53BP1 Inhibits Homologous Recombination in Brca1-Decient Cells by Blocking Resection of DNA Breaks

n,1,8 Nancy Wong,1,8 Hua-Tang Chen,1 Federica Polato,1 Amanda Gunn,4 Anne Bothmer,5 Samuel F. Bunting,1 Elsa Calle Niklas Feldhahn,5 Oscar Fernandez-Capetillo,7 Liu Cao,2 Xiaoling Xu,3 Chu-Xia Deng,3 Toren Finkel,2 Nussenzweig1,* Michel Nussenzweig,5,6 Jeremy M. Stark,4 and Andre
Immunology Branch, National Cancer Institute Medicine Branch, National Heart, Lung, and Blood Institute 3Genetics of Development and Disease Branch, National Institute for Diabetes and Digestive and Kidney Diseases National Institutes of Health, Bethesda, MD 20892, USA 4Department of Cancer Biology and Irell and Manella Graduate School of Biological Sciences, Beckman Research Institute of the City of Hope, Duarte, CA 91010, USA 5Laboratory of Molecular Immunology 6Howard Hughes Medical Institute Rockefeller University, New York, NY 10065, USA 7Genomic Instability Group, Spanish National Cancer Research Centre (CNIO), 28029 Madrid, Spain 8These authors contributed equally to this work *Correspondence: andre_nussenzweig@nih.gov DOI 10.1016/j.cell.2010.03.012
2Translational 1Experimental

SUMMARY

Defective DNA repair by homologous recombination (HR) is thought to be a major contributor to tumorigenesis in individuals carrying Brca1 mutations. Here, we show that DNA breaks in Brca1-decient cells are aberrantly joined into complex chromosome rearrangements by a process dependent on the nonhomologous end-joining (NHEJ) factors 53BP1 and DNA ligase 4. Loss of 53BP1 alleviates hypersensitivity of Brca1 mutant cells to PARP inhibition and restores error-free repair by HR. Mechanistically, 53BP1 deletion promotes ATM-dependent processing of broken DNA ends to produce recombinogenic single-stranded DNA competent for HR. In contrast, Lig4 deciency does not rescue the HR defect in Brca1 mutant cells but prevents the joining of chromatid breaks into chromosome rearrangements. Our results illustrate that HR and NHEJ compete to process DNA breaks that arise during DNA replication and that shifting the balance between these pathways can be exploited to selectively protect or kill cells harboring Brca1 mutations.
INTRODUCTION Mutations in the Brca1 gene predispose carriers to a high incidence of breast and ovarian cancer (Venkitaraman, 2004). In the absence of Brca1, Xrcc2, or other homologous recombination (HR) proteins, Rad51 foci formation and homology dependent repair are impaired (Moynahan et al., 1999; Scully et al.,

1999). Since the HR pathway is required for repair of spontaneous double-stranded breaks (DSBs) that arise during DNA replication, defects in HR result in an accumulation of chromatid breaks (Andreassen et al., 2006; Sonoda et al., 1998). Cells that cannot repair chromatid breaks by HR become more reliant on other poorly dened alternative repair pathways. These pathways are not template based like HR and therefore have the propensity to join together DSBs on different chromatids to produce complex chromosomal rearrangements, which promote genomic instability and/or trigger loss in viability (Bryant et al., 2005; Farmer et al., 2005; Sonoda et al., 1998). Genomic instability following loss-of-function of Brca1 is hypothesized to be a key factor leading to tumorigenesis in individuals with the Brca1 mutation; nevertheless, additional mutations are required to enable survival and outgrowth of tumor cells (Deng, 2006; Venkitaraman, 2004). HR-decient cells exhibit an acute sensitivity to killing by inhibitors of the single-stranded DNA (ssDNA) repair protein poly(ADP-ribose) polymerase (PARP) (Bryant et al., 2005; Farmer et al., 2005; Jackson and Bartek, 2009). Mechanistically, loss of PARP activity prevents repair of ssDNA breaks, which are then converted into DSBs during DNA replication. These breaks are normally repaired by Rad51-dependent HR using the sister chromatid as a template, hence PARP inhibition is particularly toxic in Brca1- or Brca2-decient cells, which are HR defective. The ability of PARP inhibitors to selectively kill HR-decient cells is currently being used in clinical trials for treatment of breast and ovarian cancers where Brca1 or Brca2 is mutated (Fong et al., 2009; Jackson and Bartek, 2009). More recently, it has been observed that Brca2-decient tumors are capable of acquiring reversion mutations that enable resistance to chemotherapeutic agents (Edwards et al., 2008; Sakai et al., 2008). This observation raises the possibility that additional secondary mutations could

Cell 141, 243254, April 16, 2010 2010 Elsevier Inc. 243

B
Brca111/11 p53+/Brca111/11 53BP1-/WT

Figure 1. Deletion of 53BP1 Reduces Mammary Tumorigenesis, Radial Chromosome Formation, and Cellular Proliferation Defects in Brca1D11/ D11 Cells
(A) Breast cancer incidence in mice decient in Brca1. The red line indicates tumor incidence in mice with deletion of Brca1 exon 11 targeted to the mammary cells with a Cre transgene under control of the MMTV LTR promoter (Brca1f/f; MMTV-Cre). The blue line shows mammary tumor incidence in Brca1D11/ D1153BP1/ mice, in which Brca1 exon 11 and 53BP1 are deleted in all cells. (B) Radial chromosome structures characteristic of metaphases from Brca1D11/ D11p53+/ B cells. The percentage of metaphases containing radial chromosomes in Brca1D11/ D11p53+/ (n = 300), Brca1D11/ D1153BP1/ (n = 300) and WT (n = 100) cells is indicated. Note that equivalent results were seen with Brca1D11/ D11p53+/ and Brca1D11/ D11p53/cells. (C) Flow cytometry analysis of B cells to measure cell survival. The labeled populations in the dot plots are viable cells, identied by their ability to exclude PI and their lack of caspase 3 activation. The chart shows the frequency of live cells treated with PARP inhibitor normalized to the untreated population. (D) Proliferation of B cells pulsed with CFSE and cultured with and without PARP inhibitor. CFSE signal diminishes with increasing cell division, so that cells that do not divide have the highest CFSE signal. See also Figure S1.

Brca111/1153BP1-/(n = 22) Brca1/ ;MMTV-Cre (n = 27)

10.7%

1.0%

0%

C
untreated
PI

D
+ PARPi
WT

49.69

49.06

WT

Untreated + PARPi

Caspase

45.03

12.88

Brca111/11 p53+/Brca111/11 p53+/-

55.64

46.78

Brca111/11 53BP1-/-

Percent live cells (relative to untreated)

100 80 60 40 20 0

Brca111/11 53BP1-/-

WT

Brca111/11 Brca111/11 p53+/53BP1-/-

CFSE

mediate resistance of Brca-decient tumors to the toxic effects of PARP inhibitors. Mice homozygous for the exon 11 deletion (D11) isoform of Brca1 (Brca1D11/D11) die in utero (Xu et al., 2001). Embryonic cell death is associated with extensive apoptosis and activation of the ATM-Chk2-p53 arm of the DNA damage response (Cao et al., 2006). Indeed, embryonic lethality can be rescued by complete or heterozygous loss of p53 (Xu et al., 2001) or deletion of ATM or Chk2 (Cao et al., 2006). Deletion of 53BP1 also rescues the viability of Brca1D11/D11 mice (Cao et al., 2009). However, in contrast to rescue by loss of p53, Brca1D11/D1153BP1/ mice exhibit a low incidence of tumor formation and near-normal life span (Cao et al., 2009). Nevertheless, Brca1D11/D1153BP1/ cells showed elevated levels of DSBs, intact ATM-Chk2-p53 signaling, and ionizing radiation (IR)-induced apoptosis (Cao et al., 2009). The only known functions of 53BP1 are in transducing a subset of ATM-dependent cell-cycle checkpoints (DiTullio et al., 2002; Fernandez-Capetillo et al., 2002; Lee et al., 2010; Wang et al., 2002) and facilitating the joining of distal DSBs formed at dysfunctional telomeres and during lymphocyte antigen receptor recombination (Dilippantonio et al., 2008; Dimitrova et al., 2008; Manis et al., 2004; Reina-San-Martin et al., 2007; Ward et al., 2004). None of these activities would appear to account for the survival of Brca1D11/D11 mice in the absence of 53BP1. Thus, the underlying mechanism by which loss of 53BP1 rescues cell death and prevents tumorigenesis in Brca1 mutant mice remains unclear.

