membranifaciens subsp. avinogenie W14-3, a novel riboavin-producing marine yeast Lin Wang, Zhenmin Chi
, Xianghong Wang, Liang Ju, Zhe Chi, Ning Guo
Unesco Chinese Center of Marine Biotechnology, Ocean University of China, Yushan Road, No. 5, Qingdao, Shandong 266003, China Received 17 June 2007; received in revised form 3 December 2007; accepted 9 December 2007 KEYWORDS Riboavin; Marine yeasts; C. membranifaciens subsp. avinogenie; Molecular identication Summary We found that the marine yeast strain W14-3 isolated from seawater of China Eastern Sea could produce riboavin. It is interesting to observe that the marine yeast strain produced a large amount of riboavin in the medium containing xylose, sucrose, galactose and maltose under the conditions of vigorous shaking. The yeast strain was found to belong to Candida membranifaciens subsp. avinogenie based on the results of routine and molecular identication. The protein sequences deduced from the partial genes encoding GTP cyclohydrolase II and 3,4-dihydroxy-2-butanone-4- phosphate synthase in the yeast exhibited high identity with those of the corresponding enzymes for riboavin biosynthesis in other yeasts. Fe 3+ available in the medium repressed riboavin production and expression of the genes responsible for riboavin biosynthesis in the yeast. The results have evidenced that a riboavin synthesis pathway indeed existed in the yeast. This is the rst study to report that C. membranifaciens subsp. avinogenie W14-3 from the marine environment could produce riboavin. & 2008 Elsevier GmbH. All rights reserved. Introduction Riboavin, a yellow, water-soluble vitamin has many physiological roles in human and animals. The best-known biochemically active coenzymes formed from riboavin are mononucleotide (FMN) and avin adenine dinucleotide (FAD), needed as electron acceptors in oxidoreductases (Stahmann et al., 2000). In order to avoid deciency symptoms like dermatitis, a nutritional requirement of 0.31.8 mg riboavin/day for humans and 14 mg riboavin/kg diet for animals is recommended. Riboavin can also be used in soft drinks and yogurt ARTICLE IN PRESS www.elsevier.de/micres 0944-5013/$ - see front matter & 2008 Elsevier GmbH. All rights reserved. doi:10.1016/j.micres.2007.12.001
Corresponding author. Tel/fax: +86 532 82032266.
E-mail address: zhenming@sdu.edu.cn (Z. Chi). (Stahmann et al., 2000). Chemical production still accounts for the major part of industrial riboavin synthesis. However, the disadvantages of the chemical synthesis are a maximum yield of about 60%, thus generating a lot of waste, requiring organic solvents and 25% more energy in compar- ison to the fermentation process (Stahmann et al., 2000). In recent years, the commercial fermenta- tions for riboavin production have been estab- lished and it was found that riboavin production by fermentation has many merits over the chemical process. For example, mild conditions are used, less energy is needed, riboavin is more easily recovered and less wastes are produced during the fermentation. So far the microorganisms that have been used for riboavin biosynthesis on a large scale include the hemiascomycetes Ashbya gossypii (Stahmann et al., 2000; Wendland and Walther, 2005), a lamentous fungus, Candida famata (Stahmann et al., 2000), a yeast, Pichia guillier- mondii (Fayura et al., 2007) and the genetically engineered Bacillus subtilis, which requires at least the deregulation of purine synthesis and a mutation in a avokinase/FAD synthetase (Stahmann et al., 2000). During the isolation and identication of the marine yeasts obtained in this laboratory, we found that the culture of the marine yeast strain W14-3 isolated from seawater of China Eastern Sea turned yellow when it was grown in the medium containing xylose, sucrose, galactose and maltose, at 25 1C for 24 h. Therefore, the main purposes of the present study are to identify and characterize the marine yeast strain W14-3. We also purify and identify the yellow substance produced by the marine yeast strain W14-3. Experimental Yeast strains Different samples (200 m depth, 8 1C, pH 8.1 and 2.89% salinity) of seawater