Am J Physiol Renal Physiol 300: F199F206, 2011. First published October 27, 2010; doi:10.1152/ajprenal.00513.2010.

Is caveolin involved in normal proximal tubule function? Presence in model PT systems but absence in situ
Zhenjie Zhuang, Vladimir Marshansky, Sylvie Breton, and Dennis Brown
Massachusetts General Hospital Center for Systems Biology, Program in Membrane Biology and Division of Nephrology, Simches Research Center, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts
Submitted 3 September 2010; accepted in nal form 22 October 2010

Zhuang Z, Marshansky V, Breton S, Brown D. Is caveolin involved in normal proximal tubule function? Presence in model PT systems but absence in situ. Am J Physiol Renal Physiol 300: F199F206, 2011. First published October 27, 2010; doi:10.1152/ajprenal.00513.2010.Kidney proximal tubule (PT) cells are specialized for the uptake and transport of ions, solutes, peptides, and proteins. These functions are often regulated by hormones that signal at the cell surface and are internalized by clathrin-mediated endocytosis. However, the caveolin/caveolae pathway has also been implicated in normal PT function, often based on data from isolated PTs or PT cells in culture. Although we reported previously that caveolae and caveolin 1 are not detectable in PTs in vivo, reports of caveolin expression and function in PT cells appear periodically in the literature. Therefore, we reexamined caveolin expression in PTs in vivo, in isolated puried PTs following collagenase digestion, and in cultured PT cells. Caveolin 1 and 2 protein, mRNA, or immunouorescence was undetectable in PTs in vivo, but PT cell cultures expressed caveolin 1 and/or 2. Furthermore, caveolin 1 and 2 mRNAs were detected in isolated PTs along with the endothelial markers CD31 and ICAM1. In contrast, no caveolin or endothelial marker mRNAs were detectable in samples isolated from snap-frozen kidneys by laser cut microdissection, which eliminates contamination by other cell types. We conclude 1) caveolin 1 and 2 are not normally expressed by PT cells in situ, 2) caveolin expression is activated in cultured PT cells, 3) contamination with non-PT, caveolin-expressing cells is a potential source of caveolin 1 and 2 that must be taken into account when isolated PTs are used in studies to correlate expression of these proteins with PT function. kidney; cell culture; isolated tubules; endocytosis
RENAL PROXIMAL TUBULE (PT) cells are highly specialized for the bulk reabsorption of many ions, solutes, and smaller proteins, including receptor ligands and hormones, which penetrate the glomerular ltration barrier and appear in the tubule lumen. Furthermore, PT cells respond to circulating hormones and have distinct transport properties associated with their apical and basolateral membranes. As such, they display a very distinct polarized expression of many channels, transporters, enzymes, and receptors that all contribute toward their physiological function (4 6, 8, 14, 41, 50). As part of their vectorial transporting and reabsorptive activity, many membrane proteins undergo extensive constitutive and regulated trafcking and recycling (8). In the PT, the endocytotic arm of the trafcking pathway is intimately related to a variety of specialized functions including the reabsorption of ltered molecules from the luminal uid, as well as downregulation of membrane transporters such as NaPi1a in response to activation of PTH receptors (5), and downregulation of angiotensin II

receptors (56). Plasma membrane hormone receptors themselves also undergo endocytosis and, in many cases, recycling in PT cells (14). In general, the major mechanism responsible for the extensive apical endocytotic activity of PT cells is believed to be clathrin-mediated endocytosis (14, 32, 48). This is also the case for basolateral endocytosis of, for example, the Na-K-ATPase in these cells (12, 13). In many cell types, however, an alternative endocytotic mechanism involving ask-shaped membrane invaginations known as caveolae and their associated protein, caveolin 1 (45), has been implicated in the internalization of plasma membrane proteins (16, 25, 28, 36, 42). In addition, the reported association of a variety of signal transduction proteins in lipid rafts and caveolae has led to the concept that caveolae serve as signal transduction foci in different cell types (1, 24, 35, 37). While these caveolae-related events have been reported in several different cell types in which caveolae/caveolin are clearly present, many caveolin-related interactions have also been proposed to be present and functionally important in PT cells (see DISCUSSION). However, we and others previously failed to detect caveolae in PT cells in vivo, and the caveolin 1 protein was not detectable by immunocytochemistry in these cells in situ under normal conditions (7, 18, 54, 55). The aim of this report was to reexamine PTs from intact kidneys for the expression of caveolins using different approaches and to compare our ndings with results from PT cells in culture and isolated PTs in vitro. Our results clearly demonstrate that in normal kidney, caveolins 1 and 2 are not expressed in PT cells in situ, whereas they are expressed in PT cells in culture. Furthermore, reports of caveolin expression in PTs isolated from the renal cortex appear to result from contamination with caveolin-rich vascular endothelial cells and other contaminating epithelial cells.
MATERIALS AND METHODS

Fixation of Kidneys for Immunostaining Rats and mice were anesthetized using pentobarbital sodium (Nembutal, Abbott Laboratories, Abbott Park, IL; 50 mg/kg body wt ip). The animals were then perfused via the left cardiac ventricle with PBS for 1 min followed by paraformaldehyde-lysine-periodate xative (PLP) as previously described (7). Following perfusion with PLP, the kidneys were dissected, sliced, and further xed by immersion in PLP for 4 h at room temperature and subsequently overnight at 4C. Kidneys were then rinsed extensively in PBS and stored at 4C in PBS containing 0.02% sodium azide until further use. All animal studies were approved by the Massachusetts General Hospital Subcommittee on Research Animal Care, in accordance with the National Institutes of Health, Department of Agriculture, and American Association for Accreditation of Laboratory Animal Care requirements.
F199

