Design vs. Evolution Biblical Creation Bible Authenticity Slideshows Christian Theology Aberrant Theology Christian Tribulation Christian Life Issues Discovery Course God's Love Abortion Discussion Forum Links Book Reviews Movie Reviews Search Search Site Advanced Search Enhanced Google Site Map Ministry Info About us Contact us Privacy Policy RSS Feed G & S Toolbar Newsletter name email address Subscribe General Send an e-Card Webmaster Resources Personal Pages Humor Site Helps Site Help En Espaol Help I can't see! G&S Toolbar Report page errors
Page Links Introduction Genetic diversity Morphological changes Deleterious mutations Molecular biology mtDNA y-chromosome linkage disequilibrium Rare mutations Neanderthals Ancient humans Conclusion Related Pages References Print Email Page Translate Font: A A A Evolution vs. Design Design in the Universe Design in Biology Origin of Life Descent of Humans Problems in Evolution Evolution & Bible New Pages Christians & Suicide Judging the Sabbath Land Plants Before Animals? Four Views on Divine Providence Did God have a wife? Alien Life in Meteorites? Singularity Movement Creating Life in the Lab NASA's Arsenic- Eating Bacteria The Moral Landscape 'Goldilocks' Planet Has Life? Stephen Hawking is Wrong About God Is Satan Real? Paul Invented Christianity? Ancient Hebrew Inscription Babies Go To INTRODUCTION The beginning of trouble - lack of genetic diversity among modern humans Still more trouble - Discontinuous morphological changes in the lineage Another problem - too many
Descent of Mankind Theory: Disproved by Molecular Biology by Rich Deem The current theory of human evolution states that modern humans evolved from more primitive . The first that is supposedly the ancestor of modern humans is , which appeared in the fossil record from about 4.4 to 1 million years ago throughout eastern Africa. comprised a diverse group of small-brained species that were confined to the savannas of Africa. This was supposed to have evolved into the , which has been defined as with a brain capacity over 700 cc, having appeared in the fossil record by about 2.5 million years ago as in eastern Africa. According to theory, evolved into , which had a brain capacity just over 1000 cc, appearing in the fossil record from about 1.8 million to 300 thousand years ago. lived between 400 and 28 thousand years ago. Archaic appeared 400 - 150 thousand years ago, and modern from less than 100 thousand years ago. Contrary to the claims of many creationists, there is ample evidence for the existence of human-like species of . The dates and ages of these fossils are not widely disputed in scientific circles. The reality of the fossil record and the reliability of the dates of these fossils is actually instrumental in disproving the descent of man theory. If the fossil record were not as complete as it now is, the standard evolutionist argument would apply, "we just haven't found the missing link ancestor of modern humans yet." As evolutionists studied humans and species of apes in the 1970's and 1980's, some rather surprising information was being discovered that distinguished us from apes and other . The maximum (a measure of variation between population groups) between human races is 0.08 (1, 2). However, among populations of , orangutans, and other species, are commonly more than 0.20. An examination of 62 common coding genetic , indicates a rate of 0.011/ ( versus ), to a maximum of 0.029 ( versus ). However, in nearly all other animal species studied, including apes, usually exceed 0.05 (2). In humans, (the proportion of that are , in this case within the species) is 1.8% , whereas in apes it ranges from 2.5 in the to 3.9 in the (3). An analysis of the genetics of populations of apes reveals that different population groups possess fixed novel that characterize each population. In contrast, there are no novel or genetic that specifically characterize any one human race from another. More recent studies have confirmed the early work, likewise showing that human genetic diversity is far less than what one would predict from Darwinian theory. Dr. Maryellen Ruvolo (Harvard University) has noted, "It's a mystery none of us can explain." (4). Examinations of the genetic of diverse modern human populations reveals minor, if any differences (5). All of this evidence suggested a recent origin for modern humans. discoveries