and sediments of China Eastern Sea were collected during winter 2006. Two grams of the sediments and 2.0 ml of the seawater were suspended in 20.0 ml of YPD medium contain- ing 2.0% glucose, 2.0% polypeptone and 1.0% yeast extract and supplemented with 0.05% chloramphe- nicol (to inhibit bacterial growth) immediately after sampling and cultivated at natural tempera- ture for 5 days. Suitable dilutions were prepared and plated out on YPD agar plates with 0.05% chloramphenicol and the plates were incubated at 2025 1C for 5 days. Different colonies from the plates were transferred to the fresh YPD plates. One isolate, strain W14-2, isolated from seawater of China Eastern Sea, was selected for further study based on its production of a yellow substance. The yeast strain was identied to be Candida membra- nifaciens subsp. avinogenie according to the results of routine yeast identication and molecu- lar methods as described below (MCCC No. 2E00233). C. membranifaciens PYCC2727 T , the type yeast strain, was kindly supplied by Dr. Isabel Spencer-Martins from Centro de Recursos Micro- biologicos (CREM) Biotechnology Unit, Faculty of Science and Technology, New University of Lisbon, Portugal. The yeast strains were maintained in YPD medium at 4 1C. Riboavin production One loop of the cells of the yeast strain was transferred to 50.0 ml of YPD medium prepared with distilled water in 250 ml asks and aerobically cultivated at 25 1C for 24 h. At a point when the culture reached a high cell density (OD 600nm 20.0), 0.2 ml of the culture was trans- ferred to 50.0 ml of the production medium that contained 2.0% of different sugars (xylose, maltose, galactose, sucrose, glucose, trehalose, rafnose and cellobiose), 0.5% of (NH 4 ) 2 SO 4 , 0.1% of KH 2 PO 4 , 0.05% of MgSO 4 7H 2 O, 0.01% of CaCl 2 2H 2 O, 0.01% of NaCl and 0.2% of yeast extract and grown by shaking at 170 rpm and 25 1C for 5 days. In order to determine effects of different carbon sources on riboavin production by the yeast strain, the different carbon sources were added to the production medium. The culture was centrifuged at 14,000g and 4 1C for 10 min and the supernatant obtained was used as the crude riboavin solution for quantitative determination of riboavin. Effects of iron in the production medium on riboavin production in the yeast In order to study the effects of iron in the production medium on riboavin production by the marine yeast used in this study, iron was removed from the medium with 8-hydroxyquinoline as described by Cowart et al. (1980). The iron- supplemented medium contained 0.005% FeCl 3 . Quantitative determination of riboavin The amount of riboavin in the supernatant was measured quantitatively at 440 nm by using a spectrophotometer, and riboavin from Sigma served as standard. ARTICLE IN PRESS L. Wang et al. 256 Partial purication of riboavin Fifty milliliters of 0.1 mol/l hydrochloric acid was added to the crude riboavin solution (50 ml) in a 250 ml conical ask. The solution was placed in a water bath at 100 1C for 30 min. After being allowed to cool, it was adjusted to pH 4.5 with 2.5 mol/l sodium acetate (Ndaw et al., 2000) and ltered through lter paper. The ltrate obtained was applied to an MTcleanup and concentration column (TEDA FUJI Chromatogram Developing Corp). The riboavin absorbed on the column was eluted by using pure methanol. The eluate was ltered through a MILLEX s HV lter (0.45 mm). The ltrate was used for high-performance liquid chromato- graphy (HPLC) analysis of riboavin. Chromatographic analysis The riboavin in the ltrate was analyzed by using a HPLC system (Waters, USA). The system consisted of a pump Waters Delta 600, a detector Waters 996 and a column YMC-pack ODS-(A), 250 4.6 mm, 5 mm. The elution was performed by a methanol:water solution 40:60 and the ow rate was 1.0 ml/min. Other conditions used were those described by Arella et al. (1996) for the determination of riboavin. Chromatographic peaks were quantied using a Star Chromato- graphic integrator. The riboavin standard was purchased from Sigma. DNA extraction, PCR and DNA sequencing DNA extraction and PCR techniques