Here, we show that the presence of 53BP1 limits the capacity of Brca1-decient cells to accurately repair DSBs. Importantly, the high levels of genomic instability and cell death induced in Brca1-decient cells by treatment with an inhibitor of PARP are not present in Brca1/53BP1 double-decient cells. Genomic stability is rescued because the HR pathway is largely restored in cells lacking Brca1 and 53BP1. In contrast, Brca1-decient repair is not normalized by deletion of the nonhomologous end-joining (NHEJ) factor DNA ligase 4 (Lig4), although deletion of Lig4 does prevent accumulation of chromosomal fusions. Our results indicate a role for 53BP1 and Brca1 in regulating the choice between NHEJ and HR pathways, which has implications for anticancer therapies using PARP inhibitors. RESULTS 53BP1 Promotes Genomic Instability and Mammary Tumorigenesis in Brca1 Mutant Mice Brca1D11/D11 mice rescued by loss of one or both copies of p53 (Brca1D11/D11p53+/or Brca1D11/D11p53/) develop multiple types of tumors (Cao et al., 2006; Xu et al., 1999), whereas rescue by deletion of 53BP1 (Brca1D11/D1153BP1/) results in near normal life span with signicantly reduced tumorigenesis. To further investigate the requirement for 53BP1 in tumorigenesis in Brca1-decient animals, we followed the onset of development of mammary tumors in cohorts of female mice with deletion mutations in Brca1 exon 11 (Figure 1A). As expected, mice with breast-specic deletion of Brca1 exon 11 succumbed to

244 Cell 141, 243254, April 16, 2010 2010 Elsevier Inc.

A
Chromosome breaks per 100 metaphases

Radial chromosomes per 100 metaphases

400 320 300 200 100 0 0 11 1 0 0 10 nM 1 M 0 0 94 6 0 1 8

WT 53BP1-/Brca111/11 p53-/Brca111/11 53BP1-/-

150 102 100

WT 53BP1-/Brca111/11 p53-/Brca111/11 53BP1-/-

Figure 2. Deletion of 53BP1 Reverses Sensitivity of Brca1D11/ D11 Cells to PARPi and Camptothecin
(A) Analysis of genomic instability in metaphases from B cells treated with 0, 10 nM, and 1 mM PARP inhibitor. Charts show the number of radial chromosomes, chromatid breaks, and chromosome breaks per 100 metaphases (n = 50 metaphases analyzed in each case). Note that genomic instability in Brca1D11/ D11 cells is independent of p53 status, and equivalent results were seen in Brca1D11/ D11p53+/ and Brca1D11/ D11p53/ cells. (B) Western blot showing Kap1 phosphorylation in B cells from the indicated genotypes treated with PARP inhibitor or 5Gy ionizing radiation. (C) Analysis of genomic instability in metaphases from B cells treated with 4 nM camptothecin (CPT). B cells were cultured overnight with CPT prior to xation and preparation of metaphase slides.

50 1 1 0 7 8 0 3

28 10 3 2 1 M

22

[PARPi]

10 nM

[PARPi]

Chromatid breaks per 100 metaphases

80 60 40 20 0 1 4 4 0 0 0 0

76 68

WT 53BP1-/Brca111/11 p53-/16

0 0 1 M

Brca111/11 53BP1-/-

10 nM

[PARPi]

B
PARPi

WT

Brca1 11/11 p53-/-

Brca1 11/11 53BP1-/-

WT
IR Kap1-S824 Tubulin

Brca1 11/11 p53-/-

Brca1 11/11 53BP1-/-

+
Kap1-S824

C
60

Aberrations per 100 metaphases

54

+ CPT
WT

50 40 30 20 10 0 0
Radial chromosomes Chromosome Chroma d breaks breaks

Brca111/11 p53-/18 14 8 0 6 0 0 Brca111/11 53BP1-/-

tumors of the mammary tissue (Brodie et al., 2001; Xu et al., 1999), with 12 out of 27 animals affected by 18 months of age (Figure 1A). Mice that were doubly decient for Brca1 exon 11 and 53BP1, by contrast, developed almost no breast tumors, with just one animal affected at the age of 22 months (Figure 1A; data not shown). Brca1 is thought to suppress malignancy by promoting HR (Moynahan et al., 1999; Scully et al., 1999; Venkitaraman, 2004). In light of the dramatic reduction in the frequency of mammary tumors in Brca1D11/D1153BP1/ animals, we hypothesized that loss of 53BP1 might specically affect the ability of Brca1-decient cells to repair replication-associated DNA damage. To test this, we examined chromosomal aberrations in metaphase spreads from WT, Brca1D11/D11p53+/ and Brca1D11/D1153BP1/ B cells that were stimulated to divide ex vivo for 3 days. Asymmetric radial chromosome structures, a type of chromatid exchange characteristic of HR deciency, were found in 10.7% of Brca1D11/D11p53+/ B cells (n = 300) (Venkitaraman, 2004) (Figure 1B). Strikingly, these chromosome aberrations were present in just 1.0% of Brca1D11/D1153BP1/ cells,

equivalent to a 10-fold reduction relative to Brca1D11/D11p53+/ (n = 300). Radial chromosomes were undetectable in WT and 53BP1/ cells (n = 100 cells analyzed for each genotype; Figures 1B and 2A). To exclude the possibility that p53 heterozygosity provides a survival advantage to genomically unstable Brca1-decient cells by allowing aberrant chromo n et al., 2007; somes to persist (Calle Dilippantonio et al., 2008), we quantied the incidence of radial chromosomes in Brca1D11/D11conditional B cells. By infecting these cells with a virus expressing Cre recombinase, we were able to specically delete Brca1 exon 11 in p53-sufcient cells. We found that these Brca1f/f cells still showed a signicant increase (8-fold) in the number of radial chromosomes relative to Cre-infected Brca1f/f 53BP1/cells (Figure S1A available online). Radial chromosome formation in Brca1f/f cells is therefore independent of p53 status but dependent on 53BP1. To investigate further the effect of 53BP1 in regulating repair of DNA breaks occurring during replication, we challenged Brca1 mutant cells with a chemical inhibitor of PARP (PARPi; KU58948) (Figures 1C and 1D). This drug has been shown to cause cell death in Brca1-decient cells, associated with high levels of genomic instability (Farmer et al., 2005). In the presence of PARPi, Brca1D11/D11p53+/ cells showed much lower levels of survival relative to either WT or Brca1D11/D1153BP1/ cells (Figure 1C). Equivalent PARPi-induced cell death was seen with Brca1D11/D11p53/ cells, which were nonetheless resistant to IR-induced apoptosis (Figure S1B). Thus, PARPi-mediated apoptosis in Brca1D11/D11 cells, in contrast to IR-induced apoptosis, occurs independently of p53 status. The ability of PARPi to inhibit cell proliferation in culture was measured by pulsing of the cells with the uorescent dye
Tubulin

Cell 141, 243254, April 16, 2010 2010 Elsevier Inc. 245

CFSE (carboxyuorescein succinimidyl ester). In this assay, cellular proliferation is revealed by stepwise loss of CFSE during the culture period. PARPi inhibited growth in Brca1D11/D11p53+/ cells (Figure 1D), as well as in Brca1D11/D11p53/ B cells (see below). Brca1D11/D1153BP1/ cells were distinct in that they were practically insensitive to PARPi-induced apoptosis and divided almost normally whether or not PARPi was present (Figures 1C and 1D). Consistent with these ndings in B cells, Brca1D11/D1153BP1/ mouse embryonic broblasts (MEFs) were also insensitive to cell killing with PARPi, whereas Brca1D11/D11 MEFs were hypersensitive to the drug (Figure S1C). We conclude that 53BP1 is required for the toxic effect of PARP inhibition on Brca1D11/D11 cells. PARPi is predicted to increase the frequency of S phase-associated chromosomal aberrations (Bryant et al., 2005; Farmer et al., 2005; Jackson and Bartek, 2009). To determine whether loss of 53BP1 affects S phase-specic genomic instability, we monitored the level of chromosome breaks and radial structures in Brca1-decient cells treated with and without PARPi. Whereas WT and 53BP1/ cells showed very low levels of genomic instability in the presence or absence of PARPi, exposure of Brca1D11/D11p53/ to PARPi caused a substantial increase in the level of genomic instability (Figure 2A). For example, treatment of Brca1D11/D11p53/ cells with 1 mM PARPi increased the frequency of radial chromosomes from 0.1 per cell to an average of 3.2 per cell and increased the number of DSBs (chromatid and chromosome) from 0.1 to 1.8 per cell. Thus, PARPi treatment of Brca1D11/D11p53/ cells leads to a greater than 20-fold increase in aberrations (Figure 2A). In contrast, the total frequency of chromosomal aberrations in PARPi-treated Brca1D11/D1153BP1/ cells was just 0.5 per cell, which is 10-fold lower than PARPi-treated Brca1D11/D11p53/ cells. Nevertheless, PARPi-induced genomic instability in Brca1/53BP1 doublemutant mice was somewhat elevated relative to the WT. Our ndings were further substantiated by the observation that PARPi induced a signicant amount of DNA damage signaling in Brca1D11/D11p53/ cells. Brca1D11/D11p53/ cells preincubated with PARPi for 24 hr showed induction of Kap1 phosphorylation (Figure 2B), while phosphorylated Kap-1 was undetectable in PARPi-treated WT and Brca1D11/D1153BP1/ cells (Figure 2B). This was not due to an intrinsic defect in ATM signaling, because similar levels of Kap1 phosphorylation were detected in cells from all genotypes treated with IR (Figure 2B). To determine the effects of other chemotherapeutic agents that induce replication damage, we challenged WT, Brca1-, and Brca1/53BP1-decient B cells with camptothecin (CPT). CPT and its derivatives are topoisomerase I poisons that induce DSBs during replication and are widely used as anticancer drugs (Jackson and Bartek, 2009). Brca1-decient cells are hypersensitive to CPT (Nakamura et al., 2010). Consistent with this, after treatment of Brca1D11/D11p53+/ B cells with 4 nM CPT, radial chromosomes formed at a frequency of 0.54 per cell, whereas these aberrations were undetectable in CPT-treated Brca1D11/D1153BP1/ B cells (Figure 2C). Similarly, loss of 53BP1 suppressed CPT-induced chromosome and chromatid breaks in Brca1-decient cells (Figure 2C). Thus, loss of 53BP1 greatly alleviates replication-associated aberrations and toxicity