and show that the pattern of morphological change in the fossil record was not progressive, but abrupt (6). Some adaptations essential to appeared early, but others appeared much later. Although the 3.2 million year old fossil "Lucy" ( ), was said to be , her 2.6 million year old descendent, , was indisputably (7). Primitive (similar to the reconstructed last common ancestor with the African great apes) were found in nearly all species of (8). Relative brain size increased slightly among successively younger species of , although many skulls have brain capacities no larger than those of . (9, 10). However, brain capacities expanded abruptly with the appearance of , but within early remained at about half the size of for almost a million years. The fossil record indicates an accumulation of relatively rapid shifts in successive species, and certainly not any kind of gradualistic changes. A recent study examined the rate for humans. Using "conservative assumptions" the authors found that the overall rates was 4.2 per person per generation, with a rate of 1.6 (11). When using more realistic assumptions the overall rate for humans become 6.7 with a rate of 3.1. Such a high rate should have resulted in extinction of our species long ago. They stated in their conclusion: "The rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if effects on fitness were to combine in a multiplicative way." The authors had to rely upon a rare association of , termed synergistic to explain why the numerous hypothesized have not overwhelmed our . Instead of postulating the obvious (that the human is not as old as evolution bipedal hominids bipedal hominid genus Australopithecus Australopithecus bipedal genus genus Homo bipedal primates Homo habilis Homo habilis Homo erectus Homo neanderthalensis Homo sapiens Homo sapiens bipedal primates primates Fst value chimpanzees primate Fst values protein loci substitution locus Caucasoids Mongoloids Mongoloids Negroids heterozygosity alleles polymorphic Orangutan Chimpanzee mutations mutations alleles sequences hominid Paleontological geochronology hominid bipedalism Australopithecus aferensis bipedal Australopithecus africanus arboreal craniodental complexes Hominidae Australopithecines Australopithecine chimpanzees Homo Homo Homo sapiens deleterious mutations mutation mutation mutations deleterious mutation deleterious deleterious mutation mutational mutations epistasis deleterious mutations genome genome converted by Web2PDFConvert.com
Babies Go To Heaven? Medical Marijuana 'Benefits' Genetics & Homosexuality Origin of Homochirality Natural Evil Is Religion Child Abuse? Why are Scientists Atheists? God of the Gaps Who Created God? Living Together a Good Idea? Recent origin of modern humans confirmed through The nail in the coffin would teach), evolutionists must rely upon the improbable to retain the evolutionary paradigm. ( ) In the late 1980's and early 1990's a number of studies were done examining the ( ) of women all over the world. These studies, nicknamed the "Eve theory," suggested that the last common ancestor of modern man (actually women) appeared within the last 200,000 years (12-15), much more recently than previously thought. Refinements in the measurements lowered the original estimates to 135,000 years (15) and finally 100,000 years (16). Scientists chose to examine because, being enclosed within the subcellular organelle called the , there is no genetic recombination (males make no contribution of to the fetus). All comes from our mothers and is passed down from mother to daughter, since only from the egg are used to make up the fetus. By tracing the differences in from peoples around the world, scientists have calculated the probable date of the last common ancestor of modern humans at 100,000 to 200,000 years ago. analysis In 1995, scientists have examined human origins from the perspective of male genetics (17, 18). Scientists have examined a gene (ZFY), which being on the , is passed down only from father to son. Thirty-eight men were chosen from all over the world (Africa, Asia, Australia, Europe, and Northern, Central, and South America). Scientists determined the actual genetic in each man for this gene, which is 729 long. To their surprise, all men had identical genetic (over 27,000 analyzed). Scientists have calculated the most probable date for the last common ancestor of