for ampli- cation of D1/D2 26S rDNA in the yeast were performed according to the methods described by Chi et al. (2007). The common primers for amplication of the D1/D2 26S rDNA sequence in the yeast were used, the forward primer NL-1: 5 0 -GCATATCAATAAGCGGAGGAAAAG and the reverse primer NL-4: 5 0 -GGTCCGTGTTTCAAGACGG (Sugita et al., 2003). The D1/D2 26S rDNA fragments inserted on the vector (pMD-19T) were sequenced by Shanghai Sangon Company. Phylogenetic analysis of the yeast The sequences obtained above were analyzed for similarity by using Clustal X 1.83. For comparison with currently available sequences, sequences were retrieved with over 98% similarity belonging to different genera from NCBI (http:// www.ncbi.nlm.nih.gov). The phylogenetic tree was constructed by using PHYLIP software package version 3.56 (Felsenstein, 1995). Distance matrices were generated by the DNADIST program, based on Kimuras two-parameter model (Kimura, 1980). Neighbor-joining analysis of the data sets was carried out with the program Neighbor of the PHYLIP package. Metabolic characterization of the yeast The yeast strain was also identied by using BIOLOG system TM (Biolog MicroStation with Micro- log System, Release 4.20, Biolog, Hayward, CA, USA), Biolog Universal Yeast Agar (Biolog) and Biolog Yeast microplate (Biolog) according to the procedures offered by the manufacturer (Praphai- long et al., 1997). The routine identication of the yeast was performed by using the methods as described by Kurtzman and Fell (2000). PCR-based cloning of partial GTP cyclohydrolase II gene and 3,4-dihydroxy-2- butanone-4-phosphate synthase gene PCR was used for partial GTP cyclohydrolase II and 3,4-dihydroxy-2-butanone-4-phosphate synthase DNA amplication. Genomic DNA was prepared as described above. The conserved motifs were usually used to design degenerate primers to clone these homologs. In this case, amino acid sequences of GTP cyclohydrolase II and 3,4-dihy- droxy-2-butanone-4-phosphate synthase from dif- ferent species of eukaryotic microorganisms were downloaded from GenBank (http://www.ncbi. nlm.nih.gov/) and aligned. The degenerate sense primers and antisense primers for amplication of partial GTP cyclohydrolase II DNA were rib1_1_2f1: CAACAGGGAACACTTGGCAAT and rib1_1_4r2: CGTTCACCACAATCACATCGT, and the degenerate sense primers and antisense primers for amplica- tion of partial 3,4-dihydroxy-2-butanone-4-pho- sphate synthase DNA were rib3_0_1f: GAACGTG- AAAATGAAGGTGAT and rib3_3_3r:CGACACCGACCT- CAGTGT. PCR was performed on a GeneAmp PCR System 2400 made by PerkinElmer using a program of 94 1C for 1 min, 52 1C for 1 min and 72 1C for 2 min for 30 cycles, followed by extension for 8 min at 72 1C. PCR products were separated by agarose gel electrophoresis and recovered by using UNIQ-col- umn DNA gel recovery kits (BIOASIA, Shanghai). The recovered PCR products were ligated into pMD19-T and transformed into competent cells of Escher- ichia coli DH5a. The transformants were selected on LB plates with ampicillin. The plasmids in the transformant cells were extracted by using the methods as described by Sambrook et al. (1989). ARTICLE IN PRESS Isolation and characterization of C. membranifaciens subsp. avinogenie W14-3 257 The cloned DNA fragments inserted on the vector were sequenced by Shanghai Sangon Company. The amino acid sequences of the cloned DNA frag- ments were deduced and protein sequences were aligned using CLUSTAL X program (Thompson et al., 1994). Total RNA isolation and RT-PCR Total RNA was isolated from strain W14-3 grown in the production medium without and with iron supplementation using RNAiso Reagent (TaKaRa, Japan) according to the manufacturers instruc- tions. Total RNA in the sample was determined by spectrophotometry at 260 nm. The same amount of total RNA (1.0 mg) was used to analyze mRNA levels by RT-PCR. To synthesize the rst cDNA strand of the two cloned genes mentioned above, reverse transcriptase M-MLV (RNase H
) was used according