that clinically relevant chemotherapeutic agents confer on Brca1-decient cells. Loss of 53BP1 Increases HR in Brca1 Mutant Cells Replication-associated breaks are primarily repaired by HR. We therefore hypothesized that loss of 53BP1 might restore HR, a DNA repair pathway that is signicantly compromised in the absence of Brca1 (Moynahan et al., 1999). To test this, we rst examined Rad51 foci formation, a marker of HR, which is impaired in Brca1 mutant cells (Bhattacharyya et al., 2000; Scully et al., 1997). WT, Brca1D11/D11p53+/, and Brca1D11/D11 53BP1/ B cells were treated with IR, xed, and stained with a Rad51 antibody (Figure 3A). Whereas Rad51 foci formed in just 6.8% of irradiated Brca1D11/D11p53+/ cells, more than 30% of Brca1D11/D1153BP1/ cells exhibited Rad51 foci, similar to that observed in WT cells (Figure 3A). Differences in the frequency of Rad51 foci formation was not due to alterations in cell-cycle distribution, as the percentage of cycling cells was equivalent in all genotypes tested (Figure S2). As a second measure of HR, we monitored sister chromatid exchanges (SCEs), which are dependent on Rad51 activity (Sonoda et al., 1999). While the basal level of SCEs was the same, treatment with PARPi increased the frequency of SCEs in Brca1D11/D1153BP1/ but not in Brca1D11/D11p53+/ cells (Figure 3B). PARPi treatment of Brca1D11/D11p53+/ therefore leads to an increase in aberrant radial chromosome formation, which is a marker of HR deciency (Figure 2A), whereas PARPi treatment of Brca1D11/D1153BP1/ cells promotes sister chromatid exchange, which is a marker of HR prociency (Figure 3B). As a third measure of HR, we used the DR-GFPhyg reporter system, which is designed to measure error-free HR of a sitespecic break formed by the rare-cutting endonuclease I-SceI (Nakanishi et al., 2005) In this reporter, error-free HR repair of the I-SceI-induced DSB leads to restoration of a GFP+ gene that uses iGFP as the template (Figure 3C). To analyze repair of chromosomal breaks, we integrated DR-GFPhyg into WT, Brca1D11/D11, and Brca1D11/D11 53BP1/ immortalized MEF cell lines. From these experiments, we found that HR in Brca1D11/D11 cells was reduced relative to the WT (3-fold, p < 0.0001), whereas HR in Brca1D11/D11 53BP1/ cells was increased relative to the WT (5-fold, p < 0.0028) (Figure 3C). Thus, in Brca1D11/D11 MEFs, loss of 53BP1 causes a 16-fold increase in HR repair of a sitespecic chromosomal break. In conclusion, loss of 53BP1 increases HR in Brca1 mutant cells, as evidenced by Rad51 foci, sister chromatid exchange, and recombination reporter assays. 53BP1 Does Not Affect the Activity of Xrcc2 in HR To examine whether loss of 53BP1 could rescue the defects in cells decient in other HR components, we examined chromosomal aberrations in cells from mice decient for Xrcc2, a Rad51 paralog that, like Brca1, is required for Rad51 foci formation (Liu et al., 1998; Takata et al., 2001). Metaphase spreads were prepared from conditional Xrcc2f/f B cells, in which Xrcc2 was deleted with a B cell-specic CD19-Cre transgene. As expected, Xrcc2-decient cells stimulated to proliferate in vitro exhibited chromosome and chromatid breaks and radial chromosomes, which was increased by treatment with PARPi (Figure 3D).

246 Cell 141, 243254, April 16, 2010 2010 Elsevier Inc.

Figure 3. Deletion of 53BP1 Restores HR in Brca1 but Not Xrcc2 Mutant Cells
(A) Immunouorescence images showing Rad51 foci (red) with DAPI counterstain (blue) in cells of the indicated genotypes after treatment with ionizing radiation. Chart shows the percentage of cells with Rad51 foci (n = 100 counted for each genotype). (B) B cells grown for 36 hr in BrdUTP were xed and metaphases prepared to visualize individual sister chromatids. Sister chromatid exchanges (SCEs) in metaphase chromosomes are indicated with arrows in the image in the top panel. The chart shows the mean SCEs in metaphase spreads from B cells of the indicated genotypes treated with and without PARP inhibitor. Error bars show the SD. (C) Top: Structure of the HR reporter substrate DR-GFPhyg is shown, along with the HR product expressing a functional GFP+ gene. Bottom: Frequency of HR relative to total transfected cells in WT, Brca1D11/D11, and Brca1D11/D1153BP1/ MEFs, as measured with the DR-GFPhyg reporter. *p < 0.0001 between WT and Brca1D11/D11, *p < 0.0028 between WT and Brca1D11/D11 53BP1/. (D) Analysis of genomic instability in metaphases from B cells treated with and without PARP inhibitor (1 mM). B cells were homozygous for a conditional Xrcc2 allele that was deleted with a B cell-specic CD19-Cre transgene to produce knockout Xrcc2f/f, and Xrcc2f/f53BP1/ cells. Charts show the number of radial chromosomes, chromatid breaks and chromosome breaks per 100 metaphases (n = 50 metaphases analyzed in each case). See also Figure S2.

WT

Brc a111/11 p 53+/-

Brc a111/11 53BP1-/-

% Cells with Rad51 foci

40 30 20 10 0

Exchanges per 100 metaphases

30 untreated 20 PARPi

10

0
Brc a111/11 p 53+/Brc a1 11/11 53BP1-/-

WT

Brc a1 11/11 Brc a1 11/11 53BP1 - /p 53+/ -

C
SceGFP hyg iGFP

D
100 Xrcc2/

Radial chromosomes per 100 metaphases

I-S ceI
HR GFP+ hyg

B cg I
iGFP

80 60 40 20

Xrcc2/ 53BP1-/-

B cg I

B cg I

0 untreated PARPi

Homologous Recombination (%)

100 10 1 0.1 *
100 Xrcc2/ 80 60 40 20 0 untreated PARPi Xrcc2/ 53BP1-/-

Chromatid breaks per 100 metaphases

20

10

0 untreated

Surprisingly, whereas 53BP1 deletion promoted genome stability in Brca1-decient cells (Figure 2A and Figure S1), this effect was not seen in Xrcc2 knockout cells (Figure 3D). Rather, the frequency of breaks and asymmetric radial chromosomes was similar in Xrcc2f/f53BP1/ and Xrcc2f/f cells. Thus, despite the fact that both Brca1 and Xrcc2 are required for Rad51 foci formation during HR, loss of 53BP1 reverses the HR defect in Brca1- but not in Xrcc2-decient cells. We hypothesize that Brca1 affects an early stage of HR (Stark et al., 2004), whereas Xrcc2 acts at a downstream step that is not affected by the presence of 53BP1 (Nagaraju et al., 2009) (see the Discussion, below). Lig4 Is Required for Radial Fusions in Brca1 Mutant Cells As measured by reporter substrates, the frequency of HR is enhanced in the absence of the NHEJ proteins Ku70, XRCC4,

and DNA-PKcs (Pierce et al., 2001), as well as by overexpression of a dominant negative 53BP1 fragment (Xie et al., 2007), suggesting that proteins of the NHEJ pathway can have suppressive effects on HR. Lig4 plays an essential PARPi role in NHEJ, so we hypothesized that Lig4 deciency might also rescue the HR defect in Brca1 mutant cells. To test this hypothesis, we used Cre-mediated deletion to delete conditional alleles of Lig4 and Brca1 to make B cells homozygous for the knockout Lig4f/f and Brca1f/f alleles. We scored the level of chromosomal aberrations in mitotic spreads from these cells after overnight treatment with 1 mM PARPi. Whereas WT and Lig4f/f cells treated with PARPi did not accumulate DNA damage, 80% of Cre-infected Brca1f/f cells exhibited chromosomal instability (Figure 4A). Aberrant Brca1f/f cells contained 0.8 chromatid breaks/cell, and most contained two or more radial fusions per cell, indicating that the majority of breaks are resolved into complex chromosome rearrangements in Brca1 mutant cells (Figure 4A). Sixty percent of PARPi-treated Brca1f/f Lig4f/f displayed genomic instability. However, only 0.66 radials/cell were present in Brca1f/f Lig4f/f cells, as opposed to Brca1f/f, where approximately 2.1 radials/cell
Xrcc2/ 53BP1-/-