Address for reprint requests and other correspondence: D. Brown, Massachusetts General Hospital, Simches Research Bldg., 185 Cambridge St., CPZN 8150, Boston, MA 02114 (e-mail: brown.dennis@mgh.harvard.edu). http://www.ajprenal.org

0363-6127/11 Copyright 2011 the American Physiological Society

F200

ABSENCE OF CAVEOLIN EXPRESSION IN PROXIMAL TUBULES IN SITU

Immunouorescence Microscopy of Kidney Tissue Fixed kidneys were cryoprotected in PBS containing 0.9 M sucrose, embedded in Tissue-Tek OCT compound 4583 (Sakura Finetek USA, Torrance, CA), frozen at 20C, and 4- to 5-m sections were cut on a Leica CM3050 S cryostat (Leica Microsystems, Bannockburn, IL) and mounted onto Superfrost Plus slides (Fisher Scientic, Pittsburg, PA). Slides were rehydrated in PBS for 15 min, treated with 1% SDS for 4 min as an antigen retrieval step (9), and blocked with 1% bovine serum albumin in PBS for 10 min. Sections were incubated for 1 h with rabbit anti-caveolin 1 antibody (BD Transduction Labs, 610060 or 610059) at 1:200 dilution or rabbit caveolin 2 antibody (Novus Biologicals, NB-300586) at 1:100 dilution and then for 1 h with Alexa 488-conjugated goat anti-rabbit IgG (Invitrogen, Carlsbad, CA; 2.5 g/ml). Some sections were double-stained using anticaveolin 1 as described above, followed by an anti-megalin monoclonal antibody (1:100 dilution of ascites uid), 1H2 (2) and donkey anti-mouse IgG coupled to CY3 (1:800; Jackson ImmunoResearch Laboratories, West Grove, PA; catalog no. 715165-1510). Slides were mounted in Vectashield medium (Vector Laboratories, Burlingame, CA) for microscopy and examined using a Nikon 80i epiuorescence microscopy equipped with a Hamamatsu ORCA CCD camera. Some tissues were processed for cutting semithin 1-m sections in which the relationship between PT cells and the peritubular capillaries could be better visualized. These tissues were immersed overnight in 2.3 M sucrose in PBS, and small 1- to 2-mm cubes were mounted on special microtome supports and frozen in liquid nitrogen. Sections were cut at 1-m thickness using a glass knife on a Leica UCS ultracryomicrotome with a chamber temperature of 60C. The delicate sections were picked up from the surface of the glass knife using a bacterial loop holding a drop of 2.3 M sucrose solution and were placed immediately on Superfrost Plus slides. Immunostaining was performed as described above for 5-m sections. Immunouorescence Microscopy of Cell Cultures The cell types used in these studies were immortalized rat proximal tubule (IRPT) cells, mouse proximal tubule cells (MTC), LLC-PK1 porcine kidney cells believed to be of proximal origin, and mouse inner medullary collecting duct cells (IMCD). Epithelial cell cultures were grown on glass coverslips as previously described and were xed by replacing the culture medium with 4% paraformaldehyde in 0.1 M sodium phosphate buffer, pH 7.4, for 20 min. Cells were permeabilized using 1% SDS for 4 min and were washed 3 5 min with PBS. Anti-caveolin 1 and 2 antibodies (see above for details) were applied for 1 h at room temperature, followed (after being washed) by goat antirabbit IgG conjugated to Alexa 488. Coverslips were washed and mounted using Vectashield. In Vivo Labeling of PT Cells and Laser Cut Microdissection Mouse kidney PT cells were labeled by injection of 0.1 ml albumin-Alexa 555 (10 mg/ml in 0.9% NaCl) into the lateral tail vein of mice as previously described (23). Mice were killed 15 min later and their kidneys were removed and immediately frozen by immersion in liquid nitrogen. Cryosections of the unxed kidneys were cut at 5-m thickness and mounted on special PEP-membrane slides for laser microdissection [Cellcut, Molecular Machines and Industries (MMI), Haslett, MI]. PT cells were clearly distinguished from other tubules in the renal cortex under uorescence mode by their extensive uptake of albumin-Alexa 555 (23). Selection of PT for microdissection was achieved on a Wacom touch screen display by encircling PT proles with the MMI CellTools pen, followed by cutting them out using the cold laser set at a thickness of 1 m. During the isolation procedure, great care was taken not to include the base of the cells adjacent to the capillary endothelium, to avoid potential contamination of the samples with endothelial cells. Isolated cells were removed
AJP-Renal Physiol VOL