to the protocols provided by the manufacturer. PCR amplication was performed using Taq DNA poly- merase from Promega. Two sets of the specic primers (rib1_rt_f1: TATTCCCTGGTGGATTACAAGC, rib1_rt_r1: CACAATCACATCGGGCACT, rib3_rt_f1: GCGGAATCAATCACCCAAG and rib3_rt_r1: GCGTA- GTCGCAAGTTATCGTAT designed according to the sequences of the partial genes cloned above) were used for RT-PCR. One set of specic primers for amplication of the 18S rRNA gene (18s_rt_f1: TACAGTGAAACTGCGAATGGC and 18s_rt_r1: AGCA- CAAGGTCATGCGATT) was designed according to the sequence of the 18S rRNA gene (accession number: EF362753) in this strain. The conditions for RT-PCR amplication were as follows: initial denaturation at 94 1C for 5 min, denaturation at 94 1C for 30 s, annealing temperature at 51 1C for 30 s, extension at 72 1C for 1 min and nal extension at 72 1C for 10 min. RT-PCR was run for 32 cycles. 18S rRNA gene was used as an internal standard. Results Isolation of yeast strain W14-3 and yellow substance production A total of 100 yeast strains from seawater and sediments in China Eastern Sea were obtained. We found that the culture of the marine yeast strain W14-3 turned into yellow color when it was aerobically grown in the medium containing mal- tose at 25 1C for 24 h (Figure 1B). The yeast strain was isolated from China Eastern Sea. However, the type yeast strain C. membranifaciens PYCC2727 T did not produce such a yellow substance in the same medium under the same conditions (Figure 1A). In order to know if the yeast strain could produce the yellow substance when it was grown on other carbon sources, different carbon sources (glucose, sucrose, fructose, maltose, trehalose, xylose, D-rafnose, D-galactose) were added to the production medium. The results in Table 1 indicate that the yeast strain produced more yellow substance only in the medium containing xylose, sucrose, galactose and maltose. Analysis of the yellow substance by HPLC The supernatant from the culture with a yellow color was treated as described in Materials and ARTICLE IN PRESS Figure 1. The culture color occurred in the cultures of the marine yeast strain W14-3 (B) and type yeast strain PYCC2727 T (A) within 72 h. The sugar concentrations were 2.0%. Table 1. The yellow substance production from differ- ent carbon sources A B C D E F G H + ++ ++++ ++ ++++ + +++ +++ A: D-trehalose; B: D-glucose; C: D-xylose; D: fructose; E: sucrose; F: D-rafnose; G: D-galactose; H: maltose. The sugar concentra- tions were 2.0%. ++++: the most colorful solution; +++: more colorful solution; ++: the colorful solution; +: trace yellow color in the solution. L. Wang et al. 258 ARTICLE IN PRESS 200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 400.00 420.00 440.00 460.00 480.00 5.75 440.7 364.7 256.8 218.8 5.75 440.7 364.7 265.8 218.8 nm 200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 400.00 420.00 440.00 460.00 480.00 nm 0.003 0.002 0.001 0.000 -0.001 A U 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 Minutes Minutes 0.012 0.010 0.008 0.006 0.004 0.002 0.000 A U 2.00 4.00 6.00 8.00 10.00 12.00 14.00 Figure 2. HPLC spectra of riboavin standard (A) and the partially puried yellow substance (B). Isolation and characterization of C. membranifaciens subsp. avinogenie W14-3 259 methods. The treated supernatant was applied to the column and the yellow substance in the eluate was analyzed by using HPLC. The HPLC spectra of the partially puried yellow substance show that there was only one main peak that was identical to that of the riboavin standard (Figure 2A and B). It can also be seen from the results in Figure 2 that ultraviolet spectra of the riboavin standard and the sample were the same (upper panel of Figure 2A and B). These results demonstrate that the yellow substance produced by the marine yeast strain W14-3 was riboavin. However, further work, using analytical techniques (such as NMR, MS, etc.) is needed to obtain structural characterization that will ultimately provide conclusive evidence that the compound of interest is indeed a riboavin, or a riboavin-like compound. Cloning of the partial genes encoding GTP cyclohydrolase II and 3,4-dihydroxy-2- butanone-4-phosphate synthase In order to conrm that the RIB1 gene encoding GTP cyclohydrolase II and