Xrcc2/

Chromosome breaks per 100 metaphases

Cell 141, 243254, April 16, 2010 2010 Elsevier Inc. 247

% Metaphases with aberrations

Aberrations per metaphase

100 80 60 40 20 0

3 2.5 2 1.5 1 0.5 0 Brca1/ Brca1/ Lig4/

Figure 4. Deletion of Lig4 Inhibits Formation of Radial Chromosomes but Does Not Rescue Cell Proliferation or Genomic instability in Brca1D11/ D11 Cells
(A) Analysis of genomic instability in metaphases from B cells treated with PARP inhibitor (1 mM). Conditional Brca1 and Lig4 alleles were deleted using pMX-Cre-GFP retroviral transduction to generate B cells that were homozygous for the knockout Brca1f/f and Lig4f/f alleles. The left chart shows the percentage of metaphases with genomic instability from cells of the indicated genotypes. The right chart quanties the distribution of radial chromosomes, chromatid breaks (ctd) and chromosome breaks (csb) among the aberrant metaphases (n = 50 metaphases of each genotype analyzed). (B) Cell survival after treatment with PARP inhibitor. Cultured B cells homozygous for conditional Brca1 and Lig4 alleles were infected with pMX-Cre-GFP retrovirus to produce GFP+ knockout Brca1f/f and Lig4f/f cells. The chart shows the percentage of GFP+ cells that were present in B cell cultures of the indicated genotypes ve days post-infection. PARP inhibitor treatment (10 nM or 1 mM) led to disappearance of Brca1f/f and Brca1f/f Lig4f/f cells from the cultures. (C) Chart showing the percentage of cells with Rad51 foci after ionizing radiation as measured by immunouorescence (n R 160 cells). (D) Frequency of radial chromosomes in metaphase spreads from Brca1D11/ D11p53+/ B cells cultured for 24 hr with either PARP inhibitor (PARPi) or PARPi + DNA-PKcs inhibitor (DNAPKi).

WT

Lig4 / Brca1 / Brca1/ Lig4/

Radial

Ctd

Csb

B
120

GFP-positive cells (as % untreated)

100 80 60 40 20 0

WT L ig 4 /

B rca1 / Lig4 / B rca1 /

10 nM

1M

% Cells with Rad51 foci

30

20

10

WT

Brca1/ 53BP1-/-

Brca1/

Brca1/ Lig4/

D
% metaphases with radial chromosomes

100 80 60 40 20 0

85

87.5

+ PARPi only

+ PARPi + DNAPKi

Brca111/11p53+/were observed. Instead, Brca1f/f Lig4f/f cells were characterized by high levels of unresolved chromatid breaks (average of 2.5 per cell versus 0.8 in Brca1f/f cells; Figure 4A). Thus, unlike 53BP1 deciency, which reduces all types of chromosome aberrations in Brca1-decient cells (Figure 2A), Lig4 deletion only affects the frequency of radial chromosomes. Lig4 therefore appears to be specically required for the processing of chromatid breaks into radial fusions in Brca1 mutant cells. To test whether the accumulation of chromatid breaks in Brca1f/f Lig4f/f cells has an effect on cell growth and survival, we compared the viability of WT, Lig4f/f, Brca1f/f, and Brca1f/ f Lig4f/f B cells that were treated with or without PARPi for 5 days. While Cre-infected WT and Lig4f/f cells were insensitive to PARPi (Figure 4B), there was a precipitous drop in live Cre-infected (GFP+) Brca1f/f and Brca1f/fLig4f/f

cells in response to PARPi (Figure 4B). Thus, Lig4 deciency does not relieve the toxic effects of PARPi on Brca1-decient cells. To determine whether loss of Lig4, like 53BP1 deciency, rescues the HR defect in Brca1 mutant cells, we examined IR induced Rad51 foci formation. Whereas more than 25% of WT and Brca1f/f 53BP1/ Cre-infected cells exhibited Rad51 foci, Rad51 foci formed at a lower frequency (8%11%) in Brca1f/f and Brca1f/f Lig4f/f cells (Figure 4C). Thus, despite the fact that both Lig4 or 53BP1 deciency abrogates PARPi-induced radial fusions in Brca1 mutant cells, only 53BP1 but not Lig4 deciency rescues PARPi induced cell death, chromosomal instability, and defects in IR-induced Rad51 foci formation. Similarly, we found that inhibition of the kinase activity of DNA-dependent protein kinase (DNA-PKcs), which is considered a key component of the NHEJ repair pathway, did not reduce radial chromosome formation in PARPi-treated Brca1-decient cells (Figure 4D). Reversal of genomic instability in Brca1D11/D11cells is therefore dependent on loss of 53BP1 and cannot be achieved by inactivation of any component of the nonhomologous end-joining pathway.

248 Cell 141, 243254, April 16, 2010 2010 Elsevier Inc.

53BP1-/-

53BP1-/-

A
WT
30 Gy IR

B
WT B rc a1 / B rc a1 / Lig4 / B rc a1 / 53B P 1 -/ -

+ +
Kap1-pS824 RPA-pS4/8 Tubulin

30 Gy IR

+
Kap1-pS824

Figure 5. Rescue of Homologous Recombination in Brca1D11/ D11 Cells by 53BP1 Deletion Correlates with Increased Phosphorylation of RPA and Is Dependent on ATM and CtIP
(A) Western blot analysis showing Kap1 and RPA phosphorylation in WT and 53BP1/ cells in response to 30Gy ionizing radiation. (B) RPA and Kap1 phosphorylation after 30Gy ionizing radiation in Brca1- and Lig4-decient cells. Knockout Brca1f/f and Lig4f/f cells were prepared by sorting of B cells homozygous for the conditional alleles after infection with pMXCre-GFP retrovirus. (C) Western blot showing Kap1 and RPA phosphorylation in Brca1D11/ D1153BP1/ cells after 30Gy ionizing radiation with and without ATM inhibitor (KU55993). ATMi (5 mM) was added 2 hr prior to irradiation. (D) Western blot analysis showing ionizing radiation-induced RPA phosphorylation in Brca1D11/ D11 53BP1/ MEFs after CtIP shRNA. Protein lysates were prepared from cells infected with either vector () or CtIP shRNA (CTIP), with and without 30 Gy ionizing radiation. (E) Quantication of radial chromosome structures in metaphases from Brca1D11/ D1153BP1/ cells treated with ATM inhibitor (5 mM) and/or PARP inhibitor (1 mM). ATMi was added at the start of the B cell culture, PARPi at 24 hr, and metaphases were made at 48 hr (n R 240 metaphases; mean SD is shown from two experiments). (F) CFSE dilution analysis showing proliferation of B cells cultured with ATM inhibitor and/or PARP inhibitor for 96 hr. (G) Quantication of Rad51 foci in Brca1D11/ D11 53BP1/ B cells. Rad51 foci were induced with 5Gy of ionizing radiation and cells xed for Rad51 staining 2 hr later. Cells were either untreated or pretreated for 2 hr with 5 mM ATM inhibitor. See also Figure S3.

WT

RPA-pS4/8

Tubulin

C
30 Gy IR ATMi -

Brca111/11 53BP1-/+ + +
Kap1-pS824 RPA-pS4/8

D
shRNA 30 Gy IR -

Brca111/11 53BP1-/+ CTIP CTIP

E
20

Radial chromosomes per 100 metaphases

+
CTIP

15 10 5 0
0.0 0.8 0.0

12.1

Kap1-pS824 Tubulin RPA-pS4/8

untreated

ATMi

PARPi

ATMi +PARPi

Tubulin

Brca111/11 53BP1-/-

F
Brca111/11 p53-/-

G
50

% Cells with Rad51 foci

40 30 20 10 0 untreated + ATMi

Brca111/11 53BP1-/-

CFSE

CFSE

Brca111/11 53BP1-/-

Loss of 53BP1 Promotes RPA Phosphorylation in a Manner Dependent on ATM and CtIP Brca1 has been implicated in 50 -30 DSB resection (Schlegel et al., 2006; Yun and Hiom, 2009a), which involves the nucleolytic processing of DSBs to produce ssDNA overhangs that are required for HR (Mimitou and Symington, 2009). During the process of resection, replication protein A (RPA) is loaded onto ssDNA, where it is then phosphorylated. To determine whether loss of 53BP1 affects resection, we irradiated WT and 53BP1/ B cells and assessed phosphorylation of RPA and Kap-1. Kap-1 phosphorylation, which occurs independently of DSB resection, was similar in irradiated WT and 53BP1/ cells (Figure 5A); however, the level of RPA phosphorylation was consistently higher in 53BP1/ cells (Figure 5A). We conclude that 53BP1 suppresses RPA phosphorylation. To test whether 53BP1 or Lig4 inhibits RPA phosphorylation in Brca1 mutant cells, we compared the levels of phosphorylation in WT, Brca1f/f, Brca1f/f53BP1/, and Brca1f/f Lig4f/f cells. Whereas Brca1f/f and Brca1f/f Lig4f/f B cells had similarly decreased levels of phosphorylated RPA compared to the WT (Figure 5B), importantly, Brca1f/f53BP1/ B cells displayed

a rescue of RPA phosphorylation to near WT levels (Figure 5B). Thus, loss of 53BP1 but not Lig4 is able to promote ssDNA formation competent for RPA phosphorylation. This may explain why combined deciencies in Brca1/53BP1 but not Brca1/Lig4 reverse the HR defect in Brca1 mutant cells. To provide physical evidence for resection of DSBs in 53BP1/ cells, we measured the degree of DNA processing at chromosomal translocation junctions. B cells containing I-SceI sites integrated into the c-myc (MycI allele) and IgH locus (IgHI allele) were infected with a retrovirus encoding I-SceI to induce translocations between c-myc and IgH (Figure S3A). In this system, translocation breakpoints are found at various distances from the site of I-SceI induced DSBs, dependent on the degree of nucleolytic processing at the break site (Robbiani et al., 2008). We used PCR to map translocation breakpoints induced by the I-SceI system in AID/ and AID/53BP1/ cells (Figure S3B; use of AID/ cells restricts translocations to breaks induced by I-SceI). All of the sequenced junctions showed processed DNA ends (Figure S3C). However, the average total distance of the breakpoint position from the I-SceI sites on c-myc and IgH was approximately 2-fold greater

