Breakthrough Aspergillus fumigatus and Candida albicans Double Infection during Caspofungin Treatment: Laboratory Characteristics and Implication

for Susceptibility Testing

Maiken Cavling Arendrup, Guillermo Garcia-Effron, Walter Buzina, Klaus Leth Mortensen, Nanna Reiter, Christian Lundin, Henrik Elvang Jensen, Cornelia Lass-Flrl, David S. Perlin and Brita Bruun Antimicrob. Agents Chemother. 2009, 53(3):1185. DOI: 10.1128/AAC.01292-08. Published Ahead of Print 22 December 2008. Downloaded from http://aac.asm.org/ on December 3, 2012 by UNIVERSIDAD DE CHILE

Updated information and services can be found at: http://aac.asm.org/content/53/3/1185 These include:
REFERENCES

This article cites 47 articles, 31 of which can be accessed free at: http://aac.asm.org/content/53/3/1185#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more

CONTENT ALERTS

Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Mar. 2009, p. 11851193 0066-4804/09/$08.00 0 doi:10.1128/AAC.01292-08 Copyright 2009, American Society for Microbiology. All Rights Reserved.

Vol. 53, No. 3

Breakthrough Aspergillus fumigatus and Candida albicans Double Infection during Caspofungin Treatment: Laboratory Characteristics and Implication for Susceptibility Testing
Maiken Cavling Arendrup,1* Guillermo Garcia-Effron,2 Walter Buzina,3 Klaus Leth Mortensen,1 Nanna Reiter,4 Christian Lundin,1 Henrik Elvang Jensen,5 Cornelia Lass-Florl,6 David S. Perlin,2 and Brita Bruun7
Unit of Mycology and Parasitology, Statens Serum Institut, Copenhagen, Denmark1; Public Health Research Institute, New Jersey Medical School, UMDNJ, Newark, New Jersey2; Institute of Hygiene, Microbiology, and Environmental Medicine, Medical University Graz, Graz, Austria3; Department of Intensive Care Medicine, Roskilde Hospital, Roskilde, Denmark4; Department of Disease Biology, Faculty of Life Sciences, University of Copenhagen, Copenhagen, Denmark5; Department of Hygiene and Medical Microbiology, Innsbruck Medical University, Innsbruck, Austria6; and Department of Clinical Microbiology, Hillerd Hospital, Hillerd, Denmark7
Received 26 September 2008/Returned for modication 24 November 2008/Accepted 11 December 2008

Downloaded from http://aac.asm.org/ on December 3, 2012 by UNIVERSIDAD DE CHILE

Caspofungin is used for the treatment of acute invasive candidiasis and as salvage treatment for invasive aspergillosis. We report characteristics of isolates of Candida albicans and Aspergillus fumigatus detected in a patient with breakthrough infection complicating severe gastrointestinal surgery and evaluate the capability of susceptibility methods to identify candin resistance. The susceptibility of C. albicans to caspofungin and anidulafungin was investigated by Etest, microdilution (European Committee on Antibiotic Susceptibility Testing [EUCAST] and CLSI), disk diffusion, agar dilution, and FKS1 sequencing and in a mouse model. Tissue was examined by immunohistochemistry, PCR, and sequencing for the presence of A. fumigatus and resistance mutations. The MICs for the C. albicans isolate were as follows: >32 g/ml caspofungin and 0.5 g/ml anidulafungin by Etest, 2 g/ml caspofungin and 0.125 g/ml anidulafungin by EUCAST methods, and 1 g/ml caspofungin and 0.5 g/ml anidulafungin by CLSI methods. Sequencing of the FKS1 gene revealed a mutation leading to an S645P substitution. Caspofungin and anidulafungin failed to reduce kidney CFU counts in animals inoculated with this isolate (P > 0.05 compared to untreated control animals), while both candins completely sterilized the kidneys in animals infected with a control isolate. Disk diffusion and agar dilution methods clearly separated the two isolates. Immunohistochemistry and sequencing conrmed the presence of A. fumigatus without FSK1 resistance mutations in liver and lung tissues. Breakthrough disseminated aspergillosis and candidiasis developed despite an absence of characteristic FKS1 resistance mutations in the Aspergillus isolates. EUCAST and CLSI methodology did not separate the candin-resistant clinical isolate from the sensitive control isolate as well as did the Etest and agar methods. Candins are among the preferred choices for initial treatment of candidemia (35) and are also indicated as salvage treatment for aspergillosis (48). Since caspofungin was introduced on the market in 2001, its use has increased remarkably, e.g., in Denmark, from 3 to 9,000 daily dened doses during the period of 2003 to 2007 (http://www.medstat.dk/MedStatDataViewer .php). This is a consequence of a number of recent fungemia surveys reporting a considerable proportion of cases involving species with reduced susceptibility to uconazole, such as Candida glabrata and Candida krusei (3, 22, 31, 42, 47). Moreover, in a recent trial comparing uconazole with anidulafungin, the latter was associated with an improved success rate even in cases involving uconazole-susceptible species like Candida albicans and Candida tropicalis (20). Resistance to candins has been reported only sporadically for Candida and Aspergillus isolates (4, 5, 19, 24, 25, 28, 36, 37, 39), but with the increased use of candins, the selection pressure has risen, and close monitoring and sensitive susceptibility testing methods have become increasingly important. Recently, the CLSI suggested 2 g/ml as a tentative susceptibility breakpoint for caspofungin, micafungin, and anidulafungin for Candida spp. However, Candida infections involving isolates with mutations in FKS1, which encodes the candin target, do not necessarily show MICs above this breakpoint, and minimal effective concentration determinations do not always detect Aspergillus isolates with reduced susceptibility when using microdilution tests (4, 19, 24). We report a case of breakthrough invasive C. albicans infection and aspergillosis during long-term caspofungin treatment. The C. albicans isolate was characterized by notably raised Etest endpoints, decreased susceptibility determined by disk diffusion and agar dilution, and in vivo resistance to caspofungin and anidulafungin in an animal model but with microdilution MICs not exceeding the suggested CLSI breakpoint of 2 g/ml. Sequencing demonstrated a point mutation in the FKS1 target gene. Sequencing of liver and lung tissue obtained during autopsy conrmed the presence of Aspergillus fumigatus but revealed no resistance mutations in the FKS1 gene. CASE REPORT A 59-year-old woman was admitted to a general hospital with a history of 5 days of nonspecic abdominal pain accom1185

* Corresponding author. Mailing address: Unit of Mycology and Parasitology (43/117), Statens Serum Institut, Artillerivej 5, DK-2300 Copenhagen S, Denmark. Phone: 45 22 63 27 85. Fax: 45 3268 8180. E-mail: mad@ssi.dk. Published ahead of print on 22 December 2008.

1186

ARENDRUP ET AL.