from the rest of the tissue by attachment to the adhesive cap of the collection tube. For each 0.5-ml collection tube, 120 tubules were acquired. Each section was microdissected for a maximum of 15 min to avoid mRNA degradation that occurs progressively during exposure to air at room temperature. Microdissected tubules were immediately resuspended in RNA extraction buffer. PT Isolation Mouse PTs were freshly isolated using methods previously described by Vinay et al. (51). Mice were killed by CO2 inhalation. Kidneys were quickly removed and the cortex was sliced with a Stadie-Riggs slicer (Thomas Scientic, Swedesboro, NJ) and then nely minced with a sharp scalpel. Minced tissue chunks were incubated in 20 ml 1 mg/ml type II collagenase (Worthington Biochemical, 47D9570) solution for 12 min while rotating at 37C in a hybridization oven. After incubation, tubules were released into solution by pipetting up and down 10 times. The undigested tissue pieces were allowed to settle while sitting on ice, and the supernatant was then transferred to a new tube on ice. More fresh collagenase was added to the pellet to continue to digest more of the tissue. After three repeat treatments, the supernatants were combined and tubules were recovered by centrifugation at 100 g for 5 min. Tubules were washed and then separated from other nephron segments by gradient centrifugation in Percoll solution at 35,000 g for 40 min. Collected tubules were immediately resuspended in RNA extraction buffer after centrifugation. The isolated PTs were 95% pure as determined by phase contrast microscopic inspection, consistent with previous reports (17). RNA Isolation, Amplication, and Reverse Transcription-PCR Total RNA from the laser cut microdissection (LCM) sample was extracted and puried with the Picopure RNA isolation kit (Arcturus, catalog no. 12204 01). To obtain enough material for PCR, two rounds of RNA amplication were carried out with a RiboAmp RNA amplication kit (Arcturus, catalog no. RA7011) as previously described (15). RNA from cell lines and isolated PT was extracted and puried with a RNeasy Mini Kit (Qiagen, catalog no. 74104). Some of the RNA from the MTC cell line was also amplied with the RiboAmp RNA amplication kit as a control for the efcacy of the amplication procedure. One microgram of RNA from the amplication or extracted directly from cultured cells or the isolated PTs was reverse transcribed into cDNA with a SuperScript III First-Strand Synthesis Supermix kit (Invitrogen, 11752 050). One microliter of cDNA product was used as a template for the PCR reaction. Primers used for PCR amplication are listed in Table 1. RNA was reverse transcribed into cDNA with a SuperScript III First-Strand Synthesis Supermix kit. One microliter of cDNA product was used as a template for the PCR reaction. Western Blot Analysis Protein was extracted from cultured cells with RIPA lysis buffer (Bioproduct, BP-115). Cell lysates were heated for 5 min at 70C in NuPAGE LDS sample buffer (Invitrogen, NP-0008). Proteins were loaded on to Nupage Novex Bis-Tris Gel and then transferred to PVDF membrane (Bio-Rad, 162 0174). Membranes were blocked with 5% milk in Tris-buffered saline containing 0.1% Tween 20 and immunoblotted with rabbit anti-mouse caveolin 1 (BD Transduction Laboratories, 610059, 1:2,000) or caveolin 2 (Novus Biologicals, NB-300586, 1:500) and then donkey anti-rabbit IgG-horseradish peroxidase (1:100,000). Tris-buffered saline containing 0.1% Tween 20 was used for washing between antibody incubations. Immunoreactive proteins were identied by chemiluminescence (Perkin Elmer, NEL104).
www.ajprenal.org

300 JANUARY 2011

ABSENCE OF CAVEOLIN EXPRESSION IN PROXIMAL TUBULES IN SITU

F201

Table 1. Sequences of primer sets used in this study

Gene Product Forward Primer Reverse Primer

ARNO vATPase E AldolaseB GAPDH CD31 ICAM CAV1 (mouse/pig) CAV2 (mouse) CAV2 (pig) CAV1, caveolin 1. RESULTS

CCCCCTAGAGAACCTGAGCAT GGTGGCGTTGAGATCTATAATGG CCACGAGACCCTCTACCAGAAG GCATCCTGCACCACCAACT CTGCCAGTCCGAAAATGGAAC GGCATTGTTCTCTAATGTCTCCG ATGTCTGGGGGCAAATACGTG TCACCAGCTCAACTCTCATCT CCTAACGGTGTTCCTGGCTA

GGCTTTGATGAGCTGTCCCTTA ACGGACTTCTGGCATCATCTG CACCTCCTTGGTCCAACTTGAT GCAGTGATGGCATGGACTGT CTTCATCCACCGGGGCTATC GCTCCAGGTATATCCGAGCTTC CGCGTCATACACTTGCTTCT GCCAGAAATACGGTCAGGAACT TTCAGTCATGGCTCAGTTGC

Immunocytochemical Detection of Caveolin PT cells in situ. We previously reported that caveolin 1 protein is not detectable in PT epithelial cells in the rat kidney, in situ (7). This nding was conrmed using a different antibody for mouse kidney (Fig. 1) as well as rat kidney (Fig. 2) in the present study and was extended to show that caveolin 2 is also undetectable in PT cells while it is present in adjacent cortical tubules, as well as in endothelial cells (Fig. 3, arrows). Positive staining

for megalin conrmed that the PTs in our cryosections were appropriate for immunocytochemical detection of other antigens (Fig. 2). We hypothesized that non-PT caveolin could be a potential source of contamination in isolated tubule preparations that would lead to the conclusion that caveolin is expressed in PTs. PT cells in culture. In striking contrast to our in situ data, all cell culture lines that we examined by immunouorescence showed caveolin 1 staining both on the plasma membrane and on some intracellular structures (Fig. 4, AC). The staining took the form of small punctate spots of uorescence, as well as some large areas in which the smaller spots seemed to have coalesced into a larger patch of staining. Among the cells we examined were IRPT cells, MTC cells, and LLC-PK1 cells. Other nonproximal cell lines such as IMCD cells (collecting duct) and MDCK cells (believed to be of distal origin) also showed positive caveolin 1 staining (not shown). Caveolin 2 was also localized in a similar pattern in IRPT and MTC cells but was undetectable in LLC-PK1 cells using the available anti-caveolin 2 antibodies (Fig. 4, DF). Cells exposed to the secondary antibody alone were unstained (data not shown). These data were conrmed by Western blotting. While caveolin 1 was detectable in all cell types tested (although it was much weaker in LLC-PK1 cells), caveolin 2 was detectable in IRPT and MTC cells, but not in LLC-PK1 (Fig. 5) cells under our experimental conditions. In MTC and IRPT cells, the two