Cell 141, 243254, April 16, 2010 2010 Elsevier Inc. 249

in AID/53BP1/ cells compared with AID/ (average resection, AID/: 448.2 nucleotides, versus AID/53BP1/: 742.3 nucleotides, p = 0.032) (Figure S3C). Thus, loss of 53BP1 enhances nucleolytic processing of DNA ends. These ndings are consistent with enhanced degradation of coding ends during V(D)J recombination in 53BP1/ mice (Dilippantonio et al., 2008), and inhibition of DNA end resection by the yeast 53BP1 homolog, Rad9 (Lazzaro et al., 2008). Rescue of Brca1 Mutant Cells by 53BP1 Deletion Is Dependent on ATM ATM kinase activity is required for nucleolytic processing of DSBs to generate RPA-coated ssDNA (Jazayeri et al., 2006). The CtIP protein is phosphorylated by ATM after DNA damage induced by IR (Li et al., 2000) and forms a complex with Mre11/Rad50/Nbs1 and Brca1, which is required for DSB resection (Chen et al., 2008; Sartori et al., 2007; Yun and Hiom, 2009a). Prompted by these ndings, we tested whether ATM activity and CtIP mediates the resection observed in Brca1D11/D1153BP1/ cells. We found that Brca1D11/D1153BP1/ B cells pretreated with ATM inhibitor (ATMi, KU55993) (Hickson et al., 2004) showed a signicantly lower level of phosphorylated RPA after irradiation (Figure 5C). Similarly, Brca1D11/D1153BP1/ MEFs infected with CtIP short hairpin RNA (shRNA) showed impairment of RPA phosphorylation (Figure 5D). Thus, the increase in DSB resection promoted by the absence of 53BP1 is ATM and CtIP dependent. Since increased RPA phosphorylation in Brca1/53BP1 double-decient cells correlates with rescued genomic stability, we tested whether inhibition of the ATM-dependent pathway leading to RPA phosphorylation would sensitize Brca1D11/D1153BP1/ cells to the effects of PARPi. Treatment of Brca1D11/D1153BP1/ cells with ATMi induced a small increase in the frequency of radial chromosomes, and combination of ATMi and PARPi led to a 15-fold enhancement in radials relative to ATMi alone (Figure 5E). Moreover, ATMi re-sensitized Brca1D11/D1153BP1/ cells to PARPi, evidenced by its ability to inhibit the growth of B cells (Figure 5F). Finally, ATMi reduced Rad51 foci formation in Brca1D11/D1153BP1/ cells (Figure 5G). Taken together, these results suggest that loss of 53BP1 promotes HR in Brca1-decient cells in a manner dependent on ATM. DISCUSSION Interplay between NHEJ and HR Proteins in S Phase DNA double-strand breaks can be repaired by one of two major pathways: homology-based repair with the intact chromatid as a template (HR) or direct joining across the break site (NHEJ). Our data are consistent with the idea that these two DSB repair pathways compete for repair of replication-associated chromatid breaks (Saberi et al., 2007; Shrivastav et al., 2008; Sonoda et al., 2006). In WT cells, HR-mediated Xrcc2/Rad51-dependent sister chromatid recombination is the predominant repair pathway, and interchromosomal radial fusions are only rarely produced (Figure 6A). In contrast, Brca1 deciency prevents normal HR, so that chromatid breaks, instead of being faithfully repaired, are resolved into aberrant chromatid fusions between

heterologous chromosomes. These fusions are dependent on Lig4, a component of the classical NHEJ pathway (Figure 6B). This shows that in the absence of normal Brca1-mediated HR, a toxic NHEJ pathway mediates rejoining of chromatid breaks. Although radial chromosomes are reduced in Brca1-decient cells that also lack Lig4, other types of DNA damage (notably chromatid breaks) persist, and there is no rescue of HR. By contrast, deletion of 53BP1 rescues Rad51-dependent HR almost to WT levels in Brca1-decient cells. 53BP1 promotes formation of radial fusions in Brca1 mutant cells by a different mechanism than Lig4. According to our model, 53BP1-binding to chromatid breaks in Brca1-decient cells interferes with HR, not by promoting end joining per se, but rather by partially blocking ATM-dependent resection at the break site, which is necessary for HR-mediated repair (Figures 6B and 6C). Thus, the previously puzzling observation that loss of 53BP1 suppresses both Brca1D11/D11lethality and tumorigenesis (Cao et al., 2009) can now be explained by our nding that 53BP1 deciency rescues HR by a mechanism dependent on ATM-mediated resection. Our results show that DSB repair proteins have very different abilities to affect the choice of HR versus NHEJ. 53BP1 plays a major role in pathway choice in Brca1-decient cells, whereas Lig4 does not affect the initial choice of HR versus NHEJ. Defects in HR in mammalian cells therefore might not be rescued simply by inhibiting the activity of any protein associated with NHEJ. Consistent with this, treatment of Brca1D11/D11 cells with an inhibitor of the NHEJ factor DNA-dependent protein kinase (DNA-PKcs) does not decrease the frequency of radial chromosome formation (Figure 4D). Loss of 53BP1 does not have the general effect of rescuing any defect in HR; for example, it does not normalize the genomic instability in Xrcc2-decient cells (Figure 3D). According to our model, 53BP1 affects the initial stage of HR; that is, exonuclease-mediated resection of the DSB. Xrcc2 might be active at a downstream stage of HR, as a cofactor of Rad51 during strand exchange (Figures 6A and 6C). In this case, deciency in Xrcc2 would not be rescued by increased resection. Consistent with this idea, Xrcc2 has been shown to act late during gene conversion (Nagaraju et al., 2009). 53BP1 and Brca1 Regulate the Choice between NHEJ and HR The precise role of 53BP1 in NHEJ is a matter of ongoing investigation. Previous work has shown that 53BP1 is required for long-range intrachromosomal end joining during V(D)J recombination and class-switch recombination (Dilippantonio et al., 2008; Manis et al., 2004; Reina-San-Martin et al., 2007) as well as fusions between dysfunctional telomeres (Dimitrova et al., 2008). Other NHEJ-mediated events, such as the repair of DNA damage induced by ionizing radiation, are less profoundly affected by the absence of 53BP1 (Ward et al., 2004). This has led to the hypothesis that 53BP1 acts as a synapsis factor required specically for long-range joining of distant DNA breaks by NHEJ (Dilippantonio et al., 2008; Reina-San-Martin et al., 2007). We found that radial chromosomes are present in Xrcc2/53BP1/ cells (Figure 3D) as well as in Brca1D11/D11 53BP1/ cells treated with ATMi (Figure 5E), demonstrating

250 Cell 141, 243254, April 16, 2010 2010 Elsevier Inc.

Chromad break

(A)
WT

(B)
Brca111/11

(C)
Brca111/11 53BP1-/-

Figure 6. Model for Reversal of Genomic Instability in Brca1D11/ D11 Cells by 53BP1 Deletion
Chromatid breaks accumulate in S phase cells as a consequence of errors in DNA replication or through failure of single-strand break repair (e.g., after PARP inhibition). (A) In WT cells, Brca1 displaces 53BP1 from DSBs, enabling resection at the break site by factors such as CtIP, which promotes RPA loading onto single-stranded regions of DNA. RPA is displaced by Rad51, which enables strand invasion at the homologous region of the sister chromatid. Rad51 acts in complex with several effectors of HR, including Xrcc2, leading to error-free, template-directed repair of the double-strand breaks. (B) In Brca1D11/ D11 cells, 53BP1 is not displaced and inhibits resection. In the absence of resection, the break persists, and if more than one chromatid break is present, these breaks can be joined by a Lig4-dependent NHEJ pathway. Joining of the chromatid breaks produces radial chromosome structures. (C) In Brca1D11/ D1153BP1/ cells, 53BP1 is not present at the double-strand break site, enabling resection even in Brca1-decient cells. RPA and downstream effectors of homologous recombination are able to load normally at the break site, permitting error-free DNA repair. See also Figure S4.