ANTIMICROB. AGENTS CHEMOTHER.

water) (Pzer A/S, Ballerup, Denmark), amphotericin B (5,000 g/ml in DMSO) (catalog number A2411; Sigma-Aldrich, Vallensbk Strand, Denmark), caspofungin (5,000 g/ml in DMSO) (Merck, Sharp & Dohme, Glostrup, Denmark), anidulafungin (5,000 g/ml in DMSO) (Pzer A/S, Ballerup, Denmark), itraconazole (5,000 g/ml in DMSO) (Janssen-Cilag, Birkerd, Denmark), and voriconazole (5,000 g/ml in DMSO) (Pzer A/S, Ballerup, Denmark). Microtiter plates were read spectrophotometrically at 490 nm. The MIC was dened as the lowest drug dilution giving 50% growth inhibition. C. krusei ATCC 6862 was included as a control in each run. For disk diffusion testing, we used 90-mm plates containing RPMI 1640 medium with 2% glucose agar and Mueller-Hinton agar (both from SSI Diagnostika, Hillerd, Danmark). Inoculation was done by swabbing the agar in three directions with a swab soaked in a yeast suspension of 1 106 to 5 106 cells/ml. Disks containing 1, 5, or 25 g of drug were prepared by placing 20 l of a suitable drug concentration on sterile 6-mm-diameter paper disks (Struers, Denmark) and subsequently placing the disks on the inoculated plates. Agar dilution testing was done using Sabouraud agar containing 0, 0.5, 1, and 2 g/ml of caspofungin or 0, 0.003, 0.125, and 0.5 g/ml anidulafungin, respectively, in 1-ml volumes in four-well multidish plates (1.9 cm2/well) (Nunc; Thermo Fisher Scientic, Roskilde, Denmark). The three Candida isolates (C. albicans R and C. albicans S and C) were subcultured for 2 days on CHROMagar (SSI Diagnostika, Hillerd, Denmark). Suspensions containing 1 106 to 5 106 CFU/ml were prepared in sterile water and diluted 1,500 times, and 5 l (approximately 3 to 15 cells) was spread onto each of the agar surfaces. Candidiasis animal model. A total of 56 NMRI mice (weight, 26 to 30 g) (Harlan Scandinavia, Allerd, Denmark) were kept with free access to food and water. On day 0, mice were inoculated by intravenous injection with a suspension of C. albicans (1 105 CFU in 200 l) using a 25-gauge syringe. Eight groups of seven mice were challenged with either C. albicans isolate R or C. Mice were treated by intraperitoneal injection on days 1 to 3 with 0.5 ml of either caspofungin (6 mg/kg of body weight), anidulafungin (12 mg/kg), or saline intraperitoneally (control mice) or with 0.7 ml of uconazole (50 mg/kg). Doses were chosen by multiplying the normal maintenance human daily dose (50 mg caspofungin, 100 mg anidulafungin, and 400 mg uconazole) by the mouse/human body surface ratio. Mice were sacriced by cervical dislocation on day 4. Kidneys were aseptically removed, weighed, and placed in pairs into 1,000 l of sterile saline. All organs were stored at 80C before homogenization with a homogenizer (RW 16 Basic; IKA Labortechnik, Bie & Berntsen, Denmark). CFU determinations were performed by the spot technique by plating 20- l spots of 10-fold dilutions. The results were expressed as the log10 of the number of CFU/ml kidney tissue homogenate. The lower limit of detectable CFU was 50 CFU/ml. The experiments were approved by the Danish Animal Experimentation Committee under the Ministry of Justice (approval no. 2004/561-835). Sequencing. C. albicans R and C were cultured on Sabouraud agar for 24 h at 37C. For DNA extraction, the PrepMan Ultra kit (Applied Biosystems, Foster City, CA) was used. A loopful of cells was suspended in 200 l of PrepMan Ultra sample preparation reagent in a 1.5-ml microcentrifuge tube. The samples were vortexed for 30 s and incubated at 100C for 10 min. Thereafter, the samples were centrifuged for 3 min at a relative centrifugal force of 16,000, and the supernatants were transferred into a 1.5-ml Eppendorf tube and stored at 20C until use. For PCR of the FKS1 region at positions 1717 to 2135, the primer pair consisting of GSC1F and GSC1R was used (19); for the FKS1 region at positions 4054 to 4267, the newly designed forward primer 5 -ATTGCTCCTGCCGTTG ATTG-3 and recently described reverse primer 5 -GGTCAAATCAGTGAAA ACCG-3 (24) were used. The conditions for amplication were an initial denaturation step at 94C followed by 30 cycles of denaturation at 94C for 30 s, annealing at 54C for 1 min, and extension at 74C for 1.5 min and a nal extension step at 70C for 4 min as described previously (12). The resulting amplicons were puried using an Invisorb PCRapid kit (Invitek, Berlin, Germany). Cycle sequencing was performed in both directions with the same primers as those used for PCR using the BigDye Terminator cycle sequencing kit (Applied Biosystems). Purication of the cycle sequencing products was carried out with a solution containing 2.5 l 125 mM EDTA and 25 l 96% ethanol. The pellets were dried for 15 min in a drying chamber and dissolved in 15 l HiDi (Applied Biosystems), and the sequences were generated using the 3130 Genetic Analyzer automated capillary DNA sequencer (Applied Biosystems). The resulting nucleic acid sequences were assembled and transcribed into the amino acid sequences using the internet freeware Nucleic Acid to Amino Acid Translation (http://www.biochem.ucl.ac.uk/cgi-bin/mcdonald/cgina2aa.pl). Molecular studies of Aspergillus using parafn-embedded tissue biopsies. DNA isolation was done with the Q-Biogene FastDNA kit (Irvine, CA) according to the manufacturers instructions. A previous step of parafn elimination was performed by incubating the parafn-embedded biopsies in 10 ml of Citro-