Fig. 1. Semithin (1 m) cryostat sections of mouse kidney cortex showing localization of caveolin 1 (red) in vascular smooth muscle (arrows) and endothelial cells (arrowheads), but not in proximal tubule epithelial cells (PT). A: endothelial cells in the glomerulus (G) also stain for caveolin 1. B: caveolin-positive endothelial cells (arrows) are in very close proximity to the base of proximal tubule cells, in which caveolin 1 expression is not detectable. Nuclei are labeled blue with DAPI. The green staining represents endogenous background autouorescence that was enhanced to show tubular structures. Bar 5 m. AJP-Renal Physiol VOL

Fig. 2. Cryostat section of rat kidney juxtamedullary cortex showing absence of caveolin staining in proximal tubules (PT) that are identied by positive apical staining for megalin (green). In contrast, caveolin (red) is readily detectable in other tubules including collecting ducts (CD) and in the peritubular vasculature. Bar 10 m. www.ajprenal.org

300 JANUARY 2011

F202

ABSENCE OF CAVEOLIN EXPRESSION IN PROXIMAL TUBULES IN SITU

Fig. 3. Conventional 5-m cryostat section of mouse kidney cortex showing localization of caveolin 2 (red) in cortical collecting ducts (CCD) and endothelial cells of the G and peritubular capillaries (arrows). PT are unstained. Bar 5 m.

Fig. 5. Western blotting of total cell extracts from cell cultures. Cav1 is expressed in all cells, but the expression level is lower in LLC-PK1 cells. Caveolin appears as a doublet representing the 24-kDa -isoform and the 21-kDa -isoform in MTC and IRPT cells. Only the -isoform is detectable in LLC-PK1 cells, but at much lower levels than in the 2 other PT cell lines tested. Cav2 is expressed in IRPT and MTC cells, but it is not detectable in LLC-PK1 cells, consistent with the absence of immunostaining in this cell line (see Fig. 4).

bands at 24 and 21 kDa reect the presence of two caveolin 1 isoforms, and , respectively. Only the -isoform was detectable (at low levels) in LLC-PK1 cells. Detection of Caveolin mRNA by RT-PCR in PT Samples and Cell Cultures Next, we examined the expression of caveolin 1 and 2 in mRNA samples derived from 1) collagenase-digested tissues followed by traditional Percoll gradient centrifugation, 2) sam-

ples obtained by LCM followed by mRNA amplication, and 3) the cultured cell lines. Our results show that both caveolin 1 and 2 are readily detectable in the PT samples prepared by collagenase digestion and centrifugation, and in the MTC cell line, whereas they are not detectable in the samples obtained by LCM of PTs from frozen sections of the renal cortex (Fig. 6). To exclude the possibility that the absence of PCR product from LCM samples was due to the RNA amplication technique, the RNA from cultured MTC used in this gel was also

Fig. 4. Localization of caveolin 1 and 2 in PT cell lines in culture. AC: caveolin 1 (Cav1) is expressed in all cell lines examined. The staining has a punctate appearance as well as areas of high expression that may reect coalescence of Cav1 into larger patches. Cav2 has a similar expression pattern in immortalized rat PT (IRPT) and mouse PT (MTC) cells (D, E), but it is not detectable in LLC-PK1 cells (F). Bar 5 m. AJP-Renal Physiol VOL
300 JANUARY 2011

www.ajprenal.org

ABSENCE OF CAVEOLIN EXPRESSION IN PROXIMAL TUBULES IN SITU

F203

Fig. 6. RT-PCR data showing presence of caveolin 1 and 2 in PT isolated by collagenase digestion followed by Percoll gradient centrifugation (Col), and in MTC cells, but absence of both caveolin 1 and 2 mRNA from PT samples isolated by laser cut microdissection (LCM). GAPDH is detectable in all samples. Samples from MTC cells, LCM, and the GAPDH control were from amplied RNA, whereas samples from isolated PT were not amplied.

amplied using the same technique, using the same amount of starting material (mRNA). Consistent with Western blotting and immunostaining data, all cultured cells tested expressed Cav1 mRNA. Cav2 mRNA was found in three of the cell lines, but was not detectable in LLC-PK1 cells under normal exposure conditions (Fig. 7). However, a faint Cav2 band was detectable in LLC-PK1 cells when the gel was overexposed (not shown). Furthermore, the GAPDH control lanes in Fig. 6 were also generated using amplied mRNA from the MTC and laser cut samples. The mRNA samples from collagenasedigested tubules were not amplied before RT-PCR. Finally, mRNA encoding several PT proteins (aldolase, V-ATPase E subunit, ARNO) was detectable in both the collagenase-digested samples (not shown) and the laser cut material (Fig. 8), indicating that these samples were appropriate for detection of the expression of multiple other mRNAs, including those encoding quite low abundance proteins such as the Arf-GEF protein known as ARNO (23). Collagenase-Digested PT Samples Are Contaminated By Endothelial Cells Based on our hypothesis that the caveolin mRNA that has been detected previously in isolated PTs might derive from contamination by caveolin-expressing cells including endothelial cells, the expression of two endothelial cell markers CD31

and ICAM1 was examined by RT-PCR in the various samples. Figure 9 clearly shows that while these markers were undetectable in PT samples obtained by LCM, they were readily detectable in the PTs obtained by collagenase-digestion and Percoll gradient ultracentrifugation. As an additional control, MTC cells were tested and were also negative for the endothelial cell markers. GAPDH was present as expected in all samples.
DISCUSSION