CTIP

Brca1 CTIP CTIP

53BP1

53BP1

ATMi ATMi

RPA

DNA Ligase IV

RPA

Xrcc2 Rad51

Xrcc2 Rad51

that 53BP1 is not absolutely required for long-range interchromosomal joining of DNA DSBs. Consistent with this notion, 53BP1 is dispensable for AID-dependent (Ramiro et al., 2006) and I-SceI-induced (Figure S3) translocations between c-myc and IgH. However, by inhibiting DSB resection, 53BP1 may increase the probability that blunt DNA ends can be ligated by Lig4-mediated classical NHEJ. According to this hypothesis, a key mechanism by which 53BP1 regulates the choice of HR versus NHEJ and promotes long-range end joining could be via inhibition of DSB resection. Brca1 has been implicated in several processes, including DSB repair, chromatin remodeling, cell-cycle progression, and transcription (Yun and Hiom, 2009b). Nevertheless, very little is known about how Brca1 contributes to these processes. Brca1 possesses ubiquitin-ligase activity, but this function does not appear to be essential for maintaining genomic stability (Reid et al., 2008). On the basis of our results, we propose that one critical function for Brca1, and perhaps other factors that commit cells to HR, might be to remove end-joining proteins such as 53BP1 from replication-associated breaks (Figure 6A). Interestingly, the retention of Ku (Postow et al., 2008) and 53BP1 (Watanabe et al., 2009) is dependent on DSB-induced ubiquitylations of these factors. While active removal of endjoining proteins by protein ubiquitylation may promote resection (Lee et al., 1998; Zhang et al., 2007), conversely, end resection

itself could promote dissociation of end-joining proteins (Figure 6A). For example, Mre11/CtIP dependent DSB resection (Lengsfeld et al., 2007; Sartori et al., 2007) and/or Mre11-dependent nucleosome displacement (Tsukuda et al., 2005) might facilitate the generation of nucleosome-free ssDNA regions that would be incompatible with continued 53BP1 chromatin binding but accessible for recruitment of HR proteins. Since Brca1 forms a complex with the Mre11 and CtIP (Chen et al., 2008; Sartori et al., 2007; Yu et al., 1998), Brca1 might play a similar role in the dynamic removal of NHEJ proteins from DSBs that would promote faithful sister chromatid repair and avoid inappropriate end-ligation. Implications for Cancer Therapy Germline mutations in Brca1 confer susceptibility of developing breast and ovarian cancer with high penetrance (Antoniou et al., 2003). Cancers that develop in heterozygous carriers typically lose the second functional Brca1 allele during tumor progression. It is possible that loss of one allele confers a defect in HR (Cousineau and Belmaaza, 2007), and reduction in gene dosage (haploinsufciency) fuels sufcient genomic instability to accelerate cancer promoting mutations, including loss of the remaining Brca1 WT allele. Heterozygous Brca1 mutant mice do not develop mammary tumors; however, mammary tumors develop with a long latency in mutant mice in which Brca1 is

Cell 141, 243254, April 16, 2010 2010 Elsevier Inc. 251

deleted in mammary epithelium. Notably, loss of 53BP1 signicantly reduces mammary tumorigenesis in Brca1-decient mice (Figure 1A). Our study suggests that one therapeutic strategy to treat Brca1 mutation carriers might be the systemic use of compounds that inhibit 53BP1, which we predict would render Brca1 heterozygous carriers more HR competent. One potential side effect of this approach could be defects in B cell immunoglobulin isotype switching, which is strictly dependent on 53BP1 (Figure S4). Since Brca1 is an essential gene, it remains unclear why deciency in Brca1 is tolerated in tumor cells. One possibility is that Brca1 loss is specically tolerated in breast and ovary. A more likely scenario is that secondary genetic alterations arise, in addition to loss of heterozygosity at Brca1, which promote the survival of Brca1 mutant cells. For example, loss of p53 seems to be an essential step in Brca1-associated tumorigenesis (Holstege et al., 2009; Xu et al., 1999). Tumors decient in p53 and Brca1 are severely impaired in HR, and therefore sensitive to therapies that utilize PARPi to achieve synthetic lethality. However, treatment with PARPi provides a strong selective pressure for mutations that restore DSB repair capacity. Interestingly, many Brca1-decient tumors overexpress Rad51 (Martin et al., 2007), which might partially restore DSB repair in these cells. Based on our study, loss of 53BP1 is another secondary mutation which would render Brca1 mutant cells HR competent and resistant to PARP inhibitors. Similar to 53BP1 deciency, our model predicts that other mutations that enhance DSB resection would make Brca1 mutant cells resistant to PARP inhibition. However, our nding that loss of 53BP1 rescues Brca1-decient HR by promoting ATM-dependent resection opens a therapeutic window for ATM inhibitors as a second line of chemotherapy for PARP inhibitor-resistant tumors (Figure 5E and 5F). Thus, ATM inhibitors might be used therapeutically to resensitize Brca1decient tumors that develop resistance to PARPi.
EXPERIMENTAL PROCEDURES Mice Mice carrying the Brca1 exon 11 allele were obtained from the NCI mouse repository, 53BP1/ mice were a gift from Junjie Chen, and Xrcc2 and Lig4 conditional mice were gifts from Peter McKinnon. B Cell Cultures, Retroviral Transduction, and Metaphase Preparation Resting B lymphocytes were isolated from mouse spleens and cultured with n et al., LPS (25 mg/ml, Sigma) and IL-4 (5 ng/ml, Sigma) as described (Calle 2007). ATM inhibitor (KU55993, KuDOS Pharmaceuticals) was used at 5 mM, DNA-PK inhibitor (NU7026, Sigma) was used at 20 mM and PARP inhibitor (KU58948, KuDOS) was used at various concentrations depending on the experiment. Irradiation was performed with a caesium-137 source. B cells were infected 24 hr after culture with pMX-Cre-IRES-GFP as described (Robbiani et al., 2008). GFP+ B cells were sorted 4.5 days after infection with a FACSAria (Becton Dickinson). For analysis of cell proliferation, CFSE (5 mM, Molecular Probes) labeling was at 37 C for 10 min. For quantication of apoptotic cells, the PhiPhiLux G1D2 kit was used according to manufacturers protocol (OncoImmunin). For FISH analysis, metaphases were n et al., 2007). prepared and imaged as described (Calle Western Blotting and Immunouorescence Primary antibodies were used at the following dilutions: anti-tubulin (1:15,000, Sigma), anti-Kap-1 pS824 (1:700, Bethyl Labs), anti-RPA pS4/S8 (1:1000

Bethyl Laboratories), and anti-CtIP (mAb 14-1, used at 1:50, gift from Richard Baer, Columbia University) (McBride et al., 2006). MEFs were prepared for immunouorescence by growth on 18 mm 3 18 mm glass coverslips. Lymphocytes were dropped onto slides coated with CellTak (BD). Cells were xed with methanol, incubated with anti-Rad51 primary antibody (H-92, Santa Cruz; used at 1:100) and detected with anti-rabbit-Alexa546 antibody (Invitrogen; used at 1:200). MTT Assay MEFs were plated at 10,000 cells/well. After growth for 4 days, MTT substrate (Sigma) was added for 2 hr and solubilized in isopropanol according to the manufacturers protocol. Plates were read with a Wallac Victor2 1420 multilabel counter. shRNA For CTIP depletion by shRNA, we obtained a construct containing the following hairpin sequence targeting CTIP exons 7 and 8, cloned into pMXpie-IRES-GFP (gift of Davide Robbiani, Rockefeller University): TGCTGTTGA CAGTGAGCGAGCTCTCTATGTACAAATGAATTAGTGAAGCCACAGATGTAA TTCATTTGTACATAGAGAGCGTGCCTACTGCCTCGGA. Passage-immortalized mouse embryonic broblasts were infected with this construct or empty pMX-GFP vector. Infected cells were selected by growth in medium containing 2 mg/ml puromycin for 1 week. Cells containing the shRNA construct were maintained in 1 mg/ml puromycin. GFP HR Assay HPRT-DRGFPhyg (Nakanishi et al., 2005) was electroporated into various MEF cell lines, and integrants were selected in 90125 mg/ml Hygromycin (Roche). For each integrant, an intact copy of the DR-GFPhyg reporter was conrmed by Southern blot with the iGFP fragment as the probe. For measurement of HR, 4 3 105 cells were plated in a 12-well tissue culture dish 24 hr prior to transfection. Cells were transfected with either an I-SceI expression vector (pCBASce) to measure HR or a GFP expression vector (pCAGGS-NZEGFP) to measure transfection efciency (Pierce et al., 1999). HR relative to total transfected cells was determined by division of the %GFP+ cells from each I-SceI transfection by the %GFP+ cells from a parallel GFP transfection. Values represent the mean of at least six independent transfections for each genotype, and error bars represent the standard deviation from the mean. Statistical analysis was performed using an unpaired t test. SUPPLEMENTAL INFORMATION Supplemental Information includes Extended Experimental Procedures and four gures and can be found with this article online at doi:10.1016/j.cell. 2010.03.012. ACKNOWLEDGMENTS We would like to thank Richard Baer for the CtIP antibody, Davide Robbiani for the CtIP shRNA, Junjie Chen and Peter McKinnon for mice, Susan Sharrow and Larry Granger for ow cytometry, and Jeremy Daniel and Jaqueline Barlow for comments on the manuscript. M.C.N. is a Howard Hughes Medical Institute investigator. N.F. is a fellow of the Leukemia and Lymphoma society. This research was supported in part by National Institutes of Health (NIH) grant AI037526 to M.C.N., NIH/National Cancer Institute grant RO1CA120954 to J.M.S., and the Intramural Research Program of the NIH. Received: December 21, 2009 Revised: February 12, 2010 Accepted: March 10, 2010 Published online: April 1, 2010 REFERENCES Andreassen, P.R., Ho, G.P., and DAndrea, A.D. (2006). DNA damage responses and their many interactions with the replication fork. Carcinogenesis 27, 883892.