panied by sepsis. As a child, she had suffered from polio but was otherwise healthy. Upon admission, an abdominal radiograph showed intraperitoneal gas. Acute laparotomy revealed perforation and necrosis of the sigmoid colon with fecal peritonitis leading to a Hartmanns operation. Small-bowel resection was also necessary due to extensive adhesions. Ileostomy, sigmoid colostomy, and bilateral salpingo-oophorectomy were performed. Postoperatively, the patient was transferred to the intensive care unit (ICU) in septic shock and was treated according to Surviving Sepsis Campaign guidelines (9). Respirator treatment was given during the entire ICU stay, and the patient was placed on hemodialysis due to acute renal failure. Broad-spectrum antibiotics were given and changed according to culture and susceptibility tests. On day 4, empirical treatment with 400 mg/day uconazole was given for 3 days. Due to the nding of yeast (subsequently identied as C. albicans) in blood cultures, the antifungal treatment was changed to standard doses of caspofungin on day 8. Treatment with caspofungin was continued for the rest of the ICU stay. Relaparotomy, done on day 12, revealed necrosis of the ileostomy and fecal peritonitis. Small-bowel resection was done again (day 23) and also on day 25 because of iliac perforation. On day 31, contrast radiography showed iliac stula at the site of the former perforation. No further surgical options were considered to be left, and the patient was treated conservatively. An abdominal computed tomography scan on day 33 showed mesenteric edema, liver abscesses, as well as abscesses in relation to the ileostomy. In order to optimize the chances of conservative healing, the patient was transferred to the ICU in another hospital on day 35, where continuous renal replacement therapy was performed. At the new ICU, broad-spectrum antibiotics and caspofungin were continued. As the patient continued to deteriorate on conservative treatment with rising C-reactive protein, leukocyte counts, and lactate, surgical debridement with resection of necrotic tissue, drainage of liver abscesses, rinsing, and VAC treatment were done on days 39, 40, and 41. Fluconazole (400 mg/day) was added due to the growth of caspofungin-resistant C. albicans from a dialysis catheter and catheter urine. Despite all efforts, the patient died with multiorgan failure on day 42. Autopsy revealed peritonitis with extensive necroses and bleeding, sequelae after the various operations, and multiple abscesses in liver, lungs, retroperitoneum, and left kidney. Histologically, multiple lamentous fungal elements were demonstrated within the pulmonary and hepatic processes. The elements were identied as being A. fumigatus due to positive reactivity only with the monoclonal antibody directed toward Aspergillus spp. and the heterologously absorbed polyclonal antibody directed toward A. fumigatus.
MATERIALS AND METHODS Susceptibility testing. Susceptibilities of the index isolate (C. albicans R) and of a control isolate randomly chosen among clinical blood isolates (C. albicans C) to anidulafungin and caspofungin were determined by Etest (AB Biodisk, Solna, Sweden) using RPMI 1640 medium with 2% glucose agar (SSI Diagnostika, Hillerd, Danmark) according to the manufacturers recommendations. Susceptibility testing was also performed according to European Committee on Antibiotic Susceptibility Testing (EUCAST) discussion document E7.1 (7, 8) and according to CLSI (formerly National Committee for Clinical Laboratory Standards) M27-A2 methodology (29). Drugs used were as follows: dimethyl sulfoxide (DMSO) (catalog no. D8779; Sigma-Aldrich), uconazole (10,000 g/ml in

Downloaded from http://aac.asm.org/ on December 3, 2012 by UNIVERSIDAD DE CHILE

VOL. 53, 2009

CANDIN-CROSS-RESISTANT C. ALBICANS AND A. FUMIGATUS

1187

TABLE 1. Microbiological specimens with growth of fungi during admission at hospital A day on days 0 to 35 and hospital B on days 35 to 42
Day of sampling (days after admission) Type or origin of specimen Microorganism Caspofungin MIC ( g/ml)a Method

4 5 7 17 20 21 22 22 24 29 29 35 38 38 39 40 40 41
a b c

Blood culture Tracheal suction Blood culture Tracheal suction Wound Urine Wound Tracheal suction Tracheal suction Urine Pus Hemodialysis catheter tip Tracheal suction Urine Peritoneal cavity Tracheal suction Tracheal suction Urine

C. albicansb C. albicans Yeast not identied C. albicans C. albicans C. albicans C. albicans Yeast not identied C. albicans C. albicans C. albicans C. albicans Mold not identied C. albicansc C. albicans Mold not identied, C. albicans Mold not identied C. albicans

0.25 0.25 ND ND 0.5 1 ND ND 0.25 0.25 ND 32 ND 32 ND ND ND ND

EUCAST microdilution EUCAST microdilution EUCAST microdilution EUCAST microdilution

Downloaded from http://aac.asm.org/ on December 3, 2012 by UNIVERSIDAD DE CHILE

EUCAST microdilution EUCAST microdilution Etest Etest

ND, not determined. C. albicans S isolate. C. albicans R isolate.

solv (Thermo Fisher Scientic, Austria) at room temperature for 4 h. Molecular identication of Aspergillus was performed by sequencing of the 5.8S RNA gene and the adjacent internal transcribed spacer 1 (ITS1) and ITS2 as described previously by White et al. (49). ITS sequences from A. fumigatus ATCC 13073, A. fumigatus 293, and A. fumigatus CNM-CM-237 (27) were used as controls. Sequence analysis was performed by comparing the DNA sequences with those of the control strains included in this study and with the sequences obtained from the GenBank database. FKS1 sequencing. The A. fumigatus FKS1 gene (GenBank accession no. AFU79728) was sequenced between nucleotides 1875 and 4318 by Sanger methodology using a Beckman Coulter CEQ 8000 genetic analysis system. The putative FKS1 gene from Aspergillus lentulus was sequenced between nucleotides

1880 and 2300 and between nucleotides 3900 and 4300 (nucleotides equivalent to A. fumigatus FKS1 hot spots 1 and 2). A. fumigatus ATCC 13073, A. fumigatus 293, A. fumigatus CNM-CM-237 (2), A. fumigatus EMFR-S678P (46), A. lentulus CNM-CM-3583, A. lentulus CNM-CM-3599, and A. lentulus CNM-CM-4420 (1) were used as control strains. Immunohistochemistry. Tissue sections were mounted onto adhesive slides (Superfrost Plus; Menzel-Glaser, Germany) and kept at 4C until processed. As primary reagents for immunostaining, two monoclonal antibodies that reacted specically with antigens of Aspergillus spp. and the Mucorales group (MCA1276 and MCA2577; Serotec, Oxford, United Kingdom) were used together with genus- and species-specic rabbit polyclonal antibodies directed against Candida spp., A. fumigatus, Aspergillus avus, Aspergillus niger, Geotrichum candidum,

FIG. 1. Etest susceptibility endpoints for the day 4 candin-susceptible C. albicans S isolate, the day 38 candin-resistant C. albicans R isolate, and a susceptible unrelated control C. albicans C isolate, respectively, to caspofungin (CAS) and anidulafungin (Anid). From left to right, data for C. albicans S and caspofungin Etest, C. albicans S and anidulafungin Etest, C. albicans R and caspofungin Etest, C. albicans R and anidulafungin Etest, C. albicans S and caspofungin Etest, and C. albicans C and anidulafungin Etest are shown. The MICs for each isolate and antifungal are indicated below the photograph.

1188

ARENDRUP ET AL. TABLE 2. Susceptibility results by EUCAST, Etest, and agar dilution
Susceptibility resulta Test 1st run C. albicans R 2nd run 1st run

ANTIMICROB. AGENTS CHEMOTHER.