modern man, given the diversity from modern apes. Using two different models this date is either 270,000 or 27,000 years ago. However, both these models assume that the male population during this entire period of time consisted of only 7,500 individuals. The date estimates from these models would be significantly reduced if the male population were higher than 7,500, which is very likely. Two separate studies using similar techniques looked at larger pieces of the , which would reduce the uncertainty in the calculation of dates. One study examined a gene which was 2,600 and determined a last common ancestor date of 188,000 year ago (minimum of 51,000 and maximum of 411,000 years ago) (19). The other study used a very large piece of the (18,300 ) and calculated a last common ancestor date of modern man of 43,000 years ago (minimum of 37,000 and maximum of 49,000 years ago) (16). This latter study also examined from women and determined an origination date of 90,000-120,000 years ago. analysis A study published in 1996 (20) examined at the human CD4 (a T- cell associated antigen) as a means to establish the date of modern human origins. This study determined a maximum origin date of 102,000 years ago based upon the assumption that the (-) arose 5 million years ago, or almost immediately after mankind's split from other . As they stated, "It is likely that the deletion event occurred more recently, in which case our estimates for the date of founding of the non-African populations would also be more recent." Preliminary studies from 19, 11 and 8 show similar results to that seen on 12 (the of the CD4 gene) (21). Using rare mutations to estimate population divergence times A study published in 1998 examined population divergence time using rare between populations to estimate divergence
among three Mediterranean populations. The results indicated that Danish people (who are my ancestors) would have diverged from the other groups, at most, 4,500 to 15,000 years ago (22). This number does not necessarily help us establish a date for the appearance of modern humans, but it is likely that future studies in this area (this is one of the first published) may provide accurate numbers for the appearance of human populations in different areas of the world and a lower limit to the date of appearance of modern humans. Therefore, the most accurate date (see note below) for the origin of modern humans indicate that the last common ancestor to modern humans must have existed less than 50,000 years ago (16). Such a recent date left only one potential ancestor for modern humans, that is, ( ), which lived between 400,000 and 28,000 years ago. Previous anatomical studies had cast doubt on the possibility of being the ancestors of modern humans (23-27). These studies showed differences in brain case (23) and the presence of an internal nasal margin, a medial swelling of the lateral nasal wall, and a lack of an roof over the groove (24-25). None of these features are found in , and the last feature is not found in any other terrestrial mammal! A recent analysis of hands has revealed that modern humans and differed markedly in the kind of grip they could use (26). were limited to grips as one has when holding a stone or baseball. Such a grip would have been powerful (you wouldn't want to shake hands with a ), but not very dexterous. The anatomy of the hands would have prevented them from engaging in fine motor skills, such as carving and painting. Another study showed that developed much more rapidly than modern humans (or even their own supposed ancestors) (27), further eroding their possible status as mankind's ancestors. In addition, had a huge nasal cavity coupled with a brain molecular biology Mitochondrial DNA mtDNA mitochondrial DNA mtDNA mtDNA mitochondrion mtDNA mtDNA mitochondria mtDNA Y-chromosome Y chromosome sequence base pairs sequences base pairs sequence Y chromosome base pairs Y chromosome base pairs mitochondrial DNA Linkage disequilibrium linkage disequilibrium locus Alu alleles primates Alu chromosomes chromosome locus mutations Homo neanderthalensis Neanderthals Neanderthals Neanderthal's ossified lacrimal Homo sapiens Neanderthal Neanderthals Neanderthals Neanderthal Neanderthal's Neandertals Neanderthals converted by Web2PDFConvert.com Ancient Anatomically Modern Humans - the missing evidence size larger than our own. However, with