The renal PT is specialized for a number of functions that involve membrane protein trafcking, endocytosis, and signal transduction (3, 8, 14, 39, 41, 56). Many studies have examined the cellular mechanisms and pathways that participate in several of these specialized functions, including amino acid (50), phosphate (5), glucose (4) and sodium transport (52), acid/base regulation and sensing (6, 38), and water reabsorption (49). This work involved the use of a variety of cellular systems ranging from the intact kidney in animals, isolated tubules in vitro, cell culture models, and isolated membrane domains from PT cells. It is, of course, ultimately critical to use systems that are relevant to the in vivo situation, and while it is well-known that in vitro models are certainly valid surrogates in many instances, this is not always the case. Our current data suggest that the attribution of certain PT

Fig. 7. RT-PCR showing presence of Cav1 mRNA in all cell lines examined. Cav2 mRNA is detected in IRPT, MTC, and IMCD cells, but not in LLC-PK1 cells. The LLC primers used here were directed against the pig sequence; when the gel was overexposed, a very faint band became visible in the LLC Cav2 lane (not shown). All samples were from unamplied RNA. IMCD, inner medullary collecting duct.

AJP-Renal Physiol VOL

300 JANUARY 2011

www.ajprenal.org

F204

ABSENCE OF CAVEOLIN EXPRESSION IN PROXIMAL TUBULES IN SITU

Fig. 8. Expression of 3 PT markers in PT isolated by LCM followed by mRNA amplication. Aldolase (Aldo), the V-ATPase E-subunit (V-ATP), and the Arf6-GDP/GTP exchange factor ARNO are all detectable, indicating that laser cutting followed by amplication represents a reliable source of material for analysis of mRNA expression in PT.

functions to the presence of caveolins and caveolae is problematic, because neither appears to be expressed in PT cells in situ under normal physiological conditions. Our earlier study showed that caveolin 1 protein was not detectable by immunouorescence in PTs (7). Data from other groups conrmed that the protein is not detectable by immunocytochemistry in PTs in situ (18, 55), but nevertheless reported the presence of caveolin 1 in collagenase-isolated PTs (55). The selective presence of caveolin 2 but not caveolin 1 has also been reported by Western blotting in isolated rat PTs (47). The absence of caveolin 1 immunostaining has been attributed to issues of epitope masking in situ that prevents recognition by some anti-caveolin antibodies (55), or the inability of some antibodies to recognize caveolin 1 in some intracellular locations (10). Based on our current data, generated using a polyclonal anti-Cav1 antibody, combined with our

previous report in which two different mouse monoclonal antibodies were used (6), we believe that this technical consideration does not explain the absence of caveolins in the PT. Several years ago, we reported that PT brush-border membranes prepared using the Ca/Mg precipitation method as well as PT basolateral membrane vesicles isolated from the renal cortex by density gradient centrifugation can be contaminated with endothelial membranes (40). Because caveolin 1 and 2 are highly expressed in endothelial cells, we wondered whether the reported presence of these proteins in isolated PT might also result in part from inadvertent contamination of the PT preparation. Our data show that this seems to be the case. PTs isolated using a well-established protocol involving collagenase digestion and Percoll gradient centrifugation do indeed contain caveolin 1 and 2 mRNA. But they also contain the specic endothelial markers CD31 and ICAM1. In striking contrast, PT samples isolated from frozen kidney sections by careful LCM contain no detectable caveolin 1 or 2 mRNA and, critically, no CD31 or ICAM1 mRNA. Our conclusion is that PT isolated by traditional methods indeed can carry with them endothelial cell contamination, in addition to being up to 5% contaminated with other types of epithelial cells (that may express caveolins) (17). It is, however, possible that some isolation procedures may produce more highly puried tubules (20). Indeed, neither caveolins nor the endothelial markers ICAM1 and CD31 were reported in a recent systematic transcriptome analysis (http://dir.nhlbi.nih.gov/papers/lkem/pttr/ Default.aspx) performed on isolated rat PTs (53). In view of the close relationship between endothelial cells and the basolateral pole of the PT cells, these results highlight the fact that care must be taken to quantify the extent of potential contamination in studies using isolated PT samples for gene/protein expression studies. Our current data also show that work on some cell biological aspects of PT function based on the exclusive use of cell cultures must also be approached with caution. It is clear that all cell cultures examined, including IRPT, LLC-PK1, and MTC, express caveolin 1 and to a more variable degree, caveolin 2. Furthermore, others also reported the expression of caveolin 1 in PT cell lines including immortalized mouse PT cells (43), HK-2 cells derived from the PT (55), as well as in

Fig. 9. RT-PCR showing expression of endothelial-specic markers in PT samples isolated by collagenase digestion/ centrifugation (Col) and LCM, as well as in the MTC cell line. The specic endothelial markers CD31 and ICAM1 are present in the collagenase-digested tubules only, but they are absent from the laser cut PT samples and the MTC cells. GAPDH as a control is present in all samples. Samples from MTC cells, LCM, and the GAPDH control were from amplied RNA, whereas samples from isolated PT were not amplied.