the RIB3 gene encoding 3,4- dihydroxy-2-butanone-4-phosphate synthase exist in strain W14-3 and type yeast strain C. membranifaciens PYCC2727 T used in this study, the conserved motifs ARTICLE IN PRESS Figure 3. Multiple alignment of protein sequences encoding yeast GTP cyclohydrolase II. The GTP cyclohydrolase II are referenced by their databases. Multiple sequence alignment of proteins was carried out using the method of Clustral X 1.83 based on amino acid sequences of GTP cyclohydrolase II from Candida albicans-EAK96830 (1), Candida famata- CAH17652 (2), Candida glabrata-XP_446157 (3), Debaryomyces hansenii-XP_456888 (4), Kluyveromyces lactis- XP_452081 (5), Pichia guilliermondii-CAA88916 (6), Pichia stipitis-XP_001383311 (7), Saccharomyces cerevisiae- NP_009520 (8) and amino acid sequence (9) deduced from the cloned partial DNA fragment of the yeast strain used in this study. L. Wang et al. 260 were used to design degenerate primers to clone the partial genes encoding GTP cyclohydrolase II and 3,4- dihydroxy-2-butanone-4-phosphate synthase in the yeast strain W14-3 and C. membranifaciens PYCC2727 T , respectively. In this case, amino acid sequences of GTP cyclohydrolase II and 3,4-dihy- droxy-2-butanone-4-phosphate synthase from differ- ent species of eukaryotic microorganisms were downloaded from GenBank (http://www.ncbi.nlm. nih.gov) and aligned. The PCR-generated fragments obtained from genomic DNA of the yeast strain W14-3 were sequenced. The alignment and comparison of the protein (GTP cyclohydrolase II and 3,4-dihydrox- y-2-butanone-4-phosphate synthase) sequences de- duced from the partial genes (accession numbers were EU239888 and EU275163) with sequences in the protein databases using BLAST program are shown in Figures 3 and 4, respectively. The deduced proteins showed very high identity with GTP cyclohydrolase II and 3,4-dihydroxy-2-butanone-4-phosphate synthase from other yeasts (Figures 3 and 4). Routine identication of the marine yeast strain W14-3 On yeast extract and malt (YM) medium the colonies were white to chalky, dull, powdery, dry, and wrinkled with a rough border (Figure 5A). Single cells were oval, producing daughter cells by single polar budding in liquid YM medium (Figure 5B). Pseudomycelia occurred, but no sexual reproduction was seen. It is very interesting to note that the colonies of the marine yeast strain W14-3 on the plate containing maltose are white, although it is common to all other microorganisms that riboavin production is recognizable by the yellow color of the colonies. We found that the yeast strain produced riboavin only by vigorous shaking (Figure 1B). The yeast strain could not ferment maltose, galactose, lactose and rafnose, but could ferment glucose and sucrose (data not shown). Biolog analysis shows that it could assimilate ARTICLE IN PRESS Figure 4. Multiple alignments of protein sequences of yeast 3,4-dihydroxy-2-butanone-4-phosphate synthases. They are referenced by their databases. Multiple sequence alignment of proteins was carried out using the method of Clustral X 1.83 based on amino acid sequences of of 3,4-dihydroxy-2-butanone-4-phosphate synthase from Saccharomyces cerevisiae-AAB64927 (1), Pichia stipitis-XM_001386886 (2), Kluyveromyces lactis-XP_451875 (3), Saccharomyces cerevisiae-Z21619 (4), Yarrowia lipolytica-XM_500663 (5), Candida glabrata-CAG60514 (6), Schizosaccharomyces pombe-CAA18874 (7) and amino acid sequence (8) deduced from the cloned partial DNA fragment of the yeast strain used in this study. Figure 5. Photographs of colonies (A) and microphoto- graph of vegetable cells (B) of the marine yeast strain W14-3. Medium: YPD medium; incubation temperature: 25 1C; time: 2 days. Isolation and characterization of C. membranifaciens subsp. avinogenie W14-3 261 glucose, galactose, L-sorbose, sucrose, maltose, cellobiose, trehalose, melibiose, rafnose, inulin, D-xylose, L-arabinose, D-arabinose and L-rhamnose, but could not assimilate L-rhamnose (Table 2). Based on the fermentation spectra and carbon source assimilation spectra of the marine yeast and those of the type strain (C. membranifaciens) listed