their carnivorous lifestyle, it seems likely that much of their brain might have been devoted to the sense of smell, being the "dog" among the (28). In brilliantly designed and executed independent studies, scientists have extracted from four skeletons; two from Neander Valley in Germany, another from the northern Caucasus near the Black Sea, and the fourth in Vindija Cave, Croatia, and laid to rest any question of whether could have been our ancestors (29-32). The first study examined a 379 fragment and compared it with a of 986 pairs from living humans of diverse ethnic backgrounds. The results (Table 1) showed an enormous 26 difference between the and Human (a 6.5% difference) (29). In this region of the , modern humans differ from one another in an average of eight , and those differences were completely independent of the 26 observed for the fossil. However, many of the variations found in the were shared in the . A 357 of was examined from the second fossil and was found to vary from modern human at 23 (6.4%), nineteen of which were identical to those of the first . The third differed from modern humans by 26 , 23 of which matched the first and 20 of which matched the second specimen. The fourth differed from modern humans by 23 , 22 of which matched the first , 20 of which matched the second specimen and 23 of which matched the third specimen. A summary of the findings of the two studies can be found in Table 1, below. Table 1. Differences* Between Modern Humans and Sample ( ) Sequence Number (Read Down) 111111111111111111111111111111111 666666666666666666666666666666666 000011111111111112222222222233334 378900112345568880233455667912571 786378129984692399304468238910420 Modern Human AATTCCCCGACTGCAATTCACGCAC-CATCCTC ......T.ATT.....ACTGAAA....G.... #1 GG.CTTTTATTC.T.CCCTGTAAGTATGCT.CT #2 .C.....ATT.ATCCCCTGTAA.TATGCTTC #3 GG......ATTC.TCCCCTGTAAGTATGCT.C #4 GG......ATTC.TCCCCTGTAA.TATGCT.C * mtDNA The analysis of the second sample was extremely important, since it was dated at 29,000 years ago - only 1000 years before the last disappeared (33). If and humans had interbred, one should have expected to see this in the last remnants of the genetics. In addition, since the fossils were separated geographically by over 2,500 km, it shows that were a homogeneous species. The researchers conclusion: " were not our ancestors" - a quote from the authors of the first study. In fact, the differences between modern humans and were so great that calculations indicated that the last common ancestor (according to evolutionary theory) must have existed 550,000 to 690,000 years ago (first study) and 365,000 to 853,000 years ago (second study). Although the differences between modern humans and are large, the differences among individual humans or among individual is small compared to other apes (Table 2). Such low genetic diversity among are consistent with a creation model in which were specially created as a small population in the relatively recent past. The much larger variation seen among and gorillas does not eliminate them as specially created, but does place their probable creation date considerably before that of modern humans. Table 2. Variation (%) Within Species (31) Population Individuals Mean Minimum Maximum s.d. 3 3.73 - - - Humans 5,530 3.43 0.00 10.16 1.21 Chimpanzees 359 14.81 0.00 29.06 5.70 Gorillas 28 18.57 0.40 28.79 5.26 The final blow to the idea that humans and interbred was found in a genetic analysis of their , published in 2006-2007 (34). These results showed that none of the typical SNPs found in modern humans was present in . Knowing the variation of between modern humans and is important in determining if contributed to the human gene pool. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first of these studies was published in 2001, examining the of 10 ancient Australians (35). A summary of the of these individuals (compared with the modern human reference , modern Aboriginal , , and ) can be found in Table 3, below. The first thing that one notices is that the variation of ancient humans compared to modern humans is at most 10 (in LM3, the most ancient specimen). As stated previously, the average variation among hominids mtDNA Neanderthal Neanderthals base pair Neanderthal mtDNA mtDNA sequence nucleotide nucleotide base pair Neanderthal mtDNA mtDNA base pairs Neanderthal sequence Neanderthals