C. albicans C 2nd run

EUCAST MIC ( g/ml) Caspofungin (old batch) Caspofungin (new batch) Anidulafungin (unfrozen batch) Anidulafungin (frozen batch) Fluconazole Itraconazole Voriconazole Posaconazole CLSI MIC ( g/ml) (24 h/48 h) Caspofungin (new batch) Anidulafungin Fluconazole Itraconazole Voriconazole Posaconazole Etest MIC ( g/ml) Caspofungin Anidulafungin Amphotericin B Agar dilution 0.5 g/ml caspofungin 1 g/ml caspofungin 2 g/ml caspofungin 0.003 g/ml anidulafungin 0.125 g/ml anidulafungin 0.5 g/ml anidulafungin
a

2 1 0.06 0.25 0.125 0.03 0.03 0.03 1/2 0.5/0.5 0.125/ 0.03/ 0.03/ 0.03/ 32 0.5 0.38 Growth Growth Growth Growth Growth Growth

2 1 0.06 0.125 0.125 0.03 0.03 0.03 1/1 0.25/0.5 0.125/ 0.03/ 0.03/ 0.03/ 32 0.5 0.25 Growth Growth Growth Growth Growth Growth

0.25 0.06 0.03 0.03 0.125 0.03 0.03 0.03 0.06/ 0.06 0.015/0.0150.5 tr 0.25/0.25 0.03/ 0.03 0.03/ 0.03 0.03/ 0.03 0.06 0.002 0.125 No growth No growth No growth Growth No growth No growth

0.5 0.06 0.03 0.03 0.125 0.03 0.03 0.03 0.06/ 0.06 0.015/0.0150.25 tr 0.25/0.25 0.03/ 0.03 0.03/ 0.03 0.03/ 0.03 0.125 0.003 0.25 No growth No growth No growth Growth No growth No growth

Downloaded from http://aac.asm.org/ on December 3, 2012 by UNIVERSIDAD DE CHILE

0.125 0.03 0.03 0.03

0.125 0.03 0.03 0.03

tr indicates that at the 48-h reading, trailing growth was observed, that is, 50% growth inhibition in the concentration range indicated.

Fusarium solani, and Scedosporium apiospermum (17, 18). All polyclonal antibodies were absorbed heterologously according to procedures described previously by Okuda et al. (32) and Jensen et al. (16). The Power-Vision Poly-HRP histostaining kit detection system (Immunovision Technologies Co., Brisbane, CA) was applied for visualization of immunoreactivity (21). The immunoreaction was followed by incubation for 6 min in amino-ethyl carbazol solution (Immunovision). The sections were counterstained in Harris hematoxylin for 10 s before reading. Experimentally infected murine tissues with reference fungi were used as positive controls (17). Statistics. CFU kidney burden levels among the various treatment groups were compared using the Mann-Whitney test.

RESULTS Mycology. C. albicans cells were cultured on numerous occasions, and mold was isolated from three separate tracheal suctions (Table 1). The mold was not further characterized, as the patient was dying or dead at the time of detection. The urine and catheter tip C. albicans isolates obtained on days 35 and 38 were resistant to caspofungin by Etest, in contrast to the earlier blood culture isolate (day 4) (Fig. 1). The urine isolate (C. albicans R) was further tested by EUCAST and CLSI microdilution (Table 2). Both tests conrmed the raised MICs of caspofungin but not to levels exceeding the suggested susceptible CLSI breakpoint of 2 g/ml. The murine candidiasis model showed no signicant reduction in kidney burden for animals inoculated with C. albicans R and treated with caspofungin or anidulafungin (P values of 0.053 and 0.3374, respec-

tively) (Fig. 2). In contrast, caspofungin and anidulafungin reduced the fungal burden in the animals inoculated with the control isolate (named C. albicans C) to below the detection level. For both isolates, uconazole resulted in a signicant reduction in kidney burden (P values of 0.0006 and 0.0252 for C. albicans R and control isolates, respectively). In order to investigate the discriminatory potential of alternative methods for susceptibility testing, disk diffusion and agar dilution susceptibility testings were undertaken. Disk diffusion was performed with 1-, 5-, and 25- g disks on two different agars and read after 24 and 48 h. For all combinations, the zones of the C. albicans R isolate were smaller than those for the control isolate, as illustrated by a mean difference in zone diameter of 46.2% (range, 33.7% to 58.4%) after 24 h and with the control isolate as a comparator (Table 3). Agar dilution was performed using caspofungin concentrations of 0.5, 1, and 2 g/ml and anidulafungin concentrations of 0.003, 0.125, and 0.5 g/ml. While C. albicans R grew on all the candin agars, no growth was observed for the control isolate, with the exception of agar containing 0.003 g/ml anidulafungin (Table 2 and Fig. 3). Molecular characterization. In order to characterize the underlying candin resistance mechanism, the hot spot regions of FKS1 spanning the prominent S645 codon (36) were amplied and sequenced. The translated sequences corresponding to amino acids 641 to 648 of C. albicans Fks1p (19) were aligned

VOL. 53, 2009

CANDIN-CROSS-RESISTANT C. ALBICANS AND A. FUMIGATUS

1189

and control A. fumigatus strains, and FKS1 sequencing demonstrated no mutations at the two equivalent C. albicans hot spot regions associated with echinocandin resistance (Table 4) (46). DISCUSSION We report here a case of disseminated aspergillosis and the emergence of a caspofungin-resistant C. albicans isolate from an abdominal surgical patient during 40 days of caspofungin treatment. Breakthrough Aspergillus infections in allogeneic hematopoietic stem cell transplant recipients on caspofungin therapy have been reported (25), but to our best knowledge, this is the rst reported case in a nonneutropenic patient on caspofungin treatment. ICU patients with underlying chronic obstructive pulmonary disease constitute a new and rising risk group for aspergillosis (26), but disseminated aspergillosis in abdominal surgery patients is extremely rare (14, 38). In our case, only one of the three airway samples yielding growth of mold was positive before the patient died, and thus, the diagnosis was rst established at autopsy. Immunohistochemistry and sequencing of the DNA extracted from liver and lung tissue conrmed the presence of A. fumigatus in both tissues. There were no mutations in the FKS1 hot spot regions. Moreover, it was conrmed by FKS1 sequencing that the sample did not contain A. lentulus DNA (A. fumigatus-related species with reduced echinocandin susceptibility) (46). It thus appears that the patient developed invasive aspergillosis with a wild-type A. fumigatus isolate; however, we cannot rule out that the isolate had other resistance mechanisms, as the isolate was not available for susceptibility testing. An isolate with reduced susceptibility due to an upregulation of the target enzyme level was recently reported (4). Echinocandin resistance in C. albicans has been associated with mutations in two hot spot regions of FKS1, which encode the target and major subunit of glucan synthase (24, 39, 46). In our case, a point mutation in the FKS1 gene leading to a S645P amino acid substitution was found. Caspofungin resistance was

Downloaded from http://aac.asm.org/ on December 3, 2012 by UNIVERSIDAD DE CHILE

FIG. 2. In vivo susceptibility of C. albicans R and C to anidulafungin, caspofungin, and uconazole in a murine invasive candidiasis model. Kidney burden on day 4 is shown for mice challenged with C. albicans R (solid marks) and C. albicans C (open marks) and subsequently treated with caspofungin (circles), anidulafungin (squares), uconazole (triangles), or glucose (control group) (diamonds).