in The yeast: a taxonomic study, 4th revised and enlarged edition (Kurtzman and Fell, 2000), we found that the yeast strain W14-3 was closely related to C. membranifaciens. Phylogenetic analysis of partial sequences of the D1/D2 26S rDNA sequence According to Kurtzman and Fell (2000), tradi- tional and routine identication methods, which depend on phenotype, usually lead to uncertain and inaccurate interpretations of species interac- tion. Sequence analysis of phylogeny for microbial taxonomy is a more accurate method for determin- ing inter- and intra-specic relationships. There- fore, a partial sequence of D1/D2 26S rDNA of the yeast strain was determined and aligned by using BLAST analysis (http://www.ncbi.nlm.nih.gov/ BLAST). A phylogenetic tree was constructed by using PHYLIP software package version 3.56 (Felsenstein, 1995). Distance matrices were gener- ated by the DNADIST program based on Kimuras two-parameter model (Kimura, 1980). Neighbor- joining analysis of the data sets was carried out with the program Neighbor of the PHYLIP package. Ricciocarpos natans was used as the out-group during the construction of a consensus tree of the ARTICLE IN PRESS Table 2. Assimilation of carbon sources of strain W14-3 by Biolog analysis Carbon sources Results Carbon sources Results Acetic acid D-Galactose + Formic acid D-Psicose + Propionic acid L-Rhamnose Succinic acid L-Sorbose + Succinic acid mono-methyl ester a-Methyl-D-glucoside + L-Aspartic acid b-Methyl-D-glucoside + L-Glutamic acid Amygdalin L-Proline w Arbutin + D-Gluconic acid + Salicin + Dextrin Maltitol Inulin + D-Mannitol + Fumaric acid w D-Sorbitol + L-Malic acid w Adonitol + Succinic acid mono-methyl ester Lactose + Bromosuccinic acid Amidulin + L-Glutamic acid + D-Arabitol + g-Aminobutyric acid w Xylitol + a-Ketoglutaric acid i-Erythritol + 2-Keto-gluconic acid + Glycerol + D-Gluconic acid + Tween 80 Dextrin L-Arabinose + D-Cellobiose + D-Arabinose + Gentiobiose + D-Ribose Maltose + D-Xylose + Maltotriose + Succinic acid mono-methyl ester plus D-xylose w D-Melezitose + N-acetyl-L-glutamic acid plus D-xylose D-Melibiose + Quinic acid plus D-xylose Palatinose + D-Glucuronic acid plus D-xylose D-Rafnose + Dextrin plus D-xylose Stachyose + a-D-Lactose plus D-xylose Sucrose + D-Melibiose plus D-xylose + D-Trehalose + D-Galactose plus D-xylose + Turanose + m-Inositol plus D-xylose N-Acetyl-D-glucosamine + 1,2-Propanediol plus D-xylose D-Glucosamine W Acetoin plus D-xylose a-D-glucose + W: weak; +: positive; : negative. L. Wang et al. 262 ARTICLE IN PRESS Figure 6. Consensus tree of the isolate based on D1/D2 26S rDNAs obtained in this study and 23 previously published sequences obtained from GenBank. The outgroup we used was Ricciocarpos natans. Numbers on tree branches indicate the percentages of bootstrap samplings derived from 1000 samples that supported the internal branches by 50% or higher. All the strains shown are type strains. Isolation and characterization of C. membranifaciens subsp. avinogenie W14-3 263 isolate based on the D1/D2 26S rDNA sequence. The search for the similarity between the D1/D2 26S rDNA sequence of the isolate and that in the NCBI database shows that many phylogenetically related yeast species were similar to the marine yeast strain obtained in this study. Phylogenetic relation- ships of the D1/D2 26S rDNA sequence of the marine yeast strain are shown in Figure 6 and its GenBank accession number is EF362752. The topology of the phylogram in Figure 6 conrms that 100% bootstrap values were detected between the D1/D2 26S rDNA sequence of strain W14-3 and that of C. membra- nifaciens. Therefore, the yeast strain W14-3 was closely related to C. membranifaciens. Discussion As shown in Figures 1 and 2 and Table 1, the marine yeast strain W14-3 produced a large amount of riboavin, whereas the type yeast strain C. membranifaciens PYCC2727 T did not produce any riboavin under the same conditions. The results (Figure 7) also show that the marine yeast strain W14-3 also produced a large amount of riboavin in the production medium prepared with seawater, but Fe 3+ available in the medium completely