Aquaculture Research, 2010, 41, 930^933
SHORT COMMUNICATION
Isolation and characterization of 21 novel
microsatellite markers from spotted halibut
(Verasper variegatus)
Jiashi Wang, Haiyang Yu, Hui Huang, Zhongjia Huang, Xubo Wang, Zhigang Wang & Quanqi Zhang
Laboratory of Marine Genetics and Breeding, College of Marine Life Sciences, Ocean University of China
Correspondence: Q Zhang, #5 Yushan Road, Qingdao 266003, China. E-mail: qzhang@ouc.edu.cn
Spotted halibut, Verasper variegatus (Temminck et
Schlegel), inhabiting the Asian coasts, is an impor-
tant commercial £at¢sh (Li & Wang 1995).Wild popu-
lations of the spotted halibut have been declining
due to over¢shing and damage to their habitat
(Wada, Mitsunaga, Suzuki, Yamashiya & Tanaka
2006). Arti¢cial reproduction and selective breeding
programmes have been undertaken to promote com-
mercial cultivation of the spotted halibut (Wang,
Zhang, Kang, Zhang & Zhang 2003). However, cap-
tive populations tend to be genetically less diverse
than wild populations (Sunden & Davis 1991), espe-
cially those under selective breeding. Because the
conservation of population genetic structure is im-
portant for long-term interests (Hamrick, Godt, Mur-
awski & Loveless 1991), assaying the genetic diversity
of wild populations and monitoring the variability of
cultured stocks are essential for its resource manage-
ment as well as sustainable cultivation interests.
Although microsatellite markers have been iso-
lated for spotted halibut (Ortega-Villaizan Romo, Na-
kajima & Taniguchi 2003; Sekino, Saitoh & Aritaki
2008), the number and availability are still limited.
In this study, 21 microsatellite markers were isolated
and characterized to provide appropriate evaluation
of the genetic diversity of this species.
Microsatellite-enriched libraries (AC)n and (AG)n
were constructed according to Karagyozov, Kalcheva
and Chapman (1993) and Edwards, Barer, Daly, Jones
and Karp (1996) with slight modi¢cations. Brie£y,
genomic DNA was extracted from muscle tissue as
described by Sambrook, Fritsch and Maniatis (2001)
and then digested with AluI (TaKaRa, Dalian, China).
930
doi:10.1111/j.1365-2109.2009.02359.
Fragments 400^1400 bp in length were recovered
from 1% low melting point agarose gels, ligated with
an adaptor (the annealing product of a 21-mer oligo-
nucleotide, 5 0 -CTCTTGCTTGAATTCGGACTA-3 0 and
a phosphorylated 25-mer, 5 0 -pTAGTCCGAATTCAAG
CAAGAGCACA-3 0), then denatured at 95 1C for
5 min and used for hybridization.
The oligonucleotide probes (AC)20 and (AG)20 were
mixed and spotted on nylon membranes (Roche,
Shanghai, China). After baking at 80 1C for 2 h, the
membranes were prehybridized in a bu¡er contain-
ing 50% formamide,7% SDS,5  SSC and 50 mM so-
dium phosphate at 37 1C for 2 days and then washed
in 1% SDS at 100 1C for 10 min. The denatured DNA
fragments with adaptors at two ends were hybridized
with the probes on the membrane at 37 1C for 24 h.
The membrane was then washed three times with
2  SSC at 55 1C for 15 min, twice with 1% SDS at
55 1C for 15 min and once at 62 1C for 30 min. Bound
DNA fragments were eluted by boiling the membrane
for 5 min in 150 mL of 0.1  TE bu¡er and precipi-
tated, and then ampli¢ed in a 25 mL volume by a re-
covery polymerase chain reaction (PCR) using
adapter-speci¢c primer. The PCR products were in-
serted into pMD18-T vector (TaKaRa) following the
manufacturer’s instruction and transformed into
Escherichia coli DH5a.
About1000 colonies were screened through in situ
colony hybridization with (AC)20 and (AG)20 probes
using Gene Images 3 0-oligolabelling and the ECL De-
tection System (Amersham Biosciences, London,
UK). Membrane blocking, hybridization, antibody ad-
dition as well as signal generation and detection all
r 2009 The Authors
Journal Compilation r 2009 Blackwell Publishing Ltd
 Table 1 Genetic characterization of 21 polymorphic microsatellite loci isolated fromVerasper variegatus (Temminck et Schlegel)

Accession Repeat motif Number P-values

Locus name number Primer sequence (5 0 ^3 0) Ta ( 1C) ASR (bp) in cloned allele of alleles HO HE (HWE)