and showed a site-specic mutation (at nucleic acid position 1933) (Fig. 4), resulting in a change of hydrophilic serine to hydrophobic proline. A silent heterozygous mutation was found in strain R at nucleotide 4230. Immune histochemistry using anti-Aspergillus fumigatus monoclonal antibodies was positive for liver and lung sections obtained postmortem (Fig. 5). PCR and sequencing of the tissue demonstrated that both biopsy samples contained A. fumigatus DNA. One hundred percent homology was found between the biopsy ITS amplicon

TABLE 3. Zone diameters obtained under different conditions for the caspofungin-resistant isolate and the caspofungin-susceptible isolatea
Culture condition Dose of drug ( g) Zone diam (mm) at 24-h readingb Cas R Cas S % Difference in zone diam at 24 h Zone diam (mm) at 48-h readingb Cas R Cas S % Difference in zone diam at 48 h

RPMI 1640 medium with: Caspofungin Anidulafungin

1c 5 25 1 5 25 1 5 25 1 5 25

6.2 8.6 12.4 8.5 9.5 7.7 6.1 8.8 13.4 6.7 9.4 6.8

10.7 20.6 25.3 13.7 15.9 14.9 12.1 19.2 23.3 13.2 14.2 12.8

42.60 58.40 51.10 38.20 40.20 48.60 49.20 54.00 42.20 49.00 33.70 46.70

6.2 6.2 11.9 7.8 8.8 7.1 6.1 8.8 12.7 6.8 9.9 7

10.5 21 26.4 13.2 15.7 13.8 12.5 20.4 24.9 13.9 14.6 13.1

40.90 70.60 54.90 40.50 44.30 48.90 51.50 57.10 49.10 51.30 32.50 46.20

Mueller-Hinton agar with: Caspofungin Anidulafungin

a b c

Cas R, caspofungin-resistant isolate; Cas S, caspofungin-susceptible isolate. Means of data from two experiments. Disk content of antifungal compound.

1190

ARENDRUP ET AL.

ANTIMICROB. AGENTS CHEMOTHER.

Downloaded from http://aac.asm.org/ on December 3, 2012 by UNIVERSIDAD DE CHILE

FIG. 3. Agar dilution susceptibility testing. Repeated testing of C. albicans S (a), C. albicans R (b), and the control C. albicans C isolate (c) to anidulafungin and caspofungin. Concentrations ( g/ml) of the antifungals are indicated next to the wells.

clearly shown by Etest, disk diffusion, and agar dilution, and the CLSI and EUCAST microdilution reference methods also demonstrated elevated MICs. However, none of the microdilution MICs were above the suggested CLSI susceptibility breakpoint of 2 g/ml for the candins (44). For anidulafungin, the microdilution MICs were remarkably low, 0.06 to 0.25 g/ml using EUCAST and 0.25 to 0.5 g/ml using CLSI methodology, and the Etest MIC was also below the suggested breakpoint. A number of studies have similarly demonstrated caspofungin MICs not exceeding 2 g/ml despite resistance mechanisms in C. albicans (5, 10, 11, 19, 24), while others have found more pronounced MIC elevations in resistant isolates (15, 28, 36). Susceptibility testing by the CLSI method has developed over time. Initially, 48 h of incubation and a stringent 80 to 95% inhibition endpoint were recommended when testing azoles, amphotericin B, and ucytosine. Now, 24 h of incubation and

a less stringent 50% endpoint are recommended, due to the earlier and more reproducible endpoints, and the candins have been included. When caspofungin MICs for clinical isolates of Candida species reported in the literature are compared, a considerable variation is observed, which impairs the establishment of epidemiological cutoff values that correctly dene the wild-type populations (Table 5) (2, 6, 23, 33, 40, 41, 43, 45). These differences may at least in part be explained by changing methodology, but a lack of stability of the caspofungin pure substance may also, at least in theory, play a role. Head-tohead comparisons of microdilution MICs for the three candins have demonstrated that anidulafungin and micafungin MICs are 1 log2 step (40) to 4 log2 steps (33, 34) lower than the caspofungin MICs in RPMI medium. In agreement with this nding, caspofungin endpoints were higher than anidulafungin MICs for both C. albicans isolates by microdilution and by Etest in this study. Three observations indicate that this in vitro

FIG. 4. Sequence alignment corresponding to nucleotides 1837 to 2136 of the FKS1 region (amino acids 613 to 712 of Fks1p) of C. albicans R (resistant) and C (control). The mutated site is indicated by a box.

VOL. 53, 2009

CANDIN-CROSS-RESISTANT C. ALBICANS AND A. FUMIGATUS

1191

Downloaded from http://aac.asm.org/ on December 3, 2012 by UNIVERSIDAD DE CHILE

FIG. 5. Immunohistochemical staining demonstrating the presence of Aspergillus hyphae in liver tissue. (The fungal elements are stained with anti-Aspergillus antibodies as described in Materials and Methods and appear red.)

difference in the MIC range does not translate into better activity: rstly, when susceptibility testing is performed in the presence of serum, higher and nearly equivalent MICs are yielded (30, 34); secondly, if equivalent doses are compared in

an animal model, no superiority is seen for anidulafungin and micafungin (34); and thirdly, in the present case, not only caspofungin but also anidulafungin failed to reduce the kidney burden in the animal model using doses equivalent to the

TABLE 4. Sequencing of FKS1 hot spot regions 1 (nucleotides 2023 to 2049) and 2 (nucleotides 4156 to 4183) from A. fumigatus DNA extracted from biopsies and from control strainsa
Hot spot region 1 Isolate DNA sequence Translated sequence Hot spot region 2 DNA sequence Translated sequence

Lung biopsy Liver biopsy Reference (AF293) EMFR-S678P ATCC 13073 CNM-CM-237 A. lentulus CNM-CM-3583 A. lentulus CNM-CM-3599 A. lentulus CNM-CM-4420
a

TTCCTGACCCTGTCTTTCAAGGATCCG TTCCTGACCCTGTCTTTCAAGGATCCG TTCCTGACCCTGTCTTTCAAGGATCCG TTCCTGACCCTGCCTTTCAAGGATCCG TTCCTGACCCTGTCTTTCAAGGATCCG TTCCTGACCCTGTCTTTCAAGGATCCG TTCCTGACCCTGTCTTTCAAGGACCCG TTCCTGACCCTGTCTTTCAAGGACCCG TTCCTGACCCTGTCTTTCAAGGACCCG

FLTLSFKDP FLTLSFKDP FLTLSFKDP FLTLPFKDP FLTLSFKDP FLTLSFKDP FLTLSFKDP FLTLSFKDP FLTLSFKDP

GACTGGGTCAACCGTTGTATCATCTCAA GACTGGGTCAACCGTTGTATCATCTCAA GACTGGGTCAACCGTTGTATCATCTCAA GACTGGGTCAACCGTTGTATCATCTCAA GACTGGGTCAACCGTTGTATCATCTCAA GACTGGGTCAACCGTTGTATCATCTCAA GACTGGGTCAACCGTTGTATCATCTCGA GACTGGGTCAACCGTTGTATCATCTCGA GACTGGGTCAACCGTTGTATCATCTCGA

DWVNRCIIS DWVNRCIIS DWVNRCIIS DWVNRCIIS DWVNRCIIS DWVNRCIIS DWVNRCIIS DWVNRCIIS DWVNRCIIS

Point mutations are underlined.