repressed riboavin production. Finally, the yeast strain W14-3 was identied to be C. membranifaciens subsp. avinogenie (Table 2, Figure 6), meaning that it was different from the type yeast strain C. membranifaciens due to its production of riboavin and the presence of genes responsible for riboavin biosynthesis (Figures 3 and 4). In addition, the yeast strain W14-3 grew well in the medium containing 60% glucose, while C. membranifaciens PYCC2727 T grew poorly in the same medium (data not shown). The biosynthetic pathway of riboavin has been studied in considerable detail in bacteria, fungi and yeasts (Humbelin et al., 1999; Stahmann et al., 2000; Karos et al., 2004). It has been well documented that GTP cyclohydrolase II is encoded by the RIB1 gene, while the 3,4-dihydroxy-2- butanone-4-phosphate synthase is encoded by the RIB3 gene (Humbelin et al., 1999; Stahmann et al., 2000; Karos et al., 2004). The deduced amino acid sequences from the partial genes encoding GTP cyclohydrolase II and 3,4-dihydroxy-2-butanone-4- phosphate synthase in the marine yeast strain W14-3 showed very high identity with those of GTP cyclohydrolase II and 3,4-dihydroxy-2-buta- none-4-phosphate synthase from different eucar- yotic microorganisms (Figures 3 and 4), suggesting that a riboavin synthesis pathway indeed existed in the yeast. Among the terrestrial microorganisms, A. gossy- pii, a lamentous fungus, C. famata, a yeast, and the genetically engineered B. subtilis have been commercially used to produce riboavin by fer- mentation (Stahmann et al., 2000; Wendland and Walther, 2005). In addition, Sabry et al. (1989) used C. guilliermondii Wickerham to produce riboavin and Buzzini and Rossi (1998) used the immobilized Candida tropicalis cells to produce riboavin. Eremothecium ashbyii, a fungus was also found to have the ability to produce a large amount of riboavin (Kalingan and Liao, 2002). It has been reported that P. guilliermondii is capable of riboavin overproduction under iron deciency (Fayura et al., 2007). Therefore, this is the rst study to report that C. membranifaciens subsp. avinogenie W14-3 isolated from the marine environment can produce riboavin. Usually, iron in the medium will repress riboavin production by the terrestrial yeasts and fungi. The results in Table 3 also show that added iron in the production medium completely repressed riboavin production by the marine yeast. However, removal of iron only weakly affected riboavin production by the marine yeast. Therefore, it is more suitable and economical to apply the marine yeast strain to riboavin production on a large scale than any other riboavin producers. The results in Figure 8 ARTICLE IN PRESS Table 3. Effect of iron in the production medium on riboavin production by the marine yeast Media Medium treated with 8-hydroxyquinoline Production medium without any treatment Medium supplemented with 0.005% FeCl 3 Riboavin yield (mg/ml) 16.370.1 14.770.3 070.1 Figure 7. Riboavin production in the production media. 1: The production medium prepared with distilled water; 2: the production medium supplemented with iron; 3: the production medium prepared with seawater. L. Wang et al. 264 indicate that added iron in the medium repressed expression of RIB1 and RIB3 genes in the yeast cells. This means that iron also negatively affects riboavin production by the marine yeast strain W14-3 at the transcriptional level. In order to enhance riboavin production, optimization of the medium and cultivation conditions for riboavin production by C. membranifaciens subsp. avino- genie W14-3 is being undertaken in the laboratory. Acknowledgments This research was supported by the Hi-Tech Research and Development Program of China (863), and the grant number is 2006AA09Z403. References Arella F, Lahely S, Bourguignon J, Hasselmann C. Liquid chromatographic determination of vitamins B1 and B2 in foods: a collaborative study. Food Chem 1996;56: 816. Buzzini P, Rossi J. Semi-continuous and continuous riboavin production by Candida tropicalis in concen- trated rectied grate calcium-alginate-immobil- ized must. World J Microbiol Biotechnol 1998;14: 