252 Cell 141, 243254, April 16, 2010 2010 Elsevier Inc.

Antoniou, A., Pharoah, P.D., Narod, S., Risch, H.A., Eyfjord, J.E., Hopper, J.L., Loman, N., Olsson, H., Johannsson, O., Borg, A., et al. (2003). Average risks of breast and ovarian cancer associated with BRCA1 or BRCA2 mutations detected in case Series unselected for family history: a combined analysis of 22 studies. Am. J. Hum. Genet. 72, 11171130. Bhattacharyya, A., Ear, U.S., Koller, B.H., Weichselbaum, R.R., and Bishop, D.K. (2000). The breast cancer susceptibility gene BRCA1 is required for subnuclear assembly of Rad51 and survival following treatment with the DNA cross-linking agent cisplatin. J. Biol. Chem. 275, 2389923903. Brodie, S.G., Xu, X., Qiao, W., Li, W.M., Cao, L., and Deng, C.X. (2001). Multiple genetic changes are associated with mammary tumorigenesis in Brca1 conditional knockout mice. Oncogene 20, 75147523. Bryant, H.E., Schultz, N., Thomas, H.D., Parker, K.M., Flower, D., Lopez, E., Kyle, S., Meuth, M., Curtin, N.J., and Helleday, T. (2005). Specic killing of BRCA2-decient tumours with inhibitors of poly(ADP-ribose) polymerase. Nature 434, 913917. n, E., Jankovic, M., Dilippantonio, S., Daniel, J.A., Chen, H.T., Celeste, Calle A., Pellegrini, M., McBride, K., Wangsa, D., Bredemeyer, A.L., et al. (2007). ATM prevents the persistence and propagation of chromosome breaks in lymphocytes. Cell 130, 6375. Cao, L., Kim, S., Xiao, C., Wang, R.H., Coumoul, X., Wang, X., Li, W.M., Xu, X.L., De Soto, J.A., Takai, H., et al. (2006). ATM-Chk2-p53 activation prevents tumorigenesis at an expense of organ homeostasis upon Brca1 deciency. EMBO J. 25, 21672177. Cao, L., Xu, X., Bunting, S.F., Liu, J., Wang, R.H., Cao, L.L., Wu, J.J., Peng, T.N., Chen, J., Nussenzweig, A., et al. (2009). A selective requirement for 53BP1 in the biological response to genomic instability induced by Brca1 deciency. Mol. Cell 35, 534541. Chen, L., Nievera, C.J., Lee, A.Y., and Wu, X. (2008). Cell cycle-dependent complex formation of BRCA1.CtIP.MRN is important for DNA double-strand break repair. J. Biol. Chem. 283, 77137720. Cousineau, I., and Belmaaza, A. (2007). BRCA1 haploinsufciency, but not heterozygosity for a BRCA1-truncating mutation, deregulates homologous recombination. Cell Cycle 6, 962971. Deng, C.X. (2006). BRCA1: cell cycle checkpoint, genetic instability, DNA damage response and cancer evolution. Nucleic Acids Res. 34, 14161426. Dilippantonio, S., Gapud, E., Wong, N., Huang, C.Y., Mahowald, G., Chen, H.T., Kruhlak, M.J., Callen, E., Livak, F., Nussenzweig, M.C., et al. (2008). 53BP1 facilitates long-range DNA end-joining during V(D)J recombination. Nature 456, 529533. Dimitrova, N., Chen, Y.C., Spector, D.L., and de Lange, T. (2008). 53BP1 promotes non-homologous end joining of telomeres by increasing chromatin mobility. Nature 456, 524528. DiTullio, R.A., Jr., Mochan, T.A., Venere, M., Bartkova, J., Sehested, M., Bartek, J., and Halazonetis, T.D. (2002). 53BP1 functions in an ATM-dependent checkpoint pathway that is constitutively activated in human cancer. Nat. Cell Biol. 4, 9981002. Edwards, S.L., Brough, R., Lord, C.J., Natrajan, R., Vatcheva, R., Levine, D.A., Boyd, J., Reis-Filho, J.S., and Ashworth, A. (2008). Resistance to therapy caused by intragenic deletion in BRCA2. Nature 451, 11111115. Farmer, H., McCabe, N., Lord, C.J., Tutt, A.N., Johnson, D.A., Richardson, T.B., Santarosa, M., Dillon, K.J., Hickson, I., Knights, C., et al. (2005). Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917921. Fernandez-Capetillo, O., Chen, H.T., Celeste, A., Ward, I., Romanienko, P.J., Morales, J.C., Naka, K., Xia, Z., Camerini-Otero, R.D., Motoyama, N., et al. (2002). DNA damage-induced G2-M checkpoint activation by histone H2AX and 53BP1. Nat. Cell Biol. 4, 993997. Fong, P.C., Boss, D.S., Yap, T.A., Tutt, A., Wu, P., Mergui-Roelvink, M., Mortimer, P., Swaisland, H., Lau, A., OConnor, M.J., et al. (2009). Inhibition of poly (ADP-ribose) polymerase in tumors from BRCA mutation carriers. N. Engl. J. Med. 361, 123134.

Hickson, I., Zhao, Y., Richardson, C.J., Green, S.J., Martin, N.M., Orr, A.I., Reaper, P.M., Jackson, S.P., Curtin, N.J., and Smith, G.C. (2004). Identication and characterization of a novel and specic inhibitor of the ataxia-telangiectasia mutated kinase ATM. Cancer Res. 64, 91529159. Holstege, H., Joosse, S.A., van Oostrom, C.T., Nederlof, P.M., de Vries, A., and Jonkers, J. (2009). High incidence of protein-truncating TP53 mutations in BRCA1-related breast cancer. Cancer Res. 69, 36253633. Jackson, S.P., and Bartek, J. (2009). The DNA-damage response in human biology and disease. Nature 461, 10711078. Jazayeri, A., Falck, J., Lukas, C., Bartek, J., Smith, G.C., Lukas, J., and Jackson, S.P. (2006). ATM- and cell cycle-dependent regulation of ATR in response to DNA double-strand breaks. Nat. Cell Biol. 8, 3745. Lazzaro, F., Sapountzi, V., Granata, M., Pellicioli, A., Vaze, M., Haber, J.E., Plevani, P., Lydall, D., and Muzi-Falconi, M. (2008). Histone methyltransferase Dot1 and Rad9 inhibit single-stranded DNA accumulation at DSBs and uncapped telomeres. EMBO J. 27, 15021512. Lee, S.E., Moore, J.K., Holmes, A., Umezu, K., Kolodner, R.D., and Haber, J.E. (1998). Saccharomyces Ku70, mre11/rad50 and RPA proteins regulate adaptation to G2/M arrest after DNA damage. Cell 94, 399409. Lee, J.H., Goodarzi, A.A., Jeggo, P.A., and Paull, T.T. (2010). 53BP1 promotes ATM activity through direct interactions with the MRN complex. EMBO J. 29, 574585. Lengsfeld, B.M., Rattray, A.J., Bhaskara, V., Ghirlando, R., and Paull, T.T. (2007). Sae2 is an endonuclease that processes hairpin DNA cooperatively with the Mre11/Rad50/Xrs2 complex. Mol. Cell 28, 638651. Li, S., Ting, N.S., Zheng, L., Chen, P.L., Ziv, Y., Shiloh, Y., Lee, E.Y., and Lee, W.H. (2000). Functional link of BRCA1 and ataxia telangiectasia gene product in DNA damage response. Nature 406, 210215. Liu, N., Lamerdin, J.E., Tebbs, R.S., Schild, D., Tucker, J.D., Shen, M.R., Brookman, K.W., Siciliano, M.J., Walter, C.A., Fan, W., et al. (1998). XRCC2 and XRCC3, new human Rad51-family members, promote chromosome stability and protect against DNA cross-links and other damages. Mol. Cell 1, 783793. Manis, J.P., Morales, J.C., Xia, Z., Kutok, J.L., Alt, F.W., and Carpenter, P.B. (2004). 53BP1 links DNA damage-response pathways to immunoglobulin heavy chain class-switch recombination. Nat. Immunol. 5, 481487. Martin, R.W., Orelli, B.J., Yamazoe, M., Minn, A.J., Takeda, S., and Bishop, D.K. (2007). RAD51 up-regulation bypasses BRCA1 function and is a common feature of BRCA1-decient breast tumors. Cancer Res. 67, 96589665. McBride, K.M., Gazumyan, A., Woo, E.M., Barreto, V.M., Robbiani, D.F., Chait, B.T., and Nussenzweig, M.C. (2006). Regulation of hypermutation by activation-induced cytidine deaminase phosphorylation. Proc. Natl. Acad. Sci. USA 103, 87988803. Mimitou, E.P., and Symington, L.S. (2009). DNA end resection: many nucleases make light work. DNA Repair (Amst.) 8, 983995. Moynahan, M.E., Chiu, J.W., Koller, B.H., and Jasin, M. (1999). Brca1 controls homology-directed DNA repair. Mol. Cell 4, 511518. Nagaraju, G., Hartlerode, A., Kwok, A., Chandramouly, G., and Scully, R. (2009). XRCC2 and XRCC3 regulate the balance between short- and long-tract gene conversions between sister chromatids. Mol. Cell. Biol. 29, 42834294. Nakamura, K., Kogame, T., Oshiumi, H., Shinohara, A., Sumitomo, Y., Agama, K., Pommier, Y., Tsutsui, K.M., Tsutsui, K., Hartsuiker, E., et al. (2010). Collaborative action of Brca1 and CtIP in elimination of covalent modications from double-strand breaks to facilitate subsequent break repair. PLoS Genet. 6, e1000828. Nakanishi, K., Yang, Y.G., Pierce, A.J., Taniguchi, T., Digweed, M., DAndrea, A.D., Wang, Z.Q., and Jasin, M. (2005). Human Fanconi anemia monoubiquitination pathway promotes homologous DNA repair. Proc. Natl. Acad. Sci. USA 102, 11101115. Pierce, A.J., Johnson, R.D., Thompson, L.H., and Jasin, M. (1999). XRCC3 promotes homology-directed repair of DNA damage in mammalian cells. Genes Dev. 13, 26332638.