AJP-Renal Physiol VOL

300 JANUARY 2011

www.ajprenal.org

ABSENCE OF CAVEOLIN EXPRESSION IN PROXIMAL TUBULES IN SITU

F205

LLC-PK1 cells (21, 30), which are often considered PT-like despite their uncertain tubular origin (22). This sets them apart from normal PT cells in situ, in which neither of these proteins can be detected. Furthermore, our prior electron microscopic examination of PT cells in situ failed to detect morphologically identiable caveolae in PT epithelial cells in the intact kidney (7). While the intention of this report is not to provide an exhaustive list of the PT functions that have been associated with caveolin/caveolae expression, some selected attributions that may need to be reevaluated pending conrmation by correlative biochemical and morphological approaches using PTs in situ are as follows: 1) the association of Ca2-ATPase with caveolin-rich membrane domains in the PT based on the biochemical evaluation of basolateral membrane fractions from renal cortex (46), 2) the interaction between caveolin and hsp70 in angiotensin II signaling (34), 3) the role of CD40/caveolin/caveolae interactions in renal inammatory disease (29), 4) a role for caveolin in ouabain-induced endocytosis of the Na-K-ATPase, based on work in LLC-PK1 cells (30), 5) interaction between the amino acid transporter BAT-1 and caveolin/caveolae (26), 6) interaction between the organic anion transporter OAT1 with caveolin 2 (27), 7) involvement of caveolin 2 in dopamine receptor signaling (54), and 8) association of NaPiIIa (and its endocytosis) with caveolin-containing low-density membrane microdomains (33). It is important to note that most parameters of renal function, including creatinine clearance, albumin ltration and excretion, blood urea nitrogen levels, and general blood chemistries, are no different in caveolin 1-null mice than in normal mice (11, 44). The only major difference that has emerged that can be attributed to caveolin 1 knockout is an impaired calcium reabsorption, which leads to urinary stone formation (11). This is interesting, since Ca2-ATPase, which is abundant in the basolateral plasma membrane of distal tubules, has been convincingly located in caveolae (19). In the absence of caveolin 1 and caveolae, this important enzyme appears diffusely distributed throughout the cytosol of DCT cells (11). Thus, with this exception, no renal dysfunction has yet been convincingly associated with the absence of caveolae in vivo. Do PT cells ever express caveolins in situ? Yes during regeneration/repair after renal injury, the transient expression of caveolin 1, together with the appearance of caveolae, has been demonstrated. This has been shown in both ischemic injury (31, 55) and after gentamycin-induced injury (18). However, caveolin expression is transient and rapidly downregulates to undetectable levels 8 days after recovery, when the epithelium is restored. Thus, caveolin expression could be related to injury/stress and it is, therefore, possible that caveolin expression is activated as part of an adaptation of some cells to culture conditions. Whatever the mechanisms involved, our data suggest that caveolin is unlikely to play any major role in PT function under normal physiological conditions. Studies performed using in vitro systems must, therefore, be carefully interpreted with this in mind.
GRANTS This work was supported by National Institutes of Health (NIH) Grants R37-DK-42956 (to D. Brown) and DK-38452 (to S. Breton and V. Marshansky). The Microscopy Core Facility of the Program in Membrane Biology received additional support from the Boston Area Diabetes and Endocrinology AJP-Renal Physiol VOL