VvaA3 FJ190387 F: AGAAAGACTGACTGGGAAATG 61 221–200 (TG)14 9 0.7143 0.7916 0.1407

r 2009 The Authors

R: CATATTTACCCATCCACTTC
VvaA7 FJ190388 F: CACATTTGCCACCATGACAC 63 474–373 (AC)19 . . . (ACAG)4 . . . (AC)6 . . . (CA)8 13 0.9 0.9068 0.1403
R: ATTTGGAAGACAATCTGAGC
VvaA8 FJ190389 F: TCCAAGGCAGATGTTAGACC 60 293–242 (TC)7TT(TC)5(CT)6 (TC)5 13 0.7667 0.8949 0.1047
R: GAGGCATGAAAGATGAGAAGAG . . . (CT)7 . . . T(TC)5 . . . (CT)7 . . .
VvaA10 FJ190390 F: GTGGAGGCGTTTACTTCTGA 45 292–209 (TG)26GGGG(TG)2 GG(TG)9 14 0.7857 0.9117 0.2244
R: TCTATGGGTCTAACATCTGC
VvaA13 FJ190391 F: CTTTTATCCCTGCTCCCTTATTTTC 58 295–273 (AG)13 4 0.2333 0.6537 0
Aquaculture Research, 2010, 41, 930^933

R: ATGGTCCTAGTCTTCCTTTATG
VvaA26 FJ190392 F: CAGGAATAGACTGTAGGGCTCA 53 383–302 (TG)13TT(TG)12 12 0.8333 0.8701 0.4185
R: CTCCTTGTCGGTGAAGTTTG
VvaA27 FJ190393 F: GAGCAATATCAAAGCCAGTG 57 229–168 (AG)21AA(AG)6 10 0.7143 0.8883 0.0203
R: CTCCTCGCTATACATCATCC
VvaA29 FJ190394 F: TCATAATCACACTGGACCAGAACTC 56 182–150 (TG)14TA(TG)5 12 0.7333 0.9062 0.0134
R: GAGGTATCCCACATTACATTGAC
VvaA30 FJ190395 F: TTTCCTTTGGTCAACCACG 50 193–166 (AG)19 5 0.6333 0.7243 0.0233
R: GGCTTTTCATTGTAACCTCACG
VvaA48 FJ190396 F: CTAATCTGTTACCCTTGAACTCTCC 56 170–153 (TG)10 4 0.6 0.6073 0.0007
R: TTGCTCATTCCCTCTTCTTCTG
VvaA56 FJ190397 F: GCAAATATCAAGTGGCGAATAC 59 276–219 (TG)10 10 0.6429 0.8994 0.0002
R: ACTCTGTCAGAATCCCTCCG

Journal Compilation r 2009 Blackwell Publishing Ltd, Aquaculture Research, 41, 930^933
VvaB2 FJ190398 F: GCACTTTGCTCTCCACGGTTTC 53 406–304 (TG)6(AC)16 11 0.6552 0.8978 0.0071
R: GGACTCTCACTCTGCTCCACAGTTAG
VvaB9 FJ190399 F: CTCCTGGAGACTGGCCCTGTG 57 337–292 (TG)16 9 1 0.8623 0.3539
R: GGACTCTCCCCAAAAGTGAAGCC
VvaB11 FJ190400 F: GTGAGGAGGAAATGGTTGG 54 359–286 (AC)3CC(AC)42 11 0.6333 0.8698 0.0092
R: ACATGGGAGGGTCCCTA
VvaB24 FJ190401 F: CGGATGACGGGGACATTAAGGAG 60 290–240 (TC)12(TG)13 11 0.7931 0.8947 0.0987
R: TTGACAGTTGGCTGGAGTGGC
VvaB33 FJ190402 F: ACACAGACACTTATTGCCACCC 59 286–207 (TC)11TT(TG)12 11 0.8621 0.8814 0.0183
R: GCACCGTTGTTTCTGCTGTAG
VvaB38 FJ190403 F: CACTCACCCACCCGTGTTAC 45 234–196 (TC)17 4 0.3448 0.5003 0.0273
R: TGACCAGTTTGTTGGCTTCC
VvaB41 FJ190404 F:CGATCCAATCATTCTCATTCTGT 54 475–377 (GT)18GG(GT)5(GT)10 8 0.1371 0.0487 0
R:CAATATCAAGGTCCCGTGTG