1192

ARENDRUP ET AL.

ANTIMICROB. AGENTS CHEMOTHER.

TABLE 5. Caspofungin MIC90s indicated by species as reported in studies using the M27-A3 CLSI method approved for candin susceptibility testing and in studies using earlier standards
Caspofungin MIC90 ( g/ml) M27-A 48-h incubation 95% inhibition endpoint determined in reference: 6 22 44 42 M27-A 48-h incubation 80% endpoint determined in reference 2 M27-A2 48-h incubation 50% endpoint determined in reference 32 M27-A3 24-h incubation 50% endpoint determined in reference: 40 39

Candida species

C. C. C. C. C. C. C. C. C.

albicans glabrata krusei tropicalis kefyr lusitaniae parapsilosis guilliermondii famata

0.5 1 1 0.5 2 2 16

0.25 0.5 2 0.25 2

0.25 0.25 1 0.5 2 2 8

0.25 0.25 1 0.5 1 4 8 8

0.5 1 2 0.5 1 2 1

0.5 1 2 1 1 2 2 12

0.06 0.06 0.25 0.06 0.015 0.25 1 1

0.06 0.06 0.25 0.06 0.015 0.5 1 1 1

Downloaded from http://aac.asm.org/ on December 3, 2012 by UNIVERSIDAD DE CHILE

human doses despite the fact that anidulafungin MICs were lower than caspofungin MICs. The CLSI breakpoint for candin susceptibility was established by taking into account analyses of mechanisms of resistance, the MIC population distribution, parameters associated with success in pharmakodynamic models, and results of clinical efcacy studies (44). As no signicant differences in clinical response were noted among the various species, results for all species were merged, and a susceptibility breakpoint of 2 g/ml was found to encompass the vast majority of isolates and not to bisect the population of Candida parapsilosis. However, it was noted that isolates of C. albicans and C. glabrata with MICs of 1 to 2 g/ml are clearly outside the wild-type population and that further studies and experience with such isolates are warranted. The data reported here suggest that the establishment of species-specic candin breakpoints may be necessary and also that different breakpoints for caspofungin and anidulafungin may be needed, as has been described recently for an analysis of inhibition of glucan synthase and MIC in echinocandin-resistant strains of C. albicans (13). Moreover, the ndings in this and others studies showing that the Etest separates the isolates with and without resistance mutations better clearly illustrate that further research is needed in order to dene the optimal noncommercial reference methodology for susceptibility testing of candins. In conclusion, we here present a rare case of breakthrough double infection with A. fumigatus and caspofungin-resistant C. albicans in a patient with long-term caspofungin treatment. This case illustrates the diverse challenges in diagnosing fungal infections, performing susceptibility testing, and choosing optimal antifungal treatment.

M.C.A. has been a consultant for Astellas, Pzer, and SpePharm; has been an invited speaker for Astellas, Cephalon, Merck Sharp & Dohme, Pzer, Schering-Plough, and Swedish Orphan; and has received research funding, although not for this particular study, from Pzer. C.L.-F. has been a consultant for Pzer and Schering Plough; has been an invited speaker for Pzer, Gilead, Schering Plough, and Merck Sharp & Dohme; and has received research fundings from Pzer, Gilead, Merch Sharp & Dohme, and Schering Plough. D.S.P. is a shareholder in Merck, has acted as a consultant for Merck, Pzer, and Astellas, is an advisory board member for Merck, Pzer, Astellas, and Myconostica (U.S. patent application 07763-O69WO1); has received research funding, although not for this particular study, from Merck, Pzer, Astellas, and Myconostica; and has been an invited speaker for Merck, Pzer, Astellas, and Myconostica. There are no conicts of interest for B.B., W.B., G.G.-E., K.L.M., N.R., C.L., and H.E.J.
REFERENCES 1. Alcazar-Fuoli, L., E. Mellado, A. Astruey-Izquierdo, M. Cuenca-Estrella, and J. L. Rodriguez-Tudela. 2008. Aspergillus section Fumigati: antifungal susceptibility patterns and sequence-based identication. Antimicrob. Agents Chemother. 52:12441251. 2. Alexander, B. D., T. C. Byrne, K. L. Smith, K. E. Hanson, K. J. Anstrom, J. R. Perfect, and L. B. Reller. 2007. Comparative evaluation of Etest and Sensititre YeastOne panels against the Clinical and Laboratory Standards Institute M27-A2 reference broth microdilution method for testing Candida susceptibility to seven antifungal agents. J. Clin. Microbiol. 45:698706. 3. Arendrup, M. C., K. Fuursted, B. Gahrn-Hansen, H. C. Schonheyder, J. D. Knudsen, I. M. Jensen, B. Bruun, J. J. Christensen, and H. K. Johansen. 2008. Semi-national surveillance of fungaemia in Denmark 20042006: increasing incidence of fungaemia and numbers of isolates with reduced azole susceptibility. Clin. Microbiol. Infect. 14:487494. 4. Arendrup, M. C., S. Perkhofer, S. J. Howard, G. Garcia-Effron, A. Vishukumar, D. Perlin, and C. Lass-Florl. 2008. Establishing in vitro-in vivo correlations for Aspergillus fumigatus: the challenge of azoles versus echinocandins. Antimicrob. Agents Chemother. 52:35043511. 5. Baixench, M. T., N. Aoun, M. Desnos-Ollivier, D. Garcia-Hermoso, S. Bretagne, S. Ramires, C. Piketty, and E. Dannaoui. 2007. Acquired resistance to echinocandins in Candida albicans: case report and review. J. Antimicrob. Chemother. 59:10761083. 6. Chryssanthou, E., and M. Cuenca-Estrella. 2002. Comparison of the Antifungal Susceptibility Testing Subcommittee of the European Committee on Antibiotic Susceptibility Testing proposed standard and the E-test with the NCCLS broth microdilution method for voriconazole and caspofungin susceptibility testing of yeast species. J. Clin. Microbiol. 40:38413844. 7. Cuenca-Estrella, M., M. C. Arendrup, E. Chryssanthou, E. Dannaoui, C. Lass-Florl, P. Sandven, A. Velegraki, and J. L. Rodriguez-Tudela. 2007. Multicentre determination of quality control strains and quality control ranges for antifungal susceptibility testing of yeasts and lamentous fungi using the methods of the Antifungal Susceptibility Testing Subcommittee of the European Committee on Antimicrobial Susceptibility Testing (AFSTEUCAST). Clin. Microbiol. Infect. 13:10181022. 8. Cuenca-Estrella, M., C. B. Moore, F. Barchiesi, J. Bille, E. Chryssanthou, D. W. Denning, J. P. Donnelly, F. Dromer, B. Dupont, J. H. Rex, M. D. Richardson, B. Sancak, P. E. Verweij, and J. L. Rodriguez-Tudela. 2003.