Chimpanzee base pair sequence mtDNA Neanderthal sequences bases Neanderthal Neanderthal bases Neanderthal Neandertal bases Neanderthal Sequence Neanderthals mtDNA HVR1 Chimpanzee Neandertal Neandertal Neandertal Neandertal HVR1 Neanderthal Neanderthals Neanderthal's Neanderthal Neanderthals Neanderthals Neanderthals Neanderthals Neanderthals Neanderthals Neanderthals chimpanzees mtDNASequence Neanderthals Neanderthals chromosomal DNA Neanderthal Y-chromosome DNA sequences Neanderthals Neanderthals mtDNA sequences HVR1 sequence sequence polymorphism Neanderthals chimpanzees sequence base pairs converted by Web2PDFConvert.com CONCLUSION population groups of modern humans is 8 . LM3, dated at 40,000 years old (redated from the original estimate of 62,000 years old, 36), varied the most from the modern human reference , but this variation included only three shared with specimens. Since LM3 was a contemporary (or lived even earlier than the to date), it is apparent that the human was already nearly "modern" before died out. The authors of the study made a big deal about the LM3 sharing similarity to a portion of 11 in modern humans (thought to have been inserted into the human from the ). The authors concluded that the "loss" of the ancient variation seen in LM3 could explain how do not share with modern humans. Although it is certainly possible that part of might find its way into the nuclear , it doesn't address the issue of how the variation seen in the of LM3 was "lost." In fact, of the ten differences between LM3 and the modern human reference , five of those correspond to found in modern Aboriginal people, showing that those five were not lost at all. This leaves only a five difference, certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 40,000 years stands in sharp contrast to the large differences seen between modern humans and . European evolutionists have also disputed the claims of Adcock et al. in the journal Science in June, 2001. More information on this can be found in the paper, New DNA Evidence Supports Multiregional Evolutionary Model? A second study examined the of two Cro-Magnon specimens dated to 23,000 and 25,000 years old (37). One specimen (Paglicci-25) had no differences from the modern reference , and the other (Paglicci-12) only one (see Table 3). It is remarkable that so little change in the had occurred over the last 23,000 years. Table 3. Variation of Ancient, Anatomically Modern Humans (33) Sample ( ) Age (ka) Sequence Number (Read Down) 00111111111111111222222222222222222222222222233333333333333 79001122345668889001223344444555566677888899901112345556688 83781269984393499198340413479368923448467803911780715672817 Modern Human 0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA Aboriginal 0 ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C... 0 ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC.. 0 ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C.. #1 40 GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C... LM3 40# ....................T.G...........CT.T....T..T......TC....G Paglicci-25 23 ........................................................... Paglicci-12 25 ....................T...................................... * #redated from the original 62 ka estimate. The ancient Cro-Magnon and modern European differed by only 2-3 (see Table 4). This difference is even less than that observed among modern Europeans! In contrast, these ancient modern humans differed from nearly contemporary by an average of 24 . Table 4. Variation Among Modern and Ancient (37) Individual Modern Europeans Mean Min. Max. s.d. Mean Min. Max. s.d. Paglicci-25 2.3 0 11 1.8 24.5 23 28 2.4 Paglicci-12 3.2 0 10 1.7 23.5 22 27 2.4 Modern Europeans 4.4 0 18 2.3 - - - - According to the authors of the study: "Although only six of ancient a.m.h [anatomically modern humans] and four of are available to date, the sharp differentiation among them represents a problem for any model regarding the transition from archaic to modern humans as a process taking place within a single evolving human lineage." (37) There are two currently popular theories of human evolution 1) a single recent appearance of modern humans and 2) the model, which states that modern humans evolved simultaneously on different continents. destroys the model (12-22, 29-37). In addition, even the fossil evidence does not support the model (38). Instead, all the data supports the biblical view that humanity arose in one geographical locale. Modern tells us that modern humans arose less than 100,000 years ago (confirmed by three independent techniques), and most likely, less than 50,000 years ago (12-22). This data ties in quite well with the fossil record. Sophisticated works of art first appear in the fossil record about 40,000-50,000 years ago (39) and evidence of religious expression appears only 25,000-50,000 years ago (40, 41). Other indications of rapid changes during the Middle-Upper Paleolithic transition (35,000 to 45,000 years ago) in Europe include (42): A shift in stone tool technology from predominantly "Rake" technologies to "blade" technologies, achieved by means of more economic techniques of core preparation. A simultaneous increase in the variety and complexity of stone tools involving more standardization of shape and a higher degree of "imposed form" in the various stages of production. The appearance of relatively complex and extensively shaped bone, antler, and ivory artifacts. base pairs sequence bases Neanderthal Neanderthals sequenced genome Neanderthals sequence chromosome genome mtDNA mtDNA Neanderthals mtDNA mtDNA genome mtDNA sequence sequence bases polymorphisms bases base Neanderthals mtDNA sequences sequence sequence substitution sequence mtDNASequence mtDNA HVR1 Bonobo Chimpanzee Neanderthal mtDNA HVR1 mtDNA mtDNA base pairs Neandertals base pairs mtDNASequence Hominids Neandertals HVR1 sequences sequences Neandertals multiregional Molecular biology multiregional multiregional molecular biology converted by Web2PDFConvert.com artifacts. An increase in the rate of technological change accompanied by increased regional diversification of tool, forms. The appearance of beads, pendants, and other personal ornaments made from teeth, shell, bone, stone, and ivory blanks. The appearance of sophisticated and highly complex forms of representational or "naturalistic" art. Associated changes in the socioeconomic organization of human groups, marked by a more specialized pattern of animal exploitation, based on systematic hunting a sharp increase in the overall density of human population an increase in the maximum size of local residential groups the appearance of more highly "structured" sites, including more evidence for hearths, pits, huts, tents, and other habitations. Simultaneous, rapid changes in human abilities suggest replacement of previously existing with modern humans. The fact that all these events happened ~50,000 years ago precludes any possibility that previously existing could be our ancestors, since died out 300,000 years ago, and has been proven to be too genetically different from us to have been our ancestor (29, 30). Where does this leave the evolutionists and their descent of man theory? Well, they can always fall back on their favorite line - "the fossil record is just incomplete." Alternatively, check out Genesis 1:26 (43). RELATED PAGES A Scientific and Biblical Response to "Up from the Apes. Remarkable New Evidence Is Filling in the Story of How We Became Human" Human Y Chromosome: 'horrendously different' from Nearest Living 'Relative' The Origin of Man and the Races ( PowerPoint Presentation, 1.5 MB) Man, Created in the Image of God: How Man is Unique Among All Other Creatures on Earth Book Review: Who Was Adam?: A Creation Model Approach to the Origin of Man Book Review: Origin of the Human Species A Philosophical Critical Analysis of Recent Ape-Language Studies Thomas Aquinas Meets Nim Chimpsky: On The Debate About Human Nature And The Nature Of Other Animals Who Was Adam?: A Creation Model Approach to the Origin of Man. Are humans just advanced apes or have they been specially created in the image of God? Publications by scientists almost never ask the question, whereas publications by theists seldom examine the scientific data that relates to the question. However, two scientists raised in non-Christian homes, Fuz Rana (Ph.D. in chemistry) and Hugh Ross (Ph.D. in astronomy), have written a new book (Who Was Adam?: A Creation Model Approach to the Origin of Man) that examines the question of human origins by comparing biblical and evolutionary models. REFERENCES 1. R. Lewontin 1972. The apportionment of human diversity. Evolutionary Biology 6: 381- 398 2. M. Nei and A. K. Roychoudhury. 