37781. Chi ZM, Ma CL, Wang P, Li HF. Optimization of medium and cultivation conditions for alkaline protease production by the marine yeast Aureobasidium pullulans. Bior- esour Technol 2007;98:5348. Cowart RE, Marquardt MP, Foster BG. The removal of iron and other trace elements from a complex bacteriological medium. Microbiol Lett 1980;13: 11722. Felsenstein J. PHYLIP (Phylogenetic Inference Package), Version 3.75. Distributed by author. Seattle, WA: Department of Genetics, University of Washington; 1995. Fayura LR, Fedorovych DV, Prokopiv TM, Boretsky YR, Sibirny AA. The pleiotropic nature of rib80, hit1, and red6 mutations affecting riboavin biosynthesis in the yeast Pichia guilliermondii. Microbiology 2007;76: 559. Humbelin M, Griesser V, Keller T, Schurter W, Haiker M, Hohmann HP, et al. GTP cyclohydrolase II and 3,4- dihydroxy-2-butanone 4-phosphate synthase are rate- limiting enzymes in riboavin Bacillus subtilis strain used for synthesis of an industrial riboavin produc- tion. J Ind Microbiol Biotechnol 1999;22:17. Kalingan AE, Liao CM. Inuence of type and concentra- tion of avinogenic factors on production riboavin by Eremothecium ashbyii NRRL 1363. Bioresour Technol 2002;82:21924. Karos M, Vilarino C, Bollschweiler C, Revuelta JL. A genome-wide transcription analysis of a fungal ribo- avin overproducer. J Biotechnol 2004;113:6976. Kimura M. A simple method for estimating evolutionary rate of base substitutions through comparative stu- dies on nucleotide sequences. J Mol Evol 1980;2: 8790. Kurtzman CP, Fell JW. In: The yeasts: a taxonomic study, 4th revised and enlarged edition. Amsterdam: Else- vier; 2000. p. 1525. Ndaw S, Bergaertzle M, Aoude-Werner D, Hasselmann C. Extraction procedures for the liquid chromatographic determination of thiamin, riboavin and vitamin B in foodstuffs. Food Chem 2000;71:12938. Praphailong W, Gestel MV, Fleet GH, Heard GM. Evalua- tion of the Biolog system for the identication of food and beverage yeasts. Lett Appl Microbiol 1997;24: 4559. Sabry SA, El-Refal AH, Gamati SY. Physiological study on riboavin production by a hydrocarbon-utilizing cul- ture of Candida guilliermondii Wickerham. J Islamic Acad Sci 1989;2:2730. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual, 2nd ed. Beijing: Cold Spring Harbor Laboratory Press; 1989. p. 36770 (Chinese translated ed.). Stahmann KP, Revuelta JL, Seulberger H. Three biotech- nical processes Ashbya gossypii, Candida famata or Bacillus subtilis compete with using chemical ribo- avin production. Appl Microbiol Biotechnol 2000;53: 50916. Sugita T, Takashima M, Kodama M, Tsuboi R, Nishikawa A. Description of a new yeast species Malassezia japonica, ARTICLE IN PRESS Figure 8. The changes of the amount of mRNAs encoding GTP cyclohydrolase II and 3,4-dihydroxy-2-butanone-4- phosphate synthase in the yeast cells grown in different media. 1: The amount of 18S rRNA in the yeast cells grown in the production medium. 2: The amount of 18S rRNA in the yeast cells grown in the production medium supplemented with iron. 3: The amount of mRNA encoding GTP cyclohydrolase II in the yeast cells grown in the production medium. 4: The amount of mRNA encoding GTP cyclohydrolase II in the yeast cells grown in the production medium supplemented with iron. 5: The amount of mRNA encoding 3,4-dihydroxy-2-butanone-4- phosphate synthase in the yeast cells grown in the production medium. 6: The amount of mRNA encoding 3,4-dihydroxy-2-butanone-4-phosphate synthase in the yeast cells grown in the production medium supplemen- ted with iron. M: DNA markers (the DNA bands from bottom to top are 0.1, 0.25, 0.5, 0.75, 1.0 and 2.0 kb). Isolation and characterization of C. membranifaciens subsp. avinogenie W14-3 265 and its detection in patients with atopic dermatitis and healthy subjects. J Clin Microbiol 2003;41:46959. Thompson JD, Higgins DD, Gibson JJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions specic gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:467388. Wendland J, Walther A. Ashbya gossypii: a model for fungal development biology. Nat Rev Microbiol 2005;5:4219. ARTICLE IN PRESS L. Wang et al. 266