ACKNOWLEDGMENTS We thank the Pathology Department of Hillerd Hospital for providing tissue specimens and Jytte Mark Andersen, Frederikke Rosenborg Petersen, Lydia Viekjr, and Birgit Brandt for excellent technical assistance at Statens Serum Institut. We thank Pzer for providing voriconazole and anidulafungin pure substance and the anidulafungin Etest, Merck for providing caspofungin pure substance, and Schering Plough for providing posaconazole pure substance. The study was not nancially supported by any pharmaceutical company. However, it was supported by NIH grant 1R01AI069397-01 to D.S.P.

VOL. 53, 2009

CANDIN-CROSS-RESISTANT C. ALBICANS AND A. FUMIGATUS

1193

9.

10.

11. 12.

13. 14. 15.

16. 17. 18. 19. 20.

21.

22. 23. 24.

25.

26. 27.

28.

Multicenter evaluation of the reproducibility of the proposed antifungal susceptibility testing method for fermentative yeasts of the Antifungal Susceptibility Testing Subcommittee of the European Committee on Antimicrobial Susceptibility Testing (AFST-EUCAST). Clin. Microbiol. Infect. 9:467474. Dellinger, R. P., M. M. Levy, J. M. Carlet, J. Bion, M. M. Parker, R. Jaeschke, K. Reinhart, D. C. Angus, C. Brun-Buisson, R. Beale, T. Calandra, J. F. Dhainaut, H. Gerlach, M. Harvey, J. J. Marini, J. Marshall, M. Ranieri, G. Ramsay, J. Sevransky, B. T. Thompson, S. Townsend, J. S. Vender, J. L. Zimmerman, and J. L. Vincent. 2008. Surviving Sepsis Campaign: international guidelines for management of severe sepsis and septic shock: 2008. Crit. Care Med. 36:296327. Desnos-Ollivier, M., S. Bretagne, D. Raoux, D. Hoinard, F. Dromer, and E. Dannaoui. 2008. Mutations in the fks1 gene in Candida albicans, C. tropicalis, and C. krusei correlate with elevated caspofungin MICs uncovered in AM3 medium using the method of the European Committee on Antibiotic Susceptibility Testing. Antimicrob. Agents Chemother. 52:30923098. Desnos-Ollivier, M., F. Dromer, and E. Dannaoui. 2008. Detection of caspofungin resistance in Candida spp. by Etest. J. Clin. Microbiol. 46:23892392. Edlind, T. D., K. W. Henry, J. P. Vermitsky, M. P. Edlind, S. Raj, and S. K. Katiyar. 2005. Promoter-dependent disruption of genes: simple, rapid, and specic PCR-based method with application to three different yeast. Curr. Genet. 48:117125. Garcia-Effron, G., S. Park, and D. S. Perlin. 2009. Evaluating breakpoints for echinocandin drugs through a kinetic analysis of inhibition of fks1 mutant glucan synthases from Candida albicans. Antimicrob. Agents Chemother. 53:112122. Groll, A. H., P. M. Shah, C. Mentzel, M. Schneider, G. Just-Nuebling, and K. Huebner. 1996. Trends in the postmortem epidemiology of invasive fungal infections at a university hospital. J. Infect. 33:2332. Hernandez, S., J. L. Lopez-Ribot, L. K. Najvar, D. I. McCarthy, R. Bocanegra, and J. R. Graybill. 2004. Caspofungin resistance in Candida albicans: correlating clinical outcome with laboratory susceptibility testing of three isogenic isolates serially obtained from a patient with progressive Candida esophagitis. Antimicrob. Agents Chemother. 48:13821383. Jensen, H. E., B. Aalbaek, and H. Schonheyder. 1994. Immunohistochemical identication of aetiological agents of systemic bovine zygomycosis. J. Comp. Pathol. 110:6577. Jensen, H. E., J. Salonen, and T. O. Ekfors. 1997. The use of immunohistochemistry to improve sensitivity and specicity in the diagnosis of systemic mycoses in patients with haematological malignancies. J. Pathol. 181:100105. Jensen, H. E., H. C. Schonheyder, M. Hotchi, and L. Kaufman. 1996. Diagnosis of systemic mycoses by specic immunohistochemical tests. APMIS 104:241258. Katiyar, S., M. Pfaller, and T. Edlind. 2006. Candida albicans and Candida glabrata clinical isolates exhibiting reduced echinocandin susceptibility. Antimicrob. Agents Chemother. 50:28922894. Krause, D. S., J. Reinhardt, J. A. Vazquez, A. Reboli, B. P. Goldstein, M. Wible, and T. Henkel. 2004. Phase 2, randomized, dose-ranging study evaluating the safety and efcacy of anidulafungin in invasive candidiasis and candidemia. Antimicrob. Agents Chemother. 48:20212024. Kvist, P. H., T. Iburg, M. Bielecki, M. Gerstenberg, T. Buch-Rasmussen, E. Hasselager, and H. E. Jensen. 2006. Biocompatibility of electrochemical glucose sensors implanted in the subcutis of pigs. Diabetes Technol. Ther. 8:463475. Laupland, K. B., D. B. Gregson, D. L. Church, T. Ross, and S. Elsayed. 2005. Invasive Candida species infections: a 5 year population-based assessment. J. Antimicrob. Chemother. 56:532537. Laverdiere, M., D. Hoban, C. Restieri, and F. Habel. 2002. In vitro activity of three new triazoles and one echinocandin against Candida bloodstream isolates from cancer patients. J. Antimicrob. Chemother. 50:119123. Laverdiere, M., R. G. Lalonde, J. G. Baril, D. C. Sheppard, S. Park, and D. S. Perlin. 2006. Progressive loss of echinocandin activity following prolonged use for treatment of Candida albicans oesophagitis. J. Antimicrob. Chemother. 57:705708. Madureira, A., A. Bergeron, C. Lacroix, M. Robin, V. Rocha, R. P. de Latour, C. Ferry, A. Devergie, J. Lapalu, E. Gluckmana, G. Socie, M. Ghannoum, and P. Ribaud. 2007. Breakthrough invasive aspergillosis in allogeneic haematopoietic stem cell transplant recipients treated with caspofungin. Int. J. Antimicrob. Agents 30:551554. Meersseman, W., S. J. Vandecasteele, A. Wilmer, E. Verbeken, W. E. Peetermans, and E. Van. Wijngaerden. 2004. Invasive aspergillosis in critically ill patients without malignancy. Am. J. Respir. Crit. Care Med. 170:621625. Mellado, E., T. M. Diaz-Guerra, M. Cuenca-Estrella, and J. L. RodriguezTudela. 2001. Identication of two different 14- sterol demethylase-related genes (cyp51A and cyp51B) in Aspergillus fumigatus and other Aspergillus species. J. Clin. Microbiol. 39:24312438. Miller, C. D., B. W. Lomaestro, S. Park, and D. S. Perlin. 2006. Progressive esophagitis caused by Candida albicans with reduced susceptibility to caspofungin. Pharmacotherapy 26:877880.