Cell 141, 243254, April 16, 2010 2010 Elsevier Inc. 253

Pierce, A.J., Hu, P., Han, M., Ellis, N., and Jasin, M. (2001). Ku DNA endbinding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev. 15, 32373242. Postow, L., Ghenoiu, C., Woo, E.M., Krutchinsky, A.N., Chait, B.T., and Funabiki, H. (2008). Ku80 removal from DNA through double strand break-induced ubiquitylation. J. Cell Biol. 182, 467479. Ramiro, A.R., Jankovic, M., Callen, E., Dilippantonio, S., Chen, H.T., McBride, K.M., Eisenreich, T.R., Chen, J., Dickins, R.A., Lowe, S.W., et al. (2006). Role of genomic instability and p53 in AID-induced c-myc-Igh translocations. Nature 440, 105109. Reid, L.J., Shakya, R., Modi, A.P., Lokshin, M., Cheng, J.T., Jasin, M., Baer, R., and Ludwig, T. (2008). E3 ligase activity of BRCA1 is not essential for mammalian cell viability or homology-directed repair of double-strand DNA breaks. Proc. Natl. Acad. Sci. USA 105, 2087620881. Reina-San-Martin, B., Chen, J., Nussenzweig, A., and Nussenzweig, M.C. (2007). Enhanced intra-switch region recombination during immunoglobulin class switch recombination in 53BP1-/- B cells. Eur. J. Immunol. 37, 235239. Robbiani, D.F., Bothmer, A., Callen, E., Reina-San-Martin, B., Dorsett, Y., Dilippantonio, S., Bolland, D.J., Chen, H.T., Corcoran, A.E., Nussenzweig, A., and Nussenzweig, M.C. (2008). AID is required for the chromosomal breaks in c-myc that lead to c-myc/IgH translocations. Cell 135, 10281038. Saberi, A., Hochegger, H., Szuts, D., Lan, L., Yasui, A., Sale, J.E., Taniguchi, Y., Murakawa, Y., Zeng, W., Yokomori, K., et al. (2007). RAD18 and poly(ADPribose) polymerase independently suppress the access of nonhomologous end joining to double-strand breaks and facilitate homologous recombination-mediated repair. Mol. Cell. Biol. 27, 25622571. Sakai, W., Swisher, E.M., Karlan, B.Y., Agarwal, M.K., Higgins, J., Friedman, C., Villegas, E., Jacquemont, C., Farrugia, D.J., Couch, F.J., et al. (2008). Secondary mutations as a mechanism of cisplatin resistance in BRCA2mutated cancers. Nature 451, 11161120. Sartori, A.A., Lukas, C., Coates, J., Mistrik, M., Fu, S., Bartek, J., Baer, R., Lukas, J., and Jackson, S.P. (2007). Human CtIP promotes DNA end resection. Nature 450, 509514. Schlegel, B.P., Jodelka, F.M., and Nunez, R. (2006). BRCA1 promotes induction of ssDNA by ionizing radiation. Cancer Res. 66, 51815189. Scully, R., Chen, J., Plug, A., Xiao, Y., Weaver, D., Feunteun, J., Ashley, T., and Livingston, D.M. (1997). Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell 88, 265275. Scully, R., Ganesan, S., Vlasakova, K., Chen, J., Socolovsky, M., and Livingston, D.M. (1999). Genetic analysis of BRCA1 function in a dened tumor cell line. Mol. Cell 4, 10931099. Shrivastav, M., De Haro, L.P., and Nickoloff, J.A. (2008). Regulation of DNA double-strand break repair pathway choice. Cell Res. 18, 134147. Sonoda, E., Sasaki, M.S., Buerstedde, J.M., Bezzubova, O., Shinohara, A., Ogawa, H., Takata, M., Yamaguchi-Iwai, Y., and Takeda, S. (1998). Rad51decient vertebrate cells accumulate chromosomal breaks prior to cell death. EMBO J. 17, 598608. Sonoda, E., Sasaki, M.S., Morrison, C., Yamaguchi-Iwai, Y., Takata, M., and Takeda, S. (1999). Sister chromatid exchanges are mediated by homologous recombination in vertebrate cells. Mol. Cell. Biol. 19, 51665169.

Sonoda, E., Hochegger, H., Saberi, A., Taniguchi, Y., and Takeda, S. (2006). Differential usage of non-homologous end-joining and homologous recombination in double strand break repair. DNA Repair (Amst.) 5, 10211029. Stark, J.M., Pierce, A.J., Oh, J., Pastink, A., and Jasin, M. (2004). Genetic steps of mammalian homologous repair with distinct mutagenic consequences. Mol. Cell. Biol. 24, 93059316. Takata, M., Sasaki, M.S., Tachiiri, S., Fukushima, T., Sonoda, E., Schild, D., Thompson, L.H., and Takeda, S. (2001). Chromosome instability and defective recombinational repair in knockout mutants of the ve Rad51 paralogs. Mol. Cell. Biol. 21, 28582866. Tsukuda, T., Fleming, A.B., Nickoloff, J.A., and Osley, M.A. (2005). Chromatin remodelling at a DNA double-strand break site in Saccharomyces cerevisiae. Nature 438, 379383. Venkitaraman, A.R. (2004). Tracing the network connecting BRCA and Fanconi anaemia proteins. Nat. Rev. Cancer 4, 266276. Wang, B., Matsuoka, S., Carpenter, P.B., and Elledge, S.J. (2002). 53BP1, a mediator of the DNA damage checkpoint. Science 298, 14351438. Ward, I.M., Reina-San-Martin, B., Olaru, A., Minn, K., Tamada, K., Lau, J.S., Cascalho, M., Chen, L., Nussenzweig, A., Livak, F., et al. (2004). 53BP1 is required for class switch recombination. J. Cell Biol. 165, 459464. Watanabe, K., Iwabuchi, K., Sun, J., Tsuji, Y., Tani, T., Tokunaga, K., Date, T., Hashimoto, M., Yamaizumi, M., and Tateishi, S. (2009). RAD18 promotes DNA double-strand break repair during G1 phase through chromatin retention of 53BP1. Nucleic Acids Res. 37, 21762193. Xie, A., Hartlerode, A., Stucki, M., Odate, S., Puget, N., Kwok, A., Nagaraju, G., Yan, C., Alt, F.W., Chen, J., et al. (2007). Distinct roles of chromatin-associated proteins MDC1 and 53BP1 in mammalian double-strand break repair. Mol. Cell 28, 10451057. Xu, X., Wagner, K.U., Larson, D., Weaver, Z., Li, C., Ried, T., Hennighausen, L., Wynshaw-Boris, A., and Deng, C.X. (1999). Conditional mutation of Brca1 in mammary epithelial cells results in blunted ductal morphogenesis and tumour formation. Nat. Genet. 22, 3743. Xu, X., Qiao, W., Linke, S.P., Cao, L., Li, W.M., Furth, P.A., Harris, C.C., and Deng, C.X. (2001). Genetic interactions between tumor suppressors Brca1 and p53 in apoptosis, cell cycle and tumorigenesis. Nat. Genet. 28, 266271. Yu, X., Wu, L.C., Bowcock, A.M., Aronheim, A., and Baer, R. (1998). The C-terminal (BRCT) domains of BRCA1 interact in vivo with CtIP, a protein implicated in the CtBP pathway of transcriptional repression. J. Biol. Chem. 273, 2538825392. Yun, M.H., and Hiom, K. (2009a). CtIP-BRCA1 modulates the choice of DNA double-strand-break repair pathway throughout the cell cycle. Nature 459, 460463. Yun, M.H., and Hiom, K. (2009b). Understanding the functions of BRCA1 in the DNA-damage response. Biochem. Soc. Trans. 37, 597604. Zhang, Y., Hefferin, M.L., Chen, L., Shim, E.Y., Tseng, H.M., Kwon, Y., Sung, P., Lee, S.E., and Tomkinson, A.E. (2007). Role of Dnl4-Lif1 in nonhomologous end-joining repair complex assembly and suppression of homologous recombination. Nat. Struct. Mol. Biol. 14, 639646.

254 Cell 141, 243254, April 16, 2010 2010 Elsevier Inc.