931
Microsatellite markers from spotted halibut J Wang et al.
Microsatellite markers from spotted halibut J Wang et al. Aquaculture Research, 2010, 41, 930^933

P-values
followed the manufacturer’s instructions, but mem-

0.0002
0.2518

0.0066
(HWE)
brane washing was modi¢ed once with 5  SSC and
0.1% SDS for 5 min at room temperature, once with
0.8748 1  SSC and 0.1% SDS at 37 1C for 15 min and once
0.8768

0.9141
in 1  SSC and 0.1% SDS at 42 1C for 15 min.
HE

In total, 442 positive clones were sequenced

using the ABI PRISM BigDye Terminator Cycle
0.7931

0.6667

0.6552
Sequencing Ready Reaction Kit (Applied Biosystems,
HO

Foster City, CA, USA). CHROMAS 1.62 and EDITSEQ pro-

grammes equipped in DNASTAR (DNASTAR, Madison,
of alleles

WI, USA) were used to trim the sequences. Among

Number

420 sequences containing microsatellites, 31 were

11

12
9

ASR, detected range of allele sizes; HO, observed heterozygosity; HE, expected heterozygosity; HWE, Hardy^Weinberg equilibrium; Ta, annealing temperature.

found to be duplicates; and 65 were not suitable for

primer design due to their short £anking regions,
low GC content and so on. Of 324 remaining
sequences, 70 were randomly selected for primer
design using PRIMER PREMIER 5.0 (PREMIER Biosoft,
Palo Alto, CA, USA).
All the primer pairs were subjected to the optimi-
zation of annealing temperature and Mg21 concen-
in cloned allele

tration using a temperature gradient PCR system

Repeat motif

(BioRad, Colonia Del Valle, Mexico). Fifty-two out of

(TG)11

(TG)26

(AC)25

70 primer pairs were found to be able to amplify mi-

crosatellite fragments from the genomic DNA of the
spotted halibut. Those primer pairs were then used
ASR (bp)

for the evaluation of the genetic diversity of a sample

population containing 30 individuals collected from
430–312

221–171
292–223

Bohai Sea, China (371^411N,1171^1211E). Polymerase

chain reaction ampli¢cation was conducted in a total
Ta ( 1C)

volume of 20 mL including 0.2 mM primer, 200 mM

48

60
53

dNTP (each), 1  PCR bu¡er and 1U Taq DNA poly-

merase (TaKaRa). The thermocycling conditions were
as follows: initial denaturing at 95 1C for 5 min, fol-
R:ATGTTGTGGTGTTAATGAACTGGTG
R:AGAGAGCATAATGGAGGTAGGTG

lowed by 33 cycles of denaturing at 95 1C for 30 s, an-

F:AGACAGAGTAGCCCAAGTAACC
F:CTTTGTCAATGAAGGGGAATGG
F:CTTGTCCTTATGTGACTGAGCC

nealing at the optimum temperature for 30 s,

R:AAGCCAGGTGTTGCTGTTC

depending on primer speci¢city (Table 1), extension

at 72 1C for 30 s and a ¢nal extension at 72 1C for
Primer sequence (5 0 ^3 0)

P-value, probability of being Hardy^Weinberg equilibrium.

The loci with signi¢cant deviation from HWE (Po0.005).

7 min. The PCR products were separated in 12%

non-denaturing polyacrylamide gel at 300 V for 2^
3 h, stained with ethidium bromide and visualized
under ultraviolet light.
Alleles of each locus were sized with QUANTITY ONE
version 4.4 (BioRad, Hercules, CA, USA) by referring
to MAKER 1 (TIANGEN, Beijing). The observed hetero-
Accession

zygosity (HO) and the expected heterozygosity (HE)

FJ190405

FJ190406

FJ190407
number

were calculated using POPGENE32 version 1.32 (Yeh,

Yang, Boyle,Ye & Xiyan 2000). Tests for Hardy^Wein-
Table Continued

berg equilibrium (HWE) and linkage disequilibrium

were conducted using GENEPOP 3.4 (Raymond & Rous-
Locus name

set 1995). Sequential Bonferroni correction was used

VvaB42

VvaB43

VvaB44

to modify the P-values using multiple statistical com-

parisons (Rice 1989).