29. National Committee for Clinical Laboratory Standards. 2002. Reference method for broth dilution antifungal susceptibility testing of yeasts. Approved standard M27-A2, 2nd ed. National Committee for Clinical Laboratory Standards, Wayne, PA. 30. Odabasi, Z., V. Paetznick, J. H. Rex, and L. Ostrosky-Zeichner. 2007. Effects of serum on in vitro susceptibility testing of echinocandins. Antimicrob. Agents Chemother. 51:42144216. 31. Odds, F. C., M. F. Hanson, A. D. Davidson, M. D. Jacobsen, P. Wright, J. A. Whyte, N. A. Gow, and B. L. Jones. 2007. One year prospective survey of Candida bloodstream infections in Scotland. J. Med. Microbiol. 56:1066 1075. 32. Okuda, C., M. Ito, Y. Sato, K. Oka, and M. Hotchi. 1987. Disseminated cutaneous Fusarium infection with vascular invasion in a leukemic patient. J. Med. Vet. Mycol. 25:177186. 33. Ostrosky-Zeichner, L., J. H. Rex, P. G. Pappas, R. J. Hamill, R. A. Larsen, H. W. Horowitz, W. G. Powderly, N. Hyslop, C. A. Kauffman, J. Cleary, J. E. Mangino, and J. Lee. 2003. Antifungal susceptibility survey of 2,000 bloodstream Candida isolates in the United States. Antimicrob. Agents Chemother. 47:31493154. 34. Paderu, P., G. Garcia-Effron, S. Balashov, G. Delmas, S. Park, and D. S. Perlin. 2007. Serum differentially alters the antifungal properties of echinocandin drugs. Antimicrob. Agents Chemother. 51:22532256. 35. Pappas, P. G., J. H. Rex, J. D. Sobel, S. G. Filler, W. E. Dismukes, T. J. Walsh, and J. E. Edwards. 2004. Guidelines for treatment of candidiasis. Clin. Infect. Dis. 38:161189. 36. Park, S., R. Kelly, J. N. Kahn, J. Robles, M. J. Hsu, E. Register, W. Li, V. Vyas, H. Fan, G. Abruzzo, A. Flattery, C. Gill, G. Chrebet, S. A. Parent, M. Kurtz, H. Teppler, C. M. Douglas, and D. S. Perlin. 2005. Specic substitutions in the echinocandin target Fks1p account for reduced susceptibility of rare laboratory and clinical Candida sp. isolates. Antimicrob. Agents Chemother. 49:32643273. 37. Pasquale, T., J. R. Tomada, M. Ghannoun, J. Dipersio, and H. Bonilla. 2008. Emergence of Candida tropicalis resistant to caspofungin. J. Antimicrob. Chemother. 61:219. 38. Pasqualotto, A. C., and D. W. Denning. 2006. Post-operative aspergillosis. Clin. Microbiol. Infect. 12:10601076. 39. Perlin, D. S. 2007. Resistance to echinocandin-class antifungal drugs. Drug Resist. Updat. 10:121130. 40. Pfaller, M. A., L. Boyken, R. J. Hollis, J. Kroeger, S. A. Messer, S. Tendolkar, and D. J. Diekema. 2008. In vitro susceptibility of invasive isolates of Candida spp. to anidulafungin, caspofungin, and micafungin: six years of global surveillance. J. Clin. Microbiol. 46:150156. 41. Pfaller, M. A., L. Boyken, R. J. Hollis, S. A. Messer, S. Tendolkar, and D. J. Diekema. 2006. Global surveillance of in vitro activity of micafungin against Candida: a comparison with caspofungin by CLSI-recommended methods. J. Clin. Microbiol. 44:35333538. 42. Pfaller, M. A., and D. J. Diekema. 2007. Epidemiology of invasive candidiasis: a persistent public health problem. Clin. Microbiol. Rev. 20:133163. 43. Pfaller, M. A., D. J. Diekema, S. A. Messer, R. J. Hollis, and R. N. Jones. 2003. In vitro activities of caspofungin compared with those of uconazole and itraconazole against 3,959 clinical isolates of Candida spp., including 157 uconazole-resistant isolates. Antimicrob. Agents Chemother. 47:10681071. 44. Pfaller, M. A., D. J. Diekema, L. Ostrosky-Zeichner, J. H. Rex, B. D. Alexander, D. Andes, S. D. Brown, V. Chaturvedi, M. A. Ghannoum, C. C. Knapp, D. J. Sheehan, and T. J. Walsh. 2008. Correlation of MIC with outcome for Candida species tested against caspofungin, anidulafungin, and micafungin: analysis and proposal for interpretive MIC breakpoints. J. Clin. Microbiol. 46:26202629. 45. Pfaller, M. A., S. A. Messer, K. Mills, A. Bolmstrom, and R. N. Jones. 2001. Evaluation of Etest method for determining caspofungin (MK-0991) susceptibilities of 726 clinical isolates of Candida species. J. Clin. Microbiol. 39: 43874389. 46. Rocha, E. M., G. Garcia-Effron, S. Park, and D. S. Perlin. 2007. A Ser678Pro substitution in Fks1p confers resistance to echinocandin drugs in Aspergillus fumigatus. Antimicrob. Agents Chemother. 51:41744176. 47. Swinne, D., M. Watelle, C. Suetens, K. Mertens, P. A. Fonteyne, and N. Nolard. 2004. A one-year survey of candidemia in Belgium in 2002. Epidemiol. Infect. 132:11751180. 48. Walsh, T. J., E. J. Anaissie, D. W. Denning, R. Herbrecht, D. P. Kontoyiannis, K. A. Marr, V. A. Morrison, B. H. Segal, W. J. Steinbach, D. A. Stevens, J. A. van Burik, J. R. Wingard, and T. F. Patterson. 2008. Treatment of aspergillosis: clinical practice guidelines of the Infectious Diseases Society of America. Clin. Infect. Dis. 46:327360. 49. White, T. J., T. D. Bruns, S. B. Lee, and J. W. Taylor. 1990. Amplication and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315322. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, Inc., San Diego, CA.

Downloaded from http://aac.asm.org/ on December 3, 2012 by UNIVERSIDAD DE CHILE