1982. Genetic relationship and evolution of human races. Evolutionary Biology 14: 1-59 3. Janczewski DN. Goldman D. O'Brien SJ. 1990. Molecular genetic divergence of (Pongo pygmaeus) subspecies based on isozyme and two-dimensional gel electrophoresis. Journal of Heredity 81: 375-387 4. Gibbons, A. 1995. The mystery of humanity's missing . Science 267: 35-36. 5. Pult I, Sajantila A, Simanainen J, Georgiev O, Schaffner W, Paabo S. 1994. from Switzerland reveal striking homogeneity of European populations. Biol Chem Hoppe Seyler 375: 837-840 6. Wood B. 1992. Origin and evolution of the . Nature 355: 783-790. 7. Shreeve, J. 1996. New skeleton gives path from trees to ground an odd turn. Science 272: 654 8. McHenry H.M. 1994. Body size and proportions in early . Proceedings of the National Academy of Sciences of the United States of America 91: 6780-6786. 9. Dean Falk. 1998. brain evolution: looks can be deceiving. Science 280: 1714 10. Conroy, G.C., G.W. Weber, H. Seidler, P.V. Tobias, A. Kane, and B. Brunsden. 1998. Endocranial capacity in an early cranium from Sterkfontein, South Africa. Science 280: 1730-1731. 11. Eyre-Walker, A. & Keightley, P. D. 1999. High genomic rates in . Nature 397, 344-347. 12. R.L. Cann, M. Stoneking, A.C. Wilson. 1987. and human evolution. Nature 325: 31. hominids hominids Homo erectus Homo neanderthalensis orangutan mutations Mitochondrial DNA sequences genus Homo hominids Hominid hominid deleterious mutation hominids Mitochondrial DNA converted by Web2PDFConvert.com 13. L. Vigilant, M. Stoneking, A.C. Harpending, K. Hawkes, A.C. Wilson. 1991. African populations and the evolution of human . Science 253: 1503. 14. M. Hasegawa, S. Horai. 1991. Time of the deepest root for in human . J. Mol. Evol. 32: 37. 15. Stoneking M, Sherry ST, Redd AJ, Vigilant L. 1992. New approaches to dating suggest a recent age for the human ancestor. Philos. Trans. R. Soc. Lond. B Biol. Sci. 337: 167-175. 16. Whitfield, L.S., J.E. Suston, and P.N. Goodfellow. 1995. variation of the human . Nature 378: 379-380. 17. S. Paabo. 1995. The and the origin of all of us (men). Science 268: 1141. 18. R.L. Dorit, H. Akashi, W. Gilbert. 1995. Absence of at the ZFY on the human . Science 268: 1183. 19. Hammer, M.F. 1995. A recent common ancestry for human . Nature 378: 376-378. 20. Tishkoff, S.A., E. Dietzsch, W. Speed, A.J. Pakstis, J.R. Kidd, K. Cheung, B. Bonn-Tamir, A.S. Santachiara-Benerecetti, P. Moral, M. Krings, S. Paabo, E. Watson, N. Risch, T. Jenkins, and K.K. Kidd. 1996. Global patterns of at the CD4 and modern human origins. Science 271: 1380-1387. 21. Fischman, J. 1996. Evidence mounts for our African origins - and alternatives. Science 271: 1364. 22. G. and B. Rannala. 1998. Using rare to estimate population divergence times: A maximum likelihood approach. Proceedings of the National Academy of Science USA 95: 15452-15457. 23. Seidler H, Falk D, Stringer C, Wilfing H, Muller GB, zur Nedden D, Weber GW, Reicheis W, and Arsuaga JL. 1997. A comparative study of stereolithographically modeled skulls of Petralona and Broken Hill: implications for future studies of middle evolution. J. Hum. Evol. 33:691-703. 24. Schwartz, J.A. and I. Tattersall. 1996. Significance of some previously unaccompanied apomorphies in the nasal region of . Proceedings of the National Academy of Science USA 93: 10852-10854. 25. Laitman, J.T., J.S. Reidenberg, S. Marquez, and P. J. Gannon. 1996. What the nose knows: New understandings of upper respiratory tract specializations. Proceedings of the National Academy of Science USA 93: 10543-10545. 26. Clarke, T. 2001. Relics: Early modern humans won hand over fist. Nature. Niewoehner, W. A. 2001. Behavioral inferences from the Skhul/Qafzeh early modern human hand remains. Proceedings of the National Academy of Sciences. 27. Ramirez, F. V., R. and J. Maria Bermudez de Castro. 2004. Surprisingly rapid growth in . Nature 428: 936-939 doi:10.1038/nature02428. 28. Holden, C. 1999. A New Look Into ' Noses. Science 285: 31-33. 29. Krings, M., A. Stone, R. W. Schmitz, H. Krainitzki, M. Stoneking, and S. Paabo. 1997. Sequences and the Origin of Modern Humans. Cell 90: 19-30. 30. Ovchinnikov, I.V., A. Gotherstrom, G. P. Romanovak, V. M. Kharitonov, K. Liden, and W. Goodwin. 2000. Molecular analysis of from the northern Caucasus. Nature 404: 490-493. 31. Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. Grossschmidt, G. Possnert, M. Paunovic, and S. Pbo. 2000. A view of genetic diversity Nature Genetics 26: 144-146. 32. Schmitz, R. W., Serre, D., Bonani, G., Feine, S., Hillgruber, F., Krainitzki, H., Pbo, S. & Smith, F. H. 2002. The type site revisited: Interdisciplinary investigations of skeletal remains from the Neander Valley, Germany. Proceedings of the National Academy of Science USA 99: 13342-13347 33. Stringer, C. B. and R. Mackie. 1996. African Exodus: the Origin of Modern Humanity. Cape, London. 34. Pennisi, E. 2007. ANCIENT : No Sex Please, We're . Science 316: 967. 35. Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542 36. Bowler, J. M., Johnston, H., Olley, J. M., Prescott, J. R., Roberts, R. G., Shawcross, W., and Spooner, N. A. 2003. New ages for human occupation and climatic change at Lake Mungo, Australia. Nature 421: 837-840. 37. Caramelli, D., C. Lalueza-Fox, C. Vernesi, M. Lari, A. Casoli, F. Mallegnii, B. Chiarelli, I. Dupanloup, J. Bertranpetit, G. Barbujani, and G. Bertorelle. 2003. Evidence for a genetic discontinuity between and 24,000-year-old anatomically modern Europeans. Proceedings of the National Academy of Science USA 100: 6593-6597. 38. Foley R. 1998. The context of human genetic evolution. Genome Res 8:339-347. 39. Klein, R.G. 1992. Evolutionary Anthropology 1: 5-14. Balter, M. 1999. Restorers reveal 28,000-year-old artworks. Science 283: 1835. 40. Simon, C. 1981. Stone-age sanctuary, oldest known shrine, discovered in Spain. Science News 120: 357. 41. Bower, B. 1986. When the human spirit soared. Science News 130: 378-379. 42. Clark, G.A. 1999. Highly visible, curiously intangible. Science 283: 2029-2032. 43. Then God said, "Let Us make man in Our image, according to Our likeness; and let them rule over the fish of the sea and over the birds of the sky and over the cattle and over all the earth, and over every creeping thing that creeps on the earth." (Genesis 1:26) Note: The 50,000 year date is the best estimate for modern human origins because the study used a much larger sample size, resulting in a much less uncertainty in the date generated (see the table below for further explanation). 95%confidence interval # # Total Male population mitochondrial DNA polymorphism mitochondrial DNA mtDNA Sequence Y chromosome Y chromosome polymorphism locus Y chromosome Y Chromosomes linkage disequilibrium locus mutations Pleistocene hominid Homo neanderthalensis Neanderthal Neanderthals Neandertals Neandertal DNA Neanderthal DNA Neandertal Neandertal DNA Neandertals Mitochondrial DNA sequences Neandertals nucleotide base pair base base converted by Web2PDFConvert.com Top of Page Back Home | Answers | Design | Creation | Bible | Slideshows | Theology | Aberrant Theology | Tribulation | Life Issues | Discovery | God's Love | Abortion | Discussion | Links | About us | Contact | Newsletter | e-Card | Webmaster | Personal | Humor | Search Study Model men Lower Upper Mean size Dorit, et al. 729 38 27702 0 800,000 270,000 7,500 Dorit, et al. 729 38 27702 0 80,000 27,000 7,500 Hammer 2,600 15 39,000 51,000 411,000 188,000 5,000 Whitfield, et al. 18,300 5 91,500 37,000 49,000 43,000 not given The estimate of modern origins is highly dependent upon the assumed population size (last column of table). The first study assumed a male population size of 7,500 individuals for the entire period of humanity (excluding the last couple thousand years, of course). Such a population size, according to the authors, is "an exceedingly small population size for this entire 300,000 year period" (16). However, such as small population size was necessary to make the as large as it was. Hammer used an even smaller population size (5,000), since he was concerned that his study would not be accepted if the was too small (which he admitted to doing in Internet dialogs). The first two studies (Dorit, et al. and Hammer) have very large , due to the small number of analyzed. Given the size of the in the first two studies, the numbers from all three studies are basically the same. Obviously, the Whitfield, et al. gives the most precise estimate of the date for the appearance of modern humans. http://www.godandscience.org/evolution/descent.html Last Modified February 15, 2008 pairs pairs Coalescent Star phylogeny Coalescent Coalescent coalescence time coalescence time confidence intervals nucleotide base pairs confidence intervals converted by Web2PDFConvert.com