Research Center (NIH DK-57521) and from the Center for the Study of Inammatory Bowel Disease (NIH DK-43351). DISCLOSURES No conicts of interest, nancial or otherwise, are declared by the author(s). REFERENCES 1. Allen JA, Yu JZ, Dave RH, Bhatnagar A, Roth BL, Rasenick MM. Caveolin-1 and lipid microdomains regulate Gs trafcking and attenuate Gs/adenylyl cyclase signaling. Mol Pharmacol 76: 10821093, 2009. 2. Bachinsky DR, Zheng G, Niles JL, McLaughlin M, Abbate M, Andres G, Brown D, McCluskey RT. Detection of two forms of GP330. Their role in Heymann nephritis. Am J Pathol 143: 598 611, 1993. 3. Bailey MA, Shirley DG. Effects of extracellular nucleotides on renal tubular solute transport. Purinergic Signal 5: 473480, 2009. 4. Bakris GL, Fonseca VA, Sharma K, Wright EM. Renal sodium-glucose transport: role in diabetes mellitus and potential clinical implications. Kidney Int 75: 12721277, 2009. 5. Biber J, Hernando N, Forster I, Murer H. Regulation of phosphate transport in proximal tubules. Pgers Arch 458: 39 52, 2009. 6. Boron WF. Acid-base transport by the renal proximal tubule. J Am Soc Nephrol 17: 2368 2382, 2006. 7. Breton S, Lisanti MP, Tyszkowski R, McLaughlin M, Brown D. Basolateral distribution of caveolin-1 in the kidney. Absence from HATPase-coated endocytic vesicles in intercalated cells. J Histochem Cytochem 46: 205214, 1998. 8. Brown D, Breton S, Ausiello DA, Marshansky V. Sensing, signaling and sorting events in kidney epithelial cell physiology. Trafc 10: 275 284, 2009. 9. Brown D, Lydon J, McLaughlin M, Stuart-Tilley A, Tyszkowski R, Alper S. Antigen retrieval in cryostat tissue sections and cultured cells by treatment with sodium dodecyl sulfate (SDS). Histochem Cell Biol 105: 261267, 1996. 10. Bush WS, Ihrke G, Robinson JM, Kenworthy AK. Antibody-specic detection of caveolin-1 in subapical compartments of MDCK cells. Histochem Cell Biol 126: 2734, 2006. 11. Cao G, Yang G, Timme TL, Saika T, Truong LD, Satoh T, Goltsov A, Park SH, Men T, Kusaka N, Tian W, Ren C, Wang H, Kadmon D, Cai WW, Chinault AC, Boone TB, Bradley A, Thompson TC. Disruption of the caveolin-1 gene impairs renal calcium reabsorption and leads to hypercalciuria and urolithiasis. Am J Pathol 162: 12411248, 2003. 12. Chibalin AV, Katz AI, Berggren PO, Bertorello AM. Receptor-mediated inhibition of renal Na-K-ATPase is associated with endocytosis of its - and -subunits. Am J Physiol Cell Physiol 273: C1458 C1465, 1997. 13. Chibalin AV, Zierath JR, Katz AI, Berggren PO, Bertorello AM. Phosphatidylinositol 3-kinase-mediated endocytosis of renal Na, KATPase alpha subunit in response to dopamine. Mol Biol Cell 9: 1209 1220, 1998. 14. Christensen EI, Verroust PJ, Nielsen R. Receptor-mediated endocytosis in renal proximal tubule. Pgers Arch 458: 1039 1048, 2009. 15. Da Silva N, Silberstein C, Beaulieu V, Pietrement C, Van Hoek AN, Brown D, Breton S. Postnatal expression of aquaporins in epithelial cells of the rat epididymis. Biol Reprod 74: 427438, 2006. 16. Del Pozo MA, Balasubramanian N, Alderson NB, Kiosses WB, Grande-Garcia A, Anderson RG, Schwartz MA. Phospho-caveolin-1 mediates integrin-regulated membrane domain internalization. Nat Cell Biol 7: 901908, 2005. 17. Elliget KA, Trump BF. Primary cultures of normal rat kidney proximal tubule epithelial cells for studies of renal cell injury. In Vitro Cell Dev Biol 27A: 739 748, 1991. 18. Fujigaki Y, Sakakima M, Sun Y, Goto T, Ohashi N, Fukasawa H, Tsuji T, Yamamoto T, Hishida A. Immunohistochemical study on caveolin-1alpha in regenerating process of tubular cells in gentamicininduced acute tubular injury in rats. Virchows Arch 450: 671681, 2007. 19. Fujimoto T. Calcium pump of the plasma membrane is localized in caveolae. J Cell Biol 120: 11471157, 1993. 20. Gesek FA, Wolff DW, Strandhoy JW. Improved separation method for rat proximal and distal renal tubules. Am J Physiol Renal Fluid Electrolyte Physiol 253: F358 F365, 1987. 21. Gines S, Ciruela F, Burgueno J, Casado V, Canela EI, Mallol J, Lluis C, Franco R. Involvement of caveolin in ligand-induced recruitment and www.ajprenal.org

300 JANUARY 2011

F206

ABSENCE OF CAVEOLIN EXPRESSION IN PROXIMAL TUBULES IN SITU 40. Sabolic I, Culic O, Lin SH, Brown D. Localization of ecto-ATPase in rat kidney and isolated renal cortical membrane vesicles. Am J Physiol Renal Fluid Electrolyte Physiol 262: F217F228, 1992. 41. Saito A, Sato H, Iino N, Takeda T. Molecular mechanisms of receptormediated endocytosis in the renal proximal tubular epithelium. J Biomed Biotechnol 2010: 403272, 2010. 42. Smart EJ, Foster DC, Ying YS, Kamen BA, Anderson RG. Protein kinase C activators inhibit receptor-mediated potocytosis by preventing internalization of caveolae. J Cell Biol 124: 307313, 1994. 43. Sneddon WB, Magyar CE, Willick GE, Syme CA, Galbiati F, Bisello A, Friedman PA. Ligand-selective dissociation of activation and internalization of the parathyroid hormone (PTH) receptor: conditional efcacy of PTH peptide fragments. Endocrinology 145: 28152823, 2004. 44. Sorensson J, Fierlbeck W, Heider T, Schwarz K, Park DS, Mundel P, Lisanti M, Ballermann BJ. Glomerular endothelial fenestrae in vivo are not formed from caveolae. J Am Soc Nephrol 13: 2639 2647, 2002. 45. Thomas CM, Smart EJ. Caveolae structure and function. J Cell Mol Med 12: 796 809, 2008. 46. Tortelote GG, Valverde RH, Lemos T, Guilherme A, Einicker-Lamas M, Vieyra A. The plasma membrane Ca2 pump from proximal kidney tubules is exclusively localized and active in caveolae. FEBS Lett 576: 3135, 2004. 47. Trivedi M, Narkar VA, Hussain T, Lokhandwala MF. Dopamine recruits D1A receptors to Na-K-ATPase-rich caveolar plasma membranes in rat renal proximal tubules. Am J Physiol Renal Physiol 287: F921F931, 2004. 48. Ungewickell EJ, Hinrichsen L. Endocytosis: clathrin-mediated membrane budding. Curr Opin Cell Biol 19: 417425, 2007. 49. Verkman AS. Dissecting the roles of aquaporins in renal pathophysiology using transgenic mice. Semin Nephrol 28: 217226, 2008. 50. Verrey F, Singer D, Ramadan T, Vuille-dit-Bille RN, Mariotta L, Camargo SM. Kidney amino acid transport. Pgers Arch 458: 5360, 2009. 51. Vinay P, Gougoux A, Lemieux G. Isolation of a pure suspension of rat proximal tubules. Am J Physiol Renal Fluid Electrolyte Physiol 241: F403F411, 1981. 52. Wang H, Haas M, Liang M, Cai T, Tian J, Li S, Xie Z. Ouabain assembles signaling cascades through the caveolar Na/K-ATPase. J Biol Chem 279: 17250 17259, 2004. 53. Yu MJ, Miller RL, Uawithya P, Rinschen MM, Khositseth S, Braucht DW, Chou CL, Pisitkun T, Nelson RD, Knepper MA. Systems-level analysis of cell-specic AQP2 gene expression in renal collecting duct. Proc Natl Acad Sci USA 106: 24412446, 2009. 54. Yu P, Yang Z, Jones JE, Wang Z, Owens SA, Mueller SC, Felder RA, Jose PA. D1 dopamine receptor signaling involves caveolin-2 in HEK293 cells. Kidney Int 66: 21672180, 2004. 55. Zager RA, Johnson A, Hanson S, dela Rosa V. Altered cholesterol localization and caveolin expression during the evolution of acute renal failure. Kidney Int 61: 1674 1683, 2002. 56. Zhuo JL, Li XC. Novel roles of intracrine angiotensin II and signalling mechanisms in kidney cells. J Renin Angiotensin Aldosterone Syst 8: 2333, 2007.