r 2009 The Authors

932 Journal Compilation r 2009 Blackwell Publishing Ltd, Aquaculture Research, 41, 930^933
Aquaculture Research, 2010, 41, 930^933
Of the 52 primer pairs examined, 21 showed poly-
morphisms in the sample population. The number of
alleles varied from 4 to 14 per locus (Table 1). The HO
and HE ranged from 0.137 to 1.00 and from 0.048 to
0.914 respectively. Five loci showed signi¢cant devia-
tion from HWE (Table 1), which may be due to the
small sample size or the existence of null alleles. No
locus showed signi¢cant linkage disequilibrium.
The construction of microsatellite containing frag-
ment-enriched libraries has been shown to be an e⁄-
cient way of developing microsatellite markers. The
markers developed in this study detected substantial
polymorphisms in a spotted halibut sample popula-
tion. They may serve as e⁄cient tools for the evalua-
tion of the genetic diversity in both wild populations
and arti¢cially produced o¡spring or selected stocks
of spotted halibut. They may also be used in the con-
struction of genetic linkage maps and the analysis of
QTLs from the marker-assisted selection of this eco-
nomically important species.
Acknowledgments
This work was supported by grants from the National
Science Foundation of China (no. 3067162) and the
National HighTechnology Research and Development
Program (no. 2006AA10A414, 2006AA10A404).
References
Edwards K., Barer J.J.H., Daly A., Jones C. & Karp A. (1996)
Microsatellite libraries enriched for several microsatellite
sequences in plants. BioTechniques 20,758^760.
Hamrick J.L., Godt M.J.W., Murawski D.A. & Loveless M.D.
(1991) Correlations between species traits and allozyme
diversity: implications for conservation biology. In: Genet-
ics and Conservation of Rare Plants (ed. by D.A. Falk & K.E.
Holsinger), pp. 75^86. Oxford University Press, New York,
NY, USA.
Karagyozov L., Kalcheva I.D. & Chapman V.M. (1993) Con-
struction of random small-insert genomic libraries highly
r 2009 The Authors
Journal Compilation r 2009 Blackwell Publishing Ltd, Aquaculture Research, 41, 930^933
Microsatellite markers from spotted halibut J Wang et al.
enriched for simple sequences repeats. Nucleic Acids
Research 21, 3911^3912.
Li S.Z. & Wang S.M. (1995) Class teleost. In: Fauna Sinica:
Ostichthyes, Pleuronectiformes (ed. by S.Z. Li & H.M.Wang),
pp. 234^236. Science Press, Beijing, China (in Chinese).
Ortega-Villaizan Romo M.D.D., Nakajima M. & Taniguchi N.
(2003) Isolation and characterization of microsatellite
DNA markers in the rare species bar¢n £ounder (Verasper
moseri) and its closely related species spotted halibut
(V. variegatus). Molecular Ecology Notes 3, 629^631.
Raymond M. & Rousset F. (1995) Testing heterozygote excess
and de¢ciency. Genetics 140,1413^1419.
Rice W.R. (1989) Analyzing tables of statistical tests. Evolu-
tion 43, 223^225.
Sambrook J. & Russell D.W. (2001) Molecular Cloning: A
Laboratory Manual, 3rd edn. Chapter 6. Preparation and
Analysis of Eukaryotic Genomic DNA. Cold Spring Harbor
Laboratory Press, NewYork, NY, USA, pp. 547^609.
Sekino M., Saitoh K. & Aritaki M. (2008) Microsatellite mar-
kers for a rare species of right-eye £ounderVerasper varie-
gatus (Pleuronectiformes, Pleuronectidae). Conservation
Genetics 9,761^765.
Sunden S.L.F. & Davis S.K. (1991) Evaluation of genetic varia-
tion in a domestic population of Penaeus vannamei Boone:
a comparison with three natural populations. Aquacul-
ture 97, 131^142.
Wada T., Mitsunaga N., Suzuki H.,YamashiyaY. & Tanaka M.
(2006) Growth and habitat of spotted halibutVerasper var-
iegatus in the shallow coastal nursery area, Shimabara
Peninsula in Ariake Bay, Japan. Fisheries Science 3, 603^
611.
Wang K.S., Zhang Z.F., Kang K.H., Zhang Q.Q. & Zhang F.L.
(2003) Embryonic and larval development inVerasper var-
iegatus. Journal of Fishery Sciences of China10, 451^454 (in
Chinese with English abstract).
Yeh F.C., Yang R., Boyle T.J., Ye Z. & Xiyan J.M. (2000) POP-
GENE 32, MicrosoftWindow-based Freeware for Population
Genetic Analysis, version 1.32. Molecular Biology and Bio-
technology Centre, University of Alberta, Edmonton,
Canada.
Keywords: Verasper variegatus (Temminck et
Schlegel), microsatellite marker, polymorphism,
enrichment
933