.2
- Page 131 -
Contents
Pre-3.0 Run Reports
Pre-3.0 File Links
Pre-3.0 combineAlignments Plugin
Pre-3.0 combineAlignments Plugin
The c Alignment plugin combines reports from multiple runs that analyze the same tissue sample. The plugin ombine
is used, for example, when you run a tissue sample on more than one chip. The plugin combines the reports from
those runs into one report. You run the plugin from any one of the related reports.
All runs must use the same reference.
Analyses using barcoded libraries are not supported in this release.
Run the Plugin
You run the plugin from the Report tab run report of one of the runs to be combined:
Version 3.2
- Page 132 -
That report appears in the selected reports section. Click search to find related reports:
Related reports appear in the search section. Your original report has the Add button grayed out:
Click for each run to be combined. Additional search results can be seen by clicking the button on the Add More
lower right.
When you have all runs selected and appearing in the selected report section (the lower table), select a name for
the combined alignments report, and click . Submit
Plugin Notes
the plugin includes these notes in the submission page:
This plugin combines reads aligned to the specified reference from multiple run reports. The resulting combined
Version 3.2
- Page 133 -
alignment files may be downloaded from the plugin report page or used as input for other Torrent Browser plugins
that support the use of these files, such as the Torrent Variant Caller.
Use the filters in the Report Locater to find reports then click the Add button to add them to the Selected Reports
table. Initially the list of selected reports will contain the current report name. This report, or any selected report, may
be removed from the list by clicking the Remove button. The alignment file from selected reports is combined by this
plugin after clicking the Submit button. You may also modify the default name for the combined alignment files
generated.
Note that the Report Locator will only include reports that are completed and does not support barcoded runs. Also,
the Report Locator only lists reports for runs associated with the selected reference.
Contents
Pre-3.0 Run Reports
Pre-3.0 File Links

TSUD AnalysisReportGuide 3.2 1 PDF

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

TSUD AnalysisReportGuide 3.2 1 PDF

Uploaded by

Copyright:

Available Formats

Version 3.

Run Report Metrics Before Alignment

Enrichment Predicted number of Live ISPs that

Clonal Percentage of clonal ISPs.

Polyclonal Percentage of polyclonal ISPs (ISP

This table describes the read length metric:

Run Report Metrics on Aligned Reads

Plugins can have one of the following behaviors:

The Plugin List pops up and displays a list of available plugins:

Click the plugin you want to run.

If the plugin does not require user input, it begins execution.

Manually run a plugin

Follow these steps to manually run a plugin:

Click the desired plugin name to run a plugin.

Click to close the Plugin List without running a plugin. Close

Coverage Analysis Plugin

3. Select . TheCoverage AnalysisPlugin interface appears. coverageAnalysis

Manually run the ERCC Analysis plugin

Plugin run times

View transcript details

( ) Configure the ERCC Analysis plugin Optional

Run RecognitION Plugin

Running the RunRecognitION Plugin

In , click : Select a plugin RunRecognitION

How Do I Submit My Run to the RunRecognitION leaderboard?

The Run RecognitION leaderboard is displayed for your chip type.

Optionally enter the any of this information about your run:

What Information About Me Does RunRecognitION Make Public?

Torrent Variant Caller Plugin

Run Torrent Variant Caller Manually

2012 Life Technologies Corporation. All rights reserved.

Open the test fragment report

Test Fragment Summary

Consensus Key 1-Mer

AQ17 Read Lengths

Parameter Description Percentage

Parameter Description Percentage

Pre-3.0 Plugin Summary

Plugins can have one of the following behaviors:

The Plugin List pops up and displays a list of available plugins:

Click the plugin you want to run.

If the plugin does not require user input, it begins execution.

Manually run a plugin

Follow these steps to manually run a plugin:

Click the desired plugin name to run a plugin.

Click to close the Plugin List without running a plugin. Close

You might also like