22. 23.

24. 25. 26. 27. 28. 29. 30. 31.

32. 33.

34.

35. 36. 37. 38. 39.

internalization of A(1) adenosine receptor and adenosine deaminase in an epithelial cell line. Mol Pharmacol 59: 1314 1323, 2001. Hull RN, Cherry WR, Weaver GW. The origin and characteristics of a pig kidney cell strain, LLC-PK. In Vitro 12: 670 677, 1976. Hurtado-Lorenzo A, Skinner M, El Annan J, Futai M, Sun-Wada GH, Bourgoin S, Casanova J, Wildeman A, Bechoua S, Ausiello DA, Brown D, Marshansky V. V-ATPase interacts with ARNO and Arf6 in early endosomes and regulates the protein degradative pathway. Nat Cell Biol 8: 124 136, 2006. Insel PA, Patel HH. Membrane rafts and caveolae in cardiovascular signaling. Curr Opin Nephrol Hypertens 18: 50 56, 2009. Kumari S, Mg S, Mayor S. Endocytosis unplugged: multiple ways to enter the cell. Cell Res 20: 256 275, 2010. Kwak JO, Kim HW, Jung SM, Song JH, Hong SB, Oh KJ, Ko CB, Cha SH. Colocalization and interaction of b0,-type amino acid transporter 1 (BAT1) with caveolin-1 in rat kidney. J Nephrol 18: 681689, 2005. Kwak JO, Kim HW, Oh KJ, Kim DS, Han KO, Cha SH. Colocalization and interaction of organic anion transporter 1 with caveolin-2 in rat kidney. Exp Mol Med 37: 204 212, 2005. Lakhan SE, Sabharanjak S, De A. Endocytosis of glycosylphosphatidylinositol-anchored proteins. J Biomed Sci 16: 93, 2009. Li H, Nord EP. Functional caveolae are a prerequisite for CD40 signaling in human renal proximal tubule cells. Am J Physiol Renal Physiol 286: F711F719, 2004. Liu J, Liang M, Liu L, Malhotra D, Xie Z, Shapiro JI. Ouabaininduced endocytosis of the plasmalemmal Na/K-ATPase in LLC-PK1 cells requires caveolin-1. Kidney Int 67: 1844 1854, 2005. Mahmoudi M, Willgoss D, Cuttle L, Yang T, Pat B, Winterford C, Endre Z, Johnson DW, Gobe GC. In vivo and in vitro models demonstrate a role for caveolin-1 in the pathogenesis of ischaemic acute renal failure. J Pathol 200: 396 405, 2003. Marshansky V, Ausiello DA, Brown D. Physiological importance of endosomal acidication: potential role in proximal tubulopathies. Curr Opin Nephrol Hypertens 11: 527537, 2002. Nashiki K, Taketani Y, Takeichi T, Sawada N, Yamamoto H, Ichikawa M, Arai H, Miyamoto K, Takeda E. Role of membrane microdomains in PTH-mediated downregulation of NaPi-IIa in opossum kidney cells. Kidney Int 68: 11371147, 2005. Nishiyama A, Hitomi H. Role of caveolin and heat shock protein 70 interaction in the antioxidative effects of an angiotensin II type 1 receptor blocker in spontaneously hypertensive rats proximal tubules. J Hypertens 28: 9 12, 2010. Pani B, Singh BB. Lipid rafts/caveolae as microdomains of calcium signaling. Cell Calcium 45: 625633, 2009. Parton RG. Ultrastructural localization of gangliosides; GM1 is concentrated in caveolae. J Histochem Cytochem 42: 155166, 1994. Patel HH, Murray F, Insel PA. Caveolae as organizers of pharmacologically relevant signal transduction molecules. Annu Rev Pharmacol Toxicol 48: 359 391, 2008. Preisig PA. The acid-activated signaling pathway: starting with Pyk2 and ending with increased NHE3 activity. Kidney Int 72: 1324 1329, 2007. Qi W, Chen X, Poronnik P, Pollock CA. Transforming growth factorbeta/connective tissue growth factor axis in the kidney. Int J Biochem Cell Biol 40: 9 13, 2008.

AJP-Renal Physiol VOL

300 JANUARY 2011

www.ajprenal.org